#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
WFIKKN2	124857	broad.mit.edu	37	17	48917574	48917580	+	Frame_Shift_Del	DEL	CAGGCTG	CAGGCTG	-			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:48917574_48917580delCAGGCTG	ENST00000311378.4	+	2	1453_1459	c.925_931delCAGGCTG	c.(925-933)caggctgcafs	p.QAA309fs	WFIKKN2_ENST00000426127.1_Frame_Shift_Del_p.QAA216fs|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	309					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A311S(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CAGGGGTCATCAGGCTGCAGCCACCTC	0.657																																						ENST00000311378.4	1.000000	0.350000	6.500000e-01	4.300000e-01	0.530000	0.552593	0.530000	0.530000																										1	Substitution - Missense(1)	p.A311S(1)	lung(1)	29						c.(925-933)caggctgcafs		WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2																																				SO:0001589	frameshift_variant	124857	0	0					g.chr17:48917574_48917580delCAGGCTG	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.925_931delCAGGCTG	chr17.hg19:g.48917574_48917580delCAGGCTG	ENSP00000311184:p.Gln309fs	0					WFIKKN2_ENST00000426127.1_Frame_Shift_Del_p.QAA216fs|RP11-506D12.5_ENST00000572491.2_RNA	p.QAA309fs	NM_175575.5	NP_783165.1	1	2	3	2.053906	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)	2	1453_1459	+			Q6UXZ9	Frame_Shift_Del	DEL	ENST00000311378.4	1	1	hg19	c.925_931delCAGGCTG	CCDS11575.1	0																																																																																								0.304175		TCGA-3A-A9I9-01A-11D-A38G-08	0.657	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	1	0	1		30			0	0	0	7	122	0	122	128	1	1.870000	-20.000000	1	0.300000	NM_175575		0	25	36	0	294	302	0	0	1	0	0	0	0	0	0	0	0.363067	0	0	0	0	0	0	25	294
MUC16	94025	broad.mit.edu	37	19	9086442	9086457	+	Frame_Shift_Del	DEL	GCTGGACTCTGTCCTT	GCTGGACTCTGTCCTT	-			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:9086442_9086457delGCTGGACTCTGTCCTT	ENST00000397910.4	-	1	5561_5576	c.5358_5373delAAGGACAGAGTCCAGC	c.(5356-5373)gcaaggacagagtccagcfs	p.ARTESS1786fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1786	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGTAGCTGAGCTGGACTCTGTCCTTGCTGAAGACT	0.468																																						ENST00000397910.4	0.690000	0.350000	6.000000e-01	4.200000e-01	0.500000	0.518962	0.500000	0.500000																										0				590						c.(5356-5373)gcaaggacagagtccagcfs		mucin 16, cell surface associated																																				SO:0001589	frameshift_variant	94025	0	0					g.chr19:9086442_9086457delGCTGGACTCTGTCCTT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5358_5373delAAGGACAGAGTCCAGC	chr19.hg19:g.9086442_9086457delGCTGGACTCTGTCCTT	ENSP00000381008:p.Ala1786fs	0						p.ARTESS1786fs	NM_024690.2	NP_078966.2	0	0	0	2.018298	Q8WXI7	MUC16_HUMAN		1	5561_5576	-			Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	ENST00000397910.4	0	1	hg19	c.5358_5373delAAGGACAGAGTCCAGC	CCDS54212.1	0																																																																																								0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1		36			0	0	0	3	67	0	67	69	1	1.870000	-9.043442	1	0.300000	NM_024690		0	30	63	0	359	388	0	0	1	0	0	0	0	0	0	0	0.490149	0	0	0	0	0	0	30	359
PDCD11	22984	broad.mit.edu	37	10	105158241	105158241	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr10:105158241G>C	ENST00000369797.3	+	2	152	c.58G>C	c.(58-60)Gag>Cag	p.E20Q	USMG5_ENST00000369815.1_5'Flank|USMG5_ENST00000369825.1_5'Flank|USMG5_ENST00000309579.3_5'Flank|USMG5_ENST00000337003.4_5'Flank|USMG5_ENST00000369811.1_5'Flank	NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	20					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCACAAACCAGAGAAAGCTTT	0.418																																						ENST00000369797.3	1.000000	0.780000	1	9.300000e-01	0.990000	0.973968	0.990000	1.000000																										0				64						c.(58-60)Gag>Cag		programmed cell death 11							138.0	128.0	131.0					10																	105158241		2203	4300	6503	SO:0001583	missense	22984	0	0					g.chr10:105158241G>C	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.58G>C	chr10.hg19:g.105158241G>C	ENSP00000358812:p.Glu20Gln	0					USMG5_ENST00000369825.1_5'Flank|USMG5_ENST00000369815.1_5'Flank|USMG5_ENST00000369811.1_5'Flank|USMG5_ENST00000337003.4_5'Flank|USMG5_ENST00000309579.3_5'Flank	p.E20Q	NM_014976.1	NP_055791.1	1	2	3	2.064640	Q14690	RRP5_HUMAN		2	152	+		Colorectal(252;0.0747)|Breast(234;0.128)	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	1	1	hg19	c.58G>C	CCDS31276.1	1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462398	0.43736	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.13420	2.59	5.3	5.3	0.74995	5.3	5.3	0.74995	.	0.452187	0.25628	N	0.029371	T	0.17619	0.0423	M	0.69523	2.12	0.26868	N	0.967807	B	0.32620	0.378	B	0.36289	0.221	T	0.11842	-1.0571	10	0.29301	T	0.29	-23.9668	9.3697	0.38246	0.1602:0.0:0.8398:0.0	.	20	Q14690	RRP5_HUMAN	Q	20	ENSP00000358812:E20Q	ENSP00000358812:E20Q	E	+	1	0	0	PDCD11	105148231	105148231	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	4.614000	0.61183	2.499000	0.84300	0.555000	0.69702	GAG	0.305211		TCGA-3A-A9I9-01A-11D-A38G-08	0.418	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1	1	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	1.870000	-20.000000	1	0.300000			0	34	34	0	175	171	1		1	0		0	0	81	0	0	1.000000	6.090767e-01	0	1	0	11	0	34	175
ARHGAP21	57584	broad.mit.edu	37	10	24908567	24908567	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr10:24908567G>A	ENST00000396432.2	-	9	2743	c.2257C>T	c.(2257-2259)Cat>Tat	p.H753Y	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.H540Y	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	752					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TAAGACTGATGCCTTAAAGGC	0.473																																						ENST00000396432.2	1.000000	0.710000	9.900000e-01	7.900000e-01	0.890000	0.891799	0.890000	1.000000																										0				78						c.(2257-2259)Cat>Tat		Rho GTPase activating protein 21							108.0	105.0	106.0					10																	24908567		2203	4300	6503	SO:0001583	missense	57584	1	121412	31				g.chr10:24908567G>A	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.2257C>T	chr10.hg19:g.24908567G>A	ENSP00000379709:p.His753Tyr	0					ARHGAP21_ENST00000320481.6_Missense_Mutation_p.H540Y	p.H753Y	NM_020824.3	NP_065875.3	0	1	1	2.031517	Q5T5U3	RHG21_HUMAN		9	2743	-			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	1	1	hg19	c.2257C>T	CCDS7144.2	1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307576	0.81247	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.162808	0.53938	D	0.000044	T	0.64560	0.2609	M	0.70595	2.14	0.42876	D	0.994156	D;D	0.64830	0.989;0.994	P;P	0.57152	0.814;0.656	T	0.67925	-0.5544	10	0.54805	T	0.06	.	18.8879	0.92387	0.0:0.0:1.0:0.0	.	743;752	F8W9U9;Q5T5U3	.;RHG21_HUMAN	Y	753;540;743;753;588	ENSP00000379709:H753Y;ENSP00000365604:H540Y;ENSP00000365592:H743Y;ENSP00000405018:H753Y	ENSP00000365604:H540Y	H	-	1	0	0	ARHGAP21	24948573	24948573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.340000	0.97038	2.509000	0.84616	0.655000	0.94253	CAT	0.297894		TCGA-3A-A9I9-01A-11D-A38G-08	0.473	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	1	0	1	2	2	2	2	0	0	0	0	162	162	162	160	1	1.870000	-20.000000	1	0.300000	NM_020824		0	75	72	0	482	468	1		1	1		0	0	162	0	0	1.000000	4.970817e-01	0	4	0	8	0	75	482
CDH23	64072	broad.mit.edu	37	10	73377087	73377087	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr10:73377087C>T	ENST00000224721.6	+	10	1091	c.1086C>T	c.(1084-1086)atC>atT	p.I362I	CDH23_ENST00000299366.7_Silent_p.I402I|CDH23_ENST00000398809.4_Silent_p.I357I|CDH23_ENST00000398842.3_Silent_p.I357I|CDH23_ENST00000461841.3_Silent_p.I402I	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	357	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GCGTGGCCATCACTGAGCTGG	0.557																																						ENST00000224721.6	1.000000	0.050000	2.700000e-01	9.000000e-02	0.160000	0.211375	0.160000	0.150000																										0				133						c.(1084-1086)atC>atT		cadherin-related 23							77.0	81.0	79.0					10																	73377087		2193	4289	6482	SO:0001819	synonymous_variant	64072	1	121318	34				g.chr10:73377087C>T	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.1086C>T	chr10.hg19:g.73377087C>T		0					CDH23_ENST00000461841.3_Silent_p.I402I|CDH23_ENST00000398809.4_Silent_p.I357I|CDH23_ENST00000299366.7_Silent_p.I402I|CDH23_ENST00000398842.3_Silent_p.I357I	p.I362I	NM_022124.5	NP_071407.4	1	2	3	2.064640	Q9H251	CAD23_HUMAN		10	1091	+			C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	0	1	hg19	c.1086C>T		0																																																																																								0.305211		TCGA-3A-A9I9-01A-11D-A38G-08	0.557	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	0	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	1.870000	-5.855426	1	0.300000	NM_052836		0	4	4	0	178	171	0		1	0		0	0	97	0	0	0.881827	0	0	0	0	1	0	4	178
CDH23	64072	broad.mit.edu	37	10	73545428	73545428	+	Missense_Mutation	SNP	G	G	A	rs115113440	byFrequency	TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr10:73545428G>A	ENST00000224721.6	+	43	5773	c.5768G>A	c.(5767-5769)cGg>cAg	p.R1923Q		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1918	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GACCGCGAGCGGATCCCAGAG	0.597													G|||	11	0.00219649	0.0083	0.0	5008	,	,		20424	0.0		0.0	False		,,,				2504	0.0					ENST00000224721.6	1.000000	0.550000	1	7.600000e-01	0.990000	0.910611	0.990000	1.000000																										0				133						c.(5767-5769)cGg>cAg		cadherin-related 23		G	GLN/ARG	18,4196		0,18,2089	48.0	54.0	52.0		5753	2.3	1.0	10	dbSNP_132	52	0,8414		0,0,4207	yes	missense	CDH23	NM_022124.5	43	0,18,6296	AA,AG,GG		0.0,0.4271,0.1425	benign	1918/3355	73545428	18,12610	2107	4207	6314	SO:0001583	missense	64072	68	121044	46				g.chr10:73545428G>A	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.5768G>A	chr10.hg19:g.73545428G>A	ENSP00000224721:p.Arg1923Gln	0						p.R1923Q	NM_022124.5	NP_071407.4	1	2	3	2.064640	Q9H251	CAD23_HUMAN		43	5773	+			C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	1	1	hg19	c.5768G>A		1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	G	12.73	2.024660	0.35701	0.004271	0.0	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.2	2.33	0.28932	5.2	2.33	0.28932	Cadherin (4);Cadherin-like (1);	0.074456	0.53938	D	0.000048	T	0.18173	0.0436	N	0.05510	-0.035	0.80722	D	1	B	0.22683	0.073	B	0.18871	0.023	T	0.03287	-1.1052	9	0.15499	T	0.54	.	5.4098	0.16342	0.2787:0.0:0.592:0.1293	.	1918	Q9H251	CAD23_HUMAN	Q	1923;1918;1921	.	ENSP00000224721:R1923Q	R	+	2	0	0	CDH23	73215434	73215434	0.999000	0.42202	0.991000	0.47740	0.646000	0.38490	0.633000	0.24598	0.208000	0.20626	-0.380000	0.06706	CGG	0.305211		TCGA-3A-A9I9-01A-11D-A38G-08	0.597	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.870000	-3.883401	1	0.300000	NM_052836		0	11	11	0	63	60	1		1	0		0	0	44	0	0	0.998438	2.665755e-02	0	0	0	2	0	11	63
SYNPO2L	79933	broad.mit.edu	37	10	75407582	75407582	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr10:75407582G>C	ENST00000394810.2	-	4	1977	c.1828C>G	c.(1828-1830)Cgc>Ggc	p.R610G	SYNPO2L_ENST00000372873.4_Missense_Mutation_p.R386G	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	610	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CGCTGCTCGCGAGCGCTGGGG	0.706																																						ENST00000394810.2	1.000000	0.860000	1	9.900000e-01	0.990000	0.988590	0.990000	1.000000																										0				26						c.(1828-1830)Cgc>Ggc		synaptopodin 2-like							22.0	27.0	26.0					10																	75407582		2001	4159	6160	SO:0001583	missense	79933	0	0					g.chr10:75407582G>C	AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.1828C>G	chr10.hg19:g.75407582G>C	ENSP00000378289:p.Arg610Gly	0					SYNPO2L_ENST00000372873.4_Missense_Mutation_p.R386G	p.R610G	NM_001114133.1	NP_001107605.1	1	2	3	2.064640	Q9H987	SYP2L_HUMAN		4	1977	-	Prostate(51;0.0112)		A5PKV9|Q68A20	Missense_Mutation	SNP	ENST00000394810.2	1	1	hg19	c.1828C>G	CCDS44438.1	1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805525	0.50315	.	.	ENSG00000166317	ENST00000372873;ENST00000394810	T;T	0.27402	1.67;1.98	5.02	3.05	0.35203	5.02	3.05	0.35203	.	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	L	0.50333	1.59	0.43608	D	0.995978	D;D	0.89917	1.0;1.0	D;D	0.79784	0.98;0.993	T	0.31696	-0.9934	10	0.33141	T	0.24	-16.451	12.8585	0.57899	0.0:0.0:0.4834:0.5165	.	610;386	Q9H987;Q9H987-2	SYP2L_HUMAN;.	G	386;610	ENSP00000361964:R386G;ENSP00000378289:R610G	ENSP00000361964:R386G	R	-	1	0	0	SYNPO2L	75077588	75077588	0.221000	0.23642	0.834000	0.33040	0.795000	0.44927	0.966000	0.29331	1.313000	0.45069	0.549000	0.68633	CGC	0.305211		TCGA-3A-A9I9-01A-11D-A38G-08	0.706	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316562.2	1	0	1	2	2	2	2	0	0	0	0	145	145	145	142	1	1.870000	-20.000000	1	0.300000	NM_024875		0	51	48	0	252	247	0		1			0	0	145	0	0	1.000000	0	0	0	0	0	0	51	252
MKI67	4288	broad.mit.edu	37	10	129903384	129903384	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr10:129903384C>G	ENST00000368654.3	-	13	7095	c.6720G>C	c.(6718-6720)aaG>aaC	p.K2240N	MKI67_ENST00000368653.3_Missense_Mutation_p.K1880N	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2240	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGAGACTTCTCTTGGACTGTG	0.498																																						ENST00000368654.3	1.000000	0.930000	1	9.900000e-01	0.990000	0.994600	0.990000	1.000000																										0				159						c.(6718-6720)aaG>aaC		marker of proliferation Ki-67							264.0	253.0	257.0					10																	129903384		2203	4300	6503	SO:0001583	missense	4288	0	0					g.chr10:129903384C>G	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6720G>C	chr10.hg19:g.129903384C>G	ENSP00000357643:p.Lys2240Asn	0					MKI67_ENST00000368653.3_Missense_Mutation_p.K1880N	p.K2240N	NM_002417.4	NP_002408.3	0	0	0	2.005016	P46013	KI67_HUMAN		13	7095	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	1	1	hg19	c.6720G>C	CCDS7659.1	1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061815	0.36373	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03635	3.86;3.86	3.07	2.15	0.27550	3.07	2.15	0.27550	.	0.672301	0.12961	N	0.425010	T	0.12433	0.0302	M	0.68952	2.095	0.09310	N	1	D;D;D	0.76494	0.991;0.992;0.999	P;D;D	0.72982	0.8;0.921;0.979	T	0.12066	-1.0562	10	0.30078	T	0.28	.	8.7284	0.34483	0.0:0.8779:0.0:0.1221	.	2239;1880;2240	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	N	2240;1880;2239	ENSP00000357643:K2240N;ENSP00000357642:K1880N	ENSP00000357642:K1880N	K	-	3	2	2	MKI67	129793374	129793374	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.058000	0.14301	1.716000	0.51395	0.561000	0.74099	AAG	0.287169		TCGA-3A-A9I9-01A-11D-A38G-08	0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	1	0	1	2	2	2	2	0	0	0	0	335	335	335	325	1	1.870000	-20.000000	1	0.300000	NM_002417		0	226	219	0	1167	1126	1		1	1		0	0	335	0	0	1.000000	7.578585e-01	0	8	0	8	0	226	1167
TECTA	7007	broad.mit.edu	37	11	121028674	121028674	+	Missense_Mutation	SNP	G	G	A	rs527976707		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr11:121028674G>A	ENST00000392793.1	+	14	4701	c.4430G>A	c.(4429-4431)cGc>cAc	p.R1477H	TECTA_ENST00000264037.2_Missense_Mutation_p.R1477H			O75443	TECTA_HUMAN	tectorin alpha	1477					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AACGGGGTGCGCGGCTGCTTC	0.687													G|||	1	0.000199681	0.0	0.0	5008	,	,		11888	0.0		0.0	False		,,,				2504	0.001					ENST00000392793.1	1.000000	0.680000	1	8.000000e-01	0.940000	0.918206	0.940000	1.000000																									TECTA/TBCEL(2)	0				135						c.(4429-4431)cGc>cAc		tectorin alpha							40.0	37.0	38.0					11																	121028674		2203	4298	6501	SO:0001583	missense	7007	5	121338	36				g.chr11:121028674G>A	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4430G>A	chr11.hg19:g.121028674G>A	ENSP00000376543:p.Arg1477His	0					TECTA_ENST00000264037.2_Missense_Mutation_p.R1477H	p.R1477H			1	2	3	2.118814	O75443	TECTA_HUMAN		14	4701	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		Missense_Mutation	SNP	ENST00000392793.1	1	1	hg19	c.4430G>A	CCDS8434.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397066	0.83120	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.04970	3.52;3.52	5.69	5.69	0.88448	5.69	5.69	0.88448	von Willebrand factor, type D domain (1);VWC out (1);	0.000000	0.85682	D	0.000000	T	0.16385	0.0394	L	0.31926	0.97	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.17137	-1.0379	10	0.14656	T	0.56	.	19.8006	0.96506	0.0:0.0:1.0:0.0	.	1477	O75443	TECTA_HUMAN	H	1477	ENSP00000376543:R1477H;ENSP00000264037:R1477H	ENSP00000264037:R1477H	R	+	2	0	0	TECTA	120533884	120533884	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.508000	0.98000	2.687000	0.91594	0.462000	0.41574	CGC	0.314398		TCGA-3A-A9I9-01A-11D-A38G-08	0.687	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	1	0	1	2	2	2	2	0	0	0	0	123	123	123	121	1	1.870000	-20.000000	1	0.300000	NM_005422		0	39	39	0	247	239	1		1	0		0	0	123	0	0	1.000000	0	0	0	0	1	0	39	247
OR4B1	119765	broad.mit.edu	37	11	48238701	48238701	+	Missense_Mutation	SNP	G	G	A	rs377574489		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr11:48238701G>A	ENST00000309562.2	+	1	358	c.340G>A	c.(340-342)Gtg>Atg	p.V114M		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V114L(1)		breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						CCTTTTGATTGTGGTGATGGC	0.443																																						ENST00000309562.2	1.000000	0.820000	1	9.000000e-01	0.980000	0.962266	0.980000	1.000000																										1	Substitution - Missense(1)	p.V114L(1)	lung(1)	28						c.(340-342)Gtg>Atg		olfactory receptor, family 4, subfamily B, member 1							163.0	157.0	159.0					11																	48238701		2201	4298	6499	SO:0001583	missense	119765	0	0					g.chr11:48238701G>A	AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.340G>A	chr11.hg19:g.48238701G>A	ENSP00000311605:p.Val114Met	0						p.V114M	NM_001005470.1	NP_001005470.1	0	0	0	2.030180	Q8NGF8	OR4B1_HUMAN		1	358	+			Q6IF75|Q96R64	Missense_Mutation	SNP	ENST00000309562.2	1	1	hg19	c.340G>A	CCDS31485.1	1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350283	0.41599	.	.	ENSG00000175619	ENST00000309562	T	0.00502	6.95	5.24	0.588	0.17445	5.24	0.588	0.17445	GPCR, rhodopsin-like superfamily (1);	0.647154	0.13543	N	0.380012	T	0.00637	0.0021	L	0.33710	1.025	0.09310	N	1	P	0.42248	0.774	P	0.52909	0.713	T	0.53830	-0.8383	10	0.56958	D	0.05	.	8.0126	0.30361	0.4392:0.0:0.5608:0.0	.	114	Q8NGF8	OR4B1_HUMAN	M	114	ENSP00000311605:V114M	ENSP00000311605:V114M	V	+	1	0	0	OR4B1	48195277	48195277	0.000000	0.05858	0.407000	0.26434	0.736000	0.42039	-0.124000	0.10595	0.199000	0.20427	0.385000	0.25706	GTG	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.443	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390554.1	1	0	0	2	2	2	2	0	0	0	0	147	147	147	143	1	1.870000	-20.000000	1	0.300000	NM_001005470		0	104	102	0	590	577	1		1			0	0	147	0	0	1.000000	0	0	0	0	0	0	104	590
SMTNL1	219537	broad.mit.edu	37	11	57311123	57311123	+	Silent	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr11:57311123G>A	ENST00000399154.2	+	3	648	c.648G>A	c.(646-648)caG>caA	p.Q216Q	SMTNL1_ENST00000457912.1_Silent_p.Q271Q|SMTNL1_ENST00000527972.1_Silent_p.Q253Q			A8MU46	SMTL1_HUMAN	smoothelin-like 1	216	Glu-rich.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GCGAAGAGCAGGAGCAGGACG	0.607																																						ENST00000399154.2	1.000000	0.580000	1	7.800000e-01	0.990000	0.922032	0.990000	1.000000																										0				8						c.(646-648)caG>caA		smoothelin-like 1							19.0	22.0	21.0					11																	57311123		2042	4200	6242	SO:0001819	synonymous_variant	219537	2	120812	18				g.chr11:57311123G>A	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.648G>A	chr11.hg19:g.57311123G>A		0					SMTNL1_ENST00000527972.1_Silent_p.Q253Q|SMTNL1_ENST00000457912.1_Silent_p.Q271Q	p.Q216Q			0	0	0	2.030180	A8MU46	SMTL1_HUMAN		3	648	+				Silent	SNP	ENST00000399154.2	1	1	hg19	c.648G>A		1																																																																																								0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.607	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	32	32	32	30	1	1.870000	-19.976210	1	0.300000	XM_166203		0	12	12	0	65	63	1		1	0		0	0	32	0	0	0.999266	7.572668e-02	0	0	0	3	0	12	65
DAGLA	747	broad.mit.edu	37	11	61508664	61508664	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr11:61508664G>A	ENST00000257215.5	+	19	2130	c.2014G>A	c.(2014-2016)Gct>Act	p.A672T		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	672					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GGGGAAGACCGCTCTGCTCTC	0.637																																						ENST00000257215.5	1.000000	0.720000	1	8.300000e-01	0.960000	0.931834	0.960000	1.000000																										0				43						c.(2014-2016)Gct>Act		diacylglycerol lipase, alpha							98.0	84.0	89.0					11																	61508664		2202	4299	6501	SO:0001583	missense	747	0	0					g.chr11:61508664G>A	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2014G>A	chr11.hg19:g.61508664G>A	ENSP00000257215:p.Ala672Thr	0						p.A672T	NM_006133.2	NP_006124.1	0	0	0	2.026767	Q9Y4D2	DGLA_HUMAN		19	2130	+			A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	1	1	hg19	c.2014G>A	CCDS31578.1	1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295157	0.60086	.	.	ENSG00000134780	ENST00000257215	T	0.29655	1.56	3.73	3.73	0.42828	3.73	3.73	0.42828	.	0.056336	0.64402	D	0.000001	T	0.43986	0.1272	L	0.34521	1.04	0.58432	D	0.999999	D	0.76494	0.999	D	0.72625	0.978	T	0.42949	-0.9421	10	0.48119	T	0.1	-13.0611	16.4468	0.83936	0.0:0.0:1.0:0.0	.	672	Q9Y4D2	DGLA_HUMAN	T	672	ENSP00000257215:A672T	ENSP00000257215:A672T	A	+	1	0	0	DAGLA	61265240	61265240	1.000000	0.71417	0.852000	0.33557	0.619000	0.37552	9.441000	0.97557	2.039000	0.60335	0.456000	0.33151	GCT	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.637	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	1	0	1	2	2	2	2	0	0	0	0	134	134	134	132	1	1.870000	-19.949590	1	0.300000	NM_006133		0	44	41	0	258	253	1		1	0		0	0	134	0	0	1.000000	1.614848e-01	0	0	0	5	0	44	258
CAPN5	726	broad.mit.edu	37	11	76833726	76833726	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr11:76833726C>T	ENST00000278559.3	+	12	1897	c.1708C>T	c.(1708-1710)Cgc>Tgc	p.R570C	CAPN5_ENST00000529629.1_Missense_Mutation_p.R570C|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000456580.2_Missense_Mutation_p.R610C	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	570	C2.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						CATCTTCTACCGCAAGAAGCT	0.567																																						ENST00000278559.3	1.000000	0.650000	1	7.700000e-01	0.920000	0.901151	0.920000	1.000000																										0				30						c.(1708-1710)Cgc>Tgc		calpain 5							127.0	111.0	116.0					11																	76833726		2200	4292	6492	SO:0001583	missense	726	18	121412	43				g.chr11:76833726C>T		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.1708C>T	chr11.hg19:g.76833726C>T	ENSP00000278559:p.Arg570Cys	0					CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Missense_Mutation_p.R570C|CAPN5_ENST00000456580.2_Missense_Mutation_p.R610C	p.R570C	NM_004055.4	NP_004046.2	0	0	0	2.026767	O15484	CAN5_HUMAN		12	1897	+			O00263	Missense_Mutation	SNP	ENST00000278559.3	1	1	hg19	c.1708C>T	CCDS8248.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988182	0.74589	.	.	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580	T;T;T	0.71103	-0.54;-0.54;-0.54	4.93	4.93	0.64822	4.93	4.93	0.64822	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.050653	0.85682	D	0.000000	T	0.81074	0.4747	M	0.62016	1.91	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.995;1.0	T	0.82692	-0.0331	10	0.87932	D	0	.	12.5828	0.56399	0.1658:0.8341:0.0:0.0	.	608;610;610;570	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	C	570;610;570;610	ENSP00000278559:R570C;ENSP00000432332:R570C;ENSP00000409996:R610C	ENSP00000278559:R570C	R	+	1	0	0	CAPN5	76511374	76511374	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.941000	0.49011	2.428000	0.82296	0.655000	0.94253	CGC	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.567	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	1	0	1	2	2	2	2	0	0	0	0	121	121	121	120	1	1.870000	-2.381871	0	0.300000	NM_004055		0	31	30	0	191	186	1		1	1		0	0	121	0	0	1.000000	9.999971e-01	0	54	0	74	0	31	191
UBASH3B	84959	broad.mit.edu	37	11	122667631	122667631	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr11:122667631G>A	ENST00000284273.5	+	9	1622	c.1247G>A	c.(1246-1248)cGc>cAc	p.R416H		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	416	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		CGCTACATACGCACCAACCTG	0.473																																						ENST00000284273.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999961	0.990000	1.000000																										0				26						c.(1246-1248)cGc>cAc		ubiquitin associated and SH3 domain containing B							169.0	135.0	146.0					11																	122667631		2202	4299	6501	SO:0001583	missense	84959	0	0					g.chr11:122667631G>A	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1247G>A	chr11.hg19:g.122667631G>A	ENSP00000284273:p.Arg416His	0						p.R416H	NM_032873.4	NP_116262.2	1	2	3	2.118814	Q8TF42	UBS3B_HUMAN		9	1622	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	1	1	hg19	c.1247G>A	CCDS31694.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881504	0.91740	.	.	ENSG00000154127	ENST00000284273	T	0.07567	3.18	6.05	5.14	0.70334	6.05	5.14	0.70334	Histidine phosphatase superfamily, clade-1 (1);	0.000000	0.85682	D	0.000000	T	0.31702	0.0805	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.10660	-1.0620	10	0.72032	D	0.01	-25.6525	15.3314	0.74215	0.0666:0.0:0.9334:0.0	.	416	Q8TF42	UBS3B_HUMAN	H	416	ENSP00000284273:R416H	ENSP00000284273:R416H	R	+	2	0	0	UBASH3B	122172841	122172841	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.368000	0.97152	1.577000	0.49804	0.650000	0.86243	CGC	0.314398		TCGA-3A-A9I9-01A-11D-A38G-08	0.473	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	1	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	1.870000	-3.454717	1	0.300000	NM_032873		0	73	72	0	281	275	1		1	1		0	0	90	0	0	1.000000	6.947207e-01	0	2	0	9	0	73	281
NOS1	4842	broad.mit.edu	37	12	117693813	117693813	+	Missense_Mutation	SNP	C	C	T	rs188094607	byFrequency	TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr12:117693813C>T	ENST00000338101.4	-	16	2565	c.2561G>A	c.(2560-2562)cGt>cAt	p.R854H	NOS1_ENST00000344089.3_Intron|NOS1_ENST00000317775.6_Intron			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		AGGCCCTTTACGGGGAAAGAA	0.602													C|||	4	0.000798722	0.0008	0.0014	5008	,	,		18820	0.0		0.001	False		,,,				2504	0.001				Esophageal Squamous(162;1748 2599 51982 52956)	ENST00000338101.4	1.000000	0.700000	1	7.900000e-01	0.890000	0.895737	0.890000	1.000000																										0				117						c.(2560-2562)cGt>cAt		nitric oxide synthase 1 (neuronal)		C	,,,HIS/ARG	1,1751		0,1,875	155.0	140.0	145.0		,,,2561	5.9	1.0	12		145	2,3980		0,2,1989	yes	intron,intron,intron,missense	NOS1	NM_000620.4,NM_001204213.1,NM_001204214.1,NM_001204218.1	,,,29	0,3,2864	TT,TC,CC		0.0502,0.0571,0.0523	,,,	,,,854/1469	117693813	3,5731	876	1991	2867	SO:0001583	missense	4842	62	116018	50				g.chr12:117693813C>T		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2561G>A	chr12.hg19:g.117693813C>T	ENSP00000337459:p.Arg854His	0					NOS1_ENST00000317775.6_Intron|NOS1_ENST00000344089.3_Intron	p.R854H			0	0	0	2.026697	Q8WY41	NANO1_HUMAN		16	2565	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			Missense_Mutation	SNP	ENST00000338101.4	1	1	hg19	c.2561G>A	CCDS55890.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	24.6	4.549961	0.86127	5.71E-4	5.02E-4	ENSG00000089250	ENST00000338101;ENST00000544320	T	0.01388	4.95	5.93	5.93	0.95920	5.93	5.93	0.95920	.	.	.	.	.	T	0.02455	0.0075	N	0.24115	0.695	0.80722	D	1	.	.	.	.	.	.	T	0.73132	-0.4079	7	0.29301	T	0.29	-6.7644	15.854	0.78960	0.0:1.0:0.0:0.0	.	.	.	.	H	854;20	ENSP00000337459:R854H	ENSP00000337459:R854H	R	-	2	0	0	NOS1	116178196	116178196	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.549000	0.53681	2.826000	0.97356	0.655000	0.94253	CGT	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.602	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1	1	0	1	2	2	2	2	0	0	0	0	131	131	131	131	1	1.870000	-3.075786	1	0.300000			0	61	61	0	387	373	1		1			0	0	131	0	0	1.000000	0	0	0	0	0	0	61	387
FGF6	2251	broad.mit.edu	37	12	4554454	4554454	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr12:4554454C>T	ENST00000228837.2	-	1	326	c.283G>A	c.(283-285)Ggc>Agc	p.G95S		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	95					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			AGGTGAAAGCCGATGCCCACG	0.652																																						ENST00000228837.2	1.000000	0.840000	1	9.900000e-01	0.990000	0.986820	0.990000	1.000000																										0				20						c.(283-285)Ggc>Agc		fibroblast growth factor 6							67.0	58.0	61.0					12																	4554454		2203	4300	6503	SO:0001583	missense	2251	0	0					g.chr12:4554454C>T	X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.283G>A	chr12.hg19:g.4554454C>T	ENSP00000228837:p.Gly95Ser	1						p.G95S	NM_020996.1	NP_066276.2	0	2	2	2.055419	P10767	FGF6_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	1	326	-			Q0VAE1	Missense_Mutation	SNP	ENST00000228837.2	1	1	hg19	c.283G>A	CCDS8527.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.310723	0.95629	.	.	ENSG00000111241	ENST00000228837	D	0.82526	-1.62	5.3	5.3	0.74995	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.92166	0.7516	M	0.85462	2.755	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.93036	0.6453	10	0.87932	D	0	.	19.3285	0.94273	0.0:1.0:0.0:0.0	.	95	P10767	FGF6_HUMAN	S	95	ENSP00000228837:G95S	ENSP00000228837:G95S	G	-	1	0	0	FGF6	4424715	4424715	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.636000	0.89361	0.655000	0.94253	GGC	0.300000		TCGA-3A-A9I9-01A-11D-A38G-08	0.652	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	1	0	1	2	2	2	2	0	0	0	0	98	98	98	98	1	1.870000	-20.000000	1	0.300000	NM_020996		0	38	37	0	181	178	1		1			0	0	98	0	0	1.000000	0	0	0	0	0	0	38	181
C1S	716	broad.mit.edu	37	12	7172426	7172426	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr12:7172426C>A	ENST00000406697.1	+	9	1168	c.540C>A	c.(538-540)ttC>ttA	p.F180L	C1S_ENST00000328916.3_Missense_Mutation_p.F180L|C1S_ENST00000402681.3_Missense_Mutation_p.F13L|C1S_ENST00000360817.5_Missense_Mutation_p.F180L			P09871	C1S_HUMAN	complement component 1, s subcomponent	180	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GGGATGTATTCACTGCACTGA	0.428																																					GBM(156;750 1943 12971 24779 31015)	ENST00000406697.1	1.000000	0.830000	1	9.300000e-01	0.990000	0.977571	0.990000	1.000000																										0				33						c.(538-540)ttC>ttA		complement component 1, s subcomponent	Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)						95.0	92.0	93.0					12																	7172426		2203	4300	6503	SO:0001583	missense	716	0	0					g.chr12:7172426C>A		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.540C>A	chr12.hg19:g.7172426C>A	ENSP00000385035:p.Phe180Leu	1					C1S_ENST00000328916.3_Missense_Mutation_p.F180L|C1S_ENST00000360817.5_Missense_Mutation_p.F180L|C1S_ENST00000402681.3_Missense_Mutation_p.F13L	p.F180L			0	3	3	2.377243	P09871	C1S_HUMAN		9	1168	+			D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	ENST00000406697.1	1	1	hg19	c.540C>A	CCDS31735.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195206	0.78902	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000382222;ENST00000402681;ENST00000542978	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	6.17	3.05	0.35203	6.17	3.05	0.35203	CUB (5);	0.000000	0.44483	D	0.000450	T	0.17152	0.0412	L	0.28054	0.825	0.36787	D	0.884655	P	0.39551	0.678	P	0.51777	0.679	T	0.18555	-1.0333	10	0.13853	T	0.58	.	8.1984	0.31411	0.0:0.6461:0.0:0.3539	.	180	P09871	C1S_HUMAN	L	180;180;180;169;13;13	ENSP00000385035:F180L;ENSP00000328173:F180L;ENSP00000354057:F180L;ENSP00000384171:F13L;ENSP00000442298:F13L	ENSP00000328173:F180L	F	+	3	2	2	C1S	7042687	7042687	1.000000	0.71417	0.972000	0.41901	0.871000	0.50021	0.473000	0.22132	0.941000	0.37499	0.655000	0.94253	TTC	0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.428	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	1	0	1	2	2	2	2	0	0	0	0	100	100	100	97	1	1.870000	-20.000000	1	0.300000	NM_001734		0	72	71	0	454	445	1		1	0		0	0	100	0	0	1.000000	1	0	0	0	239	0	72	454
C1RL	51279	broad.mit.edu	37	12	7254607	7254607	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr12:7254607C>T	ENST00000266542.4	-	3	469	c.377G>A	c.(376-378)aGg>aAg	p.R126K	C1RL_ENST00000545280.1_Missense_Mutation_p.G50R|C1RL_ENST00000545337.1_Missense_Mutation_p.R126K|C1RL_ENST00000544702.1_Missense_Mutation_p.R126K	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	126	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TACAAACTCCCTCTGACCAGG	0.607																																						ENST00000266542.4			0	0																														0				16						c.(376-378)aGg>aAg		complement component 1, r subcomponent-like							102.0	103.0	102.0					12																	7254607		2203	4300	6503	SO:0001583	missense	51279	0	0					g.chr12:7254607C>T	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.377G>A	chr12.hg19:g.7254607C>T	ENSP00000266542:p.Arg126Lys						C1RL_ENST00000545280.1_Missense_Mutation_p.G50R|C1RL_ENST00000544702.1_Missense_Mutation_p.R126K|C1RL_ENST00000545337.1_Missense_Mutation_p.R126K	p.R126K	NM_016546.2	NP_057630.2					Q9NZP8	C1RL_HUMAN		3	469	-			Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	1	1	hg19	c.377G>A	CCDS8573.1		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.321|3.321	-0.138671|-0.138671	0.06669|0.06669	.|.	.|.	ENSG00000139178|ENSG00000139178	ENST00000545280|ENST00000266542;ENST00000396661;ENST00000544702;ENST00000543933;ENST00000545337	.|T;T;T;T	.|0.16597	.|2.33;2.33;2.33;2.33	3.76|3.76	0.896|0.896	0.19253|0.19253	3.76|3.76	0.896|0.896	0.19253|0.19253	.|CUB (5);	.|0.544302	.|0.17177	.|N	.|0.184060	T|T	0.05547|0.05547	0.0146|0.0146	N|N	0.05574|0.05574	-0.02|-0.02	0.28959|0.28959	N|N	0.889922|0.889922	.|B;B;B	.|0.23990	.|0.095;0.004;0.001	.|B;B;B	.|0.20184	.|0.028;0.007;0.003	T|T	0.37753|0.37753	-0.9692|-0.9692	5|10	.|0.07030	.|T	.|0.85	.|.	3.4791|3.4791	0.07595|0.07595	0.1981:0.5841:0.0:0.2179|0.1981:0.5841:0.0:0.2179	.|.	.|126;126;126	.|F5GWF3;F5H7C8;Q9NZP8	.|.;.;C1RL_HUMAN	R|K	50|126	.|ENSP00000266542:R126K;ENSP00000441885:R126K;ENSP00000437398:R126K;ENSP00000442611:R126K	.|ENSP00000266542:R126K	G|R	-|-	1|2	0|0	0|0	C1RL|C1RL	7145883|7145883	7145883|7145883	0.033000|0.033000	0.19621|0.19621	0.979000|0.979000	0.43373|0.43373	0.888000|0.888000	0.51559|0.51559	-0.382000|-0.382000	0.07408|0.07408	0.183000|0.183000	0.20059|0.20059	0.462000|0.462000	0.41574|0.41574	GGG|AGG			TCGA-3A-A9I9-01A-11D-A38G-08	0.607	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	1	0	1	2	2	2	2	0	0	0	0	289	289	289	289	1	1.870000	-2.507496	1	0.300000	NM_016546		0	112	112	0	588	580	1		1	1		0	0	289	0	0	1.000000	9.859088e-01	0	2	0	35	0	112	588
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.820000	0.450000	7.300000e-01	5.300000e-01	0.620000	0.637571	0.620000	0.620000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	0	1	1	1.744959	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	106	106	106	106	1	1.870000	-14.467220	1	0.300000	NM_033360		2031	36	36	5987	286	282	1	1	1	0	1	0	0	106	222	1	1.000000	1.335233e-02	1	1	40	1	282	36	286
POLE	5426	broad.mit.edu	37	12	133240667	133240667	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr12:133240667C>G	ENST00000320574.5	-	23	2672	c.2629G>C	c.(2629-2631)Gtc>Ctc	p.V877L	POLE_ENST00000535270.1_Missense_Mutation_p.V850L	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	877					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GTCTTGAAGACAAAATTTTCT	0.517								DNA polymerases (catalytic subunits)																														ENST00000320574.5	1.000000	0.750000	1	8.800000e-01	0.990000	0.957505	0.990000	1.000000																										0				89						c.(2629-2631)Gtc>Ctc	DNA polymerases (catalytic subunits)	polymerase (DNA directed), epsilon, catalytic subunit	Cladribine(DB00242)						202.0	199.0	200.0					12																	133240667		2203	4300	6503	SO:0001583	missense	5426	0	0					g.chr12:133240667C>G		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2629G>C	chr12.hg19:g.133240667C>G	ENSP00000322570:p.Val877Leu	0					POLE_ENST00000535270.1_Missense_Mutation_p.V850L	p.V877L	NM_006231.2	NP_006222.2	0	0	0	2.026697	Q07864	DPOE1_HUMAN		23	2672	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	1	1	hg19	c.2629G>C	CCDS9278.1	1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357675	0.41801	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.13778	4.22;4.22;4.22;2.56	5.57	5.57	0.84162	5.57	5.57	0.84162	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.18593	0.0446	L	0.42245	1.32	0.58432	D	0.999996	P;B	0.36959	0.575;0.261	B;B	0.39876	0.312;0.243	T	0.00912	-1.1517	10	0.49607	T	0.09	.	19.5987	0.95551	0.0:1.0:0.0:0.0	.	850;877	F5H1D6;Q07864	.;DPOE1_HUMAN	L	877;888;850;657;812	ENSP00000322570:V877L;ENSP00000406383:V888L;ENSP00000445753:V850L;ENSP00000442519:V657L	ENSP00000322570:V877L	V	-	1	0	0	POLE	131750740	131750740	1.000000	0.71417	0.997000	0.53966	0.025000	0.11179	4.943000	0.63554	2.640000	0.89533	0.638000	0.83543	GTC	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.517	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	1	0	1	2	2	2	2	0	0	0	0	123	123	123	122	1	1.870000	-19.860310	1	0.300000	NM_006231		0	40	40	0	218	214	1		1	1		0	0	123	0	0	1.000000	7.347366e-01	0	4	0	12	0	40	218
TPP2	7174	broad.mit.edu	37	13	103301346	103301346	+	Silent	SNP	T	T	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr13:103301346T>A	ENST00000376065.4	+	22	2754	c.2718T>A	c.(2716-2718)ctT>ctA	p.L906L	TPP2_ENST00000376052.3_Silent_p.L906L	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	906					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTAAAGACCTTCCATTTATTG	0.338																																						ENST00000376065.4	1.000000	0.710000	1	8.000000e-01	0.900000	0.904532	0.900000	1.000000																										0				52						c.(2716-2718)ctT>ctA		tripeptidyl peptidase II							131.0	133.0	132.0					13																	103301346		2203	4300	6503	SO:0001819	synonymous_variant	7174	0	0					g.chr13:103301346T>A	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2718T>A	chr13.hg19:g.103301346T>A		1					TPP2_ENST00000376052.3_Silent_p.L906L	p.L906L	NM_003291.2	NP_003282.2	1	2	3	2.353886	P29144	TPP2_HUMAN		22	2754	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		Q5VZU8	Silent	SNP	ENST00000376065.4	1	1	hg19	c.2718T>A	CCDS9502.1	1																																																																																								0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.338	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2	1	0	1	2	2	2	2	0	0	0	0	88	88	88	87	1	1.870000	-20.000000	1	0.300000			0	65	64	0	482	471	1		1	1		0	0	88	0	0	1.000000	7.066586e-01	0	2	0	18	0	65	482
VTI1B	10490	broad.mit.edu	37	14	68118129	68118129	+	Silent	SNP	A	A	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr14:68118129A>C	ENST00000554659.1	-	6	1013	c.672T>G	c.(670-672)gtT>gtG	p.V224V	ARG2_ENST00000261783.3_3'UTR	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	224					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		ATTTGTAGTAAACCAGGCCTC	0.453																																						ENST00000554659.1	1.000000	0.760000	1	8.800000e-01	0.990000	0.956621	0.990000	1.000000																										0				5						c.(670-672)gtT>gtG		vesicle transport through interaction with t-SNAREs 1B							70.0	71.0	71.0					14																	68118129		2203	4300	6503	SO:0001819	synonymous_variant	10490	0	0					g.chr14:68118129A>C	AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.672T>G	chr14.hg19:g.68118129A>C		0					ARG2_ENST00000261783.3_3'UTR	p.V224V	NM_006370.2	NP_006361.1	1	2	3	2.045233	Q9UEU0	VTI1B_HUMAN		6	1013	-			O43547|Q96J28	Silent	SNP	ENST00000554659.1	1	1	hg19	c.672T>G	CCDS9786.1	1	.	.	.	.	.	.	.	.	.	.	A	6.515	0.463167	0.12402	.	.	ENSG00000100568	ENST00000554636	.	.	.	6.17	-2.23	0.06930	6.17	-2.23	0.06930	.	.	.	.	.	T	0.50343	0.1610	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43376	-0.9395	4	.	.	.	.	6.4943	0.22133	0.3206:0.2838:0.3956:0.0	.	.	.	.	C	102	.	.	F	-	2	0	0	VTI1B	67187882	67187882	0.962000	0.33011	0.993000	0.49108	0.998000	0.95712	0.084000	0.14891	-0.288000	0.09051	0.533000	0.62120	TTT	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.453	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412558.2	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	1.870000	-20.000000	1	0.300000			0	47	46	0	263	259	0		1	1		0	0	67	0	0	1.000000	1	0	89	0	307	0	47	263
MAP3K9	4293	broad.mit.edu	37	14	71200060	71200060	+	Splice_Site	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr14:71200060C>G	ENST00000554752.2	-	11	2026		c.e11-1		MAP3K9_ENST00000554146.1_Splice_Site|MAP3K9_ENST00000555993.2_Splice_Site|MAP3K9_ENST00000553414.1_Splice_Site|MAP3K9_ENST00000381250.4_Splice_Site	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9						activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		tcctcatcctctgtgaagatg	0.542																																					GBM(114;411 1587 13539 28235 50070)	ENST00000554752.2	1.000000	0.510000	1	7.000000e-01	0.940000	0.879021	0.940000	1.000000																										0				46						c.e11-1		mitogen-activated protein kinase kinase kinase 9							25.0	27.0	26.0					14																	71200060		2201	4300	6501	SO:0001630	splice_region_variant	4293	0	0					g.chr14:71200060C>G	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.2027-1G>C	chr14.hg19:g.71200060C>G		0					MAP3K9_ENST00000553414.1_Splice_Site|MAP3K9_ENST00000554146.1_Splice_Site|MAP3K9_ENST00000381250.4_Splice_Site|MAP3K9_ENST00000555993.2_Splice_Site		NM_001284230.1	NP_001271159.1	1	2	3	2.045233	P80192	M3K9_HUMAN		11	2026	-			A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Splice_Site	SNP	ENST00000554752.2	0	1	hg19			1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578227	0.65878	.	.	ENSG00000006432	ENST00000542284	.	.	.	4.77	4.77	0.60923	4.77	4.77	0.60923	.	.	.	.	.	T	0.73892	0.3645	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73366	-0.4005	4	.	.	.	.	17.9928	0.89174	0.0:1.0:0.0:0.0	.	.	.	.	Q	392	.	.	E	-	1	0	0	MAP3K9	70269813	70269813	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.862000	0.69560	2.478000	0.83669	0.561000	0.74099	GAG	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.542	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2	0	0	1	2	2	2	2	0	0	0	0	36	36	36	34	1	1.870000	-19.378620	1	0.300000		Intron	0	11	11	0	68	68	1		1			0	0	36	0	0	0.998740	0	0	0	0	0	0	11	68
EML1	2009	broad.mit.edu	37	14	100374050	100374050	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr14:100374050G>C	ENST00000262233.6	+	10	1223	c.1084G>C	c.(1084-1086)Gaa>Caa	p.E362Q	EML1_ENST00000334192.4_Missense_Mutation_p.E381Q|EML1_ENST00000327921.9_Missense_Mutation_p.E350Q	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	362	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				GCAGAAAGAAGAAAAACTAGC	0.468																																						ENST00000262233.6	1.000000	0.740000	1	8.700000e-01	0.990000	0.952594	0.990000	1.000000																										0				42						c.(1084-1086)Gaa>Caa		echinoderm microtubule associated protein like 1							100.0	102.0	102.0					14																	100374050		2203	4300	6503	SO:0001583	missense	2009	0	0					g.chr14:100374050G>C	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.1084G>C	chr14.hg19:g.100374050G>C	ENSP00000262233:p.Glu362Gln	0					EML1_ENST00000327921.9_Missense_Mutation_p.E350Q|EML1_ENST00000334192.4_Missense_Mutation_p.E381Q	p.E362Q	NM_004434.2	NP_004425.2	1	2	3	2.045233	O00423	EMAL1_HUMAN		10	1223	+		Melanoma(154;0.0879)|all_epithelial(191;0.216)	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	ENST00000262233.6	1	1	hg19	c.1084G>C	CCDS32155.1	1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911712	0.52439	.	.	ENSG00000066629	ENST00000554479;ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T;T	0.46451	5.01;0.87;0.87;0.87	4.99	4.09	0.47781	4.99	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.049952	0.85682	D	0.000000	T	0.44201	0.1282	N	0.25890	0.77	0.50813	D	0.999899	D;P;B;D;D	0.59767	0.975;0.911;0.029;0.986;0.957	P;B;B;P;B	0.57846	0.648;0.363;0.011;0.828;0.445	T	0.19712	-1.0297	10	0.21014	T	0.42	-24.9371	14.9443	0.71016	0.0:0.0:0.8557:0.1443	.	350;350;362;381;381	F8W717;B7Z650;O00423;O00423-3;B3KXA3	.;.;EMAL1_HUMAN;.;.	Q	349;350;362;381;381	ENSP00000451346:E349Q;ENSP00000327384:E350Q;ENSP00000262233:E362Q;ENSP00000334314:E381Q	ENSP00000262233:E362Q	E	+	1	0	0	EML1	99443803	99443803	1.000000	0.71417	0.042000	0.18584	0.901000	0.52897	7.832000	0.86757	1.206000	0.43276	0.655000	0.94253	GAA	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.468	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	97	1	1.870000	-3.152586	1	0.300000	NM_001008707		0	41	41	0	230	225	1		1	0		0	0	97	0	0	1.000000	5.666489e-01	0	0	0	12	0	41	230
THBS1	7057	broad.mit.edu	37	15	39876541	39876541	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr15:39876541C>T	ENST00000260356.5	+	6	1109	c.944C>T	c.(943-945)cCt>cTt	p.P315L		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	315					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CTGAGGCGGCCTCCCCTATGC	0.483																																						ENST00000260356.5	1.000000	0.810000	1	9.400000e-01	0.990000	0.977355	0.990000	1.000000																										0				53						c.(943-945)cCt>cTt		thrombospondin 1							100.0	98.0	98.0					15																	39876541		2200	4297	6497	SO:0001583	missense	7057	0	0					g.chr15:39876541C>T		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.944C>T	chr15.hg19:g.39876541C>T	ENSP00000260356:p.Pro315Leu	0						p.P315L	NM_003246.2	NP_003237.2	1	2	3	2.050126	P07996	TSP1_HUMAN		6	1109	+		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	1	1	hg19	c.944C>T	CCDS32194.1	1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.268480	0.59540	.	.	ENSG00000137801	ENST00000260356	T	0.77620	-1.11	5.88	5.88	0.94601	5.88	5.88	0.94601	.	0.224139	0.22966	N	0.053490	T	0.78091	0.4229	M	0.61703	1.905	0.47214	D	0.999351	B	0.15141	0.012	B	0.14023	0.01	T	0.72883	-0.4157	10	0.59425	D	0.04	-2.5851	19.2015	0.93713	0.0:1.0:0.0:0.0	.	315	P07996	TSP1_HUMAN	L	315	ENSP00000260356:P315L	ENSP00000260356:P315L	P	+	2	0	0	THBS1	37663833	37663833	0.032000	0.19561	0.123000	0.21794	0.901000	0.52897	2.941000	0.49011	2.786000	0.95864	0.655000	0.94253	CCT	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.483	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	1	0	1	2	2	2	2	0	0	0	0	119	119	119	117	1	1.870000	-20.000000	1	0.300000	NM_003246		0	47	47	0	244	240	1		1	1		0	0	119	0	0	1.000000	9.999759e-01	0	3	0	82	0	47	244
RNF111	54778	broad.mit.edu	37	15	59359283	59359283	+	Splice_Site	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr15:59359283G>C	ENST00000557998.1	+	6	1973		c.e6+1		RNF111_ENST00000561186.1_Splice_Site|RNF111_ENST00000559209.1_Splice_Site|RNF111_ENST00000434298.1_Splice_Site|RNF111_ENST00000348370.4_Splice_Site	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111						gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TCATGAACAGGTATGTGGAAT	0.468																																					NSCLC(72;983 1365 10746 34387 47081)	ENST00000557998.1	0.990000	0.660000	9.600000e-01	7.600000e-01	0.870000	0.865874	0.870000	0.910000																										0				35						c.e6+1		ring finger protein 111							95.0	87.0	90.0					15																	59359283		2192	4291	6483	SO:0001630	splice_region_variant	54778	0	0					g.chr15:59359283G>C	AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1686+1G>C	chr15.hg19:g.59359283G>C		1					RNF111_ENST00000559209.1_Splice_Site|RNF111_ENST00000348370.4_Splice_Site|RNF111_ENST00000561186.1_Splice_Site|RNF111_ENST00000434298.1_Splice_Site		NM_001270530.1	NP_001257459.1	0	1	1	1.733808	Q6ZNA4	RN111_HUMAN		6	1973	+			C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Splice_Site	SNP	ENST00000557998.1	1	1	hg19		CCDS58366.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008992	0.75046	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	.	.	.	5.14	5.14	0.70334	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5984	0.88018	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	RNF111	57146575	57146575	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.279000	0.89901	2.398000	0.81561	0.462000	0.41574	.	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.468	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	1	0	0	2	2	2	2	0	0	0	0	99	99	99	99	1	1.870000	-20.000000	1	0.300000	NM_017610	Intron	0	43	42	0	221	217	1		1			0	0	99	0	0	1.000000	0	0	0	0	0	0	43	221
ITFG3	83986	broad.mit.edu	37	16	313364	313364	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:313364A>T	ENST00000399932.3	+	9	1526	c.1075A>T	c.(1075-1077)Acg>Tcg	p.T359S	ITFG3_ENST00000600536.1_Missense_Mutation_p.T359S|ITFG3_ENST00000301678.3_Missense_Mutation_p.T359S|ITFG3_ENST00000442458.2_Missense_Mutation_p.T359S|ITFG3_ENST00000301679.2_Missense_Mutation_p.T359S|ITFG3_ENST00000450082.2_Missense_Mutation_p.T359S	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	359						cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				GCAGGAGCTGACGCCTCGCTG	0.652																																						ENST00000399932.3	1.000000	0.510000	9.500000e-01	6.200000e-01	0.760000	0.776855	0.760000	1.000000																										0				16						c.(1075-1077)Acg>Tcg		integrin alpha FG-GAP repeat containing 3							44.0	53.0	50.0					16																	313364		2178	4270	6448	SO:0001583	missense	83986	0	0					g.chr16:313364A>T	AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.1075A>T	chr16.hg19:g.313364A>T	ENSP00000382814:p.Thr359Ser	1					ITFG3_ENST00000442458.2_Missense_Mutation_p.T359S|ITFG3_ENST00000450082.2_Missense_Mutation_p.T359S|ITFG3_ENST00000301679.2_Missense_Mutation_p.T359S|ITFG3_ENST00000600536.1_Missense_Mutation_p.T359S|ITFG3_ENST00000301678.3_Missense_Mutation_p.T359S	p.T359S	NM_001284497.1	NP_001271426.1	1	2	3	2.286804	Q9H0X4	ITFG3_HUMAN		9	1526	+		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)	D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Missense_Mutation	SNP	ENST00000399932.3	1	1	hg19	c.1075A>T	CCDS10402.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.312|2.312	-0.357614|-0.357614	0.05138|0.05138	.|.	.|.	ENSG00000167930|ENSG00000167930	ENST00000399932;ENST00000301679;ENST00000442458;ENST00000301678;ENST00000450082|ENST00000424016	T;T;T;T;T|.	0.56611|.	0.45;0.45;0.45;0.45;0.45|.	4.23|4.23	-3.04|-3.04	0.05412|0.05412	4.23|4.23	-3.04|-3.04	0.05412|0.05412	Quinonprotein alcohol dehydrogenase-like (1);|.	1.032930|.	0.07604|.	N|.	0.924179|.	T|.	0.35068|.	0.0919|.	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B;B|.	0.27559|.	0.181;0.181|.	B;B|.	0.26693|.	0.072;0.072|.	T|.	0.39663|.	-0.9603|.	10|.	0.12430|.	T|.	0.62|.	-19.7556|-19.7556	6.642|6.642	0.22914|0.22914	0.5895:0.1307:0.2798:0.0|0.5895:0.1307:0.2798:0.0	.|.	359;359|.	Q9H0X4-2;Q9H0X4|.	.;ITFG3_HUMAN|.	S|C	359|50	ENSP00000382814:T359S;ENSP00000301679:T359S;ENSP00000397477:T359S;ENSP00000301678:T359S;ENSP00000411394:T359S|.	ENSP00000301678:T359S|.	T|X	+|+	1|3	0|0	0|0	ITFG3|ITFG3	253365|253365	253365|253365	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.036000|0.036000	0.12997|0.12997	-0.408000|-0.408000	0.07169|0.07169	-0.463000|-0.463000	0.06973|0.06973	0.459000|0.459000	0.35465|0.35465	ACG|TGA	0.384886		TCGA-3A-A9I9-01A-11D-A38G-08	0.652	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134227.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	107	1	1.870000	-20.000000	1	0.300000	NM_032039		0	26	26	0	238	232	1		1	1		0	0	109	0	0	1.000000	9.999998e-01	0	38	0	206	0	26	238
PKD1	5310	broad.mit.edu	37	16	2165466	2165466	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:2165466C>T	ENST00000262304.4	-	10	2218	c.2010G>A	c.(2008-2010)acG>acA	p.T670T	PKD1_ENST00000423118.1_Silent_p.T670T|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	670	LDL-receptor class A; atypical.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGGCCCTGACGTGCAGCCAT	0.711																																						ENST00000262304.4	1.000000	0.130000	7.900000e-01	2.600000e-01	0.460000	0.513348	0.460000	1.000000																										0				72						c.(2008-2010)acG>acA		polycystic kidney disease 1 (autosomal dominant)							12.0	15.0	14.0					16																	2165466		2163	4255	6418	SO:0001819	synonymous_variant	5310	4	119366	27				g.chr16:2165466C>T	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2010G>A	chr16.hg19:g.2165466C>T		1					RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.T670T	p.T670T	NM_001009944.2	NP_001009944	1	2	3	2.286804	P98161	PKD1_HUMAN		10	2218	-			Q15140|Q15141	Silent	SNP	ENST00000262304.4	0	1	hg19	c.2010G>A	CCDS32369.1	0	.	.	.	.	.	.	.	.	.	.	.	5.400	0.259040	0.10239	.	.	ENSG00000008710	ENST00000306101	.	.	.	4.65	-6.53	0.01866	4.65	-6.53	0.01866	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5936	0.28035	0.0:0.3152:0.2329:0.4519	.	.	.	.	.	-1	.	.	.	-	.	.	.	PKD1	2105467	2105467	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-1.318000	0.02705	-1.032000	0.03304	-0.259000	0.10710	.	0.384886		TCGA-3A-A9I9-01A-11D-A38G-08	0.711	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1	0	0	0	2	2	2	2	0	0	0	0	32	32	32	35	1	1.870000	-7.064841	1	0.300000			0	3	3	0	56	48	0		1	0		0	0	32	0	0	0.763344	1.685428e-01	0	0	0	11	0	3	56
ABCC11	85320	broad.mit.edu	37	16	48248799	48248799	+	Missense_Mutation	SNP	G	G	A	rs201784880		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:48248799G>A	ENST00000394747.1	-	8	1590	c.1241C>T	c.(1240-1242)gCg>gTg	p.A414V	ABCC11_ENST00000394748.1_Missense_Mutation_p.A414V|ABCC11_ENST00000356608.2_Missense_Mutation_p.A414V|ABCC11_ENST00000353782.5_Missense_Mutation_p.A414V|ABCC11_ENST00000537808.1_Missense_Mutation_p.A414V	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	414	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	TACCATTGACGCTGTGAGTTT	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		17852	0.0		0.001	False		,,,				2504	0.0					ENST00000394747.1	1.000000	0.590000	1	7.200000e-01	0.860000	0.860423	0.860000	1.000000																										0				83						c.(1240-1242)gCg>gTg		ATP-binding cassette, sub-family C (CFTR/MRP), member 11	Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)						124.0	103.0	110.0					16																	48248799		2201	4300	6501	SO:0001583	missense	85320	8	121412	39				g.chr16:48248799G>A	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1241C>T	chr16.hg19:g.48248799G>A	ENSP00000378230:p.Ala414Val	0					ABCC11_ENST00000353782.5_Missense_Mutation_p.A414V|ABCC11_ENST00000394748.1_Missense_Mutation_p.A414V|ABCC11_ENST00000537808.1_Missense_Mutation_p.A414V|ABCC11_ENST00000356608.2_Missense_Mutation_p.A414V	p.A414V	NM_033151.3	NP_149163.2	0	0	0	2.030203	Q96J66	ABCCB_HUMAN		8	1590	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	1	1	hg19	c.1241C>T	CCDS10732.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	12.39	1.924986	0.34002	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	4.95	2.93	0.34026	4.95	2.93	0.34026	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.956055	0.08704	N	0.905962	D	0.88112	0.6349	L	0.42744	1.35	0.09310	N	1	B;B	0.15719	0.003;0.014	B;B	0.16722	0.001;0.016	T	0.76680	-0.2870	10	0.48119	T	0.1	0.4302	7.1914	0.25828	0.2178:0.0:0.7822:0.0	.	414;414	Q96J66-2;Q96J66	.;ABCCB_HUMAN	V	414	ENSP00000311326:A414V;ENSP00000349017:A414V;ENSP00000378231:A414V;ENSP00000378230:A414V;ENSP00000438530:A414V	ENSP00000311326:A414V	A	-	2	0	0	ABCC11	46806300	46806300	0.016000	0.18221	0.000000	0.03702	0.001000	0.01503	2.029000	0.41098	0.454000	0.26884	0.650000	0.86243	GCG	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.493	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	1.870000	-13.606940	1	0.300000	NM_032583		0	27	26	0	179	179	1		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	27	179
C16orf70	80262	broad.mit.edu	37	16	67166803	67166803	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:67166803C>T	ENST00000219139.3	+	6	627	c.439C>T	c.(439-441)Cca>Tca	p.P147S	C16orf70_ENST00000569683.1_3'UTR|C16orf70_ENST00000569600.1_Missense_Mutation_p.P147S	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	147										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GACTGAGGCTCCAAAGTATGA	0.512																																						ENST00000219139.3	1.000000	0.760000	1	8.300000e-01	0.910000	0.913527	0.910000	1.000000																										0				17						c.(439-441)Cca>Tca		chromosome 16 open reading frame 70							172.0	158.0	163.0					16																	67166803		2200	4300	6500	SO:0001583	missense	80262	0	0					g.chr16:67166803C>T	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.439C>T	chr16.hg19:g.67166803C>T	ENSP00000219139:p.Pro147Ser	0					C16orf70_ENST00000569600.1_Missense_Mutation_p.P147S|C16orf70_ENST00000569683.1_3'UTR	p.P147S	NM_025187.3	NP_079463.2	0	0	0	2.020615	Q9BSU1	CP070_HUMAN		6	627	+		Ovarian(137;0.192)	Q9HA86	Missense_Mutation	SNP	ENST00000219139.3	1	1	hg19	c.439C>T	CCDS10828.1	1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294667	0.60086	.	.	ENSG00000125149	ENST00000219139	.	.	.	6.05	6.05	0.98169	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.52901	0.1763	N	0.10874	0.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.45425	-0.9262	9	0.09084	T	0.74	-10.8823	18.1025	0.89510	0.0:1.0:0.0:0.0	.	222;147	Q9BSU1-2;Q9BSU1	.;CP070_HUMAN	S	147	.	ENSP00000219139:P147S	P	+	1	0	0	C16orf70	65724304	65724304	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.624000	0.83124	2.866000	0.98385	0.650000	0.86243	CCA	0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.512	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	1	0	1	2	2	2	2	0	0	0	0	313	313	313	311	1	1.870000	-20.000000	1	0.300000	NM_025187		0	109	107	0	673	656	1		1	0		0	0	313	0	0	1.000000	4.690778e-01	0	1	0	10	0	109	673
FAM65A	79567	broad.mit.edu	37	16	67576517	67576517	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:67576517C>G	ENST00000379312.3	+	13	1961	c.1840C>G	c.(1840-1842)Cat>Gat	p.H614D	FAM65A_ENST00000422602.2_Missense_Mutation_p.H630D|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.H630D|FAM65A_ENST00000042381.4_Missense_Mutation_p.H610D|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000428437.2_Missense_Mutation_p.H624D	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	614	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		AAGCCCTACCCATACCACAGC	0.547																																						ENST00000379312.3	0.790000	0.560000	7.400000e-01	6.100000e-01	0.670000	0.679413	0.670000	0.670000																										0				39						c.(1840-1842)Cat>Gat		family with sequence similarity 65, member A							420.0	390.0	400.0					16																	67576517		2198	4300	6498	SO:0001583	missense	79567	0	0					g.chr16:67576517C>G	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1840C>G	chr16.hg19:g.67576517C>G	ENSP00000368614:p.His614Asp	0					CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.4_ENST00000564717.1_RNA|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.H610D|FAM65A_ENST00000422602.2_Missense_Mutation_p.H630D|FAM65A_ENST00000540839.3_Missense_Mutation_p.H630D|FAM65A_ENST00000428437.2_Missense_Mutation_p.H624D	p.H614D	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	0	0	0	2.020615	Q6ZS17	FA65A_HUMAN		13	1961	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	1	1	hg19	c.1840C>G	CCDS54028.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.90|14.90	2.672180|2.672180	0.47781|0.47781	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.14640|.	2.49;2.49;2.49|.	4.72|4.72	1.63|1.63	0.23807|0.23807	4.72|4.72	1.63|1.63	0.23807|0.23807	.|.	1.276350|.	0.05009|.	N|.	0.470630|.	T|T	0.16769|0.16769	0.0403|0.0403	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.26400|.	0.039;0.039;0.039;0.148|.	B;B;B;B|.	0.19946|.	0.007;0.007;0.007;0.027|.	T|T	0.28267|0.28267	-1.0049|-1.0049	10|5	0.42905|.	T|.	0.14|.	0.0019|0.0019	6.4361|6.4361	0.21825|0.21825	0.0:0.6759:0.1505:0.1737|0.0:0.6759:0.1505:0.1737	.|.	624;630;614;630|.	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9|.	.;.;FA65A_HUMAN;.|.	D|R	614;610;630;624|604	ENSP00000368614:H614D;ENSP00000042381:H610D;ENSP00000400099:H630D|.	ENSP00000042381:H610D|.	H|P	+|+	1|2	0|0	0|0	FAM65A|FAM65A	66134018|66134018	66134018|66134018	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.112000|0.112000	0.19704|0.19704	0.853000|0.853000	0.27777|0.27777	0.178000|0.178000	0.19917|0.19917	0.436000|0.436000	0.28706|0.28706	CAT|CCA	0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.547	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	1	0	1	2	2	2	2	0	0	0	0	586	586	586	570	1	1.870000	-3.221883	1	0.300000	NM_024519		0	122	118	0	1066	1022	1		1	1		0	0	586	0	0	1.000000	9.966956e-01	0	13	0	62	0	122	1066
DHX38	9785	broad.mit.edu	37	16	72138480	72138480	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:72138480C>T	ENST00000268482.3	+	15	2615	c.2106C>T	c.(2104-2106)ttC>ttT	p.F702F	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	702	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TCCCCATCTTCCACATCCCTG	0.537																																					Melanoma(97;711 1442 7855 13832 28836)	ENST00000268482.3	1.000000	0.730000	1	8.200000e-01	0.920000	0.915230	0.920000	1.000000																										0				48						c.(2104-2106)ttC>ttT		DEAH (Asp-Glu-Ala-His) box polypeptide 38							250.0	189.0	210.0					16																	72138480		2198	4300	6498	SO:0001819	synonymous_variant	9785	0	0					g.chr16:72138480C>T	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2106C>T	chr16.hg19:g.72138480C>T		0					DHX38_ENST00000536867.1_Intron	p.F702F	NM_014003.3	NP_054722.2	0	0	0	2.020615	Q92620	PRP16_HUMAN		15	2615	+		Ovarian(137;0.125)	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	1	1	hg19	c.2106C>T	CCDS10907.1	1																																																																																								0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.537	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	1	0	1	2	2	2	2	0	0	0	0	189	189	189	187	1	1.870000	-20.000000	1	0.300000	NM_014003		0	67	67	0	409	396	1		1	1		0	0	189	0	0	1.000000	9.916134e-01	0	8	0	39	0	67	409
CDYL2	124359	broad.mit.edu	37	16	80718735	80718735	+	Missense_Mutation	SNP	G	G	A	rs377184768		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:80718735G>A	ENST00000570137.2	-	2	471	c.316C>T	c.(316-318)Cgg>Tgg	p.R106W	CDYL2_ENST00000562812.1_Missense_Mutation_p.R106W|CDYL2_ENST00000566173.1_Missense_Mutation_p.R106W|CDYL2_ENST00000563890.1_Missense_Mutation_p.R106W|CDYL2_ENST00000562753.1_5'UTR	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	106						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						ATTCGCTTCCGTTTATGGGAG	0.557																																						ENST00000570137.2	1.000000	0.970000	1	9.900000e-01	0.990000	0.998014	0.990000	1.000000																										0				21						c.(316-318)Cgg>Tgg		chromodomain protein, Y-like 2		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	69.0	69.0	69.0		316	4.2	1.0	16		69	0,8600		0,0,4300	no	missense	CDYL2	NM_152342.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	106/507	80718735	1,13005	2203	4300	6503	SO:0001583	missense	124359	2	121412	36				g.chr16:80718735G>A	AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.316C>T	chr16.hg19:g.80718735G>A	ENSP00000476295:p.Arg106Trp	0					CDYL2_ENST00000563890.1_Missense_Mutation_p.R106W|CDYL2_ENST00000562753.1_5'UTR|CDYL2_ENST00000566173.1_Missense_Mutation_p.R106W|CDYL2_ENST00000562812.1_Missense_Mutation_p.R106W	p.R106W	NM_152342.2	NP_689555.2	0	0	0	2.020615	Q8N8U2	CDYL2_HUMAN		2	471	-			Q7Z5I8	Missense_Mutation	SNP	ENST00000570137.2	1	1	hg19	c.316C>T	CCDS32493.1	1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327533	0.60743	2.27E-4	0.0	ENSG00000166446	ENST00000299564	T	0.59364	0.27	5.23	4.24	0.50183	5.23	4.24	0.50183	.	0.412335	0.23696	N	0.045479	T	0.64394	0.2594	L	0.29908	0.895	0.49130	D	0.999755	D	0.89917	1.0	D	0.81914	0.995	T	0.67126	-0.5749	10	0.87932	D	0	.	13.7029	0.62620	0.0:0.0:0.7712:0.2288	.	106	Q8N8U2	CDYL2_HUMAN	W	106	ENSP00000299564:R106W	ENSP00000299564:R106W	R	-	1	2	2	CDYL2	79276236	79276236	0.995000	0.38212	1.000000	0.80357	0.702000	0.40608	0.199000	0.17237	2.713000	0.92767	0.655000	0.94253	CGG	0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.557	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434727.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.870000	-20.000000	1	0.300000	NM_152342		0	53	51	0	224	219	1		1	0		0	0	96	0	0	1.000000	3.801843e-02	0	0	0	2	0	53	224
ZNF778	197320	broad.mit.edu	37	16	89294771	89294771	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr16:89294771G>A	ENST00000433976.2	+	6	2323	c.1991G>A	c.(1990-1992)gGa>gAa	p.G664E	ZNF778_ENST00000306502.6_Missense_Mutation_p.G622E|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		CATAAACATGGAAGAATTCAC	0.403																																						ENST00000433976.2	0.450000	0.070000	3.300000e-01	1.200000e-01	0.210000	0.235020	0.210000	0.190000																										0				24						c.(1990-1992)gGa>gAa		zinc finger protein 778							48.0	52.0	50.0					16																	89294771		2174	4291	6465	SO:0001583	missense	197320	1	121306	25				g.chr16:89294771G>A	AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.1991G>A	chr16.hg19:g.89294771G>A	ENSP00000405289:p.Gly664Glu	0					RP11-46C24.6_ENST00000563182.1_RNA|ZNF778_ENST00000306502.6_Missense_Mutation_p.G622E	p.G664E	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	0	0	0	1.968406	Q96MU6	ZN778_HUMAN		6	2323	+			Q08AG0	Missense_Mutation	SNP	ENST00000433976.2	0	1	hg19	c.1991G>A	CCDS45550.1	0	.	.	.	.	.	.	.	.	.	.	G	9.055	0.993026	0.19043	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	T;T	0.07327	3.2;3.2	1.21	-2.43	0.06522	1.21	-2.43	0.06522	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02494	0.0076	N	0.01424	-0.875	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.003;0.005	T	0.40590	-0.9555	9	0.56958	D	0.05	.	2.2348	0.04005	0.3511:0.0:0.2421:0.4068	.	622;664	Q96MU6-2;Q96MU6	.;ZN778_HUMAN	E	664;622	ENSP00000405289:G664E;ENSP00000305203:G622E	ENSP00000305203:G622E	G	+	2	0	0	ZNF778	87822272	87822272	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-1.083000	0.03397	-1.203000	0.02652	-0.534000	0.04291	GGA	0.273859		TCGA-3A-A9I9-01A-11D-A38G-08	0.403	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430383.1	0	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.870000	-6.914200	1	0.300000	NM_182531		0	4	4	0	128	127	0		1	0		0	0	53	0	0	0.889744	3.785154e-02	0	1	0	7	0	4	128
KIAA0100	9703	broad.mit.edu	37	17	26971150	26971150	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:26971150G>C	ENST00000528896.2	-	2	198	c.124C>G	c.(124-126)Cta>Gta	p.L42V	KIAA0100_ENST00000544884.1_5'UTR|KIAA0100_ENST00000389003.3_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	42						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CCAATCTTTAGCTCCGCCTGC	0.473											OREG0024280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000528896.2	1.000000	0.770000	1	8.600000e-01	0.960000	0.943171	0.960000	1.000000																										0				68						c.(124-126)Cta>Gta		KIAA0100							61.0	71.0	68.0					17																	26971150		2203	4300	6503	SO:0001583	missense	9703	0	0					g.chr17:26971150G>C	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.124C>G	chr17.hg19:g.26971150G>C	ENSP00000436773:p.Leu42Val	0		OREG0024280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	790	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	p.L42V	NM_014680.3	NP_055495.2	1	2	3	2.068952	Q14667	K0100_HUMAN		2	198	-	Lung NSC(42;0.00431)		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	1	1	hg19	c.124C>G	CCDS32595.1	1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828801	0.32329	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.23552	1.9	5.32	1.1	0.20463	5.32	1.1	0.20463	FMP27, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.32971	0.0847	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.992	T	0.01591	-1.1317	10	0.31617	T	0.26	.	8.9329	0.35682	0.3431:0.0:0.6569:0.0	.	42;42	F6XS94;Q14667	.;K0100_HUMAN	V	42	ENSP00000436773:L42V	ENSP00000005905:L42V	L	-	1	2	2	KIAA0100	23995277	23995277	1.000000	0.71417	0.919000	0.36401	0.996000	0.88848	2.540000	0.45727	0.062000	0.16340	0.655000	0.94253	CTA	0.306244		TCGA-3A-A9I9-01A-11D-A38G-08	0.473	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	1	0	1	2	2	2	2	0	0	0	0	278	278	278	277	1	1.870000	-20.000000	1	0.300000	NM_014680		0	85	82	0	511	503	1		1	0		0	0	278	0	0	1.000000	2.664808e-01	0	0	0	7	0	85	511
CDC27	996	broad.mit.edu	37	17	45206848	45206848	+	Missense_Mutation	SNP	T	T	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:45206848T>A	ENST00000066544.3	-	16	2164	c.2071A>T	c.(2071-2073)Acc>Tcc	p.T691S	CDC27_ENST00000446365.2_Missense_Mutation_p.T630S|CDC27_ENST00000531206.1_Missense_Mutation_p.T697S|CDC27_ENST00000527547.1_Missense_Mutation_p.T690S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	691					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTGTTTAGGGTATCCAAAGCC	0.338																																						ENST00000066544.3	1.000000	0.130000	3.000000e-01	1.700000e-01	0.220000	0.257897	0.220000	0.220000																										0				90						c.(2071-2073)Acc>Tcc		cell division cycle 27							102.0	103.0	102.0					17																	45206848		2203	4300	6503	SO:0001583	missense	996	0	0					g.chr17:45206848T>A	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.2071A>T	chr17.hg19:g.45206848T>A	ENSP00000066544:p.Thr691Ser	0					CDC27_ENST00000531206.1_Missense_Mutation_p.T697S|CDC27_ENST00000527547.1_Missense_Mutation_p.T690S|CDC27_ENST00000446365.2_Missense_Mutation_p.T630S	p.T691S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	1	2	3	2.053906	P30260	CDC27_HUMAN		16	2164	-			G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	1	1	hg19	c.2071A>T	CCDS11509.1	0	.	.	.	.	.	.	.	.	.	.	T	28.0	4.878527	0.91740	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.68	5.68	0.88126	5.68	5.68	0.88126	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.78755	0.4333	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.988;0.988;0.993	T	0.80074	-0.1534	10	0.49607	T	0.09	-10.4546	13.8853	0.63704	0.0:0.0:0.0:1.0	.	630;690;697;691	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	691;697;630;690	ENSP00000066544:T691S;ENSP00000434614:T697S;ENSP00000392802:T630S;ENSP00000437339:T690S	ENSP00000066544:T691S	T	-	1	0	0	CDC27	42561847	42561847	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.032000	0.88838	2.156000	0.67533	0.460000	0.39030	ACC	0.304175		TCGA-3A-A9I9-01A-11D-A38G-08	0.338	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2	0	0	1	2	2	2	2	0	0	0	0	149	149	149	147	1	1.870000	-15.042200	1	0.300000			0	16	16	0	463	456	0		1	0	1	0	0	149	204	0	0.999927	1.213277e-01	9.963055e-01	0	9	17	257	16	463
SCRN2	90507	broad.mit.edu	37	17	45916852	45916852	+	Silent	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:45916852G>A	ENST00000290216.9	-	4	639	c.514C>T	c.(514-516)Ctg>Ttg	p.L172L	SCRN2_ENST00000584123.1_Silent_p.L180L|SCRN2_ENST00000407215.3_Silent_p.L172L	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	172						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						GCTGTCTCCAGCACCCACGCC	0.622																																						ENST00000290216.9	1.000000	0.740000	1	8.400000e-01	0.970000	0.938756	0.970000	1.000000																										0				14						c.(514-516)Ctg>Ttg		secernin 2							68.0	63.0	65.0					17																	45916852		2203	4300	6503	SO:0001819	synonymous_variant	90507	0	0					g.chr17:45916852G>A	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.514C>T	chr17.hg19:g.45916852G>A		0					SCRN2_ENST00000407215.3_Silent_p.L172L|SCRN2_ENST00000584123.1_Silent_p.L180L	p.L172L	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	1	2	3	2.053906	Q96FV2	SCRN2_HUMAN		4	639	-			A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	1	1	hg19	c.514C>T	CCDS11519.1	1																																																																																								0.304175		TCGA-3A-A9I9-01A-11D-A38G-08	0.622	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	1	0	0	2	2	2	2	0	0	0	0	171	171	171	169	1	1.870000	-20.000000	1	0.300000	NM_138355		0	51	50	0	302	297	0		1	1		0	0	171	0	0	1.000000	9.999312e-01	0	17	0	69	0	51	302
PHOSPHO1	162466	broad.mit.edu	37	17	47301945	47301945	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:47301945C>A	ENST00000310544.4	-	3	594	c.467G>T	c.(466-468)gGa>gTa	p.G156V	PHOSPHO1_ENST00000413580.1_Missense_Mutation_p.G181V|PHOSPHO1_ENST00000514112.1_Missense_Mutation_p.G181V			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1	156					bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	AGCCAGCAGTCCCCGCGCATC	0.701																																						ENST00000310544.4	1.000000	0.650000	1	9.500000e-01	0.990000	0.966608	0.990000	1.000000																										0										c.(466-468)gGa>gTa		phosphatase, orphan 1	Choline(DB00122)						8.0	9.0	9.0					17																	47301945		2174	4237	6411	SO:0001583	missense	162466	0	0					g.chr17:47301945C>A	AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.467G>T	chr17.hg19:g.47301945C>A	ENSP00000311925:p.Gly156Val	0					PHOSPHO1_ENST00000514112.1_Missense_Mutation_p.G181V|PHOSPHO1_ENST00000413580.1_Missense_Mutation_p.G181V	p.G156V			1	2	3	2.053906	Q8TCT1	PHOP1_HUMAN	Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)	3	594	-			E9PAM0|Q17RU6	Missense_Mutation	SNP	ENST00000310544.4	1	1	hg19	c.467G>T	CCDS11547.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626389	0.87560	.	.	ENSG00000173868	ENST00000310544;ENST00000413580;ENST00000514112;ENST00000511066	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.38	4.38	0.52667	5.38	4.38	0.52667	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.86468	0.5940	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89151	0.3523	10	0.66056	D	0.02	.	15.7956	0.78407	0.0:0.864:0.136:0.0	.	156;181	Q8TCT1;E9PAM0	PHOP1_HUMAN;.	V	156;181;181;156	ENSP00000311925:G156V;ENSP00000406909:G181V;ENSP00000427694:G181V;ENSP00000426095:G156V	ENSP00000311925:G156V	G	-	2	0	0	PHOSPHO1	44656944	44656944	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.292000	0.78731	2.510000	0.84645	0.462000	0.41574	GGA	0.304175		TCGA-3A-A9I9-01A-11D-A38G-08	0.701	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364467.2	1	0	0	2	2	2	2	0	0	0	0	14	14	14	14	1	1.870000	-18.729430	1	0.300000			0	7	6	0	27	25	0		1	0		0	0	14	0	0	0.978381	0	0	0	0	1	0	7	27
MBTD1	54799	broad.mit.edu	37	17	49272667	49272667	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:49272667C>T	ENST00000586178.1	-	13	1623	c.1280G>A	c.(1279-1281)gGa>gAa	p.G427E	MBTD1_ENST00000376381.2_Intron|MBTD1_ENST00000415868.1_Missense_Mutation_p.G427E	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	427					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			CCAGTCAGATCCGTCTGCTGC	0.428																																						ENST00000586178.1	1.000000	0.560000	8.900000e-01	6.500000e-01	0.760000	0.775394	0.760000	0.760000																										0				12						c.(1279-1281)gGa>gAa		mbt domain containing 1							117.0	100.0	106.0					17																	49272667		2203	4300	6503	SO:0001583	missense	54799	0	0					g.chr17:49272667C>T	AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.1280G>A	chr17.hg19:g.49272667C>T	ENSP00000468304:p.Gly427Glu	0					MBTD1_ENST00000415868.1_Missense_Mutation_p.G427E|MBTD1_ENST00000376381.2_Intron	p.G427E	NM_017643.2	NP_060113.2	1	2	3	2.053906	Q05BQ5	MBTD1_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.54e-08)	13	1623	-			Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	ENST00000586178.1	1	1	hg19	c.1280G>A	CCDS11581.2	0	.	.	.	.	.	.	.	.	.	.	C	34	5.328880	0.95733	.	.	ENSG00000011258	ENST00000405860;ENST00000415868	T	0.40476	1.03	5.36	5.36	0.76844	5.36	5.36	0.76844	.	0.105548	0.64402	D	0.000004	T	0.60818	0.2298	L	0.48218	1.51	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	T	0.62267	-0.6890	10	0.87932	D	0	.	19.4315	0.94772	0.0:1.0:0.0:0.0	.	427;263	Q05BQ5;Q05BQ5-3	MBTD1_HUMAN;.	E	427	ENSP00000403946:G427E	ENSP00000386072:G427E	G	-	2	0	0	MBTD1	46627666	46627666	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.033000	0.70925	2.665000	0.90641	0.643000	0.83706	GGA	0.304175		TCGA-3A-A9I9-01A-11D-A38G-08	0.428	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318124.1	1	0	1	2	2	2	2	0	0	0	0	150	150	150	150	1	1.870000	-20.000000	1	0.300000			0	43	41	0	336	330	1		1	0		0	0	150	0	0	1.000000	1.471241e-01	0	0	0	6	0	43	336
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.910000	0.460000	8.000000e-01	5.600000e-01	0.670000	0.688017	0.670000	0.670000	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	24185	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	c.(733-735)Ggc>Agc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	SO:0001583	missense	7157	1	121412	39	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577548C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	chr17.hg19:g.7577548C>T	ENSP00000269305:p.Gly245Ser	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S	p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.730853	P04637	P53_HUMAN		7	922	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.733G>A	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	0	TP53	7518273	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	6	0	0	0	0	131	131	131	129	1	1.870000	-2.599063	1	0.300000	NM_000546		0	28	27	0	203	198	1		1	1	1	0	1	131	689	0	1.000000	9.365487e-01	1	8	91	28	609	28	203
UTP18	51096	broad.mit.edu	37	17	49353296	49353296	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:49353296C>A	ENST00000225298.7	+	6	838	c.781C>A	c.(781-783)Ccc>Acc	p.P261T		NM_016001.2	NP_057085.2	Q9Y5J1	UTP18_HUMAN	UTP18 small subunit (SSU) processome component homolog (yeast)	261					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			GCAGTTCCATCCCGGTGCACA	0.383																																						ENST00000225298.7	1.000000	0.040000	1.700000e-01	7.000000e-02	0.110000	0.149601	0.110000	0.110000																										0				16						c.(781-783)Ccc>Acc		UTP18 small subunit (SSU) processome component homolog (yeast)							92.0	93.0	93.0					17																	49353296		1912	4124	6036	SO:0001583	missense	51096	0	0					g.chr17:49353296C>A	AF151806	CCDS42362.1	17q21.33	2013-05-21	2011-12-09	2006-05-16	ENSG00000011260	ENSG00000011260		"""WD repeat domain containing"""	24274	protein-coding gene	gene with protein product		612816	"""WD repeat domain 50"""	WDR50		10810093, 8619474, 15590835	Standard	NM_016001		Approved	CGI-48	uc002its.3	Q9Y5J1	OTTHUMG00000162370	ENST00000225298.7:c.781C>A	chr17.hg19:g.49353296C>A	ENSP00000225298:p.Pro261Thr	0						p.P261T	NM_016001.2	NP_057085.2	1	2	3	2.053906	Q9Y5J1	UTP18_HUMAN	BRCA - Breast invasive adenocarcinoma(22;2.09e-07)	6	838	+			Q9H4N6	Missense_Mutation	SNP	ENST00000225298.7	0	1	hg19	c.781C>A	CCDS42362.1	0	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656868	0.88154	.	.	ENSG00000011260	ENST00000225298;ENST00000508506	T	0.25414	1.8	6.07	6.07	0.98685	6.07	6.07	0.98685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.61510	-0.7048	10	0.87932	D	0	-16.6136	18.8399	0.92180	0.0:1.0:0.0:0.0	.	261	Q9Y5J1	UTP18_HUMAN	T	261;237	ENSP00000225298:P261T	ENSP00000225298:P261T	P	+	1	0	0	UTP18	46708295	46708295	1.000000	0.71417	0.997000	0.53966	0.912000	0.54170	6.329000	0.72920	2.885000	0.99019	0.655000	0.94253	CCC	0.304175		TCGA-3A-A9I9-01A-11D-A38G-08	0.383	UTP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368654.1	0	0	1	2	2	2	2	0	0	0	0	123	123	123	123	1	1.870000	-3.226472	1	0.300000	NM_016001		0	7	7	0	420	406	0		1	0		0	0	123	0	0	0.978365	1.749805e-01	0	0	0	40	0	7	420
RNF213	57674	broad.mit.edu	37	17	78324169	78324169	+	Missense_Mutation	SNP	G	G	A	rs568680037		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:78324169G>A	ENST00000582970.1	+	31	10300	c.10157G>A	c.(10156-10158)cGt>cAt	p.R3386H	CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.R1459H|RNF213_ENST00000508628.2_Missense_Mutation_p.R3435H	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3386					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GATGGAATCCGTAGCGCCCAG	0.353													g|||	1	0.000199681	0.0	0.0014	5008	,	,		17790	0.0		0.0	False		,,,				2504	0.0					ENST00000582970.1	0.500000	0.210000	4.200000e-01	2.700000e-01	0.340000	0.353417	0.340000	0.340000																										0				130						c.(10156-10158)cGt>cAt		ring finger protein 213							97.0	98.0	98.0					17																	78324169		2203	4300	6503	SO:0001583	missense	57674	1	121410	32				g.chr17:78324169G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10157G>A	chr17.hg19:g.78324169G>A	ENSP00000464087:p.Arg3386His	1					CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.R3435H|RNF213_ENST00000336301.6_Missense_Mutation_p.R1459H	p.R3386H	NM_001256071.1	NP_001243000.1	0	1	1	1.736465	Q63HN8	RN213_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)	31	10300	+	all_neural(118;0.0538)		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	1	1	hg19	c.10157G>A	CCDS58606.1	0	.	.	.	.	.	.	.	.	.	.	g	5.030	0.191195	0.09547	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.17528	2.27	5.0	-1.62	0.08372	5.0	-1.62	0.08372	.	0.947517	0.08876	N	0.880757	T	0.06325	0.0163	N	0.02736	-0.51	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42565	-0.9444	10	0.22109	T	0.4	.	7.9091	0.29780	0.4707:0.0:0.4235:0.1057	.	1459	Q63HN8	RN213_HUMAN	H	3386;3435;1459	ENSP00000338218:R1459H	ENSP00000338218:R1459H	R	+	2	0	0	RNF213	75938764	75938764	0.000000	0.05858	0.000000	0.03702	0.188000	0.23474	0.460000	0.21924	-0.543000	0.06240	-0.285000	0.09966	CGT	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.353	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	1	0	1	2	2	2	6	0	0	0	0	156	156	156	154	1	1.870000	-6.340543	1	0.300000	NM_020914		0	21	21	0	325	323	0		1	1	1	0	1	156	342	0	0.999998	2.923285e-01	9.996228e-01	3	17	14	349	21	325
MYH10	4628	broad.mit.edu	37	17	8398511	8398511	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:8398511C>A	ENST00000269243.4	-	29	4045	c.3907G>T	c.(3907-3909)Ggt>Tgt	p.G1303C	MYH10_ENST00000379980.4_Missense_Mutation_p.G1319C|MYH10_ENST00000360416.3_Missense_Mutation_p.G1334C|MYH10_ENST00000396239.1_Missense_Mutation_p.G1324C	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1303					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						AATTTAATACCCTTCTTCTCT	0.408																																						ENST00000269243.4	0.440000	0.140000	3.600000e-01	1.900000e-01	0.270000	0.283587	0.270000	0.260000																										0				52						c.(3907-3909)Ggt>Tgt		myosin, heavy chain 10, non-muscle							136.0	131.0	133.0					17																	8398511		2203	4300	6503	SO:0001583	missense	4628	0	0					g.chr17:8398511C>A	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3907G>T	chr17.hg19:g.8398511C>A	ENSP00000269243:p.Gly1303Cys	1					MYH10_ENST00000360416.3_Missense_Mutation_p.G1334C|MYH10_ENST00000396239.1_Missense_Mutation_p.G1324C|MYH10_ENST00000379980.4_Missense_Mutation_p.G1319C	p.G1303C	NM_005964.3	NP_005955.3	0	1	1	1.730853	P35580	MYH10_HUMAN		29	4045	-			B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	1	1	hg19	c.3907G>T	CCDS11144.1	0	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118677	0.37436	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	4.88	4.88	0.63580	4.88	4.88	0.63580	Myosin tail (1);	0.051033	0.85682	D	0.000000	T	0.66416	0.2787	N	0.13098	0.295	0.58432	D	0.999996	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.005;0.003;0.005	T	0.63514	-0.6620	10	0.62326	D	0.03	.	18.5819	0.91174	0.0:1.0:0.0:0.0	.	1312;1334;1303	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	C	1303;1334;1324;1319	ENSP00000269243:G1303C;ENSP00000353590:G1334C;ENSP00000379539:G1324C;ENSP00000369315:G1319C	ENSP00000269243:G1303C	G	-	1	0	0	MYH10	8339236	8339236	0.212000	0.23540	0.973000	0.42090	0.977000	0.68977	0.960000	0.29253	2.688000	0.91661	0.655000	0.94253	GGT	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.408	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2	0	0	1	2	8	2	2	1	1	1	1	152	152	152	150	1	1.870000	-2.654036	1	0.300000			0	11	11	0	222	218	0		1	0		1	0	152	0	0	0.812692	2.909272e-01	0	1	0	20	0	11	222
PCYT2	5833	broad.mit.edu	37	17	79866869	79866869	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr17:79866869C>T	ENST00000538936.2	-	3	331	c.223G>A	c.(223-225)Gag>Aag	p.E75K	PCYT2_ENST00000570388.1_5'UTR|PCYT2_ENST00000331285.3_5'UTR|PCYT2_ENST00000571105.1_Missense_Mutation_p.E75K|PCYT2_ENST00000538721.2_Missense_Mutation_p.E75K|PCYT2_ENST00000570391.1_Missense_Mutation_p.E43K	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	75					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	TTGTATCTCTCCTCCTGAGTG	0.592																																						ENST00000538936.2	0.970000	0.550000	8.800000e-01	6.500000e-01	0.760000	0.771686	0.760000	0.770000																										0				8						c.(223-225)Gag>Aag		phosphate cytidylyltransferase 2, ethanolamine	Lamivudine(DB00709)						114.0	115.0	115.0					17																	79866869		2203	4296	6499	SO:0001583	missense	5833	0	0					g.chr17:79866869C>T	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.223G>A	chr17.hg19:g.79866869C>T	ENSP00000439245:p.Glu75Lys	1					PCYT2_ENST00000570391.1_Missense_Mutation_p.E43K|PCYT2_ENST00000538721.2_Missense_Mutation_p.E75K|PCYT2_ENST00000570388.1_5'UTR|PCYT2_ENST00000571105.1_Missense_Mutation_p.E75K|PCYT2_ENST00000331285.3_5'UTR	p.E75K	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	0	1	1	1.736465	Q99447	PCY2_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)	3	331	-	all_neural(118;0.0878)|Ovarian(332;0.12)		B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	SNP	ENST00000538936.2	1	1	hg19	c.223G>A	CCDS11791.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.206311	0.95033	.	.	ENSG00000185813	ENST00000538721;ENST00000538936	D;D	0.97256	-4.31;-4.31	4.25	4.25	0.50352	4.25	4.25	0.50352	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	M	0.91140	3.18	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.99793	1.1032	10	0.87932	D	0	-43.1461	16.8397	0.85965	0.0:1.0:0.0:0.0	.	43;43;75;75	B7Z4W6;B7ZAS0;F5H8B1;Q99447	.;.;.;PCY2_HUMAN	K	75	ENSP00000442050:E75K;ENSP00000439245:E75K	ENSP00000442050:E75K	E	-	1	0	0	PCYT2	77460161	77460161	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.330000	0.65899	2.197000	0.70478	0.561000	0.74099	GAG	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.592	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	1	0	1	2	2	2	2	0	0	0	0	144	144	144	143	1	1.870000	-2.923902	1	0.300000	NM_002861		0	34	33	0	212	208	1		1	1		0	0	144	0	0	1.000000	9.787827e-01	0	22	0	19	0	34	212
DLGAP1	9229	broad.mit.edu	37	18	3879577	3879577	+	Silent	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr18:3879577G>A	ENST00000315677.3	-	4	1087	c.492C>T	c.(490-492)aaC>aaT	p.N164N	DLGAP1_ENST00000584874.1_Silent_p.N164N|DLGAP1_ENST00000581527.1_Silent_p.N164N|DLGAP1_ENST00000515196.2_Silent_p.N164N|DLGAP1-AS3_ENST00000577649.1_RNA	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	164					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CCTTGCCCCCGTTGACGCTGC	0.711																																						ENST00000315677.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999931	0.990000	1.000000																										0				56						c.(490-492)aaC>aaT		discs, large (Drosophila) homolog-associated protein 1							55.0	65.0	61.0					18																	3879577		2202	4300	6502	SO:0001819	synonymous_variant	9229	0	0					g.chr18:3879577G>A	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.492C>T	chr18.hg19:g.3879577G>A		0					DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000515196.2_Silent_p.N164N|DLGAP1_ENST00000581527.1_Silent_p.N164N|DLGAP1_ENST00000584874.1_Silent_p.N164N	p.N164N	NM_004746.3	NP_004737.2	1	2	3	2.081949	O14490	DLGP1_HUMAN		4	1087	-		Colorectal(8;0.0257)	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Silent	SNP	ENST00000315677.3	1	1	hg19	c.492C>T	CCDS11836.1	1																																																																																								0.308300		TCGA-3A-A9I9-01A-11D-A38G-08	0.711	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4	1	0	1	2	2	2	2	0	0	0	0	252	252	252	244	1	1.870000	-20.000000	1	0.300000			0	97	96	0	401	392	1		1			0	0	252	0	0	1.000000	0	0	0	0	0	0	97	401
FCGBP	8857	broad.mit.edu	37	19	40408807	40408807	+	Silent	SNP	G	G	A	rs587708149	byFrequency	TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:40408807G>A	ENST00000221347.6	-	8	4039	c.4032C>T	c.(4030-4032)aaC>aaT	p.N1344N		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1344	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGATCTGGCCGTTGGCCAGCA	0.587													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19942	0.0		0.0	False		,,,				2504	0.001					ENST00000221347.6	1.000000	0.590000	1	7.500000e-01	0.930000	0.896457	0.930000	1.000000																										0				165						c.(4030-4032)aaC>aaT		Fc fragment of IgG binding protein							23.0	20.0	21.0					19																	40408807		2203	4294	6497	SO:0001819	synonymous_variant	8857	21	121330	39				g.chr19:40408807G>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4032C>T	chr19.hg19:g.40408807G>A		0						p.N1344N	NM_003890.2	NP_003881.2	0	0	0	2.011623	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)	8	4039	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		O95784	Silent	SNP	ENST00000221347.6	0	1	hg19	c.4032C>T	CCDS12546.1	1																																																																																								0.289340		TCGA-3A-A9I9-01A-11D-A38G-08	0.587	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	76	1	1.870000	-20.000000	1	0.300000	NM_003890		0	19	12	0	114	75	0		1			0	0	71	0	0	0.999762	0	0	0	0	0	0	19	114
MEGF8	1954	broad.mit.edu	37	19	42848986	42848986	+	Splice_Site	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:42848986G>C	ENST00000251268.6	+	12	2097		c.e12+1		MEGF8_ENST00000334370.4_Splice_Site	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8						BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GCCTGACAAGGTGGGTAGGAG	0.542																																						ENST00000251268.6	0.700000	0.360000	6.100000e-01	4.300000e-01	0.510000	0.529211	0.510000	0.520000																										0				50						c.e12+1		multiple EGF-like-domains 8							60.0	61.0	61.0					19																	42848986		2203	4300	6503	SO:0001630	splice_region_variant	1954	0	0					g.chr19:42848986G>C	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2097+1G>C	chr19.hg19:g.42848986G>C		0					MEGF8_ENST00000334370.4_Splice_Site		NM_001271938.1	NP_001258867.1	0	0	0	2.011623	Q7Z7M0	MEGF8_HUMAN		12	2097	+		Prostate(69;0.00682)	A8KAY0|O75097	Splice_Site	SNP	ENST00000251268.6	1	1	hg19			0	.	.	.	.	.	.	.	.	.	.	g	16.72	3.201977	0.58234	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	.	.	.	4.93	4.93	0.64822	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.638	0.76970	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	MEGF8	47540826	47540826	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	8.593000	0.90832	2.288000	0.76882	0.457000	0.33378	.	0.289340		TCGA-3A-A9I9-01A-11D-A38G-08	0.542	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	1	0	1	2	2	2	2	0	0	0	0	226	226	226	223	1	1.870000	-20.000000	1	0.300000	NM_001410	Intron	0	32	30	0	373	365	0		1	1		0	0	226	0	0	1.000000	1.911386e-02	0	2	0	1	0	32	373
PSG6	5675	broad.mit.edu	37	19	43420449	43420449	+	Silent	SNP	G	G	A	rs386809477|rs73934315	byFrequency	TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:43420449G>A	ENST00000292125.2	-	2	299	c.255C>T	c.(253-255)caC>caT	p.H85H	PSG6_ENST00000601833.1_Silent_p.H14H|PSG6_ENST00000187910.2_Silent_p.H85H|PSG6_ENST00000402603.4_Silent_p.H85H	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	85	Ig-like V-type.		H -> D (in dbSNP:rs3198831). {ECO:0000269|PubMed:2271648, ECO:0000269|PubMed:2346748}.		female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				TAATTTGACCGTGTACTACAT	0.443													.|||	44	0.00878594	0.031	0.0029	5008	,	,		21319	0.001		0.0	False		,,,				2504	0.0					ENST00000292125.2	1.000000	0.850000	1	9.000000e-01	0.950000	0.955519	0.950000	1.000000																										0				44						c.(253-255)caC>caT		pregnancy specific beta-1-glycoprotein 6		G	,	78,4324		2,74,2125	317.0	296.0	303.0		255,255	0.3	0.0	19	dbSNP_130	303	1,8597		0,1,4298	no	coding-synonymous,coding-synonymous	PSG6	NM_001031850.2,NM_002782.3	,	2,75,6423	AA,AG,GG		0.0116,1.7719,0.6077	,	85/425,85/436	43420449	79,12921	2201	4299	6500	SO:0001819	synonymous_variant	5675	246	121320	62				g.chr19:43420449G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.255C>T	chr19.hg19:g.43420449G>A		0					PSG6_ENST00000187910.2_Silent_p.H85H|PSG6_ENST00000601833.1_Silent_p.H14H|PSG6_ENST00000402603.4_Silent_p.H85H	p.H85H	NM_002782.4	NP_002773.1	0	0	0	2.011623	Q00889	PSG6_HUMAN		2	299	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Silent	SNP	ENST00000292125.2	1	0	hg19	c.255C>T	CCDS12613.1	1																																																																																								0.289340		TCGA-3A-A9I9-01A-11D-A38G-08	0.443	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	1	0	1	2	2	2	2	0	0	0	0	460	460	460	456	1	1.870000	-10.636750	1	0.300000	NM_002782		0	246	245	0	1430	1405	0		1			0	0	460	0	0	1.000000	0	0	0	0	0	0	246	1430
FBN3	84467	broad.mit.edu	37	19	8190867	8190867	+	Silent	SNP	A	A	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:8190867A>G	ENST00000600128.1	-	22	3054	c.2640T>C	c.(2638-2640)tgT>tgC	p.C880C	FBN3_ENST00000601739.1_Silent_p.C880C|FBN3_ENST00000270509.2_Silent_p.C880C			Q75N90	FBN3_HUMAN	fibrillin 3	880	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GCCCGTTGGGACAGACTCCCG	0.637																																						ENST00000600128.1	1.000000	0.620000	1	7.400000e-01	0.890000	0.878375	0.890000	1.000000																										0				132						c.(2638-2640)tgT>tgC		fibrillin 3							64.0	56.0	59.0					19																	8190867		2203	4300	6503	SO:0001819	synonymous_variant	84467	0	0					g.chr19:8190867A>G		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2640T>C	chr19.hg19:g.8190867A>G		0					FBN3_ENST00000601739.1_Silent_p.C880C|FBN3_ENST00000270509.2_Silent_p.C880C	p.C880C			0	0	0	2.018298	Q75N90	FBN3_HUMAN		22	3054	-			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	1	1	hg19	c.2640T>C	CCDS12196.1	1																																																																																								0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	1	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	1.870000	-20.000000	1	0.300000	NM_032447		0	29	28	0	185	183	1		1			0	0	103	0	0	1.000000	0	0	0	0	0	0	29	185
FBXL12	54850	broad.mit.edu	37	19	9921950	9921950	+	Silent	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:9921950G>A	ENST00000247977.4	-	3	844	c.603C>T	c.(601-603)ctC>ctT	p.L201L	FBXL12_ENST00000586651.1_3'UTR|FBXL12_ENST00000591009.1_Silent_p.L148L|FBXL12_ENST00000588922.1_3'UTR|FBXL12_ENST00000589626.1_3'UTR|FBXL12_ENST00000585379.1_Silent_p.L148L	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	201					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						GCAGATAGCTGAGCTCCTGCA	0.667																																						ENST00000247977.4	1.000000	0.700000	1	8.400000e-01	0.990000	0.940338	0.990000	1.000000																										0				10						c.(601-603)ctC>ctT		F-box and leucine-rich repeat protein 12							32.0	32.0	32.0					19																	9921950		2199	4292	6491	SO:0001819	synonymous_variant	54850	0	0					g.chr19:9921950G>A	AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8		ENST00000247977.4:c.603C>T	chr19.hg19:g.9921950G>A		0					FBXL12_ENST00000591009.1_Silent_p.L148L|FBXL12_ENST00000586651.1_3'UTR|FBXL12_ENST00000585379.1_Silent_p.L148L|FBXL12_ENST00000588922.1_3'UTR|FBXL12_ENST00000589626.1_3'UTR	p.L201L	NM_017703.1	NP_060173.1	0	0	0	2.018298	Q9NXK8	FXL12_HUMAN		3	844	-			B3KSJ8|Q9H5K4	Silent	SNP	ENST00000247977.4	1	1	hg19	c.603C>T	CCDS12218.1	1																																																																																								0.291498		TCGA-3A-A9I9-01A-11D-A38G-08	0.667	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450265.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	1.870000	-20.000000	1	0.300000	NM_017703		0	30	30	0	167	162	1		1	1		0	0	99	0	0	1.000000	9.927314e-01	0	7	0	39	0	30	167
PPP2R1A	5518	broad.mit.edu	37	19	52709296	52709296	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr19:52709296G>C	ENST00000322088.6	+	3	308	c.250G>C	c.(250-252)Gag>Cag	p.E84Q	PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000473455.2_3'UTR|PPP2R1A_ENST00000444322.2_Intron	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	84	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GGGAGGCCCAGAGTACGTGCA	0.607			Mis		clear cell ovarian carcinoma																																	ENST00000322088.6	0.510000	0.160000	4.100000e-01	2.200000e-01	0.310000	0.326736	0.310000	0.300000				Dom?	yes			Dom?	yes		19	19q13.41	19q13.41	5518	Mis	"""protein phosphatase 2, regulatory subunit A, alpha"""				E	E			clear cell ovarian carcinoma		0				135						c.(250-252)Gag>Cag		protein phosphatase 2, regulatory subunit A, alpha							133.0	109.0	117.0					19																	52709296		2203	4300	6503	SO:0001583	missense	5518	0	0					g.chr19:52709296G>C		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.250G>C	chr19.hg19:g.52709296G>C	ENSP00000324804:p.Glu84Gln	1					PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000473455.2_3'UTR|PPP2R1A_ENST00000444322.2_Intron	p.E84Q	NM_014225.5	NP_055040.2	1	2	3	2.352969	P30153	2AAA_HUMAN		3	308	+			Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	1	1	hg19	c.250G>C	CCDS12849.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.630|8.630	0.893441|0.893441	0.17613|0.17613	.|.	.|.	ENSG00000105568|ENSG00000105568	ENST00000454220;ENST00000423369;ENST00000322088|ENST00000391791	T;T|.	0.35048|.	1.33;1.33|.	3.23|3.23	2.2|2.2	0.27929|0.27929	3.23|3.23	2.2|2.2	0.27929|0.27929	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.225700|.	0.30455|.	N|.	0.009598|.	T|T	0.62792|0.62792	0.2457|0.2457	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	B;B|.	0.15719|.	0.014;0.014|.	B;B|.	0.10450|.	0.005;0.005|.	T|T	0.64597|0.64597	-0.6370|-0.6370	10|6	0.48119|0.87932	T|D	0.1|0	-26.2108|-26.2108	8.5769|8.5769	0.33603|0.33603	0.1188:0.0:0.8812:0.0|0.1188:0.0:0.8812:0.0	.|.	84;84|.	A8K7B7;P30153|.	.;2AAA_HUMAN|.	Q|H	124;84;84|62	ENSP00000391905:E124Q;ENSP00000324804:E84Q|.	ENSP00000324804:E84Q|ENSP00000375668:Q62H	E|Q	+|+	1|3	0|2	0|2	PPP2R1A|PPP2R1A	57401108|57401108	57401108|57401108	1.000000|1.000000	0.71417|0.71417	0.672000|0.672000	0.29872|0.29872	0.515000|0.515000	0.34225|0.34225	8.178000|8.178000	0.89690|0.89690	0.948000|0.948000	0.37687|0.37687	-0.339000|-0.339000	0.08088|0.08088	GAG|CAG	0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.607	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	1	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	1.870000	-3.139827	1	0.300000	NM_014225		0	11	11	0	267	260	0		1	1		0	0	75	0	0	0.998184	9.926215e-01	0	7	0	199	0	11	267
CLCC1	23155	broad.mit.edu	37	1	109477302	109477302	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:109477302G>A	ENST00000369971.2	-	11	1775	c.1646C>T	c.(1645-1647)cCc>cTc	p.P549L	AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000369969.2_Missense_Mutation_p.P428L|CLCC1_ENST00000482889.1_Intron|CLCC1_ENST00000348264.2_Missense_Mutation_p.P364L|CLCC1_ENST00000369970.3_Missense_Mutation_p.P499L|CLCC1_ENST00000415331.1_Missense_Mutation_p.P499L|CLCC1_ENST00000302500.4_Missense_Mutation_p.P428L|CLCC1_ENST00000356970.2_Missense_Mutation_p.P549L|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000369968.2_Missense_Mutation_p.P364L	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	549						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CTAGCCACAGGGGCTGCTGAC	0.547																																						ENST00000369971.2	1.000000	0.750000	1	8.600000e-01	0.970000	0.943968	0.970000	1.000000																										0				14						c.(1645-1647)cCc>cTc		chloride channel CLIC-like 1							76.0	69.0	72.0					1																	109477302		2203	4300	6503	SO:0001583	missense	23155	0	0					g.chr1:109477302G>A	AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.1646C>T	chr1.hg19:g.109477302G>A	ENSP00000358988:p.Pro549Leu	0					CLCC1_ENST00000482889.1_Intron|CLCC1_ENST00000415331.1_Missense_Mutation_p.P499L|CLCC1_ENST00000369970.3_Missense_Mutation_p.P499L|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000356970.2_Missense_Mutation_p.P549L|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000369968.2_Missense_Mutation_p.P364L|CLCC1_ENST00000302500.4_Missense_Mutation_p.P428L|CLCC1_ENST00000348264.2_Missense_Mutation_p.P364L|CLCC1_ENST00000369969.2_Missense_Mutation_p.P428L	p.P549L	NM_001048210.1	NP_001041675.1	1	2	3	2.046472	Q96S66	CLCC1_HUMAN		11	1775	-		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	1	1	hg19	c.1646C>T	CCDS41362.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604243	0.87157	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369968;ENST00000369970;ENST00000348264;ENST00000302500	T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.81	1.51	0.23008	5.81	1.51	0.23008	.	0.372474	0.23454	N	0.048004	T	0.15652	0.0377	L	0.51422	1.61	0.34281	D	0.682164	B;B;B;B	0.17667	0.008;0.008;0.023;0.01	B;B;B;B	0.16289	0.011;0.011;0.009;0.015	T	0.02868	-1.1100	10	0.72032	D	0.01	-0.2661	3.6445	0.08180	0.2808:0.0:0.5081:0.2112	.	364;428;499;549	Q96S66-4;Q96S66-3;Q96S66-2;Q96S66	.;.;.;CLCC1_HUMAN	L	549;549;499;428;364;499;364;428	ENSP00000349456:P549L;ENSP00000358988:P549L;ENSP00000411591:P499L;ENSP00000358986:P428L;ENSP00000358985:P364L;ENSP00000358987:P499L;ENSP00000337243:P364L;ENSP00000306552:P428L	ENSP00000306552:P428L	P	-	2	0	0	CLCC1	109278825	109278825	0.063000	0.20901	0.224000	0.23877	0.685000	0.39939	0.037000	0.13840	0.392000	0.25172	0.655000	0.94253	CCC	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.547	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	0	0	1	2	11	4	2	1	1	1	1	153	153	153	150	1	1.870000	-19.999980	1	0.300000	NM_015127		0	56	56	0	327	324	1		1	1		1	0	153	0	0	1.000000	9.973308e-01	0	16	0	65	0	56	327
WDR3	10885	broad.mit.edu	37	1	118477263	118477263	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:118477263G>C	ENST00000349139.5	+	3	386	c.339G>C	c.(337-339)ttG>ttC	p.L113F	WDR3_ENST00000471680.1_3'UTR|WDR3_ENST00000369441.3_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	113						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TCACTACCTTGAAGTATGATC	0.478																																						ENST00000349139.5	0.610000	0.270000	5.000000e-01	3.300000e-01	0.410000	0.426193	0.410000	0.410000																										0				49						c.(337-339)ttG>ttC		WD repeat domain 3							112.0	104.0	107.0					1																	118477263		2203	4300	6503	SO:0001583	missense	10885	0	0					g.chr1:118477263G>C	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.339G>C	chr1.hg19:g.118477263G>C	ENSP00000308179:p.Leu113Phe	0					WDR3_ENST00000369441.3_3'UTR|WDR3_ENST00000471680.1_3'UTR	p.L113F	NM_006784.2	NP_006775.1	1	2	3	2.046472	Q9UNX4	WDR3_HUMAN		3	386	+	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		Missense_Mutation	SNP	ENST00000349139.5	1	1	hg19	c.339G>C	CCDS898.1	0	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756898	0.69648	.	.	ENSG00000065183	ENST00000349139	T	0.64803	-0.12	5.76	1.42	0.22433	5.76	1.42	0.22433	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.169045	0.50627	D	0.000118	T	0.66426	0.2788	M	0.87758	2.905	0.80722	D	1	D	0.65815	0.995	D	0.65987	0.94	T	0.66712	-0.5854	10	0.72032	D	0.01	-9.5395	3.4483	0.07488	0.1398:0.2421:0.4916:0.1265	.	113	Q9UNX4	WDR3_HUMAN	F	113	ENSP00000308179:L113F	ENSP00000308179:L113F	L	+	3	2	2	WDR3	118278786	118278786	1.000000	0.71417	0.937000	0.37676	0.873000	0.50193	0.594000	0.24014	0.406000	0.25560	-0.150000	0.13652	TTG	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.478	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	1	0	1	2	2	2	2	0	0	0	0	121	121	121	119	1	1.870000	-6.782391	1	0.300000	NM_006784		0	26	24	0	399	388	0		1	0		0	0	121	0	0	1.000000	1.082232e-01	0	1	0	8	0	26	399
CFH	3075	broad.mit.edu	37	1	196695962	196695962	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:196695962T>C	ENST00000367429.4	+	14	2368	c.2128T>C	c.(2128-2130)Tac>Cac	p.Y710H		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	710	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CCCTCCTTATTACTATGGAGA	0.393																																						ENST00000367429.4	1.000000	0.830000	1	9.300000e-01	0.990000	0.976072	0.990000	1.000000																										0				101						c.(2128-2130)Tac>Cac		complement factor H							109.0	109.0	109.0					1																	196695962		2203	4300	6503	SO:0001583	missense	3075	0	0					g.chr1:196695962T>C	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2128T>C	chr1.hg19:g.196695962T>C	ENSP00000356399:p.Tyr710His	0						p.Y710H	NM_000186.3	NP_000177.2	1	2	3	2.044382	P08603	CFAH_HUMAN		14	2368	+			A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	1	1	hg19	c.2128T>C	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	T	1.622	-0.521227	0.04171	.	.	ENSG00000000971	ENST00000367429	T	0.64085	-0.08	5.8	1.14	0.20703	5.8	1.14	0.20703	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.29882	0.0747	N	0.01003	-1.06	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.23476	-1.0187	9	0.39692	T	0.17	.	8.5839	0.33646	0.0:0.6377:0.0:0.3623	.	710	P08603	CFAH_HUMAN	H	710	ENSP00000356399:Y710H	ENSP00000356399:Y710H	Y	+	1	0	0	CFH	194962585	194962585	0.017000	0.18338	0.468000	0.27192	0.386000	0.30323	-0.083000	0.11286	0.318000	0.23185	-0.250000	0.11733	TAC	0.301048		TCGA-3A-A9I9-01A-11D-A38G-08	0.393	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	1	0	0	2	2	2	2	0	0	0	0	59	59	59	59	1	1.870000	-20.000000	1	0.300000	NM_000186		0	68	68	0	365	356	1		1	0		0	0	59	0	0	1.000000	9.855184e-01	0	0	0	38	0	68	365
LAMB3	3914	broad.mit.edu	37	1	209799171	209799171	+	Missense_Mutation	SNP	C	C	G	rs35794952		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:209799171C>G	ENST00000356082.4	-	14	1932	c.1798G>C	c.(1798-1800)Ggt>Cgt	p.G600R	MIR4260_ENST00000583107.1_RNA|LAMB3_ENST00000391911.1_Missense_Mutation_p.G600R|LAMB3_ENST00000367030.3_Missense_Mutation_p.G600R	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	600	Domain II.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CGGAGTCTACCAAAGCGCAGG	0.632																																						ENST00000356082.4	1.000000	0.680000	1	8.200000e-01	0.980000	0.933940	0.980000	1.000000																										0				45						c.(1798-1800)Ggt>Cgt		laminin, beta 3							40.0	40.0	40.0					1																	209799171		2203	4300	6503	SO:0001583	missense	3914	0	0					g.chr1:209799171C>G	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1798G>C	chr1.hg19:g.209799171C>G	ENSP00000348384:p.Gly600Arg	0					LAMB3_ENST00000391911.1_Missense_Mutation_p.G600R|LAMB3_ENST00000367030.3_Missense_Mutation_p.G600R|MIR4260_ENST00000583107.1_RNA	p.G600R	NM_000228.2	NP_000219.2	0	1	1	2.038281	Q13751	LAMB3_HUMAN		14	1932	-			D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	1	1	hg19	c.1798G>C	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	C	3.231	-0.157369	0.06544	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.34667	1.35;1.35;1.35	5.14	-3.05	0.05396	5.14	-3.05	0.05396	.	1.305210	0.04711	N	0.417607	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23297	-1.0192	10	0.14656	T	0.56	.	8.4291	0.32746	0.0:0.4658:0.1106:0.4235	.	600	Q13751	LAMB3_HUMAN	R	600	ENSP00000375778:G600R;ENSP00000348384:G600R;ENSP00000355997:G600R	ENSP00000348384:G600R	G	-	1	0	0	LAMB3	207865794	207865794	0.000000	0.05858	0.000000	0.03702	0.378000	0.30076	-1.769000	0.01792	-0.858000	0.04110	0.456000	0.33151	GGT	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.632	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	1	0	1	2	2	2	2	0	0	0	0	78	78	78	75	1	1.870000	-3.092606	1	0.300000	NM_000228		0	29	27	0	166	160	1		1	1		0	0	78	0	0	1.000000	9.999999e-01	0	75	0	80	0	29	166
OBSCN	84033	broad.mit.edu	37	1	228562337	228562337	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:228562337A>G	ENST00000422127.1	+	97	22591	c.22547A>G	c.(22546-22548)aAg>aGg	p.K7516R	OBSCN_ENST00000366707.4_Missense_Mutation_p.K5150R|OBSCN_ENST00000570156.2_Missense_Mutation_p.K8473R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7516	Ig-like 55.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCACCCTCAAGAACTTCCAG	0.622																																						ENST00000422127.1	1.000000	0.660000	9.500000e-01	7.500000e-01	0.840000	0.851633	0.840000	1.000000																										0				223						c.(22546-22548)aAg>aGg		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							91.0	101.0	97.0					1																	228562337		2097	4225	6322	SO:0001583	missense	84033	0	0					g.chr1:228562337A>G	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22547A>G	chr1.hg19:g.228562337A>G	ENSP00000409493:p.Lys7516Arg	0					OBSCN_ENST00000366707.4_Missense_Mutation_p.K5150R|OBSCN_ENST00000570156.2_Missense_Mutation_p.K8473R	p.K7516R	NM_001098623.2	NP_001092093.2	0	1	1	2.038281	Q5VST9	OBSCN_HUMAN		97	22591	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	1	1	hg19	c.22547A>G	CCDS58065.1	0	.	.	.	.	.	.	.	.	.	.	A	28.8	4.954837	0.92726	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	D;D	0.82526	-1.62;-1.62	5.16	5.16	0.70880	5.16	5.16	0.70880	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.220098	0.36628	N	0.002485	D	0.84624	0.5513	N	0.21282	0.65	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84121	0.0406	10	0.33141	T	0.24	.	15.0022	0.71483	1.0:0.0:0.0:0.0	.	7516	Q5VST9	OBSCN_HUMAN	R	7516;5150	ENSP00000409493:K7516R;ENSP00000355668:K5150R	ENSP00000355668:K5150R	K	+	2	0	0	OBSCN	226628960	226628960	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	5.428000	0.66489	1.960000	0.56953	0.459000	0.35465	AAG	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	281	281	281	278	1	1.870000	-20.000000	1	0.300000	NM_052843		0	67	67	0	458	440	1		1	0		0	0	281	0	0	1.000000	1.283174e-01	0	0	0	5	0	67	458
PUM1	9698	broad.mit.edu	37	1	31409636	31409636	+	Missense_Mutation	SNP	C	C	T	rs371056869		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:31409636C>T	ENST00000257075.5	-	21	3376	c.3283G>A	c.(3283-3285)Gct>Act	p.A1095T	PUM1_ENST00000426105.2_Missense_Mutation_p.A1097T|SNORD103A_ENST00000363284.1_RNA|PUM1_ENST00000440538.2_Missense_Mutation_p.A1071T|PUM1_ENST00000373747.3_Missense_Mutation_p.A1098T|PUM1_ENST00000423018.2_Missense_Mutation_p.A953T|PUM1_ENST00000424085.2_Missense_Mutation_p.A853T|PUM1_ENST00000373741.4_Missense_Mutation_p.A1133T|PUM1_ENST00000373742.2_Missense_Mutation_p.A1036T	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	1095	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ATGAGCACAGCGCGCTCCGTA	0.507																																						ENST00000257075.5	0.480000	0.150000	3.900000e-01	2.100000e-01	0.290000	0.310791	0.290000	0.290000																										0				48						c.(3283-3285)Gct>Act		pumilio RNA-binding family member 1		C	THR/ALA,THR/ALA	0,4406		0,0,2203	161.0	122.0	136.0		3283,3289	5.8	1.0	1		136	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PUM1	NM_014676.2,NM_001020658.1	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	1095/1187,1097/1189	31409636	1,13005	2203	4300	6503	SO:0001583	missense	9698	1	121412	35				g.chr1:31409636C>T	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.3283G>A	chr1.hg19:g.31409636C>T	ENSP00000257075:p.Ala1095Thr	1					PUM1_ENST00000423018.2_Missense_Mutation_p.A953T|PUM1_ENST00000424085.2_Missense_Mutation_p.A853T|PUM1_ENST00000373747.3_Missense_Mutation_p.A1098T|PUM1_ENST00000373741.4_Missense_Mutation_p.A1133T|PUM1_ENST00000440538.2_Missense_Mutation_p.A1071T|PUM1_ENST00000426105.2_Missense_Mutation_p.A1097T|SNORD103A_ENST00000363284.1_RNA|PUM1_ENST00000373742.2_Missense_Mutation_p.A1036T	p.A1095T	NM_014676.2	NP_055491.1	0	1	1	1.742108	Q14671	PUM1_HUMAN		21	3376	-		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	1	1	hg19	c.3283G>A	CCDS338.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.261608|4.261608	0.80358|0.80358	0.0|0.0	1.16E-4|1.16E-4	ENSG00000134644|ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000529846|ENST00000525843;ENST00000498419	T;T;T;T;T;T;T;T;T|T;T	0.13538|0.17213	2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58|2.29;2.29	5.78|5.78	5.78|5.78	0.91487|0.91487	5.78|5.78	5.78|5.78	0.91487|0.91487	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33847|0.33847	0.0877|0.0877	L|L	0.48877|0.48877	1.53|1.53	0.80722|0.80722	D|D	1|1	P;B;B;P;P;B;P;B|.	0.39250|.	0.643;0.326;0.185;0.665;0.643;0.185;0.643;0.257|.	B;B;B;B;B;B;B;B|.	0.26614|.	0.065;0.032;0.015;0.071;0.065;0.007;0.065;0.065|.	T|T	0.00847|0.00847	-1.1542|-1.1542	10|7	0.39692|0.87932	T|D	0.17|0	-7.352|-7.352	20.0137|20.0137	0.97470|0.97470	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1036;953;1133;1071;1095;1097;1098;1097|.	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5|.	.;.;.;.;PUM1_HUMAN;.;.;.|.	T|H	853;1095;1098;835;1097;1071;1133;953;1036;206|1033;808	ENSP00000400141:A853T;ENSP00000257075:A1095T;ENSP00000362852:A1098T;ENSP00000391723:A1097T;ENSP00000401777:A1071T;ENSP00000362846:A1133T;ENSP00000399440:A953T;ENSP00000362847:A1036T;ENSP00000431213:A206T|ENSP00000435825:R1033H;ENSP00000433850:R808H	ENSP00000257075:A1095T|ENSP00000433850:R808H	A|R	-|-	1|2	0|0	0|0	PUM1|PUM1	31182223|31182223	31182223|31182223	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.705000|0.705000	0.40729|0.40729	7.818000|7.818000	0.86416|0.86416	2.734000|2.734000	0.93682|0.93682	0.563000|0.563000	0.77884|0.77884	GCT|CGC	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.507	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	1.870000	-3.074004	1	0.300000			0	11	11	0	201	198	0		1	0		0	0	103	0	0	0.998338	7.459652e-01	0	0	0	50	0	11	201
THRAP3	9967	broad.mit.edu	37	1	36752630	36752631	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:36752630_36752631CC>TT	ENST00000354618.5	+	4	1023_1024	c.799_800CC>TT	c.(799-801)CCt>TTt	p.P267F	THRAP3_ENST00000469141.2_Missense_Mutation_p.P267F	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	267	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTCACCCCGTCCTAGCCCCGTG	0.614			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)	ENST00000354618.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999707|0.999589	0.990000	1.000000				Dom	yes			Dom	yes		1	1p34.3	1p34.3	9967	T	thyroid hormone receptor associated protein 3 (TRAP150)				M	M	USP6		aneurysmal bone cysts		0				37						c.(799-801)Cct>Tct|c.(799-801)cCt>cTt		thyroid hormone receptor associated protein 3																																				SO:0001583	missense	9967	0	0					g.chr1:36752630C>T|g.chr1:36752631C>T	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	Exception_encountered	chr1.hg19:g.36752630_36752631delinsTT	ENSP00000346634:p.Pro267Phe	0					THRAP3_ENST00000469141.2_Missense_Mutation_p.P267S|THRAP3_ENST00000469141.2_Missense_Mutation_p.P267L	p.P267S|p.P267L	NM_005119.3	NP_005110.2	1	2	3	2.084625	Q9Y2W1	TR150_HUMAN		4	1023|1024	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	1	1	hg19	c.799C>T|c.800C>T	CCDS405.1	1																									5.85	5.85	0.93711																																												0			36525217|36525218														0.309324		TCGA-3A-A9I9-01A-11D-A38G-08	0.614	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	1	0	1	2	2	2	2	0	0	0	0	173	175|173	175|173	170|168	1	1.870000	-20.000000|-3.121901	1	0.300000	NM_005119		0	90|91	89|90	0	390|401	383|394	1		1	1		0	0	175|173	0	0	1.000000	9.796036e-01|9.781006e-01	0	3	0	26	0	90	390
OR2B11	127623	broad.mit.edu	37	1	247614391	247614391	+	Silent	SNP	A	A	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr1:247614391A>G	ENST00000318749.6	-	1	917	c.894T>C	c.(892-894)aaT>aaC	p.N298N		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCATATCTTTATTTCTCAGGG	0.473																																						ENST00000318749.6	1.000000	0.990000	1	9.900000e-01	0.990000	0.999748	0.990000	1.000000																										0				60						c.(892-894)aaT>aaC		olfactory receptor, family 2, subfamily B, member 11							186.0	200.0	195.0					1																	247614391		2203	4300	6503	SO:0001819	synonymous_variant	127623	0	0					g.chr1:247614391A>G		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.894T>C	chr1.hg19:g.247614391A>G		0						p.N298N	NM_001004492.1	NP_001004492.1	0	1	1	2.038281	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)	1	917	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	B2RP03	Silent	SNP	ENST00000318749.6	1	1	hg19	c.894T>C	CCDS31090.1	1																																																																																								0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.473	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	1	0	1	2	2	2	2	0	0	0	0	521	521	521	515	1	1.870000	-20.000000	1	0.300000	NM_001004492		0	217	215	0	1031	1009	1		1			0	0	521	0	0	1.000000	0	0	0	0	0	0	217	1031
BLCAP	10904	broad.mit.edu	37	20	36147320	36147320	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr20:36147320C>G	ENST00000373537.2	-	2	571	c.257G>C	c.(256-258)gGc>gCc	p.G86A	BLCAP_ENST00000397134.1_Missense_Mutation_p.G86A|BLCAP_ENST00000414542.2_Missense_Mutation_p.G86A|BLCAP_ENST00000397137.1_Missense_Mutation_p.G86A|NNAT_ENST00000346199.2_5'Flank|NNAT_ENST00000062104.2_5'Flank|BLCAP_ENST00000397135.1_Missense_Mutation_p.G86A|BLCAP_ENST00000397131.1_Missense_Mutation_p.G86A	NM_001167823.1|NM_006698.3	NP_001161295.1|NP_006689.1	P62952	BLCAP_HUMAN	bladder cancer associated protein	86					apoptotic nuclear changes (GO:0030262)|cell cycle (GO:0007049)	integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(2)|stomach(1)	5		Myeloproliferative disorder(115;0.00878)				CCGTTAGGTGCCCACAACGCC	0.552																																						ENST00000373537.2	1.000000	0.670000	1	7.800000e-01	0.910000	0.901667	0.910000	1.000000																										0				5						c.(256-258)gGc>gCc		bladder cancer associated protein							63.0	63.0	63.0					20																	36147320		2203	4300	6503	SO:0001583	missense	10904	0	0					g.chr20:36147320C>G	AF053470	CCDS13295.1	20q11.23	2006-01-29			ENSG00000166619	ENSG00000166619			1055	protein-coding gene	gene with protein product		613110				10197429	Standard	NM_006698		Approved	BC10	uc021wdf.1	P62952	OTTHUMG00000032419	ENST00000373537.2:c.257G>C	chr20.hg19:g.36147320C>G	ENSP00000362637:p.Gly86Ala	0					BLCAP_ENST00000397131.1_Missense_Mutation_p.G86A|BLCAP_ENST00000397135.1_Missense_Mutation_p.G86A|BLCAP_ENST00000414542.2_Missense_Mutation_p.G86A|NNAT_ENST00000346199.2_5'Flank|BLCAP_ENST00000397137.1_Missense_Mutation_p.G86A|BLCAP_ENST00000397134.1_Missense_Mutation_p.G86A|NNAT_ENST00000062104.2_5'Flank	p.G86A	NM_001167823.1|NM_006698.3	NP_001161295.1|NP_006689.1	0	1	1	2.032123	P62952	BLCAP_HUMAN		2	571	-		Myeloproliferative disorder(115;0.00878)	A2A2K7|O60629|Q9D3B5	Missense_Mutation	SNP	ENST00000373537.2	1	1	hg19	c.257G>C	CCDS13295.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050067	0.75846	.	.	ENSG00000166619	ENST00000373537;ENST00000397137;ENST00000414542;ENST00000397135;ENST00000397134;ENST00000397131;ENST00000432507	.	.	.	4.95	4.95	0.65309	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.76870	0.4048	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.63033	0.91	T	0.80108	-0.1520	8	0.87932	D	0	.	15.7067	0.77588	0.0:1.0:0.0:0.0	.	86	P62952	BLCAP_HUMAN	A	86	.	ENSP00000362637:G86A	G	-	2	0	0	BLCAP	35580734	35580734	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.842000	0.69417	2.554000	0.86153	0.585000	0.79938	GGC	0.297894		TCGA-3A-A9I9-01A-11D-A38G-08	0.552	BLCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079113.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	108	1	1.870000	-3.320611	1	0.300000	NM_006698		0	39	39	0	243	240	1		1	1		0	0	109	0	0	1.000000	9.998603e-01	0	19	0	67	0	39	243
KCNK15	60598	broad.mit.edu	37	20	43374752	43374752	+	Silent	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr20:43374752C>A	ENST00000372861.3	+	1	332	c.201C>A	c.(199-201)ctC>ctA	p.L67L	RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA	NM_022358.3	NP_071753.2	Q9H427	KCNKF_HUMAN	potassium channel, subfamily K, member 15	67					regulation of ion transmembrane transport (GO:0034765)	integral component of membrane (GO:0016021)	potassium channel activity (GO:0005267)			NS(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(115;0.0122)				GCCTGGCGCTCCAGGCTGAGC	0.692																																						ENST00000372861.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				10						c.(199-201)ctC>ctA		potassium channel, subfamily K, member 15							8.0	11.0	10.0					20																	43374752		2138	4236	6374	SO:0001819	synonymous_variant	60598	0	0					g.chr20:43374752C>A	AF257081	CCDS13337.1	20q13.12	2012-03-07			ENSG00000124249	ENSG00000124249		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	13814	protein-coding gene	gene with protein product		607368		KCNK11, KCNK14		11409881, 11431495, 16382106	Standard	NM_022358		Approved	K2p15.1, dJ781B1.1, KT3.3, KIAA0237, TASK5, TASK-5	uc002xmr.3	Q9H427	OTTHUMG00000032544	ENST00000372861.3:c.201C>A	chr20.hg19:g.43374752C>A		1					RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA	p.L67L	NM_022358.3	NP_071753.2	1	2	3	2.305382	Q9H427	KCNKF_HUMAN		1	332	+		Myeloproliferative disorder(115;0.0122)	Q52LL3|Q9HBC8	Silent	SNP	ENST00000372861.3	1	1	hg19	c.201C>A	CCDS13337.1	1																																																																																								0.382444		TCGA-3A-A9I9-01A-11D-A38G-08	0.692	KCNK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079378.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.870000	-20.000000	1	0.300000	NM_022358		0	34	33	0	86	86	0		1	1		0	0	41	0	0	1.000000	9.747446e-01	0	4	0	14	0	34	86
DIDO1	11083	broad.mit.edu	37	20	61512310	61512310	+	Silent	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr20:61512310G>T	ENST00000266070.4	-	16	5323	c.4998C>A	c.(4996-4998)ggC>ggA	p.G1666G	DIDO1_ENST00000395343.1_Silent_p.G1666G	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1666					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GCTGCAGGGCGCCGCAAGGCG	0.726																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	ENST00000266070.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				99						c.(4996-4998)ggC>ggA		death inducer-obliterator 1							12.0	14.0	13.0					20																	61512310		2181	4255	6436	SO:0001819	synonymous_variant	11083	0	0					g.chr20:61512310G>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4998C>A	chr20.hg19:g.61512310G>T		1					DIDO1_ENST00000395343.1_Silent_p.G1666G	p.G1666G	NM_033081.2	NP_149072.2	1	2	3	2.305382	Q9BTC0	DIDO1_HUMAN		16	5323	-	Breast(26;5.68e-08)		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	1	1	hg19	c.4998C>A	CCDS33506.1	1																																																																																								0.382444		TCGA-3A-A9I9-01A-11D-A38G-08	0.726	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.870000	-20.000000	1	0.300000	NM_080796		0	35	34	0	100	99	1		1	1		0	0	61	0	0	1.000000	8.497495e-01	0	4	0	8	0	35	100
BRWD1	54014	broad.mit.edu	37	21	40571514	40571514	+	Missense_Mutation	SNP	T	T	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr21:40571514T>A	ENST00000333229.2	-	40	5155	c.4828A>T	c.(4828-4830)Aat>Tat	p.N1610Y	BRWD1_ENST00000380800.3_Missense_Mutation_p.N1610Y|BRWD1_ENST00000342449.3_Missense_Mutation_p.N1610Y	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1610					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TCCAATGAATTGTTATCAGAA	0.373											OREG0003861	type=REGULATORY REGION|Gene=BRWD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									Melanoma(170;988 1986 4794 16843 39731)	ENST00000333229.2	1.000000	0.260000	1	3.200000e-01	0.390000	0.499059	0.390000	0.380000																										0				58						c.(4828-4830)Aat>Tat		bromodomain and WD repeat domain containing 1							62.0	67.0	66.0					21																	40571514		2203	4299	6502	SO:0001583	missense	54014	0	0					g.chr21:40571514T>A	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.4828A>T	chr21.hg19:g.40571514T>A	ENSP00000330753:p.Asn1610Tyr	1		OREG0003861	type=REGULATORY REGION|Gene=BRWD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	894	BRWD1_ENST00000342449.3_Missense_Mutation_p.N1610Y|BRWD1_ENST00000380800.3_Missense_Mutation_p.N1610Y	p.N1610Y	NM_018963.4	NP_061836.2	1	4	5	2.681246	Q9NSI6	BRWD1_HUMAN		40	5155	-		Prostate(19;8.44e-08)|all_epithelial(19;0.223)	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	1	1	hg19	c.4828A>T	CCDS13662.1	0	.	.	.	.	.	.	.	.	.	.	T	17.94	3.510435	0.64522	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.56103	0.48;0.52;0.6	5.19	4.01	0.46588	5.19	4.01	0.46588	.	0.410373	0.22711	N	0.056578	T	0.59088	0.2168	M	0.64997	1.995	0.80722	D	1	P;P	0.49185	0.92;0.561	P;B	0.51135	0.66;0.128	T	0.60840	-0.7183	10	0.72032	D	0.01	-9.7638	11.0953	0.48141	0.0:0.0:0.1544:0.8456	.	1610;1610	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	Y	1610	ENSP00000330753:N1610Y;ENSP00000344333:N1610Y;ENSP00000370178:N1610Y	ENSP00000330753:N1610Y	N	-	1	0	0	BRWD1	39493384	39493384	1.000000	0.71417	0.928000	0.36995	0.993000	0.82548	1.889000	0.39718	0.783000	0.33636	0.460000	0.39030	AAT	0.474869		TCGA-3A-A9I9-01A-11D-A38G-08	0.373	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	0	0	1	2	2	2	2	0	0	0	0	168	168	168	167	1	1.870000	-20.000000	1	0.300000	NM_033656		0	35	36	0	791	775	0		1	0		0	0	168	0	0	1.000000	1.526921e-01	0	0	0	16	0	35	791
KRTAP10-9	386676	broad.mit.edu	37	21	46047922	46047922	+	Silent	SNP	C	C	T	rs587735240		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr21:46047922C>T	ENST00000397911.3	+	1	883	c.834C>T	c.(832-834)cgC>cgT	p.R278R	KRTAP10-9_ENST00000484861.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	278						keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						TGTGCTCCCGCCCGGCCTGCT	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		17931	0.0		0.0	False		,,,				2504	0.001					ENST00000397911.3	1.000000	0.750000	9.800000e-01	8.300000e-01	0.910000	0.907808	0.910000	0.960000																										0				9						c.(832-834)cgC>cgT		keratin associated protein 10-9							61.0	75.0	70.0					21																	46047922		2193	4288	6481	SO:0001819	synonymous_variant	386676	1	121344	32				g.chr21:46047922C>T	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.834C>T	chr21.hg19:g.46047922C>T		1					TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	p.R278R	NM_198690.2	NP_941963.2	0	1	1	1.684932	P60411	KR109_HUMAN		1	883	+			A2RRG1|A6NIR9|Q70LJ1	Silent	SNP	ENST00000397911.3	1	1	hg19	c.834C>T	CCDS42961.1	1																																																																																								0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.692	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1	1	0	1	2	2	2	2	0	0	0	0	241	241	241	235	1	1.870000	-3.257765	1	0.300000			0	70	68	0	338	326	1		1			0	0	241	0	0	1.000000	0	0	0	0	0	0	70	338
CACNG2	10369	broad.mit.edu	37	22	36962506	36962506	+	Silent	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr22:36962506C>A	ENST00000300105.6	-	3	1311	c.330G>T	c.(328-330)ctG>ctT	p.L110L		NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	110					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						GAATCACACTCAGGATTGGGA	0.552																																						ENST00000300105.6	1.000000	0.740000	1	8.600000e-01	0.990000	0.951366	0.990000	1.000000																										0				18						c.(328-330)ctG>ctT		calcium channel, voltage-dependent, gamma subunit 2							90.0	82.0	85.0					22																	36962506		2203	4300	6503	SO:0001819	synonymous_variant	10369	0	0					g.chr22:36962506C>A	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.330G>T	chr22.hg19:g.36962506C>A		0						p.L110L	NM_006078.3	NP_006069.1	1	2	3	2.061585	Q9Y698	CCG2_HUMAN		3	1311	-			Q2M1M1|Q5TGT3|Q9UGZ7	Silent	SNP	ENST00000300105.6	1	1	hg19	c.330G>T	CCDS13931.1	1																																																																																								0.305211		TCGA-3A-A9I9-01A-11D-A38G-08	0.552	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2	1	0	1	2	2	2	2	0	0	0	0	140	140	140	139	1	1.870000	-3.326822	1	0.300000			0	41	41	0	233	228	1		1			0	0	140	0	0	1.000000	0	0	0	0	0	0	41	233
DPP10	57628	broad.mit.edu	37	2	116510788	116510788	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:116510788C>A	ENST00000410059.1	+	11	1469	c.989C>A	c.(988-990)aCc>aAc	p.T330N	DPP10_ENST00000409163.1_Missense_Mutation_p.T280N|DPP10_ENST00000310323.8_Missense_Mutation_p.T323N|DPP10_ENST00000393147.2_Missense_Mutation_p.T334N	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	330						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GTAAGCAATACCAAGACTGTG	0.363																																						ENST00000410059.1	1.000000	0.590000	9.500000e-01	7.000000e-01	0.820000	0.826766	0.820000	1.000000																										0				101						c.(988-990)aCc>aAc		dipeptidyl-peptidase 10 (non-functional)							116.0	102.0	107.0					2																	116510788		2203	4300	6503	SO:0001583	missense	57628	0	0					g.chr2:116510788C>A	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.989C>A	chr2.hg19:g.116510788C>A	ENSP00000386565:p.Thr330Asn	0					DPP10_ENST00000310323.8_Missense_Mutation_p.T323N|DPP10_ENST00000409163.1_Missense_Mutation_p.T280N|DPP10_ENST00000393147.2_Missense_Mutation_p.T334N	p.T330N	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	0	0	0	2.005415	Q8N608	DPP10_HUMAN		11	1469	+			A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	1	1	hg19	c.989C>A	CCDS46400.1	0	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190021	0.78789	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	5.1	5.1	0.69264	5.1	5.1	0.69264	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49270	0.1547	L	0.46614	1.455	0.80722	D	1	P;D;D;P	0.76494	0.883;0.999;0.963;0.904	P;D;P;P	0.85130	0.61;0.997;0.73;0.73	T	0.27773	-1.0064	10	0.33940	T	0.23	-11.7935	17.6852	0.88255	0.0:1.0:0.0:0.0	.	323;334;326;330	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	N	330;280;334;323;280	ENSP00000386565:T330N;ENSP00000387038:T280N;ENSP00000376855:T334N;ENSP00000309066:T323N	ENSP00000309066:T323N	T	+	2	0	0	DPP10	116227258	116227258	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.299000	0.78831	2.660000	0.90430	0.650000	0.86243	ACC	0.287169		TCGA-3A-A9I9-01A-11D-A38G-08	0.363	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	1.870000	-20.000000	1	0.300000	NM_020868		0	37	38	0	257	252	1		1	0		0	0	61	0	0	1.000000	0	0	0	0	1	0	37	257
CCDC148	130940	broad.mit.edu	37	2	159077147	159077147	+	Nonsense_Mutation	SNP	T	T	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:159077147T>A	ENST00000283233.5	-	11	1643	c.1330A>T	c.(1330-1332)Aag>Tag	p.K444*	CCDC148-AS1_ENST00000412781.2_RNA|CCDC148_ENST00000409187.1_Nonsense_Mutation_p.K453*	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	444										endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						ATTAATTTCTTCAGTTCTTCT	0.328																																						ENST00000283233.5	0.970000	0.550000	8.600000e-01	6.400000e-01	0.740000	0.757564	0.740000	0.750000																										0				23						c.(1330-1332)Aag>Tag		coiled-coil domain containing 148							121.0	109.0	113.0					2																	159077147		2203	4300	6503	SO:0001587	stop_gained	130940	0	0					g.chr2:159077147T>A		CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.1330A>T	chr2.hg19:g.159077147T>A	ENSP00000283233:p.Lys444*	0					CCDC148-AS1_ENST00000412781.2_RNA|CCDC148_ENST00000409187.1_Nonsense_Mutation_p.K453*	p.K444*	NM_138803.3	NP_620158.3	0	0	0	2.005415	Q8NFR7	CC148_HUMAN		11	1643	-			F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Nonsense_Mutation	SNP	ENST00000283233.5	0	1	hg19	c.1330A>T	CCDS33304.1	0	.	.	.	.	.	.	.	.	.	.	T	38	7.213421	0.98139	.	.	ENSG00000153237	ENST00000283233;ENST00000409187	.	.	.	5.5	5.5	0.81552	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.6426	13.8506	0.63494	0.0:0.0:0.0:1.0	.	.	.	.	X	444;453	.	ENSP00000283233:K444X	K	-	1	0	0	CCDC148	158785393	158785393	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.843000	0.62838	2.203000	0.70933	0.460000	0.39030	AAG	0.287169		TCGA-3A-A9I9-01A-11D-A38G-08	0.328	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	67	1	1.870000	-20.000000	1	0.300000	NM_138803		0	41	41	0	317	307	1		1	0		0	0	69	0	0	1.000000	7.013909e-02	0	1	0	3	0	41	317
TTN	7273	broad.mit.edu	37	2	179456474	179456474	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:179456474C>G	ENST00000591111.1	-	253	55373	c.55149G>C	c.(55147-55149)tgG>tgC	p.W18383C	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.W11151C|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.W20024C|TTN_ENST00000359218.5_Missense_Mutation_p.W11084C|TTN_ENST00000460472.2_Missense_Mutation_p.W10959C|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.W17456C			Q8WZ42	TITIN_HUMAN	titin	18383	Fibronectin type-III 33. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAATTTAATCCAGTCCTGGG	0.423																																						ENST00000591111.1	0.250000	0.070000	2.000000e-01	1.000000e-01	0.140000	0.157273	0.140000	0.150000																										0				1448						c.(55147-55149)tgG>tgC		titin							123.0	116.0	118.0					2																	179456474		1867	4103	5970	SO:0001583	missense	7273	0	0					g.chr2:179456474C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55149G>C	chr2.hg19:g.179456474C>G	ENSP00000465570:p.Trp18383Cys	0					TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.W17456C|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.W10959C|TTN_ENST00000589042.1_Missense_Mutation_p.W20024C|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.W11151C|TTN_ENST00000359218.5_Missense_Mutation_p.W11084C|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA	p.W18383C			0	0	0	2.005415	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	253	55373	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.55149G>C		0	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824565	0.50739	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	6.16	6.16	0.99307	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85440	0.5697	H	0.98754	4.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.90151	0.4221	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	10959;11084;11151;18383	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	17456;10959;11151;11084;10957	ENSP00000343764:W17456C;ENSP00000434586:W10959C;ENSP00000340554:W11151C;ENSP00000352154:W11084C	ENSP00000340554:W11151C	W	-	3	0	0	TTN	179164720	179164720	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	7.770000	0.85390	2.937000	0.99478	0.650000	0.86243	TGG	0.287169		TCGA-3A-A9I9-01A-11D-A38G-08	0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	1.870000	-3.060826	1	0.300000	NM_133378		0	11	12	0	484	478	0		1			0	0	58	0	0	0.998272	0	0	0	0	0	0	11	484
TTN	7273	broad.mit.edu	37	2	179638079	179638079	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:179638079C>T	ENST00000591111.1	-	33	7836	c.7612G>A	c.(7612-7614)Ggt>Agt	p.G2538S	TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G2492S|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.G2538S|TTN_ENST00000589042.1_Missense_Mutation_p.G2538S|TTN_ENST00000359218.5_Missense_Mutation_p.G2492S|TTN_ENST00000460472.2_Missense_Mutation_p.G2492S|TTN_ENST00000342992.6_Missense_Mutation_p.G2538S			Q8WZ42	TITIN_HUMAN	titin	12861					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACGAAGACCTCTGATAATT	0.353																																						ENST00000591111.1	1.000000	0.840000	1	9.700000e-01	0.990000	0.984592	0.990000	1.000000																										0				1448						c.(7612-7614)Ggt>Agt		titin							38.0	41.0	40.0					2																	179638079		2202	4297	6499	SO:0001583	missense	7273	0	0					g.chr2:179638079C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7612G>A	chr2.hg19:g.179638079C>T	ENSP00000465570:p.Gly2538Ser	0					TTN_ENST00000360870.5_Missense_Mutation_p.G2538S|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G2538S|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G2492S|TTN_ENST00000589042.1_Missense_Mutation_p.G2538S|TTN_ENST00000342175.6_Missense_Mutation_p.G2492S|TTN_ENST00000359218.5_Missense_Mutation_p.G2492S|TTN-AS1_ENST00000584485.1_RNA	p.G2538S			1	2	3	2.071217	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	33	7836	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.7612G>A		1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134330	0.37630	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.82	5.82	0.92795	5.82	5.82	0.92795	Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75079	0.3801	L	0.42581	1.335	0.28955	N	0.890175	D;D;D;D;D	0.76494	0.978;0.978;0.978;0.989;0.999	P;P;P;P;D	0.69479	0.871;0.871;0.871;0.871;0.964	T	0.70737	-0.4790	9	0.87932	D	0	.	20.1143	0.97922	0.0:1.0:0.0:0.0	.	2492;2492;2492;2538;2538	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	S	2538;2492;2492;2492;2492;2538	ENSP00000343764:G2538S;ENSP00000434586:G2492S;ENSP00000340554:G2492S;ENSP00000352154:G2492S;ENSP00000354117:G2538S	ENSP00000340554:G2492S	G	-	1	0	0	TTN	179346324	179346324	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.965000	0.63708	2.765000	0.95021	0.650000	0.86243	GGT	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	1.870000	-3.233193	1	0.300000	NM_133378		0	52	52	0	279	273	1		1			0	0	72	0	0	1.000000	0	0	0	0	0	0	52	279
ITGA4	3676	broad.mit.edu	37	2	182347132	182347132	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:182347132G>C	ENST00000397033.2	+	8	1316	c.886G>C	c.(886-888)Gaa>Caa	p.E296Q		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	296					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	TATCTTACATGAAATGAAAGG	0.308																																						ENST00000397033.2	1.000000	0.180000	1	2.400000e-01	0.320000	0.441090	0.320000	0.300000																										0				58						c.(886-888)Gaa>Caa		integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	Natalizumab(DB00108)|Tinzaparin(DB06822)						106.0	102.0	104.0					2																	182347132		1829	4091	5920	SO:0001583	missense	3676	0	0					g.chr2:182347132G>C		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.886G>C	chr2.hg19:g.182347132G>C	ENSP00000380227:p.Glu296Gln	0						p.E296Q	NM_000885.4	NP_000876.3	1	2	3	2.071217	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)	8	1316	+			D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	1	1	hg19	c.886G>C	CCDS42788.1	0	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490462	0.44249	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.14516	2.5;2.5	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	L	0.37697	1.125	0.52501	D	0.999957	B;D	0.54772	0.22;0.968	B;P	0.51016	0.109;0.656	T	0.02020	-1.1228	10	0.13108	T	0.6	.	20.327	0.98704	0.0:0.0:1.0:0.0	.	296;296	E7EP60;P13612	.;ITA4_HUMAN	Q	296	ENSP00000380227:E296Q;ENSP00000233573:E296Q	ENSP00000233573:E296Q	E	+	1	0	0	ITGA4	182055377	182055377	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.846000	0.69444	2.794000	0.96219	0.650000	0.86243	GAA	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.308	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	1.870000	-4.641127	1	0.300000			0	18	18	0	396	391	0		1	0		0	0	64	0	0	0.999981	6.351562e-03	0	0	0	3	0	18	396
SLC11A1	6556	broad.mit.edu	37	2	219251895	219251895	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:219251895G>C	ENST00000233202.6	+	6	853	c.513G>C	c.(511-513)tgG>tgC	p.W171C	SLC11A1_ENST00000539932.1_Missense_Mutation_p.W53C	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	171					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCACTCTGGGGTGGCGTCC	0.602																																						ENST00000233202.6	1.000000	0.580000	1	7.100000e-01	0.860000	0.858611	0.860000	1.000000																										0				19						c.(511-513)tgG>tgC		solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1							110.0	96.0	100.0					2																	219251895		2203	4300	6503	SO:0001583	missense	6556	1	121412	33				g.chr2:219251895G>C	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.513G>C	chr2.hg19:g.219251895G>C	ENSP00000233202:p.Trp171Cys	0					SLC11A1_ENST00000539932.1_Missense_Mutation_p.W53C	p.W171C	NM_000578.3	NP_000569.3	1	2	3	2.071217	P49279	NRAM1_HUMAN		6	853	+		Renal(207;0.0474)	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	1	1	hg19	c.513G>C	CCDS2415.1	1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866221	0.71949	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.70516	-0.49;-0.49	5.18	5.18	0.71444	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.88544	0.6465	M	0.93328	3.405	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.971;0.995;0.995	D	0.91207	0.4996	10	0.87932	D	0	-12.7329	18.8984	0.92433	0.0:0.0:1.0:0.0	.	171;53;171	B4DQ73;C0H5Y3;P49279	.;.;NRAM1_HUMAN	C	171;53	ENSP00000233202:W171C;ENSP00000443435:W53C	ENSP00000233202:W171C	W	+	3	0	0	SLC11A1	218960139	218960139	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	6.007000	0.70731	2.694000	0.91930	0.655000	0.94253	TGG	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.602	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	1	0	1	2	2	2	2	0	0	0	0	125	125	125	125	1	1.870000	-2.559266	1	0.300000	NM_000578		0	31	31	0	230	228	1		1	0		0	0	125	0	0	1.000000	9.257395e-01	0	0	0	35	0	31	230
SLC11A1	6556	broad.mit.edu	37	2	219251897	219251897	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:219251897G>T	ENST00000233202.6	+	6	855	c.515G>T	c.(514-516)gGt>gTt	p.G172V	SLC11A1_ENST00000539932.1_Missense_Mutation_p.G54V	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	172					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACTCTGGGGTGGCGTCCTC	0.602																																						ENST00000233202.6	1.000000	0.550000	1	6.700000e-01	0.820000	0.830988	0.820000	1.000000																										0				19						c.(514-516)gGt>gTt		solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1							112.0	97.0	102.0					2																	219251897		2203	4300	6503	SO:0001583	missense	6556	0	0					g.chr2:219251897G>T	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.515G>T	chr2.hg19:g.219251897G>T	ENSP00000233202:p.Gly172Val	0					SLC11A1_ENST00000539932.1_Missense_Mutation_p.G54V	p.G172V	NM_000578.3	NP_000569.3	1	2	3	2.071217	P49279	NRAM1_HUMAN		6	855	+		Renal(207;0.0474)	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	1	1	hg19	c.515G>T	CCDS2415.1	0	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765423	0.49574	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.66280	-0.2;-0.2	5.18	4.29	0.51040	5.18	4.29	0.51040	.	0.066829	0.64402	D	0.000008	T	0.62307	0.2417	L	0.35341	1.055	0.80722	D	1	B;B;B	0.33739	0.016;0.422;0.422	B;P;B	0.46452	0.017;0.517;0.363	T	0.62774	-0.6783	10	0.41790	T	0.15	-6.105	14.3044	0.66375	0.0723:0.0:0.9277:0.0	.	172;54;172	B4DQ73;C0H5Y3;P49279	.;.;NRAM1_HUMAN	V	172;54	ENSP00000233202:G172V;ENSP00000443435:G54V	ENSP00000233202:G172V	G	+	2	0	0	SLC11A1	218960141	218960141	0.998000	0.40836	0.883000	0.34634	0.757000	0.42996	2.602000	0.46257	1.380000	0.46344	0.655000	0.94253	GGT	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.602	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	1	0	1	2	2	2	2	0	0	0	0	131	131	131	131	1	1.870000	-12.816680	1	0.300000	NM_000578		0	30	30	0	235	234	1		1	0		0	0	131	0	0	1.000000	8.945898e-01	0	0	0	33	0	30	235
CRYBA2	1412	broad.mit.edu	37	2	219856841	219856841	+	Missense_Mutation	SNP	G	G	A	rs576572225		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:219856841G>A	ENST00000295728.2	-	2	522	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W	CRYBA2_ENST00000487181.1_5'Flank|CRYBA2_ENST00000392096.2_Missense_Mutation_p.R96W	NM_057093.1	NP_476434.1	P53672	CRBA2_HUMAN	crystallin, beta A2	96	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)		structural constituent of eye lens (GO:0005212)			endometrium(1)|lung(3)|prostate(1)	5		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCACTGGCCGGAAGGACAGC	0.622													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16948	0.0		0.0	False		,,,				2504	0.0					ENST00000295728.2	1.000000	0.070000	1	1.400000e-01	0.240000	0.379000	0.240000	0.200000																										0				5						c.(286-288)Cgg>Tgg		crystallin, beta A2							41.0	38.0	39.0					2																	219856841		2203	4300	6503	SO:0001583	missense	1412	14	121396	37				g.chr2:219856841G>A		CCDS2429.1	2q35	2013-02-14			ENSG00000163499	ENSG00000163499			2395	protein-coding gene	gene with protein product		600836				7490092, 12907171	Standard	NM_057093		Approved		uc002vjj.1	P53672	OTTHUMG00000133084	ENST00000295728.2:c.286C>T	chr2.hg19:g.219856841G>A	ENSP00000295728:p.Arg96Trp	0					CRYBA2_ENST00000392096.2_Missense_Mutation_p.R96W|CRYBA2_ENST00000487181.1_5'Flank	p.R96W	NM_057093.1	NP_476434.1	1	2	3	2.071217	P53672	CRBA2_HUMAN		2	522	-		Renal(207;0.0474)	Q4ZFX0|Q9Y562	Missense_Mutation	SNP	ENST00000295728.2	0	1	hg19	c.286C>T	CCDS2429.1	0	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299333	0.60195	.	.	ENSG00000163499	ENST00000392096;ENST00000295728;ENST00000453769	D;D;D	0.83163	-1.69;-1.69;-1.69	4.65	1.67	0.24075	4.65	1.67	0.24075	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.109256	0.56097	D	0.000022	D	0.92903	0.7742	M	0.94142	3.5	0.49798	D	0.999823	D	0.89917	1.0	D	0.87578	0.998	D	0.93478	0.6825	10	0.87932	D	0	.	14.747	0.69496	0.0:0.0:0.6235:0.3765	.	96	P53672	CRBA2_HUMAN	W	96	ENSP00000375946:R96W;ENSP00000295728:R96W;ENSP00000395120:R96W	ENSP00000295728:R96W	R	-	1	2	2	CRYBA2	219565085	219565085	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	1.688000	0.37690	-0.008000	0.14320	-0.808000	0.03180	CGG	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.622	CRYBA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336424.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	73	1	1.870000	-6.352010	1	0.300000	NM_057093		0	4	4	0	137	132	0		1	0		0	0	75	0	0	0.882796	1.604477e-01	0	0	0	20	0	4	137
CHPF	79586	broad.mit.edu	37	2	220406647	220406647	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:220406647G>T	ENST00000243776.6	-	2	827	c.579C>A	c.(577-579)gaC>gaA	p.D193E	CHPF_ENST00000373891.2_Missense_Mutation_p.D193E|TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank|CHPF_ENST00000535926.1_Missense_Mutation_p.D31E	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	193					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGAAGAACCAGTCAAAGTCGT	0.672											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000243776.6	1.000000	0.120000	1	2.200000e-01	0.380000	0.481176	0.380000	0.310000																										0				21						c.(577-579)gaC>gaA		chondroitin polymerizing factor							34.0	30.0	31.0					2																	220406647		2202	4300	6502	SO:0001583	missense	79586	0	0					g.chr2:220406647G>T	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.579C>A	chr2.hg19:g.220406647G>T	ENSP00000243776:p.Asp193Glu	0		OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2266	CHPF_ENST00000373891.2_Missense_Mutation_p.D193E|TMEM198_ENST00000373883.3_5'Flank|TMEM198_ENST00000344458.2_5'Flank|CHPF_ENST00000535926.1_Missense_Mutation_p.D31E	p.D193E	NM_024536.5	NP_078812	1	2	3	2.071217	Q8IZ52	CHSS2_HUMAN		2	827	-		Renal(207;0.0183)	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	0	1	hg19	c.579C>A	CCDS2443.1	0	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294157	0.81025	.	.	ENSG00000123989	ENST00000243776;ENST00000535926;ENST00000373891	T;T	0.19394	2.15;2.44	4.41	1.63	0.23807	4.41	1.63	0.23807	.	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	L	0.49571	1.57	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.91635	0.994;0.999	T	0.02603	-1.1135	10	0.23302	T	0.38	-31.7198	9.132	0.36850	0.2372:0.0:0.7628:0.0	.	193;193	F8W6H2;Q8IZ52	.;CHSS2_HUMAN	E	193;31;193	ENSP00000243776:D193E;ENSP00000445571:D31E	ENSP00000243776:D193E	D	-	3	2	2	CHPF	220114891	220114891	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.600000	0.61083	0.242000	0.21303	0.549000	0.68633	GAC	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.672	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	0	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.870000	-7.811913	1	0.300000	NM_024536		0	4	4	0	87	86	0		1	1		0	0	53	0	0	0.889366	9.687469e-01	0	9	0	142	0	4	87
COL4A4	1286	broad.mit.edu	37	2	227875104	227875104	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:227875104C>A	ENST00000396625.3	-	46	4654	c.4447G>T	c.(4447-4449)Ggc>Tgc	p.G1483C	COL4A4_ENST00000329662.7_Missense_Mutation_p.G1480C	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1483	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CTGGGCATGCCCAGGGGGCAG	0.577																																						ENST00000396625.3	1.000000	0.700000	1	8.200000e-01	0.960000	0.928347	0.960000	1.000000																										0				98						c.(4447-4449)Ggc>Tgc		collagen, type IV, alpha 4							66.0	67.0	67.0					2																	227875104		1852	4097	5949	SO:0001583	missense	1286	0	0					g.chr2:227875104C>A		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4447G>T	chr2.hg19:g.227875104C>A	ENSP00000379866:p.Gly1483Cys	0					COL4A4_ENST00000329662.7_Missense_Mutation_p.G1480C	p.G1483C	NM_000092.4	NP_000083.3	1	2	3	2.071217	P53420	CO4A4_HUMAN		46	4654	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	1	1	hg19	c.4447G>T	CCDS42828.1	1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378418	0.61735	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.95412	-3.7;-3.7	5.69	4.82	0.62117	5.69	4.82	0.62117	C-type lectin fold (1);	.	.	.	.	D	0.98476	0.9492	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.99433	1.0936	9	0.87932	D	0	.	14.6375	0.68699	0.0:0.9302:0.0:0.0698	.	1483	P53420	CO4A4_HUMAN	C	1483;1480	ENSP00000379866:G1483C;ENSP00000328553:G1480C	ENSP00000328553:G1480C	G	-	1	0	0	COL4A4	227583348	227583348	1.000000	0.71417	0.985000	0.45067	0.807000	0.45602	7.745000	0.85046	1.418000	0.47098	-0.136000	0.14681	GGC	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.577	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	1	0	1	2	2	2	2	0	0	0	0	115	115	115	113	1	1.870000	-19.722120	1	0.300000	NM_000092		0	45	45	0	290	281	1		1			0	0	115	0	0	1.000000	0	0	0	0	0	0	45	290
TMEM214	54867	broad.mit.edu	37	2	27261588	27261588	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:27261588G>C	ENST00000238788.9	+	12	1374	c.1312G>C	c.(1312-1314)Gaa>Caa	p.E438Q	TMEM214_ENST00000404032.3_Missense_Mutation_p.E393Q	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	438					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GTCTTTGCAAGAAACCATTCA	0.512																																						ENST00000238788.9	0.780000	0.230000	6.300000e-01	3.400000e-01	0.470000	0.492032	0.470000	0.450000																										0				18						c.(1312-1314)Gaa>Caa		transmembrane protein 214							58.0	62.0	61.0					2																	27261588		2043	4181	6224	SO:0001583	missense	54867	0	0					g.chr2:27261588G>C		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.1312G>C	chr2.hg19:g.27261588G>C	ENSP00000238788:p.Glu438Gln	1					TMEM214_ENST00000404032.3_Missense_Mutation_p.E393Q	p.E438Q	NM_017727.4	NP_060197.4	0	1	1	1.715785	Q6NUQ4	TM214_HUMAN		12	1374	+			A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	0	1	hg19	c.1312G>C	CCDS42664.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.239182|4.239182	0.79800|0.79800	.|.	.|.	ENSG00000119777|ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397;ENST00000444135|ENST00000425720	T;T;T|.	0.46819|.	0.86;0.86;0.86|.	5.69|5.69	5.69|5.69	0.88448|0.88448	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.088644|.	0.85682|.	D|.	0.000000|.	T|T	0.74718|0.74718	0.3753|0.3753	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.67145|.	0.996;0.985|.	P;D|.	0.63113|.	0.902;0.911|.	T|T	0.73613|0.73613	-0.3927|-0.3927	10|5	0.40728|.	T|.	0.16|.	-12.2017|-12.2017	16.735|16.735	0.85444|0.85444	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	393;438|.	Q6NUQ4-2;Q6NUQ4|.	.;TM214_HUMAN|.	Q|N	438;393;178;98|222	ENSP00000238788:E438Q;ENSP00000384417:E393Q;ENSP00000392442:E98Q|.	ENSP00000238788:E438Q|.	E|K	+|+	1|3	0|2	0|2	TMEM214|TMEM214	27115092|27115092	27115092|27115092	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.607000|7.607000	0.82883|0.82883	2.700000|2.700000	0.92200|0.92200	0.561000|0.561000	0.74099|0.74099	GAA|AAG	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.512	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	0	0	1	2	2	2	2	0	0	0	0	71	71	71	69	1	1.870000	-14.358330	1	0.300000	NM_017727		0	9	9	0	99	97	0		1	1		0	0	71	0	0	0.994403	9.816753e-01	0	8	0	73	0	9	99
PRKD3	23683	broad.mit.edu	37	2	37520399	37520399	+	Missense_Mutation	SNP	A	A	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:37520399A>C	ENST00000379066.1	-	3	1066	c.304T>G	c.(304-306)Ttc>Gtc	p.F102V	PRKD3_ENST00000234179.2_Missense_Mutation_p.F102V			O94806	KPCD3_HUMAN	protein kinase D3	102					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ATGCCAAAGAATCCACACTCT	0.333																																					Melanoma(80;621 1355 8613 11814 51767)	ENST00000379066.1	0.190000	0.050000	1.500000e-01	7.000000e-02	0.100000	0.118611	0.100000	0.110000																										0				33						c.(304-306)Ttc>Gtc		protein kinase D3							87.0	82.0	84.0					2																	37520399		2203	4300	6503	SO:0001583	missense	23683	0	0					g.chr2:37520399A>C	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.304T>G	chr2.hg19:g.37520399A>C	ENSP00000368356:p.Phe102Val	1					PRKD3_ENST00000234179.2_Missense_Mutation_p.F102V	p.F102V			0	1	1	1.726450	O94806	KPCD3_HUMAN		3	1066	-		all_hematologic(82;0.21)	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	0	1	hg19	c.304T>G	CCDS1789.1	0	.	.	.	.	.	.	.	.	.	.	A	22.2	4.260900	0.80246	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	T;T	0.65549	-0.16;-0.16	5.32	4.13	0.48395	5.32	4.13	0.48395	.	0.056727	0.64402	N	0.000001	T	0.62986	0.2473	L	0.47716	1.5	0.58432	D	0.999999	P;B	0.36633	0.562;0.427	P;B	0.45794	0.493;0.235	T	0.62553	-0.6830	10	0.49607	T	0.09	-12.2843	12.4041	0.55430	0.8592:0.1408:0.0:0.0	.	102;102	O94806-2;O94806	.;KPCD3_HUMAN	V	102	ENSP00000368356:F102V;ENSP00000234179:F102V	ENSP00000234179:F102V	F	-	1	0	0	PRKD3	37373903	37373903	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	0.914000	0.36822	0.533000	0.62120	TTC	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.333	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	0	0	1	2	2	2	2	0	0	0	0	190	190	190	186	1	1.870000	-8.380415	1	0.300000	NM_005813		0	9	8	0	462	448	0		1	0		0	0	190	0	0	0.993406	1.241830e-02	0	0	0	8	0	9	462
SOCS5	9655	broad.mit.edu	37	2	46987120	46987120	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:46987120T>C	ENST00000306503.5	+	2	1623	c.1451T>C	c.(1450-1452)cTg>cCg	p.L484P	SOCS5_ENST00000394861.2_Missense_Mutation_p.L484P	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	484	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CCTTTTAGCCTGCAGTATATC	0.398																																						ENST00000306503.5	1.000000	0.850000	9.900000e-01	9.100000e-01	0.960000	0.958236	0.960000	0.990000																										0				22						c.(1450-1452)cTg>cCg		suppressor of cytokine signaling 5							89.0	85.0	87.0					2																	46987120		2203	4300	6503	SO:0001583	missense	9655	0	0					g.chr2:46987120T>C	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1451T>C	chr2.hg19:g.46987120T>C	ENSP00000305133:p.Leu484Pro	1					SOCS5_ENST00000394861.2_Missense_Mutation_p.L484P	p.L484P	NM_014011.4	NP_054730.1	0	1	1	1.726450	O75159	SOCS5_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.114)	2	1623	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	1	1	hg19	c.1451T>C	CCDS1830.1	1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543224	0.65198	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	D;D	0.94497	-3.44;-3.44	5.43	5.43	0.79202	5.43	5.43	0.79202	SOCS protein, C-terminal (4);SH2 motif (1);	0.000000	0.64402	D	0.000001	D	0.98229	0.9414	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99597	1.0977	10	0.87932	D	0	-13.9042	15.3001	0.73940	0.0:0.0:0.0:1.0	.	484	O75159	SOCS5_HUMAN	P	484	ENSP00000305133:L484P;ENSP00000378330:L484P	ENSP00000305133:L484P	L	+	2	0	0	SOCS5	46840624	46840624	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.868000	0.87116	2.279000	0.76181	0.533000	0.62120	CTG	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.398	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2	1	0	1	2	2	2	2	0	0	0	0	138	138	138	138	1	1.870000	-20.000000	1	0.300000			0	95	91	0	381	376	1		1	1		0	0	138	0	0	1.000000	6.760566e-01	0	2	0	9	0	95	381
SMEK2	57223	broad.mit.edu	37	2	55795477	55795477	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:55795477C>T	ENST00000345102.5	-	13	2089	c.1788G>A	c.(1786-1788)cgG>cgA	p.R596R	SMEK2_ENST00000272313.5_Silent_p.R511R|SNORA12_ENST00000390873.1_RNA|SMEK2_ENST00000407823.3_Silent_p.R564R	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	596					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GTCCAATTATCCGCCTCATAA	0.313																																						ENST00000345102.5	1.000000	0.710000	9.700000e-01	8.000000e-01	0.890000	0.887821	0.890000	0.930000																										0				16						c.(1786-1788)cgG>cgA		SMEK homolog 2, suppressor of mek1 (Dictyostelium)							55.0	59.0	58.0					2																	55795477		2203	4296	6499	SO:0001819	synonymous_variant	57223	0	0					g.chr2:55795477C>T	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1788G>A	chr2.hg19:g.55795477C>T		1					SMEK2_ENST00000272313.5_Silent_p.R511R|SMEK2_ENST00000407823.3_Silent_p.R564R|SNORA12_ENST00000390873.1_RNA	p.R596R	NM_001122964.1	NP_001116436	0	1	1	1.726450	Q5MIZ7	P4R3B_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)	13	2089	-			Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Silent	SNP	ENST00000345102.5	1	1	hg19	c.1788G>A	CCDS46289.1	1																																																																																								0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.313	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.870000	-3.250900	1	0.300000	NM_020463		0	57	56	0	285	281	1		1	1		0	0	96	0	0	1.000000	9.949058e-01	0	6	0	37	0	57	285
THAP4	51078	broad.mit.edu	37	2	242572368	242572368	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr2:242572368C>T	ENST00000407315.1	-	2	1635	c.1204G>A	c.(1204-1206)Gtc>Atc	p.V402I		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	402							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		GGATAGGGGACGCTCACTCTC	0.627																																						ENST00000407315.1	1.000000	0.200000	1	3.200000e-01	0.500000	0.574896	0.500000	0.430000																										0				9						c.(1204-1206)Gtc>Atc		THAP domain containing 4							44.0	42.0	43.0					2																	242572368		2203	4296	6499	SO:0001583	missense	51078	2	121408	27				g.chr2:242572368C>T	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.1204G>A	chr2.hg19:g.242572368C>T	ENSP00000385006:p.Val402Ile	0						p.V402I	NM_015963.5	NP_057047.4	1	2	3	2.071217	Q8WY91	THAP4_HUMAN		2	1635	-		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Missense_Mutation	SNP	ENST00000407315.1	1	1	hg19	c.1204G>A	CCDS2551.1	0	.	.	.	.	.	.	.	.	.	.	C	2.394	-0.339085	0.05243	.	.	ENSG00000176946	ENST00000407315;ENST00000512346	D	0.95554	-3.74	5.22	-10.4	0.00318	5.22	-10.4	0.00318	.	.	.	.	.	T	0.81064	0.4745	N	0.03608	-0.345	0.24018	N	0.996156	B	0.02656	0.0	B	0.01281	0.0	T	0.71431	-0.4595	9	0.21540	T	0.41	-1.1688	1.6018	0.02675	0.138:0.3253:0.2302:0.3065	.	402	Q8WY91	THAP4_HUMAN	I	402;77	ENSP00000385006:V402I	ENSP00000385006:V402I	V	-	1	0	0	THAP4	242221041	242221041	0.234000	0.23783	0.000000	0.03702	0.462000	0.32619	-0.598000	0.05706	-3.708000	0.00117	-2.089000	0.00373	GTC	0.326275		TCGA-3A-A9I9-01A-11D-A38G-08	0.627	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257267.3	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.870000	-10.262600	1	0.300000	NM_015963		0	6	6	0	91	91	0		1	1		0	0	55	0	0	0.966557	9.592442e-01	0	10	0	81	0	6	91
SIDT1	54847	broad.mit.edu	37	3	113320452	113320452	+	Missense_Mutation	SNP	G	G	C	rs138220562		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:113320452G>C	ENST00000264852.4	+	11	1789	c.1063G>C	c.(1063-1065)Gca>Cca	p.A355P	SIDT1_ENST00000393830.3_Missense_Mutation_p.A355P	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	355					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						AAATATGGTGGCATCTCATCC	0.413																																						ENST00000264852.4	0.540000	0.150000	4.000000e-01	2.100000e-01	0.290000	0.316662	0.290000	0.290000																										0				50						c.(1063-1065)Gca>Cca		SID1 transmembrane family, member 1							129.0	114.0	119.0					3																	113320452		2203	4300	6503	SO:0001583	missense	54847	0	0					g.chr3:113320452G>C	AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1063G>C	chr3.hg19:g.113320452G>C	ENSP00000264852:p.Ala355Pro	0					SIDT1_ENST00000393830.3_Missense_Mutation_p.A355P	p.A355P	NM_017699.2	NP_060169.2	1	2	3	2.050663	Q9NXL6	SIDT1_HUMAN		11	1789	+			Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	1	1	hg19	c.1063G>C	CCDS2974.1	0	.	.	.	.	.	.	.	.	.	.	G	4.852	0.158347	0.09236	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.23348	1.91;1.91	6.17	4.37	0.52481	6.17	4.37	0.52481	.	0.722817	0.12743	N	0.442876	T	0.21468	0.0517	L	0.40543	1.245	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.11591	-1.0581	10	0.33940	T	0.23	-4.7062	9.7877	0.40686	0.0667:0.0:0.6671:0.2661	.	355;355	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	P	355	ENSP00000264852:A355P;ENSP00000377416:A355P	ENSP00000264852:A355P	A	+	1	0	0	SIDT1	114803142	114803142	0.002000	0.14202	0.038000	0.18304	0.115000	0.19883	1.111000	0.31159	1.607000	0.50170	-0.181000	0.13052	GCA	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.413	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	1.870000	-4.333398	1	0.300000	NM_017699		0	10	10	0	223	221	0		1	0		0	0	61	0	0	0.996932	0	0	0	0	1	0	10	223
GRAMD1C	54762	broad.mit.edu	37	3	113595066	113595066	+	Missense_Mutation	SNP	C	C	T	rs199735566		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:113595066C>T	ENST00000358160.4	+	5	910	c.418C>T	c.(418-420)Ctc>Ttc	p.L140F	GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000479212.1_3'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	140						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						AACTGCTCGACTCATCCCAAA	0.303													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18315	0.0		0.0	False		,,,				2504	0.0					ENST00000358160.4	1.000000	0.820000	1	9.200000e-01	0.990000	0.972261	0.990000	1.000000																										0				26						c.(418-420)Ctc>Ttc		GRAM domain containing 1C		C	PHE/LEU	2,4404	4.2+/-10.8	0,2,2201	107.0	114.0	112.0		418	4.3	1.0	3		112	0,8600		0,0,4300	no	missense	GRAMD1C	NM_017577.4	22	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	140/663	113595066	2,13004	2203	4300	6503	SO:0001583	missense	54762	16	121412	47				g.chr3:113595066C>T		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.418C>T	chr3.hg19:g.113595066C>T	ENSP00000350881:p.Leu140Phe	0					GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000452134.2_5'UTR	p.L140F	NM_017577.4	NP_060047.3	1	2	3	2.050663	Q8IYS0	GRM1C_HUMAN		5	910	+			A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	1	1	hg19	c.418C>T	CCDS33826.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	16.99	3.273860	0.59649	4.54E-4	0.0	ENSG00000178075	ENST00000358160	T	0.37584	1.19	5.2	4.33	0.51752	5.2	4.33	0.51752	.	0.154190	0.40728	N	0.001026	T	0.39682	0.1087	M	0.79123	2.44	0.80722	D	1	B	0.25521	0.128	B	0.19666	0.026	T	0.37888	-0.9686	10	0.59425	D	0.04	.	11.6383	0.51217	0.0:0.9126:0.0:0.0874	.	140	Q8IYS0	GRM1C_HUMAN	F	140	ENSP00000350881:L140F	ENSP00000350881:L140F	L	+	1	0	0	GRAMD1C	115077756	115077756	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	2.219000	0.42899	1.331000	0.45412	0.655000	0.94253	CTC	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.303	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	1	0	1	2	2	2	2	0	0	0	0	176	176	176	175	1	1.870000	-20.000000	1	0.300000	NM_017577		0	80	79	0	441	428	1		1	0		0	0	176	0	0	1.000000	0	0	0	0	1	0	80	441
ZFYVE20	64145	broad.mit.edu	37	3	15116060	15116060	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:15116060C>T	ENST00000253699.3	-	14	2197	c.1584G>A	c.(1582-1584)cgG>cgA	p.R528R	ZFYVE20_ENST00000476527.2_Silent_p.R528R	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	528	Necessary for the interaction with EHD1.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						GTTCCAACTCCCGTTCACGCA	0.597																																						ENST00000253699.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				26						c.(1582-1584)cgG>cgA		zinc finger, FYVE domain containing 20							105.0	98.0	100.0					3																	15116060		2203	4300	6503	SO:0001819	synonymous_variant	64145	0	0					g.chr3:15116060C>T	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.1584G>A	chr3.hg19:g.15116060C>T		1					ZFYVE20_ENST00000476527.2_Silent_p.R528R	p.R528R	NM_022340.2	NP_071735.2	1	2	3	2.361890	Q9H1K0	RBNS5_HUMAN		14	2197	-			B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Silent	SNP	ENST00000253699.3	1	1	hg19	c.1584G>A	CCDS2623.1	1																																																																																								0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.597	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	1	0	1	2	2	2	2	0	0	0	0	210	210	210	207	1	1.870000	-20.000000	1	0.300000	NM_022340		0	121	120	0	364	353	1		1	1		0	0	210	0	0	1.000000	8.699429e-01	0	5	0	8	0	121	364
ARHGAP31	57514	broad.mit.edu	37	3	119121031	119121031	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:119121031C>T	ENST00000264245.4	+	10	1964	c.1432C>T	c.(1432-1434)Cgt>Tgt	p.R478C		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	478					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GCCCTCGCCGCGTAACCAGCG	0.587																																					Pancreas(7;176 297 5394 51128 51241)	ENST00000264245.4	1.000000	0.770000	1	8.700000e-01	0.980000	0.951941	0.980000	1.000000																										0				67						c.(1432-1434)Cgt>Tgt		Rho GTPase activating protein 31							66.0	75.0	72.0					3																	119121031		2071	4213	6284	SO:0001583	missense	57514	3	121016	41				g.chr3:119121031C>T		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1432C>T	chr3.hg19:g.119121031C>T	ENSP00000264245:p.Arg478Cys	0						p.R478C	NM_020754.2	NP_065805.2	1	2	3	2.050663	Q2M1Z3	RHG31_HUMAN		10	1964	+			Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	1	1	hg19	c.1432C>T	CCDS43135.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250570	0.80135	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.12879	2.64	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000002	T	0.26882	0.0658	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	P	0.53185	0.72	T	0.00544	-1.1679	10	0.87932	D	0	.	13.1802	0.59649	0.1592:0.8408:0.0:0.0	.	478	Q2M1Z3	RHG31_HUMAN	C	478	ENSP00000264245:R478C	ENSP00000264245:R478C	R	+	1	0	0	ARHGAP31	120603721	120603721	0.997000	0.39634	0.444000	0.26895	0.924000	0.55760	3.505000	0.53356	2.774000	0.95407	0.655000	0.94253	CGT	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.587	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2	1	0	1	2	2	2	2	0	0	0	0	198	198	198	197	1	1.870000	-20.000000	1	0.300000			0	65	64	0	375	367	1		1	0		0	0	198	0	0	1.000000	3.974105e-01	0	1	0	8	0	65	375
DHX36	170506	broad.mit.edu	37	3	154032888	154032888	+	Missense_Mutation	SNP	A	A	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:154032888A>C	ENST00000496811.1	-	3	630	c.550T>G	c.(550-552)Tta>Gta	p.L184V	DHX36_ENST00000329463.5_Missense_Mutation_p.L184V|DHX36_ENST00000308361.6_Missense_Mutation_p.L184V|DHX36_ENST00000544526.1_Missense_Mutation_p.L184V	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	184					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCTTCCAATAATTTTTGGTCT	0.289																																						ENST00000496811.1	1.000000	0.840000	1	9.500000e-01	0.990000	0.981715	0.990000	1.000000																										0				35						c.(550-552)Tta>Gta		DEAH (Asp-Glu-Ala-His) box polypeptide 36							48.0	51.0	50.0					3																	154032888		2199	4298	6497	SO:0001583	missense	170506	0	0					g.chr3:154032888A>C	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.550T>G	chr3.hg19:g.154032888A>C	ENSP00000417078:p.Leu184Val	0					DHX36_ENST00000308361.6_Missense_Mutation_p.L184V|DHX36_ENST00000329463.5_Missense_Mutation_p.L184V|DHX36_ENST00000544526.1_Missense_Mutation_p.L184V	p.L184V	NM_020865.2	NP_065916.2	1	2	3	2.050663	Q9H2U1	DHX36_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)	3	630	-			B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	1	1	hg19	c.550T>G	CCDS3171.1	1	.	.	.	.	.	.	.	.	.	.	A	12.16	1.854682	0.32791	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9	5.64	2.36	0.29203	5.64	2.36	0.29203	.	0.000000	0.64402	D	0.000001	T	0.08537	0.0212	L	0.36672	1.1	0.46774	D	0.999197	P;P;B	0.41313	0.573;0.745;0.251	B;B;B	0.37550	0.18;0.253;0.095	T	0.18116	-1.0347	10	0.51188	T	0.08	.	9.201	0.37258	0.2292:0.0:0.7708:0.0	.	184;184;184	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	V	184;184;184;184;98	ENSP00000417078:L184V;ENSP00000309296:L184V;ENSP00000444247:L184V;ENSP00000330113:L184V;ENSP00000419862:L98V	ENSP00000309296:L184V	L	-	1	2	2	DHX36	155515582	155515582	0.980000	0.34600	0.395000	0.26283	0.968000	0.65278	1.368000	0.34216	0.114000	0.18032	0.472000	0.43445	TTA	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.289	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	73	1	1.870000	-20.000000	1	0.300000	NM_020865		0	57	55	0	295	288	1		1	1		0	0	76	0	0	1.000000	5.032503e-01	0	2	0	8	0	57	295
GHSR	2693	broad.mit.edu	37	3	172165640	172165640	+	Silent	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:172165640G>A	ENST00000241256.2	-	1	606	c.564C>T	c.(562-564)aaC>aaT	p.N188N	GHSR_ENST00000427970.1_Silent_p.N188N	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	188					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GGTCGGTGCCGTTCTCGTGCT	0.637																																					Esophageal Squamous(93;641 1401 20883 29581 34638)	ENST00000241256.2	0.420000	0.050000	2.800000e-01	1.000000e-01	0.170000	0.199669	0.170000	0.160000																										0				33						c.(562-564)aaC>aaT		growth hormone secretagogue receptor							46.0	42.0	43.0					3																	172165640		2203	4300	6503	SO:0001819	synonymous_variant	2693	1	121402	32				g.chr3:172165640G>A	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.564C>T	chr3.hg19:g.172165640G>A		0					GHSR_ENST00000427970.1_Silent_p.N188N	p.N188N	NM_198407.2	NP_940799.1	1	2	3	2.050663	Q92847	GHSR_HUMAN	Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)	1	606	-	Ovarian(172;0.00143)|Breast(254;0.197)		Q14D12|Q6ISR8|Q92848|Q96RJ7	Silent	SNP	ENST00000241256.2	0	1	hg19	c.564C>T	CCDS3218.1	0																																																																																								0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.637	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	1.870000	-6.312351	1	0.300000	NM_004122		0	4	4	0	166	163	0		1			0	0	66	0	0	0.887104	0	0	0	0	0	0	4	166
SCN5A	6331	broad.mit.edu	37	3	38671831	38671831	+	Silent	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:38671831C>G	ENST00000333535.4	-	3	512	c.363G>C	c.(361-363)cgG>cgC	p.R121R	SCN5A_ENST00000425664.1_Silent_p.R121R|SCN5A_ENST00000449557.2_Silent_p.R121R|SCN5A_ENST00000423572.2_Silent_p.R121R|SCN5A_ENST00000414099.2_Silent_p.R121R|SCN5A_ENST00000451551.2_Silent_p.R121R|SCN5A_ENST00000455624.2_Silent_p.R121R|SCN5A_ENST00000443581.1_Silent_p.R121R|SCN5A_ENST00000413689.1_Silent_p.R121R|SCN5A_ENST00000450102.2_Silent_p.R121R			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	121					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CAGCCGCTCTCCGGATGGGGT	0.557																																						ENST00000333535.4	1.000000	0.650000	1	7.500000e-01	0.860000	0.867573	0.860000	1.000000																										0				107						c.(361-363)cgG>cgC		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						90.0	96.0	94.0					3																	38671831		2072	4242	6314	SO:0001819	synonymous_variant	6331	0	0					g.chr3:38671831C>G	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.363G>C	chr3.hg19:g.38671831C>G		0					SCN5A_ENST00000413689.1_Silent_p.R121R|SCN5A_ENST00000449557.2_Silent_p.R121R|SCN5A_ENST00000425664.1_Silent_p.R121R|SCN5A_ENST00000451551.2_Silent_p.R121R|SCN5A_ENST00000455624.2_Silent_p.R121R|SCN5A_ENST00000450102.2_Silent_p.R121R|SCN5A_ENST00000414099.2_Silent_p.R121R|SCN5A_ENST00000443581.1_Silent_p.R121R|SCN5A_ENST00000423572.2_Silent_p.R121R	p.R121R			1	2	3	2.042112	Q14524	SCN5A_HUMAN		3	512	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	1	1	hg19	c.363G>C	CCDS46796.1	1																																																																																								0.301048		TCGA-3A-A9I9-01A-11D-A38G-08	0.557	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	1	0	1	2	2	2	2	0	0	0	0	145	145	145	146	1	1.870000	-2.921011	1	0.300000	NM_198056		0	46	45	0	307	300	1		1			0	0	145	0	0	1.000000	0	0	0	0	0	0	46	307
ZNF619	285267	broad.mit.edu	37	3	40529155	40529155	+	Missense_Mutation	SNP	C	C	T	rs139131960	byFrequency	TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:40529155C>T	ENST00000314686.5	+	6	1511	c.1106C>T	c.(1105-1107)tCg>tTg	p.S369L	ZNF619_ENST00000429348.2_Missense_Mutation_p.S385L|ZNF619_ENST00000432264.2_Missense_Mutation_p.S385L|ZNF619_ENST00000522736.1_Missense_Mutation_p.S376L|ZNF619_ENST00000521353.1_Missense_Mutation_p.S425L|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000447116.2_Missense_Mutation_p.S425L|ZNF619_ENST00000456778.1_Missense_Mutation_p.S341L			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CACCGCAGTTCGGTATTTCTT	0.443													c|||	4	0.000798722	0.0023	0.0	5008	,	,		21349	0.0		0.0	False		,,,				2504	0.001					ENST00000314686.5	1.000000	0.870000	1	9.900000e-01	0.990000	0.988959	0.990000	1.000000																										0				21						c.(1105-1107)tCg>tTg		zinc finger protein 619		C	LEU/SER,LEU/SER,LEU/SER	2,4404	4.2+/-10.8	0,2,2201	62.0	65.0	64.0		1274,1022,1154	1.5	0.0	3	dbSNP_134	64	0,8600		0,0,4300	yes	missense,missense,missense	ZNF619	NM_001145082.2,NM_001145083.1,NM_001145093.2	145,145,145	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	425/617,341/533,385/577	40529155	2,13004	2203	4300	6503	SO:0001583	missense	285267	37	121412	46				g.chr3:40529155C>T	AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.1106C>T	chr3.hg19:g.40529155C>T	ENSP00000322529:p.Ser369Leu	0					ZNF619_ENST00000521353.1_Missense_Mutation_p.S425L|ZNF619_ENST00000447116.2_Missense_Mutation_p.S425L|ZNF619_ENST00000429348.2_Missense_Mutation_p.S385L|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000522736.1_Missense_Mutation_p.S376L|ZNF619_ENST00000456778.1_Missense_Mutation_p.S341L|ZNF619_ENST00000432264.2_Missense_Mutation_p.S385L	p.S369L			1	2	3	2.042112	Q8N2I2	ZN619_HUMAN		6	1511	+			B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	ENST00000314686.5	1	1	hg19	c.1106C>T		1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	7.811	0.715641	0.15306	4.54E-4	0.0	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25	2.44	1.51	0.23008	2.44	1.51	0.23008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26593	0.0650	M	0.81179	2.53	0.09310	N	1	D;P;P;D;P;P	0.67145	0.996;0.839;0.839;0.96;0.839;0.921	P;B;B;B;B;B	0.49683	0.619;0.071;0.071;0.394;0.098;0.118	T	0.14980	-1.0453	9	0.72032	D	0.01	.	4.6774	0.12719	0.2336:0.4962:0.2702:0.0	.	341;385;425;327;376;369	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	L	369;425;385;341;376;425;385	ENSP00000322529:S369L;ENSP00000411132:S425L;ENSP00000398024:S385L;ENSP00000397232:S341L;ENSP00000428004:S376L;ENSP00000430705:S425L;ENSP00000388710:S385L	ENSP00000322529:S369L	S	+	2	0	0	ZNF619	40504159	40504159	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-1.135000	0.03225	0.342000	0.23796	0.563000	0.77884	TCG	0.301048		TCGA-3A-A9I9-01A-11D-A38G-08	0.443	ZNF619-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000254180.2	0	0	0	2	2	2	2	0	0	0	0	82	82	82	82	1	1.870000	-4.363608	1	0.300000	NM_173656		0	54	54	0	265	259	0		1	1		0	0	82	0	0	1.000000	3.402626e-01	0	2	0	5	0	54	265
TRAIP	10293	broad.mit.edu	37	3	49867474	49867474	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:49867474C>T	ENST00000331456.2	-	12	1178	c.1065G>A	c.(1063-1065)aaG>aaA	p.K355K	TRAIP_ENST00000469027.1_Silent_p.K200K	NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	355	Interaction with CYLD.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTTTGCATATCTTCTTGGGGA	0.532																																						ENST00000331456.2	0.200000	0.040000	1.600000e-01	7.000000e-02	0.100000	0.117900	0.100000	0.100000																										0				24						c.(1063-1065)aaG>aaA		TRAF interacting protein							140.0	127.0	132.0					3																	49867474		2203	4300	6503	SO:0001819	synonymous_variant	10293	0	0					g.chr3:49867474C>T	BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.1065G>A	chr3.hg19:g.49867474C>T		0					TRAIP_ENST00000469027.1_Silent_p.K200K	p.K355K	NM_005879.2	NP_005870.2	0	1	1	2.033341	Q9BWF2	TRAIP_HUMAN		12	1178	-			B5BU84|B5BUL3|O00467	Silent	SNP	ENST00000331456.2	0	1	hg19	c.1065G>A	CCDS2806.1	0																																																																																								0.297894		TCGA-3A-A9I9-01A-11D-A38G-08	0.532	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350518.1	0	0	1	2	2	2	2	0	0	0	0	174	174	174	168	1	1.870000	-3.333272	1	0.300000	NM_005879		0	8	8	0	495	484	0		1	0		0	0	174	0	0	0.988389	2.044684e-03	0	0	0	4	0	8	495
GPR27	2850	broad.mit.edu	37	3	71804286	71804286	+	Silent	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:71804286C>A	ENST00000304411.2	+	1	1086	c.1086C>A	c.(1084-1086)acC>acA	p.T362T	EIF4E3_ENST00000448225.1_5'Flank|EIF4E3_ENST00000295612.3_5'Flank|EIF4E3_ENST00000421769.2_5'Flank	NM_018971.1	NP_061844.1	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	362					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|lung(2)|ovary(1)|prostate(1)	5		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		CCCGGACCACCCAGGCGACCC	0.647																																						ENST00000304411.2	0.830000	0.140000	6.200000e-01	2.500000e-01	0.400000	0.439490	0.400000	0.360000																										0				5						c.(1084-1086)acC>acA		G protein-coupled receptor 27							11.0	11.0	11.0					3																	71804286		2085	4131	6216	SO:0001819	synonymous_variant	2850	0	0					g.chr3:71804286C>A	AB040799	CCDS2915.1	3p21-p14	2012-08-21			ENSG00000170837	ENSG00000170837		"""GPCR / Class A : Orphans"""	4482	protein-coding gene	gene with protein product		605187				10833454	Standard	NM_018971		Approved	SREB1	uc011bge.2	Q9NS67	OTTHUMG00000158810	ENST00000304411.2:c.1086C>A	chr3.hg19:g.71804286C>A		0					EIF4E3_ENST00000421769.2_5'Flank|EIF4E3_ENST00000448225.1_5'Flank|EIF4E3_ENST00000295612.3_5'Flank	p.T362T	NM_018971.1	NP_061844.1	0	1	1	2.033341	Q9NS67	GPR27_HUMAN		1	1086	+		Prostate(10;0.00899)		Silent	SNP	ENST00000304411.2	0	1	hg19	c.1086C>A	CCDS2915.1	0																																																																																								0.297894		TCGA-3A-A9I9-01A-11D-A38G-08	0.647	GPR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352303.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.870000	-8.481318	1	0.300000	NM_018971		0	4	4	0	67	65	0		1	0		0	0	30	0	0	0.885530	1.542357e-01	0	0	0	10	0	4	67
ETV5	2119	broad.mit.edu	37	3	185783686	185783686	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr3:185783686G>C	ENST00000306376.5	-	8	1072	c.826C>G	c.(826-828)Ccg>Gcg	p.P276A	ETV5_ENST00000434744.1_Missense_Mutation_p.P276A|ETV5_ENST00000537818.1_Missense_Mutation_p.P318A|ETV5_ENST00000480706.1_5'Flank	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	276					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GGCATGCCCGGGACCCCATGT	0.552			T	"""TMPRSS2, SCL45A3"""	Prostate																																	ENST00000306376.5	0.540000	0.230000	4.500000e-01	2.900000e-01	0.360000	0.377370	0.360000	0.360000				Dom	yes			Dom	yes		3	3q28	3q28	2119	T	ets variant gene 5				E	E	TMPRSS2, SCL45A3		Prostate		0				28						c.(826-828)Ccg>Gcg		ets variant 5							74.0	84.0	80.0					3																	185783686		2203	4300	6503	SO:0001583	missense	2119	0	0					g.chr3:185783686G>C	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.826C>G	chr3.hg19:g.185783686G>C	ENSP00000306894:p.Pro276Ala	0					ETV5_ENST00000537818.1_Missense_Mutation_p.P318A|ETV5_ENST00000480706.1_5'Flank|ETV5_ENST00000434744.1_Missense_Mutation_p.P276A	p.P276A	NM_004454.2	NP_004445.1	1	2	3	2.050663	P41161	ETV5_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)	8	1072	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	1	1	hg19	c.826C>G	CCDS33906.1	0	.	.	.	.	.	.	.	.	.	.	G	11.77	1.738599	0.30774	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.24151	1.87;1.87;1.87	6.17	4.36	0.52297	6.17	4.36	0.52297	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.053049	0.85682	D	0.000000	T	0.16085	0.0387	N	0.19112	0.55	0.42954	D	0.994381	B;B	0.14438	0.01;0.008	B;B	0.16289	0.015;0.013	T	0.05321	-1.0892	10	0.37606	T	0.19	.	9.3211	0.37964	0.0734:0.0:0.7838:0.1428	.	276;318	P41161;B7Z7D7	ETV5_HUMAN;.	A	276;276;318	ENSP00000306894:P276A;ENSP00000413755:P276A;ENSP00000441737:P318A	ENSP00000306894:P276A	P	-	1	0	0	ETV5	187266380	187266380	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	3.446000	0.52928	0.907000	0.36646	0.655000	0.94253	CCG	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.552	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	1	0	1	2	2	2	2	0	0	0	0	141	141	141	137	1	1.870000	-5.194360	1	0.300000	NM_004454		0	24	23	0	422	414	0		1	0		0	0	141	0	0	1.000000	7.084748e-02	0	0	0	8	0	24	422
DAPP1	27071	broad.mit.edu	37	4	100784951	100784951	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:100784951G>C	ENST00000512369.1	+	7	693	c.625G>C	c.(625-627)Gac>Cac	p.D209H	DAPP1_ENST00000296414.7_Missense_Mutation_p.D209H	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	209	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		TCGGATCCTAGACCTAACAGA	0.303																																						ENST00000512369.1	1.000000	0.650000	1	8.500000e-01	0.990000	0.946643	0.990000	1.000000																										0				6						c.(625-627)Gac>Cac		dual adaptor of phosphotyrosine and 3-phosphoinositides							75.0	74.0	74.0					4																	100784951		1807	4072	5879	SO:0001583	missense	27071	0	0					g.chr4:100784951G>C	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.625G>C	chr4.hg19:g.100784951G>C	ENSP00000423602:p.Asp209His	0					DAPP1_ENST00000296414.7_Missense_Mutation_p.D209H	p.D209H	NM_014395.2	NP_055210.2	0	1	1	2.035556	Q9UN19	DAPP1_HUMAN		7	693	+			Q8TCK5|Q9UHF2	Missense_Mutation	SNP	ENST00000512369.1	1	1	hg19	c.625G>C	CCDS47112.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032235	0.75504	.	.	ENSG00000070190	ENST00000296414;ENST00000512369	T;T	0.76709	-1.04;-1.04	5.72	4.88	0.63580	5.72	4.88	0.63580	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.045133	0.85682	D	0.000000	D	0.87341	0.6153	M	0.78916	2.43	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.80764	0.985;0.994	D	0.88675	0.3198	10	0.72032	D	0.01	-19.8161	13.5784	0.61888	0.076:0.0:0.9239:0.0	.	209;209	Q9UN19-2;Q9UN19	.;DAPP1_HUMAN	H	209	ENSP00000296414:D209H;ENSP00000423602:D209H	ENSP00000296414:D209H	D	+	1	0	0	DAPP1	101003974	101003974	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.093000	0.64517	1.410000	0.46936	0.655000	0.94253	GAC	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.303	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.870000	-20.000000	1	0.300000			0	15	15	0	77	74	1		1	0		0	0	21	0	0	0.999896	6.159777e-01	0	0	0	12	0	15	77
NCAPG	64151	broad.mit.edu	37	4	17839269	17839269	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:17839269G>C	ENST00000251496.2	+	16	2487	c.2311G>C	c.(2311-2313)Gaa>Caa	p.E771Q		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	771					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		GGAATGCTTTGAAGAAGCTTT	0.358																																						ENST00000251496.2	1.000000	0.800000	1	8.700000e-01	0.960000	0.947308	0.960000	1.000000																										0				27						c.(2311-2313)Gaa>Caa		non-SMC condensin I complex, subunit G							150.0	150.0	150.0					4																	17839269		2203	4300	6503	SO:0001583	missense	64151	0	0					g.chr4:17839269G>C	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2311G>C	chr4.hg19:g.17839269G>C	ENSP00000251496:p.Glu771Gln	0						p.E771Q	NM_022346.4	NP_071741.2	0	1	1	2.035556	Q9BPX3	CND3_HUMAN		16	2487	+			Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	1	1	hg19	c.2311G>C	CCDS3424.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257970	0.80246	.	.	ENSG00000109805	ENST00000251496	T	0.31769	1.48	5.55	4.71	0.59529	5.55	4.71	0.59529	Armadillo-type fold (1);	0.044582	0.85682	D	0.000000	T	0.54565	0.1866	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.56517	-0.7966	10	0.45353	T	0.12	-21.4946	14.1271	0.65228	0.0721:0.0:0.9279:0.0	.	771	Q9BPX3	CND3_HUMAN	Q	771	ENSP00000251496:E771Q	ENSP00000251496:E771Q	E	+	1	0	0	NCAPG	17448367	17448367	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.813000	0.91963	1.339000	0.45563	0.591000	0.81541	GAA	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.358	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	1	0	1	2	2	2	2	0	0	0	0	126	126	126	123	1	1.870000	-20.000000	1	0.300000	NM_022346		0	109	104	0	643	633	1		1	1		0	0	126	0	0	1.000000	5.826654e-01	0	5	0	8	0	109	643
AIMP1	9255	broad.mit.edu	37	4	107252827	107252827	+	Splice_Site	SNP	A	A	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:107252827A>G	ENST00000442366.1	+	5	443		c.e5-1		AIMP1_ENST00000358008.3_Splice_Site|AIMP1_ENST00000394701.4_Splice_Site	NM_001142415.1	NP_001135887.1	Q12904	AIMP1_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 1						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of endothelial cell proliferation (GO:0001937)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|endometrium(2)|kidney(1)|lung(5)|skin(1)|urinary_tract(1)	11						AATACTTTTTAGGAGAGAAGA	0.358																																						ENST00000442366.1	0.230000	0.030000	1.700000e-01	6.000000e-02	0.110000	0.124282	0.110000	0.100000																										0				11						c.e5-1		aminoacyl tRNA synthetase complex-interacting multifunctional protein 1							66.0	71.0	70.0					4																	107252827		2200	4298	6498	SO:0001630	splice_region_variant	9255	0	0					g.chr4:107252827A>G	U10117	CCDS3674.1, CCDS47121.1	4q24	2009-05-20	2009-05-20	2009-05-20	ENSG00000164022	ENSG00000164022			10648	protein-coding gene	gene with protein product	"""EMAP II"", ""ARS-interacting multifunctional protein 1"""	603605	"""small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)"""	SCYE1		7929199, 7545917	Standard	NM_004757		Approved	EMAPII, EMAP-2, p43	uc011cfg.2	Q12904	OTTHUMG00000131217	ENST00000442366.1:c.392-1A>G	chr4.hg19:g.107252827A>G		0					AIMP1_ENST00000358008.3_Splice_Site|AIMP1_ENST00000394701.4_Splice_Site		NM_001142415.1	NP_001135887.1	0	1	1	2.035556	Q12904	AIMP1_HUMAN		5	443	+			B3KTR2|B4E1S7|Q6FG28|Q96CQ9	Splice_Site	SNP	ENST00000442366.1	0	1	hg19		CCDS3674.1	0	.	.	.	.	.	.	.	.	.	.	A	13.06	2.124201	0.37533	.	.	ENSG00000164022	ENST00000510207;ENST00000442366;ENST00000432345;ENST00000358008;ENST00000394701	.	.	.	5.23	5.23	0.72850	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1091	0.72340	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	AIMP1	107472276	107472276	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	5.339000	0.65953	1.979000	0.57680	0.528000	0.53228	.	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.358	AIMP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253961.1	0	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	1.870000	-2.543142	1	0.300000	NM_004757	Intron	0	5	5	0	312	308	0		1	0		0	0	82	0	0	0.935921	0	0	0	0	1	0	5	312
MFSD7	84179	broad.mit.edu	37	4	678335	678335	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	C	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:678335G>C	ENST00000404286.2	-	6	795	c.780C>G	c.(778-780)atC>atG	p.I260M	MFSD7_ENST00000347950.5_Missense_Mutation_p.I141M|MFSD7_ENST00000515118.1_Missense_Mutation_p.I163M|MFSD7_ENST00000503156.1_Missense_Mutation_p.I195M|MFSD7_ENST00000322224.4_Missense_Mutation_p.I259M|MFSD7_ENST00000513740.1_5'Flank	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	260					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						CAGAGATCCCGATCATTCCCC	0.642											OREG0016025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000404286.2	1.000000	0.790000	1	8.800000e-01	0.980000	0.957387	0.980000	1.000000																										0				11						c.(778-780)atC>atG		major facilitator superfamily domain containing 7							99.0	100.0	100.0					4																	678335		2203	4300	6503	SO:0001583	missense	84179	0	0					g.chr4:678335G>C	AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.780C>G	chr4.hg19:g.678335G>C	ENSP00000384616:p.Ile260Met	0		OREG0016025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	590	MFSD7_ENST00000515118.1_Missense_Mutation_p.I163M|MFSD7_ENST00000322224.4_Missense_Mutation_p.I259M|MFSD7_ENST00000347950.5_Missense_Mutation_p.I141M|MFSD7_ENST00000503156.1_Missense_Mutation_p.I195M|MFSD7_ENST00000513740.1_5'Flank	p.I260M	NM_032219.2	NP_115595.2	0	1	1	2.035556	Q6UXD7	MFSD7_HUMAN		6	795	-			A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Missense_Mutation	SNP	ENST00000404286.2	1	1	hg19	c.780C>G		1	.	.	.	.	.	.	.	.	.	.	G	9.541	1.113390	0.20795	.	.	ENSG00000169026	ENST00000347950;ENST00000322224;ENST00000404286;ENST00000515118;ENST00000503156;ENST00000507165	T;T;T;T;T;T	0.58358	0.34;0.45;0.45;0.34;0.45;0.45	4.73	-6.09	0.02145	4.73	-6.09	0.02145	Major facilitator superfamily domain, general substrate transporter (1);	0.365001	0.28011	N	0.016960	T	0.53334	0.1790	L	0.55103	1.725	0.09310	N	1	D;D;D;P;D	0.58970	0.98;0.984;0.968;0.906;0.975	P;P;P;P;P	0.59171	0.853;0.777;0.841;0.77;0.639	T	0.55147	-0.8186	10	0.42905	T	0.14	-14.7166	9.9496	0.41631	0.7043:0.1275:0.1682:0.0	.	195;163;141;260;259	D6RIZ6;D6R9R0;Q6UXD7-3;Q6UXD7;Q6UXD7-2	.;.;.;MFSD7_HUMAN;.	M	141;259;260;163;195;196	ENSP00000307545:I141M;ENSP00000320234:I259M;ENSP00000384616:I260M;ENSP00000423204:I163M;ENSP00000425753:I195M;ENSP00000424556:I196M	ENSP00000320234:I259M	I	-	3	3	3	MFSD7	668335	668335	0.041000	0.20044	0.000000	0.03702	0.002000	0.02628	-0.702000	0.05069	-1.401000	0.02058	0.460000	0.39030	ATC	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.642	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358585.1	1	0	1	2	2	2	2	0	0	0	0	225	225	225	223	1	1.870000	-20.000000	1	0.300000	NM_032219		0	75	72	0	427	420	1		1	0		0	0	225	0	0	1.000000	9.935028e-01	0	0	0	46	0	75	427
FAM114A1	92689	broad.mit.edu	37	4	38933133	38933133	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:38933133C>T	ENST00000358869.2	+	11	1399	c.1223C>T	c.(1222-1224)gCa>gTa	p.A408V	FAM114A1_ENST00000515037.1_Missense_Mutation_p.A201V	NM_138389.2	NP_612398.2	Q8IWE2	NXP20_HUMAN	family with sequence similarity 114, member A1	408						cytoplasm (GO:0005737)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	20						GTAGATGTGGCAAAAGTGTCC	0.453																																						ENST00000358869.2	0.500000	0.130000	3.900000e-01	1.900000e-01	0.280000	0.301988	0.280000	0.270000																										0				20						c.(1222-1224)gCa>gTa		family with sequence similarity 114, member A1							96.0	93.0	94.0					4																	38933133		2203	4300	6503	SO:0001583	missense	92689	0	0					g.chr4:38933133C>T		CCDS3447.1	4p14	2006-09-21			ENSG00000197712	ENSG00000197712			25087	protein-coding gene	gene with protein product							Standard	NM_138389		Approved	Noxp20	uc003gtn.3	Q8IWE2	OTTHUMG00000128583	ENST00000358869.2:c.1223C>T	chr4.hg19:g.38933133C>T	ENSP00000351740:p.Ala408Val	0					FAM114A1_ENST00000515037.1_Missense_Mutation_p.A201V	p.A408V	NM_138389.2	NP_612398.2	0	1	1	2.035556	Q8IWE2	NXP20_HUMAN		11	1399	+			A8K9W6|Q6MZV4|Q9BVL6	Missense_Mutation	SNP	ENST00000358869.2	1	1	hg19	c.1223C>T	CCDS3447.1	0	.	.	.	.	.	.	.	.	.	.	C	7.958	0.746323	0.15710	.	.	ENSG00000197712	ENST00000515037;ENST00000358869;ENST00000355404	T;T	0.22743	1.94;2.92	6.07	3.04	0.35103	6.07	3.04	0.35103	.	1.106540	0.06528	N	0.740982	T	0.18882	0.0453	L	0.57536	1.79	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.002	T	0.45381	-0.9265	10	0.02654	T	1	-0.0049	7.2024	0.25889	0.1269:0.6457:0.0:0.2274	.	201;408	Q6MZV4;Q8IWE2	.;NXP20_HUMAN	V	201;408;201	ENSP00000424115:A201V;ENSP00000351740:A408V	ENSP00000347569:A201V	A	+	2	0	0	FAM114A1	38609528	38609528	0.600000	0.26899	0.002000	0.10522	0.268000	0.26511	1.217000	0.32455	0.907000	0.36646	0.655000	0.94253	GCA	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.453	FAM114A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250436.1	0	0	1	2	2	2	2	0	0	0	0	55	55	55	53	1	1.870000	-4.093351	1	0.300000	NM_138389		0	8	8	0	186	181	0		1	0		0	0	55	0	0	0.988671	4.387243e-01	0	0	0	33	0	8	186
ALB	213	broad.mit.edu	37	4	74283893	74283893	+	Missense_Mutation	SNP	T	T	C	rs571711778		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			T	C	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:74283893T>C	ENST00000503124.1	+	10	1274	c.1067T>C	c.(1066-1068)gTg>gCg	p.V356A	ALB_ENST00000401494.3_Missense_Mutation_p.V391A|ALB_ENST00000415165.2_Missense_Mutation_p.V314A|ALB_ENST00000295897.4_Missense_Mutation_p.V506A|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000509063.1_Missense_Mutation_p.V506A			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAATCCTTGGTGAACAGGCGA	0.448													T|||	1	0.000199681	0.0	0.0	5008	,	,		19777	0.0		0.0	False		,,,				2504	0.001					ENST00000503124.1	1.000000	0.730000	1	8.200000e-01	0.920000	0.915333	0.920000	1.000000																										0				48						c.(1066-1068)gTg>gCg		albumin							119.0	111.0	114.0					4																	74283893		2203	4300	6503	SO:0001583	missense	213	4	121412	38				g.chr4:74283893T>C	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1067T>C	chr4.hg19:g.74283893T>C	ENSP00000421027:p.Val356Ala	0					ALB_ENST00000401494.3_Missense_Mutation_p.V391A|ALB_ENST00000509063.1_Missense_Mutation_p.V506A|ALB_ENST00000415165.2_Missense_Mutation_p.V314A|ALB_ENST00000295897.4_Missense_Mutation_p.V506A|ALB_ENST00000505649.1_3'UTR	p.V356A			0	1	1	2.035556	Q8TES7	FBF1_HUMAN	Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)	10	1274	+	Breast(15;0.00102)		B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	1	1	hg19	c.1067T>C		1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.808861	0.00606	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.94	2.26	0.28386	5.94	2.26	0.28386	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.507607	0.19058	N	0.123858	T	0.34048	0.0884	N	0.12471	0.22	0.28162	N	0.928932	B;B;B;B;B	0.23128	0.08;0.001;0.006;0.001;0.002	B;B;B;B;B	0.31495	0.131;0.034;0.069;0.017;0.034	T	0.33317	-0.9873	10	0.87932	D	0	-9.8227	7.1945	0.25845	0.0:0.3801:0.0:0.6199	.	391;314;356;506;506	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.;.;.;.;ALBU_HUMAN	A	506;314;293;356;506;391;515	ENSP00000295897:V506A;ENSP00000401820:V314A;ENSP00000421027:V356A;ENSP00000422784:V506A;ENSP00000384695:V391A	ENSP00000295897:V506A	V	+	2	0	0	ALB	74502757	74502757	0.993000	0.37304	0.762000	0.31397	0.006000	0.05464	1.347000	0.33975	0.503000	0.28060	-0.297000	0.09499	GTG	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.448	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	1	0	1	2	2	2	2	0	0	0	0	122	122	122	121	1	1.870000	-20.000000	1	0.300000	NM_000477		0	76	75	0	471	465	1		1	0		0	0	122	0	0	1.000000	9.999999e-01	0	0	0	139	0	76	471
IBSP	3381	broad.mit.edu	37	4	88727301	88727301	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:88727301G>T	ENST00000226284.5	+	5	278	c.211G>T	c.(211-213)Gga>Tga	p.G71*		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	71	Asp/Glu-rich (acidic).				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		CGAAGAAAATGGAGATGACAG	0.348																																						ENST00000226284.5	1.000000	0.720000	1	8.600000e-01	0.990000	0.952582	0.990000	1.000000																										0				21						c.(211-213)Gga>Tga		integrin-binding sialoprotein							79.0	82.0	81.0					4																	88727301		2203	4300	6503	SO:0001587	stop_gained	3381	0	0					g.chr4:88727301G>T		CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.211G>T	chr4.hg19:g.88727301G>T	ENSP00000226284:p.Gly71*	0						p.G71*	NM_004967.3	NP_004958.2	0	1	1	2.035556	P21815	SIAL_HUMAN		5	278	+		Hepatocellular(203;0.114)		Nonsense_Mutation	SNP	ENST00000226284.5	0	1	hg19	c.211G>T	CCDS3624.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.856098	0.97030	.	.	ENSG00000029559	ENST00000226284	.	.	.	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.190255	0.36932	N	0.002329	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.9553	0.86257	0.0:0.0:1.0:0.0	.	.	.	.	X	71	.	ENSP00000226284:G71X	G	+	1	0	0	IBSP	88946325	88946325	0.998000	0.40836	0.988000	0.46212	0.981000	0.71138	3.591000	0.53986	2.861000	0.98227	0.650000	0.86243	GGA	0.298948		TCGA-3A-A9I9-01A-11D-A38G-08	0.348	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.870000	-3.248383	1	0.300000			0	31	31	0	169	165	0		1	0		0	0	47	0	0	1.000000	6.867288e-02	0	0	0	3	0	31	169
FAT1	2195	broad.mit.edu	37	4	187524664	187524664	+	Silent	SNP	A	A	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr4:187524664A>G	ENST00000441802.2	-	19	11225	c.11016T>C	c.(11014-11016)ggT>ggC	p.G3672G		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3672					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCCTCCTCACACCCAGGATGT	0.502										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	ENST00000441802.2	1.000000	0.560000	9.600000e-01	6.900000e-01	0.830000	0.826438	0.830000	1.000000																										0				228						c.(11014-11016)ggT>ggC		FAT atypical cadherin 1							59.0	63.0	61.0					4																	187524664		2082	4226	6308	SO:0001819	synonymous_variant	2195	0	0					g.chr4:187524664A>G	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11016T>C	chr4.hg19:g.187524664A>G		1	HNSCC(5;0.00058)					p.G3672G	NM_005245.3	NP_005236.2	0	1	1	1.794579	Q14517	FAT1_HUMAN		19	11225	-				Silent	SNP	ENST00000441802.2	1	1	hg19	c.11016T>C	CCDS47177.1	0																																																																																								0.183673		TCGA-3A-A9I9-01A-11D-A38G-08	0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.870000	-13.651160	1	0.300000	NM_005245		0	23	23	0	128	125	1		1	1		0	0	68	0	0	1.000000	9.768967e-01	0	11	0	26	0	23	128
PCDHB2	56133	broad.mit.edu	37	5	140475321	140475321	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr5:140475321C>T	ENST00000194155.4	+	1	1095	c.947C>T	c.(946-948)aCa>aTa	p.T316I		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	316	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCATCCAGACATACACAGTA	0.423																																						ENST00000194155.4	1.000000	0.680000	1	7.800000e-01	0.900000	0.894446	0.900000	1.000000																										0				71						c.(946-948)aCa>aTa		protocadherin beta 2							94.0	96.0	95.0					5																	140475321		2203	4300	6503	SO:0001583	missense	56133	0	0					g.chr5:140475321C>T	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.947C>T	chr5.hg19:g.140475321C>T	ENSP00000194155:p.Thr316Ile	0						p.T316I	NM_018936.2	NP_061759.1	1	2	3	2.051815	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1095	+			Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	1	1	hg19	c.947C>T	CCDS4244.1	1	.	.	.	.	.	.	.	.	.	.	C	2.170	-0.390128	0.04932	.	.	ENSG00000112852	ENST00000194155	T	0.52057	0.68	5.38	0.0927	0.14474	5.38	0.0927	0.14474	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.31420	0.0796	L	0.38733	1.17	0.09310	N	1	B	0.22541	0.071	B	0.21546	0.035	T	0.22556	-1.0213	9	0.23302	T	0.38	.	4.5758	0.12232	0.3845:0.2605:0.2888:0.0662	.	316	Q9Y5E7	PCDB2_HUMAN	I	316	ENSP00000194155:T316I	ENSP00000194155:T316I	T	+	2	0	0	PCDHB2	140455505	140455505	0.000000	0.05858	0.135000	0.22099	0.049000	0.14656	-3.545000	0.00435	0.020000	0.15106	0.650000	0.86243	ACA	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.423	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	1	0	1	2	2	2	2	0	0	0	0	146	146	146	143	1	1.870000	-19.938540	1	0.300000	NM_018936		0	47	46	0	301	296	1		1	1		0	0	146	0	0	1.000000	4.063775e-01	0	5	0	5	0	47	301
PCDHGC5	56097	broad.mit.edu	37	5	140869580	140869580	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr5:140869580G>A	ENST00000252087.1	+	1	773	c.773G>A	c.(772-774)gGt>gAt	p.G258D	PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	258	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACCCATTGGTACTCTGCTG	0.517																																						ENST00000252087.1	1.000000	0.890000	1	9.800000e-01	0.990000	0.990549	0.990000	1.000000																										0				35						c.(772-774)gGt>gAt		protocadherin gamma subfamily C, 5							177.0	177.0	177.0					5																	140869580		2203	4300	6503	SO:0001583	missense	56097	0	0					g.chr5:140869580G>A	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.773G>A	chr5.hg19:g.140869580G>A	ENSP00000252087:p.Gly258Asp	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA12_ENST00000252085.3_Intron	p.G258D	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	1	2	3	2.051815	Q9Y5F6	PCDGM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	773	+			Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	1	1	hg19	c.773G>A	CCDS4263.1	1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638018	0.29157	.	.	ENSG00000240764	ENST00000252087	T	0.04454	3.62	6.08	6.08	0.98989	6.08	6.08	0.98989	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000019	T	0.13286	0.0322	M	0.66506	2.035	0.58432	D	0.999995	B;P	0.48294	0.311;0.908	B;P	0.51777	0.334;0.679	T	0.00032	-1.2273	10	0.51188	T	0.08	.	13.4893	0.61386	0.0718:0.0:0.9282:0.0	.	258;258	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	D	258	ENSP00000252087:G258D	ENSP00000252087:G258D	G	+	2	0	0	PCDHGC5	140849764	140849764	1.000000	0.71417	0.569000	0.28460	0.003000	0.03518	5.776000	0.68924	2.890000	0.99128	0.655000	0.94253	GGT	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.517	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	1	0	1	2	2	2	2	0	0	0	0	288	288	288	282	1	1.870000	-20.000000	1	0.300000	NM_018929		0	110	107	0	572	557	1		1	0		0	0	288	0	0	1.000000	2.645613e-02	0	0	0	2	0	110	572
PPARGC1B	133522	broad.mit.edu	37	5	149216585	149216585	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr5:149216585C>G	ENST00000309241.5	+	8	2599	c.2567C>G	c.(2566-2568)tCt>tGt	p.S856C	PPARGC1B_ENST00000360453.4_Missense_Mutation_p.S817C|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.S792C|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.S856C	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	856					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CGCTCAAGCTCTGGCTCTTCA	0.637																																						ENST00000309241.5	1.000000	0.670000	9.700000e-01	7.600000e-01	0.860000	0.863893	0.860000	1.000000																										0				30						c.(2566-2568)tCt>tGt		peroxisome proliferator-activated receptor gamma, coactivator 1 beta							59.0	66.0	64.0					5																	149216585		2203	4300	6503	SO:0001583	missense	133522	0	0					g.chr5:149216585C>G	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2567C>G	chr5.hg19:g.149216585C>G	ENSP00000312649:p.Ser856Cys	0					PPARGC1B_ENST00000360453.4_Missense_Mutation_p.S817C|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.S856C|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.S792C	p.S856C	NM_133263.3	NP_573570.3	1	2	3	2.051815	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)	8	2599	+			A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	1	1	hg19	c.2567C>G	CCDS4298.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013777	0.75161	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.619197	0.15973	N	0.235681	T	0.72277	0.3440	M	0.62723	1.935	0.52501	D	0.999955	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.999;0.998;0.999	T	0.71859	-0.4465	10	0.72032	D	0.01	-20.0049	18.2397	0.89963	0.0:1.0:0.0:0.0	.	835;835;817;856;856	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	C	817;856;856;792	ENSP00000353638:S817C;ENSP00000377855:S856C;ENSP00000312649:S856C;ENSP00000384403:S792C	ENSP00000312649:S856C	S	+	2	0	0	PPARGC1B	149196778	149196778	0.997000	0.39634	0.975000	0.42487	0.977000	0.68977	3.862000	0.56009	2.747000	0.94245	0.462000	0.41574	TCT	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.637	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	1	0	1	2	2	2	2	0	0	0	0	224	224	224	220	1	1.870000	-3.142713	1	0.300000	NM_133263		0	62	58	0	419	409	1		1			0	0	224	0	0	1.000000	0	0	0	0	0	0	62	419
PDE8B	8622	broad.mit.edu	37	5	76646926	76646926	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr5:76646926G>A	ENST00000264917.5	+	9	1099	c.1054G>A	c.(1054-1056)Ggg>Agg	p.G352R	PDE8B_ENST00000333194.4_Missense_Mutation_p.G352R|PDE8B_ENST00000340978.3_Missense_Mutation_p.G305R|PDE8B_ENST00000342343.4_Missense_Mutation_p.G332R|PDE8B_ENST00000346042.3_Intron	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	352					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.G352R(1)	GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	ACGGAAATCCGGGGACAGCAT	0.502																																						ENST00000264917.5	1.000000	0.430000	9.200000e-01	5.700000e-01	0.740000	0.747146	0.740000	1.000000																									GMDS/PDE8B(2)	1	Substitution - Missense(1)	p.G352R(1)	skin(1)	40						c.(1054-1056)Ggg>Agg		phosphodiesterase 8B	Caffeine(DB00201)|Ketotifen(DB00920)						122.0	113.0	116.0					5																	76646926		2203	4300	6503	SO:0001583	missense	8622	0	0					g.chr5:76646926G>A	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1054G>A	chr5.hg19:g.76646926G>A	ENSP00000264917:p.Gly352Arg	1					PDE8B_ENST00000333194.4_Missense_Mutation_p.G352R|PDE8B_ENST00000340978.3_Missense_Mutation_p.G305R|PDE8B_ENST00000346042.3_Intron|PDE8B_ENST00000342343.4_Missense_Mutation_p.G332R	p.G352R	NM_003719.3	NP_003710.1	0	1	1	1.745013	O95263	PDE8B_HUMAN		9	1099	+		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	1	1	hg19	c.1054G>A	CCDS4037.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.260123	0.95368	.	.	ENSG00000113231	ENST00000340978;ENST00000264917;ENST00000342343;ENST00000333194;ENST00000503963	D;D;D;D;T	0.87179	-2.22;-2.22;-2.22;-2.22;-0.39	5.39	5.39	0.77823	5.39	5.39	0.77823	PAS (1);PAS fold (1);	0.588962	0.18116	N	0.151194	D	0.96021	0.8704	H	0.96889	3.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.984;0.988;0.984;0.993	D	0.96973	0.9710	10	0.62326	D	0.03	.	17.9374	0.89017	0.0:0.0:1.0:0.0	.	305;352;332;352	O95263-6;O95263-3;O95263-4;O95263	.;.;.;PDE8B_HUMAN	R	305;352;332;352;114	ENSP00000345446:G305R;ENSP00000264917:G352R;ENSP00000345646:G332R;ENSP00000331336:G352R;ENSP00000422861:G114R	ENSP00000264917:G352R	G	+	1	0	0	PDE8B	76682682	76682682	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.494000	0.97962	2.528000	0.85240	0.563000	0.77884	GGG	0.185099		TCGA-3A-A9I9-01A-11D-A38G-08	0.502	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.870000	-2.802626	1	0.300000	NM_003719		0	13	13	0	83	81	1		1	0		0	0	31	0	0	0.999610	1.555184e-01	0	0	0	5	0	13	83
DRD1	1812	broad.mit.edu	37	5	174869707	174869707	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr5:174869707C>G	ENST00000393752.2	-	2	1388	c.396G>C	c.(394-396)gaG>gaC	p.E132D		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	132					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	TCATCTTTCTCTCATACCGGA	0.542																																						ENST00000393752.2	1.000000	0.810000	1	9.200000e-01	0.990000	0.974269	0.990000	1.000000																										0				23						c.(394-396)gaG>gaC		dopamine receptor D1	Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)						105.0	110.0	108.0					5																	174869707		2203	4300	6503	SO:0001583	missense	1812	0	0					g.chr5:174869707C>G	X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.396G>C	chr5.hg19:g.174869707C>G	ENSP00000377353:p.Glu132Asp	0						p.E132D	NM_000794.3	NP_000785.1	0	0	0	2.011166	P21728	DRD1_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	2	1388	-	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	B2RA44|Q4QRJ0	Missense_Mutation	SNP	ENST00000393752.2	1	1	hg19	c.396G>C	CCDS4393.1	1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172325	0.38315	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.72505	-0.66	5.55	3.77	0.43336	5.55	3.77	0.43336	GPCR, rhodopsin-like superfamily (1);	0.046619	0.85682	D	0.000000	T	0.81079	0.4748	M	0.82517	2.595	0.51233	D	0.999911	D	0.60575	0.988	P	0.61722	0.893	T	0.81150	-0.1064	10	0.62326	D	0.03	.	8.8539	0.35217	0.0:0.772:0.0:0.228	.	132	P21728	DRD1_HUMAN	D	132	ENSP00000377353:E132D	ENSP00000327652:E132D	E	-	3	2	2	DRD1	174802313	174802313	1.000000	0.71417	0.978000	0.43139	0.401000	0.30781	1.935000	0.40173	0.819000	0.34492	0.655000	0.94253	GAG	0.289340		TCGA-3A-A9I9-01A-11D-A38G-08	0.542	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252982.2	0	0	1	2	11	2	2	1	1	1	1	132	132	132	129	1	1.870000	-2.821127	1	0.300000	NM_000794		0	57	56	0	298	295	1		1			1	0	132	0	0	1.000000	0	0	0	0	0	0	57	298
RREB1	6239	broad.mit.edu	37	6	7231195	7231195	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr6:7231195G>A	ENST00000349384.6	+	10	3177	c.2863G>A	c.(2863-2865)Gaa>Aaa	p.E955K	RREB1_ENST00000379938.2_Missense_Mutation_p.E955K|RREB1_ENST00000379933.3_Missense_Mutation_p.E955K|RREB1_ENST00000334984.6_Missense_Mutation_p.E955K	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	955					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CACTCCCAGCGAAGCCAAGAA	0.617																																						ENST00000349384.6	1.000000	0.680000	1	8.700000e-01	0.990000	0.955398	0.990000	1.000000																										0				58						c.(2863-2865)Gaa>Aaa		ras responsive element binding protein 1							28.0	30.0	30.0					6																	7231195		2203	4300	6503	SO:0001583	missense	6239	2	121410	26				g.chr6:7231195G>A	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2863G>A	chr6.hg19:g.7231195G>A	ENSP00000305560:p.Glu955Lys	0					RREB1_ENST00000379938.2_Missense_Mutation_p.E955K|RREB1_ENST00000334984.6_Missense_Mutation_p.E955K|RREB1_ENST00000379933.3_Missense_Mutation_p.E955K	p.E955K	NM_001003698.3	NP_001003698.1	1	2	3	2.043999	Q92766	RREB1_HUMAN		10	3177	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	1	1	hg19	c.2863G>A	CCDS34336.1	1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404290	0.25378	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.11604	2.88;2.87;2.88;2.76	4.75	3.88	0.44766	4.75	3.88	0.44766	.	0.198485	0.34025	N	0.004340	T	0.03959	0.0111	L	0.40543	1.245	0.30128	N	0.805065	P;P;D	0.56035	0.954;0.956;0.974	B;B;P	0.47251	0.374;0.27;0.542	T	0.11792	-1.0573	10	0.07325	T	0.83	-13.4013	12.3157	0.54955	0.0:0.0:0.6923:0.3077	.	955;955;955	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	K	955	ENSP00000369265:E955K;ENSP00000369270:E955K;ENSP00000305560:E955K;ENSP00000335574:E955K	ENSP00000335574:E955K	E	+	1	0	0	RREB1	7176194	7176194	0.988000	0.35896	0.020000	0.16555	0.182000	0.23217	2.986000	0.49370	1.194000	0.43101	0.655000	0.94253	GAA	0.301048		TCGA-3A-A9I9-01A-11D-A38G-08	0.617	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	0	0	1	2	7	2	2	1	1	1	1	66	66	66	64	1	1.870000	-20.000000	1	0.300000			0	17	17	0	86	85	1		1	1		1	0	66	0	0	0.991139	4.675654e-01	0	3	0	6	0	17	86
TNFAIP3	7128	broad.mit.edu	37	6	138202266	138202266	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr6:138202266G>A	ENST00000237289.4	+	9	2249	c.2183G>A	c.(2182-2184)cGc>cAc	p.R728H		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	728	Interaction with TNIP1. {ECO:0000250}.|Required for lysosomal localization and for TRAF2 lysosomal degradation.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CTGGCCTGCCGCAGCGAGGAG	0.657			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	ENST00000237289.4	0.180000	0.030000	1.400000e-01	5.000000e-02	0.090000	0.101251	0.090000	0.090000				Rec	yes			Rec	yes		6	6q23	6q23	7128	D, N, F	"""tumor necrosis factor, alpha-induced protein 3"""				L	L			marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma		25	Whole gene deletion(25)	p.0?(25)	haematopoietic_and_lymphoid_tissue(25)	225						c.(2182-2184)cGc>cAc		tumor necrosis factor, alpha-induced protein 3							45.0	52.0	50.0					6																	138202266		2203	4300	6503	SO:0001583	missense	7128	4	121412	38				g.chr6:138202266G>A	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.2183G>A	chr6.hg19:g.138202266G>A	ENSP00000237289:p.Arg728His	1						p.R728H	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	0	1	1	1.734104	P21580	TNAP3_HUMAN		9	2249	+	Breast(32;0.135)|Colorectal(23;0.24)		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	0	1	hg19	c.2183G>A	CCDS5187.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.621768	0.96660	.	.	ENSG00000118503	ENST00000237289;ENST00000535574	T	0.46819	0.86	5.67	5.67	0.87782	5.67	5.67	0.87782	Zinc finger, A20-type (3);	0.253340	0.44902	D	0.000405	T	0.50786	0.1636	L	0.48642	1.525	0.53005	D	0.999965	D	0.58620	0.983	P	0.57283	0.817	T	0.50056	-0.8872	10	0.56958	D	0.05	-19.7323	17.9431	0.89031	0.0:0.0:1.0:0.0	.	728	P21580	TNAP3_HUMAN	H	728	ENSP00000237289:R728H	ENSP00000237289:R728H	R	+	2	0	0	TNFAIP3	138243959	138243959	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.069000	0.71209	2.673000	0.90976	0.563000	0.77884	CGC	0.176471		TCGA-3A-A9I9-01A-11D-A38G-08	0.657	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1	0	0	1	2	2	2	2	0	0	0	0	190	190	190	187	1	1.870000	-2.865474	1	0.300000			0	6	6	0	379	365	0		1	0		0	0	190	0	0	0.961064	1.553160e-01	0	0	0	38	0	6	379
EPHB4	2050	broad.mit.edu	37	7	100421350	100421350	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr7:100421350C>T	ENST00000358173.3	-	3	795	c.327G>A	c.(325-327)gaG>gaA	p.E109E	EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Silent_p.E109E|RN7SL750P_ENST00000582814.1_RNA	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	109	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CGGTGAAGGTCTCCTTGCAGG	0.667																																					GBM(200;2113 3072 25865 52728)	ENST00000358173.3	1.000000	0.690000	1	8.000000e-01	0.930000	0.915356	0.930000	1.000000																										0				47						c.(325-327)gaG>gaA		EPH receptor B4							65.0	62.0	63.0					7																	100421350		2203	4300	6503	SO:0001819	synonymous_variant	2050	0	0					g.chr7:100421350C>T	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.327G>A	chr7.hg19:g.100421350C>T		1					RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000360620.3_Silent_p.E109E|EPHB4_ENST00000477446.1_5'UTR	p.E109E	NM_004444.4	NP_004435.3	1	2	3	2.359084	P54760	EPHB4_HUMAN		3	795	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	1	1	hg19	c.327G>A	CCDS5706.1	1																																																																																								0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.667	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	1	0	1	2	2	2	2	0	0	0	0	149	149	149	147	1	1.870000	-3.318817	1	0.300000	NM_004444		0	44	42	0	317	307	1		1	1		0	0	149	0	0	1.000000	9.268978e-01	0	6	0	28	0	44	317
RELN	5649	broad.mit.edu	37	7	103234836	103234836	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr7:103234836C>T	ENST00000428762.1	-	26	3802	c.3643G>A	c.(3643-3645)Gat>Aat	p.D1215N	RELN_ENST00000424685.2_Missense_Mutation_p.D1215N|RELN_ENST00000343529.5_Missense_Mutation_p.D1215N	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1215					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATGATGTCATCGACTGCCCAC	0.517																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	1.000000	0.850000	1	9.100000e-01	0.980000	0.968529	0.980000	1.000000																										0				227						c.(3643-3645)Gat>Aat		reelin							261.0	250.0	254.0					7																	103234836		2203	4300	6503	SO:0001583	missense	5649	0	0					g.chr7:103234836C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3643G>A	chr7.hg19:g.103234836C>T	ENSP00000392423:p.Asp1215Asn	1					RELN_ENST00000343529.5_Missense_Mutation_p.D1215N|RELN_ENST00000424685.2_Missense_Mutation_p.D1215N	p.D1215N	NM_005045.3	NP_005036.2	1	2	3	2.359084	P78509	RELN_HUMAN		26	3802	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	1	1	hg19	c.3643G>A	CCDS47680.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.144229	0.94603	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.38560	1.13;1.13;1.13	5.75	5.75	0.90469	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.67951	0.2948	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.73708	0.952;0.981	T	0.70392	-0.4884	10	0.87932	D	0	.	19.9347	0.97133	0.0:1.0:0.0:0.0	.	1215;1215	P78509-2;P78509	.;RELN_HUMAN	N	1215	ENSP00000392423:D1215N;ENSP00000345694:D1215N;ENSP00000388446:D1215N	ENSP00000345694:D1215N	D	-	1	0	0	RELN	103022072	103022072	1.000000	0.71417	0.960000	0.40013	0.990000	0.78478	7.267000	0.78462	2.707000	0.92482	0.591000	0.81541	GAT	0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.517	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	1	0	1	2	2	2	2	0	0	0	0	284	284	284	280	1	1.870000	-20.000000	1	0.300000	NM_005045		0	176	173	0	1186	1165	1		1			0	0	284	0	0	1.000000	0	0	0	0	0	0	176	1186
AMPH	273	broad.mit.edu	37	7	38502605	38502605	+	Silent	SNP	G	G	A	rs372756485		TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr7:38502605G>A	ENST00000356264.2	-	10	1073	c.858C>T	c.(856-858)ccC>ccT	p.P286P	AMPH_ENST00000428293.2_Silent_p.P286P|AMPH_ENST00000325590.5_Silent_p.P286P	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	286					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GTGCTGGTGCGGGAGACGCAG	0.547																																						ENST00000356264.2	1.000000	0.770000	1	8.700000e-01	0.980000	0.950309	0.980000	1.000000																										0				62						c.(856-858)ccC>ccT		amphiphysin		G	,	0,4406		0,0,2203	162.0	152.0	155.0		858,858	-4.6	1.0	7		155	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AMPH	NM_001635.3,NM_139316.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	286/696,286/654	38502605	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	273	3	121386	40				g.chr7:38502605G>A		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.858C>T	chr7.hg19:g.38502605G>A		0					AMPH_ENST00000428293.2_Silent_p.P286P|AMPH_ENST00000325590.5_Silent_p.P286P	p.P286P	NM_001635.3	NP_001626.1	0	0	0	2.030441	P49418	AMPH_HUMAN		10	1073	-			A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Silent	SNP	ENST00000356264.2	1	1	hg19	c.858C>T	CCDS5456.1	1	.	.	.	.	.	.	.	.	.	.	G	7.801	0.713694	0.15306	0.0	1.16E-4	ENSG00000078053	ENST00000441628	.	.	.	6.17	-4.56	0.03431	6.17	-4.56	0.03431	.	.	.	.	.	T	0.36386	0.0965	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37502	-0.9703	4	.	.	.	-16.034	1.5039	0.02482	0.2196:0.2615:0.324:0.1949	.	.	.	.	C	37	.	.	R	-	1	0	0	AMPH	38469130	38469130	0.005000	0.15991	0.968000	0.41197	0.560000	0.35617	-1.526000	0.02229	-0.560000	0.06102	-1.202000	0.01658	CGC	0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.547	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	0	0	1	2	12	2	2	1	1	1	1	139	139	139	137	1	1.870000	-2.151298	0	0.300000	NM_001635		0	66	67	0	378	367	1		1	0		1	0	139	0	0	1.000000	0	0	0	0	1	0	66	378
PKD1L1	168507	broad.mit.edu	37	7	47842826	47842826	+	Silent	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr7:47842826G>T	ENST00000289672.2	-	53	7994	c.7944C>A	c.(7942-7944)ccC>ccA	p.P2648P	C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2648					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CAAAGATGCTGGGGAGTGAGT	0.463																																						ENST00000289672.2	1.000000	0.520000	8.800000e-01	6.300000e-01	0.740000	0.758838	0.740000	1.000000																									BBS9/PKD1L1(2)	0				142						c.(7942-7944)ccC>ccA		polycystic kidney disease 1 like 1							129.0	119.0	122.0					7																	47842826		2203	4300	6503	SO:0001819	synonymous_variant	168507	0	0					g.chr7:47842826G>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7944C>A	chr7.hg19:g.47842826G>T		0					C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron	p.P2648P	NM_138295.3	NP_612152.1	0	0	0	2.030441	Q8TDX9	PK1L1_HUMAN		53	7994	-			Q6UWK1	Silent	SNP	ENST00000289672.2	1	1	hg19	c.7944C>A	CCDS34633.1	0																																																																																								0.295775		TCGA-3A-A9I9-01A-11D-A38G-08	0.463	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	93	1	1.870000	-2.744790	1	0.300000	NM_138295		0	32	31	0	251	248	1		1	0		0	0	97	0	0	1.000000	0	0	0	0	1	0	32	251
ZNF746	155061	broad.mit.edu	37	7	149171720	149171720	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr7:149171720G>A	ENST00000340622.3	-	7	1970	c.1690C>T	c.(1690-1692)Cgg>Tgg	p.R564W	ZNF746_ENST00000458143.2_Missense_Mutation_p.R565W			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	564					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GTGAAGGGCCGCACGCCCGTG	0.672																																						ENST00000340622.3	1.000000	0.320000	8.600000e-01	4.600000e-01	0.640000	0.661786	0.640000	1.000000																										0				34						c.(1690-1692)Cgg>Tgg		zinc finger protein 746							51.0	38.0	42.0					7																	149171720		2202	4300	6502	SO:0001583	missense	155061	0	0					g.chr7:149171720G>A	AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.1690C>T	chr7.hg19:g.149171720G>A	ENSP00000345140:p.Arg564Trp	1					ZNF746_ENST00000458143.2_Missense_Mutation_p.R565W	p.R564W			1	2	3	2.376325	Q6NUN9	ZN746_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00358)	7	1970	-	Melanoma(164;0.165)		A8K6Z9|Q6ZRF9	Missense_Mutation	SNP	ENST00000340622.3	1	1	hg19	c.1690C>T	CCDS5897.1	0	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654521	0.67472	.	.	ENSG00000181220	ENST00000340622;ENST00000458143	T;T	0.15139	2.45;2.45	5.58	4.67	0.58626	5.58	4.67	0.58626	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000277	T	0.43010	0.1228	M	0.84082	2.675	0.36220	D	0.851953	D;D	0.89917	1.0;1.0	D;D	0.78314	0.917;0.991	T	0.55891	-0.8069	10	0.87932	D	0	-24.6663	11.729	0.51726	0.0:0.0:0.6974:0.3026	.	565;564	Q6NUN9-2;Q6NUN9	.;ZN746_HUMAN	W	564;565	ENSP00000345140:R564W;ENSP00000395007:R565W	ENSP00000345140:R564W	R	-	1	2	2	ZNF746	148802653	148802653	0.497000	0.26067	1.000000	0.80357	0.991000	0.79684	0.576000	0.23744	2.630000	0.89119	0.462000	0.41574	CGG	0.391304		TCGA-3A-A9I9-01A-11D-A38G-08	0.672	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.870000	-13.836400	1	0.300000	NM_152557		0	9	9	0	102	98	0		1	1		0	0	46	0	0	0.993899	7.360498e-01	0	5	0	26	0	9	102
NCOA2	10499	broad.mit.edu	37	8	71082538	71082538	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr8:71082538A>G	ENST00000452400.2	-	6	621	c.440T>C	c.(439-441)cTa>cCa	p.L147P		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	147	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GTTATACCTTAGATACTGTGT	0.418			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	ENST00000452400.2	1.000000	0.500000	1	6.700000e-01	0.890000	0.856378	0.890000	1.000000				Dom	yes			Dom	yes		8	8q13.1	8q13.1	10499	T	nuclear receptor coactivator 2 (TIF2)				L	L	RUNXBP2, HEY1		AML, Chondrosarcoma	PAX3/NCOA2(4)|HEY1/NCOA2(10)	0				60						c.(439-441)cTa>cCa		nuclear receptor coactivator 2							113.0	100.0	104.0					8																	71082538		1893	4116	6009	SO:0001583	missense	10499	0	0					g.chr8:71082538A>G	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.440T>C	chr8.hg19:g.71082538A>G	ENSP00000399968:p.Leu147Pro	0						p.L147P	NM_006540.2	NP_006531.1	0	1	1	2.033253	Q15596	NCOA2_HUMAN	Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)	6	621	-	Breast(64;0.201)		Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	0	1	hg19	c.440T>C	CCDS47872.1	1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567322	0.86439	.	.	ENSG00000140396	ENST00000452400	T	0.24908	1.83	5.49	5.49	0.81192	5.49	5.49	0.81192	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80125	-0.1513	10	0.87932	D	0	.	15.5729	0.76354	1.0:0.0:0.0:0.0	.	147	Q15596	NCOA2_HUMAN	P	147	ENSP00000399968:L147P	ENSP00000399968:L147P	L	-	2	0	0	NCOA2	71245092	71245092	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.335000	0.96500	2.074000	0.62210	0.528000	0.53228	CTA	0.297894		TCGA-3A-A9I9-01A-11D-A38G-08	0.418	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.870000	-8.687685	1	0.300000			0	12	11	0	78	78	1		1	1		0	0	15	0	0	0.999292	2.066883e-01	0	2	0	4	0	12	78
MATN2	4147	broad.mit.edu	37	8	99019798	99019798	+	Silent	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr8:99019798C>T	ENST00000520016.1	+	9	1666	c.1542C>T	c.(1540-1542)caC>caT	p.H514H	MATN2_ENST00000521689.1_Silent_p.H514H|MATN2_ENST00000522025.2_Silent_p.H230H|MATN2_ENST00000524308.1_Silent_p.H473H|MATN2_ENST00000254898.5_Silent_p.H514H			O00339	MATN2_HUMAN	matrilin 2	514	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CTGAGGGACACGTGCTCCGCA	0.567																																						ENST00000520016.1	1.000000	0.930000	1	9.900000e-01	0.990000	0.996225	0.990000	1.000000																										0				31						c.(1540-1542)caC>caT		matrilin 2							145.0	142.0	143.0					8																	99019798		2140	4250	6390	SO:0001819	synonymous_variant	4147	0	0					g.chr8:99019798C>T	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1542C>T	chr8.hg19:g.99019798C>T		0					MATN2_ENST00000522025.2_Silent_p.H230H|MATN2_ENST00000521689.1_Silent_p.H514H|MATN2_ENST00000524308.1_Silent_p.H473H|MATN2_ENST00000254898.5_Silent_p.H514H	p.H514H			1	2	3	2.042262	O00339	MATN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.244)	9	1666	+	Breast(36;1.43e-06)		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	1	1	hg19	c.1542C>T	CCDS55264.1	1	.	.	.	.	.	.	.	.	.	.	C	0.079	-1.186741	0.01620	.	.	ENSG00000132561	ENST00000518154	.	.	.	5.65	-7.32	0.01436	5.65	-7.32	0.01436	.	.	.	.	.	T	0.41073	0.1143	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	T	0.41270	-0.9518	4	.	.	.	-16.2738	16.4012	0.83641	0.0:0.2847:0.0:0.7153	.	.	.	.	C	297	.	.	R	+	1	0	0	MATN2	99088974	99088974	0.000000	0.05858	0.037000	0.18230	0.086000	0.17979	-1.867000	0.01646	-1.505000	0.01807	-1.553000	0.00894	CGT	0.301048		TCGA-3A-A9I9-01A-11D-A38G-08	0.567	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1	1	0	1	2	2	2	2	0	0	0	0	137	137	137	135	1	1.870000	-20.000000	1	0.300000			0	64	62	0	296	283	0		1	1		0	0	137	0	0	1.000000	9.996553e-01	0	12	0	45	0	64	296
ATAD2	29028	broad.mit.edu	37	8	124348628	124348628	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr8:124348628C>G	ENST00000287394.5	-	22	3303	c.3196G>C	c.(3196-3198)Gat>Cat	p.D1066H	ATAD2_ENST00000521903.1_Missense_Mutation_p.D384H	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1066	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.D1066Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GGATCTCTATCTGGATTGTAT	0.373																																						ENST00000287394.5	1.000000	0.740000	1	8.400000e-01	0.960000	0.937391	0.960000	1.000000																										1	Substitution - Missense(1)	p.D1066Y(1)	breast(1)	48						c.(3196-3198)Gat>Cat		ATPase family, AAA domain containing 2							73.0	71.0	72.0					8																	124348628		2203	4299	6502	SO:0001583	missense	29028	0	0					g.chr8:124348628C>G	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3196G>C	chr8.hg19:g.124348628C>G	ENSP00000287394:p.Asp1066His	0					ATAD2_ENST00000521903.1_Missense_Mutation_p.D384H	p.D1066H	NM_014109.3	NP_054828.2	1	2	3	2.042262	Q6PL18	ATAD2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)	22	3303	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	1	1	hg19	c.3196G>C	CCDS6343.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066390	0.76187	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	T;T	0.29917	1.55;1.55	5.89	5.89	0.94794	5.89	5.89	0.94794	Bromodomain (5);	0.507344	0.17654	U	0.166599	T	0.55641	0.1933	M	0.78223	2.4	0.58432	D	0.999999	D	0.55385	0.971	P	0.56398	0.797	T	0.56992	-0.7887	10	0.72032	D	0.01	-27.5249	20.2576	0.98430	0.0:1.0:0.0:0.0	.	1066	Q6PL18	ATAD2_HUMAN	H	1066;384	ENSP00000287394:D1066H;ENSP00000429213:D384H	ENSP00000287394:D1066H	D	-	1	0	0	ATAD2	124417809	124417809	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	7.541000	0.82084	2.783000	0.95769	0.655000	0.94253	GAT	0.301048		TCGA-3A-A9I9-01A-11D-A38G-08	0.373	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	1	0	1	2	2	2	2	0	0	0	0	103	103	103	101	1	1.870000	-3.319915	1	0.300000	NM_014109		0	57	56	0	337	327	1		1	1		0	0	103	0	0	1.000000	4.919688e-01	0	5	0	6	0	57	337
TLN1	7094	broad.mit.edu	37	9	35700280	35700280	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr9:35700280C>T	ENST00000314888.9	-	49	6921	c.6568G>A	c.(6568-6570)Gtt>Att	p.V2190I	TLN1_ENST00000540444.1_Missense_Mutation_p.V2078I	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2190					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCAGCAGCAACGGCCTTGGCG	0.547																																						ENST00000314888.9	0.440000	0.160000	3.700000e-01	2.200000e-01	0.280000	0.299417	0.280000	0.280000																										0				85						c.(6568-6570)Gtt>Att		talin 1							71.0	70.0	70.0					9																	35700280		2203	4300	6503	SO:0001583	missense	7094	4	121412	36				g.chr9:35700280C>T	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6568G>A	chr9.hg19:g.35700280C>T	ENSP00000316029:p.Val2190Ile	0					TLN1_ENST00000540444.1_Missense_Mutation_p.V2078I	p.V2190I	NM_006289.3	NP_006280.3	0	1	1	2.032459	Q9Y490	TLN1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)	49	6921	-	all_epithelial(49;0.167)		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	1	1	hg19	c.6568G>A	CCDS35009.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.358745	0.95854	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.74421	-0.84;-0.83	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.85859	2.78	0.80722	D	1	D	0.54207	0.965	B	0.39771	0.309	D	0.84352	0.0533	10	0.87932	D	0	-20.4308	18.3575	0.90362	0.0:1.0:0.0:0.0	.	2190	Q9Y490	TLN1_HUMAN	I	2190;2078	ENSP00000316029:V2190I;ENSP00000442981:V2078I	ENSP00000316029:V2190I	V	-	1	0	0	TLN1	35690280	35690280	1.000000	0.71417	0.788000	0.31933	0.938000	0.57974	7.747000	0.85070	2.436000	0.82500	0.655000	0.94253	GTT	0.297894		TCGA-3A-A9I9-01A-11D-A38G-08	0.547	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	0	0	1	2	2	2	2	0	0	0	0	132	132	132	132	1	1.870000	-4.433175	1	0.300000	NM_006289		0	16	16	0	357	350	0		1	0		0	0	132	0	0	0.999927	9.916581e-01	0	1	0	175	0	16	357
FAM189A2	9413	broad.mit.edu	37	9	71951186	71951186	+	Splice_Site	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr9:71951186G>T	ENST00000257515.8	+	2	432		c.e2+1		FAM189A2_ENST00000455972.1_Splice_Site	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2							integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						GATACTCCTGGTATGTACTGA	0.333																																						ENST00000257515.8	1.000000	0.700000	9.600000e-01	7.800000e-01	0.860000	0.872168	0.860000	1.000000																										0				12						c.e2+1		family with sequence similarity 189, member A2							163.0	164.0	164.0					9																	71951186		2203	4299	6502	SO:0001630	splice_region_variant	9413	0	0					g.chr9:71951186G>T	L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.12+1G>T	chr9.hg19:g.71951186G>T		0					FAM189A2_ENST00000455972.1_Splice_Site		NM_004816.3	NP_004807.3	1	2	3	2.051050	Q15884	F1892_HUMAN		2	432	+			Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Splice_Site	SNP	ENST00000257515.8	1	1	hg19		CCDS6629.1	1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323082	0.60634	.	.	ENSG00000135063	ENST00000455972;ENST00000257515	.	.	.	5.04	5.04	0.67666	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2361	0.65927	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	FAM189A2	71141006	71141006	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.913000	0.63341	2.526000	0.85167	0.655000	0.94253	.	0.302094		TCGA-3A-A9I9-01A-11D-A38G-08	0.333	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052576.2	1	0	1	2	2	2	2	0	0	0	0	158	158	158	156	1	1.870000	-20.000000	1	0.300000	NM_004816	Intron	0	86	85	0	575	563	1		1			0	0	158	0	0	1.000000	0	0	0	0	0	0	86	575
ENTPD8	377841	broad.mit.edu	37	9	140330612	140330612	+	Silent	SNP	G	G	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chr9:140330612G>T	ENST00000472938.1	-	6	919	c.903C>A	c.(901-903)ctC>ctA	p.L301L	ENTPD8_ENST00000344119.2_Silent_p.L301L|ENTPD8_ENST00000371506.2_Silent_p.L301L			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	301					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		GGTTCTGGGGGAGGCTCAGCG	0.642																																						ENST00000472938.1	1.000000	0.690000	1	8.100000e-01	0.940000	0.919208	0.940000	1.000000																										0				7						c.(901-903)ctC>ctA		ectonucleoside triphosphate diphosphohydrolase 8							51.0	50.0	50.0					9																	140330612		2202	4300	6502	SO:0001819	synonymous_variant	377841	0	0					g.chr9:140330612G>T	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.903C>A	chr9.hg19:g.140330612G>T		0					ENTPD8_ENST00000371506.2_Silent_p.L301L|ENTPD8_ENST00000344119.2_Silent_p.L301L	p.L301L			0	0	0	2.015732	Q5MY95	ENTP8_HUMAN		6	919	-	all_cancers(76;0.0926)		A2BG17|Q6UVZ0	Silent	SNP	ENST00000472938.1	1	1	hg19	c.903C>A	CCDS43913.1	1																																																																																								0.289340		TCGA-3A-A9I9-01A-11D-A38G-08	0.642	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355991.1	1	0	1	2	2	2	2	0	0	0	0	118	118	118	117	1	1.870000	-18.638740	1	0.300000	NM_198585		0	38	38	0	225	219	1		1	1		0	0	118	0	0	1.000000	5.409179e-01	0	5	0	7	0	38	225
ZNF157	7712	broad.mit.edu	37	X	47272834	47272834	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chrX:47272834A>T	ENST00000377073.3	+	4	1448	c.1362A>T	c.(1360-1362)aaA>aaT	p.K454N		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	454					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						TCTATGTGAAAGTACGCCTCA	0.438																																						ENST00000377073.3	0.980000	0.560000	9.100000e-01	6.700000e-01	0.790000	0.793811	0.790000	0.800000																										0				11						c.(1360-1362)aaA>aaT		zinc finger protein 157							81.0	70.0	73.0					X																	47272834		2203	4300	6503	SO:0001583	missense	7712	0	0					g.chrX:47272834A>T	U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.1362A>T	chrX.hg19:g.47272834A>T	ENSP00000366273:p.Lys454Asn							p.K454N	NM_003446.3	NP_003437.2	0	1	1		P51786	ZN157_HUMAN		4	1448	+			Q96LE9	Missense_Mutation	SNP	ENST00000377073.3	1	1	hg19	c.1362A>T	CCDS14278.1	0	.	.	.	.	.	.	.	.	.	.	A	7.389	0.630476	0.14322	.	.	ENSG00000147117	ENST00000377073	T	0.13778	2.56	3.37	2.2	0.27929	3.37	2.2	0.27929	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07818	0.0196	L	0.28054	0.825	0.09310	N	1	B	0.30482	0.281	B	0.24848	0.056	T	0.35895	-0.9770	9	0.26408	T	0.33	.	4.5131	0.11921	0.7149:0.0:0.2851:0.0	.	454	P51786	ZN157_HUMAN	N	454	ENSP00000366273:K454N	ENSP00000366273:K454N	K	+	3	2	2	ZNF157	47157778	47157778	0.000000	0.05858	0.678000	0.29963	0.998000	0.95712	-0.418000	0.07080	0.514000	0.28300	0.486000	0.48141	AAA	0.300000		TCGA-3A-A9I9-01A-11D-A38G-08	0.438	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056415.1	1	0	0	2	2	2	2	0	0	0	0	41	41	41	41	1	1.870000	-20.000000	1	0.300000	NM_003446		0	28	27	0	86	84	1		1	0		0	0	41	0	0	1.000000	0	0	0	0	1	0	28	86
ELK1	2002	broad.mit.edu	37	X	47498346	47498346	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chrX:47498346G>A	ENST00000247161.3	-	3	701	c.602C>T	c.(601-603)cCa>cTa	p.P201L	ELK1_ENST00000592066.1_Missense_Mutation_p.P147L|ELK1_ENST00000376983.3_Missense_Mutation_p.P201L|ELK1_ENST00000343894.4_Intron	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	201					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						CAAGGGGCTTGGACTGGTGCT	0.632																																						ENST00000247161.3	1.000000	0.620000	9.800000e-01	7.700000e-01	0.900000	0.881637	0.900000	0.990000																										0				10						c.(601-603)cCa>cTa		ELK1, member of ETS oncogene family							10.0	9.0	9.0					X																	47498346		2197	4263	6460	SO:0001583	missense	2002	0	0					g.chrX:47498346G>A	M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.602C>T	chrX.hg19:g.47498346G>A	ENSP00000247161:p.Pro201Leu						ELK1_ENST00000376983.3_Missense_Mutation_p.P201L|ELK1_ENST00000592066.1_Missense_Mutation_p.P147L|ELK1_ENST00000343894.4_Intron	p.P201L	NM_005229.4	NP_005220.2	0	1	1		P19419	ELK1_HUMAN		3	701	-			B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Missense_Mutation	SNP	ENST00000247161.3	0	1	hg19	c.602C>T	CCDS14283.1	1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734656	0.69189	.	.	ENSG00000126767	ENST00000247161;ENST00000376983	T;T	0.44482	0.92;0.92	3.73	3.73	0.42828	3.73	3.73	0.42828	.	0.322177	0.29355	N	0.012395	T	0.47395	0.1443	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.44651	-0.9314	10	0.52906	T	0.07	.	10.0463	0.42188	0.0:0.0:1.0:0.0	.	201	P19419	ELK1_HUMAN	L	201	ENSP00000247161:P201L;ENSP00000366182:P201L	ENSP00000247161:P201L	P	-	2	0	0	ELK1	47383290	47383290	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.925000	0.56484	2.122000	0.65172	0.529000	0.55759	CCA	0.300000		TCGA-3A-A9I9-01A-11D-A38G-08	0.632	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056436.1	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.870000	-20.000000	1	0.300000	NM_005229		0	11	11	0	14	12	1		1	1		0	0	9	0	0	0.999115	9.994712e-01	0	9	0	16	0	11	14
SHROOM4	57477	broad.mit.edu	37	X	50350791	50350791	+	Silent	SNP	T	T	C			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chrX:50350791T>C	ENST00000289292.7	-	6	3634	c.3351A>G	c.(3349-3351)gcA>gcG	p.A1117A	SHROOM4_ENST00000376020.2_Silent_p.A1117A|SHROOM4_ENST00000460112.3_Silent_p.A1001A			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1117					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					gctgctgGGCTGCACGAAAGA	0.577																																						ENST00000289292.7	0.640000	0.230000	5.300000e-01	3.100000e-01	0.410000	0.430462	0.410000	0.410000																										0				52						c.(3349-3351)gcA>gcG		shroom family member 4							26.0	24.0	25.0					X																	50350791		2202	4299	6501	SO:0001819	synonymous_variant	57477	0	0					g.chrX:50350791T>C	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3351A>G	chrX.hg19:g.50350791T>C							SHROOM4_ENST00000460112.3_Silent_p.A1001A|SHROOM4_ENST00000376020.2_Silent_p.A1117A	p.A1117A			0	1	1		Q9ULL8	SHRM4_HUMAN		6	3634	-	Ovarian(276;0.236)		A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	1	1	hg19	c.3351A>G	CCDS35277.1	0																																																																																								0.300000		TCGA-3A-A9I9-01A-11D-A38G-08	0.577	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.870000	-20.000000	1	0.300000	NM_020717		0	13	13	0	91	90	1		1			0	0	34	0	0	0.999628	0	0	0	0	0	0	13	91
MAGED2	10916	broad.mit.edu	37	X	54841940	54841940	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chrX:54841940C>A	ENST00000375068.1	+	12	1879	c.1646C>A	c.(1645-1647)aCt>aAt	p.T549N	SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000375058.1_Missense_Mutation_p.T549N|MAGED2_ENST00000347546.4_Missense_Mutation_p.T531N|MAGED2_ENST00000396224.1_Missense_Mutation_p.T549N|MAGED2_ENST00000375062.4_Missense_Mutation_p.T464N|MAGED2_ENST00000375060.1_Missense_Mutation_p.T464N|MAGED2_ENST00000218439.4_Missense_Mutation_p.T549N|MAGED2_ENST00000375053.2_Missense_Mutation_p.T549N			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	549						membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						agtgccagcactggtgccagt	0.597																																						ENST00000375068.1	0.990000	0.460000	9.400000e-01	6.300000e-01	0.800000	0.789105	0.800000	0.910000																										0				26						c.(1645-1647)aCt>aAt		melanoma antigen family D, 2							33.0	27.0	29.0					X																	54841940		2197	4293	6490	SO:0001583	missense	10916	0	0					g.chrX:54841940C>A	AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1646C>A	chrX.hg19:g.54841940C>A	ENSP00000364209:p.Thr549Asn						MAGED2_ENST00000375060.1_Missense_Mutation_p.T464N|MAGED2_ENST00000396224.1_Missense_Mutation_p.T549N|MAGED2_ENST00000375062.4_Missense_Mutation_p.T464N|MAGED2_ENST00000375058.1_Missense_Mutation_p.T549N|SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000218439.4_Missense_Mutation_p.T549N|MAGED2_ENST00000347546.4_Missense_Mutation_p.T531N|MAGED2_ENST00000375053.2_Missense_Mutation_p.T549N	p.T549N			0	1	1		Q9UNF1	MAGD2_HUMAN		12	1879	+			A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Missense_Mutation	SNP	ENST00000375068.1	1	1	hg19	c.1646C>A	CCDS14362.1	0	.	.	.	.	.	.	.	.	.	.	C	3.309	-0.141160	0.06669	.	.	ENSG00000102316	ENST00000375068;ENST00000375053;ENST00000347546;ENST00000343474;ENST00000375062;ENST00000218439;ENST00000375058;ENST00000375060;ENST00000396224	T;T;T;T;T;T;T;T;T	0.42513	4.04;4.04;4.1;4.01;0.97;4.04;4.04;0.97;4.04	4.21	2.36	0.29203	4.21	2.36	0.29203	.	0.474225	0.17920	N	0.157539	T	0.27629	0.0679	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20472	-1.0274	10	0.59425	D	0.04	.	8.9422	0.35736	0.4:0.6:0.0:0.0	.	464;549	Q5H907;Q9UNF1	.;MAGD2_HUMAN	N	549;549;493;531;464;549;549;464;549	ENSP00000364209:T549N;ENSP00000364193:T549N;ENSP00000336962:T493N;ENSP00000340290:T531N;ENSP00000364202:T464N;ENSP00000218439:T549N;ENSP00000364198:T549N;ENSP00000364200:T464N;ENSP00000379526:T549N	ENSP00000218439:T549N	T	+	2	0	0	MAGED2	54858665	54858665	0.007000	0.16637	0.001000	0.08648	0.045000	0.14185	0.681000	0.25320	0.314000	0.23086	0.513000	0.50165	ACT	0.300000		TCGA-3A-A9I9-01A-11D-A38G-08	0.597	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	1	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	1.870000	-19.885600	1	0.300000	NM_014599		0	9	9	0	22	21	1		1	1		0	0	13	0	0	0.995938	1	0	96	0	400	0	9	22
GPR50	9248	broad.mit.edu	37	X	150345311	150345311	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9I9-01A-11D-A38G-08	TCGA-3A-A9I9-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a00e940f-6021-454d-be90-a2fdebd8751d	6bf66319-97e4-4169-887d-b861913257f1	g.chrX:150345311G>A	ENST00000218316.3	+	1	187	c.118G>A	c.(118-120)Gtt>Att	p.V40I	GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	40					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TATCACCATCGTTGTAGACCT	0.512																																						ENST00000218316.3	0.850000	0.600000	7.900000e-01	6.600000e-01	0.720000	0.731677	0.720000	0.730000																										0				38						c.(118-120)Gtt>Att		G protein-coupled receptor 50							146.0	141.0	142.0					X																	150345311		1909	4106	6015	SO:0001583	missense	9248	0	0					g.chrX:150345311G>A	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.118G>A	chrX.hg19:g.150345311G>A	ENSP00000218316:p.Val40Ile						GPR50-AS1_ENST00000454196.1_RNA	p.V40I	NM_004224.3	NP_004215.2	0	1	1		Q13585	MTR1L_HUMAN		1	187	+	Acute lymphoblastic leukemia(192;6.56e-05)		Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	1	1	hg19	c.118G>A	CCDS44012.1	0	.	.	.	.	.	.	.	.	.	.	G	6.356	0.433766	0.12045	.	.	ENSG00000102195	ENST00000218316	T	0.37411	1.2	4.2	3.34	0.38264	4.2	3.34	0.38264	.	0.154979	0.42821	N	0.000654	T	0.16257	0.0391	N	0.08118	0	0.30817	N	0.738223	B	0.24092	0.097	B	0.15870	0.014	T	0.09840	-1.0656	10	0.31617	T	0.26	-12.3268	7.0452	0.25042	0.1279:0.0:0.8721:0.0	.	40	Q13585	MTR1L_HUMAN	I	40	ENSP00000218316:V40I	ENSP00000218316:V40I	V	+	1	0	0	GPR50	150095969	150095969	0.914000	0.31030	0.782000	0.31804	0.022000	0.10575	1.373000	0.34272	0.789000	0.33779	0.292000	0.19580	GTT	0.300000		TCGA-3A-A9I9-01A-11D-A38G-08	0.512	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	1	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	1.870000	-20.000000	1	0.300000	NM_004224		0	104	102	0	370	361	1		1			0	0	135	0	0	1.000000	0	0	0	0	0	0	104	370
