#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PLCE1	51196	broad.mit.edu	37	10	95791760	95791760	+	Frame_Shift_Del	DEL	G	G	-	rs573916830	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr10:95791760delG	ENST00000371380.3	+	1	1192	c.957delG	c.(955-957)aagfs	p.K319fs	PLCE1_ENST00000260766.3_Frame_Shift_Del_p.K319fs			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	319					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				AAAGCAAAAAGGAGCGATCCA	0.388																																						ENST00000371380.3	0.650000	0.390000	5.800000e-01	4.500000e-01	0.510000	0.519832	0.510000	0.510000																										0				8						c.(955-957)aagfs		phospholipase C, epsilon 1							114.0	112.0	113.0					10																	95791760		1853	4088	5941	SO:0001589	frameshift_variant	51196	0	0					g.chr10:95791760delG		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.957delG	chr10.hg19:g.95791760delG	ENSP00000360431:p.Lys319fs	0					PLCE1_ENST00000260766.3_Frame_Shift_Del_p.K319fs	p.K319fs			1	2	3	2.067720	Q9P212	PLCE1_HUMAN		1	1192	+		Colorectal(252;0.0458)	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Frame_Shift_Del	DEL	ENST00000371380.3	1	1	hg19	c.957delG	CCDS41552.1	0																																																																																								0.441229		TCGA-2L-AAQJ-01A-12D-A397-08	0.388	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	1	0	1		33	2		0	0	0	3	88	0	88	89	1	1.870000	-19.750740	1	0.440000	NM_016341		0	57	66	0	448	446	0	0	1	0	0	0	0	88	0	0	0.997694	3.586020e-14	0	0	0	1	0	57	448
SETD1A	9739	broad.mit.edu	37	16	30977566	30977567	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr16:30977566_30977567delAG	ENST00000262519.8	+	8	3050_3051	c.2364_2365delAG	c.(2362-2367)gcaggcfs	p.G789fs		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	789					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TCCCGACAGCAGGCACCGTGGG	0.658																																						ENST00000262519.8	1.000000	0.620000	1	7.300000e-01	0.850000	0.856636	0.850000	1.000000																										0				59						c.(2362-2367)gcaggcfs		SET domain containing 1A																																				SO:0001589	frameshift_variant	9739	0	0					g.chr16:30977566_30977567delAG	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.2364_2365delAG	chr16.hg19:g.30977566_30977567delAG	ENSP00000262519:p.Gly789fs	0						p.G789fs	NM_014712.1	NP_055527.1	0	0	0	2.044786	O15047	SET1A_HUMAN		8	3050_3051	+			A6NP62|Q6PIF3|Q8TAJ6	Frame_Shift_Del	DEL	ENST00000262519.8	1	1	hg19	c.2364_2365delAG	CCDS32435.1	1																																																																																								0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.658	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	1	0	1		2	2		0	0	0	0	35	0	35	35	1	1.870000	-20.000000	1	0.440000	NM_014712		0	34	35	0	145	145	0	0	1	1	0	0	0	35	0	0	1.000000	9.520197e-01	0	3	0	21	0	34	145
GAS7	8522	broad.mit.edu	37	17	9923188	9923189	+	Frame_Shift_Ins	INS	-	-	A	rs200563905		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:9923188_9923189insA	ENST00000432992.2	-	2	369_370	c.209_210insT	c.(208-210)ccgfs	p.P70fs	GAS7_ENST00000578655.1_5'UTR|GAS7_ENST00000323816.4_Frame_Shift_Ins_p.P10fs|GAS7_ENST00000579158.1_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000540214.1_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000437099.2_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000396115.2_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000585266.1_Frame_Shift_Ins_p.P10fs|GAS7_ENST00000542249.1_Frame_Shift_Ins_p.P6fs	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	70	Poly-Pro.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						TTTCTTCTCCCGGCGGAGGGGG	0.54			T	MLL	AML*																																	ENST00000432992.2	0.930000	0.610000	8.600000e-01	6.900000e-01	0.770000	0.778383	0.770000	0.770000				Dom	yes			Dom	yes		17	17p	17p	8522	T	growth arrest-specific 7				L	L	MLL		AML*		0				39						c.(208-210)ccgfs		growth arrest-specific 7																																				SO:0001589	frameshift_variant	8522	0	0					g.chr17:9923188_9923189insA	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.209_210insT	chr17.hg19:g.9923188_9923189insA	ENSP00000407552:p.Pro70fs	1					GAS7_ENST00000542249.1_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000540214.1_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000585266.1_Frame_Shift_Ins_p.P10fs|GAS7_ENST00000578655.1_5'UTR|GAS7_ENST00000323816.4_Frame_Shift_Ins_p.P10fs|GAS7_ENST00000437099.2_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000579158.1_Frame_Shift_Ins_p.P6fs|GAS7_ENST00000396115.2_Frame_Shift_Ins_p.P6fs	p.P70fs	NM_201433.1	NP_958839.1	0	1	1	1.685553	O60861	GAS7_HUMAN		2	369_370	-			A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Frame_Shift_Ins	INS	ENST00000432992.2	0	1	hg19	c.209_210insT	CCDS11152.1	0																																																																																								0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.540	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	1	0	1		2	2		0	0	0	0	38	0	38	38	1	1.870000	-3.071452	1	0.440000	NM_003644, NM_201432, NM_201433		0	66	71	0	234	234	0	0	1	0	0	0	0	38	0	0	1.000000	5.564741e-01	0	0	0	8	0	66	234
MYO3A	53904	broad.mit.edu	37	10	26434386	26434386	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr10:26434386G>A	ENST00000265944.5	+	22	2594	c.2428G>A	c.(2428-2430)Ggt>Agt	p.G810S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	810	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AAAATTTGAAGGTAACCTGAA	0.313																																						ENST00000265944.5	0.930000	0.430000	8.000000e-01	5.400000e-01	0.660000	0.679641	0.660000	0.660000																										0				146						c.(2428-2430)Ggt>Agt		myosin IIIA							60.0	60.0	60.0					10																	26434386		2203	4298	6501	SO:0001583	missense	53904	0	0					g.chr10:26434386G>A	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2428G>A	chr10.hg19:g.26434386G>A	ENSP00000265944:p.Gly810Ser	0					MYO3A_ENST00000543632.1_Intron	p.G810S	NM_017433.4	NP_059129.3	0	0	0	2.040737	Q8NEV4	MYO3A_HUMAN		22	2594	+			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	1	1	hg19	c.2428G>A	CCDS7148.1	0	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325787	0.60743	.	.	ENSG00000095777	ENST00000265944	T	0.70164	-0.46	5.72	3.72	0.42706	5.72	3.72	0.42706	Myosin head, motor domain (2);	0.357715	0.33144	N	0.005222	T	0.48223	0.1488	N	0.11023	0.085	0.80722	D	1	B	0.26547	0.152	B	0.32928	0.155	T	0.44205	-0.9343	10	0.34782	T	0.22	.	11.4508	0.50151	0.1574:0.0:0.8426:0.0	.	810	Q8NEV4	MYO3A_HUMAN	S	810	ENSP00000265944:G810S	ENSP00000265944:G810S	G	+	1	0	0	MYO3A	26474392	26474392	1.000000	0.71417	0.957000	0.39632	0.999000	0.98932	5.647000	0.67923	1.276000	0.44395	0.655000	0.94253	GGT	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.313	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	1	0	1	2	2	2	2	0	0	0	0	27	0	27	27	1	1.870000	-3.169113	1	0.440000	NM_017433		0	22	22	0	127	127	1		1	0		0	0	27	0	0	0.999999	0	0	0	0	1	0	22	127
KIAA1462	57608	broad.mit.edu	37	10	30336573	30336573	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr10:30336573G>A	ENST00000375377.1	-	2	270	c.169C>T	c.(169-171)Cgt>Tgt	p.R57C		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	57					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GACGTCTTACGATGTGCGAGG	0.662																																						ENST00000375377.1	1.000000	0.720000	1	8.200000e-01	0.930000	0.918833	0.930000	1.000000																										0				75						c.(169-171)Cgt>Tgt		KIAA1462							46.0	51.0	50.0					10																	30336573		2026	4175	6201	SO:0001583	missense	57608	1	120938	31				g.chr10:30336573G>A	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.169C>T	chr10.hg19:g.30336573G>A	ENSP00000364526:p.Arg57Cys	0						p.R57C	NM_020848.2	NP_065899.1	0	0	0	2.040737	Q9P266	JCAD_HUMAN		2	270	-			Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	1	1	hg19	c.169C>T	CCDS41500.1	1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551265	0.45383	.	.	ENSG00000165757	ENST00000375377	T	0.12569	2.67	5.06	1.48	0.22813	5.06	1.48	0.22813	.	0.673294	0.14424	N	0.320462	T	0.08088	0.0202	N	0.14661	0.345	0.09310	N	1	D	0.56521	0.976	P	0.44696	0.458	T	0.22626	-1.0211	10	0.56958	D	0.05	-6.0436	4.5512	0.12114	0.0:0.1942:0.1909:0.6149	.	57	Q9P266	K1462_HUMAN	C	57	ENSP00000364526:R57C	ENSP00000364526:R57C	R	-	1	0	0	KIAA1462	30376579	30376579	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.567000	0.23608	0.069000	0.16605	0.467000	0.42956	CGT	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.662	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	1	0	1	2	2	2	2	0	0	0	0	71	0	71	71	1	1.870000	-3.668932	1	0.440000	NM_020848		0	55	54	0	210	206	1		1	0		0	0	71	0	0	1.000000	1.145889e-01	0	0	0	3	0	55	210
HSPA12A	259217	broad.mit.edu	37	10	118434408	118434408	+	Missense_Mutation	SNP	C	C	T	rs41284376	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr10:118434408C>T	ENST00000369209.3	-	12	2016	c.1912G>A	c.(1912-1914)Gcc>Acc	p.A638T	RP11-498B4.5_ENST00000433600.1_RNA	NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	638						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		TCCCTCCGGGCGGGCACCGCA	0.577													C|||	17	0.00339457	0.0	0.0014	5008	,	,		17021	0.001		0.0119	False		,,,				2504	0.0031					ENST00000369209.3	1.000000	0.740000	1	8.300000e-01	0.940000	0.927086	0.940000	1.000000																										0				32						c.(1912-1914)Gcc>Acc		heat shock 70kDa protein 12A		C	THR/ALA	2,3944		0,2,1971	73.0	76.0	75.0		1912	-1.0	0.3	10	dbSNP_127	75	35,8257		1,33,4112	yes	missense	HSPA12A	NM_025015.2	58	1,35,6083	TT,TC,CC		0.4221,0.0507,0.3023	benign	638/676	118434408	37,12201	1973	4146	6119	SO:0001583	missense	259217	586	120908	59				g.chr10:118434408C>T	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1912G>A	chr10.hg19:g.118434408C>T	ENSP00000358211:p.Ala638Thr	0					RP11-498B4.5_ENST00000433600.1_RNA	p.A638T	NM_025015.2	NP_079291.2	1	2	3	2.067720	O43301	HS12A_HUMAN		12	2016	-				Missense_Mutation	SNP	ENST00000369209.3	1	0	hg19	c.1912G>A	CCDS41569.1	1	11	0.005036630036630037	0	0.0	2	0.0055248618784530384	0	0.0	9	0.011873350923482849	C	0.572	-0.840640	0.02692	5.07E-4	0.004221	ENSG00000165868	ENST00000369209	T	0.41758	0.99	6.02	-1.03	0.10102	6.02	-1.03	0.10102	.	0.615275	0.18234	N	0.147479	T	0.11367	0.0277	N	0.08118	0	0.19945	N	0.99994	B	0.02656	0.0	B	0.06405	0.002	T	0.23084	-1.0198	10	0.11485	T	0.65	.	5.9177	0.19063	0.0:0.3231:0.366:0.311	rs41284376	638	O43301	HS12A_HUMAN	T	638	ENSP00000358211:A638T	ENSP00000358211:A638T	A	-	1	0	0	HSPA12A	118424398	118424398	0.006000	0.16342	0.315000	0.25238	0.186000	0.23388	0.029000	0.13666	-0.068000	0.12953	0.655000	0.94253	GCC	0.441229		TCGA-2L-AAQJ-01A-12D-A397-08	0.577	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	1	0	1	2	2	2	2	0	0	0	0	68	0	68	67	1	1.870000	-2.305815	0	0.440000	NM_025015		0	62	60	0	237	237	1		1	0		0	0	68	0	0	1.000000	4.435546e-02	0	1	0	1	0	62	237
DYNC2H1	79659	broad.mit.edu	37	11	102980335	102980335	+	Missense_Mutation	SNP	T	T	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:102980335T>C	ENST00000375735.2	+	1	176	c.32T>C	c.(31-33)cTc>cCc	p.L11P	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L11P|DYNC2H1_ENST00000334267.7_Missense_Mutation_p.L11P	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	11	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTTCGGAAGCTCTTCATCTTC	0.507																																						ENST00000375735.2	0.670000	0.210000	5.400000e-01	3.000000e-01	0.400000	0.426042	0.400000	0.390000																										0				33						c.(31-33)cTc>cCc		dynein, cytoplasmic 2, heavy chain 1							60.0	57.0	58.0					11																	102980335		1878	4110	5988	SO:0001583	missense	79659	0	0					g.chr11:102980335T>C	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.32T>C	chr11.hg19:g.102980335T>C	ENSP00000364887:p.Leu11Pro	0					DYNC2H1_ENST00000334267.7_Missense_Mutation_p.L11P|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L11P	p.L11P	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	0	0	0	2.041626	Q8NCM8	DYHC2_HUMAN		1	176	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	1	1	hg19	c.32T>C	CCDS53701.1	0	.	.	.	.	.	.	.	.	.	.	T	11.60	1.686710	0.29962	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093	T;T;T	0.30182	1.67;1.54;1.67	5.63	3.2	0.36748	5.63	3.2	0.36748	.	0.568065	0.12492	U	0.464170	T	0.26738	0.0654	L	0.36672	1.1	0.24814	N	0.992625	B;B;B	0.29590	0.25;0.082;0.066	B;B;B	0.37091	0.241;0.05;0.079	T	0.15578	-1.0432	10	0.30854	T	0.27	.	8.7491	0.34605	0.1029:0.0:0.2424:0.6546	.	11;11;11	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	P	11	ENSP00000364887:L11P;ENSP00000334021:L11P;ENSP00000381167:L11P	ENSP00000334021:L11P	L	+	2	0	0	DYNC2H1	102485545	102485545	0.140000	0.22579	0.989000	0.46669	0.993000	0.82548	0.695000	0.25527	2.137000	0.66172	0.482000	0.46254	CTC	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.507	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	1	0	1	2	2	2	2	0	0	0	0	24	0	24	24	1	1.870000	-15.664810	1	0.440000	XM_370652		0	10	10	0	103	103	0		1			0	0	24	0	0	0.997309	0	0	0	0	0	0	10	103
OR51I1	390063	broad.mit.edu	37	11	5462461	5462461	+	Missense_Mutation	SNP	G	G	A	rs115148889		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:5462461G>A	ENST00000380211.1	-	1	283	c.284C>T	c.(283-285)gCg>gTg	p.A95V	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	95					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCATTAAACGCAACATGGTT	0.458																																						ENST00000380211.1	1.000000	0.880000	1	9.900000e-01	0.990000	0.991182	0.990000	1.000000																										0				30						c.(283-285)gCg>gTg		olfactory receptor, family 51, subfamily I, member 1							138.0	123.0	128.0					11																	5462461		2201	4297	6498	SO:0001583	missense	390063	3	121408	40				g.chr11:5462461G>A	BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.284C>T	chr11.hg19:g.5462461G>A	ENSP00000369559:p.Ala95Val	0					HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	p.A95V	NM_001005288.2	NP_001005288.1	0	0	0	2.041626	Q9H343	O51I1_HUMAN		1	283	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	1	1	hg19	c.284C>T	CCDS31382.1	1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529926	0.45073	.	.	ENSG00000167359	ENST00000317283;ENST00000321307;ENST00000380211	T	0.37235	1.21	5.78	-2.31	0.06765	5.78	-2.31	0.06765	GPCR, rhodopsin-like superfamily (1);	0.518492	0.17730	N	0.163931	T	0.19366	0.0465	L	0.39898	1.24	0.09310	N	1	B	0.27700	0.186	B	0.19148	0.024	T	0.12708	-1.0537	10	0.62326	D	0.03	.	0.4262	0.00464	0.2041:0.2902:0.1998:0.3058	.	95	Q9H343	O51I1_HUMAN	V	80;92;95	ENSP00000369559:A95V	ENSP00000348350:A80V	A	-	2	0	0	OR51I1	5419037	5419037	0.000000	0.05858	0.025000	0.17156	0.074000	0.17049	-2.368000	0.01077	-0.628000	0.05582	-0.231000	0.12243	GCG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.458	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	1	0	1	2	2	2	2	0	0	0	0	60	0	60	60	1	1.870000	-20.000000	1	0.440000	NM_001005288		0	52	51	0	153	151	1		1			0	0	60	0	0	1.000000	0	0	0	0	0	0	52	153
OR5J2	282775	broad.mit.edu	37	11	55944377	55944377	+	Missense_Mutation	SNP	C	C	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:55944377C>G	ENST00000312298.1	+	1	284	c.284C>G	c.(283-285)tCt>tGt	p.S95C		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					ATTTCTTTCTCTGCTTGCATG	0.458																																						ENST00000312298.1	0.180000	0.040000	1.400000e-01	6.000000e-02	0.090000	0.106941	0.090000	0.100000																										0				44						c.(283-285)tCt>tGt		olfactory receptor, family 5, subfamily J, member 2							169.0	138.0	148.0					11																	55944377		2201	4295	6496	SO:0001583	missense	282775	0	0					g.chr11:55944377C>G	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.284C>G	chr11.hg19:g.55944377C>G	ENSP00000310788:p.Ser95Cys	0						p.S95C	NM_001005492.1	NP_001005492.1	0	0	0	2.041626	Q8NH18	OR5J2_HUMAN		1	284	+	Esophageal squamous(21;0.00693)		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	0	1	hg19	c.284C>G	CCDS31522.1	0	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311684	0.40895	.	.	ENSG00000174957	ENST00000312298	T	0.00408	7.54	4.67	-0.729	0.11158	4.67	-0.729	0.11158	GPCR, rhodopsin-like superfamily (1);	0.831860	0.10480	N	0.669723	T	0.00496	0.0016	L	0.46670	1.46	0.09310	N	1	D	0.67145	0.996	P	0.55785	0.784	T	0.53746	-0.8395	10	0.38643	T	0.18	.	6.1701	0.20412	0.1189:0.5225:0.0:0.3586	.	95	Q8NH18	OR5J2_HUMAN	C	95	ENSP00000310788:S95C	ENSP00000310788:S95C	S	+	2	0	0	OR5J2	55700953	55700953	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.352000	0.07701	-0.056000	0.13221	0.584000	0.79450	TCT	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.458	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	0	0	1	2	2	2	2	0	0	0	0	56	0	56	56	1	1.870000	-2.407337	0	0.440000	NM_001005492		0	9	9	0	409	409	0		1			0	0	56	0	0	0.994269	0	0	0	0	0	0	9	409
SYT12	91683	broad.mit.edu	37	11	66807576	66807576	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:66807576C>T	ENST00000393946.2	+	7	1685	c.523C>T	c.(523-525)Cag>Tag	p.Q175*	SYT12_ENST00000525457.1_Nonsense_Mutation_p.Q175*|SYT12_ENST00000526281.1_3'UTR|SYT12_ENST00000527043.1_Nonsense_Mutation_p.Q175*			Q8IV01	SYT12_HUMAN	synaptotagmin XII	175	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						GGCGGTGATGCAGGGCAAGGA	0.632																																					Ovarian(65;2862 3307)	ENST00000393946.2	0.210000	0.030000	1.600000e-01	6.000000e-02	0.100000	0.112963	0.100000	0.100000																										0				20						c.(523-525)Cag>Tag		synaptotagmin XII							60.0	58.0	59.0					11																	66807576		2200	4295	6495	SO:0001587	stop_gained	91683	0	0					g.chr11:66807576C>T	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.523C>T	chr11.hg19:g.66807576C>T	ENSP00000377520:p.Gln175*	0					SYT12_ENST00000527043.1_Nonsense_Mutation_p.Q175*|SYT12_ENST00000525457.1_Nonsense_Mutation_p.Q175*|SYT12_ENST00000526281.1_3'UTR	p.Q175*			0	0	0	2.041626	Q8IV01	SYT12_HUMAN		7	1685	+				Nonsense_Mutation	SNP	ENST00000393946.2	0	1	hg19	c.523C>T	CCDS8154.1	0	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273932	0.80580	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	.	.	.	5.63	5.63	0.86233	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	17.1708	0.86830	0.0:1.0:0.0:0.0	.	.	.	.	X	175	.	ENSP00000377520:Q175X	Q	+	1	0	0	SYT12	66564152	66564152	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	7.797000	0.85911	2.655000	0.90218	0.462000	0.41574	CAG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.632	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	0	0	1	2	2	2	2	0	0	0	0	57	0	57	55	1	1.870000	-3.865519	1	0.440000	NM_177963		0	5	5	0	231	224	0		1	0		0	0	57	0	0	0.933143	2.165887e-03	0	0	0	3	0	5	231
PDE2A	5138	broad.mit.edu	37	11	72295749	72295749	+	Silent	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:72295749G>A	ENST00000334456.5	-	18	1628	c.1383C>T	c.(1381-1383)gcC>gcT	p.A461A	PDE2A_ENST00000444035.2_Silent_p.A452A|RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000540345.1_Silent_p.A452A|PDE2A_ENST00000418754.2_Silent_p.A346A|PDE2A_ENST00000376450.3_Silent_p.A205A|PDE2A_ENST00000544570.1_Silent_p.A454A	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	461	GAF 2.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	TGCCCTGATCGGCCGGGATGC	0.622																																						ENST00000334456.5	1.000000	0.690000	1	8.100000e-01	0.940000	0.919394	0.940000	1.000000																										0				36						c.(1381-1383)gcC>gcT		phosphodiesterase 2A, cGMP-stimulated	Caffeine(DB00201)|Tofisopam(DB08811)						46.0	49.0	48.0					11																	72295749		2200	4292	6492	SO:0001819	synonymous_variant	5138	0	0					g.chr11:72295749G>A	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.1383C>T	chr11.hg19:g.72295749G>A		0					PDE2A_ENST00000418754.2_Silent_p.A346A|PDE2A_ENST00000444035.2_Silent_p.A452A|RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000544570.1_Silent_p.A454A|PDE2A_ENST00000540345.1_Silent_p.A452A|PDE2A_ENST00000376450.3_Silent_p.A205A	p.A461A	NM_002599.4	NP_002590.1	0	0	0	2.041626	O00408	PDE2A_HUMAN	BRCA - Breast invasive adenocarcinoma(5;3.55e-05)	18	1628	-			B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Silent	SNP	ENST00000334456.5	1	1	hg19	c.1383C>T	CCDS8216.1	1																																																																																								0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.622	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	1	0	1	2	2	2	2	0	0	0	0	40	0	40	40	1	1.870000	-19.999450	1	0.440000	NM_002599		0	36	34	0	135	134	0		1	0		0	0	40	0	0	1.000000	5.327078e-01	0	0	0	8	0	36	135
USP35	57558	broad.mit.edu	37	11	77907359	77907359	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:77907359G>A	ENST00000529308.1	+	2	329	c.68G>A	c.(67-69)cGg>cAg	p.R23Q	USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_5'Flank|USP35_ENST00000441408.2_5'Flank|USP35_ENST00000530267.1_Intron	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	23					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			GGGCTGGTTCGGCGCGTGCTG	0.716																																						ENST00000529308.1	1.000000	0.720000	1	8.100000e-01	0.910000	0.911448	0.910000	1.000000																										0				23						c.(67-69)cGg>cAg		ubiquitin specific peptidase 35							30.0	36.0	34.0					11																	77907359		2186	4275	6461	SO:0001583	missense	57558	0	0					g.chr11:77907359G>A	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.68G>A	chr11.hg19:g.77907359G>A	ENSP00000431876:p.Arg23Gln	0					USP35_ENST00000530267.1_Intron|USP35_ENST00000441408.2_5'Flank|USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_5'Flank	p.R23Q	NM_020798.2	NP_065849.1	0	0	0	2.041626	Q9P2H5	UBP35_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)	2	329	+	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)			Missense_Mutation	SNP	ENST00000529308.1	1	1	hg19	c.68G>A	CCDS41693.1	1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652237	0.47362	.	.	ENSG00000118369	ENST00000529308	T	0.05649	3.41	4.31	3.38	0.38709	4.31	3.38	0.38709	.	0.000000	0.41823	D	0.000817	T	0.04588	0.0125	L	0.29908	0.895	0.80722	D	1	P	0.35155	0.487	B	0.22152	0.038	T	0.50583	-0.8811	10	0.27785	T	0.31	-28.6736	13.2753	0.60184	0.0:0.0:0.8307:0.1693	.	23	Q9P2H5	UBP35_HUMAN	Q	23	ENSP00000431876:R23Q	ENSP00000431876:R23Q	R	+	2	0	0	USP35	77585007	77585007	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	6.220000	0.72237	0.989000	0.38761	0.313000	0.20887	CGG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.716	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	1	0	1	2	2	2	2	0	0	0	0	46	0	46	44	1	1.870000	-20.000000	1	0.440000	XM_290527		0	59	59	0	229	225	0		1	0		0	0	46	0	0	1.000000	0	0	1	0	0	0	59	229
ADAMTS15	170689	broad.mit.edu	37	11	130343367	130343367	+	Missense_Mutation	SNP	C	C	T	rs200241034		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr11:130343367C>T	ENST00000299164.2	+	8	2504	c.2504C>T	c.(2503-2505)cCg>cTg	p.P835L		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	835	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GTGGAGCAGCCGGACGACAGG	0.697													C|||	1	0.000199681	0.0	0.0	5008	,	,		13674	0.001		0.0	False		,,,				2504	0.0					ENST00000299164.2	1.000000	0.870000	1	9.500000e-01	0.990000	0.983884	0.990000	1.000000																										0				36						c.(2503-2505)cCg>cTg		ADAM metallopeptidase with thrombospondin type 1 motif, 15							45.0	55.0	52.0					11																	130343367		2193	4287	6480	SO:0001583	missense	170689	16	121108	45				g.chr11:130343367C>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2504C>T	chr11.hg19:g.130343367C>T	ENSP00000299164:p.Pro835Leu	0						p.P835L	NM_139055.2	NP_620686.1	0	0	0	2.059310	Q8TE58	ATS15_HUMAN		8	2504	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	1	1	hg19	c.2504C>T	CCDS8488.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	11.83	1.754593	0.31046	.	.	ENSG00000166106	ENST00000299164	T	0.61742	0.08	5.69	4.77	0.60923	5.69	4.77	0.60923	.	.	.	.	.	T	0.35393	0.0930	N	0.08118	0	0.37764	D	0.926416	B	0.25105	0.118	B	0.14578	0.011	T	0.24870	-1.0148	9	0.19147	T	0.46	.	14.1591	0.65434	0.1583:0.8417:0.0:0.0	.	835	Q8TE58	ATS15_HUMAN	L	835	ENSP00000299164:P835L	ENSP00000299164:P835L	P	+	2	0	0	ADAMTS15	129848577	129848577	0.000000	0.05858	0.681000	0.30009	0.939000	0.58152	1.050000	0.30404	1.373000	0.46208	0.655000	0.94253	CCG	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.697	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	0	0	1	2	2	2	2	0	0	0	0	117	0	117	115	1	1.870000	-4.375662	1	0.440000	NM_139055		0	112	110	0	376	371	0		1	0		0	0	117	0	0	1.000000	0	0	0	0	1	0	112	376
BTBD11	121551	broad.mit.edu	37	12	108051434	108051434	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:108051434G>T	ENST00000280758.5	+	17	3782	c.3254G>T	c.(3253-3255)aGg>aTg	p.R1085M	BTBD11_ENST00000357167.4_Missense_Mutation_p.R622M|BTBD11_ENST00000494235.2_Missense_Mutation_p.R164M|BTBD11_ENST00000420571.2_Missense_Mutation_p.R966M	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	1085						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GACTTACAGAGGACGTTGGCC	0.493																																						ENST00000280758.5	1.000000	0.570000	9.300000e-01	6.700000e-01	0.790000	0.801056	0.790000	1.000000																										0				53						c.(3253-3255)aGg>aTg		BTB (POZ) domain containing 11							128.0	114.0	119.0					12																	108051434		2203	4300	6503	SO:0001583	missense	121551	0	0					g.chr12:108051434G>T	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.3254G>T	chr12.hg19:g.108051434G>T	ENSP00000280758:p.Arg1085Met	0					BTBD11_ENST00000420571.2_Missense_Mutation_p.R966M|BTBD11_ENST00000494235.2_Missense_Mutation_p.R164M|BTBD11_ENST00000357167.4_Missense_Mutation_p.R622M	p.R1085M	NM_001018072.1	NP_001018082.1	1	2	3	2.095273	A6QL63	BTBDB_HUMAN		17	3782	+			A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	1	1	hg19	c.3254G>T	CCDS31893.1	0	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402325	0.83230	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000357167;ENST00000494235	T;T;T;T	0.39997	1.26;1.39;1.05;1.17	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.085133	0.85682	D	0.000000	T	0.41026	0.1141	N	0.22421	0.69	0.58432	D	0.999994	D;D	0.56521	0.976;0.976	P;P	0.47744	0.459;0.556	T	0.22103	-1.0226	10	0.48119	T	0.1	.	20.1551	0.98106	0.0:0.0:1.0:0.0	.	622;1085	E9PHS4;A6QL63	.;BTBDB_HUMAN	M	1085;966;622;164	ENSP00000280758:R1085M;ENSP00000413889:R966M;ENSP00000349690:R622M;ENSP00000448322:R164M	ENSP00000280758:R1085M	R	+	2	0	0	BTBD11	106575564	106575564	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.694000	0.68272	2.760000	0.94817	0.655000	0.94253	AGG	0.446093		TCGA-2L-AAQJ-01A-12D-A397-08	0.493	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	1	0	1	2	2	2	2	0	0	0	0	63	0	63	63	1	1.870000	-3.294152	1	0.440000	NM_152322		0	38	38	0	184	181	1		1	1		0	0	63	0	0	1.000000	2.105079e-01	0	2	0	3	0	38	184
PRDM4	11108	broad.mit.edu	37	12	108138409	108138409	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:108138409G>A	ENST00000228437.5	-	7	1765	c.1306C>T	c.(1306-1308)Cgg>Tgg	p.R436W	RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	436	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						AAGCAAGTCCGCACAGGAATG	0.463																																						ENST00000228437.5	1.000000	0.030000	1.500000e-01	5.000000e-02	0.090000	0.138354	0.090000	0.090000																										0				20						c.(1306-1308)Cgg>Tgg		PR domain containing 4							155.0	134.0	141.0					12																	108138409		2203	4300	6503	SO:0001583	missense	11108	3	121412	34				g.chr12:108138409G>A	AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.1306C>T	chr12.hg19:g.108138409G>A	ENSP00000228437:p.Arg436Trp	0					RP11-864J10.4_ENST00000546714.1_RNA	p.R436W	NM_012406.3	NP_036538.3	1	2	3	2.095273	Q9UKN5	PRDM4_HUMAN		7	1765	-			Q9UFA6	Missense_Mutation	SNP	ENST00000228437.5	0	1	hg19	c.1306C>T	CCDS9115.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108122	0.77096	.	.	ENSG00000110851	ENST00000228437;ENST00000550659	T;T	0.41758	0.99;0.99	5.88	4.98	0.66077	5.88	4.98	0.66077	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	M	0.78049	2.395	0.53688	D	0.999977	D	0.62365	0.991	B	0.43331	0.416	T	0.50980	-0.8763	10	0.54805	T	0.06	-1.7026	8.8668	0.35291	0.0726:0.0:0.6819:0.2455	.	436	Q9UKN5	PRDM4_HUMAN	W	436;188	ENSP00000228437:R436W;ENSP00000449295:R188W	ENSP00000228437:R436W	R	-	1	2	2	PRDM4	106662539	106662539	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.390000	0.52523	1.481000	0.48307	0.655000	0.94253	CGG	0.446093		TCGA-2L-AAQJ-01A-12D-A397-08	0.463	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1	0	0	1	2	2	2	2	0	0	0	0	47	0	47	47	1	1.870000	-2.578033	1	0.440000	NM_012406		0	5	5	0	256	256	0		1	0		0	0	47	0	0	0.938133	3.273736e-02	0	0	0	12	0	5	256
TRPV4	59341	broad.mit.edu	37	12	110221488	110221488	+	Missense_Mutation	SNP	G	G	A	rs372583866		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:110221488G>A	ENST00000418703.2	-	15	2648	c.2554C>T	c.(2554-2556)Cgc>Tgc	p.R852C	TRPV4_ENST00000536838.1_Missense_Mutation_p.R818C|TRPV4_ENST00000346520.2_Missense_Mutation_p.R792C|TRPV4_ENST00000537083.1_Missense_Mutation_p.R792C|TRPV4_ENST00000541794.1_Missense_Mutation_p.R805C|TRPV4_ENST00000392719.2_Missense_Mutation_p.R805C|TRPV4_ENST00000261740.2_Missense_Mutation_p.R852C|TRPV4_ENST00000544971.1_Missense_Mutation_p.R745C	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	852					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CCATCGCAGCGGGGGTTCCCC	0.642																																						ENST00000418703.2	1.000000	0.640000	1	7.600000e-01	0.890000	0.886737	0.890000	1.000000																										0				35						c.(2554-2556)Cgc>Tgc		transient receptor potential cation channel, subfamily V, member 4		G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	65.0	55.0	58.0		2413,2452,2233,2554,2374	1.7	1.0	12		58	1,8599		0,1,4299	no	missense,missense,missense,missense,missense	TRPV4	NM_001177428.1,NM_001177431.1,NM_001177433.1,NM_021625.4,NM_147204.2	180,180,180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	805/825,818/838,745/765,852/872,792/812	110221488	1,13005	2203	4300	6503	SO:0001583	missense	59341	3	121408	33				g.chr12:110221488G>A	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.2554C>T	chr12.hg19:g.110221488G>A	ENSP00000406191:p.Arg852Cys	0					TRPV4_ENST00000544971.1_Missense_Mutation_p.R745C|TRPV4_ENST00000392719.2_Missense_Mutation_p.R805C|TRPV4_ENST00000541794.1_Missense_Mutation_p.R805C|TRPV4_ENST00000346520.2_Missense_Mutation_p.R792C|TRPV4_ENST00000536838.1_Missense_Mutation_p.R818C|TRPV4_ENST00000537083.1_Missense_Mutation_p.R792C|TRPV4_ENST00000261740.2_Missense_Mutation_p.R852C	p.R852C	NM_001177431.1	NP_001170902.1	1	2	3	2.095273	Q9HBA0	TRPV4_HUMAN		15	2648	-			B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	1	1	hg19	c.2554C>T	CCDS9134.1	1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909237	0.33721	0.0	1.16E-4	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.89343	-2.5;-2.5;-2.29;-2.5;-2.29;-2.5;-2.29;-2.5	5.39	1.7	0.24286	5.39	1.7	0.24286	.	0.722577	0.14111	N	0.340695	T	0.72028	0.3410	N	0.08118	0	0.28470	N	0.915481	P;B;P;B;B	0.41546	0.754;0.389;0.584;0.34;0.167	B;B;B;B;B	0.34722	0.188;0.083;0.13;0.097;0.123	T	0.67604	-0.5628	10	0.62326	D	0.03	-0.0455	4.314	0.10984	0.0:0.2373:0.1878:0.5749	.	792;852;745;805;818	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	C	852;852;805;792;745;792;805;818	ENSP00000406191:R852C;ENSP00000261740:R852C;ENSP00000376480:R805C;ENSP00000319003:R792C;ENSP00000443611:R745C;ENSP00000442738:R792C;ENSP00000442167:R805C;ENSP00000444336:R818C	ENSP00000261740:R852C	R	-	1	0	0	TRPV4	108705871	108705871	0.983000	0.35010	0.998000	0.56505	0.533000	0.34776	0.091000	0.15046	0.356000	0.24157	-0.397000	0.06425	CGC	0.446093		TCGA-2L-AAQJ-01A-12D-A397-08	0.642	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	1	0	1	2	2	2	2	0	0	0	0	34	0	34	33	1	1.870000	-3.406252	1	0.440000	NM_021625		0	34	34	0	141	140	1		1	1		0	0	34	0	0	1.000000	9.859692e-01	0	14	0	17	0	34	141
VWF	7450	broad.mit.edu	37	12	6138548	6138548	+	Missense_Mutation	SNP	C	C	T	rs181452677		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:6138548C>T	ENST00000261405.5	-	22	3181	c.2927G>A	c.(2926-2928)cGc>cAc	p.R976H		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	976	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GCTCAGGTGGCGGTCCCAGAC	0.557													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19884	0.0		0.0	False		,,,				2504	0.0					ENST00000261405.5	0.970000	0.670000	9.100000e-01	7.400000e-01	0.820000	0.828196	0.820000	0.830000																										0				129						c.(2926-2928)cGc>cAc		von Willebrand factor	Antihemophilic Factor(DB00025)						147.0	134.0	138.0					12																	6138548		2203	4300	6503	SO:0001583	missense	7450	3	121412	41				g.chr12:6138548C>T		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2927G>A	chr12.hg19:g.6138548C>T	ENSP00000261405:p.Arg976His	1						p.R976H	NM_000552.3	NP_000543	0	1	1	1.630284	P04275	VWF_HUMAN		22	3181	-			Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	1	1	hg19	c.2927G>A	CCDS8539.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	4.964	0.178991	0.09443	.	.	ENSG00000110799	ENST00000261405	T	0.59364	0.27	4.58	-4.91	0.03085	4.58	-4.91	0.03085	von Willebrand factor, type D domain (3);	1.340220	0.05412	N	0.542595	T	0.42471	0.1204	L	0.31578	0.945	0.09310	N	0.999998	B	0.14012	0.009	B	0.10450	0.005	T	0.30268	-0.9984	10	0.32370	T	0.25	.	10.1299	0.42672	0.111:0.1943:0.0:0.6948	.	976	P04275	VWF_HUMAN	H	976	ENSP00000261405:R976H	ENSP00000261405:R976H	R	-	2	0	0	VWF	6008809	6008809	0.000000	0.05858	0.141000	0.22245	0.187000	0.23431	-0.956000	0.03865	-1.024000	0.03338	-0.347000	0.07816	CGC	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.557	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	1	0	1	2	2	2	2	0	0	0	0	90	0	90	90	1	1.870000	-20.000000	1	0.440000	NM_000552		0	76	76	0	247	240	1		1	0		0	0	90	0	0	1.000000	9.999972e-01	0	0	0	64	0	76	247
LPCAT3	10162	broad.mit.edu	37	12	7086376	7086376	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:7086376G>C	ENST00000261407.4	-	12	1481	c.1396C>G	c.(1396-1398)Cta>Gta	p.L466V	LPCAT3_ENST00000535021.1_5'UTR|U47924.30_ENST00000606112.1_lincRNA	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	466					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AATATGAATAGTAGGCTCAGG	0.418																																						ENST00000261407.4	1.000000	0.760000	9.800000e-01	8.400000e-01	0.920000	0.917278	0.920000	0.990000																										0				17						c.(1396-1398)Cta>Gta		lysophosphatidylcholine acyltransferase 3							88.0	90.0	89.0					12																	7086376		2203	4300	6503	SO:0001583	missense	10162	0	0					g.chr12:7086376G>C	U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.1396C>G	chr12.hg19:g.7086376G>C	ENSP00000261407:p.Leu466Val	1					U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'UTR	p.L466V	NM_005768.5	NP_005759.4	0	1	1	1.630284	Q6P1A2	MBOA5_HUMAN		12	1481	-			B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	ENST00000261407.4	1	1	hg19	c.1396C>G	CCDS8572.1	1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379121	0.24944	.	.	ENSG00000111684	ENST00000261407	T	0.73897	-0.79	4.77	2.95	0.34219	4.77	2.95	0.34219	.	0.147474	0.46758	D	0.000278	T	0.63698	0.2533	L	0.39898	1.24	0.48696	D	0.999699	P	0.49090	0.919	B	0.42087	0.375	T	0.58994	-0.7537	10	0.32370	T	0.25	-13.8297	10.1817	0.42972	0.2237:0.0:0.7763:0.0	.	466	Q6P1A2	MBOA5_HUMAN	V	466	ENSP00000261407:L466V	ENSP00000261407:L466V	L	-	1	2	2	LPCAT3	6956637	6956637	0.980000	0.34600	0.277000	0.24703	0.895000	0.52256	1.816000	0.38992	0.627000	0.30340	-0.258000	0.10820	CTA	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.418	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1	1	0	1	2	2	2	2	0	0	0	0	44	0	44	44	1	1.870000	-20.000000	1	0.440000	NM_005768		0	62	62	0	158	157	1		1	1		0	0	44	0	0	1.000000	1	0	57	0	29	0	62	158
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.970000	0.630000	9.100000e-01	7.200000e-01	0.810000	0.816580	0.810000	0.820000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	1	1	1.726764	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	25	2	2	2	0	14	0	0	58	7988	58	57	1	1.870000	-20.000000	1	0.440000	NM_033360		2326	55	55	5689	181	181	1	1	1	1	1	0	0	58	208	1	1.000000	9.792503e-01	1	22	56	1	211	55	181
IRAK3	11213	broad.mit.edu	37	12	66641598	66641598	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:66641598G>A	ENST00000261233.4	+	12	1859	c.1438G>A	c.(1438-1440)Gaa>Aaa	p.E480K	IRAK3_ENST00000457197.2_Missense_Mutation_p.E419K	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		TATTCCAGTGGAAGATGATGA	0.428																																						ENST00000261233.4	1.000000	0.860000	1	9.700000e-01	0.990000	0.986344	0.990000	1.000000																										0				36						c.(1438-1440)Gaa>Aaa		interleukin-1 receptor-associated kinase 3							126.0	117.0	120.0					12																	66641598		2203	4300	6503	SO:0001583	missense	11213	0	0					g.chr12:66641598G>A	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1438G>A	chr12.hg19:g.66641598G>A	ENSP00000261233:p.Glu480Lys	0					IRAK3_ENST00000457197.2_Missense_Mutation_p.E419K	p.E480K	NM_007199.2	NP_009130.2	1	2	3	2.095273				12	1859	+				Missense_Mutation	SNP	ENST00000261233.4	1	1	hg19	c.1438G>A	CCDS8975.1	1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955128	0.92726	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.73258	-0.69;-0.73	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.77458	0.4133	L	0.36672	1.1	0.40471	D	0.980346	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.75628	-0.3252	9	.	.	.	-27.7703	15.4984	0.75677	0.0:0.0:1.0:0.0	.	419;480	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	K	480;419	ENSP00000261233:E480K;ENSP00000409852:E419K	.	E	+	1	0	0	IRAK3	64927865	64927865	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.853000	0.62911	2.724000	0.93272	0.561000	0.74099	GAA	0.446093		TCGA-2L-AAQJ-01A-12D-A397-08	0.428	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1	1	0	1	2	2	2	2	0	0	0	0	42	0	42	42	1	1.870000	-20.000000	1	0.440000			0	65	65	0	210	208	1		1	0		0	0	42	0	0	1.000000	9.901520e-01	0	1	0	25	0	65	210
CAND1	55832	broad.mit.edu	37	12	67691335	67691335	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:67691335C>T	ENST00000545606.1	+	5	1077	c.640C>T	c.(640-642)Ctt>Ttt	p.L214F		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	214					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTTTGTAGATCTTATTGAACA	0.403																																						ENST00000545606.1	1.000000	0.860000	1	9.500000e-01	0.990000	0.984623	0.990000	1.000000																										0				35						c.(640-642)Ctt>Ttt		cullin-associated and neddylation-dissociated 1							127.0	124.0	125.0					12																	67691335		2203	4300	6503	SO:0001583	missense	55832	0	0					g.chr12:67691335C>T		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.640C>T	chr12.hg19:g.67691335C>T	ENSP00000442318:p.Leu214Phe	0						p.L214F	NM_018448.3	NP_060918.2	1	2	3	2.095273	Q86VP6	CAND1_HUMAN	GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	5	1077	+			B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	1	1	hg19	c.640C>T	CCDS8977.1	1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963385	0.92791	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047	T	0.67865	-0.29	5.61	5.61	0.85477	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79575	0.4469	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76940	-0.2773	9	.	.	.	-12.9708	19.6379	0.95744	0.0:1.0:0.0:0.0	.	214	Q86VP6	CAND1_HUMAN	F	214;214;56	ENSP00000442318:L214F	.	L	+	1	0	0	CAND1	65977602	65977602	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.657000	0.90304	0.655000	0.94253	CTT	0.446093		TCGA-2L-AAQJ-01A-12D-A397-08	0.403	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	0	0	1	2	18	3	2	1	0	1	1	69	0	69	68	1	1.870000	-20.000000	1	0.440000	NM_018448		0	87	86	0	291	288	1		1	1		1	0	69	0	0	1.000000	8.890906e-01	0	5	0	16	0	87	291
CLIP1	6249	broad.mit.edu	37	12	122825945	122825945	+	Silent	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr12:122825945G>A	ENST00000540338.1	-	10	1847	c.1806C>T	c.(1804-1806)aaC>aaT	p.N602N	CLIP1_ENST00000361654.4_Silent_p.N556N|CLIP1_ENST00000537178.1_Silent_p.N556N|CLIP1_ENST00000302528.7_Silent_p.N591N|CLIP1_ENST00000358808.2_Silent_p.N591N|CLIP1_ENST00000545889.1_Silent_p.N292N			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	602					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TCAATGACTCGTTCTCTTTGG	0.468																																						ENST00000540338.1	1.000000	0.550000	7.400000e-01	6.000000e-01	0.670000	0.686238	0.670000	0.670000																										0				60						c.(1804-1806)aaC>aaT		CAP-GLY domain containing linker protein 1							140.0	131.0	134.0					12																	122825945		2203	4300	6503	SO:0001819	synonymous_variant	6249	27	121412	49				g.chr12:122825945G>A		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1806C>T	chr12.hg19:g.122825945G>A		0					CLIP1_ENST00000361654.4_Silent_p.N556N|CLIP1_ENST00000545889.1_Silent_p.N292N|CLIP1_ENST00000537178.1_Silent_p.N556N|CLIP1_ENST00000302528.7_Silent_p.N591N|CLIP1_ENST00000358808.2_Silent_p.N591N	p.N602N			1	2	3	2.095273	P30622	CLIP1_HUMAN		10	1847	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		A0AVD3|Q17RS4|Q29RG0	Silent	SNP	ENST00000540338.1	1	1	hg19	c.1806C>T	CCDS58285.1	0																																																																																								0.446093		TCGA-2L-AAQJ-01A-12D-A397-08	0.468	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	0	0	1	2	2	2	2	0	0	0	0	115	0	115	114	1	1.870000	-20.000000	1	0.440000	NM_002956		0	103	102	0	603	601	1		1	1		0	0	115	0	0	1.000000	9.991301e-01	0	11	0	51	0	103	603
SACS	26278	broad.mit.edu	37	13	23912096	23912096	+	Missense_Mutation	SNP	T	T	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr13:23912096T>G	ENST00000382292.3	-	9	6192	c.5919A>C	c.(5917-5919)aaA>aaC	p.K1973N	SACS_ENST00000402364.1_Missense_Mutation_p.K1223N|SACS_ENST00000382298.3_Missense_Mutation_p.K1973N			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1973					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TGGTCAGTTCTTTCCCTTTTC	0.363																																						ENST00000382292.3	0.830000	0.460000	7.400000e-01	5.400000e-01	0.630000	0.648128	0.630000	0.640000																										0				189						c.(5917-5919)aaA>aaC		sacsin molecular chaperone							61.0	64.0	63.0					13																	23912096		2203	4300	6503	SO:0001583	missense	26278	0	0					g.chr13:23912096T>G	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5919A>C	chr13.hg19:g.23912096T>G	ENSP00000371729:p.Lys1973Asn	0					SACS_ENST00000402364.1_Missense_Mutation_p.K1223N|SACS_ENST00000382298.3_Missense_Mutation_p.K1973N	p.K1973N			0	1	1	1.931512	Q9NZJ4	SACS_HUMAN		9	6192	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	1	1	hg19	c.5919A>C	CCDS9300.2	0	.	.	.	.	.	.	.	.	.	.	T	6.072	0.381555	0.11524	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88354	-2.22;-2.37;-2.22	5.93	-1.21	0.09524	5.93	-1.21	0.09524	.	0.145938	0.64402	D	0.000008	T	0.78817	0.4343	N	0.25647	0.755	0.30667	N	0.753783	B	0.13594	0.008	B	0.11329	0.006	T	0.66048	-0.6020	10	0.33940	T	0.23	.	10.3333	0.43835	0.0:0.4088:0.0:0.5912	.	1973	Q9NZJ4	SACS_HUMAN	N	1973;1223;1973	ENSP00000371729:K1973N;ENSP00000385844:K1223N;ENSP00000371735:K1973N	ENSP00000371729:K1973N	K	-	3	2	2	SACS	22810096	22810096	1.000000	0.71417	0.742000	0.31022	0.119000	0.20118	0.854000	0.27791	-0.412000	0.07519	-0.353000	0.07706	AAA	0.406025		TCGA-2L-AAQJ-01A-12D-A397-08	0.363	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	1	0	1	2	2	2	2	0	0	0	0	41	0	41	41	1	1.870000	-19.408850	1	0.440000	NM_014363		0	39	39	0	222	219	1		1	0		0	0	41	0	0	1.000000	2.362023e-02	0	1	0	1	0	39	222
FREM2	341640	broad.mit.edu	37	13	39262875	39262875	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr13:39262875C>T	ENST00000280481.7	+	1	1610	c.1394C>T	c.(1393-1395)cCg>cTg	p.P465L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	465					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P465L(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGCAGTGGTCCGCAAAACTTG	0.582																																						ENST00000280481.7			0	0																														1	Substitution - Missense(1)	p.P465L(1)	prostate(1)	148						c.(1393-1395)cCg>cTg		FRAS1 related extracellular matrix protein 2							51.0	54.0	53.0					13																	39262875		2203	4300	6503	SO:0001583	missense	341640	3	121412	35				g.chr13:39262875C>T	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1394C>T	chr13.hg19:g.39262875C>T	ENSP00000280481:p.Pro465Leu							p.P465L	NM_207361.4	NP_997244.3					Q5SZK8	FREM2_HUMAN		1	1610	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	1	1	hg19	c.1394C>T	CCDS31960.1		.	.	.	.	.	.	.	.	.	.	C	3.698	-0.062202	0.07317	.	.	ENSG00000150893	ENST00000280481	T	0.18174	2.23	5.6	2.0	0.26442	5.6	2.0	0.26442	.	0.505278	0.18484	N	0.139857	T	0.13756	0.0333	L	0.43152	1.355	0.09310	N	0.999998	B	0.13145	0.007	B	0.06405	0.002	T	0.21621	-1.0240	10	0.34782	T	0.22	.	8.9993	0.36072	0.0:0.6923:0.0:0.3077	.	465	Q5SZK8	FREM2_HUMAN	L	465	ENSP00000280481:P465L	ENSP00000280481:P465L	P	+	2	0	0	FREM2	38160875	38160875	0.000000	0.05858	0.001000	0.08648	0.248000	0.25809	0.505000	0.22642	0.063000	0.16370	-1.036000	0.02392	CCG			TCGA-2L-AAQJ-01A-12D-A397-08	0.582	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	1	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	1.870000	-2.968319	1	0.440000	NM_207361		0	24	24	0	168	167	1		1			0	0	49	0	0	1.000000	0	0	0	0	0	0	24	168
SIAH3	283514	broad.mit.edu	37	13	46357678	46357678	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr13:46357678G>A	ENST00000400405.2	-	2	756	c.650C>T	c.(649-651)aCg>aTg	p.T217M		NM_198849.2	NP_942146.2	Q8IW03	SIAH3_HUMAN	siah E3 ubiquitin protein ligase family member 3	217					multicellular organismal development (GO:0007275)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			large_intestine(3)|lung(7)|ovary(1)|skin(1)	12						AGACCGGGGCGTGGCCTCCCA	0.612																																						ENST00000400405.2	1.000000	0.640000	1	7.600000e-01	0.890000	0.885740	0.890000	1.000000																										0				12						c.(649-651)aCg>aTg		siah E3 ubiquitin protein ligase family member 3							48.0	54.0	52.0					13																	46357678		1999	4152	6151	SO:0001583	missense	283514	0	0					g.chr13:46357678G>A		CCDS41883.1	13q14.12	2012-02-23	2012-02-23		ENSG00000215475	ENSG00000215475			30553	protein-coding gene	gene with protein product		615609	"""seven in absentia homolog 3 (Drosophila)"""			12477932	Standard	NM_198849		Approved	FLJ39203	uc001vap.3	Q8IW03	OTTHUMG00000016862	ENST00000400405.2:c.650C>T	chr13.hg19:g.46357678G>A	ENSP00000383256:p.Thr217Met	1						p.T217M	NM_198849.2	NP_942146.2	2	2	4	2.196026	Q8IW03	SIAH3_HUMAN		2	756	-			B7ZBP0|Q8N8M6	Missense_Mutation	SNP	ENST00000400405.2	1	1	hg19	c.650C>T	CCDS41883.1	1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.748952	0.69533	.	.	ENSG00000215475	ENST00000400405	T	0.27256	1.68	5.07	5.07	0.68467	5.07	5.07	0.68467	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	U	0.000000	T	0.44767	0.1309	L	0.44542	1.39	0.51482	D	0.999923	D	0.89917	1.0	D	0.91635	0.999	T	0.31223	-0.9951	10	0.51188	T	0.08	-19.0347	17.4324	0.87543	0.0:0.0:1.0:0.0	.	217	Q8IW03	SIAH3_HUMAN	M	217	ENSP00000383256:T217M	ENSP00000383256:T217M	T	-	2	0	0	SIAH3	45255679	45255679	1.000000	0.71417	0.987000	0.45799	0.493000	0.33554	9.719000	0.98760	2.369000	0.80426	0.561000	0.74099	ACG	0.474672		TCGA-2L-AAQJ-01A-12D-A397-08	0.612	SIAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044788.2	1	0	1	2	2	2	2	0	0	0	0	38	0	38	36	1	1.870000	-20.000000	1	0.440000	NM_198849		0	37	37	0	168	168	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	37	168
DIO3	1735	broad.mit.edu	37	14	102028119	102028119	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr14:102028119G>A	ENST00000510508.4	+	1	432	c.286G>A	c.(286-288)Gat>Aat	p.D96N	DIO3_ENST00000359323.3_Missense_Mutation_p.D70N|DIO3OS_ENST00000408206.1_lincRNA			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	96					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				GGTGCCTCCCGATGACCCGCC	0.642																																						ENST00000510508.4	0.920000	0.560000	8.400000e-01	6.400000e-01	0.730000	0.746465	0.730000	0.740000																										0				22						c.(286-288)Gat>Aat		deiodinase, iodothyronine, type III							42.0	48.0	46.0					14																	102028119		1996	4141	6137	SO:0001583	missense	1735	0	0					g.chr14:102028119G>A	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	ENST00000510508.4:c.286G>A	chr14.hg19:g.102028119G>A	ENSP00000427336:p.Asp96Asn	0					DIO3_ENST00000359323.3_Missense_Mutation_p.D70N|DIO3OS_ENST00000408206.1_lincRNA	p.D96N			0	0	0	2.042068	P55073	IOD3_HUMAN		1	432	+		all_neural(303;0.185)	G3XAM0|Q8WVN5	Missense_Mutation	SNP	ENST00000510508.4	1	1	hg19	c.286G>A	CCDS41992.2	0	.	.	.	.	.	.	.	.	.	.	g	18.36	3.607744	0.66558	.	.	ENSG00000197406;ENSG00000258865	ENST00000359323;ENST00000510508	T;T	0.35236	1.37;1.32	3.21	3.21	0.36854	3.21	3.21	0.36854	.	0.000000	0.40302	U	0.001121	T	0.54565	0.1866	M	0.80028	2.48	0.28273	N	0.924327	D	0.89917	1.0	D	0.70227	0.968	T	0.46679	-0.9174	10	0.34782	T	0.22	.	7.8692	0.29556	0.124:0.0:0.876:0.0	.	70	P55073	IOD3_HUMAN	N	70;96	ENSP00000352273:D70N;ENSP00000427336:D96N	ENSP00000352273:D96N	D	+	1	0	0	DIO3;AL049836.1	101097872	101097872	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	6.208000	0.72165	1.608000	0.50180	0.457000	0.33378	GAT	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.642	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	0	0	1	2	2	2	2	0	0	0	0	84	0	84	82	1	1.870000	-3.342333	1	0.440000	NM_001362		0	53	52	0	271	267	0		1	0		0	0	84	0	0	1.000000	2.786064e-02	0	1	0	1	0	53	271
ARHGAP5	394	broad.mit.edu	37	14	32623887	32623887	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr14:32623887G>A	ENST00000345122.3	+	7	4557	c.4242G>A	c.(4240-4242)tgG>tgA	p.W1414*	ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.W1414*|ARHGAP5_ENST00000396582.2_Nonsense_Mutation_p.W149*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.W1413*|ARHGAP5_ENST00000433497.1_Nonsense_Mutation_p.W153*|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.W1413*	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1414	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TCTGTTTTTGGCCAACCTTGA	0.338																																					NSCLC(9;77 350 3443 29227 41353)	ENST00000345122.3	1.000000	0.850000	1	9.400000e-01	0.990000	0.980703	0.990000	1.000000																										0				55						c.(4240-4242)tgG>tgA		Rho GTPase activating protein 5							105.0	97.0	100.0					14																	32623887		2203	4300	6503	SO:0001587	stop_gained	394	0	0					g.chr14:32623887G>A	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.4242G>A	chr14.hg19:g.32623887G>A	ENSP00000371897:p.Trp1414*	0					ARHGAP5_ENST00000396582.2_Nonsense_Mutation_p.W149*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.W1413*|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.W1414*|ARHGAP5_ENST00000433497.1_Nonsense_Mutation_p.W153*|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.W1413*	p.W1414*	NM_001030055.1	NP_001025226.1	0	0	0	2.042068	Q13017	RHG05_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	7	4557	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	ENST00000345122.3	0	1	hg19	c.4242G>A	CCDS32062.1	1	.	.	.	.	.	.	.	.	.	.	G	45	11.775769	0.99601	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497	.	.	.	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.5752	0.91153	0.0:0.0:1.0:0.0	.	.	.	.	X	1413;1414;149;1414;1413;153	.	ENSP00000371897:W1414X	W	+	3	0	0	ARHGAP5	31693638	31693638	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.748000	0.98867	2.475000	0.83589	0.549000	0.68633	TGG	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.338	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	1	0	1	2	2	2	2	0	0	0	0	79	0	79	78	1	1.870000	-20.000000	1	0.440000	NM_001030055		0	84	83	0	279	277	1		1	1		0	0	79	0	0	1.000000	9.999999e-01	0	54	0	30	0	84	279
AKAP6	9472	broad.mit.edu	37	14	33291973	33291973	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr14:33291973C>T	ENST00000280979.4	+	13	5124	c.4954C>T	c.(4954-4956)Cga>Tga	p.R1652*	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1652	Ser-rich.				action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAAGATAAAACGAAGTGTTTC	0.418																																					Melanoma(49;821 1200 7288 13647 42351)	ENST00000280979.4	1.000000	0.710000	1	8.000000e-01	0.910000	0.907275	0.910000	1.000000																										0				122						c.(4954-4956)Cga>Tga		A kinase (PRKA) anchor protein 6							71.0	71.0	71.0					14																	33291973		2203	4300	6503	SO:0001587	stop_gained	9472	0	0					g.chr14:33291973C>T	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4954C>T	chr14.hg19:g.33291973C>T	ENSP00000280979:p.Arg1652*	0					AKAP6_ENST00000557272.1_Intron	p.R1652*	NM_004274.4	NP_004265.3	0	0	0	2.042068	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	13	5124	+	Breast(36;0.0388)|Prostate(35;0.15)		A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	ENST00000280979.4	0	1	hg19	c.4954C>T	CCDS9644.1	1	.	.	.	.	.	.	.	.	.	.	C	44	10.633637	0.99441	.	.	ENSG00000151320	ENST00000280979	.	.	.	5.98	3.08	0.35506	5.98	3.08	0.35506	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6398	15.1411	0.72612	0.3707:0.6293:0.0:0.0	.	.	.	.	X	1652	.	ENSP00000280979:R1652X	R	+	1	2	2	AKAP6	32361724	32361724	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	4.452000	0.60054	0.371000	0.24564	-0.188000	0.12872	CGA	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.418	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	1	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	1.870000	-20.000000	1	0.440000	NM_004274		0	55	55	0	216	213	1		1			0	0	51	0	0	1.000000	0	0	0	0	0	0	55	216
KIF26A	26153	broad.mit.edu	37	14	104618363	104618363	+	Silent	SNP	C	C	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr14:104618363C>A	ENST00000423312.2	+	3	300	c.300C>A	c.(298-300)ctC>ctA	p.L100L	KIF26A_ENST00000315264.7_5'UTR	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	100					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		ATCCTTGCCTCTCTGCCCTGC	0.672																																						ENST00000423312.2	1.000000	0.850000	1	9.600000e-01	0.990000	0.985077	0.990000	1.000000																										0				21						c.(298-300)ctC>ctA		kinesin family member 26A							23.0	27.0	26.0					14																	104618363		2109	4140	6249	SO:0001819	synonymous_variant	26153	0	0					g.chr14:104618363C>A	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.300C>A	chr14.hg19:g.104618363C>A		0					KIF26A_ENST00000315264.7_5'UTR	p.L100L	NM_015656.1	NP_056471.1	0	0	0	2.042068	Q9ULI4	KI26A_HUMAN	Epithelial(46;0.152)	3	300	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	1	1	hg19	c.300C>A	CCDS45171.1	1																																																																																								0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.672	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1	1	0	1	2	2	2	2	0	0	0	0	50	0	50	50	1	1.870000	-20.000000	1	0.440000			0	55	55	0	172	170	1		1	0		0	0	50	0	0	1.000000	1.501976e-01	0	0	0	3	0	55	172
VPS39	23339	broad.mit.edu	37	15	42457994	42457994	+	Silent	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr15:42457994C>T	ENST00000348544.4	-	18	1733	c.1734G>A	c.(1732-1734)ccG>ccA	p.P578P	VPS39_ENST00000318006.5_Silent_p.P567P			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	578					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ACTCCACTTCCGGGAGATCTT	0.473																																						ENST00000348544.4	0.150000	0.010000	1.100000e-01	3.000000e-02	0.060000	0.076844	0.060000	0.060000																										0				28						c.(1732-1734)ccG>ccA		vacuolar protein sorting 39 homolog (S. cerevisiae)							76.0	77.0	77.0					15																	42457994		2203	4299	6502	SO:0001819	synonymous_variant	23339	2	121412	31				g.chr15:42457994C>T	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1734G>A	chr15.hg19:g.42457994C>T		0					VPS39_ENST00000318006.5_Silent_p.P567P	p.P578P			0	0	0	2.049200	Q96JC1	VPS39_HUMAN		18	1733	-		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Silent	SNP	ENST00000348544.4	0	1	hg19	c.1734G>A	CCDS10083.1	0																																																																																								0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.473	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	0	0	1	2	2	2	2	0	0	0	0	65	0	65	65	1	1.870000	-3.166510	1	0.440000	NM_015289		0	4	4	0	287	285	0		1	0		0	0	65	0	0	0.889409	1.844012e-01	0	0	0	45	0	4	287
MORF4L1	10933	broad.mit.edu	37	15	79186408	79186408	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr15:79186408C>T	ENST00000331268.5	+	11	959	c.755C>T	c.(754-756)gCg>gTg	p.A252V	MORF4L1_ENST00000558502.1_Missense_Mutation_p.A125V|MORF4L1_ENST00000558746.1_Missense_Mutation_p.A186V|MORF4L1_ENST00000559345.1_Missense_Mutation_p.A125V|MORF4L1_ENST00000379535.4_Missense_Mutation_p.A238V|MORF4L1_ENST00000426013.2_Missense_Mutation_p.A213V|MORF4L1_ENST00000561171.1_Intron	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1	252	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.|Sufficient for interaction with PHF12.|Sufficient for interaction with SIN3A.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						AGGGAGTATGCGGTTAATGAA	0.333																																						ENST00000331268.5	0.120000	0.020000	9.000000e-02	3.000000e-02	0.060000	0.068044	0.060000	0.060000																										0				10						c.(754-756)gCg>gTg		mortality factor 4 like 1							95.0	102.0	99.0					15																	79186408		2196	4293	6489	SO:0001583	missense	10933	0	0					g.chr15:79186408C>T	AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.755C>T	chr15.hg19:g.79186408C>T	ENSP00000331310:p.Ala252Val	0					MORF4L1_ENST00000559345.1_Missense_Mutation_p.A125V|MORF4L1_ENST00000561171.1_Intron|MORF4L1_ENST00000558502.1_Missense_Mutation_p.A125V|MORF4L1_ENST00000426013.2_Missense_Mutation_p.A213V|MORF4L1_ENST00000558746.1_Missense_Mutation_p.A186V|MORF4L1_ENST00000379535.4_Missense_Mutation_p.A238V	p.A252V	NM_206839.2	NP_996670.1	0	0	0	2.049200	Q9UBU8	MO4L1_HUMAN		11	959	+			B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	Missense_Mutation	SNP	ENST00000331268.5	0	1	hg19	c.755C>T	CCDS10307.1	0	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761130	0.69763	.	.	ENSG00000185787	ENST00000379535;ENST00000426013;ENST00000331268	T;T;T	0.08458	3.09;3.09;3.09	4.36	4.36	0.52297	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.11580	0.0282	L	0.48174	1.505	0.80722	D	1	D;D	0.67145	0.996;0.978	P;B	0.48840	0.592;0.366	T	0.20107	-1.0285	10	0.09590	T	0.72	-22.9863	15.8341	0.78787	0.0:1.0:0.0:0.0	.	213;252	Q9UBU8-2;Q9UBU8	.;MO4L1_HUMAN	V	238;213;252	ENSP00000368850:A238V;ENSP00000408880:A213V;ENSP00000331310:A252V	ENSP00000331310:A252V	A	+	2	0	0	MORF4L1	76973463	76973463	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.604000	0.82830	2.123000	0.65237	0.650000	0.86243	GCG	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.333	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000290131.4	0	0	1	2	2	2	2	0	0	0	0	95	0	95	94	1	1.870000	-1.807614	0	0.440000	NM_006791		0	7	7	0	522	490	0		1	0		0	0	95	0	0	0.975966	9.977517e-01	0	0	0	886	0	7	522
ADAMTSL3	57188	broad.mit.edu	37	15	84705713	84705713	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr15:84705713G>A	ENST00000286744.5	+	29	5167	c.4943G>A	c.(4942-4944)cGg>cAg	p.R1648Q	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R1648Q	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1648						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			ATTTCCTGGCGGCACTGTCTT	0.527																																						ENST00000286744.5	1.000000	0.760000	1	8.700000e-01	0.990000	0.955385	0.990000	1.000000																										0				130						c.(4942-4944)cGg>cAg		ADAMTS-like 3							87.0	79.0	82.0					15																	84705713		2203	4299	6502	SO:0001583	missense	57188	2	121410	32				g.chr15:84705713G>A	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.4943G>A	chr15.hg19:g.84705713G>A	ENSP00000286744:p.Arg1648Gln	0					ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R1648Q	p.R1648Q	NM_207517.2	NP_997400.2	0	0	0	2.049200	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)	29	5167	+			A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	1	1	hg19	c.4943G>A	CCDS10326.1	1	.	.	.	.	.	.	.	.	.	.	G	6.948	0.544751	0.13312	.	.	ENSG00000156218	ENST00000286744	T	0.61274	0.12	5.19	2.26	0.28386	5.19	2.26	0.28386	.	1.096740	0.07323	N	0.878014	T	0.31888	0.0811	N	0.11364	0.135	0.27026	N	0.964354	B;B	0.21452	0.033;0.056	B;B	0.10450	0.005;0.002	T	0.22661	-1.0210	10	0.02654	T	1	.	7.0906	0.25282	0.4565:0.0:0.5435:0.0	.	1648;1648	P82987-2;P82987	.;ATL3_HUMAN	Q	1648	ENSP00000286744:R1648Q	ENSP00000286744:R1648Q	R	+	2	0	0	ADAMTSL3	82496717	82496717	1.000000	0.71417	0.966000	0.40874	0.998000	0.95712	1.780000	0.38634	0.701000	0.31803	0.655000	0.94253	CGG	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.527	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	1	0	1	2	2	2	2	0	0	0	0	37	0	37	36	1	1.870000	-4.041260	1	0.440000	NM_207517		0	47	47	0	164	159	1		1	0		0	0	37	0	0	1.000000	0	0	0	0	1	0	47	164
DNAH3	55567	broad.mit.edu	37	16	21080832	21080832	+	Silent	SNP	T	T	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr16:21080832T>A	ENST00000261383.3	-	23	3284	c.3285A>T	c.(3283-3285)ccA>ccT	p.P1095P	DNAH3_ENST00000415178.1_Silent_p.P1095P	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1095	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AACTGAAGATTGGTTCCAGGT	0.433																																						ENST00000261383.3	0.120000	0.020000	9.000000e-02	4.000000e-02	0.060000	0.070680	0.060000	0.060000																										0				202						c.(3283-3285)ccA>ccT		dynein, axonemal, heavy chain 3							195.0	158.0	171.0					16																	21080832		2201	4300	6501	SO:0001819	synonymous_variant	55567	0	0					g.chr16:21080832T>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3285A>T	chr16.hg19:g.21080832T>A		0					DNAH3_ENST00000415178.1_Silent_p.P1095P	p.P1095P	NM_017539.1	NP_060009.1	0	0	0	2.042094	Q8TD57	DYH3_HUMAN		23	3284	-			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	0	1	hg19	c.3285A>T	CCDS10594.1	0																																																																																								0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.433	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	0	0	1	2	2	2	2	0	0	0	0	129	0	129	128	1	1.870000	-3.225134	1	0.440000	NM_017539		0	9	9	0	628	621	0		1			0	0	129	0	0	0.993969	0	0	0	0	0	0	9	628
DNASE1	1773	broad.mit.edu	37	16	3706107	3706107	+	Missense_Mutation	SNP	G	G	A	rs140530129	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr16:3706107G>A	ENST00000246949.5	+	4	3450	c.241G>A	c.(241-243)Gca>Aca	p.A81T	DNASE1_ENST00000407479.1_Missense_Mutation_p.A81T|DNASE1_ENST00000414110.2_Start_Codon_SNP_p.M1I	NM_005223.3	NP_005214.2	P24855	DNAS1_HUMAN	deoxyribonuclease I	81					apoptotic process (GO:0006915)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	deoxyribonuclease I activity (GO:0004530)			lung(1)	1		Ovarian(90;0.0261)		Kidney(780;0.0556)		ATCCAGGGATGCACCAGACAC	0.597													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17749	0.0		0.0	False		,,,				2504	0.0					ENST00000246949.5	1.000000	0.670000	9.700000e-01	7.600000e-01	0.860000	0.865328	0.860000	1.000000																										0				1						c.(241-243)Gca>Aca		deoxyribonuclease I							85.0	78.0	81.0					16																	3706107		2197	4300	6497	SO:0001583	missense	1773	3	121412	33				g.chr16:3706107G>A		CCDS10507.1	16p13.3	2008-02-05			ENSG00000213918	ENSG00000213918	3.1.21.1		2956	protein-coding gene	gene with protein product		125505		DNL1		2349940	Standard	XM_005255148		Approved		uc002cvr.3	P24855	OTTHUMG00000129426	ENST00000246949.5:c.241G>A	chr16.hg19:g.3706107G>A	ENSP00000246949:p.Ala81Thr	0					DNASE1_ENST00000414110.2_Start_Codon_SNP_p.M1I|DNASE1_ENST00000407479.1_Missense_Mutation_p.A81T	p.A81T	NM_005223.3	NP_005214.2	0	0	0	2.042094	P24855	DNAS1_HUMAN		4	3450	+		Ovarian(90;0.0261)	B4DV35|Q14UU9|Q14UV0	Missense_Mutation	SNP	ENST00000246949.5	0	1	hg19	c.241G>A	CCDS10507.1	1	2|2	9.157509157509158E-4|9.157509157509158E-4	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	12.44|12.44	1.938101|1.938101	0.34189|0.34189	.|.	.|.	ENSG00000213918|ENSG00000213918	ENST00000407479;ENST00000246949|ENST00000414110	T;T|T	0.51071|0.40476	0.72;0.72|1.03	5.06|5.06	-0.503|-0.503	0.12000|0.12000	5.06|5.06	-0.503|-0.503	0.12000|0.12000	Endonuclease/exonuclease/phosphatase (2);|.	1.806170|.	0.02552|.	N|.	0.095796|.	T|T	0.23806|0.23806	0.0576|0.0576	N|N	0.12182|0.12182	0.205|0.205	0.09310|0.09310	N|N	1|1	B|.	0.14438|.	0.01|.	B|.	0.12837|.	0.008|.	T|T	0.29027|0.29027	-1.0025|-1.0025	10|7	0.42905|0.87932	T|D	0.14|0	-7.8118|-7.8118	4.4516|4.4516	0.11623|0.11623	0.3473:0.0:0.4251:0.2276|0.3473:0.0:0.4251:0.2276	.|.	81|.	P24855|.	DNAS1_HUMAN|.	T|I	81|1	ENSP00000385905:A81T;ENSP00000246949:A81T|ENSP00000416699:M1I	ENSP00000246949:A81T|ENSP00000416699:M1I	A|M	+|+	1|3	0|0	0|0	DNASE1|DNASE1	3646108|3646108	3646108|3646108	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.028000|0.028000	0.11728|0.11728	-0.075000|-0.075000	0.11431|0.11431	0.527000|0.527000	0.28560|0.28560	-0.291000|-0.291000	0.09656|0.09656	GCA|ATG	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.597	DNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251585.2	1	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	1.870000	-20.000000	1	0.440000			0	57	57	0	241	239	1		1	1		0	0	49	0	0	1.000000	4.752164e-01	0	3	0	5	0	57	241
PRSS36	146547	broad.mit.edu	37	16	31152793	31152793	+	Missense_Mutation	SNP	A	A	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr16:31152793A>G	ENST00000268281.4	-	12	1956	c.1898T>C	c.(1897-1899)cTc>cCc	p.L633P	PRSS36_ENST00000569305.1_Missense_Mutation_p.L628P|PRSS36_ENST00000418068.2_Missense_Mutation_p.L633P	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	633	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						GACCCACCTGAGGACACAGTG	0.547																																						ENST00000268281.4	0.120000	0.010000	9.000000e-02	3.000000e-02	0.050000	0.066957	0.050000	0.060000																										0				17						c.(1897-1899)cTc>cCc		protease, serine, 36							62.0	71.0	68.0					16																	31152793		2197	4300	6497	SO:0001583	missense	146547	0	0					g.chr16:31152793A>G	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.1898T>C	chr16.hg19:g.31152793A>G	ENSP00000268281:p.Leu633Pro	0					PRSS36_ENST00000418068.2_Missense_Mutation_p.L633P|PRSS36_ENST00000569305.1_Missense_Mutation_p.L628P	p.L633P	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	0	0	0	2.044786	Q5K4E3	POLS2_HUMAN		12	1956	-			A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	0	1	hg19	c.1898T>C	CCDS32436.1	0	.	.	.	.	.	.	.	.	.	.	A	16.81	3.225929	0.58668	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.88818	-2.43;-1.57	5.29	3.99	0.46301	5.29	3.99	0.46301	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.85435	0.5696	N	0.05554	-0.025	0.53005	D	0.999966	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.985;0.985	T	0.82182	-0.0584	9	0.27785	T	0.31	.	7.6216	0.28189	0.8891:0.0:0.1109:0.0	.	633;628;633	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	P	633	ENSP00000268281:L633P;ENSP00000407160:L633P	ENSP00000268281:L633P	L	-	2	0	0	PRSS36	31060294	31060294	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.959000	0.49153	1.996000	0.58369	0.374000	0.22700	CTC	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.547	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	0	0	1	2	2	2	2	0	0	0	0	91	0	91	90	1	1.870000	-5.813833	1	0.440000	NM_173502		0	6	6	0	464	459	0		1	0		0	0	91	0	0	0.964016	7.429741e-04	0	0	0	3	0	6	464
ABAT	18	broad.mit.edu	37	16	8858595	8858595	+	Splice_Site	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr16:8858595G>T	ENST00000396600.2	+	8	1386	c.448G>T	c.(448-450)Gtg>Ttg	p.V150L	ABAT_ENST00000425191.2_Splice_Site_p.V150L|ABAT_ENST00000567812.1_Splice_Site_p.V165L|ABAT_ENST00000268251.8_Splice_Site_p.V150L|ABAT_ENST00000569156.1_Splice_Site_p.V150L	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	150					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	CTCCCCACAGGTGGCTCCCAA	0.597																																						ENST00000396600.2	0.240000	0.050000	1.900000e-01	9.000000e-02	0.130000	0.141766	0.130000	0.130000																										0				26						c.(448-450)Gtg>Ttg		4-aminobutyrate aminotransferase	L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)						116.0	93.0	101.0					16																	8858595		2197	4300	6497	SO:0001630	splice_region_variant	18	0	0					g.chr16:8858595G>T	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.448-1G>T	chr16.hg19:g.8858595G>T		0					ABAT_ENST00000425191.2_Splice_Site_p.V150L|ABAT_ENST00000567812.1_Splice_Site_p.V165L|ABAT_ENST00000569156.1_Splice_Site_p.V150L|ABAT_ENST00000268251.8_Splice_Site_p.V150L	p.V150L	NM_000663.4	NP_000654.2	0	0	0	2.042094	P80404	GABT_HUMAN		8	1386	+			A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Splice_Site	SNP	ENST00000396600.2	0	1	hg19	c.448G>T	CCDS10534.1	0	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754306	0.69648	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.74315	-0.83;-0.83;-0.83	5.63	5.63	0.86233	5.63	5.63	0.86233	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.057206	0.64402	D	0.000001	T	0.76485	0.3994	L	0.60455	1.87	0.80722	D	1	B	0.17268	0.021	B	0.35182	0.197	T	0.69964	-0.5002	9	.	.	.	-19.9755	18.7245	0.91710	0.0:0.0:1.0:0.0	.	150	P80404	GABT_HUMAN	L	150	ENSP00000268251:V150L;ENSP00000379845:V150L;ENSP00000411916:V150L	.	V	+	1	0	0	ABAT	8766096	8766096	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	6.063000	0.71162	2.661000	0.90470	0.650000	0.86243	GTG	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.597	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433620.2	0	0	1	2	2	2	2	0	0	0	0	62	0	62	61	1	1.870000	-9.039571	1	0.440000	NM_020686	Missense_Mutation	0	8	6	0	276	274	0		1	0		0	0	62	0	0	0.989023	1.015284e-02	0	0	0	5	0	8	276
ZNF423	23090	broad.mit.edu	37	16	49671084	49671084	+	Missense_Mutation	SNP	C	C	T	rs200218868		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr16:49671084C>T	ENST00000561648.1	-	4	2032	c.1979G>A	c.(1978-1980)cGg>cAg	p.R660Q	ZNF423_ENST00000563137.2_Missense_Mutation_p.R600Q|ZNF423_ENST00000562871.1_Missense_Mutation_p.R600Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.R543Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.R600Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.R660Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.R543Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	660					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CGCTTGCTTCCGCAGCAGCAG	0.552																																						ENST00000561648.1	1.000000	0.570000	9.000000e-01	6.600000e-01	0.780000	0.789052	0.780000	1.000000																										0				89						c.(1978-1980)cGg>cAg		zinc finger protein 423							47.0	47.0	47.0					16																	49671084		2198	4300	6498	SO:0001583	missense	23090	3	121412	37				g.chr16:49671084C>T	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1979G>A	chr16.hg19:g.49671084C>T	ENSP00000455426:p.Arg660Gln	0					ZNF423_ENST00000562871.1_Missense_Mutation_p.R600Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.R600Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.R543Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.R660Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.R600Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.R543Q	p.R660Q	NM_001271620.1	NP_001258549.1	0	0	0	2.044786	Q2M1K9	ZN423_HUMAN		4	2032	-		all_cancers(37;0.0155)	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	1	1	hg19	c.1979G>A	CCDS32445.1	0	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225160	0.58668	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.30714	1.52;1.52	4.86	4.86	0.63082	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	L	0.42529	1.33	0.48830	D	0.999718	B	0.29862	0.259	B	0.23150	0.044	T	0.04454	-1.0950	9	.	.	.	.	18.0121	0.89227	0.0:1.0:0.0:0.0	.	660	Q2M1K9	ZN423_HUMAN	Q	660;543	ENSP00000262383:R660Q;ENSP00000442321:R543Q	.	R	-	2	0	0	ZNF423	48228585	48228585	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.679000	0.61649	2.250000	0.74265	0.462000	0.41574	CGG	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.552	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	1	0	1	2	2	2	2	0	0	0	0	51	0	51	50	1	1.870000	-3.004217	1	0.440000	NM_015069		0	37	37	0	177	172	1		1	0		0	0	51	0	0	1.000000	2.156132e-01	0	0	0	4	0	37	177
MYO15A	51168	broad.mit.edu	37	17	18043920	18043920	+	Silent	SNP	G	G	A	rs371647200		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:18043920G>A	ENST00000205890.5	+	20	5639	c.5301G>A	c.(5299-5301)gcG>gcA	p.A1767A	MYO15A_ENST00000412324.1_3'UTR	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1767	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TCTACAAGGCGCACACTGTGG	0.662											OREG0024223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		17663	0.001		0.0	False		,,,				2504	0.0					ENST00000205890.5	0.100000	0.010000	8.000000e-02	3.000000e-02	0.050000	0.058585	0.050000	0.050000																										0				99						c.(5299-5301)gcG>gcA		myosin XVA		G		1,3991		0,1,1995	66.0	77.0	73.0		5301	-8.4	0.3	17		73	1,8327		0,1,4163	no	coding-synonymous	MYO15A	NM_016239.3		0,2,6158	AA,AG,GG		0.012,0.0251,0.0162		1767/3531	18043920	2,12318	1996	4164	6160	SO:0001819	synonymous_variant	51168	6	120914	43				g.chr17:18043920G>A	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.5301G>A	chr17.hg19:g.18043920G>A		1		OREG0024223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	722	MYO15A_ENST00000412324.1_3'UTR	p.A1767A	NM_016239.3	NP_057323.3	0	1	1	1.685553	Q9UKN7	MYO15_HUMAN		20	5639	+	all_neural(463;0.228)		B4DFC7	Silent	SNP	ENST00000205890.5	0	1	hg19	c.5301G>A	CCDS42271.1	0																																																																																								0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.662	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	0	0	1	2	2	2	2	0	0	0	0	131	0	131	131	1	1.870000	-2.400880	0	0.440000	NM_016239		0	6	6	0	413	405	0		1			0	0	131	0	0	0.963093	0	0	0	0	0	0	6	413
TIAF1	9220	broad.mit.edu	37	17	27401145	27401145	+	Missense_Mutation	SNP	G	G	A	rs151013388		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:27401145G>A	ENST00000359450.6	-	1	4730	c.73C>T	c.(73-75)Cgg>Tgg	p.R25W	TIAF1_ENST00000408971.2_Missense_Mutation_p.R25W|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000531253.1_3'UTR|MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000533112.1_3'UTR|MYO18A_ENST00000527372.1_3'UTR	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1	25					apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)				kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			ACCTGGACCCGGCTCTCCTCA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		16598	0.001		0.0	False		,,,				2504	0.0					ENST00000359450.6	1.000000	0.460000	7.800000e-01	5.400000e-01	0.640000	0.673497	0.640000	0.630000																										0				3						c.(73-75)Cgg>Tgg		TGFB1-induced anti-apoptotic factor 1		G	,,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	56.0	56.0		,,73	-10.5	0.0	17	dbSNP_134	56	0,8600		0,0,4300	no	utr-3,utr-3,missense	TIAF1,MYO18A	NM_078471.3,NM_203318.1,NM_004740.3	,,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,benign	,,25/116	27401145	1,13005	2203	4300	6503	SO:0001583	missense	9220	2	121412	38				g.chr17:27401145G>A	AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.73C>T	chr17.hg19:g.27401145G>A	ENSP00000352424:p.Arg25Trp	0					MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000533112.1_3'UTR|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000531253.1_3'UTR|MYO18A_ENST00000354329.4_3'UTR|TIAF1_ENST00000408971.2_Missense_Mutation_p.R25W	p.R25W	NM_004740.3	NP_004731.2	1	2	3	2.152119	O95411	TIAF1_HUMAN	Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)	1	4730	-	Lung NSC(42;0.015)		A2RRE2|Q6PEG2	Missense_Mutation	SNP	ENST00000359450.6	1	1	hg19	c.73C>T	CCDS32599.1	0	.	.	.	.	.	.	.	.	.	.	G	4.088	0.014265	0.07959	2.27E-4	0.0	ENSG00000221995	ENST00000408971;ENST00000511177	.	.	.	5.99	-10.5	0.00291	5.99	-10.5	0.00291	.	.	.	.	.	T	0.18215	0.0437	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42068	-0.9473	8	0.87932	D	0	.	9.1113	0.36730	0.3327:0.2671:0.4002:0.0	.	25	O95411	TIAF1_HUMAN	W	25	.	ENSP00000386130:R25W	R	-	1	2	2	TIAF1	24425271	24425271	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	-0.869000	0.04232	-1.616000	0.01572	-1.595000	0.00837	CGG	0.453232		TCGA-2L-AAQJ-01A-12D-A397-08	0.592	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372394.2	1	0	1	2	2	2	2	0	0	0	0	47	0	47	47	1	1.870000	-3.076960	1	0.440000	NM_004740		0	39	39	0	248	245	1		1	1		0	0	47	0	0	1.000000	1	0	86	0	209	0	39	248
AP2B1	163	broad.mit.edu	37	17	33954713	33954713	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:33954713C>T	ENST00000262325.7	+	9	1676	c.1123C>T	c.(1123-1125)Cgg>Tgg	p.R375W	AP2B1_ENST00000538556.1_Missense_Mutation_p.R318W|AP2B1_ENST00000537622.2_Missense_Mutation_p.R375W|AP2B1_ENST00000312678.8_Missense_Mutation_p.R375W|AP2B1_ENST00000592545.1_Missense_Mutation_p.R337W|AP2B1_ENST00000589344.1_Missense_Mutation_p.R375W|AP2B1_ENST00000545922.2_3'UTR	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	375					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AAAAGCTGTGCGGGCCATTGG	0.438																																						ENST00000262325.7	1.000000	0.010000	1.400000e-01	4.000000e-02	0.070000	0.163183	0.070000	0.070000																										0				28						c.(1123-1125)Cgg>Tgg		adaptor-related protein complex 2, beta 1 subunit							119.0	110.0	113.0					17																	33954713		2203	4300	6503	SO:0001583	missense	163	0	0					g.chr17:33954713C>T	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1123C>T	chr17.hg19:g.33954713C>T	ENSP00000262325:p.Arg375Trp	0					AP2B1_ENST00000589344.1_Missense_Mutation_p.R375W|AP2B1_ENST00000538556.1_Missense_Mutation_p.R318W|AP2B1_ENST00000312678.8_Missense_Mutation_p.R375W|AP2B1_ENST00000592545.1_Missense_Mutation_p.R337W|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000537622.2_Missense_Mutation_p.R375W	p.R375W	NM_001282.2	NP_001273.1	1	2	3	2.152119	P63010	AP2B1_HUMAN		9	1676	+		Ovarian(249;0.17)	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	0	1	hg19	c.1123C>T	CCDS32622.1	0	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483673	0.63962	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.74	2.04	0.26737	5.74	2.04	0.26737	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67420	0.2891	H	0.97158	3.95	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;0.996	T	0.77787	-0.2457	10	0.87932	D	0	-0.402	14.3775	0.66889	0.4861:0.5139:0.0:0.0	.	112;337;375;375	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	W	375;375;318;375;112	ENSP00000262325:R375W;ENSP00000314414:R375W;ENSP00000440563:R318W;ENSP00000437413:R375W	ENSP00000262325:R375W	R	+	1	2	2	AP2B1	30978826	30978826	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.241000	0.32743	0.128000	0.18479	-1.036000	0.02392	CGG	0.453232		TCGA-2L-AAQJ-01A-12D-A397-08	0.438	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1	0	0	1	2	2	2	2	0	0	0	0	60	0	60	60	1	1.870000	-2.364776	0	0.440000			0	4	4	0	278	277	0		1	0		0	0	60	0	0	0.890211	7.505153e-01	0	1	0	179	0	4	278
BECN1	8678	broad.mit.edu	37	17	40967986	40967986	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:40967986G>A	ENST00000361523.4	-	8	902	c.770C>T	c.(769-771)gCc>gTc	p.A257V	BECN1_ENST00000590099.1_Missense_Mutation_p.A257V|BECN1_ENST00000438274.3_Missense_Mutation_p.A181V	NM_003766.3	NP_003757.1	Q14457	BECN1_HUMAN	beclin 1, autophagy related	257					autophagic vacuole assembly (GO:0000045)|beta-amyloid metabolic process (GO:0050435)|cellular defense response (GO:0006968)|cellular response to aluminum ion (GO:0071275)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokinesis (GO:0000910)|defense response to virus (GO:0051607)|lysosome organization (GO:0007040)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|positive regulation of macroautophagy (GO:0016239)|regulation of catalytic activity (GO:0050790)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to vitamin E (GO:0033197)|viral process (GO:0016032)	dendrite (GO:0030425)|membrane (GO:0016020)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		CTGCGTCTGGGCATAACGCAT	0.463																																						ENST00000361523.4	0.130000	0.020000	1.000000e-01	4.000000e-02	0.060000	0.073175	0.060000	0.060000																										0				13						c.(769-771)gCc>gTc		beclin 1, autophagy related							241.0	204.0	216.0					17																	40967986		2203	4300	6503	SO:0001583	missense	8678	0	0					g.chr17:40967986G>A	AF077301	CCDS11441.1	17q21	2014-02-12	2008-01-14		ENSG00000126581	ENSG00000126581			1034	protein-coding gene	gene with protein product	"""ATG6 autophagy related 6 homolog (S. cerevisiae)"""	604378	"""beclin 1 (coiled-coil, moesin-like BCL2 interacting protein)"""			9765397	Standard	NM_003766		Approved	ATG6, VPS30	uc002ibn.2	Q14457		ENST00000361523.4:c.770C>T	chr17.hg19:g.40967986G>A	ENSP00000355231:p.Ala257Val	1					BECN1_ENST00000438274.3_Missense_Mutation_p.A181V|BECN1_ENST00000590099.1_Missense_Mutation_p.A257V	p.A257V	NM_003766.3	NP_003757.1	0	1	1	1.664854	Q14457	BECN1_HUMAN		8	902	-		Breast(137;0.00104)	B2R6N7|O75595|Q9UNA8	Missense_Mutation	SNP	ENST00000361523.4	0	1	hg19	c.770C>T	CCDS11441.1	0	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830695	0.50845	.	.	ENSG00000126581	ENST00000361523;ENST00000438274;ENST00000543382	T;T	0.46451	0.87;2.55	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.171847	0.52532	D	0.000064	T	0.34978	0.0916	L	0.33339	1.005	0.58432	D	0.999994	B;B	0.32188	0.359;0.024	B;B	0.29663	0.105;0.094	T	0.07083	-1.0791	10	0.18710	T	0.47	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	181;257	E7EV84;Q14457	.;BECN1_HUMAN	V	257;181;170	ENSP00000355231:A257V;ENSP00000416173:A181V	ENSP00000355231:A257V	A	-	2	0	0	BECN1	38221512	38221512	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	6.847000	0.75404	2.824000	0.97209	0.655000	0.94253	GCC	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.463	BECN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452405.1	0	0	1	2	2	2	2	0	0	0	0	92	0	92	92	1	1.870000	-1.737995	0	0.440000	NM_003766		0	7	8	0	376	376	0		1	0		0	0	92	0	0	0.981016	6.875938e-01	0	0	0	124	0	7	376
AMZ2	51321	broad.mit.edu	37	17	66253070	66253070	+	Missense_Mutation	SNP	A	A	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:66253070A>C	ENST00000359904.3	+	7	2175	c.1043A>C	c.(1042-1044)aAa>aCa	p.K348T	AMZ2_ENST00000577866.1_Missense_Mutation_p.K348T|AMZ2_ENST00000580753.1_Missense_Mutation_p.K348T|AMZ2_ENST00000392720.2_Missense_Mutation_p.K348T|AMZ2_ENST00000577273.1_3'UTR|AMZ2_ENST00000577985.1_Missense_Mutation_p.K348T|ARSG_ENST00000448504.2_5'Flank|AMZ2_ENST00000359783.4_Missense_Mutation_p.K290T	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	348							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAGGAATGGAAAGAGTGGATA	0.398																																						ENST00000359904.3	1.000000	0.530000	1	6.100000e-01	0.700000	0.743462	0.700000	0.690000																										0				9						c.(1042-1044)aAa>aCa		archaelysin family metallopeptidase 2							97.0	93.0	95.0					17																	66253070		2203	4300	6503	SO:0001583	missense	51321	0	0					g.chr17:66253070A>C	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.1043A>C	chr17.hg19:g.66253070A>C	ENSP00000352976:p.Lys348Thr	1					ARSG_ENST00000448504.2_5'Flank|AMZ2_ENST00000359783.4_Missense_Mutation_p.K290T|AMZ2_ENST00000580753.1_Missense_Mutation_p.K348T|AMZ2_ENST00000577273.1_3'UTR|AMZ2_ENST00000392720.2_Missense_Mutation_p.K348T|AMZ2_ENST00000577866.1_Missense_Mutation_p.K348T|AMZ2_ENST00000577985.1_Missense_Mutation_p.K348T	p.K348T	NM_016627.4	NP_057711.3	2	5	7	2.566464	Q86W34	AMZ2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)	7	2175	+	all_cancers(12;1.12e-09)		A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	ENST00000359904.3	1	1	hg19	c.1043A>C	CCDS11674.1	0	.	.	.	.	.	.	.	.	.	.	A	6.893	0.534347	0.13188	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.33865	1.39;1.39;1.39	3.42	-3.74	0.04385	3.42	-3.74	0.04385	.	0.527164	0.15835	N	0.242322	T	0.28928	0.0718	L	0.54323	1.7	0.40767	D	0.983057	B;B	0.32245	0.181;0.361	B;B	0.31686	0.134;0.134	T	0.06110	-1.0845	10	0.51188	T	0.08	-21.1054	10.9082	0.47092	0.2793:0.0:0.7207:0.0	.	290;348	A6NLD9;Q86W34	.;AMZ2_HUMAN	T	348;290;348	ENSP00000352976:K348T;ENSP00000352831:K290T;ENSP00000376481:K348T	ENSP00000352831:K290T	K	+	2	0	0	AMZ2	63764665	63764665	0.719000	0.27986	0.392000	0.26245	0.101000	0.19017	0.235000	0.17948	-0.834000	0.04239	-0.353000	0.07706	AAA	0.553073		TCGA-2L-AAQJ-01A-12D-A397-08	0.398	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	1	0	1	2	2	2	2	0	0	0	0	85	0	85	85	1	1.870000	-20.000000	1	0.440000	NM_016627		0	57	57	0	418	412	1		1	1		0	0	85	0	0	1.000000	9.999999e-01	0	27	0	152	0	57	418
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	T	rs193920774		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:7577141C>T	ENST00000269305.4	-	8	986	c.797G>A	c.(796-798)gGa>gAa	p.G266E	TP53_ENST00000445888.2_Missense_Mutation_p.G266E|TP53_ENST00000455263.2_Missense_Mutation_p.G266E|TP53_ENST00000359597.4_Missense_Mutation_p.G266E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.G266E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.990000	0.530000	9.400000e-01	6.700000e-01	0.820000	0.810034	0.820000	0.880000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)	24185						c.(796-798)gGa>gAa	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						50.0	44.0	46.0					17																	7577141		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577141C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>A	chr17.hg19:g.7577141C>T	ENSP00000269305:p.Gly266Glu	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.G266E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G266E|TP53_ENST00000420246.2_Missense_Mutation_p.G266E|TP53_ENST00000359597.4_Missense_Mutation_p.G266E|TP53_ENST00000413465.2_Intron	p.G266E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.685553	P04637	P53_HUMAN		8	986	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.797G>A	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614795	0.87359	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99898	-7.61;-7.61;-7.61;-7.61;-7.61;-7.61	5.13	5.13	0.70059	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.998	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	266;266;266;266;266;255;134	ENSP00000352610:G266E;ENSP00000269305:G266E;ENSP00000398846:G266E;ENSP00000391127:G266E;ENSP00000391478:G266E;ENSP00000425104:G134E	ENSP00000269305:G266E	G	-	2	0	0	TP53	7517866	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	13	0	13	13	1	1.870000	-20.000000	1	0.440000	NM_000546		0	15	14	0	43	43	0		1	1	1	0	0	13	468	0	0.999936	9.996204e-01	1	33	271	12	512	15	43
GPR142	350383	broad.mit.edu	37	17	72363648	72363648	+	Missense_Mutation	SNP	A	A	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:72363648A>T	ENST00000335666.4	+	1	52	c.4A>T	c.(4-6)Agt>Tgt	p.S2C		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	2						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						GTTAGCAATGAGTATTATGAT	0.527																																						ENST00000335666.4	1.000000	0.590000	1	6.800000e-01	0.800000	0.819603	0.800000	0.780000																										0				35						c.(4-6)Agt>Tgt		G protein-coupled receptor 142							116.0	109.0	112.0					17																	72363648		2203	4300	6503	SO:0001583	missense	350383	0	0					g.chr17:72363648A>T	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.4A>T	chr17.hg19:g.72363648A>T	ENSP00000335158:p.Ser2Cys	1						p.S2C	NM_181790.1	NP_861455.1	2	5	7	2.566464	Q7Z601	GP142_HUMAN		1	52	+			A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	1	1	hg19	c.4A>T	CCDS11698.1	0	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417868	0.25552	.	.	ENSG00000257008	ENST00000335666	T	0.71817	-0.6	2.61	1.45	0.22620	2.61	1.45	0.22620	.	.	.	.	.	T	0.46776	0.1410	N	0.08118	0	0.27124	N	0.962078	P	0.51653	0.947	B	0.40741	0.339	T	0.42032	-0.9475	9	0.87932	D	0	.	6.1442	0.20276	0.773:0.0:0.0:0.227	.	2	Q7Z601	GP142_HUMAN	C	2	ENSP00000335158:S2C	ENSP00000335158:S2C	S	+	1	0	0	GPR142	69875243	69875243	1.000000	0.71417	0.001000	0.08648	0.000000	0.00434	4.243000	0.58721	0.062000	0.16340	-0.343000	0.07986	AGT	0.553073		TCGA-2L-AAQJ-01A-12D-A397-08	0.527	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	1	0	1	2	2	2	2	0	0	0	0	68	0	68	67	1	1.870000	-20.000000	1	0.440000	NM_181790		0	51	51	0	324	320	1		1			0	0	68	0	0	1.000000	0	0	0	0	0	0	51	324
AFMID	125061	broad.mit.edu	37	17	76187132	76187132	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:76187132G>T	ENST00000586731.1	+	2	115	c.94G>T	c.(94-96)Gga>Tga	p.G32*	AFMID_ENST00000591952.1_Nonsense_Mutation_p.G49*|AFMID_ENST00000409257.5_Nonsense_Mutation_p.G49*|AFMID_ENST00000588800.1_Nonsense_Mutation_p.G49*|AFMID_ENST00000327898.5_Nonsense_Mutation_p.G49*|AFMID_ENST00000589256.1_Nonsense_Mutation_p.G49*					arylformamidase											autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)	19			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)			CTCACAGATAGGAATTGAAGG	0.557																																						ENST00000586731.1	1.000000	0.070000	1	1.300000e-01	0.210000	0.340724	0.210000	0.190000																										0				19						c.(94-96)Gga>Tga		arylformamidase							144.0	100.0	115.0					17																	76187132		2203	4300	6503	SO:0001587	stop_gained	125061	0	0					g.chr17:76187132G>T	BX648442	CCDS32750.2, CCDS45801.1	17q25.3	2005-11-09			ENSG00000183077	ENSG00000183077	3.5.1.9		20910	protein-coding gene	gene with protein product							Standard	NR_027083		Approved	DKFZp686F03259, KF	uc002juz.3	Q63HM1	OTTHUMG00000153957	ENST00000586731.1:c.94G>T	chr17.hg19:g.76187132G>T	ENSP00000466241:p.Gly32*	1					AFMID_ENST00000589256.1_Nonsense_Mutation_p.G49*|AFMID_ENST00000327898.5_Nonsense_Mutation_p.G49*|AFMID_ENST00000588800.1_Nonsense_Mutation_p.G49*|AFMID_ENST00000409257.5_Nonsense_Mutation_p.G49*|AFMID_ENST00000591952.1_Nonsense_Mutation_p.G49*	p.G32*			2	5	7	2.566464			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)	2	115	+				Nonsense_Mutation	SNP	ENST00000586731.1	0	1	hg19	c.94G>T		0	.	.	.	.	.	.	.	.	.	.	G	34	5.309732	0.95629	.	.	ENSG00000183077	ENST00000409257;ENST00000409431;ENST00000409722;ENST00000392388;ENST00000327898	.	.	.	4.9	3.86	0.44501	4.9	3.86	0.44501	.	0.483859	0.21363	N	0.075763	.	.	.	.	.	.	0.38453	D	0.947022	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-12.3045	4.8598	0.13577	0.1436:0.2108:0.6456:0.0	.	.	.	.	X	49	.	ENSP00000328938:G49X	G	+	1	0	0	AFMID	73698727	73698727	0.755000	0.28372	0.050000	0.19076	0.691000	0.40173	1.557000	0.36299	2.224000	0.72417	0.609000	0.83330	GGA	0.553073		TCGA-2L-AAQJ-01A-12D-A397-08	0.557	AFMID-015	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000438866.1	0	0	1	2	2	2	2	0	0	0	0	21	0	21	20	1	1.870000	-8.053794	1	0.440000	XM_058889		0	6	6	0	184	183	0		1	1		0	0	21	0	0	0.965142	9.167167e-01	0	4	0	135	0	6	184
PIK3R5	23533	broad.mit.edu	37	17	8791989	8791989	+	Missense_Mutation	SNP	G	G	C	rs201413001		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:8791989G>C	ENST00000447110.1	-	10	1239	c.1115C>G	c.(1114-1116)tCg>tGg	p.S372W	PIK3R5_ENST00000581552.1_Missense_Mutation_p.S372W|PIK3R5_ENST00000584803.1_Missense_Mutation_p.S372W	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	372					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						CAGATGGCGCGAGAGGGCCGG	0.632																																					NSCLC(18;589 615 7696 20311 50332)	ENST00000447110.1	0.660000	0.280000	5.600000e-01	3.600000e-01	0.450000	0.469066	0.450000	0.450000																										0				34						c.(1114-1116)tCg>tGg		phosphoinositide-3-kinase, regulatory subunit 5							63.0	67.0	65.0					17																	8791989		2203	4300	6503	SO:0001583	missense	23533	0	0					g.chr17:8791989G>C	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1115C>G	chr17.hg19:g.8791989G>C	ENSP00000392812:p.Ser372Trp	1					PIK3R5_ENST00000584803.1_Missense_Mutation_p.S372W|PIK3R5_ENST00000581552.1_Missense_Mutation_p.S372W	p.S372W	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	0	1	1	1.685553	Q8WYR1	PI3R5_HUMAN		10	1239	-			B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	1	1	hg19	c.1115C>G	CCDS11147.1	0	.	.	.	.	.	.	.	.	.	.	G	4.122	0.020770	0.08006	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.80304	-1.36	5.51	4.53	0.55603	5.51	4.53	0.55603	.	0.440169	0.25296	N	0.031685	T	0.81664	0.4870	N	0.24115	0.695	0.48452	D	0.99965	D	0.61697	0.99	P	0.61275	0.886	D	0.84368	0.0542	10	0.87932	D	0	-10.1214	15.3433	0.74314	0.0:0.0:0.8589:0.141	.	372	Q8WYR1	PI3R5_HUMAN	W	372	ENSP00000392812:S372W	ENSP00000269300:S372W	S	-	2	0	0	PIK3R5	8732714	8732714	0.943000	0.32029	0.003000	0.11579	0.023000	0.10783	2.226000	0.42963	1.312000	0.45043	0.650000	0.86243	TCG	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.632	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	1	0	1	2	2	2	2	0	0	0	0	40	0	40	38	1	1.870000	-3.326904	1	0.440000	NM_014308		0	18	18	0	121	120	1		1	0		0	0	40	0	0	0.999987	9.285503e-02	0	0	0	4	0	18	121
DNAH17	8632	broad.mit.edu	37	17	76567670	76567670	+	Splice_Site	SNP	A	A	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr17:76567670A>T	ENST00000585328.1	-	4	857		c.e4+1		DNAH17_ENST00000389840.5_Splice_Site	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGGAGGCCGTACCTGTTCATG	0.667																																						ENST00000585328.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				116						c.e4+1		dynein, axonemal, heavy chain 17							43.0	49.0	47.0					17																	76567670		2035	4167	6202	SO:0001630	splice_region_variant	8632	0	0					g.chr17:76567670A>T	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.732+1T>A	chr17.hg19:g.76567670A>T		1					DNAH17_ENST00000389840.5_Splice_Site		NM_173628.3	NP_775899.3	2	5	7	2.566464	Q9UFH2	DYH17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)	4	857	-			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Splice_Site	SNP	ENST00000585328.1	1	0	hg19			1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.058575	0.55325	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	.	.	.	5.13	5.13	0.70059	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1577	0.59527	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	DNAH17	74079265	74079265	1.000000	0.71417	0.965000	0.40720	0.502000	0.33828	7.753000	0.85153	1.922000	0.55676	0.459000	0.35465	.	0.553073		TCGA-2L-AAQJ-01A-12D-A397-08	0.667	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	1	0	1	2	2	2	2	0	0	0	0	56	0	56	54	1	1.870000	-20.000000	1	0.440000	NM_173628	Intron	0	113	112	0	218	217	0		1			0	0	56	0	0	1.000000	0	0	0	0	0	0	113	218
DLGAP1	9229	broad.mit.edu	37	18	3879329	3879329	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr18:3879329G>A	ENST00000315677.3	-	4	1335	c.740C>T	c.(739-741)gCg>gTg	p.A247V	DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000515196.2_Missense_Mutation_p.A247V|DLGAP1_ENST00000581527.1_Missense_Mutation_p.A247V|DLGAP1_ENST00000584874.1_Missense_Mutation_p.A247V	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	247					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGCCTTCACCGCCTGCTCGCT	0.657																																						ENST00000315677.3	1.000000	0.750000	1	8.400000e-01	0.940000	0.928370	0.940000	1.000000																										0				56						c.(739-741)gCg>gTg		discs, large (Drosophila) homolog-associated protein 1							62.0	62.0	62.0					18																	3879329		2203	4300	6503	SO:0001583	missense	9229	0	0					g.chr18:3879329G>A	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.740C>T	chr18.hg19:g.3879329G>A	ENSP00000316377:p.Ala247Val	0					DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000515196.2_Missense_Mutation_p.A247V|DLGAP1_ENST00000581527.1_Missense_Mutation_p.A247V|DLGAP1_ENST00000584874.1_Missense_Mutation_p.A247V	p.A247V	NM_004746.3	NP_004737.2	1	2	3	2.061695	O14490	DLGP1_HUMAN		4	1335	-		Colorectal(8;0.0257)	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	1	1	hg19	c.740C>T	CCDS11836.1	1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688161	0.68271	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.16597	2.33;2.33	5.51	5.51	0.81932	5.51	5.51	0.81932	.	0.118257	0.64402	D	0.000017	T	0.16642	0.0400	L	0.40543	1.245	0.53688	D	0.999975	B;P;B	0.40931	0.384;0.733;0.181	B;B;B	0.33339	0.038;0.162;0.069	T	0.01993	-1.1233	10	0.62326	D	0.03	-12.462	19.4162	0.94700	0.0:0.0:1.0:0.0	.	247;247;247	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	V	247	ENSP00000316377:A247V;ENSP00000445973:A247V	ENSP00000316377:A247V	A	-	2	0	0	DLGAP1	3869329	3869329	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.431000	0.80335	2.605000	0.88082	0.655000	0.94253	GCG	0.441229		TCGA-2L-AAQJ-01A-12D-A397-08	0.657	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4	1	0	1	2	2	2	2	0	0	0	0	69	0	69	68	1	1.870000	-20.000000	1	0.440000			0	68	68	0	260	258	1		1			0	0	69	0	0	1.000000	0	0	0	0	0	0	68	260
SETBP1	26040	broad.mit.edu	37	18	42530405	42530405	+	Missense_Mutation	SNP	G	G	A	rs367742803		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr18:42530405G>A	ENST00000282030.5	+	4	1396	c.1100G>A	c.(1099-1101)gGg>gAg	p.G367E		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	367						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AATACAGAAGGGAAAAGGGAA	0.448									Schinzel-Giedion syndrome																													ENST00000282030.5	1.000000	0.770000	1	8.600000e-01	0.960000	0.946051	0.960000	1.000000																										0				104						c.(1099-1101)gGg>gAg		SET binding protein 1							65.0	65.0	65.0					18																	42530405		2203	4300	6503	SO:0001583	missense	26040	0	0		Schinzel-Giedion syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	g.chr18:42530405G>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1100G>A	chr18.hg19:g.42530405G>A	ENSP00000282030:p.Gly367Glu	1						p.G367E	NM_015559.2	NP_056374.2	0	1	1	1.704625	Q9Y6X0	SETBP_HUMAN		4	1396	+			A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	1	1	hg19	c.1100G>A	CCDS11923.2	1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702158	0.48307	.	.	ENSG00000152217	ENST00000282030	T	0.37058	1.22	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.166529	0.53938	D	0.000041	T	0.31358	0.0794	L	0.27053	0.805	0.36681	D	0.87903	P	0.38597	0.639	B	0.35655	0.207	T	0.34551	-0.9824	10	0.87932	D	0	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	367	Q9Y6X0	SETBP_HUMAN	E	367	ENSP00000282030:G367E	ENSP00000282030:G367E	G	+	2	0	0	SETBP1	40784403	40784403	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	3.539000	0.53604	2.894000	0.99253	0.655000	0.94253	GGG	0.323998		TCGA-2L-AAQJ-01A-12D-A397-08	0.448	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	1	0	1	2	2	2	2	0	0	0	0	45	0	45	44	1	1.870000	-4.890624	1	0.440000	NM_001130110		0	61	60	0	173	172	1		1	0		0	0	45	0	0	1.000000	3.937572e-01	0	0	0	5	0	61	173
MBD2	8932	broad.mit.edu	37	18	51691000	51691000	+	Silent	SNP	C	C	A	rs375244494		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr18:51691000C>A	ENST00000256429.3	-	5	1230	c.1002G>T	c.(1000-1002)gcG>gcT	p.A334A		NM_003927.4	NP_003918.1	Q9UBB5	MBD2_HUMAN	methyl-CpG binding domain protein 2	334					ATP-dependent chromatin remodeling (GO:0043044)|cellular protein complex assembly (GO:0043623)|maternal behavior (GO:0042711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|protein domain specific binding (GO:0019904)|satellite DNA binding (GO:0003696)|siRNA binding (GO:0035197)			breast(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8				Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)		CTGTGATTGGCGCAGAGCTTG	0.473																																						ENST00000256429.3	0.160000	0.020000	1.200000e-01	4.000000e-02	0.070000	0.083634	0.070000	0.070000																										0				8						c.(1000-1002)gcG>gcT		methyl-CpG binding domain protein 2							112.0	97.0	102.0					18																	51691000		2203	4300	6503	SO:0001819	synonymous_variant	8932	1	121412	33				g.chr18:51691000C>A	AF072242	CCDS11953.1, CCDS45871.1	18q21	2008-08-01			ENSG00000134046	ENSG00000134046			6917	protein-coding gene	gene with protein product		603547				9774669, 10441743	Standard	NM_003927		Approved		uc002lfg.2	Q9UBB5	OTTHUMG00000132705	ENST00000256429.3:c.1002G>T	chr18.hg19:g.51691000C>A		1						p.A334A	NM_003927.4	NP_003918.1	0	1	1	1.704625	Q9UBB5	MBD2_HUMAN		5	1230	-			O95242|Q9UIS8	Silent	SNP	ENST00000256429.3	0	1	hg19	c.1002G>T	CCDS11953.1	0																																																																																								0.323998		TCGA-2L-AAQJ-01A-12D-A397-08	0.473	MBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256003.2	0	0	1	2	2	2	2	0	0	0	0	41	0	41	41	1	1.870000	-3.112260	1	0.440000	NM_003927		0	4	4	0	217	215	0		1	0		0	0	41	0	0	0.889020	8.811227e-01	0	0	0	212	0	4	217
GPI	2821	broad.mit.edu	37	19	34884838	34884838	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:34884838C>T	ENST00000356487.5	+	12	1170	c.929C>T	c.(928-930)aCg>aTg	p.T310M	GPI_ENST00000586425.1_Missense_Mutation_p.T310M|GPI_ENST00000415930.3_Missense_Mutation_p.T321M	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	310					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					TTCCGCACGACGCCCCTGGAG	0.627																																						ENST00000356487.5	0.960000	0.710000	9.000000e-01	7.700000e-01	0.830000	0.840314	0.830000	0.840000																										0				25						c.(928-930)aCg>aTg		glucose-6-phosphate isomerase							128.0	127.0	127.0					19																	34884838		2203	4300	6503	SO:0001583	missense	2821	3	121410	37				g.chr19:34884838C>T	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.929C>T	chr19.hg19:g.34884838C>T	ENSP00000348877:p.Thr310Met	0					GPI_ENST00000415930.3_Missense_Mutation_p.T321M|GPI_ENST00000586425.1_Missense_Mutation_p.T310M	p.T310M	NM_000175.3	NP_000166.2	0	0	0	2.024636	P06744	G6PI_HUMAN		12	1170	+	Esophageal squamous(110;0.162)		B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	1	1	hg19	c.929C>T	CCDS12437.1	0	.	.	.	.	.	.	.	.	.	.	C	13.96	2.394367	0.42410	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.93763	-3.28;-3.28	5.65	4.6	0.57074	5.65	4.6	0.57074	.	0.386357	0.32868	N	0.005554	D	0.96030	0.8707	M	0.75085	2.285	0.44454	D	0.997381	B;D;B;B	0.56746	0.05;0.977;0.299;0.286	B;D;B;B	0.64144	0.094;0.922;0.094;0.157	D	0.96395	0.9292	10	0.72032	D	0.01	-0.4064	15.9577	0.79898	0.1361:0.8639:0.0:0.0	.	282;321;283;310	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	M	321;310	ENSP00000405573:T321M;ENSP00000348877:T310M	ENSP00000348877:T310M	T	+	2	0	0	GPI	39576678	39576678	0.815000	0.29118	0.084000	0.20598	0.007000	0.05969	7.487000	0.81328	1.371000	0.46172	-0.188000	0.12872	ACG	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.627	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3	1	0	1	2	2	2	2	0	0	0	0	165	0	165	162	1	1.870000	-20.000000	1	0.440000			0	147	148	0	636	621	1		1	1		0	0	165	0	0	1.000000	1	0	173	0	393	0	147	636
HPN	3249	broad.mit.edu	37	19	35556925	35556925	+	Missense_Mutation	SNP	C	C	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:35556925C>G	ENST00000262626.2	+	12	2029	c.1204C>G	c.(1204-1206)Cag>Gag	p.Q402E	HPN_ENST00000597419.1_Missense_Mutation_p.Q244E|HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000392226.1_Missense_Mutation_p.Q402E	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	402	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	GTGGATCTTCCAGGCCATAAA	0.562																																						ENST00000262626.2	0.140000	0.030000	1.100000e-01	5.000000e-02	0.070000	0.085148	0.070000	0.080000																										0				19						c.(1204-1206)Cag>Gag		hepsin	Coagulation factor VIIa(DB00036)						96.0	104.0	101.0					19																	35556925		2203	4300	6503	SO:0001583	missense	3249	0	0					g.chr19:35556925C>G		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.1204C>G	chr19.hg19:g.35556925C>G	ENSP00000262626:p.Gln402Glu	0					HPN_ENST00000392226.1_Missense_Mutation_p.Q402E|HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000597419.1_Missense_Mutation_p.Q244E	p.Q402E	NM_182983.2	NP_892028.1	0	0	0	2.024636	P05981	HEPS_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0849)	12	2029	+	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	0	1	hg19	c.1204C>G	CCDS32993.1	0	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570793	0.28003	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	D;D	0.87887	-2.31;-2.31	4.86	3.81	0.43845	4.86	3.81	0.43845	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.194075	0.40908	D	0.000999	T	0.62575	0.2439	N	0.01656	-0.775	0.80722	D	1	B;B;B	0.23249	0.024;0.067;0.082	B;B;B	0.13407	0.003;0.006;0.009	T	0.62558	-0.6829	10	0.02654	T	1	.	10.3731	0.44066	0.3539:0.6461:0.0:0.0	.	374;402;402	B7Z1L4;B2ZDQ2;P05981	.;.;HEPS_HUMAN	E	402;402;374	ENSP00000262626:Q402E;ENSP00000376060:Q402E	ENSP00000262626:Q402E	Q	+	1	0	0	HPN	40248765	40248765	0.966000	0.33281	1.000000	0.80357	0.970000	0.65996	1.161000	0.31773	1.252000	0.44001	0.455000	0.32223	CAG	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.562	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	0	0	1	2	2	2	2	0	0	0	0	145	0	145	145	1	1.870000	-2.290691	0	0.440000	NM_002151		0	11	11	0	615	610	0		1	1		0	0	145	0	0	0.998276	3.861395e-02	0	2	0	14	0	11	615
PLEKHG2	64857	broad.mit.edu	37	19	39914871	39914871	+	Nonsense_Mutation	SNP	C	C	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:39914871C>G	ENST00000409794.3	+	19	3948	c.3098C>G	c.(3097-3099)tCa>tGa	p.S1033*	PLEKHG2_ENST00000409797.2_Intron|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000458508.2_Nonsense_Mutation_p.S974*|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000425673.1_Nonsense_Mutation_p.S1004*	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1033					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TTCACAGTTTCAGTCACCACC	0.547																																						ENST00000409794.3	1.000000	0.690000	9.600000e-01	7.700000e-01	0.860000	0.868087	0.860000	1.000000																										0				40						c.(3097-3099)tCa>tGa		pleckstrin homology domain containing, family G (with RhoGef domain) member 2							126.0	115.0	119.0					19																	39914871		2203	4300	6503	SO:0001587	stop_gained	64857	0	0					g.chr19:39914871C>G	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3098C>G	chr19.hg19:g.39914871C>G	ENSP00000386733:p.Ser1033*	0					PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000425673.1_Nonsense_Mutation_p.S1004*|PLEKHG2_ENST00000458508.2_Nonsense_Mutation_p.S974*|CTB-60E11.4_ENST00000601124.1_lincRNA	p.S1033*	NM_022835.2	NP_073746.2	0	0	0	2.024636	Q9H7P9	PKHG2_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)	19	3948	+	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Nonsense_Mutation	SNP	ENST00000409794.3	0	1	hg19	c.3098C>G	CCDS33022.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.087494|6.087494	0.97271|0.97271	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000205135|ENST00000409794;ENST00000425673;ENST00000458508	.|.	.|.	.|.	3.08|3.08	-3.41|-3.41	0.04839|0.04839	3.08|3.08	-3.41|-3.41	0.04839|0.04839	.|.	.|1.788450	.|0.03467	.|N	.|0.213043	T|.	0.31513|.	0.0799|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.26538|.	-1.0100|.	4|.	.|0.28530	.|T	.|0.3	.|.	9.007|9.007	0.36117|0.36117	0.0:0.6787:0.0:0.3213|0.0:0.6787:0.0:0.3213	.|.	.|.	.|.	.|.	E|X	901|1033;1004;974	.|.	.|ENSP00000386733:S1033X	Q|S	+|+	1|2	0|0	0|0	PLEKHG2|PLEKHG2	44606711|44606711	44606711|44606711	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.725000|0.725000	0.41563|0.41563	-0.142000|-0.142000	0.10311|0.10311	-0.739000|-0.739000	0.04809|0.04809	0.491000|0.491000	0.48974|0.48974	CAG|TCA	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.547	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	1	0	1	2	2	2	2	0	0	0	0	66	0	66	65	1	1.870000	-20.000000	1	0.440000	NM_022835		0	69	69	0	286	283	1		1	1		0	0	66	0	0	1.000000	9.710426e-01	0	3	0	23	0	69	286
PSG6	5675	broad.mit.edu	37	19	43411814	43411814	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:43411814G>A	ENST00000292125.2	-	4	943	c.899C>T	c.(898-900)aCg>aTg	p.T300M	PSG6_ENST00000402603.4_Intron|PSG6_ENST00000187910.2_Missense_Mutation_p.T300M	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	300	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				TTCATTTCTCGTGACACTGGG	0.488																																						ENST00000292125.2	1.000000	0.910000	1	9.700000e-01	0.990000	0.991422	0.990000	1.000000																										0				44						c.(898-900)aCg>aTg		pregnancy specific beta-1-glycoprotein 6							191.0	184.0	187.0					19																	43411814		2201	4295	6496	SO:0001583	missense	5675	1	121350	34				g.chr19:43411814G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.899C>T	chr19.hg19:g.43411814G>A	ENSP00000292125:p.Thr300Met	0					PSG6_ENST00000187910.2_Missense_Mutation_p.T300M|PSG6_ENST00000402603.4_Intron	p.T300M	NM_002782.4	NP_002773.1	0	0	0	2.024636	Q00889	PSG6_HUMAN		4	943	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	1	1	hg19	c.899C>T	CCDS12613.1	1	.	.	.	.	.	.	.	.	.	.	N	8.993	0.978199	0.18812	.	.	ENSG00000170848	ENST00000187910;ENST00000292125	T;T	0.15603	2.41;2.41	1.42	-0.067	0.13762	1.42	-0.067	0.13762	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.30665	0.0772	H	0.95745	3.715	0.09310	N	0.999998	B;P	0.39520	0.331;0.676	B;B	0.40864	0.146;0.342	T	0.33523	-0.9865	9	0.72032	D	0.01	.	4.8586	0.13571	0.0:0.397:0.603:0.0	.	300;300	Q00889;Q00889-2	PSG6_HUMAN;.	M	300	ENSP00000187910:T300M;ENSP00000292125:T300M	ENSP00000187910:T300M	T	-	2	0	0	PSG6	48103654	48103654	0.000000	0.05858	0.347000	0.25668	0.098000	0.18820	-0.625000	0.05534	0.792000	0.33850	0.134000	0.15878	ACG	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.488	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	1	0	1	2	2	2	2	0	0	0	0	178	0	178	183	1	1.870000	-20.000000	1	0.440000	NM_002782		0	199	187	0	650	606	1		1			0	0	178	0	0	1.000000	0	0	0	0	0	0	199	650
PTPRS	5802	broad.mit.edu	37	19	5244288	5244288	+	Silent	SNP	G	G	A	rs144956737		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:5244288G>A	ENST00000587303.1	-	10	1293	c.1194C>T	c.(1192-1194)taC>taT	p.Y398Y	PTPRS_ENST00000357368.4_Silent_p.Y398Y|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000372412.4_Silent_p.Y399Y|PTPRS_ENST00000348075.2_Silent_p.Y385Y|PTPRS_ENST00000262963.6_Silent_p.Y394Y|PTPRS_ENST00000588012.1_Silent_p.Y385Y|PTPRS_ENST00000592099.1_Silent_p.Y385Y|PTPRS_ENST00000353284.2_Silent_p.Y385Y			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	398	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CCCAGATCTCGTACTCCGAGT	0.637																																						ENST00000587303.1	1.000000	0.850000	1	9.500000e-01	0.990000	0.982518	0.990000	1.000000																										0				61						c.(1192-1194)taC>taT		protein tyrosine phosphatase, receptor type, S	Alendronate(DB00630)|Etidronic acid(DB01077)	G	,,,	1,4405	2.1+/-5.4	0,1,2202	69.0	58.0	62.0		1194,1155,1155,1167	-4.9	0.9	19	dbSNP_134	62	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PTPRS	NM_002850.3,NM_130853.2,NM_130854.2,NM_130855.2	,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,	398/1949,385/1502,385/1911,389/1506	5244288	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5802	3	121410	34				g.chr19:5244288G>A	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1194C>T	chr19.hg19:g.5244288G>A		0					PTPRS_ENST00000348075.2_Silent_p.Y385Y|PTPRS_ENST00000372412.4_Silent_p.Y399Y|PTPRS_ENST00000592099.1_Silent_p.Y385Y|PTPRS_ENST00000357368.4_Silent_p.Y398Y|PTPRS_ENST00000353284.2_Silent_p.Y385Y|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000588012.1_Silent_p.Y385Y|PTPRS_ENST00000262963.6_Silent_p.Y394Y	p.Y398Y			0	0	0	2.031251	Q13332	PTPRS_HUMAN		10	1293	-			O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	ENST00000587303.1	1	1	hg19	c.1194C>T	CCDS45930.1	1																																																																																								0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.637	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2	1	0	1	2	2	2	2	0	0	0	0	54	0	54	53	1	1.870000	-20.000000	1	0.440000			0	64	63	0	205	202	1		1	0		0	0	54	0	0	1.000000	1.460317e-01	0	0	0	3	0	64	205
FPR2	2358	broad.mit.edu	37	19	52272706	52272706	+	Silent	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:52272706C>T	ENST00000598776.1	+	2	1567	c.795C>T	c.(793-795)acC>acT	p.T265T	FPR2_ENST00000340023.6_Silent_p.T265T|FPR2_ENST00000598953.1_Silent_p.T265T	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	265					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						TTCTGGGCACCGTCTGGCTCA	0.502																																						ENST00000598776.1	1.000000	0.740000	1	8.500000e-01	0.970000	0.941424	0.970000	1.000000																										0				33						c.(793-795)acC>acT		formyl peptide receptor 2							125.0	106.0	112.0					19																	52272706		2203	4300	6503	SO:0001819	synonymous_variant	2358	0	0					g.chr19:52272706C>T	M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.795C>T	chr19.hg19:g.52272706C>T		0					FPR2_ENST00000598953.1_Silent_p.T265T|FPR2_ENST00000340023.6_Silent_p.T265T	p.T265T	NM_001462.3	NP_001453.1	0	0	0	2.024636	P25090	FPR2_HUMAN		2	1567	+			A8K3E2	Silent	SNP	ENST00000598776.1	1	1	hg19	c.795C>T	CCDS12840.1	1																																																																																								0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.502	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	1	0	1	2	2	2	2	0	0	0	0	28	0	28	27	1	1.870000	-3.870410	1	0.440000	NM_001005738		0	45	45	0	160	159	1		1	0		0	0	28	0	0	1.000000	1.275764e-01	0	0	0	3	0	45	160
ZNF835	90485	broad.mit.edu	37	19	57175831	57175831	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr19:57175831C>T	ENST00000537055.2	-	2	967	c.736G>A	c.(736-738)Ggt>Agt	p.G246S		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GGCTTCTCACCGGTGTGGATG	0.692																																						ENST00000537055.2	0.770000	0.310000	6.500000e-01	4.000000e-01	0.510000	0.533266	0.510000	0.500000																										0				47						c.(736-738)Ggt>Agt		zinc finger protein 835							40.0	39.0	39.0					19																	57175831		2203	4299	6502	SO:0001583	missense	90485	2	121392	28				g.chr19:57175831C>T	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.736G>A	chr19.hg19:g.57175831C>T	ENSP00000444747:p.Gly246Ser	0						p.G246S	NM_001005850.2	NP_001005850.2	0	0	0	2.024636	Q9Y2P0	ZN835_HUMAN		2	967	-			B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	1	1	hg19	c.736G>A	CCDS56105.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.267381	0.95399	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.25085	1.82	2.12	2.12	0.27331	2.12	2.12	0.27331	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39963	0.1098	L	0.43152	1.355	0.31918	N	0.61385	D	0.89917	1.0	D	0.83275	0.996	T	0.46857	-0.9161	9	0.87932	D	0	.	10.2869	0.43573	0.0:1.0:0.0:0.0	.	268	Q9Y2P0	ZN835_HUMAN	S	268;246	ENSP00000444747:G246S	ENSP00000341756:G268S	G	-	1	0	0	ZNF835	61867643	61867643	0.002000	0.14202	0.005000	0.12908	0.717000	0.41224	1.681000	0.37618	1.506000	0.48736	0.561000	0.74099	GGT	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.692	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	1	0	1	2	2	2	2	0	0	0	0	25	0	25	25	1	1.870000	-3.321058	1	0.440000	NM_001005850		0	16	16	0	123	122	1		1	0		0	0	25	0	0	0.999949	0	0	0	0	1	0	16	123
ATP5F1	515	broad.mit.edu	37	1	111992194	111992194	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:111992194G>A	ENST00000369722.3	+	1	637	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	WDR77_ENST00000497278.1_5'Flank|WDR77_ENST00000235090.5_5'Flank|WDR77_ENST00000411751.2_5'Flank|ATP5F1_ENST00000483994.1_Missense_Mutation_p.A11T|Y_RNA_ENST00000363020.1_RNA|ATP5F1_ENST00000369721.4_3'UTR	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	11					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		TTCCGCCGCCGCCACAGCGGG	0.577																																						ENST00000369722.3	0.100000	0.010000	8.000000e-02	3.000000e-02	0.050000	0.058021	0.050000	0.050000																										0				8						c.(31-33)Gcc>Acc		ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1							76.0	78.0	77.0					1																	111992194		2203	4300	6503	SO:0001583	missense	515	0	0					g.chr1:111992194G>A	X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.31G>A	chr1.hg19:g.111992194G>A	ENSP00000358737:p.Ala11Thr	1					ATP5F1_ENST00000483994.1_Missense_Mutation_p.A11T|Y_RNA_ENST00000363020.1_RNA|ATP5F1_ENST00000369721.4_3'UTR|WDR77_ENST00000411751.2_5'Flank|WDR77_ENST00000497278.1_5'Flank|WDR77_ENST00000235090.5_5'Flank	p.A11T	NM_001688.4	NP_001679.2	0	1	1	1.798735	P24539	AT5F1_HUMAN		1	637	+		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	ENST00000369722.3	0	1	hg19	c.31G>A	CCDS836.1	0	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843991	0.71488	.	.	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.31510	1.49;1.51	5.73	4.82	0.62117	5.73	4.82	0.62117	.	0.250346	0.33650	N	0.004681	T	0.09202	0.0227	L	0.54323	1.7	0.20074	N	0.999938	P;P	0.48640	0.913;0.913	B;B	0.28385	0.089;0.089	T	0.11817	-1.0572	10	0.24483	T	0.36	.	11.2813	0.49197	0.0844:0.0:0.9156:0.0	.	11;11	Q08ET0;P24539	.;AT5F1_HUMAN	T	11	ENSP00000358737:A11T;ENSP00000420366:A11T	ENSP00000358737:A11T	A	+	1	0	0	ATP5F1	111793717	111793717	0.986000	0.35501	1.000000	0.80357	0.867000	0.49689	2.836000	0.48183	1.562000	0.49601	0.655000	0.94253	GCC	0.338061		TCGA-2L-AAQJ-01A-12D-A397-08	0.577	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032455.1	0	0	0	2	2	2	2	0	0	0	0	105	0	105	105	1	1.870000	-2.421037	0	0.440000	NM_001688		0	6	5	0	454	454	0		1	1		0	0	105	0	0	0.964964	9.088540e-01	0	2	0	324	0	6	454
KPRP	448834	broad.mit.edu	37	1	152733552	152733552	+	Silent	SNP	C	C	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:152733552C>A	ENST00000606109.1	+	1	1516	c.1488C>A	c.(1486-1488)cgC>cgA	p.R496R	KPRP_ENST00000368773.1_Silent_p.R496R			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	496	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACTTGGCGCAGCCCCAGCC	0.647																																						ENST00000606109.1	1.000000	0.070000	2.700000e-01	1.000000e-01	0.150000	0.276156	0.150000	0.140000																										0				60						c.(1486-1488)cgC>cgA		keratinocyte proline-rich protein							45.0	51.0	49.0					1																	152733552		2203	4300	6503	SO:0001819	synonymous_variant	448834	0	0					g.chr1:152733552C>A	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1488C>A	chr1.hg19:g.152733552C>A		1					KPRP_ENST00000368773.1_Silent_p.R496R	p.R496R			2	2	4	2.219696	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	1	1516	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)			Silent	SNP	ENST00000606109.1	0	1	hg19	c.1488C>A	CCDS30862.1	0																																																																																								0.481097		TCGA-2L-AAQJ-01A-12D-A397-08	0.647	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	0	0	1	2	2	2	2	0	0	0	0	52	0	52	52	1	1.870000	-9.944246	1	0.440000	NM_001025231		0	9	9	0	296	292	0		1			0	0	52	0	0	0.994053	0	0	0	0	0	0	9	296
FDPS	2224	broad.mit.edu	37	1	155289625	155289625	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:155289625G>A	ENST00000356657.6	+	10	1127	c.965G>A	c.(964-966)gGc>gAc	p.G322D	RUSC1-AS1_ENST00000543656.1_RNA|FDPS_ENST00000447866.1_Missense_Mutation_p.G256D|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368352.5_5'Flank|RUSC1-AS1_ENST00000450199.1_RNA|FDPS_ENST00000368356.4_Missense_Mutation_p.G322D	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	322					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	AGTGTGACCGGCAAAATTGGC	0.567																																						ENST00000356657.6	1.000000	0.020000	1.200000e-01	3.000000e-02	0.060000	0.195827	0.060000	0.060000																										0				10						c.(964-966)gGc>gAc		farnesyl diphosphate synthase	Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)						113.0	112.0	112.0					1																	155289625		2203	4300	6503	SO:0001583	missense	2224	0	0					g.chr1:155289625G>A	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.965G>A	chr1.hg19:g.155289625G>A	ENSP00000349078:p.Gly322Asp	1					RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368352.5_5'Flank|FDPS_ENST00000368356.4_Missense_Mutation_p.G322D|FDPS_ENST00000447866.1_Missense_Mutation_p.G256D|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368354.3_5'Flank	p.G322D	NM_001135821.1	NP_001129293.1	2	2	4	2.219696	P14324	FPPS_HUMAN	Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)	10	1127	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	ENST00000356657.6	0	1	hg19	c.965G>A	CCDS1110.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143251	0.77888	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	T;T;T	0.73681	-0.77;-0.77;-0.77	4.28	4.28	0.50868	4.28	4.28	0.50868	Terpenoid synthase (2);	0.000000	0.44688	D	0.000439	D	0.88250	0.6386	H	0.94698	3.57	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.90597	0.4541	10	0.87932	D	0	-1.7784	14.6536	0.68817	0.0:0.0:1.0:0.0	.	322	P14324	FPPS_HUMAN	D	256;322;322	ENSP00000391755:G256D;ENSP00000357340:G322D;ENSP00000349078:G322D	ENSP00000349078:G322D	G	+	2	0	0	FDPS	153556249	153556249	1.000000	0.71417	0.997000	0.53966	0.488000	0.33401	9.276000	0.95745	2.673000	0.90976	0.561000	0.74099	GGC	0.481097		TCGA-2L-AAQJ-01A-12D-A397-08	0.567	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039053.1	0	0	1	2	18	26	2	1	0	1	1	114	0	114	111	1	1.870000	-1.788477	0	0.440000	NM_002004		0	7	7	0	586	577	0		0	0		1	0	114	0	0	0.018526	2.698581e-02	0	2	0	947	0	7	586
BCAN	63827	broad.mit.edu	37	1	156621427	156621427	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:156621427G>A	ENST00000329117.5	+	7	1579	c.1243G>A	c.(1243-1245)Gga>Aga	p.G415R	BCAN_ENST00000361588.5_Missense_Mutation_p.G415R|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	415	Glu-rich.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGAGGACGGAGGAGGTGGAAG	0.557																																						ENST00000329117.5	1.000000	0.670000	9.900000e-01	7.400000e-01	0.830000	0.848985	0.830000	0.820000																										0				55						c.(1243-1245)Gga>Aga		brevican							90.0	89.0	89.0					1																	156621427		2203	4300	6503	SO:0001583	missense	63827	7	121410	41				g.chr1:156621427G>A	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1243G>A	chr1.hg19:g.156621427G>A	ENSP00000331210:p.Gly415Arg	1					RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.G415R	p.G415R	NM_021948.4	NP_068767.3	2	2	4	2.219696	Q96GW7	PGCB_HUMAN		7	1579	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	1	1	hg19	c.1243G>A	CCDS1149.1	0	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292944	0.23564	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.13196	2.61;3.33	5.17	3.16	0.36331	5.17	3.16	0.36331	.	0.777525	0.10979	N	0.612889	T	0.02193	0.0068	N	0.11201	0.11	0.09310	N	1	B;B	0.15473	0.006;0.013	B;B	0.14578	0.005;0.011	T	0.43940	-0.9360	10	0.15066	T	0.55	-0.351	11.1054	0.48199	0.1755:0.0:0.8245:0.0	.	415;415	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	R	354;415;415	ENSP00000331210:G415R;ENSP00000354925:G415R	ENSP00000255029:G354R	G	+	1	0	0	BCAN	154888051	154888051	0.011000	0.17503	0.672000	0.29872	0.985000	0.73830	1.976000	0.40579	1.418000	0.47098	0.655000	0.94253	GGA	0.481097		TCGA-2L-AAQJ-01A-12D-A397-08	0.557	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	1	0	1	2	2	2	2	0	0	0	0	84	0	84	84	1	1.870000	-20.000000	1	0.440000	NM_021948		0	88	88	0	438	434	1		1			0	0	84	0	0	1.000000	0	0	0	0	0	0	88	438
TNN	63923	broad.mit.edu	37	1	175105027	175105027	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:175105027G>T	ENST00000239462.4	+	16	3490	c.3377G>T	c.(3376-3378)tGg>tTg	p.W1126L		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1126	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.W1126*(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TTCAAGCGATGGAGGAGCTAT	0.537																																						ENST00000239462.4	1.000000	0.870000	1	9.500000e-01	0.990000	0.984020	0.990000	1.000000																										1	Substitution - Nonsense(1)	p.W1126*(1)	large_intestine(1)	156						c.(3376-3378)tGg>tTg		tenascin N							151.0	151.0	151.0					1																	175105027		2203	4300	6503	SO:0001583	missense	63923	0	0					g.chr1:175105027G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3377G>T	chr1.hg19:g.175105027G>T	ENSP00000239462:p.Trp1126Leu	1						p.W1126L	NM_022093.1	NP_071376.1	2	2	4	2.219696	Q9UQP3	TENN_HUMAN		16	3490	+		Breast(1374;0.000962)	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	1	1	hg19	c.3377G>T	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912742	0.92178	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	D	0.86865	-2.18	5.5	5.5	0.81552	5.5	5.5	0.81552	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.115488	0.64402	D	0.000005	D	0.96614	0.8895	H	0.98818	4.34	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.98254	1.0495	10	0.87932	D	0	.	19.003	0.92841	0.0:0.0:1.0:0.0	.	1126	Q9UQP3	TENN_HUMAN	L	1126;949	ENSP00000239462:W1126L	ENSP00000239462:W1126L	W	+	2	0	0	TNN	173371650	173371650	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.420000	0.97426	2.555000	0.86185	0.655000	0.94253	TGG	0.481097		TCGA-2L-AAQJ-01A-12D-A397-08	0.537	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	1	0	1	2	2	2	2	0	0	0	0	97	0	97	97	1	1.870000	-3.575378	1	0.440000	XM_040527		0	106	104	0	395	389	1		1			0	0	97	0	0	1.000000	0	0	0	0	0	0	106	395
TNR	7143	broad.mit.edu	37	1	175365862	175365862	+	Missense_Mutation	SNP	G	G	A	rs138654492		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:175365862G>A	ENST00000367674.2	-	5	1766	c.1058C>T	c.(1057-1059)aCg>aTg	p.T353M	TNR_ENST00000263525.2_Missense_Mutation_p.T353M			Q92752	TENR_HUMAN	tenascin R	353	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CACATATTCCGTCACTGCCAT	0.617																																						ENST00000367674.2	1.000000	0.020000	1.300000e-01	4.000000e-02	0.060000	0.200547	0.060000	0.070000																										0				177						c.(1057-1059)aCg>aTg		tenascin R		G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	83.0	83.0	83.0		1058	6.0	1.0	1	dbSNP_134	83	0,8600		0,0,4300	no	missense	TNR	NM_003285.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	353/1359	175365862	1,13005	2203	4300	6503	SO:0001583	missense	7143	7	121412	42				g.chr1:175365862G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1058C>T	chr1.hg19:g.175365862G>A	ENSP00000356646:p.Thr353Met	1					TNR_ENST00000263525.2_Missense_Mutation_p.T353M	p.T353M			2	2	4	2.219696	Q92752	TENR_HUMAN		5	1766	-	Renal(580;0.146)		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	0	1	hg19	c.1058C>T	CCDS1318.1	0	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905250	0.92035	2.27E-4	0.0	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.60171	0.21;0.21	5.96	5.96	0.96718	5.96	5.96	0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.055941	0.64402	D	0.000001	T	0.77805	0.4185	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.76277	-0.3018	10	0.46703	T	0.11	.	19.9958	0.97383	0.0:0.0:1.0:0.0	.	353	Q92752	TENR_HUMAN	M	353	ENSP00000356646:T353M;ENSP00000263525:T353M	ENSP00000263525:T353M	T	-	2	0	0	TNR	173632485	173632485	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.328000	0.96403	2.826000	0.97356	0.655000	0.94253	ACG	0.481097		TCGA-2L-AAQJ-01A-12D-A397-08	0.617	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	0	0	1	2	2	2	2	0	0	0	0	86	0	86	86	1	1.870000	-5.621657	1	0.440000	NM_003285		0	7	7	0	540	529	0		1			0	0	86	0	0	0.979406	0	0	0	0	0	0	7	540
ENO1	2023	broad.mit.edu	37	1	8926458	8926458	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:8926458G>A	ENST00000234590.4	-	7	666	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	183	Required for repression of c-myc promoter activity.				carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GCTCCAATGCGCATGGCTTCC	0.512																																					Esophageal Squamous(21;302 608 19946 22210 33560)	ENST00000234590.4	0.110000	0.010000	8.000000e-02	3.000000e-02	0.050000	0.058738	0.050000	0.050000																										0				10						c.(547-549)Cgc>Tgc		enolase 1, (alpha)							141.0	132.0	135.0					1																	8926458		2203	4300	6503	SO:0001583	missense	2023	2	121412	37				g.chr1:8926458G>A	BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.547C>T	chr1.hg19:g.8926458G>A	ENSP00000234590:p.Arg183Cys	1						p.R183C	NM_001428.3	NP_001419.1	0	1	1	1.797343	P06733	ENOA_HUMAN		7	666	-	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Missense_Mutation	SNP	ENST00000234590.4	0	1	hg19	c.547C>T	CCDS97.1	0	.	.	.	.	.	.	.	.	.	.	G	19.56	3.849934	0.71603	.	.	ENSG00000074800	ENST00000234590	T	0.58358	0.34	5.33	5.33	0.75918	5.33	5.33	0.75918	Enolase, C-terminal (1);	0.052249	0.85682	N	0.000000	T	0.63792	0.2541	M	0.87097	2.86	0.80722	D	1	B;B;B;B;B	0.31769	0.194;0.238;0.339;0.161;0.194	B;B;B;B;B	0.34991	0.102;0.123;0.193;0.061;0.102	T	0.69720	-0.5069	10	0.87932	D	0	-2.9305	18.013	0.89230	0.0:0.0:1.0:0.0	.	87;150;21;90;183	E2DRY6;A4UCS8;Q9BT62;P06733-2;P06733	.;.;.;.;ENOA_HUMAN	C	183	ENSP00000234590:R183C	ENSP00000234590:R183C	R	-	1	0	0	ENO1	8849045	8849045	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.984000	0.88150	2.492000	0.84095	0.563000	0.77884	CGC	0.343186		TCGA-2L-AAQJ-01A-12D-A397-08	0.512	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004945.1	0	0	1	2	2	2	2	0	0	0	0	104	0	104	103	1	1.870000	-2.202556	0	0.440000	NM_001428		0	6	6	0	452	448	0		1	0		0	0	104	0	0	0.964240	9.994856e-01	0	0	0	1288	0	6	452
KIAA1522	57648	broad.mit.edu	37	1	33237860	33237860	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:33237860G>A	ENST00000373480.1	+	6	3006	c.2903G>A	c.(2902-2904)cGc>cAc	p.R968H	KIAA1522_ENST00000401073.2_Missense_Mutation_p.R1027H|KIAA1522_ENST00000373481.3_Missense_Mutation_p.R979H|YARS_ENST00000469100.1_5'Flank|KIAA1522_ENST00000294521.3_Intron	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	968	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CCTGTGGCCCGCAAGCCGTCT	0.662																																						ENST00000373480.1	0.190000	0.020000	1.400000e-01	5.000000e-02	0.080000	0.099028	0.080000	0.080000																										0				24						c.(2902-2904)cGc>cAc		KIAA1522							30.0	36.0	34.0					1																	33237860		1900	4100	6000	SO:0001583	missense	57648	4	120800	33				g.chr1:33237860G>A	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2903G>A	chr1.hg19:g.33237860G>A	ENSP00000362579:p.Arg968His	1					YARS_ENST00000469100.1_5'Flank|KIAA1522_ENST00000401073.2_Missense_Mutation_p.R1027H|KIAA1522_ENST00000373481.3_Missense_Mutation_p.R979H|KIAA1522_ENST00000294521.3_Intron	p.R968H	NM_001198972.1	NP_001185901.1	0	1	1	1.756461	Q9P206	K1522_HUMAN		6	3006	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	0	1	hg19	c.2903G>A	CCDS55588.1	0	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043295	0.75732	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.16597	2.33;2.34;2.35	5.05	4.14	0.48551	5.05	4.14	0.48551	.	0.086750	0.45867	D	0.000333	T	0.20941	0.0504	M	0.61703	1.905	0.30845	N	0.73524	D;D;D	0.57257	0.979;0.979;0.979	P;P;P	0.46049	0.502;0.502;0.502	T	0.16541	-1.0399	10	0.46703	T	0.11	-11.6125	8.9717	0.35910	0.2107:0.0:0.7892:0.0	.	979;968;1027	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	H	1027;979;968	ENSP00000383851:R1027H;ENSP00000362580:R979H;ENSP00000362579:R968H	ENSP00000362579:R968H	R	+	2	0	0	KIAA1522	33010447	33010447	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.416000	0.52707	1.503000	0.48686	0.650000	0.86243	CGC	0.323998		TCGA-2L-AAQJ-01A-12D-A397-08	0.662	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1	0	0	1	2	12	11	2	1	0	1	1	56	0	56	55	1	1.870000	-2.521368	1	0.440000			0	4	4	0	182	178	0		0	0		1	0	56	0	0	0.031157	3.529645e-02	0	0	0	168	0	4	182
PM20D1	148811	broad.mit.edu	37	1	205819140	205819140	+	Missense_Mutation	SNP	T	T	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr1:205819140T>G	ENST00000367136.4	-	1	105	c.61A>C	c.(61-63)Acc>Ccc	p.T21P	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	21					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CTGGAGACGGTAGGGAAAACT	0.602																																						ENST00000367136.4	1.000000	0.350000	7.100000e-01	4.200000e-01	0.520000	0.582681	0.520000	0.500000																										0				28						c.(61-63)Acc>Ccc		peptidase M20 domain containing 1							82.0	77.0	79.0					1																	205819140		2203	4300	6503	SO:0001583	missense	148811	0	0					g.chr1:205819140T>G		CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.61A>C	chr1.hg19:g.205819140T>G	ENSP00000356104:p.Thr21Pro	1					PM20D1_ENST00000460624.1_5'UTR	p.T21P	NM_152491.4	NP_689704.4	2	2	4	2.219696	Q6GTS8	P20D1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0252)	1	105	-	Breast(84;0.201)		Q6P4E3|Q96DM4	Missense_Mutation	SNP	ENST00000367136.4	1	1	hg19	c.61A>C	CCDS1460.1	0	.	.	.	.	.	.	.	.	.	.	T	12.71	2.018274	0.35606	.	.	ENSG00000162877	ENST00000367136	T	0.07327	3.2	5.44	0.353	0.16058	5.44	0.353	0.16058	.	0.566255	0.20291	N	0.095250	T	0.08714	0.0216	L	0.59436	1.845	0.09310	N	1	P	0.49961	0.93	P	0.44860	0.462	T	0.20874	-1.0262	10	0.36615	T	0.2	.	3.7543	0.08579	0.1477:0.2187:0.0:0.6336	.	21	Q6GTS8	P20D1_HUMAN	P	21	ENSP00000356104:T21P	ENSP00000356104:T21P	T	-	1	0	0	PM20D1	204085763	204085763	0.961000	0.32948	0.001000	0.08648	0.039000	0.13416	0.604000	0.24164	-0.105000	0.12132	0.533000	0.62120	ACC	0.481097		TCGA-2L-AAQJ-01A-12D-A397-08	0.602	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087736.1	1	0	1	2	2	2	2	0	0	0	0	58	0	58	57	1	1.870000	-20.000000	1	0.440000	NM_152491		0	28	27	0	245	245	1		1	0		0	0	58	0	0	1.000000	0	0	0	0	1	0	28	245
SIGLEC1	6614	broad.mit.edu	37	20	3673686	3673686	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr20:3673686C>T	ENST00000344754.4	-	14	3600	c.3601G>A	c.(3601-3603)Gcc>Acc	p.A1201T	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.A1201T	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1201	Ig-like C2-type 12.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GCCAGCTGGGCGGGCGGGCGG	0.721																																						ENST00000344754.4	1.000000	0.780000	9.900000e-01	8.700000e-01	0.940000	0.934704	0.940000	0.990000																										0				70						c.(3601-3603)Gcc>Acc		sialic acid binding Ig-like lectin 1, sialoadhesin							11.0	15.0	14.0					20																	3673686		2156	4245	6401	SO:0001583	missense	6614	1	119828	27				g.chr20:3673686C>T	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3601G>A	chr20.hg19:g.3673686C>T	ENSP00000341141:p.Ala1201Thr	1					SIGLEC1_ENST00000202578.4_Missense_Mutation_p.A1201T	p.A1201T	NM_023068.3	NP_075556.1	0	1	1	1.597628	Q9BZZ2	SN_HUMAN		14	3600	-			Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	1	1	hg19	c.3601G>A	CCDS13060.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.66|17.66	3.443368|3.443368	0.63067|0.63067	.|.	.|.	ENSG00000088827|ENSG00000088827	ENST00000344754;ENST00000202578|ENST00000419548	T;T|.	0.75154|.	-0.91;-0.91|.	4.74|4.74	4.74|4.74	0.60224|0.60224	4.74|4.74	4.74|4.74	0.60224|0.60224	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.39615|.	N|.	0.001309|.	T|T	0.73992|0.73992	0.3658|0.3658	M|M	0.78223|0.78223	2.4|2.4	0.36727|0.36727	D|D	0.88151|0.88151	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.75484|.	0.986;0.966|.	T|T	0.79339|0.79339	-0.1844|-0.1844	10|5	0.30078|.	T|.	0.28|.	.|.	13.088|13.088	0.59153|0.59153	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1201;1201|.	Q9BZZ2;Q9BZZ2-3|.	SN_HUMAN;.|.	T|H	1201|14	ENSP00000341141:A1201T;ENSP00000202578:A1201T|.	ENSP00000202578:A1201T|.	A|R	-|-	1|2	0|0	0|0	SIGLEC1|SIGLEC1	3621686|3621686	3621686|3621686	0.045000|0.045000	0.20229|0.20229	0.979000|0.979000	0.43373|0.43373	0.294000|0.294000	0.27393|0.27393	0.222000|0.222000	0.17699|0.17699	2.477000|2.477000	0.83638|0.83638	0.655000|0.655000	0.94253|0.94253	GCC|CGC	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.721	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	1	0	1	2	2	2	2	0	0	0	0	22	0	22	21	1	1.870000	-6.835376	1	0.440000	NM_023068		0	48	48	0	104	103	0		1	0		0	0	22	0	0	1.000000	0	0	0	0	1	0	48	104
RBM12	10137	broad.mit.edu	37	20	34240896	34240896	+	Silent	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr20:34240896C>T	ENST00000374114.3	-	3	2612	c.2349G>A	c.(2347-2349)tcG>tcA	p.S783S	CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000352393.4_Intron|RBM12_ENST00000359646.1_Silent_p.S783S|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000317677.5_Intron|RBM12_ENST00000374104.3_Silent_p.S783S|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397446.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	783	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CTCCAAATCCCGATGGCCCAC	0.562																																						ENST00000374114.3	1.000000	0.870000	1	9.700000e-01	0.990000	0.987650	0.990000	1.000000																										0				36						c.(2347-2349)tcG>tcA		RNA binding motif protein 12							39.0	43.0	42.0					20																	34240896		2198	4293	6491	SO:0001819	synonymous_variant	10137	0	0					g.chr20:34240896C>T	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2349G>A	chr20.hg19:g.34240896C>T		0					CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Silent_p.S783S|RBM12_ENST00000359646.1_Silent_p.S783S|CPNE1_ENST00000397445.1_Intron	p.S783S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	0	0	0	2.020317	Q9NTZ6	RBM12_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00953)	3	2612	-	Lung NSC(9;0.00608)|all_lung(11;0.00918)		B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	1	1	hg19	c.2349G>A	CCDS13261.1	1																																																																																								0.427403		TCGA-2L-AAQJ-01A-12D-A397-08	0.562	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	1	0	1	2	2	2	2	0	0	0	0	67	0	67	66	1	1.870000	-4.091664	1	0.440000	NM_006047		0	79	77	0	246	245	0		1	1		0	0	67	0	0	1.000000	9.999997e-01	0	29	0	42	0	79	246
BAGE2	85319	broad.mit.edu	37	21	11098773	11098773	+	RNA	SNP	G	G	A	rs77771067	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr21:11098773G>A	ENST00000470054.1	-	0	152							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		cgctcaggccgccctcctaac	0.627													-|||	2	0.000399361	0.0015	0.0	5008	,	,		42901	0.0		0.0	False		,,,				2504	0.0					ENST00000470054.1	0.380000	0.220000	3.400000e-01	2.500000e-01	0.290000	0.305350	0.290000	0.300000																										0												B melanoma antigen family, member 2		G		3,4281		0,3,2139	82.0	116.0	105.0				0.0	21	dbSNP_131	105	1,8543		0,1,4271	no	intergenic				0,4,6410	AA,AG,GG		0.0117,0.07,0.0312			11098773	4,12824	2142	4272	6414			85319	21	121250	43				g.chr21:11098773G>A	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		chr21.hg19:g.11098773G>A		0									0	0	0	2.026235	Q86Y30	BAGE2_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	0	152	-			A8K925|Q08ER0	RNA	SNP	ENST00000470054.1	1	1	hg19			0																																																																																								0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.627	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	0	0	1	2	2	2	2	0	0	0	0	183	0	183	177	1	1.870000	-2.966611	1	0.440000	NM_182482		0	54	51	0	747	677	0		1			0	0	183	0	0	1.000000	0	0	0	0	0	0	54	747
ADARB1	104	broad.mit.edu	37	21	46596475	46596475	+	Missense_Mutation	SNP	C	C	T	rs142476560		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr21:46596475C>T	ENST00000360697.3	+	2	874	c.859C>T	c.(859-861)Cgg>Tgg	p.R287W	ADARB1_ENST00000348831.4_Missense_Mutation_p.R287W|ADARB1_ENST00000539173.1_Missense_Mutation_p.R287W|ADARB1_ENST00000389863.4_Missense_Mutation_p.R287W|ADARB1_ENST00000437626.1_Intron			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	287	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		TGCCAAGGCCCGGGCTGCGCA	0.572																																						ENST00000360697.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999360	0.990000	1.000000																										0				17						c.(859-861)Cgg>Tgg		adenosine deaminase, RNA-specific, B1							52.0	56.0	55.0					21																	46596475		2203	4300	6503	SO:0001583	missense	104	0	0					g.chr21:46596475C>T	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.859C>T	chr21.hg19:g.46596475C>T	ENSP00000353920:p.Arg287Trp	0					ADARB1_ENST00000389863.4_Missense_Mutation_p.R287W|ADARB1_ENST00000539173.1_Missense_Mutation_p.R287W|ADARB1_ENST00000348831.4_Missense_Mutation_p.R287W|ADARB1_ENST00000437626.1_Intron	p.R287W			0	0	0	2.026235	P78563	RED1_HUMAN		2	874	+			A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	1	1	hg19	c.859C>T	CCDS33589.1	1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077779	0.76528	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.14	5.14	0.70334	5.14	5.14	0.70334	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.061314	0.64402	D	0.000003	D	0.86727	0.6002	M	0.77486	2.375	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.998;0.998	D;D;D;D;D	0.77004	0.957;0.989;0.975;0.957;0.957	D	0.87690	0.2553	10	0.72032	D	0.01	-46.512	11.5532	0.50733	0.1787:0.8213:0.0:0.0	.	314;287;287;315;287	P78563-4;P78563;Q4AE77;G5E9B4;P78563-3	.;RED1_HUMAN;.;.;.	W	287	ENSP00000441897:R287W;ENSP00000374513:R287W;ENSP00000015877:R287W;ENSP00000353920:R287W	ENSP00000015877:R287W	R	+	1	2	2	ADARB1	45420903	45420903	0.994000	0.37717	1.000000	0.80357	0.976000	0.68499	2.697000	0.47060	2.552000	0.86080	0.655000	0.94253	CGG	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.572	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	1	0	1	2	2	2	2	0	0	0	0	57	0	57	57	1	1.870000	-5.924463	1	0.440000	NM_015833		0	87	86	0	230	229	1		1	0		0	0	57	0	0	1.000000	1.861163e-01	0	0	0	3	0	87	230
CECR2	27443	broad.mit.edu	37	22	18021889	18021889	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr22:18021889C>T	ENST00000400585.2	+	16	2006	c.1568C>T	c.(1567-1569)aCa>aTa	p.T523I	CECR2_ENST00000400573.5_Missense_Mutation_p.T664I|CECR2_ENST00000262608.8_Missense_Mutation_p.T665I			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	706					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AGGCTAGGCACACCAGAGGAG	0.547																																						ENST00000400585.2	0.840000	0.240000	6.600000e-01	3.500000e-01	0.490000	0.509919	0.490000	0.470000																										0				59						c.(1567-1569)aCa>aTa		cat eye syndrome chromosome region, candidate 2							34.0	35.0	35.0					22																	18021889		1997	4153	6150	SO:0001583	missense	27443	0	0					g.chr22:18021889C>T	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1568C>T	chr22.hg19:g.18021889C>T	ENSP00000383428:p.Thr523Ile	0					CECR2_ENST00000400573.5_Missense_Mutation_p.T664I|CECR2_ENST00000262608.8_Missense_Mutation_p.T665I	p.T523I			1	2	3	2.062546	Q9BXF3	CECR2_HUMAN		16	2006	+		all_epithelial(15;0.139)	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	ENST00000400585.2	0	1	hg19	c.1568C>T		0	.	.	.	.	.	.	.	.	.	.	C	4.046	0.006138	0.07866	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.26223	1.88;1.87;1.75	5.28	3.1	0.35709	5.28	3.1	0.35709	.	1.079560	0.07208	N	0.858745	T	0.25195	0.0612	L	0.51422	1.61	0.09310	N	1	B;B;B	0.23442	0.085;0.049;0.029	B;B;B	0.14023	0.01;0.01;0.01	T	0.17684	-1.0361	10	0.29301	T	0.29	-0.0068	10.7002	0.45922	0.0:0.7801:0.0:0.2199	.	706;523;664	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	I	523;664;665	ENSP00000383428:T523I;ENSP00000383417:T664I;ENSP00000262608:T665I	ENSP00000262608:T665I	T	+	2	0	0	CECR2	16401889	16401889	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.558000	0.23469	1.467000	0.48044	0.655000	0.94253	ACA	0.441229		TCGA-2L-AAQJ-01A-12D-A397-08	0.547	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	0	0	1	2	2	2	2	0	0	0	0	21	0	21	20	1	1.870000	-15.383410	1	0.440000	NM_031413		0	9	9	0	77	76	0		1	0		0	0	21	0	0	0.994775	0	0	0	0	1	0	9	77
TRMU	55687	broad.mit.edu	37	22	46742405	46742405	+	Missense_Mutation	SNP	G	G	A	rs34012206	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr22:46742405G>A	ENST00000290846.4	+	4	782	c.442G>A	c.(442-444)Gaa>Aaa	p.E148K	TRMU_ENST00000381019.3_Missense_Mutation_p.E148K|TRMU_ENST00000424260.2_Missense_Mutation_p.E113K	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	148			E -> K (in dbSNP:rs34012206).		tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)	p.E148K(1)		NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		TAAGAAGCCCGAAGGGCTTTT	0.443													g|||	84	0.0167732	0.0613	0.0043	5008	,	,		20996	0.0		0.0	False		,,,				2504	0.0					ENST00000290846.4	1.000000	0.840000	1	9.200000e-01	0.990000	0.974810	0.990000	1.000000																										1	Substitution - Missense(1)	p.E148K(1)	NS(1)	10						c.(442-444)Gaa>Aaa		tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase			LYS/GLU	208,4198	129.0+/-165.8	7,194,2002	79.0	83.0	82.0		442	0.6	0.3	22	dbSNP_126	82	4,8596	3.0+/-9.4	0,4,4296	yes	missense	TRMU	NM_018006.4	56	7,198,6298	AA,AG,GG		0.0465,4.7208,1.63	benign	148/422	46742405	212,12794	2203	4300	6503	SO:0001583	missense	55687	561	121412	60				g.chr22:46742405G>A	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.442G>A	chr22.hg19:g.46742405G>A	ENSP00000290846:p.Glu148Lys	0					TRMU_ENST00000424260.2_Missense_Mutation_p.E113K|TRMU_ENST00000381019.3_Missense_Mutation_p.E148K	p.E148K	NM_018006.4	NP_060476.2	0	1	1	2.056367	O75648	MTU1_HUMAN		4	782	+		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	1	0	hg19	c.442G>A	CCDS14075.1	1	35	0.016025641025641024	34	0.06910569105691057	1	0.0027624309392265192	0	0.0	0	0.0	g	11.94	1.787630	0.31593	0.047208	4.65E-4	ENSG00000100416	ENST00000290846;ENST00000381019;ENST00000424260	T;T;T	0.74106	-0.49;-0.81;0.01	5.41	0.554	0.17241	5.41	0.554	0.17241	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.611098	0.17383	N	0.176250	T	0.06962	0.0177	N	0.08118	0	0.09310	N	1	B;B;B	0.10296	0.002;0.003;0.002	B;B;B	0.06405	0.002;0.001;0.001	T	0.10359	-1.0633	10	0.38643	T	0.18	-16.2804	10.4278	0.44389	0.1212:0.5516:0.3271:0.0	rs34012206	148;148;148	B4DHM1;O75648-2;O75648	.;.;MTU1_HUMAN	K	148;148;113	ENSP00000290846:E148K;ENSP00000370407:E148K;ENSP00000406038:E113K	ENSP00000290846:E148K	E	+	1	0	0	TRMU	45121069	45121069	0.055000	0.20627	0.331000	0.25455	0.916000	0.54674	0.716000	0.25836	0.616000	0.30141	0.651000	0.88453	GAA	0.438765		TCGA-2L-AAQJ-01A-12D-A397-08	0.443	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	0	0	1	2	2	2	2	0	0	0	0	87	0	87	86	1	1.870000	-2.046559	0	0.440000	NM_018006		0	93	93	0	319	318	1		1	1		0	0	87	0	0	1.000000	9.710165e-01	0	2	0	20	0	93	319
APOB	338	broad.mit.edu	37	2	21231133	21231133	+	Silent	SNP	A	A	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr2:21231133A>G	ENST00000233242.1	-	26	8734	c.8607T>C	c.(8605-8607)ctT>ctC	p.L2869L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2869					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCATTACTAAGCTCCAGTG	0.393																																						ENST00000233242.1	0.110000	0.020000	9.000000e-02	3.000000e-02	0.050000	0.065084	0.050000	0.060000																										0				305						c.(8605-8607)ctT>ctC		apolipoprotein B							163.0	164.0	163.0					2																	21231133		2203	4300	6503	SO:0001819	synonymous_variant	338	0	0					g.chr2:21231133A>G	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8607T>C	chr2.hg19:g.21231133A>G		0						p.L2869L	NM_000384.2	NP_000375	0	0	0	2.058326	P04114	APOB_HUMAN		26	8734	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	0	1	hg19	c.8607T>C	CCDS1703.1	0																																																																																								0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.393	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1	0	0	1	2	2	2	2	0	0	0	0	112	0	112	112	1	1.870000	-6.972063	1	0.440000			0	9	8	0	686	684	0		1			0	0	112	0	0	0.994141	0	0	0	0	0	0	9	686
ITSN2	50618	broad.mit.edu	37	2	24533237	24533237	+	Missense_Mutation	SNP	C	C	T	rs550046461		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr2:24533237C>T	ENST00000355123.4	-	7	1012	c.569G>A	c.(568-570)gGg>gAg	p.G190E	ITSN2_ENST00000406921.3_Missense_Mutation_p.G190E|ITSN2_ENST00000407704.1_5'Flank|ITSN2_ENST00000361999.3_Missense_Mutation_p.G190E	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	190					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAAGATGACCCATGAGGCAA	0.343													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17730	0.0		0.0	False		,,,				2504	0.0					ENST00000355123.4	0.670000	0.480000	6.300000e-01	5.200000e-01	0.570000	0.580895	0.570000	0.580000																										0				61						c.(568-570)gGg>gAg		intersectin 2							191.0	202.0	198.0					2																	24533237		2203	4300	6503	SO:0001583	missense	50618	1	121412	36				g.chr2:24533237C>T	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.569G>A	chr2.hg19:g.24533237C>T	ENSP00000347244:p.Gly190Glu	0					ITSN2_ENST00000406921.3_Missense_Mutation_p.G190E|ITSN2_ENST00000361999.3_Missense_Mutation_p.G190E|ITSN2_ENST00000407704.1_5'Flank	p.G190E	NM_006277.2	NP_006268.2	0	0	0	2.058326	Q9NZM3	ITSN2_HUMAN		7	1012	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	1	1	hg19	c.569G>A	CCDS1710.2	0	.	.	.	.	.	.	.	.	.	.	C	12.21	1.868542	0.32977	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011;ENST00000443927	T;T;T;T;T;T	0.59906	0.25;0.23;0.25;0.65;0.74;1.57	4.98	4.1	0.47936	4.98	4.1	0.47936	.	0.809232	0.09677	U	0.770329	T	0.49779	0.1577	N	0.14661	0.345	0.24743	N	0.993024	B;B;B;P	0.40050	0.131;0.131;0.314;0.7	B;B;B;P	0.44477	0.028;0.028;0.041;0.451	T	0.48410	-0.9038	10	0.56958	D	0.05	.	13.9001	0.63797	0.0:0.1599:0.8401:0.0	.	190;190;190;190	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	E	190;190;190;189;190;190;176	ENSP00000354561:G190E;ENSP00000347244:G190E;ENSP00000370250:G190E;ENSP00000384499:G190E;ENSP00000391224:G190E;ENSP00000391715:G176E	ENSP00000347244:G190E	G	-	2	0	0	ITSN2	24386741	24386741	1.000000	0.71417	0.889000	0.34880	0.766000	0.43426	3.658000	0.54482	1.218000	0.43458	-0.499000	0.04595	GGG	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.343	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	1	0	1	2	2	2	2	0	0	0	0	166	0	166	165	1	1.870000	-3.142702	1	0.440000	NM_006277		0	123	123	0	844	838	1		1	1		0	0	166	0	0	1.000000	6.229116e-01	0	4	0	12	0	123	844
BCL11A	53335	broad.mit.edu	37	2	60688782	60688782	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr2:60688782C>T	ENST00000335712.6	-	4	1492	c.1265G>A	c.(1264-1266)cGc>cAc	p.R422H	BCL11A_ENST00000358510.4_Missense_Mutation_p.R388H|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.R388H|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.R422H|BCL11A_ENST00000537768.1_Missense_Mutation_p.R91H	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	422					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CTTCATGTGGCGCTTCAGCTT	0.647			T	IGH@	B-CLL																																	ENST00000335712.6	0.160000	0.030000	1.200000e-01	5.000000e-02	0.080000	0.094216	0.080000	0.080000				Dom	yes			Dom	yes		2	2p13	2p13	53335	T	B-cell CLL/lymphoma 11A				L	L	IGH@		B-CLL		0				59						c.(1264-1266)cGc>cAc		B-cell CLL/lymphoma 11A (zinc finger protein)							102.0	93.0	96.0					2																	60688782		2203	4300	6503	SO:0001583	missense	53335	0	0					g.chr2:60688782C>T	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1265G>A	chr2.hg19:g.60688782C>T	ENSP00000338774:p.Arg422His	0					BCL11A_ENST00000538214.1_Missense_Mutation_p.R388H|BCL11A_ENST00000537768.1_Missense_Mutation_p.R91H|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.R388H|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.R422H	p.R422H	NM_022893.3	NP_075044.2	0	0	0	2.046845	Q9H165	BC11A_HUMAN	LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)	4	1492	-			D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	0	1	hg19	c.1265G>A	CCDS1862.1	0	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291279	0.40494	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.16743	3.17;3.17;2.32;5.19;5.19	5.27	4.37	0.52481	5.27	4.37	0.52481	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.062434	0.64402	D	0.000010	T	0.41396	0.1157	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.98;0.997;0.998;0.997	T	0.34153	-0.9840	10	0.56958	D	0.05	-2.2443	15.0016	0.71476	0.1436:0.8564:0.0:0.0	.	388;91;388;422;422	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	H	422;458;388;91;422;388	ENSP00000349300:R422H;ENSP00000438303:R388H;ENSP00000443712:R91H;ENSP00000338774:R422H;ENSP00000351307:R388H	ENSP00000338774:R422H	R	-	2	0	0	BCL11A	60542286	60542286	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	1.173000	0.42796	0.655000	0.94253	CGC	0.437525		TCGA-2L-AAQJ-01A-12D-A397-08	0.647	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	0	0	1	2	2	2	2	0	0	0	0	85	0	85	84	1	1.870000	-2.615840	1	0.440000	NM_022893		0	8	8	0	421	416	0		1	0		0	0	85	0	0	0.988998	0	0	0	0	1	0	8	421
GLB1L	79411	broad.mit.edu	37	2	220101856	220101856	+	Missense_Mutation	SNP	T	T	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr2:220101856T>C	ENST00000295759.7	-	17	2216	c.1903A>G	c.(1903-1905)Atc>Gtc	p.I635V	GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000392089.2_Missense_Mutation_p.I635V|GLB1L_ENST00000409640.1_Missense_Mutation_p.I545V|GLB1L_ENST00000356283.3_Missense_Mutation_p.I545V			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	635					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGAATTGATATGTGTCCTG	0.468																																						ENST00000295759.7	1.000000	0.730000	9.700000e-01	8.000000e-01	0.880000	0.888803	0.880000	1.000000																										0				22						c.(1903-1905)Atc>Gtc		galactosidase, beta 1-like							163.0	148.0	153.0					2																	220101856		2203	4300	6503	SO:0001583	missense	79411	0	0					g.chr2:220101856T>C		CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1903A>G	chr2.hg19:g.220101856T>C	ENSP00000295759:p.Ile635Val	0					GLB1L_ENST00000356283.3_Missense_Mutation_p.I545V|GLB1L_ENST00000409640.1_Missense_Mutation_p.I545V|GLB1L_ENST00000392089.2_Missense_Mutation_p.I635V|GLB1L_ENST00000497855.1_5'UTR	p.I635V			0	0	0	2.022512	Q6UWU2	GLB1L_HUMAN		17	2216	-		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)	Q96DR0	Missense_Mutation	SNP	ENST00000295759.7	1	1	hg19	c.1903A>G	CCDS2437.1	1	.	.	.	.	.	.	.	.	.	.	T	4.871	0.161916	0.09287	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	D;D;D;D	0.96992	-4.2;-3.93;-4.2;-3.93	4.93	-9.86	0.00473	4.93	-9.86	0.00473	Galactose-binding domain-like (1);	3.089320	0.00575	N	0.000313	D	0.86112	0.5855	N	0.04959	-0.14	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.81204	-0.1039	10	0.21540	T	0.41	0.3857	2.6931	0.05126	0.1812:0.3995:0.1959:0.2234	.	545;635	Q6UWU2-2;Q6UWU2	.;GLB1L_HUMAN	V	635;545;635;545	ENSP00000295759:I635V;ENSP00000386354:I545V;ENSP00000375939:I635V;ENSP00000348628:I545V	ENSP00000295759:I635V	I	-	1	0	0	GLB1L	219810100	219810100	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.053000	0.03500	-2.213000	0.00735	-0.256000	0.11100	ATC	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.468	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	1	0	1	2	2	2	2	0	0	0	0	107	0	107	106	1	1.870000	-20.000000	1	0.440000	NM_024506		0	99	98	0	398	394	1		1	1		0	0	107	0	0	1.000000	9.999935e-01	0	20	0	51	0	99	398
OXTR	5021	broad.mit.edu	37	3	8794835	8794835	+	Missense_Mutation	SNP	G	G	A	rs200966415		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr3:8794835G>A	ENST00000316793.3	-	4	1622	c.998C>T	c.(997-999)aCg>aTg	p.T333M	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	333					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	GAGGTGGCCCGTGAACAGCAT	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19866	0.0		0.0	False		,,,				2504	0.0					ENST00000316793.3	1.000000	0.770000	9.800000e-01	8.500000e-01	0.920000	0.921743	0.920000	0.990000																										0				13						c.(997-999)aCg>aTg		oxytocin receptor	Carbetocin(DB01282)|Oxytocin(DB00107)	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	71.0	63.0	66.0		998	4.2	0.8	3		66	1,8599	1.2+/-3.3	0,1,4299	no	missense	OXTR	NM_000916.3	81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	333/390	8794835	2,13004	2203	4300	6503	SO:0001583	missense	5021	4	121412	35				g.chr3:8794835G>A		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.998C>T	chr3.hg19:g.8794835G>A	ENSP00000324270:p.Thr333Met	1					CAV3_ENST00000472766.1_Intron	p.T333M	NM_000916.3	NP_000907.2	0	1	1	1.610984	P30559	OXYR_HUMAN		4	1622	-			Q15071	Missense_Mutation	SNP	ENST00000316793.3	1	1	hg19	c.998C>T	CCDS2570.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	23.0	4.366953	0.82463	2.27E-4	1.16E-4	ENSG00000180914	ENST00000316793	T	0.38560	1.13	5.13	4.23	0.50019	5.13	4.23	0.50019	.	0.052718	0.85682	D	0.000000	T	0.55449	0.1921	M	0.63428	1.95	0.41902	D	0.990422	D	0.71674	0.998	P	0.57204	0.815	T	0.62158	-0.6913	10	0.87932	D	0	-32.9382	14.1848	0.65598	0.0:0.1509:0.8491:0.0	.	333	P30559	OXYR_HUMAN	M	333	ENSP00000324270:T333M	ENSP00000324270:T333M	T	-	2	0	0	OXTR	8769835	8769835	1.000000	0.71417	0.845000	0.33349	0.985000	0.73830	5.333000	0.65917	1.330000	0.45394	0.655000	0.94253	ACG	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.617	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2	0	0	1	2	15	2	2	1	0	1	1	47	0	47	46	1	1.870000	-6.283823	1	0.440000			0	61	61	0	152	150	0		1	1		1	0	47	0	0	1.000000	3.283906e-01	0	2	0	2	0	61	152
TGFBR2	7048	broad.mit.edu	37	3	30713171	30713171	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr3:30713171C>T	ENST00000295754.5	+	4	878	c.496C>T	c.(496-498)Caa>Taa	p.Q166*	TGFBR2_ENST00000359013.4_Nonsense_Mutation_p.Q191*	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	166					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						AGTCATATTTCAAGTGACAGG	0.473																																						ENST00000295754.5	0.990000	0.670000	9.500000e-01	7.600000e-01	0.860000	0.861450	0.860000	0.880000																										0				53						c.(496-498)Caa>Taa		transforming growth factor, beta receptor II (70/80kDa)							112.0	98.0	103.0					3																	30713171		2203	4300	6503	SO:0001587	stop_gained	7048	0	0					g.chr3:30713171C>T		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.496C>T	chr3.hg19:g.30713171C>T	ENSP00000295754:p.Gln166*	1					TGFBR2_ENST00000359013.4_Nonsense_Mutation_p.Q191*	p.Q166*	NM_003242.5	NP_003233.4	0	1	1	1.610984	P37173	TGFR2_HUMAN		4	878	+			B4DTV5|Q15580|Q6DKT6|Q99474	Nonsense_Mutation	SNP	ENST00000295754.5	0	1	hg19	c.496C>T	CCDS2648.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.940423	0.97952	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000383765;ENST00000439925	.	.	.	4.86	3.91	0.45181	4.86	3.91	0.45181	.	0.557577	0.20898	N	0.083695	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	12.5905	0.56439	0.231:0.769:0.0:0.0	.	.	.	.	X	166;191;68;32	.	ENSP00000295754:Q166X	Q	+	1	0	0	TGFBR2	30688175	30688175	1.000000	0.71417	0.989000	0.46669	0.920000	0.55202	2.769000	0.47654	2.508000	0.84585	0.655000	0.94253	CAA	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.473	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2	1	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	1.870000	-4.720671	1	0.440000			0	50	49	0	148	148	1		1	1	1	0	0	49	191	0	1.000000	9.999827e-01	1	6	76	47	223	50	148
LRRC2	79442	broad.mit.edu	37	3	46563080	46563080	+	Missense_Mutation	SNP	C	C	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr3:46563080C>G	ENST00000395905.3	-	8	1390	c.998G>C	c.(997-999)aGt>aCt	p.S333T	LRRC2_ENST00000296144.3_Missense_Mutation_p.S333T	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	333										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		ATCCCGTTCACTTTCCATTAT	0.328																																						ENST00000395905.3	0.200000	0.030000	1.500000e-01	5.000000e-02	0.090000	0.107110	0.090000	0.090000																										0				17						c.(997-999)aGt>aCt		leucine rich repeat containing 2							114.0	112.0	113.0					3																	46563080		2203	4300	6503	SO:0001583	missense	79442	0	0					g.chr3:46563080C>G	AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.998G>C	chr3.hg19:g.46563080C>G	ENSP00000379241:p.Ser333Thr	1					LRRC2_ENST00000296144.3_Missense_Mutation_p.S333T	p.S333T	NM_024512.4	NP_078788.2	0	1	1	1.610984	Q9BYS8	LRRC2_HUMAN		8	1390	-		Ovarian(412;0.0563)	B2RDQ7|Q96LT5	Missense_Mutation	SNP	ENST00000395905.3	0	1	hg19	c.998G>C	CCDS2741.1	0	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554666	0.27739	.	.	ENSG00000163827	ENST00000395905;ENST00000296144	T;T	0.17854	2.25;2.25	4.56	3.67	0.42095	4.56	3.67	0.42095	.	0.161627	0.41097	N	0.000942	T	0.13457	0.0326	L	0.40543	1.245	0.32701	N	0.512847	B	0.06786	0.001	B	0.08055	0.003	T	0.13845	-1.0494	10	0.14656	T	0.56	.	12.2733	0.54719	0.0:0.8089:0.1911:0.0	.	333	Q9BYS8	LRRC2_HUMAN	T	333	ENSP00000379241:S333T;ENSP00000296144:S333T	ENSP00000296144:S333T	S	-	2	0	0	LRRC2	46538084	46538084	0.998000	0.40836	0.863000	0.33907	0.897000	0.52465	0.599000	0.24089	1.245000	0.43885	0.591000	0.81541	AGT	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.328	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257375.2	0	0	1	2	2	2	2	0	0	0	0	45	0	45	45	1	1.870000	-7.000087	1	0.440000			0	5	5	0	189	188	0		1	0		0	0	45	0	0	0.937509	0	0	0	0	1	0	5	189
DOCK3	1795	broad.mit.edu	37	3	51378785	51378785	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr3:51378785G>A	ENST00000266037.9	+	38	3907	c.3884G>A	c.(3883-3885)cGg>cAg	p.R1295Q		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1295	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GGACTGTGCCGGAAGATCATT	0.532																																						ENST00000266037.9	0.310000	0.050000	2.300000e-01	9.000000e-02	0.150000	0.167997	0.150000	0.140000																										0				45						c.(3883-3885)cGg>cAg		dedicator of cytokinesis 3							60.0	64.0	63.0					3																	51378785		2086	4222	6308	SO:0001583	missense	1795	3	121008	31				g.chr3:51378785G>A	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3884G>A	chr3.hg19:g.51378785G>A	ENSP00000266037:p.Arg1295Gln	1						p.R1295Q	NM_004947.4	NP_004938.1	0	1	1	1.610984	Q8IZD9	DOCK3_HUMAN		38	3907	+			O15017	Missense_Mutation	SNP	ENST00000266037.9	0	1	hg19	c.3884G>A	CCDS46835.1	0	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977405	0.53720	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.04603	3.59	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.08891	0.0220	N	0.20766	0.605	0.58432	D	0.999999	D	0.67145	0.996	P	0.55087	0.768	T	0.47032	-0.9148	10	0.28530	T	0.3	.	19.4028	0.94637	0.0:0.0:1.0:0.0	.	1295	Q8IZD9	DOCK3_HUMAN	Q	1295;91	ENSP00000266037:R1295Q	ENSP00000266037:R1295Q	R	+	2	0	0	DOCK3	51353825	51353825	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.863000	0.87023	2.574000	0.86865	0.655000	0.94253	CGG	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.532	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	0	0	1	2	2	2	10	0	0	0	0	23	0	23	22	1	1.870000	-3.045236	1	0.440000	NM_004947		0	5	5	0	117	116	0		1		0	0	2	23	543	0	0.937523	0	9.898736e-01	0	4	0	773	5	117
CACNA1D	776	broad.mit.edu	37	3	53752385	53752385	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr3:53752385G>T	ENST00000350061.5	+	10	1959	c.1448G>T	c.(1447-1449)gGc>gTc	p.G483V	CACNA1D_ENST00000422281.2_Missense_Mutation_p.G483V|CACNA1D_ENST00000288139.4_Missense_Mutation_p.G483V	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	483					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGCGGTGAAGGCGAGAACCGA	0.592																																						ENST00000350061.5	0.980000	0.690000	9.300000e-01	7.600000e-01	0.840000	0.851812	0.840000	0.860000																										0				90						c.(1447-1449)gGc>gTc		calcium channel, voltage-dependent, L type, alpha 1D subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						136.0	115.0	122.0					3																	53752385		2203	4300	6503	SO:0001583	missense	776	0	0					g.chr3:53752385G>T	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1448G>T	chr3.hg19:g.53752385G>T	ENSP00000288133:p.Gly483Val	1					CACNA1D_ENST00000288139.4_Missense_Mutation_p.G483V|CACNA1D_ENST00000422281.2_Missense_Mutation_p.G483V	p.G483V	NM_001128840.1	NP_001122312.1	0	1	1	1.610984	Q01668	CAC1D_HUMAN		10	1959	+			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	1	1	hg19	c.1448G>T	CCDS46848.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.02|10.02	1.235118|1.235118	0.22626|0.22626	.|.	.|.	ENSG00000157388|ENSG00000157388	ENST00000481085|ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	.|D;D;D;D	.|0.93712	.|-3.27;-3.27;-3.27;-3.27	5.44|5.44	4.57|4.57	0.56435|0.56435	5.44|5.44	4.57|4.57	0.56435|0.56435	.|.	.|153.860000	.|0.00166	.|N	.|0.000000	D|D	0.89853|0.89853	0.6835|0.6835	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.25486	.|0.01;0.001;0.002;0.127	.|B;B;B;B	.|0.28305	.|0.01;0.002;0.008;0.088	T|T	0.69544|0.69544	-0.5117|-0.5117	5|10	.|0.39692	.|T	.|0.17	.|.	10.5212|10.5212	0.44920|0.44920	0.0:0.1448:0.7048:0.1504|0.0:0.1448:0.7048:0.1504	.|.	.|483;156;483;483	.|B0FYA3;Q59GD8;Q01668;Q01668-2	.|.;.;CAC1D_HUMAN;.	S|V	197|483;483;483;156	.|ENSP00000288133:G483V;ENSP00000288139:G483V;ENSP00000409174:G483V;ENSP00000418014:G156V	.|ENSP00000288139:G483V	A|G	+|+	1|2	0|0	0|0	CACNA1D|CACNA1D	53727425|53727425	53727425|53727425	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.433000|0.433000	0.31745|0.31745	3.391000|3.391000	0.52530|0.52530	1.292000|1.292000	0.44672|0.44672	-0.150000|-0.150000	0.13652|0.13652	GCG|GGC	0.282051		TCGA-2L-AAQJ-01A-12D-A397-08	0.592	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	1	0	1	2	2	2	2	0	0	0	0	96	0	96	93	1	1.870000	-20.000000	1	0.440000	NM_000720		0	76	75	0	236	233	1		1	0		0	0	96	0	0	1.000000	0	0	1	0	0	0	76	236
ADCY5	111	broad.mit.edu	37	3	123021980	123021980	+	Silent	SNP	C	C	T	rs148384901		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr3:123021980C>T	ENST00000462833.1	-	14	3858	c.2646G>A	c.(2644-2646)gcG>gcA	p.A882A	ADCY5_ENST00000309879.5_Silent_p.A532A|ADCY5_ENST00000491190.1_Silent_p.A515A	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	882					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGGCCGACTCCGCCACGTGAC	0.652																																						ENST00000462833.1	1.000000	0.690000	1	8.000000e-01	0.920000	0.907529	0.920000	1.000000																										0				60						c.(2644-2646)gcG>gcA		adenylate cyclase 5		C	,	1,4405	2.1+/-5.4	0,1,2202	59.0	53.0	55.0		1596,2646	1.1	1.0	3	dbSNP_134	55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ADCY5	NM_001199642.1,NM_183357.2	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	532/912,882/1262	123021980	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	111	3	121410	37				g.chr3:123021980C>T	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2646G>A	chr3.hg19:g.123021980C>T		0					ADCY5_ENST00000309879.5_Silent_p.A532A|ADCY5_ENST00000491190.1_Silent_p.A515A	p.A882A	NM_183357.2	NP_899200.1	1	2	3	2.071607	O95622	ADCY5_HUMAN		14	3858	-			B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	1	1	hg19	c.2646G>A	CCDS3022.1	1																																																																																								0.441229		TCGA-2L-AAQJ-01A-12D-A397-08	0.652	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	1	0	1	2	2	2	2	0	0	0	0	44	0	44	42	1	1.870000	-3.683136	1	0.440000	XM_171048		0	43	43	0	169	166	1		1	0		0	0	44	0	0	1.000000	4.371882e-01	0	0	0	7	0	43	169
LDB2	9079	broad.mit.edu	37	4	16504411	16504411	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr4:16504411G>A	ENST00000304523.5	-	8	1300	c.977C>T	c.(976-978)aCg>aTg	p.T326M	RP11-446J8.1_ENST00000512370.1_RNA|LDB2_ENST00000502640.1_3'UTR|LDB2_ENST00000441778.2_3'UTR|LDB2_ENST00000515064.1_Missense_Mutation_p.T324M	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	326	LIM-binding domain (LID). {ECO:0000250}.				epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						ATCATATTGCGTGTTTTCTAA	0.537																																						ENST00000304523.5	1.000000	0.750000	9.700000e-01	8.200000e-01	0.880000	0.894130	0.880000	1.000000																										0				33						c.(976-978)aCg>aTg		LIM domain binding 2							238.0	209.0	219.0					4																	16504411		2203	4300	6503	SO:0001583	missense	9079	1	121412	35				g.chr4:16504411G>A	AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.977C>T	chr4.hg19:g.16504411G>A	ENSP00000306772:p.Thr326Met	0					LDB2_ENST00000441778.2_3'UTR|LDB2_ENST00000515064.1_Missense_Mutation_p.T324M|LDB2_ENST00000502640.1_3'UTR|RP11-446J8.1_ENST00000512370.1_RNA	p.T326M	NM_001290.3	NP_001281.1	0	1	1	2.055782	O43679	LDB2_HUMAN		8	1300	-			O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	1	1	hg19	c.977C>T	CCDS3420.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.11|16.11	3.030178|3.030178	0.54790|0.54790	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000507464|ENST00000515064;ENST00000304523	.|T;T	.|0.26810	.|1.71;1.71	5.48|5.48	5.48|5.48	0.80851|0.80851	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.50531|0.50531	0.1621|0.1621	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.998;1.0;1.0	.|D;P;P;D	.|0.75020	.|0.985;0.899;0.891;0.949	T|T	0.43491|0.43491	-0.9388|-0.9388	5|10	.|0.45353	.|T	.|0.12	-13.6093|-13.6093	18.3199|18.3199	0.90234|0.90234	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|290;324;326;300	.|B7Z6D0;G5E9Y7;O43679;O43679-3	.|.;.;LDB2_HUMAN;.	C|M	247|324;326	.|ENSP00000422552:T324M;ENSP00000306772:T326M	.|ENSP00000306772:T326M	R|T	-|-	1|2	0|0	0|0	LDB2|LDB2	16113509|16113509	16113509|16113509	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.558000|2.558000	0.86282|0.86282	0.655000|0.655000	0.94253|0.94253	CGC|ACG	0.438765		TCGA-2L-AAQJ-01A-12D-A397-08	0.537	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2	1	0	1	2	17	3	2	1	0	1	1	131	0	131	130	1	1.870000	-20.000000	1	0.440000			0	126	125	0	513	504	1		1	0		1	0	131	0	0	1.000000	9.571750e-01	0	0	0	31	0	126	513
COX7B2	170712	broad.mit.edu	37	4	46737152	46737152	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr4:46737152G>C	ENST00000396533.1	-	4	308	c.58C>G	c.(58-60)Caa>Gaa	p.Q20E	COX7B2_ENST00000302930.5_Missense_Mutation_p.Q20E|COX7B2_ENST00000543208.1_Missense_Mutation_p.Q19E|COX7B2_ENST00000355591.3_Missense_Mutation_p.Q20E			Q8TF08	CX7B2_HUMAN	cytochrome c oxidase subunit VIIb2	20						integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			large_intestine(1)|lung(4)	5						GCCATGCTTTGCAGAATGCTT	0.423																																						ENST00000396533.1	0.130000	0.010000	9.000000e-02	3.000000e-02	0.050000	0.067131	0.050000	0.060000																										0				5						c.(58-60)Caa>Gaa		cytochrome c oxidase subunit VIIb2							158.0	137.0	144.0					4																	46737152		2203	4300	6503	SO:0001583	missense	170712	0	0					g.chr4:46737152G>C	AF125109	CCDS3472.2	4p12	2011-07-04			ENSG00000170516	ENSG00000170516		"""Mitochondrial respiratory chain complex / Complex IV"""	24381	protein-coding gene	gene with protein product		609811				15623157	Standard	NM_130902		Approved		uc003gxf.3	Q8TF08	OTTHUMG00000099423	ENST00000396533.1:c.58C>G	chr4.hg19:g.46737152G>C	ENSP00000379784:p.Gln20Glu	0					COX7B2_ENST00000355591.3_Missense_Mutation_p.Q20E|COX7B2_ENST00000543208.1_Missense_Mutation_p.Q19E|COX7B2_ENST00000302930.5_Missense_Mutation_p.Q20E	p.Q20E			0	1	1	2.055782	Q8TF08	CX7B2_HUMAN		4	308	-			Q32Q40	Missense_Mutation	SNP	ENST00000396533.1	0	1	hg19	c.58C>G	CCDS3472.2	0	.	.	.	.	.	.	.	.	.	.	G	5.784	0.329026	0.10956	.	.	ENSG00000170516	ENST00000355591;ENST00000396533;ENST00000302930;ENST00000543208;ENST00000505102	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	4.22	1.33	0.21861	4.22	1.33	0.21861	.	0.393840	0.25771	N	0.028415	T	0.29256	0.0728	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.14023	0.01	T	0.24368	-1.0162	9	0.72032	D	0.01	-8.2035	6.926	0.24416	0.0:0.3509:0.4531:0.1959	.	20	Q8TF08	CX7B2_HUMAN	E	20;20;20;19;20	ENSP00000347799:Q20E;ENSP00000379784:Q20E;ENSP00000305964:Q20E;ENSP00000437439:Q19E;ENSP00000423519:Q20E	ENSP00000305964:Q20E	Q	-	1	0	0	COX7B2	46431909	46431909	0.003000	0.15002	0.019000	0.16419	0.193000	0.23685	1.002000	0.29796	0.255000	0.21593	0.585000	0.79938	CAA	0.438765		TCGA-2L-AAQJ-01A-12D-A397-08	0.423	COX7B2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313899.1	0	0	1	2	2	2	2	0	0	0	0	71	0	71	71	1	1.870000	-3.317288	1	0.440000	NM_130902		0	5	5	0	397	393	0		1			0	0	71	0	0	0.936259	0	0	0	0	0	0	5	397
CEP135	9662	broad.mit.edu	37	4	56877620	56877620	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr4:56877620G>T	ENST00000257287.4	+	20	2672	c.2548G>T	c.(2548-2550)Gaa>Taa	p.E850*		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	850					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AGAAAAAGAAGAAATGAAGAG	0.333																																						ENST00000257287.4	1.000000	0.580000	9.200000e-01	6.800000e-01	0.790000	0.803493	0.790000	1.000000																										0				50						c.(2548-2550)Gaa>Taa		centrosomal protein 135kDa							91.0	93.0	93.0					4																	56877620		2203	4300	6503	SO:0001587	stop_gained	9662	0	0					g.chr4:56877620G>T	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2548G>T	chr4.hg19:g.56877620G>T	ENSP00000257287:p.Glu850*	0						p.E850*	NM_025009.4	NP_079285.2	0	1	1	2.055782	Q66GS9	CP135_HUMAN		20	2672	+	Glioma(25;0.08)|all_neural(26;0.101)		B2RMY0|O75130|Q58F25|Q9H8H7	Nonsense_Mutation	SNP	ENST00000257287.4	0	1	hg19	c.2548G>T	CCDS33986.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.869519	0.98984	.	.	ENSG00000174799	ENST00000257287	.	.	.	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.046328	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	18.5341	0.91002	0.0:0.0:1.0:0.0	.	.	.	.	X	850	.	ENSP00000257287:E850X	E	+	1	0	0	CEP135	56572377	56572377	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.811000	0.86092	2.373000	0.80994	0.591000	0.81541	GAA	0.438765		TCGA-2L-AAQJ-01A-12D-A397-08	0.333	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	1	0	1	2	2	2	2	0	0	0	0	37	0	37	37	1	1.870000	-20.000000	1	0.440000	NM_025009		0	38	38	0	178	175	1		1	0		0	0	37	0	0	1.000000	4.945258e-01	0	1	0	8	0	38	178
NAA11	84779	broad.mit.edu	37	4	80246531	80246531	+	Silent	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr4:80246531G>A	ENST00000286794.4	-	1	673	c.501C>T	c.(499-501)ggC>ggT	p.G167G	NAA11_ENST00000513733.1_5'UTR	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	167					N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						CCACATACCCGCCCTTCTTCA	0.532																																						ENST00000286794.4	1.000000	0.840000	1	9.700000e-01	0.990000	0.985715	0.990000	1.000000																										0				23						c.(499-501)ggC>ggT		N(alpha)-acetyltransferase 11, NatA catalytic subunit							56.0	57.0	57.0					4																	80246531		1986	4167	6153	SO:0001819	synonymous_variant	84779	0	0					g.chr4:80246531G>A		CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.501C>T	chr4.hg19:g.80246531G>A		0					NAA11_ENST00000513733.1_5'UTR	p.G167G	NM_032693.2	NP_116082.1	0	1	1	2.055782	Q9BSU3	NAA11_HUMAN		1	673	-			Q66K19|Q6P479	Silent	SNP	ENST00000286794.4	1	1	hg19	c.501C>T	CCDS47084.1	1																																																																																								0.438765		TCGA-2L-AAQJ-01A-12D-A397-08	0.532	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1	1	0	1	2	2	2	2	0	0	0	0	31	0	31	31	1	1.870000	-4.581958	1	0.440000			0	42	41	0	127	126	1		1			0	0	31	0	0	1.000000	0	0	0	0	0	0	42	127
PDHA2	5161	broad.mit.edu	37	4	96762066	96762066	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr4:96762066G>T	ENST00000295266.4	+	1	828	c.765G>T	c.(763-765)atG>atT	p.M255I		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	255					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TCGATGGAATGGATGTTCTGT	0.463																																						ENST00000295266.4	1.000000	0.750000	1	8.600000e-01	0.980000	0.949661	0.980000	1.000000																										0				46						c.(763-765)atG>atT		pyruvate dehydrogenase (lipoamide) alpha 2							149.0	149.0	149.0					4																	96762066		2203	4300	6503	SO:0001583	missense	5161	0	0					g.chr4:96762066G>T		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.765G>T	chr4.hg19:g.96762066G>T	ENSP00000295266:p.Met255Ile	0						p.M255I	NM_005390.4	NP_005381.1	0	1	1	2.055782	P29803	ODPAT_HUMAN		1	828	+		Hepatocellular(203;0.114)	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	1	1	hg19	c.765G>T	CCDS3644.1	1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365331	0.61513	.	.	ENSG00000163114	ENST00000295266	D	0.97209	-4.29	4.91	4.91	0.64330	4.91	4.91	0.64330	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98848	0.9611	H	0.94264	3.515	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.99282	1.0896	10	0.87932	D	0	-26.8691	16.0034	0.80327	0.0:0.0:1.0:0.0	.	255	P29803	ODPAT_HUMAN	I	255	ENSP00000295266:M255I	ENSP00000295266:M255I	M	+	3	0	0	PDHA2	96981089	96981089	1.000000	0.71417	0.992000	0.48379	0.523000	0.34469	4.138000	0.58017	2.733000	0.93635	0.467000	0.42956	ATG	0.438765		TCGA-2L-AAQJ-01A-12D-A397-08	0.463	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1	1	0	1	2	2	2	2	0	0	0	0	38	0	38	38	1	1.870000	-20.000000	1	0.440000			0	48	48	0	171	171	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	48	171
TCERG1	10915	broad.mit.edu	37	5	145886749	145886749	+	Silent	SNP	A	A	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr5:145886749A>G	ENST00000296702.5	+	19	2927	c.2889A>G	c.(2887-2889)caA>caG	p.Q963Q	TCERG1_ENST00000394421.2_Silent_p.Q942Q	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	963	FF 5.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTTTAGGCAACTTCTGGATG	0.338																																						ENST00000296702.5	1.000000	0.780000	1	8.700000e-01	0.970000	0.948660	0.970000	1.000000																										0				46						c.(2887-2889)caA>caG		transcription elongation regulator 1							78.0	83.0	81.0					5																	145886749		2203	4300	6503	SO:0001819	synonymous_variant	10915	0	0					g.chr5:145886749A>G	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2889A>G	chr5.hg19:g.145886749A>G		0					TCERG1_ENST00000394421.2_Silent_p.Q942Q	p.Q963Q	NM_006706.3	NP_006697.2	1	2	3	2.075514	O14776	TCRG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	19	2927	+		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	1	1	hg19	c.2889A>G	CCDS4282.1	1																																																																																								0.442453		TCGA-2L-AAQJ-01A-12D-A397-08	0.338	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	1	0	1	2	2	2	2	0	0	0	0	72	0	72	72	1	1.870000	-20.000000	1	0.440000	NM_001040006		0	72	71	0	265	264	1		1	1		0	0	72	0	0	1.000000	1	0	31	0	63	0	72	265
STK32A	202374	broad.mit.edu	37	5	146750320	146750320	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr5:146750320C>A	ENST00000397936.3	+	9	1097	c.764C>A	c.(763-765)tCa>tAa	p.S255*	STK32A_ENST00000398523.3_Nonsense_Mutation_p.S255*	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	255	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAATGGTGTCACTTCTTAAA	0.418																																						ENST00000397936.3	1.000000	0.670000	9.400000e-01	7.500000e-01	0.840000	0.847287	0.840000	1.000000																										0				13						c.(763-765)tCa>tAa		serine/threonine kinase 32A							152.0	131.0	138.0					5																	146750320		1568	3582	5150	SO:0001587	stop_gained	202374	0	0					g.chr5:146750320C>A		CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.764C>A	chr5.hg19:g.146750320C>A	ENSP00000381030:p.Ser255*	0					STK32A_ENST00000398523.3_Nonsense_Mutation_p.S255*	p.S255*	NM_001112724.1	NP_001106195.1	1	2	3	2.075514	Q8WU08	ST32A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	9	1097	+			B3KSY0	Nonsense_Mutation	SNP	ENST00000397936.3	0	1	hg19	c.764C>A	CCDS47299.1	0	.	.	.	.	.	.	.	.	.	.	C	38	6.721010	0.97788	.	.	ENSG00000169302	ENST00000397936;ENST00000398523	.	.	.	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.191964	0.25885	N	0.027664	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.563	0.91107	0.0:1.0:0.0:0.0	.	.	.	.	X	255	.	ENSP00000381030:S255X	S	+	2	0	0	STK32A	146730513	146730513	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	4.191000	0.58372	2.761000	0.94854	0.655000	0.94253	TCA	0.442453		TCGA-2L-AAQJ-01A-12D-A397-08	0.418	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373306.1	1	0	1	2	2	2	2	0	0	0	0	68	0	68	68	1	1.870000	-20.000000	1	0.440000	NM_145001		0	70	70	0	309	304	0		1	0		0	0	68	0	0	1.000000	0	0	0	0	1	0	70	309
GM2A	2760	broad.mit.edu	37	5	150639359	150639359	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr5:150639359G>C	ENST00000357164.3	+	2	450	c.125G>C	c.(124-126)gGg>gCg	p.G42A		NM_000405.4|NM_001167607.1	NP_000396.2|NP_001161079.1	P17900	SAP3_HUMAN	GM2 ganglioside activator	42					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|learning or memory (GO:0007611)|lipid storage (GO:0019915)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	apical cortex (GO:0045179)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|mitochondrion (GO:0005739)	beta-N-acetylhexosaminidase activity (GO:0004563)|lipid transporter activity (GO:0005319)|phospholipase activator activity (GO:0016004)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|upper_aerodigestive_tract(2)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTGATGAAGGGAAGGACCCT	0.527																																						ENST00000357164.3	0.270000	0.030000	1.800000e-01	6.000000e-02	0.110000	0.133120	0.110000	0.100000																										0				8						c.(124-126)gGg>gCg		GM2 ganglioside activator							70.0	62.0	65.0					5																	150639359		2203	4300	6503	SO:0001583	missense	2760	0	0					g.chr5:150639359G>C		CCDS4313.1	5q33.1	2010-03-17	2004-05-20		ENSG00000196743	ENSG00000196743			4367	protein-coding gene	gene with protein product	"""cerebroside sulfate activator protein"", ""sphingolipid activator protein 3"""	613109	"""GM2 ganglioside activator protein"""			115863, 1915857	Standard	NM_000405		Approved	SAP-3	uc003ltr.4	P17900	OTTHUMG00000130124	ENST00000357164.3:c.125G>C	chr5.hg19:g.150639359G>C	ENSP00000349687:p.Gly42Ala	0						p.G42A	NM_000405.4|NM_001167607.1	NP_000396.2|NP_001161079.1	1	2	3	2.075514	P17900	SAP3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	2	450	+		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	B2R699|D3DQH6|Q14426|Q14428|Q6LBL5	Missense_Mutation	SNP	ENST00000357164.3	0	1	hg19	c.125G>C	CCDS4313.1	0	.	.	.	.	.	.	.	.	.	.	G	2.987	-0.209025	0.06140	.	.	ENSG00000196743	ENST00000523466;ENST00000357164	T;T	0.71579	-0.58;-0.58	4.96	2.14	0.27477	4.96	2.14	0.27477	MD-2-related lipid-recognition (1);	0.306608	0.35772	N	0.002992	T	0.57417	0.2052	L	0.47716	1.5	0.09310	N	1	P;P	0.46142	0.797;0.873	B;B	0.39027	0.117;0.288	T	0.48570	-0.9024	10	0.29301	T	0.29	-7.8707	8.4518	0.32875	0.0857:0.4541:0.4602:0.0	.	42;42	B4DQM5;P17900	.;SAP3_HUMAN	A	57;42	ENSP00000429100:G57A;ENSP00000349687:G42A	ENSP00000349687:G42A	G	+	2	0	0	GM2A	150619552	150619552	0.006000	0.16342	0.021000	0.16686	0.165000	0.22458	0.193000	0.17116	0.140000	0.18849	-0.136000	0.14681	GGG	0.442453		TCGA-2L-AAQJ-01A-12D-A397-08	0.527	GM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252432.1	0	0	1	2	2	2	2	0	0	0	0	28	0	28	28	1	1.870000	-3.315606	1	0.440000	NM_000405		0	4	4	0	176	174	0		1	0		0	0	28	0	0	0.888650	4.868203e-01	0	1	0	62	0	4	176
FAM71B	153745	broad.mit.edu	37	5	156590194	156590194	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr5:156590194G>A	ENST00000302938.4	-	2	1177	c.1082C>T	c.(1081-1083)gCg>gTg	p.A361V		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	361						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGCGGCCCCCGCCATCGAGGT	0.567																																						ENST00000302938.4	1.000000	0.680000	1	7.800000e-01	0.890000	0.889361	0.890000	1.000000																										0				68						c.(1081-1083)gCg>gTg		family with sequence similarity 71, member B							33.0	36.0	35.0					5																	156590194		2203	4300	6503	SO:0001583	missense	153745	4	121412	34				g.chr5:156590194G>A		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1082C>T	chr5.hg19:g.156590194G>A	ENSP00000305596:p.Ala361Val	0						p.A361V	NM_130899.2	NP_570969.2	1	2	3	2.075514	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	2	1177	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	1	1	hg19	c.1082C>T	CCDS4335.1	1	.	.	.	.	.	.	.	.	.	.	G	8.201	0.798141	0.16397	.	.	ENSG00000170613	ENST00000302938	T	0.04156	3.69	3.83	-0.0601	0.13790	3.83	-0.0601	0.13790	.	2.284610	0.01796	N	0.032639	T	0.01695	0.0054	N	0.08118	0	0.09310	N	1	P	0.35628	0.513	B	0.14023	0.01	T	0.32929	-0.9888	10	0.02654	T	1	0.1287	1.1705	0.01824	0.2063:0.1729:0.4431:0.1777	.	361	Q8TC56	FA71B_HUMAN	V	361	ENSP00000305596:A361V	ENSP00000305596:A361V	A	-	2	0	0	FAM71B	156522772	156522772	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.879000	0.04188	-0.036000	0.13669	-0.224000	0.12420	GCG	0.442453		TCGA-2L-AAQJ-01A-12D-A397-08	0.567	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	1	0	1	2	2	2	2	0	0	0	0	59	0	59	57	1	1.870000	-2.671760	1	0.440000	NM_130899		0	49	49	0	201	198	1		1			0	0	59	0	0	1.000000	0	0	0	0	0	0	49	201
TPD52L1	7164	broad.mit.edu	37	6	125541274	125541274	+	Missense_Mutation	SNP	A	A	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr6:125541274A>T	ENST00000534000.1	+	2	366	c.70A>T	c.(70-72)Agt>Tgt	p.S24C	TPD52L1_ENST00000368402.5_Missense_Mutation_p.S24C|TPD52L1_ENST00000368388.2_Missense_Mutation_p.S24C|TPD52L1_ENST00000304877.13_Missense_Mutation_p.S24C|TPD52L1_ENST00000524679.1_5'UTR|TPD52L1_ENST00000527711.1_Missense_Mutation_p.S24C|TPD52L1_ENST00000528193.1_Missense_Mutation_p.S24C|TPD52L1_ENST00000534199.1_5'UTR|HDDC2_ENST00000608456.1_5'UTR|TPD52L1_ENST00000532429.1_5'UTR|TPD52L1_ENST00000392482.2_5'UTR	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	24					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		TGCAGTAGCCAGTGCTGACTT	0.378																																						ENST00000534000.1	0.150000	0.010000	1.100000e-01	3.000000e-02	0.060000	0.074888	0.060000	0.060000																										0				5						c.(70-72)Agt>Tgt		tumor protein D52-like 1							140.0	136.0	138.0					6																	125541274		2203	4300	6503	SO:0001583	missense	7164	0	0					g.chr6:125541274A>T	U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.70A>T	chr6.hg19:g.125541274A>T	ENSP00000434142:p.Ser24Cys	0					TPD52L1_ENST00000368402.5_Missense_Mutation_p.S24C|TPD52L1_ENST00000304877.13_Missense_Mutation_p.S24C|TPD52L1_ENST00000368388.2_Missense_Mutation_p.S24C|TPD52L1_ENST00000532429.1_5'UTR|TPD52L1_ENST00000528193.1_Missense_Mutation_p.S24C|HDDC2_ENST00000608456.1_5'UTR|TPD52L1_ENST00000392482.2_5'UTR|TPD52L1_ENST00000524679.1_5'UTR|TPD52L1_ENST00000534199.1_5'UTR|TPD52L1_ENST00000527711.1_Missense_Mutation_p.S24C	p.S24C	NM_003287.2	NP_003278.1	0	0	0	2.005955	Q16890	TPD53_HUMAN	LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	2	366	+			A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	ENST00000534000.1	0	1	hg19	c.70A>T	CCDS5130.1	0	.	.	.	.	.	.	.	.	.	.	A	16.93	3.258538	0.59321	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000368402;ENST00000368388;ENST00000527711;ENST00000528193;ENST00000392484	T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73	5.26	-0.253	0.12996	5.26	-0.253	0.12996	.	0.282976	0.43919	D	0.000514	T	0.12263	0.0298	L	0.38175	1.15	0.38267	D	0.942041	P;P;P	0.51537	0.844;0.844;0.946	B;B;P	0.50590	0.416;0.416;0.645	T	0.06058	-1.0848	10	0.56958	D	0.05	-0.967	5.6478	0.17598	0.4559:0.1515:0.3926:0.0	.	24;24;24	Q16890-3;Q16890-2;Q16890	.;.;TPD53_HUMAN	C	24	ENSP00000306285:S24C;ENSP00000434142:S24C;ENSP00000357387:S24C;ENSP00000357373:S24C;ENSP00000436953:S24C;ENSP00000434743:S24C	ENSP00000306285:S24C	S	+	1	0	0	TPD52L1	125582973	125582973	0.999000	0.42202	0.993000	0.49108	0.840000	0.47671	1.953000	0.40352	0.087000	0.17167	-0.250000	0.11733	AGT	0.424815		TCGA-2L-AAQJ-01A-12D-A397-08	0.378	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042065.2	0	0	0	2	2	2	2	0	0	0	0	54	0	54	54	1	1.870000	-5.096504	1	0.440000			0	4	4	0	288	287	0		1	0		0	0	54	0	0	0.890225	2.010071e-01	0	0	0	48	0	4	288
NOTCH4	4855	broad.mit.edu	37	6	32168996	32168996	+	Missense_Mutation	SNP	C	C	T	rs8192573	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr6:32168996C>T	ENST00000375023.3	-	22	4175	c.4037G>A	c.(4036-4038)cGg>cAg	p.R1346Q		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1346			R -> P (in dbSNP:rs8192573).		cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TTCTTCAGCCCGGGCCCCAGG	0.617																																						ENST00000375023.3	0.360000	0.140000	3.000000e-01	1.900000e-01	0.240000	0.250089	0.240000	0.240000																										0				100						c.(4036-4038)cGg>cAg		notch 4							58.0	67.0	64.0					6																	32168996		1508	2707	4215	SO:0001583	missense	4855	0	0					g.chr6:32168996C>T		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.4037G>A	chr6.hg19:g.32168996C>T	ENSP00000364163:p.Arg1346Gln	0						p.R1346Q	NM_004557.3	NP_004548.3	0	0	0	2.030214	Q99466	NOTC4_HUMAN		22	4175	-			B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	1	0	hg19	c.4037G>A	CCDS34420.1	0	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397977	0.25205	.	.	ENSG00000204301	ENST00000375023	T	0.80824	-1.42	4.37	1.09	0.20402	4.37	1.09	0.20402	.	0.581966	0.13081	N	0.415340	T	0.35098	0.0920	N	0.03608	-0.345	0.80722	D	1	B;B	0.18741	0.03;0.001	B;B	0.17979	0.02;0.0	T	0.08534	-1.0717	10	0.25106	T	0.35	.	5.443	0.16519	0.0:0.4431:0.0:0.5569	.	1346;1345	Q99466;B0S882	NOTC4_HUMAN;.	Q	1346	ENSP00000364163:R1346Q	ENSP00000364163:R1346Q	R	-	2	0	0	NOTCH4	32276974	32276974	0.999000	0.42202	0.990000	0.47175	0.931000	0.56810	1.224000	0.32539	0.052000	0.16007	0.456000	0.33151	CGG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.617	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2	1	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	1.870000	-2.484114	0	0.440000			0	19	19	0	338	332	0		1	0		0	0	54	0	0	0.999990	4.943782e-01	0	0	0	30	0	19	338
PGC	5225	broad.mit.edu	37	6	41704646	41704646	+	Missense_Mutation	SNP	A	A	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr6:41704646A>G	ENST00000373025.3	-	9	1173	c.1111T>C	c.(1111-1113)Tac>Cac	p.Y371H	TFEB_ENST00000230323.4_5'Flank|TFEB_ENST00000420312.1_5'Flank|TFEB_ENST00000358871.2_5'Flank|TFEB_ENST00000373033.1_5'Flank|TFEB_ENST00000403298.4_5'Flank|RP11-298J23.5_ENST00000438967.1_RNA	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	371					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			ACGGAATAGTAGGACCTGAGG	0.602																																						ENST00000373025.3	0.370000	0.110000	2.900000e-01	1.500000e-01	0.210000	0.230305	0.210000	0.210000																										0				16						c.(1111-1113)Tac>Cac		progastricsin (pepsinogen C)							117.0	98.0	105.0					6																	41704646		2203	4300	6503	SO:0001583	missense	5225	0	0					g.chr6:41704646A>G		CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.1111T>C	chr6.hg19:g.41704646A>G	ENSP00000362116:p.Tyr371His	0					TFEB_ENST00000230323.4_5'Flank|TFEB_ENST00000420312.1_5'Flank|TFEB_ENST00000403298.4_5'Flank|TFEB_ENST00000373033.1_5'Flank|TFEB_ENST00000358871.2_5'Flank|RP11-298J23.5_ENST00000438967.1_RNA	p.Y371H	NM_002630.3	NP_002621.1	0	0	0	2.005955	P20142	PEPC_HUMAN	Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)	9	1173	-	Ovarian(28;0.0355)|Colorectal(47;0.121)		B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	ENST00000373025.3	1	1	hg19	c.1111T>C	CCDS4859.1	0	.	.	.	.	.	.	.	.	.	.	A	14.87	2.663054	0.47572	.	.	ENSG00000096088	ENST00000373025	T	0.34275	1.37	4.82	4.82	0.62117	4.82	4.82	0.62117	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.64402	D	0.000001	T	0.64136	0.2571	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76091	-0.3086	10	0.87932	D	0	.	14.2156	0.65790	1.0:0.0:0.0:0.0	.	371	P20142	PEPC_HUMAN	H	371	ENSP00000362116:Y371H	ENSP00000362116:Y371H	Y	-	1	0	0	PGC	41812624	41812624	1.000000	0.71417	0.967000	0.41034	0.048000	0.14542	6.504000	0.73704	2.013000	0.59113	0.459000	0.35465	TAC	0.424815		TCGA-2L-AAQJ-01A-12D-A397-08	0.602	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2	1	0	1	2	2	2	2	0	0	0	0	39	0	39	39	1	1.870000	-12.524860	1	0.440000			0	10	10	0	198	197	0		1	1		0	0	39	0	0	0.997020	1	0	11	0	1109	0	10	198
KIAA0408	9729	broad.mit.edu	37	6	127771349	127771349	+	Missense_Mutation	SNP	G	G	A	rs551811170	byFrequency	TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr6:127771349G>A	ENST00000483725.3	-	3	620	c.284C>T	c.(283-285)aCg>aTg	p.T95M	SOGA3_ENST00000368268.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	95								p.T95M(1)		endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		TTTGTGATTCGTCCTTATAAA	0.358													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		18584	0.0		0.0	False		,,,				2504	0.0					ENST00000483725.3	0.130000	0.020000	1.000000e-01	3.000000e-02	0.060000	0.070535	0.060000	0.060000																										1	Substitution - Missense(1)	p.T95M(1)	pancreas(1)	28						c.(283-285)aCg>aTg		KIAA0408							125.0	126.0	125.0					6																	127771349		2203	4300	6503	SO:0001583	missense	9729	6	121406	42				g.chr6:127771349G>A	AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.284C>T	chr6.hg19:g.127771349G>A	ENSP00000435150:p.Thr95Met	0					SOGA3_ENST00000368268.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	p.T95M	NM_014702.4	NP_055517.3	0	0	0	2.005955	Q6ZU52	K0408_HUMAN		3	620	-			B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Missense_Mutation	SNP	ENST00000483725.3	0	1	hg19	c.284C>T	CCDS34531.1	0	.	.	.	.	.	.	.	.	.	.	G	0.313	-0.966787	0.02232	.	.	ENSG00000189367	ENST00000483725;ENST00000487331	T;T	0.43294	0.95;0.95	5.7	3.22	0.36961	5.7	3.22	0.36961	.	0.603786	0.12642	N	0.451213	T	0.04952	0.0133	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38628	-0.9652	10	0.30078	T	0.28	0.4989	7.4927	0.27471	0.766:0.0:0.234:0.0	.	95	Q6ZU52	K0408_HUMAN	M	95;107	ENSP00000435150:T95M;ENSP00000434384:T107M	ENSP00000435150:T95M	T	-	2	0	0	KIAA0408	127813042	127813042	0.001000	0.12720	0.008000	0.14137	0.002000	0.02628	0.957000	0.29215	0.978000	0.38470	-0.300000	0.09419	ACG	0.424815		TCGA-2L-AAQJ-01A-12D-A397-08	0.358	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	0	0	1	2	2	2	2	0	0	0	0	68	0	68	68	1	1.870000	-2.781143	1	0.440000	NM_014702		0	6	6	0	430	430	0		1			0	0	68	0	0	0.965221	0	0	0	0	0	0	6	430
DOCK4	9732	broad.mit.edu	37	7	111368508	111368508	+	Missense_Mutation	SNP	C	C	T	rs374504389		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:111368508C>T	ENST00000437633.1	-	52	5979	c.5723G>A	c.(5722-5724)cGg>cAg	p.R1908Q	DOCK4_ENST00000494651.2_Missense_Mutation_p.R791Q|DOCK4_ENST00000428084.1_Missense_Mutation_p.R1917Q	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1908	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CCGCAGAGTCCGCTCGTAGAC	0.731																																						ENST00000437633.1	1.000000	0.830000	1	9.400000e-01	0.990000	0.979552	0.990000	1.000000																										0				72						c.(5722-5724)cGg>cAg		dedicator of cytokinesis 4		C	GLN/ARG	0,4120		0,0,2060	23.0	29.0	27.0		5723	5.6	1.0	7		27	1,8365		0,1,4182	no	missense	DOCK4	NM_014705.3	43	0,1,6242	TT,TC,CC		0.012,0.0,0.0080	probably-damaging	1908/1967	111368508	1,12485	2060	4183	6243	SO:0001583	missense	9732	9	120600	39				g.chr7:111368508C>T		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5723G>A	chr7.hg19:g.111368508C>T	ENSP00000404179:p.Arg1908Gln	0					DOCK4_ENST00000428084.1_Missense_Mutation_p.R1917Q|DOCK4_ENST00000494651.2_Missense_Mutation_p.R791Q	p.R1908Q	NM_014705.3	NP_055520.3	0	0	0	2.040935	Q8N1I0	DOCK4_HUMAN		52	5979	-		Acute lymphoblastic leukemia(1;0.0441)	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	1	1	hg19	c.5723G>A	CCDS47688.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.850010|5.850010	0.97023|0.97023	0.0|0.0	1.2E-4|1.2E-4	ENSG00000128512|ENSG00000128512	ENST00000423057;ENST00000445943|ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	.|T;T;T	.|0.32753	.|1.44;1.44;1.44	5.59|5.59	5.59|5.59	0.84812|0.84812	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.53706|0.53706	0.1813|0.1813	L|L	0.57536|0.57536	1.79|1.79	0.46927|0.46927	D|D	0.999258|0.999258	.|D;P;D;D;D;D	.|0.89917	.|0.994;0.951;0.981;0.994;0.997;1.0	.|D;B;B;D;D;D	.|0.85130	.|0.921;0.404;0.391;0.921;0.964;0.997	T|T	0.40515|0.40515	-0.9559|-0.9559	5|10	.|0.33141	.|T	.|0.24	.|.	19.5919|19.5919	0.95518|0.95518	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|777;791;1953;1908;1879;221	.|B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4	.|.;.;.;DOCK4_HUMAN;.;.	R|Q	1331;1941|1896;1917;791;1908;1867	.|ENSP00000410746:R1917Q;ENSP00000440944:R791Q;ENSP00000404179:R1908Q	.|ENSP00000345432:R1867Q	G|R	-|-	1|2	0|0	0|0	DOCK4|DOCK4	111155744|111155744	111155744|111155744	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.513000|5.513000	0.67037|0.67037	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GGA|CGG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.731	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	1	0	1	2	2	2	2	0	0	0	0	62	0	62	59	1	1.870000	-4.473540	1	0.440000	NM_014705		0	62	62	0	201	198	0		1	0		0	0	62	0	0	1.000000	8.112629e-01	0	1	0	11	0	62	201
FAM71F1	84691	broad.mit.edu	37	7	128363345	128363345	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:128363345C>T	ENST00000315184.5	+	4	835	c.782C>T	c.(781-783)gCc>gTc	p.A261V	FAM71F1_ENST00000485070.1_Missense_Mutation_p.A162V|FAM71F1_ENST00000469348.1_3'UTR	NM_001282788.1|NM_032599.2	NP_001269717.1|NP_115988.1	Q96KD3	F71F1_HUMAN	family with sequence similarity 71, member F1	261								p.A261V(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18						CAGATTTTTGCCGACTTACAC	0.502																																						ENST00000315184.5	0.130000	0.020000	1.000000e-01	4.000000e-02	0.060000	0.074872	0.060000	0.060000																										1	Substitution - Missense(1)	p.A261V(1)	prostate(1)	18						c.(781-783)gCc>gTc		family with sequence similarity 71, member F1							118.0	116.0	117.0					7																	128363345		2203	4300	6503	SO:0001583	missense	84691	5	121412	39				g.chr7:128363345C>T	AF367470	CCDS5804.1, CCDS64763.1	7q32.1	2007-11-20	2007-11-20	2007-11-20	ENSG00000135248	ENSG00000135248			30704	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member A"""	FAM137A		12477932	Standard	XM_005250645		Approved	NYD-SP18	uc003vno.1	Q96KD3	OTTHUMG00000158276	ENST00000315184.5:c.782C>T	chr7.hg19:g.128363345C>T	ENSP00000326652:p.Ala261Val	0					FAM71F1_ENST00000485070.1_Missense_Mutation_p.A162V|FAM71F1_ENST00000469348.1_3'UTR	p.A261V	NM_001282788.1|NM_032599.2	NP_001269717.1|NP_115988.1	0	0	0	2.040935	Q96KD3	F71F1_HUMAN		4	835	+			Q8IY75|Q8NA48	Missense_Mutation	SNP	ENST00000315184.5	0	1	hg19	c.782C>T	CCDS5804.1	0	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717581	0.48622	.	.	ENSG00000135248	ENST00000485070;ENST00000315184;ENST00000466842	T;T;T	0.24151	1.87;3.23;1.92	5.2	3.36	0.38483	5.2	3.36	0.38483	.	0.643829	0.14692	N	0.304119	T	0.17365	0.0417	L	0.33485	1.01	0.26152	N	0.980124	B;B;B;B;B	0.18310	0.011;0.01;0.003;0.002;0.027	B;B;B;B;B	0.15052	0.012;0.006;0.004;0.002;0.006	T	0.17992	-1.0351	10	0.30854	T	0.27	-2.5683	6.5261	0.22303	0.1782:0.7313:0.0:0.0905	.	153;261;261;261;162	B4DY15;F8WC62;Q96KD3-2;Q96KD3;Q8NA48	.;.;.;F71F1_HUMAN;.	V	162;261;117	ENSP00000418192:A162V;ENSP00000326652:A261V;ENSP00000417930:A117V	ENSP00000326652:A261V	A	+	2	0	0	FAM71F1	128150581	128150581	0.133000	0.22466	0.998000	0.56505	0.995000	0.86356	0.071000	0.14594	0.862000	0.35528	0.555000	0.69702	GCC	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.502	FAM71F1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350544.2	0	0	1	2	2	2	2	0	0	0	0	81	0	81	80	1	1.870000	-1.790619	0	0.440000	NM_032599		0	6	6	0	412	410	0		1			0	0	81	0	0	0.964714	0	0	0	0	0	0	6	412
SDK1	221935	broad.mit.edu	37	7	4188979	4188979	+	Silent	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:4188979C>T	ENST00000404826.2	+	30	4648	c.4509C>T	c.(4507-4509)agC>agT	p.S1503S	SDK1_ENST00000389531.3_Silent_p.S1503S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1503	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TCCCGGGCAGCGACGGGGCCT	0.677																																						ENST00000404826.2	1.000000	0.400000	9.800000e-01	5.600000e-01	0.750000	0.762280	0.750000	1.000000																										0				153						c.(4507-4509)agC>agT		sidekick cell adhesion molecule 1							27.0	28.0	27.0					7																	4188979		2202	4299	6501	SO:0001819	synonymous_variant	221935	1	121250	26				g.chr7:4188979C>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4509C>T	chr7.hg19:g.4188979C>T		0					SDK1_ENST00000389531.3_Silent_p.S1503S	p.S1503S	NM_152744.3	NP_689957.3	0	0	0	2.040935	Q7Z5N4	SDK1_HUMAN		30	4648	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	1	1	hg19	c.4509C>T	CCDS34590.1	0																																																																																								0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.677	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	1	0	1	2	2	2	2	0	0	0	0	17	0	17	17	1	1.870000	-19.021370	1	0.440000	NM_152744		0	10	10	0	50	50	1		1	0		0	0	17	0	0	0.997708	3.588710e-01	0	0	0	7	0	10	50
WIPI2	26100	broad.mit.edu	37	7	5232787	5232787	+	Missense_Mutation	SNP	G	G	A	rs200762936		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:5232787G>A	ENST00000288828.4	+	2	345	c.113G>A	c.(112-114)cGt>cAt	p.R38H	WIPI2_ENST00000401525.3_Intron|WIPI2_ENST00000404704.3_Missense_Mutation_p.R38H|WIPI2_ENST00000382384.2_Intron|WIPI2_ENST00000485854.1_Intron	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	38					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		GGTCTTGGCCGTCGCGCTGTT	0.388																																						ENST00000288828.4	1.000000	0.760000	1	8.300000e-01	0.910000	0.916210	0.910000	1.000000																										0				16						c.(112-114)cGt>cAt		WD repeat domain, phosphoinositide interacting 2							136.0	136.0	136.0					7																	5232787		2203	4300	6503	SO:0001583	missense	26100	1	121412	35				g.chr7:5232787G>A		CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.113G>A	chr7.hg19:g.5232787G>A	ENSP00000288828:p.Arg38His	0					WIPI2_ENST00000382384.2_Intron|WIPI2_ENST00000404704.3_Missense_Mutation_p.R38H|WIPI2_ENST00000485854.1_Intron|WIPI2_ENST00000401525.3_Intron	p.R38H	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	0	0	0	2.040935	Q9Y4P8	WIPI2_HUMAN		2	345	+		Ovarian(82;0.0175)	B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Missense_Mutation	SNP	ENST00000288828.4	1	1	hg19	c.113G>A	CCDS5339.1	1	.	.	.	.	.	.	.	.	.	.	G	7.818	0.717084	0.15372	.	.	ENSG00000157954	ENST00000288828;ENST00000404704	T;T	0.35973	1.28;1.28	3.42	-6.11	0.02131	3.42	-6.11	0.02131	.	608.758000	0.01314	U	0.010739	T	0.15782	0.0380	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18967	-1.0320	10	0.40728	T	0.16	.	6.7201	0.23325	0.3457:0.1644:0.4899:0.0	.	38;38	Q9Y4P8-6;Q9Y4P8	.;WIPI2_HUMAN	H	38	ENSP00000288828:R38H;ENSP00000385297:R38H	ENSP00000288828:R38H	R	+	2	0	0	WIPI2	5199313	5199313	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.087000	0.01360	-1.161000	0.02800	-1.223000	0.01593	CGT	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.388	WIPI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241669.2	0	0	1	2	19	2	2	1	0	1	1	86	0	86	83	1	1.870000	-20.000000	1	0.440000	NM_015610		0	97	96	0	377	373	1		1	1		1	0	86	0	0	1.000000	9.065020e-01	0	7	0	11	0	97	377
FSCN1	6624	broad.mit.edu	37	7	5644983	5644983	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:5644983G>A	ENST00000382361.3	+	5	1474	c.1360G>A	c.(1360-1362)Gag>Aag	p.E454K	FSCN1_ENST00000340250.6_Missense_Mutation_p.E433K	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	454					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		CTTCTTCTTCGAGTTCTGCGA	0.617																																						ENST00000382361.3	1.000000	0.770000	1	8.800000e-01	0.990000	0.960091	0.990000	1.000000																										0				9						c.(1360-1362)Gag>Aag		fascin actin-bundling protein 1							63.0	58.0	60.0					7																	5644983		2203	4300	6503	SO:0001583	missense	6624	0	0					g.chr7:5644983G>A	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1360G>A	chr7.hg19:g.5644983G>A	ENSP00000371798:p.Glu454Lys	0					FSCN1_ENST00000340250.6_Missense_Mutation_p.E433K	p.E454K	NM_003088.3	NP_003079.1	0	0	0	2.040935	Q16658	FSCN1_HUMAN		5	1474	+		Ovarian(82;0.0694)	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	1	1	hg19	c.1360G>A	CCDS5342.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.060521	0.93846	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000535097	T;T	0.52057	0.68;0.68	4.0	4.0	0.46444	4.0	4.0	0.46444	Fascin domain (1);Actin cross-linking (1);	0.062034	0.64402	D	0.000007	T	0.45377	0.1339	M	0.62209	1.925	0.80722	D	1	P	0.50443	0.935	B	0.39068	0.289	T	0.59069	-0.7523	10	0.87932	D	0	-0.2446	15.5031	0.75716	0.0:0.0:1.0:0.0	.	454	Q16658	FSCN1_HUMAN	K	433;454;176	ENSP00000339729:E433K;ENSP00000371798:E454K	ENSP00000339729:E433K	E	+	1	0	0	FSCN1	5611509	5611509	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	9.420000	0.97426	1.944000	0.56390	0.549000	0.68633	GAG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.617	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	1	0	1	2	2	2	2	0	0	0	0	46	0	46	44	1	1.870000	-20.000000	1	0.440000	NM_003088		0	46	45	0	157	156	1		1	1		0	0	46	0	0	1.000000	1	0	84	0	182	0	46	157
CDK13	8621	broad.mit.edu	37	7	40027359	40027359	+	Missense_Mutation	SNP	A	A	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:40027359A>C	ENST00000181839.4	+	2	1978	c.1373A>C	c.(1372-1374)aAa>aCa	p.K458T	CDK13_ENST00000340829.5_Missense_Mutation_p.K458T	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	458					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						AAGAATAAAAAagcacgagca	0.488																																						ENST00000181839.4	0.190000	0.020000	1.400000e-01	4.000000e-02	0.080000	0.096540	0.080000	0.080000																										0				49						c.(1372-1374)aAa>aCa		cyclin-dependent kinase 13							44.0	44.0	44.0					7																	40027359		2203	4300	6503	SO:0001583	missense	8621	0	0					g.chr7:40027359A>C	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1373A>C	chr7.hg19:g.40027359A>C	ENSP00000181839:p.Lys458Thr	0					CDK13_ENST00000340829.5_Missense_Mutation_p.K458T	p.K458T	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	0	0	0	2.040935	Q14004	CDK13_HUMAN		2	1978	+			Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	ENST00000181839.4	0	1	hg19	c.1373A>C	CCDS5461.1	0	.	.	.	.	.	.	.	.	.	.	A	17.32	3.358737	0.61403	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.66638	-0.22;-0.22	5.95	5.95	0.96441	5.95	5.95	0.96441	.	.	.	.	.	T	0.79924	0.4530	M	0.61703	1.905	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.79212	-0.1896	8	.	.	.	-13.8654	16.4101	0.83708	1.0:0.0:0.0:0.0	.	458;458	Q14004-2;Q14004	.;CDK13_HUMAN	T	458	ENSP00000181839:K458T;ENSP00000340557:K458T	.	K	+	2	0	0	CDK13	39993884	39993884	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.281000	0.72632	2.280000	0.76307	0.460000	0.39030	AAA	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.488	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	0	0	1	2	2	2	2	0	0	0	0	48	0	48	47	1	1.870000	-7.210621	1	0.440000	NM_003718		0	4	4	0	226	226	0		1	0		0	0	48	0	0	0.891141	3.325394e-01	0	1	0	55	0	4	226
GLI3	2737	broad.mit.edu	37	7	42005299	42005299	+	Silent	SNP	G	G	A	rs542238121		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:42005299G>A	ENST00000395925.3	-	15	3456	c.3372C>T	c.(3370-3372)caC>caT	p.H1124H	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1124					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CACCGGGCCCGTGGGGCACTT	0.657									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				G|||	1	0.000199681	0.0	0.0	5008	,	,		15149	0.001		0.0	False		,,,				2504	0.0					ENST00000395925.3	1.000000	0.760000	1	8.400000e-01	0.920000	0.923828	0.920000	1.000000																										0				112						c.(3370-3372)caC>caT		GLI family zinc finger 3							54.0	60.0	58.0					7																	42005299		2203	4300	6503	SO:0001819	synonymous_variant	2737	0	0		Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42005299G>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3372C>T	chr7.hg19:g.42005299G>A		0					GLI3_ENST00000479210.1_5'UTR	p.H1124H	NM_000168.5	NP_000159.3	0	0	0	2.040935	P10071	GLI3_HUMAN		15	3456	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	1	1	hg19	c.3372C>T	CCDS5465.1	1																																																																																								0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.657	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	1	0	1	2	2	2	2	0	0	0	0	109	0	109	109	1	1.870000	-20.000000	1	0.440000	NM_000168		0	97	96	0	372	366	1		1	0		0	0	109	0	0	1.000000	4.364137e-02	0	0	0	2	0	97	372
OGDH	4967	broad.mit.edu	37	7	44715672	44715672	+	Missense_Mutation	SNP	T	T	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:44715672T>C	ENST00000222673.5	+	9	1172	c.1130T>C	c.(1129-1131)cTt>cCt	p.L377P	OGDH_ENST00000449767.1_Missense_Mutation_p.L373P|OGDH_ENST00000443864.2_Missense_Mutation_p.L377P|OGDH_ENST00000444676.1_Missense_Mutation_p.L392P|OGDH_ENST00000439616.2_Missense_Mutation_p.L227P|OGDH_ENST00000543843.1_Missense_Mutation_p.L328P|OGDH_ENST00000447398.1_Missense_Mutation_p.L388P	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	377					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CCTTCCCACCTTGAGGCCGCT	0.557																																						ENST00000222673.5	0.800000	0.520000	7.400000e-01	5.800000e-01	0.650000	0.665688	0.650000	0.660000																										0				36						c.(1129-1131)cTt>cCt		oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	Valproic Acid(DB00313)						133.0	115.0	121.0					7																	44715672		2203	4300	6503	SO:0001583	missense	4967	0	0					g.chr7:44715672T>C	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1130T>C	chr7.hg19:g.44715672T>C	ENSP00000222673:p.Leu377Pro	0					OGDH_ENST00000449767.1_Missense_Mutation_p.L373P|OGDH_ENST00000444676.1_Missense_Mutation_p.L392P|OGDH_ENST00000443864.2_Missense_Mutation_p.L377P|OGDH_ENST00000439616.2_Missense_Mutation_p.L227P|OGDH_ENST00000543843.1_Missense_Mutation_p.L328P|OGDH_ENST00000447398.1_Missense_Mutation_p.L388P	p.L377P	NM_002541.3	NP_002532.2	0	0	0	2.040935	Q02218	ODO1_HUMAN		9	1172	+			B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	1	1	hg19	c.1130T>C	CCDS34627.1	0	.	.	.	.	.	.	.	.	.	.	T	22.6	4.306757	0.81247	.	.	ENSG00000105953	ENST00000439616;ENST00000443864;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;T;D;D;D;D;D	0.95788	-3.81;2.0;-3.81;-3.81;-3.81;-3.81;-3.81	5.14	5.14	0.70334	5.14	5.14	0.70334	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98738	0.9576	H	0.98996	4.395	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.99521	1.0958	10	0.87932	D	0	-27.6918	14.9242	0.70862	0.0:0.0:0.0:1.0	.	172;227;373;388;279;377;377	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218;Q96DD3	.;.;.;.;.;ODO1_HUMAN;.	P	227;377;373;388;392;377;328	ENSP00000398576:L227P;ENSP00000388084:L377P;ENSP00000392878:L373P;ENSP00000388183:L388P;ENSP00000414662:L392P;ENSP00000222673:L377P;ENSP00000443821:L328P	ENSP00000222673:L377P	L	+	2	0	0	OGDH	44682197	44682197	1.000000	0.71417	0.987000	0.45799	0.892000	0.51952	7.788000	0.85771	2.063000	0.61619	0.379000	0.24179	CTT	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.557	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1	1	0	1	2	2	2	2	0	0	0	0	106	0	106	106	1	1.870000	-20.000000	1	0.440000			0	71	71	0	413	408	1		1	1		0	0	106	0	0	1.000000	9.999272e-01	0	21	0	60	0	71	413
C7orf57	136288	broad.mit.edu	37	7	48080979	48080979	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:48080979C>T	ENST00000348904.3	+	3	316	c.104C>T	c.(103-105)gCc>gTc	p.A35V	C7orf57_ENST00000435376.1_5'UTR|C7orf57_ENST00000420324.1_Missense_Mutation_p.A80V|C7orf57_ENST00000539619.1_Missense_Mutation_p.A35V|C7orf57_ENST00000430738.1_Missense_Mutation_p.A80V	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	35										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						GCCGTGGATGCCCCACCAGCG	0.567																																						ENST00000348904.3	0.200000	0.020000	1.500000e-01	5.000000e-02	0.090000	0.105597	0.090000	0.080000																										0				9						c.(103-105)gCc>gTc		chromosome 7 open reading frame 57							53.0	57.0	56.0					7																	48080979		1934	4147	6081	SO:0001583	missense	136288	0	0					g.chr7:48080979C>T	BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.104C>T	chr7.hg19:g.48080979C>T	ENSP00000335500:p.Ala35Val	0					C7orf57_ENST00000430738.1_Missense_Mutation_p.A80V|C7orf57_ENST00000539619.1_Missense_Mutation_p.A35V|C7orf57_ENST00000420324.1_Missense_Mutation_p.A80V|C7orf57_ENST00000435376.1_5'UTR	p.A35V	NM_001100159.2	NP_001093629.1	0	0	0	2.040935	Q8NEG2	CG057_HUMAN		3	316	+			C9JBJ8	Missense_Mutation	SNP	ENST00000348904.3	0	1	hg19	c.104C>T	CCDS47583.1	0	.	.	.	.	.	.	.	.	.	.	C	0.418	-0.909812	0.02434	.	.	ENSG00000164746	ENST00000420324;ENST00000430738;ENST00000348904;ENST00000539619	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.69	-1.12	0.09808	5.69	-1.12	0.09808	.	0.758231	0.12566	N	0.457767	T	0.29491	0.0735	N	0.11698	0.16	0.09310	N	1	B	0.14438	0.01	B	0.16722	0.016	T	0.22765	-1.0207	10	0.18710	T	0.47	-42.8651	9.8678	0.41154	0.0:0.4479:0.0:0.5521	.	35	Q8NEG2	CG057_HUMAN	V	80;80;35;35	ENSP00000394648:A80V;ENSP00000410944:A80V;ENSP00000335500:A35V;ENSP00000442474:A35V	ENSP00000335500:A35V	A	+	2	0	0	C7orf57	48047504	48047504	0.000000	0.05858	0.005000	0.12908	0.037000	0.13140	-0.525000	0.06214	-0.112000	0.11979	-0.251000	0.11542	GCC	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.567	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341745.1	0	0	1	2	2	2	2	0	0	0	0	48	0	48	48	1	1.870000	-2.863991	1	0.440000	NM_001100159		0	4	4	0	206	204	0		1			0	0	48	0	0	0.888935	0	0	0	0	0	0	4	206
MAGI2	9863	broad.mit.edu	37	7	77885649	77885649	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:77885649C>T	ENST00000354212.4	-	10	1911	c.1658G>A	c.(1657-1659)cGg>cAg	p.R553Q	MAGI2_ENST00000522391.1_Missense_Mutation_p.R553Q|MAGI2_ENST00000536571.1_Missense_Mutation_p.R385Q|MAGI2_ENST00000535697.1_Missense_Mutation_p.R390Q|MAGI2_ENST00000419488.1_Missense_Mutation_p.R553Q	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	553					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CTGTGAGGTCCGAGAAATGTA	0.512																																						ENST00000354212.4	1.000000	0.620000	9.800000e-01	7.300000e-01	0.840000	0.851045	0.840000	1.000000																										0				84						c.(1657-1659)cGg>cAg		membrane associated guanylate kinase, WW and PDZ domain containing 2							124.0	100.0	109.0					7																	77885649		2203	4300	6503	SO:0001583	missense	9863	3	121408	36				g.chr7:77885649C>T	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1658G>A	chr7.hg19:g.77885649C>T	ENSP00000346151:p.Arg553Gln	0					MAGI2_ENST00000419488.1_Missense_Mutation_p.R553Q|MAGI2_ENST00000536571.1_Missense_Mutation_p.R385Q|MAGI2_ENST00000522391.1_Missense_Mutation_p.R553Q|MAGI2_ENST00000535697.1_Missense_Mutation_p.R390Q	p.R553Q	NM_012301.3	NP_036433.2	0	0	0	2.040935	Q86UL8	MAGI2_HUMAN		10	1911	-		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	1	1	hg19	c.1658G>A	CCDS5594.1	0	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488783	0.44249	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.10382	2.97;2.98;2.88;3.82;3.83	5.94	5.06	0.68205	5.94	5.06	0.68205	.	0.000000	0.33253	U	0.005115	T	0.12220	0.0297	N	0.16790	0.44	0.49130	D	0.999757	D;B;D;D;B;D	0.76494	0.988;0.145;0.998;0.998;0.376;0.999	P;B;P;P;B;P	0.55011	0.507;0.018;0.652;0.652;0.068;0.766	T	0.23940	-1.0174	10	0.11485	T	0.65	.	14.5211	0.67851	0.0:0.9297:0.0:0.0703	.	390;385;553;553;553;553	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	Q	553;553;553;553;385;390	ENSP00000405766:R553Q;ENSP00000346151:R553Q;ENSP00000428389:R553Q;ENSP00000441584:R385Q;ENSP00000441603:R390Q	ENSP00000346151:R553Q	R	-	2	0	0	MAGI2	77723585	77723585	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.243000	0.51392	1.519000	0.48950	0.561000	0.74099	CGG	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.512	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	1	0	1	2	2	2	2	0	0	0	0	38	0	38	38	1	1.870000	-2.948967	1	0.440000	NM_012301		0	38	38	0	163	161	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	38	163
PTPRN2	5799	broad.mit.edu	37	7	157926586	157926586	+	Missense_Mutation	SNP	C	C	T	rs142388788		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr7:157926586C>T	ENST00000389418.4	-	9	1348	c.1339G>A	c.(1339-1341)Gtc>Atc	p.V447I	PTPRN2_ENST00000409483.1_Missense_Mutation_p.V409I|PTPRN2_ENST00000389416.4_Missense_Mutation_p.V430I|PTPRN2_ENST00000404321.2_Missense_Mutation_p.V470I|PTPRN2_ENST00000389413.3_Missense_Mutation_p.V447I	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	447					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TGGCTCTTGACGTTCTCCACT	0.612																																						ENST00000389418.4	1.000000	0.760000	9.800000e-01	8.300000e-01	0.900000	0.906609	0.900000	1.000000																										0				86						c.(1339-1341)Gtc>Atc		protein tyrosine phosphatase, receptor type, N polypeptide 2			ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	70.0	74.0	73.0		1339,1288,1339	2.9	0.0	7	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PTPRN2	NM_002847.3,NM_130842.2,NM_130843.2	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	447/1016,430/999,447/987	157926586	1,13005	2203	4300	6503	SO:0001583	missense	5799	1	121412	36				g.chr7:157926586C>T	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1339G>A	chr7.hg19:g.157926586C>T	ENSP00000374069:p.Val447Ile	0					PTPRN2_ENST00000389413.3_Missense_Mutation_p.V447I|PTPRN2_ENST00000409483.1_Missense_Mutation_p.V409I|PTPRN2_ENST00000404321.2_Missense_Mutation_p.V470I|PTPRN2_ENST00000389416.4_Missense_Mutation_p.V430I	p.V447I	NM_002847.3	NP_002838.2	0	0	0	2.040935	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	9	1348	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	1	1	hg19	c.1339G>A	CCDS5947.1	1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997688	0.35226	0.0	1.16E-4	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.07327	3.29;3.2;3.26;3.29;3.25	3.78	2.88	0.33553	3.78	2.88	0.33553	.	0.310886	0.20844	U	0.084645	T	0.05181	0.0138	L	0.32530	0.975	0.26315	N	0.977769	P;P;P;P;P	0.45902	0.868;0.792;0.868;0.792;0.792	B;B;B;B;B	0.30572	0.117;0.055;0.117;0.055;0.055	T	0.32214	-0.9915	10	0.56958	D	0.05	.	9.1024	0.36676	0.0:0.89:0.0:0.11	.	470;409;447;430;447	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	I	409;447;430;447;470	ENSP00000387114:V409I;ENSP00000374064:V447I;ENSP00000374067:V430I;ENSP00000374069:V447I;ENSP00000385464:V470I	ENSP00000374064:V447I	V	-	1	0	0	PTPRN2	157619347	157619347	0.443000	0.25641	0.048000	0.18961	0.043000	0.13939	1.614000	0.36911	0.681000	0.31386	0.585000	0.79938	GTC	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.612	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1	1	0	1	2	2	2	2	0	0	0	0	122	0	122	122	1	1.870000	-20.000000	1	0.440000			0	123	121	0	487	482	1		1	1		0	0	122	0	0	1.000000	9.999559e-01	0	36	0	23	0	123	487
CSMD1	64478	broad.mit.edu	37	8	3216706	3216706	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr8:3216706C>T	ENST00000520002.1	-	22	3830	c.3275G>A	c.(3274-3276)cGt>cAt	p.R1092H	CSMD1_ENST00000400186.3_Missense_Mutation_p.R1092H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1092H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1092H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1092	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTCCACACACGGCGGCCCCC	0.562																																						ENST00000520002.1	0.190000	0.040000	1.400000e-01	6.000000e-02	0.090000	0.108472	0.090000	0.100000																										0				25						c.(3274-3276)cGt>cAt		CUB and Sushi multiple domains 1							70.0	74.0	72.0					8																	3216706		2203	4300	6503	SO:0001583	missense	64478	4	121412	35				g.chr8:3216706C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3275G>A	chr8.hg19:g.3216706C>T	ENSP00000430733:p.Arg1092His	0					CSMD1_ENST00000542608.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1092H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1091H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1092H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1092H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1091H	p.R1092H			0	0	0	2.027595	Q96PZ7	CSMD1_HUMAN		22	3830	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	0	1	hg19	c.3275G>A		0	.	.	.	.	.	.	.	.	.	.	c	36	5.695321	0.96793	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	5.34	5.34	0.76211	5.34	5.34	0.76211	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.84483	0.5482	M	0.92268	3.29	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.994	D;D;P	0.85130	0.997;0.957;0.837	D	0.87265	0.2282	10	0.52906	T	0.07	.	19.067	0.93116	0.0:1.0:0.0:0.0	.	1092;1092;1092	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	H	1092;1092;954;1091;1091;1091	ENSP00000383047:R1092H;ENSP00000430733:R1092H;ENSP00000441462:R1091H;ENSP00000446243:R1091H;ENSP00000441675:R1091H	ENSP00000320445:R954H	R	-	2	0	0	CSMD1	3204113	3204113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.762000	0.62250	2.489000	0.83994	0.550000	0.68814	CGT	0.429967		TCGA-2L-AAQJ-01A-12D-A397-08	0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	0	0	1	2	2	2	2	0	0	0	0	64	0	64	61	1	1.870000	-3.082203	1	0.440000	NM_033225		0	7	7	0	319	310	0		1			0	0	64	0	0	0.978882	0	0	0	0	0	0	7	319
ENTPD4	9583	broad.mit.edu	37	8	23294452	23294452	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr8:23294452C>T	ENST00000358689.4	-	10	1604	c.1369G>A	c.(1369-1371)Gca>Aca	p.A457T	ENTPD4_ENST00000356206.6_Missense_Mutation_p.A449T|ENTPD4_ENST00000521321.1_5'UTR|ENTPD4_ENST00000417069.2_Missense_Mutation_p.A449T	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	457					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		GGTACCTTTGCAGCTTTAGTA	0.483																																						ENST00000358689.4	0.980000	0.690000	9.100000e-01	7.600000e-01	0.830000	0.840971	0.830000	0.840000																										0				25						c.(1369-1371)Gca>Aca		ectonucleoside triphosphate diphosphohydrolase 4							105.0	110.0	108.0					8																	23294452		2203	4300	6503	SO:0001583	missense	9583	0	0					g.chr8:23294452C>T	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1369G>A	chr8.hg19:g.23294452C>T	ENSP00000351520:p.Ala457Thr	0					ENTPD4_ENST00000417069.2_Missense_Mutation_p.A449T|ENTPD4_ENST00000521321.1_5'UTR|ENTPD4_ENST00000356206.6_Missense_Mutation_p.A449T	p.A457T	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	0	0	0	2.039724	Q9Y227	ENTP4_HUMAN		10	1604	-		Prostate(55;0.114)	D3DSS3|O15092	Missense_Mutation	SNP	ENST00000358689.4	1	1	hg19	c.1369G>A	CCDS6041.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.132882	0.94517	.	.	ENSG00000197217	ENST00000518471;ENST00000356206;ENST00000358689;ENST00000417069	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	5.59	5.59	0.84812	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.30759	0.0775	L	0.56340	1.77	0.80722	D	1	D;D;D	0.56521	0.976;0.97;0.976	P;P;P	0.61070	0.883;0.857;0.883	T	0.00236	-1.1891	10	0.35671	T	0.21	-17.3279	18.1443	0.89651	0.0:1.0:0.0:0.0	.	449;449;457	Q8NE73;Q9Y227-2;Q9Y227	.;.;ENTP4_HUMAN	T	52;449;457;449	ENSP00000430579:A52T;ENSP00000348536:A449T;ENSP00000351520:A457T;ENSP00000408573:A449T	ENSP00000348536:A449T	A	-	1	0	0	ENTPD4	23350397	23350397	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	7.818000	0.86416	2.631000	0.89168	0.462000	0.41574	GCA	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.483	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	1	0	1	2	2	2	2	0	0	0	0	98	0	98	98	1	1.870000	-20.000000	1	0.440000	NM_004901		0	99	98	0	433	427	1		1	1		0	0	98	0	0	1.000000	9.998515e-01	0	17	0	41	0	99	433
DOCK5	80005	broad.mit.edu	37	8	25193885	25193885	+	Silent	SNP	T	T	C	rs200618924		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr8:25193885T>C	ENST00000276440.7	+	22	2367	c.2323T>C	c.(2323-2325)Ttg>Ctg	p.L775L		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	775					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGTGCTCTACTTGAGGTAATG	0.448													T|||	1	0.000199681	0.0	0.0	5008	,	,		22263	0.001		0.0	False		,,,				2504	0.0				Pancreas(145;34 1887 3271 10937 30165)	ENST00000276440.7	1.000000	0.480000	9.200000e-01	6.100000e-01	0.750000	0.767735	0.750000	1.000000																										0				72						c.(2323-2325)Ttg>Ctg		dedicator of cytokinesis 5							97.0	85.0	89.0					8																	25193885		2203	4300	6503	SO:0001819	synonymous_variant	80005	8	121410	38				g.chr8:25193885T>C		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2323T>C	chr8.hg19:g.25193885T>C		0						p.L775L	NM_024940.6	NP_079216.4	0	0	0	2.039724	Q9H7D0	DOCK5_HUMAN		22	2367	+		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Silent	SNP	ENST00000276440.7	1	1	hg19	c.2323T>C	CCDS6047.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	9.240	1.038124	0.19669	.	.	ENSG00000147459	ENST00000444569	.	.	.	5.76	-4.24	0.03777	5.76	-4.24	0.03777	.	0.000000	0.64402	D	0.000001	T	0.64875	0.2638	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65348	-0.6190	5	.	.	.	.	15.9667	0.79979	0.0:0.7662:0.0:0.2338	.	.	.	.	P	546	.	.	L	+	2	0	0	DOCK5	25249802	25249802	0.795000	0.28851	0.949000	0.38748	0.803000	0.45373	-0.041000	0.12084	-0.567000	0.06046	-0.263000	0.10527	CTT	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.448	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	0	0	1	2	2	2	2	0	0	0	0	30	0	30	30	1	1.870000	-12.972770	1	0.440000	NM_024940		0	19	18	0	94	93	1		1	1		0	0	30	0	0	0.999994	5.841187e-01	0	4	0	7	0	19	94
PAG1	55824	broad.mit.edu	37	8	81888976	81888976	+	Missense_Mutation	SNP	T	T	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr8:81888976T>G	ENST00000220597.4	-	9	1812	c.1102A>C	c.(1102-1104)Act>Cct	p.T368P	PAG1_ENST00000523463.1_5'Flank	NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	368					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CTGTTTGGAGTTTTTTCGAAG	0.512																																						ENST00000220597.4	0.760000	0.380000	6.600000e-01	4.600000e-01	0.550000	0.569510	0.550000	0.550000																										0				11						c.(1102-1104)Act>Cct		phosphoprotein membrane anchor with glycosphingolipid microdomains 1							89.0	88.0	89.0					8																	81888976		2203	4300	6503	SO:0001583	missense	55824	0	0					g.chr8:81888976T>G	AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.1102A>C	chr8.hg19:g.81888976T>G	ENSP00000220597:p.Thr368Pro	1					PAG1_ENST00000523463.1_5'Flank	p.T368P	NM_018440.3	NP_060910.3	1	2	3	2.471346	Q9NWQ8	PHAG1_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)	9	1812	-	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	ENST00000220597.4	1	1	hg19	c.1102A>C	CCDS6227.1	0	.	.	.	.	.	.	.	.	.	.	T	3.651	-0.071468	0.07228	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.05	-2.76	0.05896	5.05	-2.76	0.05896	.	0.702006	0.14361	N	0.324452	T	0.34687	0.0906	L	0.51422	1.61	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.26815	-1.0092	9	0.45353	T	0.12	-1.9998	6.671	0.23068	0.0:0.1378:0.3656:0.4965	.	368	Q9NWQ8	PAG1_HUMAN	P	368	.	ENSP00000220597:T368P	T	-	1	0	0	PAG1	82051531	82051531	0.005000	0.15991	0.027000	0.17364	0.026000	0.11368	0.003000	0.13083	-0.242000	0.09667	-1.106000	0.02097	ACT	0.540984		TCGA-2L-AAQJ-01A-12D-A397-08	0.512	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3	1	0	1	2	2	2	2	0	0	0	0	39	0	39	38	1	1.870000	-11.301750	1	0.440000	NM_018440		0	30	30	0	269	264	0		1	1		0	0	39	0	0	1.000000	1.587105e-01	0	4	0	3	0	30	269
COL14A1	7373	broad.mit.edu	37	8	121160087	121160087	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr8:121160087G>T	ENST00000297848.3	+	2	276	c.6G>T	c.(4-6)aaG>aaT	p.K2N	COL14A1_ENST00000537875.1_Missense_Mutation_p.K2N|COL14A1_ENST00000309791.4_Missense_Mutation_p.K2N|COL14A1_ENST00000247781.3_Missense_Mutation_p.K2N|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ATAAAATGAAGATTTTCCAGC	0.383																																						ENST00000297848.3	1.000000	0.390000	7.100000e-01	4.800000e-01	0.580000	0.601961	0.580000	0.570000																										0				119						c.(4-6)aaG>aaT		collagen, type XIV, alpha 1							95.0	89.0	91.0					8																	121160087		2203	4300	6503	SO:0001583	missense	7373	0	0					g.chr8:121160087G>T		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.6G>T	chr8.hg19:g.121160087G>T	ENSP00000297848:p.Lys2Asn	1					COL14A1_ENST00000537875.1_Missense_Mutation_p.K2N|COL14A1_ENST00000247781.3_Missense_Mutation_p.K2N|COL14A1_ENST00000309791.4_Missense_Mutation_p.K2N|COL14A1_ENST00000432943.2_3'UTR	p.K2N	NM_021110.1	NP_066933.1	1	2	3	2.477001			OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)	2	276	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)			Missense_Mutation	SNP	ENST00000297848.3	1	1	hg19	c.6G>T	CCDS34938.1	0	.	.	.	.	.	.	.	.	.	.	G	11.64	1.697656	0.30142	.	.	ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781	T;D;D;D	0.87966	0.45;-2.14;-2.16;-2.32	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.536026	0.19314	N	0.117330	T	0.78214	0.4248	N	0.14661	0.345	0.26614	N	0.972785	B	0.19583	0.037	B	0.17098	0.017	T	0.64296	-0.6441	10	0.27082	T	0.32	.	15.8249	0.78690	0.0:0.0:1.0:0.0	.	2	Q05707	COEA1_HUMAN	N	2	ENSP00000443974:K2N;ENSP00000311809:K2N;ENSP00000297848:K2N;ENSP00000247781:K2N	ENSP00000247781:K2N	K	+	3	2	2	COL14A1	121229268	121229268	1.000000	0.71417	0.513000	0.27749	0.105000	0.19272	2.807000	0.47955	2.818000	0.97014	0.655000	0.94253	AAG	0.537649		TCGA-2L-AAQJ-01A-12D-A397-08	0.383	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	1	0	1	2	2	2	2	0	0	0	0	43	0	43	43	1	1.870000	-20.000000	1	0.440000	NM_021110		0	26	27	0	223	222	1		1	0		0	0	43	0	0	1.000000	2.523345e-01	0	0	0	9	0	26	223
SH2D3C	10044	broad.mit.edu	37	9	130511512	130511512	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr9:130511512G>A	ENST00000314830.8	-	5	1230	c.1117C>T	c.(1117-1119)Cgc>Tgc	p.R373C	SH2D3C_ENST00000373274.3_Missense_Mutation_p.R213C|SH2D3C_ENST00000420366.1_Missense_Mutation_p.R215C|SH2D3C_ENST00000373276.3_Missense_Mutation_p.R305C|SH2D3C_ENST00000373277.4_Missense_Mutation_p.R216C|SH2D3C_ENST00000429553.1_Missense_Mutation_p.R19C|SH2D3C_ENST00000471939.1_Intron	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	373					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)	p.R373S(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCATCGCTGCGGGTGACCTTG	0.617																																						ENST00000314830.8	0.830000	0.520000	7.500000e-01	5.900000e-01	0.660000	0.676990	0.660000	0.670000																										2	Substitution - Missense(2)	p.R373S(2)	lung(2)	28						c.(1117-1119)Cgc>Tgc		SH2 domain containing 3C							55.0	56.0	56.0					9																	130511512		2203	4300	6503	SO:0001583	missense	10044	0	0					g.chr9:130511512G>A	AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.1117C>T	chr9.hg19:g.130511512G>A	ENSP00000317817:p.Arg373Cys	0					SH2D3C_ENST00000429553.1_Missense_Mutation_p.R19C|SH2D3C_ENST00000471939.1_Intron|SH2D3C_ENST00000373274.3_Missense_Mutation_p.R213C|SH2D3C_ENST00000420366.1_Missense_Mutation_p.R215C|SH2D3C_ENST00000373277.4_Missense_Mutation_p.R216C|SH2D3C_ENST00000373276.3_Missense_Mutation_p.R305C	p.R373C	NM_170600.2	NP_733745.1	0	0	0	2.034520	Q8N5H7	SH2D3_HUMAN		5	1230	-			A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	1	1	hg19	c.1117C>T	CCDS6877.1	0	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986440	0.35036	.	.	ENSG00000095370	ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830;ENST00000414380	T;T;T;T;T;T;T	0.38722	2.55;2.56;2.3;2.56;1.68;2.51;1.12	5.37	3.42	0.39159	5.37	3.42	0.39159	.	0.469026	0.24884	N	0.034822	T	0.33469	0.0864	L	0.51422	1.61	0.47123	D	0.999322	B;B;B;B;B	0.21821	0.007;0.061;0.033;0.007;0.005	B;B;B;B;B	0.14578	0.003;0.011;0.005;0.007;0.004	T	0.15867	-1.0422	10	0.38643	T	0.18	-28.0923	7.986	0.30212	0.0869:0.0:0.6601:0.253	.	213;373;305;216;215	E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.;SH2D3_HUMAN;.;.;.	C	216;215;305;213;19;373;190	ENSP00000362374:R216C;ENSP00000388536:R215C;ENSP00000362373:R305C;ENSP00000362371:R213C;ENSP00000394632:R19C;ENSP00000317817:R373C;ENSP00000413760:R190C	ENSP00000317817:R373C	R	-	1	0	0	SH2D3C	129551333	129551333	1.000000	0.71417	0.993000	0.49108	0.615000	0.37417	2.677000	0.46892	1.413000	0.46997	0.561000	0.74099	CGC	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.617	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	1	0	1	2	2	2	2	0	0	0	0	84	0	84	83	1	1.870000	-2.475894	0	0.440000	NM_005489		0	59	58	0	337	333	1		1	0		0	0	84	0	0	1.000000	9.225326e-01	0	0	0	27	0	59	337
LRRC8A	56262	broad.mit.edu	37	9	131669884	131669884	+	Silent	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr9:131669884G>A	ENST00000259324.5	+	3	964	c.441G>A	c.(439-441)ccG>ccA	p.P147P	LRRC8A_ENST00000372599.3_Silent_p.P147P|LRRC8A_ENST00000372600.4_Silent_p.P147P	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	147					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						TCAAATTCCCGCGCACCAGCT	0.572																																						ENST00000259324.5	1.000000	0.710000	1	8.300000e-01	0.950000	0.929177	0.950000	1.000000																										0				28						c.(439-441)ccG>ccA		leucine rich repeat containing 8 family, member A							74.0	72.0	73.0					9																	131669884		2203	4300	6503	SO:0001819	synonymous_variant	56262	1	121412	31				g.chr9:131669884G>A	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.441G>A	chr9.hg19:g.131669884G>A		0					LRRC8A_ENST00000372600.4_Silent_p.P147P|LRRC8A_ENST00000372599.3_Silent_p.P147P	p.P147P	NM_001127244.1	NP_001120716.1	0	0	0	2.034520	Q8IWT6	LRC8A_HUMAN		3	964	+			Q6UXM2|Q8NCI0|Q9P2B1	Silent	SNP	ENST00000259324.5	1	1	hg19	c.441G>A	CCDS35155.1	1																																																																																								0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.572	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	1	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	1.870000	-3.840315	1	0.440000	NM_019594		0	43	42	0	159	158	1		1	1		0	0	51	0	0	1.000000	1	0	80	0	147	0	43	159
ENTPD2	954	broad.mit.edu	37	9	139944888	139944888	+	Missense_Mutation	SNP	A	A	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chr9:139944888A>T	ENST00000355097.2	-	6	924	c.877T>A	c.(877-879)Ttc>Atc	p.F293I	ENTPD2_ENST00000312665.5_Missense_Mutation_p.F293I|RP11-229P13.15_ENST00000439076.1_RNA|ENTPD2_ENST00000460614.1_5'Flank	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	293					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CTGCTGTTGAAGTTCTGGGGC	0.632											OREG0019627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000355097.2	1.000000	0.740000	1	8.500000e-01	0.990000	0.946237	0.990000	1.000000																										0				12						c.(877-879)Ttc>Atc		ectonucleoside triphosphate diphosphohydrolase 2							54.0	55.0	55.0					9																	139944888		2203	4300	6503	SO:0001583	missense	954	0	0					g.chr9:139944888A>T	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.877T>A	chr9.hg19:g.139944888A>T	ENSP00000347213:p.Phe293Ile	0		OREG0019627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1652	ENTPD2_ENST00000312665.5_Missense_Mutation_p.F293I|RP11-229P13.15_ENST00000439076.1_RNA|ENTPD2_ENST00000460614.1_5'Flank	p.F293I	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	0	0	0	2.034520	Q9Y5L3	ENTP2_HUMAN	STAD - Stomach adenocarcinoma(284;0.123)	6	924	-	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	ENST00000355097.2	1	1	hg19	c.877T>A	CCDS7026.1	1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.267428	0.40095	.	.	ENSG00000054179	ENST00000355097;ENST00000312665	T;T	0.11277	2.8;2.79	4.95	1.35	0.21983	4.95	1.35	0.21983	.	0.427784	0.23684	N	0.045587	T	0.09905	0.0243	L	0.59436	1.845	0.09310	N	1	B;B	0.22541	0.058;0.071	B;B	0.24006	0.03;0.05	T	0.23261	-1.0193	10	0.42905	T	0.14	-9.6179	4.0512	0.09796	0.5803:0.0:0.262:0.1576	.	293;293	Q9Y5L3-2;Q9Y5L3	.;ENTP2_HUMAN	I	293	ENSP00000347213:F293I;ENSP00000312494:F293I	ENSP00000312494:F293I	F	-	1	0	0	ENTPD2	139064709	139064709	0.411000	0.25384	0.155000	0.22561	0.030000	0.12068	0.623000	0.24447	0.244000	0.21351	0.459000	0.35465	TTC	0.435028		TCGA-2L-AAQJ-01A-12D-A397-08	0.632	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055169.1	1	0	1	2	2	2	2	0	0	0	0	35	0	35	35	1	1.870000	-20.000000	1	0.440000	NM_203468		0	40	39	0	141	141	1		1	1		0	0	35	0	0	1.000000	9.999377e-01	0	30	0	26	0	40	141
VSIG1	340547	broad.mit.edu	37	X	107316507	107316507	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:107316507G>A	ENST00000217957.5	+	5	713	c.596G>A	c.(595-597)gGa>gAa	p.G199E	VSIG1_ENST00000415430.3_Missense_Mutation_p.G235E	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	199	Ig-like C2-type 2.					integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						TTGGTCATTGGAAATCTGACA	0.418																																						ENST00000217957.5	0.830000	0.630000	7.800000e-01	6.800000e-01	0.720000	0.736116	0.720000	0.740000																										0				17						c.(595-597)gGa>gAa		V-set and immunoglobulin domain containing 1							231.0	213.0	219.0					X																	107316507		2203	4300	6503	SO:0001583	missense	340547	0	0					g.chrX:107316507G>A	BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.596G>A	chrX.hg19:g.107316507G>A	ENSP00000217957:p.Gly199Glu						VSIG1_ENST00000415430.3_Missense_Mutation_p.G235E	p.G199E	NM_182607.4	NP_872413.1	0	1	1		Q86XK7	VSIG1_HUMAN		5	713	+			C9J4P2|Q6MZS4	Missense_Mutation	SNP	ENST00000217957.5	1	1	hg19	c.596G>A	CCDS14535.1	0	.	.	.	.	.	.	.	.	.	.	G	19.23	3.786560	0.70337	.	.	ENSG00000101842	ENST00000415430;ENST00000217957	T;T	0.11495	2.77;2.77	5.27	4.41	0.53225	5.27	4.41	0.53225	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.207594	0.40908	D	0.000995	T	0.12944	0.0314	N	0.16790	0.44	0.42936	D	0.99433	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.985	T	0.13845	-1.0494	10	0.02654	T	1	.	9.9443	0.41600	0.0969:0.0:0.9031:0.0	.	235;199	C9J4P2;Q86XK7	.;VSIG1_HUMAN	E	235;199	ENSP00000402219:G235E;ENSP00000217957:G199E	ENSP00000217957:G199E	G	+	2	0	0	VSIG1	107203163	107203163	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.976000	0.56867	1.198000	0.43158	0.513000	0.50165	GGA	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.418	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057858.1	1	0	1	2	2	2	2	0	0	0	0	282	0	282	280	1	1.870000	-20.000000	1	0.440000	NM_182607		0	195	193	0	1012	1004	1		1	1		0	0	282	0	0	1.000000	1	0	8	0	425	0	195	1012
ARHGAP36	158763	broad.mit.edu	37	X	130218925	130218925	+	Missense_Mutation	SNP	T	T	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:130218925T>C	ENST00000276211.5	+	7	1187	c.842T>C	c.(841-843)cTg>cCg	p.L281P	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.L269P|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.L145P	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	281	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GATGTAGTGCTGGATGACAAT	0.488																																						ENST00000276211.5	0.900000	0.640000	8.400000e-01	7.000000e-01	0.770000	0.780044	0.770000	0.780000																										0				71						c.(841-843)cTg>cCg		Rho GTPase activating protein 36							197.0	162.0	174.0					X																	130218925		2203	4300	6503	SO:0001583	missense	158763	0	0					g.chrX:130218925T>C		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.842T>C	chrX.hg19:g.130218925T>C	ENSP00000276211:p.Leu281Pro						ARHGAP36_ENST00000370921.1_Missense_Mutation_p.L145P|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.L269P	p.L281P	NM_144967.3	NP_659404.2	0	1	1		Q6ZRI8	RHG36_HUMAN		7	1187	+			B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	1	1	hg19	c.842T>C	CCDS14628.1	0	.	.	.	.	.	.	.	.	.	.	T	23.1	4.378294	0.82682	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.16	5.16	0.70880	5.16	5.16	0.70880	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.187606	0.26397	N	0.024602	T	0.65186	0.2667	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.988;0.987	T	0.68876	-0.5293	10	0.52906	T	0.07	.	10.0987	0.42491	0.0:0.0:0.0:1.0	.	250;269;281	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	P	281;269;250;145	ENSP00000276211:L281P;ENSP00000359960:L269P;ENSP00000408515:L250P;ENSP00000359959:L145P	ENSP00000276211:L281P	L	+	2	0	0	ARHGAP36	130046606	130046606	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.818000	0.75257	1.909000	0.55274	0.356000	0.21956	CTG	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.488	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	1	0	1	2	2	2	2	0	0	0	0	134	0	134	134	1	1.870000	-20.000000	1	0.440000	NM_144967		0	113	113	0	548	547	1		1	0		0	0	134	0	0	1.000000	0	0	0	0	1	0	113	548
NR0B1	190	broad.mit.edu	37	X	30326930	30326930	+	Missense_Mutation	SNP	T	T	G			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:30326930T>G	ENST00000378970.4	-	1	785	c.551A>C	c.(550-552)aAa>aCa	p.K184T	NR0B1_ENST00000453287.1_Missense_Mutation_p.K184T|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	184	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	TAGCGCCTCTTTACCCCCTGG	0.692											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000378970.4	1.000000	0.660000	1	8.500000e-01	0.990000	0.949802	0.990000	1.000000																										0				24						c.(550-552)aAa>aCa		nuclear receptor subfamily 0, group B, member 1	Dexamethasone(DB01234)|Tretinoin(DB00755)						11.0	9.0	10.0					X																	30326930		2189	4273	6462	SO:0001583	missense	190	0	0					g.chrX:30326930T>G	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.551A>C	chrX.hg19:g.30326930T>G	ENSP00000368253:p.Lys184Thr			OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	816	NR0B1_ENST00000453287.1_Missense_Mutation_p.K184T|NR0B1_ENST00000378963.1_5'Flank	p.K184T	NM_000475.4	NP_000466.2	0	1	1		P51843	NR0B1_HUMAN		1	785	-			Q96F69	Missense_Mutation	SNP	ENST00000378970.4	1	1	hg19	c.551A>C	CCDS14223.1	1	.	.	.	.	.	.	.	.	.	.	T	2.662	-0.279477	0.05642	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.97752	-3.63;-4.52	4.32	0.238	0.15480	4.32	0.238	0.15480	.	1.525170	0.04086	N	0.310508	D	0.91597	0.7345	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	D	0.85206	0.1018	10	0.52906	T	0.07	0.6249	4.5457	0.12079	0.0:0.422:0.3572:0.2207	.	184	P51843	NR0B1_HUMAN	T	184	ENSP00000368253:K184T;ENSP00000396403:K184T	ENSP00000368253:K184T	K	-	2	0	0	NR0B1	30236851	30236851	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.356000	0.07661	-0.201000	0.10284	-0.402000	0.06365	AAA	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.692	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	1	0	1	2	2	2	2	0	0	0	0	23	0	23	22	1	1.870000	-20.000000	1	0.440000	NM_000475		0	14	14	0	44	42	1		1			0	0	23	0	0	0.999843	0	0	0	0	0	0	14	44
NR0B1	190	broad.mit.edu	37	X	30327066	30327066	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:30327066G>C	ENST00000378970.4	-	1	649	c.415C>G	c.(415-417)Cac>Gac	p.H139D	NR0B1_ENST00000453287.1_Missense_Mutation_p.H139D|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	139	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	TGCCGCGGGTGGTCTTCACCA	0.692											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000378970.4	1.000000	0.800000	1	9.200000e-01	0.990000	0.972910	0.990000	1.000000																										0				24						c.(415-417)Cac>Gac		nuclear receptor subfamily 0, group B, member 1	Dexamethasone(DB01234)|Tretinoin(DB00755)						22.0	21.0	21.0					X																	30327066		2202	4293	6495	SO:0001583	missense	190	0	0					g.chrX:30327066G>C	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.415C>G	chrX.hg19:g.30327066G>C	ENSP00000368253:p.His139Asp			OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	816	NR0B1_ENST00000453287.1_Missense_Mutation_p.H139D|NR0B1_ENST00000378963.1_5'Flank	p.H139D	NM_000475.4	NP_000466.2	0	1	1		P51843	NR0B1_HUMAN		1	649	-			Q96F69	Missense_Mutation	SNP	ENST00000378970.4	1	1	hg19	c.415C>G	CCDS14223.1	1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507718	0.64410	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.98164	-3.9;-4.76	3.96	3.96	0.45880	3.96	3.96	0.45880	.	0.000000	0.42053	D	0.000762	D	0.98397	0.9467	M	0.66939	2.045	0.40318	D	0.978796	D	0.69078	0.997	D	0.69142	0.962	D	0.99107	1.0845	10	0.87932	D	0	-5.5412	12.706	0.57061	0.0:0.0:1.0:0.0	.	139	P51843	NR0B1_HUMAN	D	139	ENSP00000368253:H139D;ENSP00000396403:H139D	ENSP00000368253:H139D	H	-	1	0	0	NR0B1	30236987	30236987	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	3.474000	0.53129	2.222000	0.72286	0.513000	0.50165	CAC	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.692	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	1	0	1	2	2	2	2	0	0	0	0	41	0	41	39	1	1.870000	-20.000000	1	0.440000	NM_000475		0	42	41	0	137	136	1		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	42	137
FAM47A	158724	broad.mit.edu	37	X	34148936	34148936	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:34148936C>T	ENST00000346193.3	-	1	1511	c.1460G>A	c.(1459-1461)cGg>cAg	p.R487Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	487								p.R487Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACTGGACCTCCGACGTGTCTT	0.642																																						ENST00000346193.3	1.000000	0.730000	1	8.100000e-01	0.900000	0.903808	0.900000	1.000000																										1	Substitution - Missense(1)	p.R487Q(1)	large_intestine(1)	97						c.(1459-1461)cGg>cAg		family with sequence similarity 47, member A							47.0	54.0	51.0					X																	34148936		2192	4286	6478	SO:0001583	missense	158724	0	0					g.chrX:34148936C>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1460G>A	chrX.hg19:g.34148936C>T	ENSP00000345029:p.Arg487Gln							p.R487Q	NM_203408.3	NP_981953.2	0	1	1		Q5JRC9	FA47A_HUMAN		1	1511	-			A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	1	1	hg19	c.1460G>A	CCDS43926.1	1	.	.	.	.	.	.	.	.	.	.	c	9.489	1.100058	0.20552	.	.	ENSG00000185448	ENST00000346193	T	0.16196	2.36	0.446	0.446	0.16602	0.446	0.446	0.16602	.	.	.	.	.	T	0.10380	0.0254	N	0.24115	0.695	0.09310	N	1	D	0.62365	0.991	P	0.44811	0.461	T	0.23762	-1.0179	8	0.13470	T	0.59	.	.	.	.	.	487	Q5JRC9	FA47A_HUMAN	Q	487	ENSP00000345029:R487Q	ENSP00000345029:R487Q	R	-	2	0	0	FAM47A	34058857	34058857	0.022000	0.18835	0.006000	0.13384	0.016000	0.09150	0.010000	0.13242	0.435000	0.26365	0.183000	0.17082	CGG	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.642	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	1	0	1	2	2	2	2	0	0	0	0	85	0	85	82	1	1.870000	-3.239998	1	0.440000	NM_203408		0	76	76	0	304	299	1		1			0	0	85	0	0	1.000000	0	0	0	0	0	0	76	304
MED14	9282	broad.mit.edu	37	X	40526067	40526067	+	Missense_Mutation	SNP	A	A	C			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:40526067A>C	ENST00000324817.1	-	24	3288	c.3170T>G	c.(3169-3171)tTg>tGg	p.L1057W		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1057	Pro-rich.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGGGCTCTCAAAGCCCCACT	0.493																																						ENST00000324817.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999291	0.990000	1.000000																										0				39						c.(3169-3171)tTg>tGg		mediator complex subunit 14							29.0	26.0	27.0					X																	40526067		2201	4290	6491	SO:0001583	missense	9282	0	0					g.chrX:40526067A>C	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.3170T>G	chrX.hg19:g.40526067A>C	ENSP00000323720:p.Leu1057Trp							p.L1057W	NM_004229.3	NP_004220.2	0	1	1		O60244	MED14_HUMAN		24	3288	-			Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	0	1	hg19	c.3170T>G	CCDS14254.1	1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337558	0.81911	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.75155	0.3811	L	0.53249	1.67	0.58432	D	0.999991	D	0.76494	0.999	D	0.77557	0.99	T	0.77587	-0.2532	9	0.72032	D	0.01	.	14.8838	0.70553	1.0:0.0:0.0:0.0	.	1057	O60244	MED14_HUMAN	W	1057	.	ENSP00000323720:L1057W	L	-	2	0	0	MED14	40411011	40411011	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.721000	0.91446	1.896000	0.54893	0.402000	0.26972	TTG	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.493	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	0	0	1	2	2	2	2	0	0	0	0	18	0	18	18	1	1.870000	-20.000000	1	0.440000	NM_004229		0	31	30	0	66	65	0		1	1		0	0	18	0	0	1.000000	9.989050e-01	0	2	0	25	0	31	66
KCND1	3750	broad.mit.edu	37	X	48819916	48819916	+	Missense_Mutation	SNP	C	C	T	rs145016539		TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:48819916C>T	ENST00000218176.3	-	6	3167	c.1870G>A	c.(1870-1872)Ggc>Agc	p.G624S	KCND1_ENST00000376477.1_Missense_Mutation_p.G247S	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	624					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	AGGGTGCTGCCGGCCCTGCCA	0.632																																						ENST00000218176.3	1.000000	0.680000	1	8.300000e-01	0.990000	0.939084	0.990000	1.000000																										0				24						c.(1870-1872)Ggc>Agc		potassium voltage-gated channel, Shal-related subfamily, member 1	Dalfampridine(DB06637)		SER/GLY	3,3832		0,2,1,1630,570	31.0	27.0	28.0		1870	-1.0	0.0	X	dbSNP_134	28	0,6728		0,0,0,2428,1872	no	missense	KCND1	NM_004979.4	56	0,2,1,4058,2442	TT,TC,T,CC,C		0.0,0.0782,0.0284	benign	624/648	48819916	3,10560	2203	4300	6503	SO:0001583	missense	3750	33	121348	41				g.chrX:48819916C>T	AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.1870G>A	chrX.hg19:g.48819916C>T	ENSP00000218176:p.Gly624Ser						KCND1_ENST00000376477.1_Missense_Mutation_p.G247S	p.G624S	NM_004979.4	NP_004970.3	0	1	1		Q9NSA2	KCND1_HUMAN		6	3167	-			A6NEF1|B2RCG0|O75671	Missense_Mutation	SNP	ENST00000218176.3	1	1	hg19	c.1870G>A	CCDS14314.1	1	.	.	.	.	.	.	.	.	.	.	c	1.827	-0.470870	0.04445	7.82E-4	0.0	ENSG00000102057	ENST00000376477;ENST00000218176	D;D	0.95918	-3.34;-3.85	5.32	-0.965	0.10323	5.32	-0.965	0.10323	.	1.211090	0.05587	N	0.573947	D	0.88919	0.6568	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.77501	-0.2564	10	0.02654	T	1	.	3.4758	0.07583	0.197:0.4041:0.0:0.3989	.	624	Q9NSA2	KCND1_HUMAN	S	247;624	ENSP00000365660:G247S;ENSP00000218176:G624S	ENSP00000218176:G624S	G	-	1	0	0	KCND1	48704860	48704860	0.959000	0.32827	0.014000	0.15608	0.107000	0.19398	1.496000	0.35638	0.195000	0.20347	-0.743000	0.03520	GGC	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.632	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	1	0	1	2	2	2	2	0	0	0	0	25	0	25	24	1	1.870000	-20.000000	1	0.440000	NM_004979		0	24	23	0	84	83	1		1	0		0	0	25	0	0	1.000000	4.925881e-01	0	0	0	7	0	24	84
HDX	139324	broad.mit.edu	37	X	83724365	83724365	+	Silent	SNP	T	T	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:83724365T>A	ENST00000297977.5	-	3	477	c.366A>T	c.(364-366)acA>acT	p.T122T	HDX_ENST00000506585.2_Silent_p.T64T|HDX_ENST00000373177.2_Silent_p.T122T	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	122						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TATGTTTGTTTGTTCCTTGCC	0.403																																					Pancreas(53;231 1169 36156 43751 51139)	ENST00000297977.5	0.830000	0.530000	7.600000e-01	6.000000e-01	0.670000	0.683934	0.670000	0.680000																										0				48						c.(364-366)acA>acT		highly divergent homeobox							272.0	225.0	241.0					X																	83724365		2203	4300	6503	SO:0001819	synonymous_variant	139324	0	0					g.chrX:83724365T>A	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.366A>T	chrX.hg19:g.83724365T>A							HDX_ENST00000373177.2_Silent_p.T122T|HDX_ENST00000506585.2_Silent_p.T64T	p.T122T	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	0	1	1		Q7Z353	HDX_HUMAN		3	477	-			A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	ENST00000297977.5	1	1	hg19	c.366A>T	CCDS35342.1	0																																																																																								0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.403	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	1	0	1	2	2	2	2	0	0	0	0	84	0	84	83	1	1.870000	-20.000000	1	0.440000	NM_144657		0	66	66	0	376	373	1		1	0		0	0	84	0	0	1.000000	6.204219e-02	0	0	0	3	0	66	376
ARHGEF6	9459	broad.mit.edu	37	X	135789073	135789073	+	Missense_Mutation	SNP	T	T	A			TCGA-2L-AAQJ-01A-12D-A397-08	TCGA-2L-AAQJ-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de369dbb-736e-4970-998d-a0470029653f	cb472e98-8801-40f4-9c2c-6ebb03b41c40	g.chrX:135789073T>A	ENST00000250617.6	-	9	2245	c.1040A>T	c.(1039-1041)cAg>cTg	p.Q347L	ARHGEF6_ENST00000535227.1_Missense_Mutation_p.Q220L|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.Q193L|ARHGEF6_ENST00000370620.1_Missense_Mutation_p.Q193L	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	347	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					TTACCTGTGCTGAGTGAGCAC	0.408																																						ENST00000250617.6	0.100000	0.010000	8.000000e-02	3.000000e-02	0.040000	0.056928	0.040000	0.050000																										0				38						c.(1039-1041)cAg>cTg		Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6							184.0	166.0	172.0					X																	135789073		2203	4300	6503	SO:0001583	missense	9459	0	0					g.chrX:135789073T>A	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1040A>T	chrX.hg19:g.135789073T>A	ENSP00000250617:p.Gln347Leu						ARHGEF6_ENST00000370620.1_Missense_Mutation_p.Q193L|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.Q220L|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.Q193L	p.Q347L	NM_004840.2	NP_004831.1	0	1	1		Q15052	ARHG6_HUMAN		9	2245	-	Acute lymphoblastic leukemia(192;0.000127)		A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	0	1	hg19	c.1040A>T	CCDS14660.1	0	.	.	.	.	.	.	.	.	.	.	T	17.07	3.295049	0.60086	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.15	5.15	0.70609	5.15	5.15	0.70609	Dbl homology (DH) domain (5);	0.210007	0.49916	D	0.000125	T	0.70718	0.3256	M	0.81802	2.56	0.42510	D	0.992962	P;P	0.43352	0.629;0.804	B;P	0.47346	0.326;0.544	T	0.76280	-0.3017	10	0.72032	D	0.01	.	13.1422	0.59440	0.0:0.0:0.0:1.0	.	220;347	B7Z3C7;Q15052	.;ARHG6_HUMAN	L	347;193;193;193;220	ENSP00000250617:Q347L;ENSP00000359654:Q193L;ENSP00000359656:Q193L;ENSP00000439483:Q220L	ENSP00000250617:Q347L	Q	-	2	0	0	ARHGEF6	135616739	135616739	1.000000	0.71417	0.995000	0.50966	0.557000	0.35523	7.138000	0.77305	1.813000	0.52934	0.486000	0.48141	CAG	0.440000		TCGA-2L-AAQJ-01A-12D-A397-08	0.408	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	0	0	0	2	2	2	2	0	0	0	0	122	0	122	122	1	1.870000	-5.715155	1	0.440000	NM_004840		0	7	5	0	629	624	0		1	0		0	0	122	0	0	0.979906	7.314050e-03	0	0	0	10	0	7	629
