#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ZNF45	7596	broad.mit.edu	37	19	44417694	44417695	+	Frame_Shift_Del	DEL	TT	TT	-	rs577243801		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:44417694_44417695delTT	ENST00000269973.5	-	10	2983_2984	c.1893_1894delAA	c.(1891-1896)caaagafs	p.R632fs	ZNF45_ENST00000589703.1_Frame_Shift_Del_p.R632fs|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	632					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						GTGTGAACTCTTTGATGGGCTT	0.485																																						ENST00000269973.5	0.990000	0.680000	0.910000	0.750000	0.820000	0.834494	0.820000	0.830000																										0				17						c.(1891-1896)caaagafs		zinc finger protein 45																																				SO:0001589	frameshift_variant	7596	0	0					g.chr19:44417694_44417695delTT	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1893_1894delAA	chr19.hg19:g.44417694_44417695delTT	ENSP00000269973:p.Arg632fs	0					RP11-15A1.2_ENST00000586247.1_RNA|ZNF45_ENST00000589703.1_Frame_Shift_Del_p.R632fs	p.R632fs	NM_003425.3	NP_003416.1	1	2	3	2.007661	Q02386	ZNF45_HUMAN		10	2983_2984	-			P17016|P78472|Q9P1U9	Frame_Shift_Del	DEL	ENST00000269973.5	1	0	hg19	c.1893_1894delAA	CCDS12632.1	0																																																																																								0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.485	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	1	0	1		20	2		0	0	0	2	203	0	203	194	1	1.980000	-3.221885	1	0.330000	NM_003425		0	103	115	0	649	650	0	0	1	1	0	0	0	203	0	0	1.000000	6.658681e-01	0	2	0	14	0	103	649
TDP2	51567	broad.mit.edu	37	6	24654677	24654682	+	In_Frame_Del	DEL	GGAAAA	GGAAAA	-			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr6:24654677_24654682delGGAAAA	ENST00000378198.4	-	5	764_769	c.594_599delTTTTCC	c.(592-600)ccttttcca>cca	p.198_200PFP>P	TDP2_ENST00000341060.3_In_Frame_Del_p.140_142PFP>P|TDP2_ENST00000545995.1_In_Frame_Del_p.228_230PFP>P|TDP2_ENST00000478285.1_5'UTR			O95551	TYDP2_HUMAN	tyrosyl-DNA phosphodiesterase 2	198					cell surface receptor signaling pathway (GO:0007166)|double-strand break repair (GO:0006302)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|PML body (GO:0016605)	5'-tyrosyl-DNA phosphodiesterase activity (GO:0070260)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)|tyrosyl-RNA phosphodiesterase activity (GO:0036317)			kidney(2)|large_intestine(1)|lung(5)|ovary(1)	9						TTTGGTACTTGGAAAAGGAATAATCT	0.272								Direct reversal of damage																														ENST00000378198.4	0.680000	0.330000	0.590000	0.400000	0.490000	0.503211	0.490000	0.490000																										0				9						c.(592-600)ccttttcca>cca	Direct reversal of damage	tyrosyl-DNA phosphodiesterase 2																																				SO:0001651	inframe_deletion	51567	0	0					g.chr6:24654677_24654682delGGAAAA	AJ269473	CCDS4557.1	6p22.3-p22.1	2010-05-07	2010-05-07	2010-05-07	ENSG00000111802	ENSG00000111802	3.1.4.-		17768	protein-coding gene	gene with protein product		605764	"""TRAF and TNF receptor associated protein"""	TTRAP		11478795	Standard	NM_016614		Approved		uc003nej.3	O95551	OTTHUMG00000014360	ENST00000378198.4:c.594_599delTTTTCC	chr6.hg19:g.24654677_24654682delGGAAAA	ENSP00000367440:p.Pro198_Phe199del	0					TDP2_ENST00000545995.1_In_Frame_Del_p.228_230PFP>P|TDP2_ENST00000478285.1_5'UTR|TDP2_ENST00000341060.3_In_Frame_Del_p.140_142PFP>P	p.198_200PFP>P			0	0	0	1.961174	O95551	TYDP2_HUMAN		5	764_769	-			B4DKL8|B4DQ95|Q2TBE2|Q5JYM0|Q7Z6U5|Q9NUK5|Q9NYY9	In_Frame_Del	DEL	ENST00000378198.4	1	1	hg19	c.594_599delTTTTCC	CCDS4557.1	0																																																																																								0.314157		TCGA-3A-A9I5-01A-11D-A38G-08	0.272	TDP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000040012.1	1	0	1		15	2		0	0	0	2	140	0	140	139	1	1.980000	-2.716734	1	0.330000			0	28	51	0	309	323	0	0	1	0	0	0	0	140	0	0	0.994756	6.331938e-01	0	1	0	24	0	28	309
MUC17	140453	broad.mit.edu	37	7	100679767	100679767	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr7:100679767delT	ENST00000306151.4	+	3	5134	c.5070delT	c.(5068-5070)actfs	p.T1690fs		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1690	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AAGGAAGAACTCCTTTAACAA	0.473																																						ENST00000306151.4	0.750000	0.550000	0.700000	0.600000	0.640000	0.654506	0.640000	0.650000																										0				343						c.(5068-5070)actfs		mucin 17, cell surface associated							185.0	200.0	195.0					7																	100679767		2203	4300	6503	SO:0001589	frameshift_variant	140453	0	0					g.chr7:100679767delT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5070delT	chr7.hg19:g.100679767delT	ENSP00000302716:p.Thr1690fs	0						p.T1690fs	NM_001040105.1	NP_001035194.1	0	0	0	1.998491	Q685J3	MUC17_HUMAN		3	5134	+	Lung NSC(181;0.136)|all_lung(186;0.182)		O14761|Q685J2|Q8TDH7	Frame_Shift_Del	DEL	ENST00000306151.4	1	0	hg19	c.5070delT	CCDS34711.1	0																																																																																								0.327782		TCGA-3A-A9I5-01A-11D-A38G-08	0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	1	0	1		2			0	0	0	0	402	0	402	389	1	1.980000	-20.000000	1	0.330000	NM_001040105		0	165	204	0	1363	1341	0	0	1		0	0	0	402	0	0	1.000000		0	0	0	0	0	165	1363
MRC1	4360	broad.mit.edu	37	10	17949641	17949641	+	Silent	SNP	A	A	G			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr10:17949641A>G	ENST00000331429.2	+	28	4108	c.4005A>G	c.(4003-4005)ttA>ttG	p.L1335L																	breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GTGTAGCTTTACATGCGTCTT	0.423																																						ENST00000331429.2	1.000000	0.850000	1.000000	0.930000	0.990000	0.975872	0.990000	1.000000																										0				14						c.(4003-4005)ttA>ttG									154.0	162.0	159.0					10																	17949641		2186	4283	6469	SO:0001819	synonymous_variant	0	1	120534	32				g.chr10:17949641A>G																												ENST00000331429.2:c.4005A>G	chr10.hg19:g.17949641A>G		0						p.L1335L			1	2	3	2.006938				28	4108	+				Silent	SNP	ENST00000331429.2	0	1	hg19	c.4005A>G		1																																																																																								0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.423	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1	0	0	1		2	2		0	0	0	0	253	0	253	303	1	1.980000	-20.000000	1	0.330000			0	108	96	0	533	488	0	0	1	0	0	0	0	253	0	0	1.000000	2.877577e-02	0	0	0	2	0	108	533
ZEB1	6935	broad.mit.edu	37	10	31799625	31799625	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr10:31799625T>C	ENST00000320985.10	+	5	616	c.506T>C	c.(505-507)tTa>tCa	p.L169S	ZEB1_ENST00000560721.2_Missense_Mutation_p.L149S|ZEB1_ENST00000446923.2_Missense_Mutation_p.L153S|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Missense_Mutation_p.L102S|ZEB1_ENST00000361642.5_Missense_Mutation_p.L170S			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	169					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TTTTCACAATTACTCACCTGT	0.318																																					Ovarian(40;423 959 14296 36701 49589)	ENST00000320985.10	1.000000	0.920000	1.000000	0.990000	0.990000	0.995863	0.990000	1.000000																										0				77						c.(505-507)tTa>tCa		zinc finger E-box binding homeobox 1							69.0	67.0	68.0					10																	31799625		2202	4300	6502	SO:0001583	missense	6935	0	0					g.chr10:31799625T>C	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.506T>C	chr10.hg19:g.31799625T>C	ENSP00000319248:p.Leu169Ser	0					ZEB1_ENST00000446923.2_Missense_Mutation_p.L153S|ZEB1_ENST00000560721.2_Missense_Mutation_p.L149S|ZEB1_ENST00000361642.5_Missense_Mutation_p.L170S|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Missense_Mutation_p.L102S	p.L169S			1	2	3	2.006938	P37275	ZEB1_HUMAN		5	616	+		Prostate(175;0.0156)	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	1	1	hg19	c.506T>C	CCDS7169.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.4|24.4	4.532407|4.532407	0.85812|0.85812	.|.	.|.	ENSG00000148516|ENSG00000148516	ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000424869;ENST00000446923|ENST00000543514	T;T;T;T;T|.	0.15139|.	2.45;2.52;2.45;2.52;2.5|.	5.83|5.83	5.83|5.83	0.93111|0.93111	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.291763|.	0.23908|.	N|.	0.043369|.	T|T	0.70622|0.70622	0.3245|0.3245	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.999;0.999;0.999;1.0;0.999;0.999|.	D;D;D;D;D;D;D;D|.	0.97110|.	1.0;0.999;0.998;0.998;0.998;0.999;0.998;0.998|.	T|T	0.66143|0.66143	-0.5997|-0.5997	10|6	0.72032|0.18276	D|T	0.01|0.48	-8.4191|-8.4191	16.1952|16.1952	0.82023|0.82023	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	102;169;153;169;169;149;170;169|.	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275|.	.;.;.;.;.;.;.;ZEB1_HUMAN|.	S|H	169;170;169;102;169;149;28;170;153|61	ENSP00000354487:L170S;ENSP00000444891:L102S;ENSP00000319248:L169S;ENSP00000415961:L170S;ENSP00000391612:L153S|.	ENSP00000319248:L169S|ENSP00000443742:Y61H	L|Y	+|+	2|1	0|0	0|0	ZEB1|ZEB1	31839631|31839631	31839631|31839631	1.000000|1.000000	0.71417|0.71417	0.883000|0.883000	0.34634|0.34634	0.979000|0.979000	0.70002|0.70002	7.630000|7.630000	0.83225|0.83225	2.236000|2.236000	0.73375|0.73375	0.482000|0.482000	0.46254|0.46254	TTA|TAC	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.318	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	1	0	1		2	2		0	0	0	0	83	0	83	83	1	1.980000	-20.000000	1	0.330000	NM_030751		0	56	55	0	228	225	1	0	1		0	0	0	83	0	0	1.000000	0	0	0	0	0	0	56	228
ZNF32	7580	broad.mit.edu	37	10	44139613	44139613	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr10:44139613C>T	ENST00000395797.1	-	3	895	c.707G>A	c.(706-708)gGc>gAc	p.G236D	ZNF32_ENST00000485351.1_5'Flank|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32_ENST00000374433.2_Missense_Mutation_p.G236D|ZNF32-AS2_ENST00000418966.1_RNA	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		GTGGATTTTGCCATGCAGAAT	0.532																																						ENST00000395797.1	0.270000	0.030000	0.190000	0.070000	0.110000	0.131939	0.110000	0.110000																										0				14						c.(706-708)gGc>gAc		zinc finger protein 32							89.0	89.0	89.0					10																	44139613		2203	4300	6503	SO:0001583	missense	7580	0	0					g.chr10:44139613C>T	U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.707G>A	chr10.hg19:g.44139613C>T	ENSP00000379143:p.Gly236Asp	0					ZNF32_ENST00000374433.2_Missense_Mutation_p.G236D|ZNF32-AS2_ENST00000418966.1_RNA|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32_ENST00000485351.1_5'Flank	p.G236D	NM_001005368.1	NP_001005368.1	1	2	3	2.006938	P17041	ZNF32_HUMAN		3	895	-		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)	Q92951	Missense_Mutation	SNP	ENST00000395797.1	0	1	hg19	c.707G>A	CCDS7206.1	0	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107138	0.37145	.	.	ENSG00000169740	ENST00000374433;ENST00000395797	T;T	0.07444	3.19;3.19	4.67	4.67	0.58626	4.67	4.67	0.58626	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.135771	0.34411	N	0.003995	T	0.08044	0.0201	L	0.37750	1.13	0.33588	D	0.60073	B	0.15930	0.015	B	0.22880	0.042	T	0.02766	-1.1113	10	0.87932	D	0	-4.6653	8.9989	0.36069	0.0:0.9032:0.0:0.0968	.	236	P17041	ZNF32_HUMAN	D	236	ENSP00000363556:G236D;ENSP00000379143:G236D	ENSP00000363556:G236D	G	-	2	0	0	ZNF32	43459619	43459619	0.000000	0.05858	1.000000	0.80357	0.980000	0.70556	0.715000	0.25822	2.876000	0.98609	0.655000	0.94253	GGC	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.532	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047723.1	0	0	1		10	15		1	0	1	1	88	0	88	88	1	1.980000	-2.983906	1	0.330000	NM_006973		0	4	4	0	222	220	0	0	0	0	0	1	0	88	0	0	0.082426	9.417638e-02	0	0	0	372	0	4	222
ANK3	288	broad.mit.edu	37	10	61831534	61831534	+	Silent	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr10:61831534G>A	ENST00000280772.2	-	37	9296	c.9105C>T	c.(9103-9105)tgC>tgT	p.C3035C	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3035					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CGAGAGGTGGGCATAAACCTA	0.418																																						ENST00000280772.2	0.140000	0.020000	0.100000	0.040000	0.060000	0.074961	0.060000	0.060000																										0				196						c.(9103-9105)tgC>tgT		ankyrin 3, node of Ranvier (ankyrin G)							79.0	87.0	85.0					10																	61831534		2203	4300	6503	SO:0001819	synonymous_variant	288	0	0					g.chr10:61831534G>A	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.9105C>T	chr10.hg19:g.61831534G>A		0					ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	p.C3035C	NM_020987.3	NP_066267.2	1	2	3	2.007897	Q12955	ANK3_HUMAN		37	9296	-			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	0	1	hg19	c.9105C>T	CCDS7258.1	0																																																																																								0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.418	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	0	0	1		2	2		0	0	0	0	165	0	165	155	1	1.980000	-1.787122	0	0.330000	NM_020987		0	6	6	0	557	545	0	0	1		0	0	0	165	0	0	0.962943	0	0	0	0	0	0	6	557
FAT3	120114	broad.mit.edu	37	11	92532244	92532244	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr11:92532244C>A	ENST00000298047.6	+	9	6082	c.6065C>A	c.(6064-6066)cCa>cAa	p.P2022Q	FAT3_ENST00000525166.1_Missense_Mutation_p.P1872Q|FAT3_ENST00000409404.2_Missense_Mutation_p.P2022Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2022	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATCTTAAACCCAGGAAATAAG	0.408										TCGA Ovarian(4;0.039)																												ENST00000298047.6	0.170000	0.020000	0.130000	0.050000	0.080000	0.092812	0.080000	0.080000																										0				85						c.(6064-6066)cCa>cAa		FAT atypical cadherin 3							75.0	75.0	75.0					11																	92532244		1851	4093	5944	SO:0001583	missense	120114	0	0					g.chr11:92532244C>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6065C>A	chr11.hg19:g.92532244C>A	ENSP00000298047:p.Pro2022Gln	1	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Missense_Mutation_p.P1872Q|FAT3_ENST00000409404.2_Missense_Mutation_p.P2022Q	p.P2022Q			0	1	1	2.000205	Q8TDW7	FAT3_HUMAN		9	6082	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	0	1	hg19	c.6065C>A		0	.	.	.	.	.	.	.	.	.	.	C	15.37	2.813099	0.50527	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.49432	0.78;0.78;0.78	5.82	5.82	0.92795	5.82	5.82	0.92795	.	.	.	.	.	T	0.36413	0.0966	L	0.32530	0.975	0.80722	D	1	P	0.35656	0.514	B	0.27715	0.082	T	0.31280	-0.9949	9	0.66056	D	0.02	.	14.8861	0.70570	0.1434:0.8566:0.0:0.0	.	2022	Q8TDW7-3	.	Q	2022;2022;1872	ENSP00000298047:P2022Q;ENSP00000387040:P2022Q;ENSP00000432586:P1872Q	ENSP00000298047:P2022Q	P	+	2	0	0	FAT3	92171892	92171892	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.778000	0.62368	2.760000	0.94817	0.655000	0.94253	CCA	0.197605		TCGA-3A-A9I5-01A-11D-A38G-08	0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2	2		0	0	0	0	93	0	93	91	1	1.980000	-1.922709	0	0.330000	NM_001008781		0	5	5	0	316	311	0	0	1		0	0	0	93	0	0	0.935410	0	0	0	0	0	0	5	316
LRP6	4040	broad.mit.edu	37	12	12284920	12284920	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr12:12284920G>A	ENST00000261349.4	-	18	3881	c.3805C>T	c.(3805-3807)Cgg>Tgg	p.R1269W	LRP6_ENST00000543091.1_Intron|LRP6_ENST00000540415.1_5'UTR|BCL2L14_ENST00000396369.1_Intron	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1269	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CCATCGCACCGCCAAGCCACA	0.483																																						ENST00000261349.4	1.000000	0.040000	0.210000	0.080000	0.130000	0.179539	0.130000	0.120000																										0				85						c.(3805-3807)Cgg>Tgg		low density lipoprotein receptor-related protein 6							94.0	85.0	88.0					12																	12284920		2203	4300	6503	SO:0001583	missense	4040	0	0					g.chr12:12284920G>A	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3805C>T	chr12.hg19:g.12284920G>A	ENSP00000261349:p.Arg1269Trp	0					BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000540415.1_5'UTR|LRP6_ENST00000543091.1_Intron	p.R1269W	NM_002336.2	NP_002327.2	1	2	3	2.036704	O75581	LRP6_HUMAN		18	3881	-		Prostate(47;0.0865)	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	0	1	hg19	c.3805C>T	CCDS8647.1	0	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726908	0.69074	.	.	ENSG00000070018	ENST00000261349	D	0.95980	-3.87	5.92	1.86	0.25419	5.92	1.86	0.25419	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.56097	D	0.000024	D	0.96914	0.8992	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96190	0.9137	10	0.52906	T	0.07	.	15.8612	0.79021	0.0:0.0:0.5352:0.4648	.	1269	O75581	LRP6_HUMAN	W	1269	ENSP00000261349:R1269W	ENSP00000261349:R1269W	R	-	1	2	2	LRP6	12176187	12176187	1.000000	0.71417	0.958000	0.39756	0.805000	0.45488	2.391000	0.44424	0.378000	0.24764	-0.182000	0.12963	CGG	0.336568		TCGA-3A-A9I5-01A-11D-A38G-08	0.483	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1	0	0	1		2	2		0	0	0	0	108	0	108	104	1	1.980000	-2.288066	0	0.330000			0	5	5	0	255	248	0	0	1		0	0	0	108	0	0	0.933561	0	0	0	0	0	0	5	255
IFT88	8100	broad.mit.edu	37	13	21205194	21205194	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr13:21205194A>G	ENST00000319980.6	+	18	1693	c.1366A>G	c.(1366-1368)Aga>Gga	p.R456G	IFT88_ENST00000537103.1_Missense_Mutation_p.R428G|IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000351808.5_Missense_Mutation_p.R447G|IFT88_ENST00000382778.4_Missense_Mutation_p.R456G	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	456					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.R456G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		AAAGGACAGTAGAGTGAAAAG	0.338																																						ENST00000319980.6	1.000000	0.780000	1.000000	0.860000	0.950000	0.938795	0.950000	1.000000																										1	Substitution - Missense(1)	p.R456G(1)	large_intestine(1)	27						c.(1366-1368)Aga>Gga		intraflagellar transport 88							118.0	120.0	119.0					13																	21205194		2203	4300	6503	SO:0001583	missense	8100	0	0					g.chr13:21205194A>G	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1366A>G	chr13.hg19:g.21205194A>G	ENSP00000323580:p.Arg456Gly	0					IFT88_ENST00000382778.4_Missense_Mutation_p.R456G|IFT88_ENST00000351808.5_Missense_Mutation_p.R447G|IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.R428G	p.R456G	NM_175605.3	NP_783195.2	0	0	0	1.997416	Q13099	IFT88_HUMAN		18	1693	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	1	1	hg19	c.1366A>G	CCDS31944.1	1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.254980	0.59321	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.75938	-0.98;0.84;0.84;0.84	5.42	2.75	0.32379	5.42	2.75	0.32379	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.76709	0.4025	M	0.72894	2.215	0.58432	D	0.999998	P;P;B;B	0.44734	0.842;0.756;0.243;0.376	P;B;B;B	0.47645	0.553;0.351;0.09;0.079	T	0.76498	-0.2937	10	0.39692	T	0.17	-17.5293	13.3327	0.60497	0.7395:0.2605:0.0:0.0	.	428;456;254;456	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	G	456;319;447;456;428	ENSP00000372228:R456G;ENSP00000261632:R447G;ENSP00000323580:R456G;ENSP00000437719:R428G	ENSP00000323580:R456G	R	+	1	2	2	IFT88	20103194	20103194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.496000	0.35638	0.849000	0.35215	0.533000	0.62120	AGA	0.327782		TCGA-3A-A9I5-01A-11D-A38G-08	0.338	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	1	0	1		2	2		0	0	0	0	215	0	215	212	1	1.980000	-20.000000	1	0.330000	NM_006531		0	92	91	0	490	483	1	0	1	1	0	0	0	215	0	0	1.000000	7.448150e-01	0	6	0	10	0	92	490
COG6	57511	broad.mit.edu	37	13	40293931	40293931	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr13:40293931C>A	ENST00000455146.3	+	15	1601	c.1551C>A	c.(1549-1551)ttC>ttA	p.F517L	COG6_ENST00000416691.1_Missense_Mutation_p.F517L	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	517					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TATTTGAATTCACTGACAGAC	0.348																																						ENST00000455146.3	0.940000	0.570000	0.850000	0.650000	0.740000	0.756356	0.740000	0.750000																										0				13						c.(1549-1551)ttC>ttA		component of oligomeric golgi complex 6							93.0	88.0	90.0					13																	40293931		2203	4299	6502	SO:0001583	missense	57511	0	0					g.chr13:40293931C>A	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.1551C>A	chr13.hg19:g.40293931C>A	ENSP00000397441:p.Phe517Leu	0					COG6_ENST00000416691.1_Missense_Mutation_p.F517L	p.F517L	NM_020751.2	NP_065802.1	0	0	0	1.997416	Q9Y2V7	COG6_HUMAN		15	1601	+		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	ENST00000455146.3	1	1	hg19	c.1551C>A	CCDS9370.1	0	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534911	0.85812	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000455146	T;T	0.56275	0.47;0.47	5.36	4.5	0.54988	5.36	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.69620	0.3131	M	0.85777	2.775	0.80722	D	1	D;D	0.67145	0.996;0.985	D;P	0.63381	0.914;0.873	T	0.70722	-0.4794	10	0.41790	T	0.15	-31.3845	10.4589	0.44567	0.0:0.8468:0.0:0.1532	.	538;517	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	L	517;548;517	ENSP00000403733:F517L;ENSP00000397441:F517L	ENSP00000255468:F548L	F	+	3	2	2	COG6	39191931	39191931	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.407000	0.34657	2.661000	0.90470	0.655000	0.94253	TTC	0.327782		TCGA-3A-A9I5-01A-11D-A38G-08	0.348	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3	1	0	1		2	2		0	0	0	0	140	0	140	139	1	1.980000	-3.318800	1	0.330000			0	55	55	0	388	385	1	0	1	0	0	0	0	140	0	0	1.000000	2.667516e-01	0	1	0	7	0	55	388
CELF6	60677	broad.mit.edu	37	15	72611989	72611989	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr15:72611989G>A	ENST00000569547.1	-	1	298	c.227C>T	c.(226-228)aCg>aTg	p.T76M	RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000539635.1_De_novo_Start_OutOfFrame|CELF6_ENST00000287202.5_Missense_Mutation_p.T76M|CELF6_ENST00000567083.1_Missense_Mutation_p.T76M			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	76	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						CTTCAGCACCGTCAGCTCGTA	0.672																																						ENST00000569547.1	1.000000	0.180000	0.930000	0.340000	0.590000	0.621114	0.590000	1.000000																										0				13						c.(226-228)aCg>aTg		CUGBP, Elav-like family member 6							26.0	20.0	22.0					15																	72611989		2196	4290	6486	SO:0001583	missense	60677	0	0					g.chr15:72611989G>A	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.227C>T	chr15.hg19:g.72611989G>A	ENSP00000454749:p.Thr76Met	0					RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000567083.1_Missense_Mutation_p.T76M|CELF6_ENST00000539635.1_De_novo_Start_OutOfFrame|CELF6_ENST00000287202.5_Missense_Mutation_p.T76M	p.T76M			0	0	0	1.994058	Q96J87	CELF6_HUMAN		1	298	-			B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	ENST00000569547.1	0	1	hg19	c.227C>T	CCDS10242.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140441	0.77775	.	.	ENSG00000140488	ENST00000287202;ENST00000437872	T	0.16597	2.33	4.76	4.76	0.60689	4.76	4.76	0.60689	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.45361	U	0.000362	T	0.36936	0.0985	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.15093	-1.0449	10	0.87932	D	0	-12.5926	16.3333	0.83050	0.0:0.0:1.0:0.0	.	76;76	B4DJB6;Q96J87	.;CELF6_HUMAN	M	76	ENSP00000287202:T76M	ENSP00000287202:T76M	T	-	2	0	0	CELF6	70399043	70399043	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.551000	0.82182	2.182000	0.69389	0.563000	0.77884	ACG	0.325549		TCGA-3A-A9I5-01A-11D-A38G-08	0.672	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	0	0	1		2	2		0	0	0	0	19	0	19	18	1	1.980000	-8.631695	1	0.330000	NM_052840		0	3	3	0	30	30	0	0	1	0	0	0	0	19	0	0	0.812722	4.247104e-02	0	0	0	3	0	3	30
PTX4	390667	broad.mit.edu	37	16	1537593	1537593	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr16:1537593G>A	ENST00000447419.2	-	2	545	c.520C>T	c.(520-522)Cgg>Tgg	p.R174W	PTX4_ENST00000440447.2_Intron|PTX4_ENST00000293922.1_Missense_Mutation_p.R169W			Q96A99	PTX4_HUMAN	pentraxin 4, long	174						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						ACGGGCAGCCGCCCCTCCAGA	0.721																																						ENST00000447419.2	1.000000	0.390000	0.990000	0.570000	0.770000	0.770777	0.770000	1.000000																										0				17						c.(520-522)Cgg>Tgg		pentraxin 4, long							11.0	13.0	12.0					16																	1537593		2163	4220	6383	SO:0001583	missense	390667	2	119952	27				g.chr16:1537593G>A		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.520C>T	chr16.hg19:g.1537593G>A	ENSP00000445277:p.Arg174Trp	1					PTX4_ENST00000293922.1_Missense_Mutation_p.R169W|PTX4_ENST00000440447.2_Intron	p.R174W			0	1	1	1.771659	Q96A99	PTX4_HUMAN		2	545	-				Missense_Mutation	SNP	ENST00000447419.2	1	1	hg19	c.520C>T		0	.	.	.	.	.	.	.	.	.	.	G	9.721	1.159636	0.21454	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.05996	3.52;3.36	5.28	0.783	0.18572	5.28	0.783	0.18572	.	2.155680	0.01935	N	0.041519	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.39165	-0.9627	10	0.42905	T	0.14	.	6.0711	0.19889	0.2607:0.0:0.608:0.1313	.	169	Q96A99-2	.	W	174;169	ENSP00000445277:R174W;ENSP00000293922:R169W	ENSP00000293922:R169W	R	-	1	2	2	PTX4	1477594	1477594	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.388000	0.20735	-0.209000	0.10156	-2.067000	0.00394	CGG	0.219205		TCGA-3A-A9I5-01A-11D-A38G-08	0.721	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	1	0	1		2	2		0	0	0	0	36	0	36	36	1	1.980000	-15.988350	1	0.330000	NM_001013658		0	8	8	0	42	41	0	0	1		0	0	0	36	0	0	0.990650	0	0	0	0	0	0	8	42
PKD1	5310	broad.mit.edu	37	16	2150516	2150516	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr16:2150516C>T	ENST00000262304.4	-	27	9657	c.9449G>A	c.(9448-9450)gGc>gAc	p.G3150D	PKD1_ENST00000423118.1_Missense_Mutation_p.G3150D	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3150	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTGCCGGTGGCCGCTCCGGCT	0.672																																						ENST00000262304.4	0.380000	0.060000	0.280000	0.110000	0.180000	0.200493	0.180000	0.160000																										0				72						c.(9448-9450)gGc>gAc		polycystic kidney disease 1 (autosomal dominant)							30.0	29.0	29.0					16																	2150516		2194	4286	6480	SO:0001583	missense	5310	0	0					g.chr16:2150516C>T	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.9449G>A	chr16.hg19:g.2150516C>T	ENSP00000262304:p.Gly3150Asp	1					PKD1_ENST00000423118.1_Missense_Mutation_p.G3150D	p.G3150D	NM_001009944.2	NP_001009944	0	1	1	1.771659	P98161	PKD1_HUMAN		27	9657	-			Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	0	1	hg19	c.9449G>A	CCDS32369.1	0	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579605	0.86645	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.66280	-0.2;-0.2	4.49	4.49	0.54785	4.49	4.49	0.54785	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.054327	0.64402	D	0.000001	T	0.77356	0.4118	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75374	-0.3340	10	0.28530	T	0.3	.	17.3723	0.87382	0.0:1.0:0.0:0.0	.	3150;3150	P98161-3;P98161	.;PKD1_HUMAN	D	3150;3150;2485	ENSP00000262304:G3150D;ENSP00000399501:G3150D	ENSP00000262304:G3150D	G	-	2	0	0	PKD1	2090517	2090517	1.000000	0.71417	0.996000	0.52242	0.760000	0.43138	7.193000	0.77780	2.326000	0.78906	0.555000	0.69702	GGC	0.219205		TCGA-3A-A9I5-01A-11D-A38G-08	0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1	0	0	0		2	2		0	0	0	0	64	0	64	66	1	1.980000	-6.577764	1	0.330000			0	4	3	0	120	94	0	0	1	0	0	0	0	64	0	0	0.823319	1.044746e-02	0	0	0	4	0	4	120
CPNE2	221184	broad.mit.edu	37	16	57157386	57157386	+	Splice_Site	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr16:57157386G>A	ENST00000535318.2	+	11	1288		c.e11+1		CPNE2_ENST00000565874.1_Splice_Site|CPNE2_ENST00000290776.8_Splice_Site|CPNE2_ENST00000537605.1_Splice_Site			Q96FN4	CPNE2_HUMAN	copine II							extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				CATGTTCACCGTAAGGCTCTC	0.577																																						ENST00000535318.2	0.240000	0.030000	0.170000	0.060000	0.110000	0.122624	0.110000	0.100000																										0				21						c.e11+1		copine II							114.0	96.0	102.0					16																	57157386		2198	4300	6498	SO:0001630	splice_region_variant	221184	0	0					g.chr16:57157386G>A		CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.927+1G>A	chr16.hg19:g.57157386G>A		0					CPNE2_ENST00000290776.8_Splice_Site|CPNE2_ENST00000537605.1_Splice_Site|CPNE2_ENST00000565874.1_Splice_Site				1	2	3	2.009631	Q96FN4	CPNE2_HUMAN		11	1288	+		all_neural(199;0.224)	Q68D19|Q719H8|Q86XP9	Splice_Site	SNP	ENST00000535318.2	0	1	hg19		CCDS10774.1	0	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493625	0.64186	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	.	.	.	4.97	4.97	0.65823	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6008	0.91247	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	CPNE2	55714887	55714887	1.000000	0.71417	0.998000	0.56505	0.670000	0.39368	9.789000	0.99068	2.456000	0.83038	0.561000	0.74099	.	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.577	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	0	0	1		2	2		0	0	0	0	74	0	74	71	1	1.980000	-2.557646	1	0.330000	NM_152727	Intron	0	5	5	0	288	282	0	0	1		0	0	0	74	0	0	0.934616	0	0	0	0	0	0	5	288
FOXC2	2303	broad.mit.edu	37	16	86602198	86602198	+	Silent	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr16:86602198G>A	ENST00000320354.4	+	1	1342	c.1257G>A	c.(1255-1257)gcG>gcA	p.A419A	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	419					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						ccgccgcggcGCAGGCGGCCT	0.756									Late-onset Hereditary Lymphedema																													ENST00000320354.4	1.000000	0.510000	1.000000	0.710000	0.950000	0.883112	0.950000	1.000000																										0				15						c.(1255-1257)gcG>gcA		forkhead box C2 (MFH-1, mesenchyme forkhead 1)							7.0	9.0	8.0					16																	86602198		2059	4069	6128	SO:0001819	synonymous_variant	2303	0	0		Late-onset Hereditary Lymphedema	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	g.chr16:86602198G>A	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.1257G>A	chr16.hg19:g.86602198G>A		0					RP11-463O9.5_ENST00000563280.1_RNA	p.A419A	NM_005251.2	NP_005242.1	1	2	3	2.009631	Q99958	FOXC2_HUMAN		1	1342	+			C6KMR9|Q14DA6	Silent	SNP	ENST00000320354.4	1	1	hg19	c.1257G>A	CCDS10958.1	1																																																																																								0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.756	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	1	0	1		2	2		0	0	0	0	38	0	38	35	1	1.980000	-19.036180	1	0.330000	NM_005251		0	10	8	0	54	50	0	0	1	0	0	0	0	38	0	0	0.996111	0	0	0	0	1	0	10	54
GSG2	83903	broad.mit.edu	37	17	3629075	3629075	+	Nonsense_Mutation	SNP	C	C	T	rs143259437	byFrequency	TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr17:3629075C>T	ENST00000325418.4	+	1	1865	c.1846C>T	c.(1846-1848)Cga>Tga	p.R616*	ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	616	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										AGAGCAAATGCGAACCAAGTT	0.493																																						ENST00000325418.4	1.000000	0.610000	0.890000	0.690000	0.780000	0.792388	0.780000	0.780000																										0										c.(1846-1848)Cga>Tga		germ cell associated 2 (haspin)							104.0	101.0	102.0					17																	3629075		2203	4300	6503	SO:0001587	stop_gained	83903	60	121410	51				g.chr17:3629075C>T	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1846C>T	chr17.hg19:g.3629075C>T	ENSP00000325290:p.Arg616*	0					ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	p.R616*	NM_031965.2	NP_114171.2	1	2	3	2.015237	Q8TF76	HASP_HUMAN		1	1865	+			Q5U5K3|Q96MN1|Q9BXS7	Nonsense_Mutation	SNP	ENST00000325418.4	0	1	hg19	c.1846C>T	CCDS11036.1	0	.	.	.	.	.	.	.	.	.	.	c	17.44	3.389675	0.61956	.	.	ENSG00000177602	ENST00000325418	.	.	.	4.7	2.4	0.29515	4.7	2.4	0.29515	.	0.312616	0.27956	N	0.017167	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-35.8234	10.2856	0.43564	0.6793:0.3207:0.0:0.0	.	.	.	.	X	616	.	ENSP00000325290:R616X	R	+	1	2	2	GSG2	3575824	3575824	0.759000	0.28416	0.406000	0.26421	0.044000	0.14063	1.353000	0.34045	0.349000	0.23975	-0.259000	0.10710	CGA	0.332204		TCGA-3A-A9I5-01A-11D-A38G-08	0.493	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	0	0	1		2	2		0	0	0	0	265	0	265	263	1	1.980000	-3.221879	1	0.330000	NM_031965		0	63	63	0	425	417	1	0	1	0	0	0	0	265	0	0	1.000000	1.729083e-02	0	1	0	1	0	63	425
KCNH4	23415	broad.mit.edu	37	17	40318480	40318480	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr17:40318480C>A	ENST00000264661.3	-	10	2007	c.1675G>T	c.(1675-1677)Gca>Tca	p.A559S	KCNH4_ENST00000607371.1_Missense_Mutation_p.A559S	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	559					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTGCTCGCTGCCCCGAACAAC	0.622																																					NSCLC(117;707 1703 2300 21308 31858)	ENST00000264661.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				32						c.(1675-1677)Gca>Tca		potassium voltage-gated channel, subfamily H (eag-related), member 4							43.0	37.0	39.0					17																	40318480		2203	4299	6502	SO:0001583	missense	23415	0	0					g.chr17:40318480C>A	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1675G>T	chr17.hg19:g.40318480C>A	ENSP00000264661:p.Ala559Ser	1					KCNH4_ENST00000607371.1_Missense_Mutation_p.A559S	p.A559S	NM_012285.2	NP_036417.1	1	2	3	2.298072	Q9UQ05	KCNH4_HUMAN		10	2007	-		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		Missense_Mutation	SNP	ENST00000264661.3	1	1	hg19	c.1675G>T	CCDS11420.1	1	.	.	.	.	.	.	.	.	.	.	C	9.884	1.202261	0.22121	.	.	ENSG00000089558	ENST00000264661	D	0.96459	-4.02	4.2	4.2	0.49525	4.2	4.2	0.49525	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.39341	N	0.001385	D	0.85340	0.5674	N	0.03000	-0.44	0.39245	D	0.963924	B	0.14438	0.01	B	0.20184	0.028	T	0.79408	-0.1816	10	0.07325	T	0.83	.	4.9932	0.14226	0.0:0.7295:0.0:0.2705	.	559	Q9UQ05	KCNH4_HUMAN	S	559	ENSP00000264661:A559S	ENSP00000264661:A559S	A	-	1	0	0	KCNH4	37572006	37572006	0.174000	0.23070	0.998000	0.56505	0.556000	0.35491	0.088000	0.14979	2.182000	0.69389	0.563000	0.77884	GCA	0.417467		TCGA-3A-A9I5-01A-11D-A38G-08	0.622	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	1	0	1		2	2		0	0	0	0	89	0	89	86	1	1.980000	-20.000000	1	0.330000	NM_012285		0	79	76	0	171	166	1	0	1		0	0	0	89	0	0	1.000000	0	0	0	0	0	0	79	171
SPNS2	124976	broad.mit.edu	37	17	4436651	4436651	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr17:4436651C>T	ENST00000329078.3	+	8	1412	c.1202C>T	c.(1201-1203)gCc>gTc	p.A401V		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	401					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						CTGGTGTGTGCCGTGGGCATG	0.642																																						ENST00000329078.3	0.350000	0.040000	0.230000	0.080000	0.140000	0.168205	0.140000	0.130000																										0				6						c.(1201-1203)gCc>gTc		spinster homolog 2 (Drosophila)							43.0	43.0	43.0					17																	4436651		1568	3582	5150	SO:0001583	missense	124976	0	0					g.chr17:4436651C>T	BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1202C>T	chr17.hg19:g.4436651C>T	ENSP00000333292:p.Ala401Val	0						p.A401V	NM_001124758.1	NP_001118230.1	1	2	3	2.015237	Q8IVW8	SPNS2_HUMAN		8	1412	+			B9A1T3	Missense_Mutation	SNP	ENST00000329078.3	0	1	hg19	c.1202C>T	CCDS42237.1	0	.	.	.	.	.	.	.	.	.	.	c	35	5.572813	0.96553	.	.	ENSG00000183018	ENST00000329078	T	0.58652	0.32	4.72	4.72	0.59763	4.72	4.72	0.59763	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.77280	0.4107	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81536	-0.0888	10	0.87932	D	0	.	16.2505	0.82481	0.0:1.0:0.0:0.0	.	401	Q8IVW8	SPNS2_HUMAN	V	401	ENSP00000333292:A401V	ENSP00000333292:A401V	A	+	2	0	0	SPNS2	4383400	4383400	1.000000	0.71417	0.956000	0.39512	0.972000	0.66771	7.815000	0.86186	2.161000	0.67846	0.486000	0.48141	GCC	0.332204		TCGA-3A-A9I5-01A-11D-A38G-08	0.642	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438802.1	0	0	1		2	2		0	0	0	0	78	0	78	78	1	1.980000	-3.544469	1	0.330000			0	4	4	0	182	178	0	0	1	0	0	0	0	78	0	0	0.886093	6.502030e-02	0	0	0	15	0	4	182
SPNS2	124976	broad.mit.edu	37	17	4439661	4439661	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr17:4439661G>A	ENST00000329078.3	+	11	1757	c.1547G>A	c.(1546-1548)gGc>gAc	p.G516D		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	516					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						GTCCTGGGCGGCATGTTCTTC	0.667																																						ENST00000329078.3	0.270000	0.050000	0.190000	0.080000	0.130000	0.148596	0.130000	0.120000																										0				6						c.(1546-1548)gGc>gAc		spinster homolog 2 (Drosophila)							99.0	82.0	87.0					17																	4439661		1568	3582	5150	SO:0001583	missense	124976	0	0					g.chr17:4439661G>A	BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1547G>A	chr17.hg19:g.4439661G>A	ENSP00000333292:p.Gly516Asp	0						p.G516D	NM_001124758.1	NP_001118230.1	1	2	3	2.015237	Q8IVW8	SPNS2_HUMAN		11	1757	+			B9A1T3	Missense_Mutation	SNP	ENST00000329078.3	0	1	hg19	c.1547G>A	CCDS42237.1	0	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027900	0.93518	.	.	ENSG00000183018	ENST00000329078	T	0.60040	0.22	4.82	4.82	0.62117	4.82	4.82	0.62117	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.84846	2.72	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	T	0.82255	-0.0548	10	0.87932	D	0	.	16.6284	0.84993	0.0:0.0:1.0:0.0	.	516	Q8IVW8	SPNS2_HUMAN	D	516	ENSP00000333292:G516D	ENSP00000333292:G516D	G	+	2	0	0	SPNS2	4386410	4386410	1.000000	0.71417	0.998000	0.56505	0.647000	0.38526	7.685000	0.84117	2.504000	0.84457	0.563000	0.77884	GGC	0.332204		TCGA-3A-A9I5-01A-11D-A38G-08	0.667	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438802.1	0	0	1		2	2		0	0	0	0	156	0	156	155	1	1.980000	-2.832811	1	0.330000			0	7	7	0	336	332	0	0	1	0	0	0	0	156	0	0	0.980263	2.224059e-01	0	0	0	38	0	7	336
CCDC43	124808	broad.mit.edu	37	17	42757964	42757964	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr17:42757964C>T	ENST00000315286.8	-	4	484	c.476G>A	c.(475-477)gGt>gAt	p.G159D	C17orf104_ENST00000588805.1_Intron|CCDC43_ENST00000588210.1_Missense_Mutation_p.G162D|CCDC43_ENST00000457422.2_Intron	NM_144609.2	NP_653210.2	Q96MW1	CCD43_HUMAN	coiled-coil domain containing 43	159										lung(2)	2		Prostate(33;0.0322)				TTTGTCAGAACCAATGTTCAT	0.433																																						ENST00000315286.8	1.000000	0.020000	0.140000	0.050000	0.080000	0.157738	0.080000	0.090000																										0				2						c.(475-477)gGt>gAt		coiled-coil domain containing 43							193.0	190.0	191.0					17																	42757964		1950	4161	6111	SO:0001583	missense	124808	0	0					g.chr17:42757964C>T	AK056357	CCDS45704.1, CCDS45705.1	17q21.31	2005-12-16							26472	protein-coding gene	gene with protein product						12477932	Standard	NM_001099225		Approved	FLJ31795	uc002ihc.2	Q96MW1		ENST00000315286.8:c.476G>A	chr17.hg19:g.42757964C>T	ENSP00000323782:p.Gly159Asp	1					CCDC43_ENST00000457422.2_Intron|CCDC43_ENST00000588210.1_Missense_Mutation_p.G162D|C17orf104_ENST00000588805.1_Intron	p.G159D	NM_144609.2	NP_653210.2	1	2	3	2.298072	Q96MW1	CCD43_HUMAN		4	484	-		Prostate(33;0.0322)	C9JVK9	Missense_Mutation	SNP	ENST00000315286.8	0	1	hg19	c.476G>A	CCDS45704.1	0	.	.	.	.	.	.	.	.	.	.	C	17.56	3.418900	0.62622	.	.	ENSG00000180329	ENST00000315286	.	.	.	6.06	6.06	0.98353	6.06	6.06	0.98353	.	0.509221	0.21926	N	0.067089	T	0.57080	0.2029	L	0.41710	1.295	0.39483	D	0.967924	B	0.18610	0.029	B	0.13407	0.009	T	0.51325	-0.8720	9	0.42905	T	0.14	-9.135	18.4128	0.90558	0.0:1.0:0.0:0.0	.	159	Q96MW1	CCD43_HUMAN	D	159	.	ENSP00000323782:G159D	G	-	2	0	0	CCDC43	40113490	40113490	0.314000	0.24563	0.994000	0.49952	0.936000	0.57629	1.807000	0.38902	2.880000	0.98712	0.650000	0.86243	GGT	0.417467		TCGA-3A-A9I5-01A-11D-A38G-08	0.433	CCDC43-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457812.1	0	0	1		2	2		0	0	0	0	212	0	212	207	1	1.980000	-3.075015	1	0.330000	NM_144609		0	6	6	0	523	512	0	0	1	0	0	0	0	212	0	0	0.962592	2.274641e-02	0	0	0	17	0	6	523
RYR1	6261	broad.mit.edu	37	19	38976333	38976333	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:38976333G>A	ENST00000359596.3	+	34	5038	c.5038G>A	c.(5038-5040)Gtg>Atg	p.V1680M	RYR1_ENST00000360985.3_Missense_Mutation_p.V1680M|RYR1_ENST00000355481.4_Missense_Mutation_p.V1680M			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1680	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CAACAATCGCGTGGCGCACGC	0.672																																						ENST00000359596.3	1.000000	0.870000	1.000000	0.990000	0.990000	0.989987	0.990000	1.000000																										0				285						c.(5038-5040)Gtg>Atg		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						47.0	46.0	47.0					19																	38976333		2203	4298	6501	SO:0001583	missense	6261	0	0					g.chr19:38976333G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5038G>A	chr19.hg19:g.38976333G>A	ENSP00000352608:p.Val1680Met	0					RYR1_ENST00000360985.3_Missense_Mutation_p.V1680M|RYR1_ENST00000355481.4_Missense_Mutation_p.V1680M	p.V1680M			0	1	1	2.002295	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	34	5038	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	1	1	hg19	c.5038G>A	CCDS33011.1	1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731538	0.69189	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98150	-4.75;-4.75;-4.75	4.07	4.07	0.47477	4.07	4.07	0.47477	.	0.190439	0.31872	U	0.006936	D	0.98642	0.9545	M	0.83603	2.65	0.47153	D	0.999332	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99758	1.1020	10	0.87932	D	0	.	16.0625	0.80847	0.0:0.0:1.0:0.0	.	1680;1680	P21817-2;P21817	.;RYR1_HUMAN	M	1680	ENSP00000352608:V1680M;ENSP00000347667:V1680M;ENSP00000354254:V1680M	ENSP00000347667:V1680M	V	+	1	0	0	RYR1	43668173	43668173	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.556000	0.98127	2.096000	0.63516	0.650000	0.86243	GTG	0.328893		TCGA-3A-A9I5-01A-11D-A38G-08	0.672	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	1	0	1		2	2		0	0	0	0	173	0	173	172	1	1.980000	-20.000000	1	0.330000			0	58	57	0	253	246	1	0	1		0	0	0	173	0	0	1.000000	0	0	0	0	0	0	58	253
RYR1	6261	broad.mit.edu	37	19	39008205	39008205	+	Missense_Mutation	SNP	G	G	A	rs544339193		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:39008205G>A	ENST00000359596.3	+	66	9892	c.9892G>A	c.(9892-9894)Gcc>Acc	p.A3298T	RYR1_ENST00000360985.3_Missense_Mutation_p.A3298T|RYR1_ENST00000355481.4_Missense_Mutation_p.A3298T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3298					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGCCCTGCCCGCCGGCGCCCC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		11651	0.0		0.0	False		,,,				2504	0.001					ENST00000359596.3	0.420000	0.060000	0.310000	0.120000	0.190000	0.219086	0.190000	0.180000																										0				285						c.(9892-9894)Gcc>Acc		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						30.0	28.0	29.0					19																	39008205		2201	4299	6500	SO:0001583	missense	6261	12	121396	40				g.chr19:39008205G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.9892G>A	chr19.hg19:g.39008205G>A	ENSP00000352608:p.Ala3298Thr	0					RYR1_ENST00000360985.3_Missense_Mutation_p.A3298T|RYR1_ENST00000355481.4_Missense_Mutation_p.A3298T	p.A3298T			0	1	1	2.002295	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	66	9892	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	0	1	hg19	c.9892G>A	CCDS33011.1	0	.	.	.	.	.	.	.	.	.	.	G	4.453	0.083940	0.08583	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96554	-4.05;-4.05;-4.05	3.6	2.39	0.29439	3.6	2.39	0.29439	.	0.186063	0.32868	U	0.005550	D	0.92107	0.7498	L	0.51422	1.61	0.24955	N	0.991763	P;B;B	0.36660	0.564;0.411;0.147	B;B;B	0.27262	0.078;0.054;0.007	D	0.84408	0.0564	10	0.22109	T	0.4	.	13.1533	0.59503	0.0:0.2423:0.7577:0.0	.	3298;3298;3298	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	T	3298;3298;3298;218	ENSP00000352608:A3298T;ENSP00000347667:A3298T;ENSP00000354254:A3298T	ENSP00000347667:A3298T	A	+	1	0	0	RYR1	43700045	43700045	0.680000	0.27605	0.892000	0.35008	0.030000	0.12068	2.996000	0.49449	1.567000	0.49668	0.205000	0.17691	GCC	0.328893		TCGA-3A-A9I5-01A-11D-A38G-08	0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	0	0	1		2	2		0	0	0	0	102	0	102	99	1	1.980000	-3.526471	1	0.330000			0	4	4	0	130	127	0	0	1		0	0	0	102	0	0	0.884364	0	0	0	0	0	0	4	130
MEGF8	1954	broad.mit.edu	37	19	42860499	42860499	+	Missense_Mutation	SNP	C	C	T	rs142361779	byFrequency	TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:42860499C>T	ENST00000251268.6	+	26	4516	c.4516C>T	c.(4516-4518)Cgc>Tgc	p.R1506C	MEGF8_ENST00000334370.4_Missense_Mutation_p.R1439C	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1506					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CACTGCCAGCCGCTTCCTGCA	0.652																																						ENST00000251268.6	1.000000	0.550000	1.000000	0.710000	0.910000	0.876204	0.910000	1.000000																										0				50						c.(4516-4518)Cgc>Tgc		multiple EGF-like-domains 8		C	CYS/ARG	2,4404	2.1+/-5.4	0,2,2201	42.0	36.0	38.0		4315	5.0	1.0	19	dbSNP_134	38	1,8599	1.2+/-3.3	0,1,4299	no	missense	MEGF8	NM_001410.2	180	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	1439/2779	42860499	3,13003	2203	4300	6503	SO:0001583	missense	1954	7	121402	36				g.chr19:42860499C>T	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4516C>T	chr19.hg19:g.42860499C>T	ENSP00000251268:p.Arg1506Cys	0					MEGF8_ENST00000334370.4_Missense_Mutation_p.R1439C	p.R1506C	NM_001271938.1	NP_001258867.1	1	2	3	2.007661	Q7Z7M0	MEGF8_HUMAN		26	4516	+		Prostate(69;0.00682)	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	1	1	hg19	c.4516C>T		1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770638	0.69992	4.54E-4	1.16E-4	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.66460	-0.21;-0.21	5.02	5.02	0.67125	5.02	5.02	0.67125	Galactose oxidase/kelch, beta-propeller (1);	0.000000	0.64402	D	0.000002	T	0.76535	0.4001	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.967	T	0.79037	-0.1967	10	0.72032	D	0.01	-31.8929	17.1145	0.86685	0.0:1.0:0.0:0.0	.	1506;1439	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	C	1439;1506	ENSP00000334219:R1439C;ENSP00000251268:R1506C	ENSP00000251268:R1506C	R	+	1	0	0	MEGF8	47552339	47552339	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	4.395000	0.59678	2.345000	0.79718	0.557000	0.71058	CGC	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	1	0	1		2	2		0	0	0	0	37	0	37	37	1	1.980000	-19.999990	1	0.330000	NM_001410		0	15	14	0	85	82	1	0	1	0	0	0	0	37	0	0	0.999885	6.870799e-02	0	0	0	3	0	15	85
PRR12	57479	broad.mit.edu	37	19	50101153	50101153	+	Silent	SNP	C	C	T	rs561427502		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:50101153C>T	ENST00000418929.2	+	4	3573	c.3561C>T	c.(3559-3561)ccC>ccT	p.P1187P		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CTGCGGGGCCCGCCTCGGCCT	0.766																																						ENST00000418929.2	1.000000	0.320000	1.000000	0.610000	0.990000	0.854021	0.990000	1.000000																										0				11						c.(3559-3561)ccC>ccT		proline rich 12							2.0	2.0	2.0					19																	50101153		991	2594	3585	SO:0001819	synonymous_variant	57479	0	0					g.chr19:50101153C>T	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.3561C>T	chr19.hg19:g.50101153C>T		0						p.P1187P	NM_020719.1	NP_065770.1	1	2	3	2.007661	Q9ULL5	PRR12_HUMAN		4	3573	+		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)	E9PB06|Q8N4J6	Silent	SNP	ENST00000418929.2	0	1	hg19	c.3561C>T	CCDS46143.1	1																																																																																								0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.766	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	0	0	1		2	2		0	0	0	0	16	0	16	11	1	1.980000	-10.656440	1	0.330000	NM_020719		0	3	3	0	15	14	0	0	1	0	0	0	0	16	0	0	0.794372	1.168831e-01	0	0	0	3	0	3	15
KLK15	55554	broad.mit.edu	37	19	51330227	51330227	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:51330227G>A	ENST00000598239.1	-	3	418	c.388C>T	c.(388-390)Cgt>Tgt	p.R130C	KLK15_ENST00000596931.1_Missense_Mutation_p.R129C|KLK15_ENST00000416184.1_Intron|KLK15_ENST00000326856.4_Missense_Mutation_p.R129C|KLK15_ENST00000301421.2_Missense_Mutation_p.R130C	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	130	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		TGGGGGCAACGCGTGGGTAGC	0.711																																					Pancreas(140;10 2513 7143 9246)	ENST00000598239.1	1.000000	0.870000	1.000000	0.990000	0.990000	0.990298	0.990000	1.000000																										0				24						c.(388-390)Cgt>Tgt		kallikrein-related peptidase 15							31.0	33.0	33.0					19																	51330227		2201	4297	6498	SO:0001583	missense	55554	0	0					g.chr19:51330227G>A	AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.388C>T	chr19.hg19:g.51330227G>A	ENSP00000469315:p.Arg130Cys	0					KLK15_ENST00000596931.1_Missense_Mutation_p.R129C|KLK15_ENST00000416184.1_Intron|KLK15_ENST00000326856.4_Missense_Mutation_p.R129C|KLK15_ENST00000301421.2_Missense_Mutation_p.R130C	p.R130C	NM_017509.2	NP_059979.2	1	2	3	2.007661	Q9H2R5	KLK15_HUMAN		3	418	-		all_neural(266;0.057)	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	ENST00000598239.1	1	1	hg19	c.388C>T	CCDS12805.1	1	.	.	.	.	.	.	.	.	.	.	g	14.99	2.699087	0.48307	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.88975	-2.45	4.39	4.39	0.52855	4.39	4.39	0.52855	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.444898	0.19247	N	0.119028	D	0.91945	0.7449	M	0.64997	1.995	0.09310	N	0.999999	D;P;D	0.89917	1.0;0.732;0.999	P;B;D	0.64877	0.892;0.167;0.93	D	0.84679	0.0716	10	0.72032	D	0.01	.	10.6517	0.45653	0.0:0.1948:0.8052:0.0	.	130;129;130	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	C	130	ENSP00000301421:R130C	ENSP00000301421:R130C	R	-	1	0	0	KLK15	56022039	56022039	0.000000	0.05858	0.063000	0.19743	0.016000	0.09150	-0.260000	0.08708	2.454000	0.82982	0.555000	0.69702	CGT	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.711	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465160.1	1	0	1		2	2		0	0	0	0	116	0	116	113	1	1.980000	-20.000000	1	0.330000	NM_017509		0	47	45	0	200	196	1	0	1		0	0	0	116	0	0	1.000000	0	0	0	0	0	0	47	200
ZNF274	10782	broad.mit.edu	37	19	58718233	58718233	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr19:58718233G>T	ENST00000326804.4	+	5	862	c.403G>T	c.(403-405)Gat>Tat	p.D135Y	ZNF274_ENST00000345813.3_Missense_Mutation_p.D103Y|ZNF274_ENST00000424679.2_Missense_Mutation_p.D30Y|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		ATATGCTGAAGATGGAAGCCT	0.597																																						ENST00000326804.4	1.000000	0.790000	1.000000	0.970000	0.990000	0.980621	0.990000	1.000000																										0				21						c.(403-405)Gat>Tat		zinc finger protein 274							35.0	40.0	38.0					19																	58718233		2073	4209	6282	SO:0001583	missense	10782	0	0					g.chr19:58718233G>T	AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.403G>T	chr19.hg19:g.58718233G>T	ENSP00000321209:p.Asp135Tyr	0					ZNF274_ENST00000424679.2_Missense_Mutation_p.D30Y|ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000345813.3_Missense_Mutation_p.D103Y	p.D135Y	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	1	2	3	2.044746	Q96GC6	ZN274_HUMAN		5	862	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	ENST00000326804.4	1	1	hg19	c.403G>T		1	.	.	.	.	.	.	.	.	.	.	G	9.784	1.176193	0.21704	.	.	ENSG00000171606	ENST00000326804;ENST00000345813;ENST00000424679	T;T;T	0.08193	3.19;3.12;3.16	3.45	-1.9	0.07665	3.45	-1.9	0.07665	.	1.323810	0.05424	N	0.544714	T	0.18635	0.0447	L	0.51422	1.61	0.09310	N	1	D;D;P	0.76494	0.987;0.999;0.94	P;D;P	0.63703	0.663;0.917;0.462	T	0.30995	-0.9959	10	0.87932	D	0	-0.3588	6.8146	0.23822	0.5997:0.0:0.4003:0.0	.	30;103;135	Q96GC6-3;Q96GC6-2;Q96GC6	.;.;ZN274_HUMAN	Y	135;103;30	ENSP00000321209:D135Y;ENSP00000321187:D103Y;ENSP00000409872:D30Y	ENSP00000321209:D135Y	D	+	1	0	0	ZNF274	63410045	63410045	0.076000	0.21285	0.001000	0.08648	0.215000	0.24574	0.215000	0.17562	-0.267000	0.09325	0.462000	0.41574	GAT	0.337650		TCGA-3A-A9I5-01A-11D-A38G-08	0.597	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1		2	2		0	0	0	0	41	0	41	41	1	1.980000	-20.000000	1	0.330000	NM_133502		0	22	22	0	92	91	1	0	1	0	0	0	0	41	0	0	0.999999	1.807444e-01	0	0	0	4	0	22	92
GJA5	2702	broad.mit.edu	37	1	147230999	147230999	+	Missense_Mutation	SNP	C	C	G	rs150168016		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr1:147230999C>G	ENST00000271348.2	-	2	509	c.348G>C	c.(346-348)gaG>gaC	p.E116D	GJA5_ENST00000369237.1_Missense_Mutation_p.E116D|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	116					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			AGCCCCGGACCTCTTTGGCCC	0.622																																						ENST00000271348.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				20						c.(346-348)gaG>gaC		gap junction protein, alpha 5, 40kDa							70.0	69.0	69.0					1																	147230999		2203	4300	6503	SO:0001583	missense	2702	0	0					g.chr1:147230999C>G		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.348G>C	chr1.hg19:g.147230999C>G	ENSP00000271348:p.Glu116Asp	1					GJA5_ENST00000369237.1_Missense_Mutation_p.E116D|RP11-433J22.2_ENST00000428911.1_RNA	p.E116D	NM_005266.5	NP_005257.2	1	3	4	2.591576	P36382	CXA5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.202)	2	509	-	all_hematologic(923;0.0276)		Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	1	1	hg19	c.348G>C	CCDS929.1	1	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.432319	0.01108	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.97752	-4.46;-4.46;-4.52	5.47	2.17	0.27698	5.47	2.17	0.27698	.	0.857393	0.10119	N	0.713656	D	0.86339	0.5909	N	0.16478	0.41	0.09310	N	0.999997	B	0.15141	0.012	B	0.17979	0.02	T	0.79694	-0.1696	10	0.14656	T	0.56	.	6.9223	0.24395	0.2411:0.5858:0.106:0.0671	.	116	P36382	CXA5_HUMAN	D	116	ENSP00000271348:E116D;ENSP00000358240:E116D;ENSP00000407645:E116D	ENSP00000271348:E116D	E	-	3	2	2	GJA5	145697623	145697623	0.363000	0.24989	0.121000	0.21740	0.021000	0.10359	0.607000	0.24209	0.660000	0.30964	-0.309000	0.09137	GAG	0.496241		TCGA-3A-A9I5-01A-11D-A38G-08	0.622	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	1	0	1		2	2		0	0	0	0	122	0	122	120	1	1.980000	-2.841725	1	0.330000	NM_181703		0	114	114	0	302	294	1	0	1	0	0	0	0	122	0	0	1.000000	6.898578e-01	0	0	0	8	0	114	302
SNX27	81609	broad.mit.edu	37	1	151611414	151611414	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr1:151611414T>C	ENST00000458013.2	+	2	482	c.362T>C	c.(361-363)aTt>aCt	p.I121T	SNX27_ENST00000368838.1_Missense_Mutation_p.I28T|SNX27_ENST00000368843.3_Missense_Mutation_p.I121T			Q96L92	SNX27_HUMAN	sorting nexin family member 27	121	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GTGGACCTGATTCGAGCAGGC	0.483																																					Colon(46;291 966 40145 41237 41888)	ENST00000458013.2	1.000000	0.610000	1.000000	0.730000	0.860000	0.864276	0.860000	1.000000																										0				5						c.(361-363)aTt>aCt		sorting nexin family member 27							138.0	119.0	125.0					1																	151611414		2203	4300	6503	SO:0001583	missense	81609	0	0					g.chr1:151611414T>C	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.362T>C	chr1.hg19:g.151611414T>C	ENSP00000400333:p.Ile121Thr	1					SNX27_ENST00000368843.3_Missense_Mutation_p.I121T|SNX27_ENST00000368838.1_Missense_Mutation_p.I28T	p.I121T			1	3	4	2.591576	Q96L92	SNX27_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)	2	482	+	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	1	1	hg19	c.362T>C		1	.	.	.	.	.	.	.	.	.	.	T	19.79	3.892752	0.72524	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.56103	0.48;0.48;0.48	4.13	4.13	0.48395	4.13	4.13	0.48395	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.58409	0.2120	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.63773	-0.6561	10	0.72032	D	0.01	.	12.3924	0.55366	0.0:0.0:0.0:1.0	.	121;121	Q96L92;Q96L92-3	SNX27_HUMAN;.	T	121;121;28	ENSP00000400333:I121T;ENSP00000357836:I121T;ENSP00000357831:I28T	ENSP00000357831:I28T	I	+	2	0	0	SNX27	149878038	149878038	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.460000	0.80816	1.862000	0.54008	0.482000	0.46254	ATT	0.496241		TCGA-3A-A9I5-01A-11D-A38G-08	0.483	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	1	0	1		2	2		0	0	0	0	103	0	103	101	1	1.980000	-13.516450	1	0.330000	NM_030918		0	34	33	0	283	277	1	0	1	0	0	0	0	103	0	0	1.000000	1.234326e-02	0	0	0	2	0	34	283
FAM129A	116496	broad.mit.edu	37	1	184764871	184764871	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr1:184764871A>T	ENST00000367511.3	-	14	2220	c.2027T>A	c.(2026-2028)cTc>cAc	p.L676H	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	676					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TGTGCCCGGGAGTCCTGCTGT	0.582																																						ENST00000367511.3	1.000000	0.680000	1.000000	0.810000	0.960000	0.924742	0.960000	1.000000																										0				45						c.(2026-2028)cTc>cAc		family with sequence similarity 129, member A							65.0	56.0	59.0					1																	184764871		2203	4300	6503	SO:0001583	missense	116496	0	0					g.chr1:184764871A>T	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2027T>A	chr1.hg19:g.184764871A>T	ENSP00000356481:p.Leu676His	1					FAM129A_ENST00000487074.1_5'UTR	p.L676H	NM_052966.2	NP_443198.1	1	3	4	2.628533	Q9BZQ8	NIBAN_HUMAN		14	2220	-			Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	1	1	hg19	c.2027T>A	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795937	0.31777	.	.	ENSG00000135842	ENST00000367511	T	0.10005	2.92	5.17	2.64	0.31445	5.17	2.64	0.31445	.	0.972905	0.08410	N	0.950059	T	0.06234	0.0161	N	0.08118	0	0.09310	N	1	P	0.45827	0.867	B	0.41202	0.35	T	0.32214	-0.9915	10	0.41790	T	0.15	0.0338	7.1356	0.25527	0.209:0.1395:0.6516:0.0	.	676	Q9BZQ8	NIBAN_HUMAN	H	676	ENSP00000356481:L676H	ENSP00000356481:L676H	L	-	2	0	0	FAM129A	183031494	183031494	0.000000	0.05858	0.003000	0.11579	0.060000	0.15804	0.365000	0.20348	0.960000	0.38005	0.402000	0.26972	CTC	0.494988		TCGA-3A-A9I5-01A-11D-A38G-08	0.582	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1	1	0	1		2	2		0	0	0	0	85	0	85	80	1	1.980000	-13.283360	1	0.330000			0	32	31	0	236	226	1	0	1	0	0	0	0	85	0	0	1.000000	0	0	0	0	1	0	32	236
HMCN1	83872	broad.mit.edu	37	1	186086639	186086639	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr1:186086639A>T	ENST00000271588.4	+	77	11961	c.11732A>T	c.(11731-11733)cAt>cTt	p.H3911L	HMCN1_ENST00000367492.2_Missense_Mutation_p.H3911L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3911	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTAACCAAACATGCCCCAGCA	0.438																																						ENST00000271588.4	0.160000	0.010000	0.110000	0.030000	0.070000	0.077366	0.070000	0.080000																										0				308						c.(11731-11733)cAt>cTt		hemicentin 1							98.0	94.0	95.0					1																	186086639		2203	4300	6503	SO:0001583	missense	83872	0	0					g.chr1:186086639A>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11732A>T	chr1.hg19:g.186086639A>T	ENSP00000271588:p.His3911Leu	1					HMCN1_ENST00000367492.2_Missense_Mutation_p.H3911L	p.H3911L	NM_031935.2	NP_114141.2	1	3	4	2.628533	Q96RW7	HMCN1_HUMAN		77	11961	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	0	1	hg19	c.11732A>T	CCDS30956.1	0	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.476078	0.01035	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66815	-0.23;-0.23	5.65	0.272	0.15645	5.65	0.272	0.15645	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.499501	0.22254	N	0.062503	T	0.33469	0.0864	N	0.02736	-0.51	0.19945	N	0.999942	B	0.32753	0.383	B	0.34038	0.174	T	0.23013	-1.0200	10	0.23302	T	0.38	.	4.2131	0.10521	0.3639:0.0:0.305:0.3311	.	3911	Q96RW7	HMCN1_HUMAN	L	3911	ENSP00000271588:H3911L;ENSP00000356462:H3911L	ENSP00000271588:H3911L	H	+	2	0	0	HMCN1	184353262	184353262	0.139000	0.22563	0.011000	0.14972	0.269000	0.26545	1.675000	0.37555	0.088000	0.17205	0.533000	0.62120	CAT	0.494988		TCGA-3A-A9I5-01A-11D-A38G-08	0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	0	0	0		2	2		0	0	0	0	125	0	125	123	1	1.980000	-4.628285	1	0.330000	NM_031935		0	5	5	0	608	596	0	0	1		0	0	0	125	0	0	0.934468	0	0	0	0	0	0	5	608
CACNA1S	779	broad.mit.edu	37	1	201079298	201079298	+	Silent	SNP	G	G	A	rs112868209	byFrequency	TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr1:201079298G>A	ENST00000362061.3	-	2	478	c.252C>T	c.(250-252)ctC>ctT	p.L84L	CACNA1S_ENST00000367338.3_Silent_p.L84L	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	84					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTACCAGGCCGAGGTTCAGAG	0.607													G|||	37	0.00738818	0.0272	0.0014	5008	,	,		21644	0.0		0.0	False		,,,				2504	0.0					ENST00000362061.3	1.000000	0.690000	1.000000	0.820000	0.970000	0.930179	0.970000	1.000000																										0				102						c.(250-252)ctC>ctT		calcium channel, voltage-dependent, L type, alpha 1S subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	G		71,4335	64.7+/-102.0	2,67,2134	170.0	133.0	145.0		252	-9.7	0.7	1	dbSNP_132	145	0,8600		0,0,4300	no	coding-synonymous	CACNA1S	NM_000069.2		2,67,6434	AA,AG,GG		0.0,1.6114,0.5459		84/1874	201079298	71,12935	2203	4300	6503	SO:0001819	synonymous_variant	779	208	121412	56				g.chr1:201079298G>A	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.252C>T	chr1.hg19:g.201079298G>A		1					CACNA1S_ENST00000367338.3_Silent_p.L84L	p.L84L	NM_000069.2	NP_000060.2	1	3	4	2.645065	Q13698	CAC1S_HUMAN		2	478	-			A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	1	0	hg19	c.252C>T	CCDS1407.1	1																																																																																								0.494988		TCGA-3A-A9I5-01A-11D-A38G-08	0.607	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	1	0	1		2	2		0	0	0	0	87	0	87	86	1	1.980000	-2.774700	1	0.330000	NM_000069		0	35	35	0	256	250	1	0	1		0	0	0	87	0	0	1.000000	0	0	0	0	0	0	35	256
PTPN14	5784	broad.mit.edu	37	1	214557519	214557519	+	Missense_Mutation	SNP	T	T	G			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr1:214557519T>G	ENST00000366956.5	-	13	1873	c.1679A>C	c.(1678-1680)aAg>aCg	p.K560T	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	560					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GAGATAGTTCTTAAGCATGTG	0.652																																					Colon(92;557 1424 24372 34121 40073)	ENST00000366956.5	0.260000	0.040000	0.190000	0.070000	0.120000	0.137982	0.120000	0.120000																										0				58						c.(1678-1680)aAg>aCg		protein tyrosine phosphatase, non-receptor type 14							63.0	64.0	63.0					1																	214557519		2203	4300	6503	SO:0001583	missense	5784	0	0					g.chr1:214557519T>G	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1679A>C	chr1.hg19:g.214557519T>G	ENSP00000355923:p.Lys560Thr	1					PTPN14_ENST00000543945.1_3'UTR	p.K560T	NM_005401.4	NP_005392.2	1	3	4	2.645065	Q15678	PTN14_HUMAN		13	1873	-			Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	0	1	hg19	c.1679A>C	CCDS1514.1	0	.	.	.	.	.	.	.	.	.	.	T	16.31	3.086987	0.55861	.	.	ENSG00000152104	ENST00000366956	T	0.71341	-0.56	5.61	3.29	0.37713	5.61	3.29	0.37713	.	0.095764	0.64402	D	0.000001	T	0.65523	0.2699	M	0.61703	1.905	0.80722	D	1	B	0.31383	0.321	B	0.31614	0.133	T	0.62383	-0.6866	10	0.52906	T	0.07	.	9.8328	0.40952	0.0:0.1389:0.0:0.8611	.	560	Q15678	PTN14_HUMAN	T	560	ENSP00000355923:K560T	ENSP00000355923:K560T	K	-	2	0	0	PTPN14	212624142	212624142	0.995000	0.38212	1.000000	0.80357	0.985000	0.73830	2.671000	0.46842	0.502000	0.28037	0.528000	0.53228	AAG	0.494988		TCGA-3A-A9I5-01A-11D-A38G-08	0.652	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	0	0	1		2	2		0	0	0	0	135	0	135	123	1	1.980000	-6.452759	1	0.330000	NM_005401		0	6	6	0	399	392	0	0	1		0	0	0	135	0	0	0.963317	0	0	0	0	0	0	6	399
TSHZ2	128553	broad.mit.edu	37	20	51872260	51872260	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr20:51872260C>T	ENST00000371497.5	+	2	3150	c.2263C>T	c.(2263-2265)Cgc>Tgc	p.R755C	TSHZ2_ENST00000329613.6_Missense_Mutation_p.R752C|TSHZ2_ENST00000603338.2_Missense_Mutation_p.R752C|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	755					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CGTGTCCAGGCGCTACCTGTT	0.512																																						ENST00000371497.5	1.000000	0.810000	1.000000	0.920000	0.990000	0.973289	0.990000	1.000000																										0				84						c.(2263-2265)Cgc>Tgc		teashirt zinc finger homeobox 2							93.0	90.0	91.0					20																	51872260		2203	4300	6503	SO:0001583	missense	128553	1	121410	41				g.chr20:51872260C>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2263C>T	chr20.hg19:g.51872260C>T	ENSP00000360552:p.Arg755Cys	0					TSHZ2_ENST00000603338.2_Missense_Mutation_p.R752C|TSHZ2_ENST00000329613.6_Missense_Mutation_p.R752C|RP4-678D15.1_ENST00000606932.1_RNA	p.R755C	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	1	2	3	2.013415	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)	2	3150	+			B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	1	1	hg19	c.2263C>T	CCDS33490.1	1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992826	0.35131	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.50277	0.75;0.75	5.23	5.23	0.72850	5.23	5.23	0.72850	.	0.475787	0.23196	N	0.050846	T	0.43144	0.1234	M	0.68317	2.08	0.34997	D	0.755567	P	0.49358	0.923	B	0.34452	0.183	T	0.65709	-0.6102	10	0.87932	D	0	-5.9641	13.7395	0.62838	0.1538:0.8461:0.0:0.0	.	755	Q9NRE2	TSH2_HUMAN	C	755;752;281	ENSP00000360552:R755C;ENSP00000333114:R752C	ENSP00000333114:R752C	R	+	1	0	0	TSHZ2	51305667	51305667	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.499000	0.53310	2.438000	0.82558	0.579000	0.79373	CGC	0.332204		TCGA-3A-A9I5-01A-11D-A38G-08	0.512	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	1	0	1		2	2		0	0	0	0	135	0	135	130	1	1.980000	-20.000000	1	0.330000	NM_173485		0	60	58	0	289	281	1	0	1	0	0	0	0	135	0	0	1.000000	0	0	0	0	1	0	60	289
SON	6651	broad.mit.edu	37	21	34925616	34925616	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr21:34925616T>C	ENST00000356577.4	+	3	4554	c.4079T>C	c.(4078-4080)cTg>cCg	p.L1360P	SON_ENST00000290239.6_Missense_Mutation_p.L1360P|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.L1360P|SON_ENST00000300278.4_Missense_Mutation_p.L1360P	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1360	4 X 8 AA tandem repeats of V-L-E-SS- [AVT]-VT.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						ATGGCTGTCCTGGAGTCTTCG	0.572																																						ENST00000356577.4	1.000000	0.570000	0.920000	0.670000	0.790000	0.798399	0.790000	1.000000																										0				72						c.(4078-4080)cTg>cCg		SON DNA binding protein							48.0	42.0	44.0					21																	34925616		2203	4300	6503	SO:0001583	missense	6651	3	119922	34				g.chr21:34925616T>C	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4079T>C	chr21.hg19:g.34925616T>C	ENSP00000348984:p.Leu1360Pro	0					SON_ENST00000290239.6_Missense_Mutation_p.L1360P|SON_ENST00000381679.4_Missense_Mutation_p.L1360P|SON_ENST00000300278.4_Missense_Mutation_p.L1360P|SON_ENST00000381692.2_Intron	p.L1360P	NM_138927.1	NP_620305	1	2	3	2.011505	P18583	SON_HUMAN		3	4554	+			D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	0	0	hg19	c.4079T>C	CCDS13629.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.596|8.596	0.885735|0.885735	0.17540|0.17540	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679|ENST00000436227	T;T;T;T|.	0.10477|.	3.06;3.06;3.05;2.87|.	5.3|5.3	-0.528|-0.528	0.11905|0.11905	5.3|5.3	-0.528|-0.528	0.11905|0.11905	.|.	0.923213|.	0.09101|.	N|.	0.848564|.	T|T	0.20373|0.20373	0.0490|0.0490	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	0.999999|0.999999	B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B|.	0.04013|.	0.001;0.0;0.001;0.0;0.001|.	T|T	0.27806|0.27806	-1.0063|-1.0063	10|5	0.02654|.	T|.	1|.	.|.	5.0629|5.0629	0.14566|0.14566	0.4286:0.4019:0.0:0.1695|0.4286:0.4019:0.0:0.1695	.|.	1360;1360;1041;1360;1360|.	P18583-10;P18583;P18583-2;P18583-3;P18583-6|.	.;SON_HUMAN;.;.;.|.	P|R	1360|355	ENSP00000348984:L1360P;ENSP00000290239:L1360P;ENSP00000300278:L1360P;ENSP00000371095:L1360P|.	ENSP00000290239:L1360P|.	L|W	+|+	2|1	0|0	0|0	SON|SON	33847486|33847486	33847486|33847486	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.055000|0.055000	0.15305|0.15305	0.101000|0.101000	0.15251|0.15251	0.009000|0.009000	0.14813|0.14813	-0.231000|-0.231000	0.12243|0.12243	CTG|TGG	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.572	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	1	0	0		2	2		0	0	0	0	131	0	131	128	1	1.980000	-20.000000	1	0.330000	NM_138927		0	36	43	0	240	227	1	0	1	0	0	0	0	131	0	0	1.000000	1.858741e-01	0	1	0	5	0	36	240
SON	6651	broad.mit.edu	37	21	34925626	34925626	+	Silent	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr21:34925626G>A	ENST00000356577.4	+	3	4564	c.4089G>A	c.(4087-4089)tcG>tcA	p.S1363S	SON_ENST00000290239.6_Silent_p.S1363S|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Silent_p.S1363S|SON_ENST00000300278.4_Silent_p.S1363S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1363	4 X 8 AA tandem repeats of V-L-E-SS- [AVT]-VT.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TGGAGTCTTCGGCTGTGACCG	0.582																																						ENST00000356577.4	1.000000	0.660000	1.000000	0.770000	0.900000	0.890716	0.900000	1.000000																										0				72						c.(4087-4089)tcG>tcA		SON DNA binding protein							54.0	47.0	49.0					21																	34925626		2203	4300	6503	SO:0001819	synonymous_variant	6651	0	0					g.chr21:34925626G>A	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4089G>A	chr21.hg19:g.34925626G>A		0					SON_ENST00000290239.6_Silent_p.S1363S|SON_ENST00000381679.4_Silent_p.S1363S|SON_ENST00000300278.4_Silent_p.S1363S|SON_ENST00000381692.2_Intron	p.S1363S	NM_138927.1	NP_620305	1	2	3	2.011505	P18583	SON_HUMAN		3	4564	+			D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	1	0	hg19	c.4089G>A	CCDS13629.1	1	.	.	.	.	.	.	.	.	.	.	G	4.547	0.101635	0.08731	.	.	ENSG00000159140	ENST00000436227	.	.	.	5.08	-5.66	0.02451	5.08	-5.66	0.02451	.	.	.	.	.	T	0.19046	0.0457	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.31280	-0.9949	4	.	.	.	.	4.4732	0.11722	0.413:0.0:0.3013:0.2857	.	.	.	.	Q	358	.	.	R	+	2	0	0	SON	33847496	33847496	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	-0.373000	0.07494	-0.705000	0.05035	-0.351000	0.07748	CGG	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.582	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	1	0	0		2	2		0	0	0	0	139	0	139	135	1	1.980000	-2.304577	0	0.330000	NM_138927		0	41	44	0	235	225	1	0	1	1	0	0	0	139	0	0	1.000000	5.521144e-01	0	2	0	10	0	41	235
CACNA1I	8911	broad.mit.edu	37	22	40075258	40075258	+	Silent	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr22:40075258C>T	ENST00000402142.3	+	32	5202	c.5202C>T	c.(5200-5202)gaC>gaT	p.D1734D	CACNA1I_ENST00000336649.4_Silent_p.D1740D|CACNA1I_ENST00000401624.1_Silent_p.D1734D|CACNA1I_ENST00000407673.1_Silent_p.D1699D|CACNA1I_ENST00000400164.3_Silent_p.D1699D|CACNA1I_ENST00000404898.1_Silent_p.D1699D	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1734					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	AGCACCTGGACGACAGCAACA	0.642																																						ENST00000402142.3	1.000000	0.580000	1.000000	0.810000	0.990000	0.935063	0.990000	1.000000																										0				60						c.(5200-5202)gaC>gaT		calcium channel, voltage-dependent, T type, alpha 1I subunit	Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)						27.0	31.0	30.0					22																	40075258		2168	4250	6418	SO:0001819	synonymous_variant	8911	6	119886	29				g.chr22:40075258C>T	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5202C>T	chr22.hg19:g.40075258C>T		0					CACNA1I_ENST00000400164.3_Silent_p.D1699D|CACNA1I_ENST00000404898.1_Silent_p.D1699D|CACNA1I_ENST00000401624.1_Silent_p.D1734D|CACNA1I_ENST00000336649.4_Silent_p.D1740D|CACNA1I_ENST00000407673.1_Silent_p.D1699D	p.D1734D	NM_021096.3	NP_066919.2	1	2	3	2.007387	Q9P0X4	CAC1I_HUMAN		32	5202	+	Melanoma(58;0.0749)		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	1	1	hg19	c.5202C>T	CCDS46710.1	1																																																																																								0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	1	0	1		2	2		0	0	0	0	32	0	32	32	1	1.980000	-17.926420	1	0.330000	NM_001003406		0	9	9	0	40	38	1	0	1		0	0	0	32	0	0	0.994771	0	0	0	0	0	0	9	40
SCUBE1	80274	broad.mit.edu	37	22	43625113	43625113	+	Missense_Mutation	SNP	C	C	T	rs201101225		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr22:43625113C>T	ENST00000360835.4	-	9	1175	c.1049G>A	c.(1048-1050)cGc>cAc	p.R350H		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	350	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				GATGTAGCCGCGGTGACACAG	0.677											OREG0026614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17295	0.0		0.0	False		,,,				2504	0.0					ENST00000360835.4	1.000000	0.910000	1.000000	0.990000	0.990000	0.995272	0.990000	1.000000																										0				31						c.(1048-1050)cGc>cAc		signal peptide, CUB domain, EGF-like 1							85.0	59.0	68.0					22																	43625113		2203	4300	6503	SO:0001583	missense	80274	7	121314	36				g.chr22:43625113C>T		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1049G>A	chr22.hg19:g.43625113C>T	ENSP00000354080:p.Arg350His	0		OREG0026614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	917		p.R350H	NM_173050.3	NP_766638.2	1	2	3	2.035951	Q8IWY4	SCUB1_HUMAN		9	1175	-		all_neural(38;0.0414)|Ovarian(80;0.07)	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	1	1	hg19	c.1049G>A	CCDS14048.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	15.69	2.908995	0.52439	.	.	ENSG00000159307	ENST00000360835	D	0.92199	-2.99	4.96	2.8	0.32819	4.96	2.8	0.32819	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.231622	0.41605	N	0.000847	D	0.82660	0.5085	N	0.16862	0.45	0.80722	D	1	B	0.13594	0.008	B	0.11329	0.006	T	0.74990	-0.3475	10	0.51188	T	0.08	.	6.3429	0.21332	0.0:0.567:0.0:0.433	.	350	Q8IWY4	SCUB1_HUMAN	H	350	ENSP00000354080:R350H	ENSP00000354080:R350H	R	-	2	0	0	SCUBE1	41955057	41955057	0.764000	0.28473	0.977000	0.42913	0.412000	0.31113	1.204000	0.32296	0.729000	0.32403	-0.345000	0.07892	CGC	0.338729		TCGA-3A-A9I5-01A-11D-A38G-08	0.677	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	1	0	1		2	2		0	0	0	0	79	0	79	77	1	1.980000	-20.000000	1	0.330000	NM_173050		0	29	28	0	108	106	1	0	1	0	0	0	0	79	0	0	1.000000	0	0	0	0	1	0	29	108
ARSA	410	broad.mit.edu	37	22	51064677	51064677	+	Missense_Mutation	SNP	C	C	T	rs199476387		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr22:51064677C>T	ENST00000547307.1	-	5	1283	c.878G>A	c.(877-879)gGc>gAc	p.G293D	ARSA_ENST00000356098.5_Missense_Mutation_p.G295D|ARSA_ENST00000395621.3_Missense_Mutation_p.G295D|ARSA_ENST00000395619.3_Missense_Mutation_p.G295D|ARSA_ENST00000610191.1_5'Flank|ARSA_ENST00000216124.5_Missense_Mutation_p.G295D|ARSA_ENST00000453344.2_Missense_Mutation_p.G209D|ARSA_ENST00000547805.1_Missense_Mutation_p.G293D			P15289	ARSA_HUMAN	arylsulfatase A	293			G -> D (in MLD; late-onset; dbSNP:rs199476387). {ECO:0000269|PubMed:15026521}.|G -> S (in MLD; adult type; causes a severe reduction of enzyme activity; dbSNP:rs199476349). {ECO:0000269|PubMed:15326627}.		autophagy (GO:0006914)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum lumen (GO:0005788)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|cerebroside-sulfatase activity (GO:0004098)|sulfuric ester hydrolase activity (GO:0008484)			endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|skin(1)	9		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)|Suramin(DB04786)	ACCGGAGCAGCCGCCTCGGGA	0.652																																						ENST00000547307.1	1.000000	0.110000	0.670000	0.220000	0.390000	0.446131	0.390000	0.310000																										0				9	GRCh37	CM044574	ARSA	M		c.(877-879)gGc>gAc		arylsulfatase A	Micafungin(DB01141)|Suramin(DB04786)						50.0	46.0	47.0					22																	51064677		2203	4300	6503	SO:0001583	missense	410	0	0					g.chr22:51064677C>T	X52150	CCDS14100.1, CCDS46736.1, CCDS14100.2	22q13.33	2013-09-19			ENSG00000100299	ENSG00000100299	3.1.6.8	"""Arylsulfatase family"""	713	protein-coding gene	gene with protein product	"""metachromatic leucodystrophy"""	607574				15772092	Standard	NM_000487		Approved		uc003bmz.5	P15289	OTTHUMG00000150180	ENST00000547307.1:c.878G>A	chr22.hg19:g.51064677C>T	ENSP00000448440:p.Gly293Asp	0					ARSA_ENST00000395621.3_Missense_Mutation_p.G295D|ARSA_ENST00000356098.5_Missense_Mutation_p.G295D|ARSA_ENST00000395619.3_Missense_Mutation_p.G295D|ARSA_ENST00000547805.1_Missense_Mutation_p.G293D|ARSA_ENST00000453344.2_Missense_Mutation_p.G209D|ARSA_ENST00000216124.5_Missense_Mutation_p.G295D|ARSA_ENST00000610191.1_5'Flank	p.G293D			1	2	3	2.035951	P15289	ARSA_HUMAN		5	1283	-		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	B2RCA6|B7XD04|F8WCC8|Q6ICI5|Q96CJ0	Missense_Mutation	SNP	ENST00000547307.1	0	1	hg19	c.878G>A		0	.	.	.	.	.	.	.	.	.	.	C	33	5.206728	0.95033	.	.	ENSG00000100299	ENST00000356098;ENST00000216124;ENST00000547307;ENST00000547805;ENST00000395621;ENST00000453344;ENST00000395619	D;D;D;D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96;-3.96;-3.96;-3.96	5.21	5.21	0.72293	5.21	5.21	0.72293	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.096084	0.64402	D	0.000001	D	0.97480	0.9175	L	0.58925	1.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98251	1.0493	10	0.87932	D	0	.	16.2653	0.82574	0.0:1.0:0.0:0.0	.	293	P15289	ARSA_HUMAN	D	295;295;293;293;295;209;295	ENSP00000348406:G295D;ENSP00000216124:G295D;ENSP00000448440:G293D;ENSP00000448932:G293D;ENSP00000378983:G295D;ENSP00000412542:G209D;ENSP00000378981:G295D	ENSP00000216124:G295D	G	-	2	0	0	ARSA	49411543	49411543	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	5.842000	0.69417	2.435000	0.82474	0.609000	0.83330	GGC	0.338729		TCGA-3A-A9I5-01A-11D-A38G-08	0.652	ARSA-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	1		2	2		0	0	0	0	30	0	30	30	1	1.980000	-6.883658	1	0.330000	NM_000487		0	3	3	0	53	50	0	0	1	0	0	0	0	30	0	0	0.794736	9.849027e-01	0	0	0	169	0	3	53
CASR	846	broad.mit.edu	37	3	121980827	121980827	+	Silent	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr3:121980827C>T	ENST00000490131.1	+	4	1317	c.945C>T	c.(943-945)ggC>ggT	p.G315G	CASR_ENST00000296154.5_Silent_p.G315G|CASR_ENST00000498619.1_Silent_p.G315G	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	315					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	ACGTGGTTGGCGGCACCATTG	0.587																																						ENST00000490131.1	0.220000	0.020000	0.160000	0.050000	0.100000	0.113549	0.100000	0.090000																										0				84						c.(943-945)ggC>ggT		calcium-sensing receptor	Cinacalcet(DB01012)						59.0	52.0	54.0					3																	121980827		2203	4300	6503	SO:0001819	synonymous_variant	846	0	0					g.chr3:121980827C>T	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.945C>T	chr3.hg19:g.121980827C>T		0					CASR_ENST00000296154.5_Silent_p.G315G|CASR_ENST00000498619.1_Silent_p.G315G	p.G315G	NM_000388.3	NP_000379	0	0	0	1.989794	P41180	CASR_HUMAN		4	1317	+			Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	ENST00000490131.1	0	1	hg19	c.945C>T	CCDS3010.1	0																																																																																								0.325549		TCGA-3A-A9I5-01A-11D-A38G-08	0.587	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	0	0	1		12	2		1	0	1	1	88	0	88	86	1	1.980000	-3.004119	1	0.330000	NM_000388		0	4	4	0	257	255	0	0	0	0	0	1	0	88	0	0	0.034353	4.320774e-04	0	0	0	2	0	4	257
XRN1	54464	broad.mit.edu	37	3	142151540	142151540	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr3:142151540G>A	ENST00000264951.4	-	2	388	c.271C>T	c.(271-273)Cga>Tga	p.R91*	XRN1_ENST00000544157.1_5'UTR|XRN1_ENST00000463916.1_Nonsense_Mutation_p.R91*|XRN1_ENST00000465074.1_5'Flank|XRN1_ENST00000392981.2_Nonsense_Mutation_p.R91*	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	91					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R91*(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATTTTTGCTCGAGGAGCCACA	0.338																																						ENST00000264951.4	0.990000	0.410000	0.830000	0.530000	0.670000	0.687540	0.670000	1.000000																										1	Substitution - Nonsense(1)	p.R91*(1)	endometrium(1)	61						c.(271-273)Cga>Tga		5'-3' exoribonuclease 1							42.0	40.0	40.0					3																	142151540		2203	4299	6502	SO:0001587	stop_gained	54464	0	0					g.chr3:142151540G>A	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.271C>T	chr3.hg19:g.142151540G>A	ENSP00000264951:p.Arg91*	0					XRN1_ENST00000463916.1_Nonsense_Mutation_p.R91*|XRN1_ENST00000544157.1_5'UTR|XRN1_ENST00000392981.2_Nonsense_Mutation_p.R91*|XRN1_ENST00000465074.1_5'Flank	p.R91*	NM_019001.3	NP_061874.3	0	0	0	1.989794	Q8IZH2	XRN1_HUMAN		2	388	-			Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Nonsense_Mutation	SNP	ENST00000264951.4	0	1	hg19	c.271C>T	CCDS3123.1	0	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683679	0.68157	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916	.	.	.	5.94	3.98	0.46160	5.94	3.98	0.46160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7693	13.4404	0.61109	0.0:0.0:0.6797:0.3203	.	.	.	.	X	91	.	ENSP00000264951:R91X	R	-	1	2	2	XRN1	143634230	143634230	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	3.127000	0.50484	2.816000	0.96949	0.561000	0.74099	CGA	0.325549		TCGA-3A-A9I5-01A-11D-A38G-08	0.338	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	1	0	1		2	2		0	0	0	0	77	0	77	77	1	1.980000	-19.999990	1	0.330000	NM_019001		0	17	17	0	136	134	1	0	1	0	0	0	0	77	0	0	0.999972	0	0	0	0	1	0	17	136
TNIK	23043	broad.mit.edu	37	3	170811703	170811703	+	Silent	SNP	C	C	T	rs556088275		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr3:170811703C>T	ENST00000436636.2	-	23	2990	c.2646G>A	c.(2644-2646)acG>acA	p.T882T	TNIK_ENST00000470834.1_Silent_p.T845T|TNIK_ENST00000341852.6_Silent_p.T798T|TNIK_ENST00000475336.1_Silent_p.T790T|TNIK_ENST00000538048.1_Silent_p.T834T|TNIK_ENST00000460047.1_Silent_p.T819T|TNIK_ENST00000369326.5_Silent_p.T860T|TNIK_ENST00000488470.1_Silent_p.T827T|TNIK_ENST00000357327.5_Silent_p.T853T|TNIK_ENST00000284483.8_Silent_p.T874T	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	882	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CCAGCCCATGCGTCCCCACCA	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		16823	0.0		0.0	False		,,,				2504	0.001					ENST00000436636.2	0.300000	0.040000	0.220000	0.080000	0.130000	0.155085	0.130000	0.120000																										0				62						c.(2644-2646)acG>acA		TRAF2 and NCK interacting kinase							111.0	112.0	112.0					3																	170811703		2075	4228	6303	SO:0001819	synonymous_variant	23043	10	121016	40				g.chr3:170811703C>T	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2646G>A	chr3.hg19:g.170811703C>T		0					TNIK_ENST00000538048.1_Silent_p.T834T|TNIK_ENST00000341852.6_Silent_p.T798T|TNIK_ENST00000470834.1_Silent_p.T845T|TNIK_ENST00000460047.1_Silent_p.T819T|TNIK_ENST00000475336.1_Silent_p.T790T|TNIK_ENST00000369326.5_Silent_p.T860T|TNIK_ENST00000488470.1_Silent_p.T827T|TNIK_ENST00000357327.5_Silent_p.T853T|TNIK_ENST00000284483.8_Silent_p.T874T	p.T882T	NM_015028.2	NP_055843.1	0	0	0	1.989794	Q9UKE5	TNIK_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	23	2990	-	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Silent	SNP	ENST00000436636.2	0	1	hg19	c.2646G>A	CCDS46956.1	0																																																																																								0.325549		TCGA-3A-A9I5-01A-11D-A38G-08	0.468	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	0	0	1		2	2		0	0	0	0	83	0	83	79	1	1.980000	-3.252775	1	0.330000	XM_039796		0	4	4	0	186	179	0	0	1	0	0	0	0	83	0	0	0.882216	0	0	0	0	1	0	4	186
ROBO2	6092	broad.mit.edu	37	3	77684144	77684144	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr3:77684144G>A	ENST00000461745.1	+	24	4784	c.3884G>A	c.(3883-3885)cGg>cAg	p.R1295Q	ROBO2_ENST00000332191.8_Missense_Mutation_p.R1356Q|ROBO2_ENST00000487694.3_Missense_Mutation_p.R1311Q	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1295					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AAGGGAGGGCGGATGGACCAA	0.517																																						ENST00000461745.1	1.000000	0.740000	1.000000	0.840000	0.930000	0.925005	0.930000	1.000000																										0				117						c.(3883-3885)cGg>cAg		roundabout, axon guidance receptor, homolog 2 (Drosophila)							104.0	107.0	106.0					3																	77684144		1981	4156	6137	SO:0001583	missense	6092	1	120926	38				g.chr3:77684144G>A	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3884G>A	chr3.hg19:g.77684144G>A	ENSP00000417164:p.Arg1295Gln	1					ROBO2_ENST00000487694.3_Missense_Mutation_p.R1311Q|ROBO2_ENST00000332191.8_Missense_Mutation_p.R1356Q	p.R1295Q	NM_002942.4	NP_002933.1	0	1	1	1.682018	Q9HCK4	ROBO2_HUMAN		24	4784	+			O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	1	1	hg19	c.3884G>A	CCDS43109.1	1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346305	0.61073	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191	T;T;T	0.63096	0.01;0.05;-0.02	5.34	4.45	0.53987	5.34	4.45	0.53987	.	0.224186	0.21846	N	0.068253	T	0.34832	0.0911	N	0.08118	0	0.28032	N	0.934087	B;P;B	0.46327	0.196;0.876;0.196	B;B;B	0.28784	0.016;0.094;0.016	T	0.54227	-0.8325	9	0.36615	T	0.2	.	14.9245	0.70866	0.0725:0.0:0.9275:0.0	.	1311;1356;1295	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	Q	1311;1311;1295;1356	ENSP00000417335:R1311Q;ENSP00000417164:R1295Q;ENSP00000327536:R1356Q	ENSP00000327536:R1356Q	R	+	2	0	0	ROBO2	77766834	77766834	0.998000	0.40836	0.981000	0.43875	0.987000	0.75469	4.160000	0.58164	2.664000	0.90586	0.650000	0.86243	CGG	0.200763		TCGA-3A-A9I5-01A-11D-A38G-08	0.517	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	1	0	1		2	2		0	0	0	0	85	0	85	84	1	1.980000	-3.418639	1	0.330000	XM_031246		0	38	38	0	139	135	1	0	1	0	0	0	0	85	0	0	1.000000	4.788214e-02	0	0	0	2	0	38	139
EPHB3	2049	broad.mit.edu	37	3	184294634	184294634	+	Silent	SNP	G	G	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr3:184294634G>T	ENST00000330394.2	+	5	1469	c.1017G>T	c.(1015-1017)gtG>gtT	p.V339V	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	339	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TCACAGCCGTGCCATCTCCAC	0.587																																						ENST00000330394.2	1.000000	0.540000	0.950000	0.660000	0.800000	0.806072	0.800000	1.000000																										0				51						c.(1015-1017)gtG>gtT		EPH receptor B3							68.0	67.0	67.0					3																	184294634		2202	4293	6495	SO:0001819	synonymous_variant	2049	0	0					g.chr3:184294634G>T	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.1017G>T	chr3.hg19:g.184294634G>T		0					EIF2B5_ENST00000444495.1_Intron	p.V339V	NM_004443.3	NP_004434.2	0	0	0	1.989794	P54753	EPHB3_HUMAN	Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)	5	1469	+	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Q7Z740	Silent	SNP	ENST00000330394.2	1	1	hg19	c.1017G>T	CCDS3268.1	0																																																																																								0.325549		TCGA-3A-A9I5-01A-11D-A38G-08	0.587	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	1	0	1		2	2		0	0	0	0	114	0	114	113	1	1.980000	-13.856190	1	0.330000	NM_004443		0	27	27	0	176	173	0	0	1	1	0	0	0	114	0	0	1.000000	1.425224e-01	0	2	0	3	0	27	176
EGF	1950	broad.mit.edu	37	4	110909769	110909769	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr4:110909769G>A	ENST00000265171.5	+	18	3083	c.2638G>A	c.(2638-2640)Gtg>Atg	p.V880M	EGF_ENST00000509793.1_Missense_Mutation_p.V838M|EGF_ENST00000503392.1_Missense_Mutation_p.V880M	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	880	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GGGTGTCCCAGTGTGCCCCCC	0.463																																						ENST00000265171.5	1.000000	0.810000	0.990000	0.870000	0.930000	0.934210	0.930000	1.000000																										0				50						c.(2638-2640)Gtg>Atg		epidermal growth factor	Sucralfate(DB00364)						172.0	173.0	172.0					4																	110909769		2203	4300	6503	SO:0001583	missense	1950	0	0					g.chr4:110909769G>A	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2638G>A	chr4.hg19:g.110909769G>A	ENSP00000265171:p.Val880Met	1					EGF_ENST00000503392.1_Missense_Mutation_p.V880M|EGF_ENST00000509793.1_Missense_Mutation_p.V838M	p.V880M	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	0	1	1	1.706221	P01133	EGF_HUMAN		18	3083	+		Hepatocellular(203;0.0893)	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	1	1	hg19	c.2638G>A	CCDS3689.1	1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129552	0.37630	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	T;D;D	0.92199	1.97;-2.99;-2.99	5.25	3.48	0.39840	5.25	3.48	0.39840	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.815723	0.11241	N	0.584665	D	0.88355	0.6414	N	0.25245	0.725	0.09310	N	1	P;P;P	0.51537	0.946;0.883;0.946	P;P;P	0.48840	0.592;0.456;0.592	T	0.79085	-0.1948	10	0.44086	T	0.13	.	9.6075	0.39643	0.0927:0.2322:0.6751:0.0	.	880;838;880	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	M	838;880;880	ENSP00000424316:V838M;ENSP00000265171:V880M;ENSP00000421384:V880M	ENSP00000265171:V880M	V	+	1	0	0	EGF	111129218	111129218	0.000000	0.05858	0.007000	0.13788	0.055000	0.15305	-0.548000	0.06048	1.206000	0.43276	0.655000	0.94253	GTG	0.199187		TCGA-3A-A9I5-01A-11D-A38G-08	0.463	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1	1	0	1		2	2		0	0	0	0	271	0	271	259	1	1.980000	-20.000000	1	0.330000			0	134	131	0	566	557	1	0	1		0	0	0	271	0	0	1.000000	0	0	0	0	0	0	134	566
ARHGAP10	79658	broad.mit.edu	37	4	148802993	148802993	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr4:148802993A>G	ENST00000336498.3	+	10	1183	c.944A>G	c.(943-945)gAc>gGc	p.D315G	ARHGAP10_ENST00000414545.2_5'Flank	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TTGCAGGGGGACGGAGAGGTG	0.408																																						ENST00000336498.3	1.000000	0.040000	0.180000	0.070000	0.100000	0.197957	0.100000	0.100000																										0				33						c.(943-945)gAc>gGc		Rho GTPase activating protein 10							148.0	144.0	145.0					4																	148802993		2203	4300	6503	SO:0001583	missense	79658	0	0					g.chr4:148802993A>G	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.944A>G	chr4.hg19:g.148802993A>G	ENSP00000336923:p.Asp315Gly	0					ARHGAP10_ENST00000414545.2_5'Flank	p.D315G	NM_024605.3	NP_078881.3	1	2	3	2.077278	Q5T5U3	RHG21_HUMAN		10	1183	+	all_hematologic(180;0.151)	Renal(17;0.0166)	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	0	1	hg19	c.944A>G	CCDS34075.1	0	.	.	.	.	.	.	.	.	.	.	A	10.50	1.368824	0.24771	.	.	ENSG00000071205	ENST00000336498	T	0.40756	1.02	4.94	4.94	0.65067	4.94	4.94	0.65067	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.053409	0.85682	D	0.000000	T	0.38692	0.1050	L	0.56769	1.78	0.80722	D	1	B	0.31026	0.304	B	0.29077	0.098	T	0.19257	-1.0311	10	0.19590	T	0.45	.	14.2898	0.66270	1.0:0.0:0.0:0.0	.	315	A1A4S6	RHG10_HUMAN	G	315	ENSP00000336923:D315G	ENSP00000336923:D315G	D	+	2	0	0	ARHGAP10	149022443	149022443	1.000000	0.71417	0.826000	0.32828	0.073000	0.16967	8.306000	0.89962	1.853000	0.53794	0.482000	0.46254	GAC	0.343008		TCGA-3A-A9I5-01A-11D-A38G-08	0.408	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	0	0	1		10	2		1	0	1	1	181	0	181	177	1	1.980000	-2.059807	0	0.330000	NM_024605		0	7	7	0	430	425	0	0	0	0	0	1	0	181	0	0	0.302570	5.262456e-03	0	0	0	6	0	7	430
IRF2	3660	broad.mit.edu	37	4	185339858	185339858	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr4:185339858C>A	ENST00000393593.3	-	4	399	c.192G>T	c.(190-192)aaG>aaT	p.K64N	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	64					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		CTGGTTGATGCTTTCCTAACA	0.378																																						ENST00000393593.3	1.000000	0.660000	1.000000	0.790000	0.910000	0.898734	0.910000	1.000000																										0				22						c.(190-192)aaG>aaT		interferon regulatory factor 2							62.0	61.0	62.0					4																	185339858		2203	4300	6503	SO:0001583	missense	3660	0	0					g.chr4:185339858C>A		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.192G>T	chr4.hg19:g.185339858C>A	ENSP00000377218:p.Lys64Asn	1					IRF2_ENST00000512020.1_5'UTR	p.K64N	NM_002199.3	NP_002190.2	0	1	1	1.736724	P14316	IRF2_HUMAN		4	399	-		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	1	1	hg19	c.192G>T	CCDS3835.1	1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711954	0.68730	.	.	ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83	5.26	5.26	0.73747	5.26	5.26	0.73747	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98529	0.9509	M	0.66297	2.02	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.98597	1.0657	10	0.87932	D	0	-8.3921	12.7922	0.57541	0.0:0.9154:0.0:0.0846	.	64	P14316	IRF2_HUMAN	N	64	ENSP00000377218:K64N;ENSP00000427204:K64N;ENSP00000424552:K64N;ENSP00000422860:K64N	ENSP00000377218:K64N	K	-	3	2	2	IRF2	185576852	185576852	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.950000	0.40323	2.740000	0.93945	0.561000	0.74099	AAG	0.203897		TCGA-3A-A9I5-01A-11D-A38G-08	0.378	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1	0	0	1		2	2		0	0	0	0	71	0	71	70	1	1.980000	-17.877970	1	0.330000			0	26	27	0	102	101	1	0	1	1	0	0	0	71	0	0	1.000000	9.272120e-01	0	16	0	4	0	26	102
FGFR4	2264	broad.mit.edu	37	5	176523645	176523645	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr5:176523645G>A	ENST00000292408.4	+	16	2301	c.2056G>A	c.(2056-2058)Ggg>Agg	p.G686R	FGFR4_ENST00000393637.1_Missense_Mutation_p.G646R|FGFR4_ENST00000502906.1_Missense_Mutation_p.G686R|FGFR4_ENST00000393648.2_Missense_Mutation_p.G618R|FGFR4_ENST00000292410.3_Missense_Mutation_p.G646R	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	686	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CTTCACCCTCGGGGGCTCCCC	0.667										TSP Lung(9;0.080)																												ENST00000292408.4	0.150000	0.020000	0.110000	0.040000	0.060000	0.078401	0.060000	0.060000																										0				34						c.(2056-2058)Ggg>Agg		fibroblast growth factor receptor 4	Palifermin(DB00039)|Ponatinib(DB08901)						75.0	74.0	74.0					5																	176523645		2203	4300	6503	SO:0001583	missense	2264	0	0					g.chr5:176523645G>A	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.2056G>A	chr5.hg19:g.176523645G>A	ENSP00000292408:p.Gly686Arg	0	TSP Lung(9;0.080)				FGFR4_ENST00000393637.1_Missense_Mutation_p.G646R|FGFR4_ENST00000393648.2_Missense_Mutation_p.G618R|FGFR4_ENST00000292410.3_Missense_Mutation_p.G646R|FGFR4_ENST00000502906.1_Missense_Mutation_p.G686R	p.G686R	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	0	1	1	2.005941	P22455	FGFR4_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	16	2301	+	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	0	1	hg19	c.2056G>A	CCDS4410.1	0	.	.	.	.	.	.	.	.	.	.	g	28.1	4.892229	0.91889	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34;-3.34	4.19	4.19	0.49359	4.19	4.19	0.49359	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96436	0.8837	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97231	0.9884	10	0.87932	D	0	.	16.1407	0.81519	0.0:0.0:1.0:0.0	.	618;646;686	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	R	686;618;686;646;646;914	ENSP00000292408:G686R;ENSP00000377259:G618R;ENSP00000424960:G686R;ENSP00000292410:G646R;ENSP00000377254:G646R	ENSP00000292408:G686R	G	+	1	0	0	FGFR4	176456251	176456251	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.855000	0.99526	1.891000	0.54761	0.556000	0.70494	GGG	0.328893		TCGA-3A-A9I5-01A-11D-A38G-08	0.667	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1	0	0	0		2	2		0	0	0	0	214	0	214	205	1	1.980000	-3.193129	1	0.330000			0	5	5	0	454	442	0	0	1	1	0	0	0	214	0	0	0.933411	9.738470e-01	0	21	0	599	0	5	454
VGLL2	245806	broad.mit.edu	37	6	117593645	117593645	+	Silent	SNP	C	C	G			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr6:117593645C>G	ENST00000326274.5	+	4	1132	c.942C>G	c.(940-942)tcC>tcG	p.S314S	VGLL2_ENST00000352536.3_Silent_p.S140S	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	314					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		GTGGTGCATCCCTCCTGAGCT	0.542																																						ENST00000326274.5	0.920000	0.690000	0.870000	0.740000	0.800000	0.809872	0.800000	0.810000																										0				5						c.(940-942)tcC>tcG		vestigial-like family member 2							470.0	393.0	419.0					6																	117593645		2203	4300	6503	SO:0001819	synonymous_variant	245806	1	121412	38				g.chr6:117593645C>G	AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.942C>G	chr6.hg19:g.117593645C>G		0					VGLL2_ENST00000352536.3_Silent_p.S140S	p.S314S	NM_182645.3	NP_872586.1	0	0	0	1.984916	Q8N8G2	VGLL2_HUMAN		4	1132	+			Q8WWX1	Silent	SNP	ENST00000326274.5	1	1	hg19	c.942C>G	CCDS5115.1	0																																																																																								0.321038		TCGA-3A-A9I5-01A-11D-A38G-08	0.542	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041975.2	1	0	1		2	2		0	0	0	0	598	0	598	585	1	1.980000	-20.000000	1	0.330000	NM_153453		0	158	155	0	1012	990	1	0	1		0	0	0	598	0	0	1.000000	0	0	0	0	0	0	158	1012
DST	667	broad.mit.edu	37	6	56469950	56469951	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr6:56469950_56469951GA>AT	ENST00000361203.3	-	36	8849_8850	c.8842_8843TC>AT	c.(8842-8844)TCg>ATg	p.S2948M	DST_ENST00000312431.6_Missense_Mutation_p.S2948M|DST_ENST00000446842.2_Missense_Mutation_p.S2622M|DST_ENST00000370769.4_Missense_Mutation_p.S2948M|DST_ENST00000370754.5_Missense_Mutation_p.S3126M|DST_ENST00000421834.2_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	2948					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCCTTCCCACGATGTAATGTCT	0.332																																						ENST00000361203.3	1.000000	0.480000|0.520000	0.920000|0.970000	0.600000|0.650000	0.750000|0.800000	0.763236|0.804284	0.750000|0.800000	1.000000																										0				105						c.(8842-8844)tCg>tTg|c.(8842-8844)Tcg>Acg		dystonin																																				SO:0001583	missense	667	0	0					g.chr6:56469950G>A|g.chr6:56469951A>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.8842_8843delinsAT	chr6.hg19:g.56469950_56469951delinsAT	ENSP00000354508:p.Ser2948Met	0					DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.S3126L|DST_ENST00000446842.2_Missense_Mutation_p.S2622L|DST_ENST00000312431.6_Missense_Mutation_p.S2948L|DST_ENST00000244364.6_Intron|DST_ENST00000370769.4_Missense_Mutation_p.S2948L|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.S3126T|DST_ENST00000446842.2_Missense_Mutation_p.S2622T|DST_ENST00000312431.6_Missense_Mutation_p.S2948T|DST_ENST00000244364.6_Intron|DST_ENST00000370769.4_Missense_Mutation_p.S2948T	p.S2948L|p.S2948T			0	0	0	1.984916	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)	36	8850|8849	-	Lung NSC(77;0.103)		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	1	1	hg19	c.8843C>T|c.8842T>A		0																									4.75|4.44	-3.65|-2.96	0.04502|0.05547																																												0			56577909|56577910														0.321038		TCGA-3A-A9I5-01A-11D-A38G-08	0.332	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	0	0	1		2	2		0	0	0	0	52	0	52|53	51|52	1	1.980000	-3.322624|-20.000000	1	0.330000	NM_001723		0	20|21	20	0	139|136	135|132	0|1	0	1		0	0	0	52|53	0	0	0.999996|0.999998	0	0	0	0	0	0	20	136
LATS1	9113	broad.mit.edu	37	6	150004721	150004721	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr6:150004721G>A	ENST00000543571.1	-	4	2051	c.1504C>T	c.(1504-1506)Cgt>Tgt	p.R502C	LATS1_ENST00000392273.3_Missense_Mutation_p.R502C|LATS1_ENST00000253339.5_Missense_Mutation_p.R502C|LATS1_ENST00000542747.1_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.R502C(1)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TTTAATACACGCATACTTTTC	0.443																																						ENST00000543571.1	1.000000	0.670000	0.930000	0.750000	0.830000	0.845232	0.830000	1.000000																										1	Substitution - Missense(1)	p.R502C(1)	lung(1)	6						c.(1504-1506)Cgt>Tgt		large tumor suppressor kinase 1							134.0	139.0	137.0					6																	150004721		2203	4300	6503	SO:0001583	missense	9113	0	0					g.chr6:150004721G>A	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.1504C>T	chr6.hg19:g.150004721G>A	ENSP00000437550:p.Arg502Cys	0					LATS1_ENST00000392273.3_Missense_Mutation_p.R502C|LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Missense_Mutation_p.R502C	p.R502C	NM_004690.3	NP_004681.1	0	0	0	1.984916				4	2051	-		Ovarian(120;0.0164)		Missense_Mutation	SNP	ENST00000543571.1	1	1	hg19	c.1504C>T	CCDS34551.1	0	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285733	0.59867	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273	T;T;T	0.58358	0.34;0.34;2.51	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000014	T	0.65048	0.2654	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.992;0.999	T	0.64296	-0.6441	9	.	.	.	.	14.635	0.68682	0.0:0.0:0.8543:0.1457	.	354;502;502	Q59FN4;O95835-2;O95835	.;.;LATS1_HUMAN	C	502	ENSP00000437550:R502C;ENSP00000253339:R502C;ENSP00000444678:R502C	.	R	-	1	0	0	LATS1	150046414	150046414	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.163000	0.71880	2.767000	0.95098	0.655000	0.94253	CGT	0.321038		TCGA-3A-A9I5-01A-11D-A38G-08	0.443	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	1	0	1		2	2		0	0	0	0	263	0	263	260	1	1.980000	-3.318846	1	0.330000	NM_004690		0	82	80	0	500	493	1	0	1	0	0	0	0	263	0	0	1.000000	2.040745e-02	0	0	0	2	0	82	500
KBTBD2	25948	broad.mit.edu	37	7	32909811	32909811	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr7:32909811G>T	ENST00000304056.4	-	4	1717	c.1018C>A	c.(1018-1020)Ctt>Att	p.L340I	AVL9_ENST00000404479.1_Intron|KBTBD2_ENST00000485611.1_5'Flank	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	340										endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			GCAGTCTGAAGTTTGCTTGTT	0.403																																						ENST00000304056.4	1.000000	0.730000	0.970000	0.800000	0.880000	0.890866	0.880000	1.000000																										0				17						c.(1018-1020)Ctt>Att		kelch repeat and BTB (POZ) domain containing 2							214.0	200.0	205.0					7																	32909811		2203	4300	6503	SO:0001583	missense	25948	0	0					g.chr7:32909811G>T	AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.1018C>A	chr7.hg19:g.32909811G>T	ENSP00000302586:p.Leu340Ile	0					KBTBD2_ENST00000485611.1_5'Flank|AVL9_ENST00000404479.1_Intron	p.L340I	NM_015483.2	NP_056298.2	0	0	0	1.998491	Q8IY47	KBTB2_HUMAN	GBM - Glioblastoma multiforme(11;0.0499)	4	1717	-			A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	ENST00000304056.4	1	1	hg19	c.1018C>A	CCDS34614.1	1	.	.	.	.	.	.	.	.	.	.	G	3.828	-0.036369	0.07497	.	.	ENSG00000170852	ENST00000304056;ENST00000537125	T	0.67345	-0.26	5.65	1.87	0.25490	5.65	1.87	0.25490	Kelch-type beta propeller (1);	0.248699	0.40554	N	0.001063	T	0.58293	0.2112	L	0.54323	1.7	0.41608	D	0.988898	B	0.06786	0.001	B	0.06405	0.002	T	0.52555	-0.8560	10	0.45353	T	0.12	.	10.35	0.43929	0.2573:0.0:0.7427:0.0	.	340	Q8IY47	KBTB2_HUMAN	I	340;147	ENSP00000302586:L340I	ENSP00000302586:L340I	L	-	1	0	0	KBTBD2	32876336	32876336	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	2.583000	0.46094	0.140000	0.18849	-0.339000	0.08088	CTT	0.327782		TCGA-3A-A9I5-01A-11D-A38G-08	0.403	KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328890.1	1	0	1		2	2		0	0	0	0	225	0	225	223	1	1.980000	-20.000000	1	0.330000	XM_291224		0	102	102	0	589	576	1	0	1	1	0	0	0	225	0	0	1.000000	7.930838e-01	0	5	0	14	0	102	589
EGR3	1960	broad.mit.edu	37	8	22550452	22550452	+	Silent	SNP	G	G	A	rs375168773		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr8:22550452G>A	ENST00000317216.2	-	1	363	c.6C>T	c.(4-6)acC>acT	p.T2T	EGR3_ENST00000519492.1_Silent_p.T2T|RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000522910.1_5'Flank|EGR3_ENST00000524088.1_5'Flank	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	2					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		CGAGTTTGCCGGTCATAGCAC	0.657																																						ENST00000317216.2	0.360000	0.050000	0.260000	0.100000	0.170000	0.187335	0.170000	0.150000																										0				10						c.(4-6)acC>acT		early growth response 3		G		0,4406		0,0,2203	39.0	35.0	36.0		6	4.0	1.0	8		36	1,8599		0,1,4299	no	coding-synonymous	EGR3	NM_004430.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		2/388	22550452	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1960	0	0					g.chr8:22550452G>A	X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.6C>T	chr8.hg19:g.22550452G>A		1					EGR3_ENST00000519492.1_Silent_p.T2T|EGR3_ENST00000522910.1_5'Flank|EGR3_ENST00000524088.1_5'Flank|RP11-459E5.1_ENST00000523627.1_RNA	p.T2T	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	0	1	1	1.713682	Q06889	EGR3_HUMAN		1	363	-		Prostate(55;0.0421)|Breast(100;0.102)	A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Silent	SNP	ENST00000317216.2	0	1	hg19	c.6C>T	CCDS6033.1	0																																																																																								0.208552		TCGA-3A-A9I5-01A-11D-A38G-08	0.657	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215098.1	0	0	1		2	2		0	0	0	0	94	0	94	92	1	1.980000	-6.781042	1	0.330000	NM_004430		0	4	4	0	127	125	0	0	1	0	0	0	0	94	0	0	0.887900	9.417016e-03	0	0	0	4	0	4	127
ANK1	286	broad.mit.edu	37	8	41573238	41573238	+	Missense_Mutation	SNP	G	G	A	rs369968960		TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr8:41573238G>A	ENST00000347528.4	-	14	1617	c.1534C>T	c.(1534-1536)Cgt>Tgt	p.R512C	ANK1_ENST00000379758.2_Missense_Mutation_p.R512C|ANK1_ENST00000352337.4_Missense_Mutation_p.R512C|ANK1_ENST00000396945.1_Missense_Mutation_p.R512C|ANK1_ENST00000396942.1_Missense_Mutation_p.R512C|ANK1_ENST00000265709.8_Missense_Mutation_p.R545C|ANK1_ENST00000289734.7_Missense_Mutation_p.R512C	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	512	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGGCCCTCACGGGCTGCAATG	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		19013	0.001		0.0	False		,,,				2504	0.0					ENST00000347528.4	1.000000	0.540000	0.960000	0.640000	0.770000	0.789304	0.770000	1.000000																										0				122						c.(1534-1536)Cgt>Tgt		ankyrin 1, erythrocytic		G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	90.0	83.0	85.0		1534,1633,1534,1534,1534	6.0	1.0	8		85	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	ANK1	NM_000037.3,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2	180,180,180,180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	512/1881,545/1898,512/1857,512/1882,512/1720	41573238	1,13005	2203	4300	6503	SO:0001583	missense	286	4	121412	41				g.chr8:41573238G>A	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1534C>T	chr8.hg19:g.41573238G>A	ENSP00000339620:p.Arg512Cys	1					ANK1_ENST00000396945.1_Missense_Mutation_p.R512C|ANK1_ENST00000289734.7_Missense_Mutation_p.R512C|ANK1_ENST00000396942.1_Missense_Mutation_p.R512C|ANK1_ENST00000379758.2_Missense_Mutation_p.R512C|ANK1_ENST00000352337.4_Missense_Mutation_p.R512C|ANK1_ENST00000265709.8_Missense_Mutation_p.R545C	p.R512C	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	1	2	3	2.314498	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)	14	1617	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	1	1	hg19	c.1534C>T	CCDS6119.1	0	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162987	0.57476	2.27E-4	0.0	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	6.03	6.03	0.97812	6.03	6.03	0.97812	Ankyrin repeat-containing domain (3);	0.059791	0.64402	D	0.000002	T	0.80565	0.4647	M	0.69185	2.1	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.703;0.997;1.0	D;D;B;P;D	0.79108	0.992;0.98;0.108;0.68;0.992	T	0.81284	-0.1002	10	0.87932	D	0	.	15.9973	0.80260	0.0:0.0:0.8649:0.1351	.	545;512;512;512;512	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	C	512;512;512;512;512;512;545;512	ENSP00000339620:R512C;ENSP00000289734:R512C;ENSP00000369082:R512C;ENSP00000380149:R512C;ENSP00000380147:R512C;ENSP00000309131:R512C;ENSP00000265709:R545C	ENSP00000265709:R545C	R	-	1	0	0	ANK1	41692395	41692395	1.000000	0.71417	0.997000	0.53966	0.139000	0.21198	5.396000	0.66297	2.868000	0.98415	0.555000	0.69702	CGT	0.414105		TCGA-3A-A9I5-01A-11D-A38G-08	0.607	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	1	0	1		2	2		0	0	0	0	123	0	123	117	1	1.980000	-2.402343	0	0.330000	NM_020475		0	35	35	0	287	282	1	0	1		0	0	0	123	0	0	1.000000	0	0	0	0	0	0	35	287
KIF27	55582	broad.mit.edu	37	9	86498835	86498835	+	Nonsense_Mutation	SNP	T	T	A			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr9:86498835T>A	ENST00000297814.2	-	10	2481	c.2338A>T	c.(2338-2340)Aag>Tag	p.K780*	KIF27_ENST00000334204.2_Nonsense_Mutation_p.K780*|KIF27_ENST00000413982.1_Nonsense_Mutation_p.K780*|KIF27_ENST00000376347.1_Nonsense_Mutation_p.K171*	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	780					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TGTAGCTGCTTTTGTGTTTCA	0.388																																						ENST00000297814.2	0.410000	0.180000	0.340000	0.220000	0.280000	0.289062	0.280000	0.280000																										0				43						c.(2338-2340)Aag>Tag		kinesin family member 27							154.0	141.0	146.0					9																	86498835		2203	4299	6502	SO:0001587	stop_gained	55582	0	0					g.chr9:86498835T>A	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2338A>T	chr9.hg19:g.86498835T>A	ENSP00000297814:p.Lys780*	0					KIF27_ENST00000334204.2_Nonsense_Mutation_p.K780*|KIF27_ENST00000413982.1_Nonsense_Mutation_p.K780*|KIF27_ENST00000376347.1_Nonsense_Mutation_p.K171*	p.K780*	NM_017576.1	NP_060046.1	1	2	3	2.011654	Q86VH2	KIF27_HUMAN		10	2481	-			B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Nonsense_Mutation	SNP	ENST00000297814.2	0	1	hg19	c.2338A>T	CCDS6665.1	0	.	.	.	.	.	.	.	.	.	.	T	40	8.370270	0.98781	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	.	.	.	5.36	5.36	0.76844	5.36	5.36	0.76844	.	0.093400	0.45126	D	0.000388	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3543	0.74415	0.0:0.0:0.0:1.0	.	.	.	.	X	780;780;780;171	.	ENSP00000297814:K780X	K	-	1	0	0	KIF27	85688655	85688655	1.000000	0.71417	0.992000	0.48379	0.954000	0.61252	3.791000	0.55469	2.022000	0.59522	0.477000	0.44152	AAG	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.388	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	1	0	1		12	2		0	0	0	1	203	0	203	196	1	1.980000	-20.000000	1	0.330000	NM_017576		0	26	26	0	537	527	0	0	1	0	0	0	0	203	0	0	0.992695	2.364051e-03	0	0	0	2	0	26	537
RPL7A	6130	broad.mit.edu	37	9	136218131	136218131	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chr9:136218131G>T	ENST00000323345.6	+	8	741	c.711G>T	c.(709-711)tgG>tgT	p.W237C	SNORD36C_ENST00000516733.1_RNA|SNORD36A_ENST00000362874.1_RNA|SNORD24_ENST00000383884.1_RNA|RPL7A_ENST00000463740.1_3'UTR|SURF1_ENST00000495952.1_5'Flank|RPL7A_ENST00000315731.4_Missense_Mutation_p.W122C|SNORD36B_ENST00000363961.1_RNA	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a	237					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		GCCGTCACTGGGGTGGCAATG	0.453																																						ENST00000323345.6	0.340000	0.040000	0.240000	0.080000	0.150000	0.165813	0.150000	0.140000																										0				7						c.(709-711)tgG>tgT		ribosomal protein L7a							78.0	75.0	76.0					9																	136218131		2203	4300	6503	SO:0001583	missense	6130	0	0					g.chr9:136218131G>T	BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.711G>T	chr9.hg19:g.136218131G>T	ENSP00000361076:p.Trp237Cys	0					RPL7A_ENST00000463740.1_3'UTR|SNORD36A_ENST00000362874.1_RNA|SURF1_ENST00000495952.1_5'Flank|RPL7A_ENST00000315731.4_Missense_Mutation_p.W122C|SNORD24_ENST00000383884.1_RNA|SNORD36C_ENST00000516733.1_RNA|SNORD36B_ENST00000363961.1_RNA	p.W237C	NM_000972.2	NP_000963.1	1	2	3	2.011654	P62424	RL7A_HUMAN		8	741	+			P11518|Q5T8U4	Missense_Mutation	SNP	ENST00000323345.6	0	1	hg19	c.711G>T	CCDS6965.1	0	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814931	0.32053	.	.	ENSG00000148303	ENST00000323345;ENST00000315731	T;T	0.70164	0.06;-0.46	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.057096	0.85682	D	0.000000	D	0.85256	0.5655	H	0.97783	4.075	0.80722	D	1	P	0.37997	0.614	P	0.47044	0.535	D	0.89670	0.3883	10	0.87932	D	0	.	17.9044	0.88914	0.0:0.0:1.0:0.0	.	237	P62424	RL7A_HUMAN	C	237;122	ENSP00000361076:W237C;ENSP00000361071:W122C	ENSP00000361071:W122C	W	+	3	0	0	RPL7A	135207952	135207952	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	9.081000	0.94049	2.481000	0.83766	0.561000	0.74099	TGG	0.331104		TCGA-3A-A9I5-01A-11D-A38G-08	0.453	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054869.1	0	0	1		2	2		0	0	0	0	93	0	93	91	1	1.980000	-2.695887	1	0.330000	NM_000972		0	4	4	0	175	172	0	0	1	0	0	0	0	93	0	0	0.887285	1	0	0	0	7735	0	4	175
DMD	1756	broad.mit.edu	37	X	32867854	32867854	+	Silent	SNP	C	C	T			TCGA-3A-A9I5-01A-11D-A38G-08	TCGA-3A-A9I5-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	242cc845-981e-4772-af88-8e6ce84038ee	e3d88c3f-250b-4419-be51-02552fe0d73e	g.chrX:32867854C>T	ENST00000357033.4	-	3	383	c.177G>A	c.(175-177)ggG>ggA	p.G59G	DMD_ENST00000288447.4_Silent_p.G51G|DMD_ENST00000378677.2_Silent_p.G55G|snoU13_ENST00000459244.1_RNA	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	59	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.		Missing (in BMD).		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCAGTTTTTGCCCTGTCAGGC	0.383																																						ENST00000357033.4	0.170000	0.020000	0.130000	0.040000	0.070000	0.090142	0.070000	0.070000																										0				77						c.(175-177)ggG>ggA		dystrophin							74.0	69.0	71.0					X																	32867854		2202	4300	6502	SO:0001819	synonymous_variant	1756	0	0					g.chrX:32867854C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.177G>A	chrX.hg19:g.32867854C>T							DMD_ENST00000288447.4_Silent_p.G51G|snoU13_ENST00000459244.1_RNA|DMD_ENST00000378677.2_Silent_p.G55G	p.G59G	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	0	1	1		P11532	DMD_HUMAN		3	383	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	0	1	hg19	c.177G>A	CCDS14233.1	0																																																																																								0.330000		TCGA-3A-A9I5-01A-11D-A38G-08	0.383	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	0	0	1		2	2		0	0	0	0	76	0	76	75	1	1.980000	-2.594059	1	0.330000	NM_004006		0	4	4	0	160	157	0	0	1		0	0	0	76	0	0	0.886972	0	0	0	0	0	0	4	160
