#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
C18orf8	29919	broad.mit.edu	37	18	21098885	21098887	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			CAT	-	CAT	CAT		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr18:21098885_21098887delCAT	ENST00000269221.3	+	8	795_797	c.685_687delCAT	c.(685-687)catdel	p.H230del	C18orf8_ENST00000590868.1_In_Frame_Del_p.H182del	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	230						lysosomal membrane (GO:0005765)				endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTTCTTGAGGCATCATTCTCGGA	0.424																																						ENST00000269221.3	1.000000	7.800000e-01	1.000000	0.880000	0.990000	0.956841	0.990000	1.000000																										0				21						c.(685-687)catdel		chromosome 18 open reading frame 8																																				SO:0001651	inframe_deletion	29919	0	0					g.chr18:21098885_21098887delCAT	AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.685_687delCAT	chr18.hg19:g.21098888_21098890delCAT	ENSP00000269221:p.His230del	1					C18orf8_ENST00000590868.1_In_Frame_Del_p.H182del	p.H230del	NM_013326.3	NP_037458.3	0	2	2	1.872751	Q96DM3	MIC1_HUMAN		8	795_797	+	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)		Q9BU17|Q9Y5M0	In_Frame_Del	DEL	ENST00000269221.3	1	1	hg19	c.685_687delCAT	CCDS32803.1	1																																																																																								0.380000		TCGA-3A-A9IB-01A-21D-A397-08	0.424	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445386.1	1	0	0		2	2		0	0	0	0	57	0	57	56	1	1.970000	-20.000000	1	0.380000	NM_013326		0	70	84	0	306	314	0	0	1	1	0	0	0	57	0	0	1.000000	9.998735e-01	0	16	0	44	0	70	306
TNFRSF10A	8797	broad.mit.edu	37	8	23054679	23054701	+	Frame_Shift_Del	DEL	CAGCCTCCTCCTCTGAGACCCTT	CAGCCTCCTCCTCTGAGACCCTT	-	rs372908951		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr8:23054679_23054701delCAGCCTCCTCCTCTGAGACCCTT	ENST00000221132.3	-	9	1095_1117	c.1031_1053delAAGGGTCTCAGAGGAGGAGGCTG	c.(1030-1053)gaagggtctcagaggaggaggctgfs	p.EGSQRRRL344fs		NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	344					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)			NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		CTGGAACCAGCAGCCTCCTCCTCTGAGACCCTTCAGCTTCTGC	0.556																																						ENST00000221132.3	0.290000	1.100000e-01	0.240000	0.140000	0.180000	0.196979	0.180000	0.190000																										0				16						c.(1030-1053)gaagggtctcagaggaggaggctgfs		tumor necrosis factor receptor superfamily, member 10a																																				SO:0001589	frameshift_variant	8797	0	0					g.chr8:23054679_23054701delCAGCCTCCTCCTCTGAGACCCTT	U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.1031_1053delAAGGGTCTCAGAGGAGGAGGCTG	chr8.hg19:g.23054679_23054701delCAGCCTCCTCCTCTGAGACCCTT	ENSP00000221132:p.Glu344fs	1						p.EGSQRRRL344fs	NM_003844.3	NP_003835.3	0	1	1	1.694817	O00220	TR10A_HUMAN		9	1095_1117	-		Prostate(55;0.0421)|Breast(100;0.14)	A8K5I4|Q53Y72|Q96E62	Frame_Shift_Del	DEL	ENST00000221132.3	1	1	hg19	c.1031_1053delAAGGGTCTCAGAGGAGGAGGCTG	CCDS6039.1	0																																																																																								0.243441		TCGA-3A-A9IB-01A-21D-A397-08	0.556	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215133.2	0	0	1		16	2		0	0	0	1	102	0	102	103	1	1.970000	-4.112441	1	0.380000	NM_003844		0	17	47	0	372	400	0	0	1	0	0	0	0	102	0	0	0.775461	6.688081e-01	0	0	0	51	0	17	372
SEC31B	25956	broad.mit.edu	37	10	102267770	102267770	+	Silent	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr10:102267770C>T	ENST00000370345.3	-	6	631	c.534G>A	c.(532-534)cgG>cgA	p.R178R	SEC31B_ENST00000535773.1_Silent_p.R21R|SEC31B_ENST00000451524.1_Silent_p.R178R|SEC31B_ENST00000370329.5_Silent_p.R181R|NDUFB8_ENST00000557395.1_3'UTR|NDUFB8_ENST00000531258.1_3'UTR	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	178					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GTTGGGCTTGCCGGTTCCAAG	0.517																																						ENST00000370345.3	1.000000	2.000000e-02	0.110000	0.040000	0.060000	0.139997	0.060000	0.060000																										0				36						c.(532-534)cgG>cgA		SEC31 homolog B (S. cerevisiae)							191.0	164.0	173.0					10																	102267770		2203	4300	6503	SO:0001819	synonymous_variant	25956	0	0					g.chr10:102267770C>T	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.534G>A	chr10.hg19:g.102267770C>T		0					SEC31B_ENST00000535773.1_Silent_p.R21R|NDUFB8_ENST00000531258.1_3'UTR|SEC31B_ENST00000451524.1_Silent_p.R178R|NDUFB8_ENST00000557395.1_3'UTR|SEC31B_ENST00000370329.5_Silent_p.R181R	p.R178R	NM_015490.3	NP_056305.1	1	2	3	2.071752	Q9NQW1	SC31B_HUMAN		6	631	-		Colorectal(252;0.117)	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	ENST00000370345.3	0	1	hg19	c.534G>A	CCDS7495.1	0																																																																																								0.390424		TCGA-3A-A9IB-01A-21D-A397-08	0.517	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	0	0	1	2	2	2	2	0	0	0	0	50	0	50	50	1	1.970000	-1.972706	0	0.380000	NM_015490		0	6	6	0	507	502	0		1	0		0	0	50	0	0	0.964087	3.017397e-03	0	0	0	6	0	6	507
CHST15	51363	broad.mit.edu	37	10	125805512	125805512	+	Missense_Mutation	SNP	G	G	A	rs145631200		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr10:125805512G>A	ENST00000346248.5	-	2	859	c.217C>T	c.(217-219)Cgc>Tgc	p.R73C	CHST15_ENST00000462406.1_5'Flank|CHST15_ENST00000435907.1_Missense_Mutation_p.R73C|CHST15_ENST00000421115.1_Missense_Mutation_p.R73C	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	73					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						TTTTTGAAGCGCAAAAACCCA	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20352	0.0		0.0	False		,,,				2504	0.0					ENST00000346248.5	1.000000	2.000000e-02	0.140000	0.050000	0.080000	0.154757	0.080000	0.080000																										0				26						c.(217-219)Cgc>Tgc		carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15		G	CYS/ARG,CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	85.0	75.0	79.0		217,217	4.8	1.0	10	dbSNP_134	79	0,8600		0,0,4300	yes	missense,missense	CHST15	NM_014863.2,NM_015892.3	180,180	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign,benign	73/507,73/562	125805512	3,13003	2203	4300	6503	SO:0001583	missense	51363	10	121412	43				g.chr10:125805512G>A	AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.217C>T	chr10.hg19:g.125805512G>A	ENSP00000333947:p.Arg73Cys	0					CHST15_ENST00000421115.1_Missense_Mutation_p.R73C|CHST15_ENST00000435907.1_Missense_Mutation_p.R73C|CHST15_ENST00000462406.1_5'Flank	p.R73C	NM_015892.4	NP_056976.2	1	2	3	2.071752	Q7LFX5	CHSTF_HUMAN		2	859	-			O60338|O60474|Q86VM4	Missense_Mutation	SNP	ENST00000346248.5	0	1	hg19	c.217C>T	CCDS7638.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	7.620	0.676663	0.14841	6.81E-4	0.0	ENSG00000182022	ENST00000346248;ENST00000435907;ENST00000434607;ENST00000546346;ENST00000421115	.	.	.	5.67	4.77	0.60923	5.67	4.77	0.60923	.	0.253960	0.41294	N	0.000904	T	0.20740	0.0499	N	0.04508	-0.205	0.31534	N	0.660833	B;B	0.25007	0.116;0.071	B;B	0.19391	0.025;0.011	T	0.13469	-1.0508	9	0.44086	T	0.13	-28.6264	9.5674	0.39407	0.1996:0.0:0.8004:0.0	.	73;73	Q7LFX5-2;Q7LFX5	.;CHSTF_HUMAN	C	73	.	ENSP00000333947:R73C	R	-	1	0	0	CHST15	125795502	125795502	0.905000	0.30787	0.951000	0.38953	0.262000	0.26303	1.908000	0.39907	1.415000	0.47037	-0.219000	0.12488	CGC	0.390424		TCGA-3A-A9IB-01A-21D-A397-08	0.453	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	0	0	1	2	2	2	2	0	0	0	0	87	0	87	86	1	1.970000	-2.478128	0	0.380000	NM_015892		0	6	6	0	414	409	0		1	0		0	0	87	0	0	0.964184	3.192314e-01	0	0	0	70	0	6	414
MMP13	4322	broad.mit.edu	37	11	102822878	102822878	+	Missense_Mutation	SNP	G	G	A	rs147544761	byFrequency	TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr11:102822878G>A	ENST00000260302.3	-	5	690	c.662C>T	c.(661-663)gCg>gTg	p.A221V	MMP13_ENST00000340273.4_Missense_Mutation_p.A221V	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	221	Interaction with TIMP2.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GAACTCATGCGCAGCAACAAG	0.423													G|||	6	0.00119808	0.0045	0.0	5008	,	,		17489	0.0		0.0	False		,,,				2504	0.0					ENST00000260302.3	1.000000	2.000000e-02	0.110000	0.040000	0.070000	0.114902	0.070000	0.070000																										0				27						c.(661-663)gCg>gTg		matrix metallopeptidase 13 (collagenase 3)	Marimastat(DB00786)	G	VAL/ALA	3,4401	8.1+/-20.4	0,3,2199	140.0	135.0	137.0		662	5.8	1.0	11	dbSNP_134	137	0,8598		0,0,4299	yes	missense	MMP13	NM_002427.3	64	0,3,6498	AA,AG,GG		0.0,0.0681,0.0231	probably-damaging	221/472	102822878	3,12999	2202	4299	6501	SO:0001583	missense	4322	17	121412	46				g.chr11:102822878G>A	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.662C>T	chr11.hg19:g.102822878G>A	ENSP00000260302:p.Ala221Val	0					MMP13_ENST00000340273.4_Missense_Mutation_p.A221V	p.A221V	NM_002427.3	NP_002418.1	1	2	3	2.044609	P45452	MMP13_HUMAN		5	690	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	0	1	hg19	c.662C>T	CCDS8324.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	36	5.655859	0.96724	6.81E-4	0.0	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.21543	2.0;2.0	5.75	5.75	0.90469	5.75	5.75	0.90469	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.093477	0.64402	D	0.000001	T	0.48277	0.1491	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.32955	-0.9887	10	0.59425	D	0.04	.	20.312	0.98644	0.0:0.0:1.0:0.0	.	221	P45452	MMP13_HUMAN	V	221	ENSP00000260302:A221V;ENSP00000339672:A221V	ENSP00000260302:A221V	A	-	2	0	0	MMP13	102328088	102328088	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.946000	0.87746	2.866000	0.98385	0.650000	0.86243	GCG	0.385835		TCGA-3A-A9IB-01A-21D-A397-08	0.423	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	0	0	1	2	2	2	2	0	0	0	0	63	0	63	63	1	1.970000	-2.447729	0	0.380000	NM_002427		0	7	7	0	521	517	0		1	0		0	0	63	0	0	0.980200	0	0	0	0	1	0	7	521
SLC5A12	159963	broad.mit.edu	37	11	26743035	26743035	+	Missense_Mutation	SNP	C	C	T	rs142065702		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr11:26743035C>T	ENST00000396005.3	-	1	536	c.227G>A	c.(226-228)cGc>cAc	p.R76H	SLC5A12_ENST00000280467.6_Missense_Mutation_p.R76H	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	76					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.R76L(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						TGCCCCAAAGCGGTAGACTTC	0.512																																						ENST00000396005.3	1.000000	7.500000e-01	1.000000	0.860000	0.980000	0.945417	0.980000	1.000000																										2	Substitution - Missense(2)	p.R76L(2)	lung(2)	35						c.(226-228)cGc>cAc		solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12		C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	91.0	92.0	92.0		227	5.6	1.0	11	dbSNP_134	92	0,8598		0,0,4299	no	missense	SLC5A12	NM_178498.3	29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	76/619	26743035	1,13003	2203	4299	6502	SO:0001583	missense	159963	4	121412	39				g.chr11:26743035C>T	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.227G>A	chr11.hg19:g.26743035C>T	ENSP00000379326:p.Arg76His	0					SLC5A12_ENST00000280467.6_Missense_Mutation_p.R76H	p.R76H	NM_178498.3	NP_848593.2	1	2	3	2.044609	Q1EHB4	SC5AC_HUMAN		1	536	-			Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	1	1	hg19	c.227G>A	CCDS7860.2	1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467643	0.63625	2.27E-4	0.0	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.87966	-2.32;-2.32	5.59	5.59	0.84812	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.89567	0.6752	M	0.73962	2.25	0.53688	D	0.99997	B;P	0.50617	0.227;0.937	B;P	0.47015	0.082;0.534	D	0.88612	0.3157	10	0.35671	T	0.21	.	19.5898	0.95506	0.0:1.0:0.0:0.0	.	76;76	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	H	76	ENSP00000379326:R76H;ENSP00000280467:R76H	ENSP00000280467:R76H	R	-	2	0	0	SLC5A12	26699611	26699611	0.985000	0.35326	1.000000	0.80357	0.898000	0.52572	2.683000	0.46943	2.643000	0.89663	0.585000	0.79938	CGC	0.385835		TCGA-3A-A9IB-01A-21D-A397-08	0.512	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	1	0	1	2	2	2	2	0	0	0	0	48	0	48	46	1	1.970000	-20.000000	1	0.380000	NM_178498		0	50	50	0	221	220	1		1			0	0	48	0	0	1.000000	0	0	0	0	0	0	50	221
RTN3	10313	broad.mit.edu	37	11	63449189	63449189	+	Silent	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr11:63449189C>T	ENST00000377819.5	+	1	235	c.81C>T	c.(79-81)ggC>ggT	p.G27G	RTN3_ENST00000538995.1_3'UTR|RTN3_ENST00000356000.3_Silent_p.G27G|RTN3_ENST00000341307.2_Silent_p.G27G|RTN3_ENST00000537981.1_Silent_p.G27G|RTN3_ENST00000540798.1_Silent_p.G27G|RTN3_ENST00000339997.4_Silent_p.G27G|RTN3_ENST00000354497.4_Silent_p.G27G	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	27					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						CGCCCGGCGGCGGCGGGAGCC	0.746																																						ENST00000377819.5	1.000000	7.500000e-01	1.000000	0.890000	0.990000	0.963169	0.990000	1.000000																										0				20						c.(79-81)ggC>ggT		reticulon 3							10.0	14.0	13.0					11																	63449189		2093	4136	6229	SO:0001819	synonymous_variant	10313	0	0					g.chr11:63449189C>T	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.81C>T	chr11.hg19:g.63449189C>T		0					RTN3_ENST00000354497.4_Silent_p.G27G|RTN3_ENST00000538995.1_3'UTR|RTN3_ENST00000540798.1_Silent_p.G27G|RTN3_ENST00000537981.1_Silent_p.G27G|RTN3_ENST00000356000.3_Silent_p.G27G|RTN3_ENST00000339997.4_Silent_p.G27G|RTN3_ENST00000341307.2_Silent_p.G27G	p.G27G	NM_001265589.1	NP_001252518.1	1	2	3	2.044609	O95197	RTN3_HUMAN		1	235	+			B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Silent	SNP	ENST00000377819.5	1	1	hg19	c.81C>T	CCDS58141.1	1																																																																																								0.385835		TCGA-3A-A9IB-01A-21D-A397-08	0.746	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1	1	0	1	2	2	2	2	0	0	0	0	50	0	50	48	1	1.970000	-20.000000	1	0.380000	NM_006054		0	31	30	0	125	123	0		1	1		0	0	50	0	0	1.000000	1	0	73	0	134	0	31	125
MMP13	4322	broad.mit.edu	37	11	102826101	102826101	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr11:102826101C>T	ENST00000260302.3	-	2	270	c.242G>A	c.(241-243)gGc>gAc	p.G81D	MMP13_ENST00000340273.4_Missense_Mutation_p.G81D	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	81					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GTCAAGTTTGCCAGTCACCTC	0.473																																						ENST00000260302.3	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.096228	0.050000	0.060000																										0				27						c.(241-243)gGc>gAc		matrix metallopeptidase 13 (collagenase 3)	Marimastat(DB00786)						155.0	150.0	152.0					11																	102826101		2202	4299	6501	SO:0001583	missense	4322	0	0					g.chr11:102826101C>T	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.242G>A	chr11.hg19:g.102826101C>T	ENSP00000260302:p.Gly81Asp	0					MMP13_ENST00000340273.4_Missense_Mutation_p.G81D	p.G81D	NM_002427.3	NP_002418.1	1	2	3	2.044609	P45452	MMP13_HUMAN		2	270	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	0	1	hg19	c.242G>A	CCDS8324.1	0	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846161	0.91277	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	D;D	0.90197	-2.63;-2.63	5.77	5.77	0.91146	5.77	5.77	0.91146	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97111	0.9056	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97478	1.0045	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	81	P45452	MMP13_HUMAN	D	81	ENSP00000260302:G81D;ENSP00000339672:G81D	ENSP00000260302:G81D	G	-	2	0	0	MMP13	102331311	102331311	1.000000	0.71417	0.995000	0.50966	0.870000	0.49936	7.776000	0.85560	2.885000	0.99019	0.655000	0.94253	GGC	0.385835		TCGA-3A-A9IB-01A-21D-A397-08	0.473	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	0	0	1	2	2	2	2	0	0	0	0	75	0	75	74	1	1.970000	-1.929216	0	0.380000	NM_002427		0	7	7	0	692	691	0		1	0		0	0	75	0	0	0.980570	0	0	0	0	1	0	7	692
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.400000e-01	1.000000	0.990000	0.990000	0.996734	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.053135	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.408115		TCGA-3A-A9IB-01A-21D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	31	2	2	2	0	19	0	0	65	7994	65	64	1	1.970000	-20.000000	1	0.380000	NM_033360		2089	66	66	5927	244	243	1	1	1	1	1	0	0	65	223	1	1.000000	9.876195e-01	1	13	75	15	311	66	244
KRT85	3891	broad.mit.edu	37	12	52760836	52760836	+	Silent	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr12:52760836G>A	ENST00000257901.3	-	1	429	c.354C>T	c.(352-354)tgC>tgT	p.C118C	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	118	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTGCTTCACGCACTGTGCGT	0.632																																						ENST00000257901.3	1.000000	8.200000e-01	1.000000	0.890000	0.980000	0.960504	0.980000	1.000000																										0				36						c.(352-354)tgC>tgT		keratin 85							164.0	153.0	157.0					12																	52760836		2203	4296	6499	SO:0001819	synonymous_variant	3891	0	0					g.chr12:52760836G>A	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.354C>T	chr12.hg19:g.52760836G>A		0					KRT85_ENST00000544265.1_5'Flank	p.C118C	NM_002283.3	NP_002274.1	1	2	3	2.053135	P78386	KRT85_HUMAN		1	429	-	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)		Q9NSB1	Silent	SNP	ENST00000257901.3	1	1	hg19	c.354C>T	CCDS8824.1	1																																																																																								0.408115		TCGA-3A-A9IB-01A-21D-A397-08	0.632	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	1	0	1	2	2	2	2	0	0	0	0	182	0	182	205	1	1.970000	-20.000000	1	0.380000	NM_002283		0	129	123	0	606	584	1		1			0	0	182	0	0	1.000000	0	0	0	0	0	0	129	606
ERBB3	2065	broad.mit.edu	37	12	56495712	56495712	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr12:56495712A>G	ENST00000267101.3	+	28	4342	c.3902A>G	c.(3901-3903)cAg>cGg	p.Q1301R	ERBB3_ENST00000415288.2_Missense_Mutation_p.Q1242R|ERBB3_ENST00000549832.1_Missense_Mutation_p.Q421R|ERBB3_ENST00000450146.2_Missense_Mutation_p.Q658R|RP11-603J24.17_ENST00000548595.1_RNA|PA2G4_ENST00000303305.6_5'Flank|PA2G4_ENST00000552766.1_5'Flank|RP11-603J24.9_ENST00000548861.1_Intron|ERBB3_ENST00000553131.1_Missense_Mutation_p.Q542R	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1301					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CCTGGACATCAGGCCCCCCAT	0.537																																						ENST00000267101.3	1.000000	0	1.000000	0.020000	0.050000	0.222902	0.050000	0.050000																										0				8						c.(3901-3903)cAg>cGg		v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3							107.0	117.0	113.0					12																	56495712		2203	4300	6503	SO:0001583	missense	2065	0	0					g.chr12:56495712A>G	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3902A>G	chr12.hg19:g.56495712A>G	ENSP00000267101:p.Gln1301Arg	0					PA2G4_ENST00000552766.1_5'Flank|ERBB3_ENST00000450146.2_Missense_Mutation_p.Q658R|RP11-603J24.17_ENST00000548595.1_RNA|ERBB3_ENST00000549832.1_Missense_Mutation_p.Q421R|PA2G4_ENST00000303305.6_5'Flank|RP11-603J24.9_ENST00000548861.1_Intron|ERBB3_ENST00000553131.1_Missense_Mutation_p.Q542R|ERBB3_ENST00000415288.2_Missense_Mutation_p.Q1242R	p.Q1301R	NM_001982.3	NP_001973.2	1	2	3	2.053135	P21860	ERBB3_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.112)	28	4342	+			A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	0	1	hg19	c.3902A>G	CCDS31833.1	0	.	.	.	.	.	.	.	.	.	.	A	7.897	0.733645	0.15574	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.78003	-1.0;-0.92;-0.99;-1.14;-0.88	5.39	4.26	0.50523	5.39	4.26	0.50523	.	0.563354	0.17890	N	0.158548	T	0.56093	0.1962	N	0.14661	0.345	0.23855	N	0.996651	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37454	-0.9705	10	0.07482	T	0.82	.	8.109	0.30903	0.8379:0.0:0.1621:0.0	.	1242;421;1301	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	R	1301;658;1242;424;542;421	ENSP00000267101:Q1301R;ENSP00000399178:Q658R;ENSP00000408340:Q1242R;ENSP00000449129:Q542R;ENSP00000448729:Q421R	ENSP00000267101:Q1301R	Q	+	2	0	0	ERBB3	54781979	54781979	0.059000	0.20769	0.807000	0.32361	0.337000	0.28794	0.589000	0.23939	1.069000	0.40788	0.533000	0.62120	CAG	0.408115		TCGA-3A-A9IB-01A-21D-A397-08	0.537	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3	0	0	1	2	2	2	2	0	0	0	0	140	0	140	139	1	1.970000	-2.336163	0	0.380000			0	6	6	0	717	712	0		1	0		0	0	140	0	0	0.964309	5.702678e-01	0	1	0	210	0	6	717
B4GALNT3	283358	broad.mit.edu	37	12	662878	662878	+	Missense_Mutation	SNP	G	G	A	rs202219145		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr12:662878G>A	ENST00000266383.5	+	14	1802	c.1789G>A	c.(1789-1791)Gca>Aca	p.A597T		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	597					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GGTGGCGGCCGCAGGCCAGGA	0.617																																						ENST00000266383.5	1.000000	3.000000e-02	1.000000	0.060000	0.110000	0.274625	0.110000	0.090000																										0				26						c.(1789-1791)Gca>Aca		beta-1,4-N-acetyl-galactosaminyl transferase 3							35.0	34.0	35.0					12																	662878		2203	4300	6503	SO:0001583	missense	283358	8	121392	41				g.chr12:662878G>A	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.1789G>A	chr12.hg19:g.662878G>A	ENSP00000266383:p.Ala597Thr	0						p.A597T	NM_173593.3	NP_775864.3	1	2	3	2.053135	Q6L9W6	B4GN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)	14	1802	+	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	0	1	hg19	c.1789G>A	CCDS8504.1	0	.	.	.	.	.	.	.	.	.	.	G	7.395	0.631635	0.14322	.	.	ENSG00000139044	ENST00000266383;ENST00000322843	T;T	0.32515	3.46;1.45	5.63	2.78	0.32641	5.63	2.78	0.32641	.	0.762765	0.12432	N	0.469495	T	0.23886	0.0578	L	0.47716	1.5	0.09310	N	1	B;B	0.14438	0.01;0.002	B;B	0.08055	0.003;0.001	T	0.30357	-0.9981	10	0.18276	T	0.48	-0.4872	7.5465	0.27770	0.0673:0.2194:0.601:0.1124	.	500;597	E9PHD9;Q6L9W6	.;B4GN3_HUMAN	T	597;500	ENSP00000266383:A597T;ENSP00000322953:A500T	ENSP00000266383:A597T	A	+	1	0	0	B4GALNT3	533139	533139	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.620000	0.24403	0.309000	0.22966	-1.332000	0.01269	GCA	0.408115		TCGA-3A-A9IB-01A-21D-A397-08	0.617	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	0	0	1	2	2	2	2	0	0	0	0	41	0	41	40	1	1.970000	-5.106352	1	0.380000	NM_173593		0	4	4	0	230	224	0		1	0		0	0	41	0	0	0.884931	1.752873e-01	0	0	0	35	0	4	230
LRP1	4035	broad.mit.edu	37	12	57594247	57594247	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr12:57594247G>A	ENST00000243077.3	+	63	10503	c.10037G>A	c.(10036-10038)tGc>tAc	p.C3346Y		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3346	LDL-receptor class A 21. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AACGACAAGTGCATCCCCTTC	0.617																																						ENST00000243077.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999948	0.990000	1.000000																										0				184						c.(10036-10038)tGc>tAc		low density lipoprotein receptor-related protein 1	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						46.0	44.0	45.0					12																	57594247		2203	4299	6502	SO:0001583	missense	4035	0	0					g.chr12:57594247G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.10037G>A	chr12.hg19:g.57594247G>A	ENSP00000243077:p.Cys3346Tyr	0						p.C3346Y	NM_002332.2	NP_002323.2	1	2	3	2.053135	Q07954	LRP1_HUMAN		63	10503	+			Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	1	1	hg19	c.10037G>A	CCDS8932.1	1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652311	0.67472	.	.	ENSG00000123384	ENST00000243077	D	0.99919	-8.0	4.56	4.56	0.56223	4.56	4.56	0.56223	Low-density lipoprotein (LDL) receptor class A, conserved site (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.99943	0.9975	H	0.97491	4.015	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.96047	0.9028	10	0.59425	D	0.04	.	16.3322	0.83039	0.0:0.0:1.0:0.0	.	3346	Q07954	LRP1_HUMAN	Y	3346	ENSP00000243077:C3346Y	ENSP00000243077:C3346Y	C	+	2	0	0	LRP1	55880514	55880514	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.765000	0.85310	2.386000	0.81285	0.555000	0.69702	TGC	0.408115		TCGA-3A-A9IB-01A-21D-A397-08	0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	1	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	1.970000	-20.000000	1	0.380000	NM_002332		0	72	71	0	216	213	0		1	1		0	0	51	0	0	1.000000	1	0	64	0	203	0	72	216
MYO16	23026	broad.mit.edu	37	13	109779895	109779895	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr13:109779895G>A	ENST00000357550.2	+	30	4023	c.3982G>A	c.(3982-3984)Gaa>Aaa	p.E1328K	MYO16_ENST00000356711.2_Missense_Mutation_p.E1328K|MYO16_ENST00000457511.2_Missense_Mutation_p.E840K	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AGCGGCCAACGAAGGTCAGCC	0.662																																						ENST00000357550.2	1.000000	5.200000e-01	1.000000	0.670000	0.870000	0.848516	0.870000	1.000000																										0				121						c.(3982-3984)Gaa>Aaa		myosin XVI							16.0	19.0	18.0					13																	109779895		2198	4295	6493	SO:0001583	missense	23026	0	0					g.chr13:109779895G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3982G>A	chr13.hg19:g.109779895G>A	ENSP00000350160:p.Glu1328Lys	1					MYO16_ENST00000356711.2_Missense_Mutation_p.E1328K|MYO16_ENST00000457511.2_Missense_Mutation_p.E840K	p.E1328K	NM_001198950.1	NP_001185879.1	2	2	4	2.246067			BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)	30	4023	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)			Missense_Mutation	SNP	ENST00000357550.2	1	1	hg19	c.3982G>A	CCDS32008.1	1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151349	0.57151	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	T;T;T	0.42900	0.96;0.96;0.96	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.38605	U	0.001637	T	0.50394	0.1613	M	0.67953	2.075	0.48571	D	0.999678	D;D	0.59767	0.986;0.985	P;B	0.47705	0.555;0.41	T	0.53330	-0.8454	9	.	.	.	.	17.5095	0.87756	0.0:0.0:1.0:0.0	.	840;1328	F8W883;Q9Y6X6	.;MYO16_HUMAN	K	1328;1328;840	ENSP00000349145:E1328K;ENSP00000350160:E1328K;ENSP00000401633:E840K	.	E	+	1	0	0	MYO16	108577896	108577896	1.000000	0.71417	0.922000	0.36590	0.090000	0.18270	5.411000	0.66386	2.367000	0.80283	0.563000	0.77884	GAA	0.445339		TCGA-3A-A9IB-01A-21D-A397-08	0.662	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	1	0	1	2	2	2	2	0	0	0	0	28	0	28	26	1	1.970000	-20.000000	1	0.380000	NM_015011		0	18	16	0	114	114	1		1	0		0	0	28	0	0	0.999987	0	0	0	0	1	0	18	114
FBN1	2200	broad.mit.edu	37	15	48707785	48707785	+	Missense_Mutation	SNP	C	C	T	rs149062442		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr15:48707785C>T	ENST00000316623.5	-	64	8454	c.7999G>A	c.(7999-8001)Gag>Aag	p.E2667K	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2667	EGF-like 47; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TAACCGCCCTCGGTATTGGAA	0.542																																						ENST00000316623.5	1.000000	9.800000e-01	1.000000	0.990000	0.990000	0.998822	0.990000	1.000000																										0				139						c.(7999-8001)Gag>Aag		fibrillin 1		C	LYS/GLU	1,4395	2.1+/-5.4	0,1,2197	85.0	75.0	79.0		7999	5.8	1.0	15	dbSNP_134	79	1,8591	1.2+/-3.3	0,1,4295	no	missense	FBN1	NM_000138.4	56	0,2,6492	TT,TC,CC		0.0116,0.0227,0.0154	benign	2667/2872	48707785	2,12986	2198	4296	6494	SO:0001583	missense	2200	4	121412	37				g.chr15:48707785C>T	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7999G>A	chr15.hg19:g.48707785C>T	ENSP00000325527:p.Glu2667Lys	1					FBN1_ENST00000561429.1_5'UTR	p.E2667K	NM_000138.4	NP_000129	0	1	1	1.871649	P35555	FBN1_HUMAN		64	8454	-		all_lung(180;0.00279)	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	1	1	hg19	c.7999G>A	CCDS32232.1	1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651521	0.47362	2.27E-4	1.16E-4	ENSG00000166147	ENST00000316623	D	0.87412	-2.25	5.81	5.81	0.92471	5.81	5.81	0.92471	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.155020	0.64402	D	0.000019	T	0.74329	0.3702	N	0.16266	0.395	0.80722	D	1	P	0.44090	0.826	B	0.34452	0.183	T	0.76063	-0.3096	10	0.06099	T	0.92	.	18.8343	0.92155	0.0:1.0:0.0:0.0	.	2667	P35555	FBN1_HUMAN	K	2667	ENSP00000325527:E2667K	ENSP00000325527:E2667K	E	-	1	0	0	FBN1	46495077	46495077	1.000000	0.71417	0.988000	0.46212	0.657000	0.38888	4.893000	0.63199	2.745000	0.94114	0.655000	0.94253	GAG	0.317782		TCGA-3A-A9IB-01A-21D-A397-08	0.542	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1	1	0	1	2	2	2	2	0	0	0	0	53	0	53	52	1	1.970000	-5.014298	1	0.380000			0	82	81	0	242	242	1		1	1		0	0	53	0	0	1.000000	1	0	14	0	376	0	82	242
NKD1	85407	broad.mit.edu	37	16	50664178	50664178	+	Missense_Mutation	SNP	C	C	T	rs377648064		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr16:50664178C>T	ENST00000268459.3	+	7	768	c.544C>T	c.(544-546)Cgg>Tgg	p.R182W		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	182	Interaction with DVL1, DVL2 and DVL3. {ECO:0000250}.				eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CAAGATGCTGCGGGTAAAGCT	0.592																																						ENST00000268459.3	1.000000	3.200000e-01	1.000000	0.400000	0.500000	0.601661	0.500000	0.470000																										0				23						c.(544-546)Cgg>Tgg		naked cuticle homolog 1 (Drosophila)		C	TRP/ARG	0,4396		0,0,2198	80.0	70.0	74.0		544	3.9	1.0	16		74	1,8599	1.2+/-3.3	0,1,4299	no	missense	NKD1	NM_033119.4	101	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	182/471	50664178	1,12995	2198	4300	6498	SO:0001583	missense	85407	2	121412	35				g.chr16:50664178C>T	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.544C>T	chr16.hg19:g.50664178C>T	ENSP00000268459:p.Arg182Trp	1						p.R182W	NM_033119.4	NP_149110.1	1	2	3	2.248531	Q969G9	NKD1_HUMAN		7	768	+		all_cancers(37;0.229)	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	0	1	hg19	c.544C>T	CCDS10743.1	0	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707405	0.48412	0.0	1.16E-4	ENSG00000140807	ENST00000268459	T	0.72505	-0.66	4.88	3.91	0.45181	4.88	3.91	0.45181	.	0.000000	0.85682	D	0.000000	D	0.84306	0.5443	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86778	0.1977	10	0.87932	D	0	-22.9129	14.0418	0.64681	0.2725:0.7275:0.0:0.0	.	182	Q969G9	NKD1_HUMAN	W	182	ENSP00000268459:R182W	ENSP00000268459:R182W	R	+	1	2	2	NKD1	49221679	49221679	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	3.134000	0.50538	1.151000	0.42436	0.655000	0.94253	CGG	0.441542		TCGA-3A-A9IB-01A-21D-A397-08	0.592	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1	1	0	1	2	19	3	2	1	0	1	1	63	0	63	63	1	1.970000	-3.142702	1	0.380000			0	29	28	0	334	333	0		1	0		1	0	63	0	0	0.947125	1.429727e-01	0	0	0	16	0	29	334
RHOT2	89941	broad.mit.edu	37	16	721954	721954	+	Missense_Mutation	SNP	G	G	A	rs543941700		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr16:721954G>A	ENST00000315082.4	+	13	1163	c.1049G>A	c.(1048-1050)cGc>cAc	p.R350H		NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2	350					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				CGCACAGTCCGCACAGAGGCC	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		10655	0.0		0.0	False		,,,				2504	0.001					ENST00000315082.4	1.000000	2.000000e-02	1.000000	0.050000	0.080000	0.285007	0.080000	0.080000																										0				13						c.(1048-1050)cGc>cAc		ras homolog family member T2							48.0	60.0	56.0					16																	721954		2201	4297	6498	SO:0001583	missense	89941	11	120846	41				g.chr16:721954G>A	BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.1049G>A	chr16.hg19:g.721954G>A	ENSP00000321971:p.Arg350His	1						p.R350H	NM_138769.2	NP_620124.1	1	2	3	2.254564	Q8IXI1	MIRO2_HUMAN		13	1163	+		Hepatocellular(780;0.0218)	A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	Missense_Mutation	SNP	ENST00000315082.4	0	1	hg19	c.1049G>A	CCDS10417.1	0	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319598	0.41096	.	.	ENSG00000140983	ENST00000315082	T	0.10099	2.91	5.31	2.09	0.27110	5.31	2.09	0.27110	EF hand associated, type-1 (1);	0.488085	0.25897	N	0.027587	T	0.10380	0.0254	N	0.22421	0.69	0.20403	N	0.999906	P	0.44006	0.824	P	0.44477	0.451	T	0.10497	-1.0627	10	0.44086	T	0.13	-4.7154	15.1832	0.72975	0.0:0.4165:0.5835:0.0	.	350	Q8IXI1	MIRO2_HUMAN	H	350	ENSP00000321971:R350H	ENSP00000321971:R350H	R	+	2	0	0	RHOT2	661955	661955	0.971000	0.33674	0.002000	0.10522	0.006000	0.05464	1.740000	0.38228	0.186000	0.20125	0.456000	0.33151	CGC	0.448153		TCGA-3A-A9IB-01A-21D-A397-08	0.692	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241617.1	0	0	1	2	2	2	2	0	0	0	0	151	0	151	148	1	1.970000	-2.445671	0	0.380000	NM_138769		0	6	6	0	486	480	0		1	0		0	0	151	0	0	0.963824	5.650552e-01	0	0	0	141	0	6	486
PMFBP1	83449	broad.mit.edu	37	16	72163043	72163043	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr16:72163043C>G	ENST00000237353.10	-	13	2133	c.1872G>C	c.(1870-1872)aaG>aaC	p.K624N	PMFBP1_ENST00000355636.6_Missense_Mutation_p.K479N|PMFBP1_ENST00000537465.1_Missense_Mutation_p.K629N	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	629						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				CTTTGCTCTTCTTCAACTGCT	0.468																																						ENST00000237353.10	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				45						c.(1870-1872)aaG>aaC		polyamine modulated factor 1 binding protein 1							287.0	291.0	290.0					16																	72163043		2198	4300	6498	SO:0001583	missense	83449	0	0					g.chr16:72163043C>G	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1872G>C	chr16.hg19:g.72163043C>G	ENSP00000237353:p.Lys624Asn	1					PMFBP1_ENST00000537465.1_Missense_Mutation_p.K629N|PMFBP1_ENST00000355636.6_Missense_Mutation_p.K479N	p.K624N	NM_031293.2	NP_112583.2	1	2	3	2.232757	Q8TBY8	PMFBP_HUMAN		13	2133	-		Ovarian(137;0.179)	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	1	1	hg19	c.1872G>C	CCDS32483.1	1	.	.	.	.	.	.	.	.	.	.	C	5.334	0.246930	0.10130	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.13538	2.58;2.59;2.58	4.31	2.09	0.27110	4.31	2.09	0.27110	.	0.129090	0.35646	N	0.003070	T	0.09291	0.0229	L	0.29908	0.895	0.23449	N	0.997656	B;P;B	0.39250	0.447;0.665;0.447	B;B;B	0.41088	0.147;0.347;0.147	T	0.19844	-1.0293	10	0.26408	T	0.33	-18.0873	5.1417	0.14963	0.0:0.2541:0.0:0.7459	.	629;624;629	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	N	629;624;479	ENSP00000443817:K629N;ENSP00000237353:K624N;ENSP00000347854:K479N	ENSP00000237353:K624N	K	-	3	2	2	PMFBP1	70720544	70720544	0.996000	0.38824	0.994000	0.49952	0.049000	0.14656	0.330000	0.19715	0.458000	0.26988	-0.302000	0.09304	AAG	0.432806		TCGA-3A-A9IB-01A-21D-A397-08	0.468	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	1	0	1	2	2	2	2	0	0	0	0	179	0	179	174	1	1.970000	-20.000000	1	0.380000	NM_031293		0	321	314	0	953	946	1		1			0	0	179	0	0	1.000000	0	0	0	0	0	0	321	953
FANCA	2175	broad.mit.edu	37	16	89842201	89842201	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr16:89842201G>C	ENST00000389301.3	-	21	1879	c.1849C>G	c.(1849-1851)Ctg>Gtg	p.L617V	FANCA_ENST00000567284.2_5'UTR|FANCA_ENST00000568369.1_Missense_Mutation_p.L617V	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	617					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GTGGAGTACAGAGATGGGGGG	0.443			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													ENST00000389301.3	1.000000	3.700000e-01	1.000000	0.500000	0.690000	0.727917	0.690000	0.610000			yes	Rec		Fanconi anaemia A	yes	Rec		Fanconi anaemia A	16	16q24.3	16q24.3	2175	D, Mis, N, F, S	"""Fanconi anemia, complementation group A"""				L	L		AML, leukemia			0				47						c.(1849-1851)Ctg>Gtg	Involved in tolerance or repair of DNA crosslinks	Fanconi anemia, complementation group A							52.0	46.0	48.0					16																	89842201		2198	4300	6498	SO:0001583	missense	2175	0	0		Fanconi Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	g.chr16:89842201G>C	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1849C>G	chr16.hg19:g.89842201G>C	ENSP00000373952:p.Leu617Val	1					FANCA_ENST00000568369.1_Missense_Mutation_p.L617V|FANCA_ENST00000567284.2_5'UTR	p.L617V	NM_000135.2	NP_000126.2	1	2	3	2.232757	O15360	FANCA_HUMAN		21	1879	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	1	1	hg19	c.1849C>G	CCDS32515.1	0	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255899	0.22965	.	.	ENSG00000187741	ENST00000389301	D	0.85411	-1.98	5.03	-0.755	0.11061	5.03	-0.755	0.11061	.	0.494987	0.16475	N	0.212816	T	0.77246	0.4102	M	0.71581	2.175	0.09310	N	1	B;B	0.29909	0.261;0.261	B;B	0.20184	0.028;0.016	T	0.67898	-0.5551	10	0.66056	D	0.02	-1.1651	1.6061	0.02684	0.3053:0.1378:0.4164:0.1405	.	617;617	B4DRI7;O15360	.;FANCA_HUMAN	V	617	ENSP00000373952:L617V	ENSP00000373952:L617V	L	-	1	2	2	FANCA	88369702	88369702	0.000000	0.05858	0.008000	0.14137	0.759000	0.43091	-0.464000	0.06688	-0.023000	0.13963	0.650000	0.86243	CTG	0.432806		TCGA-3A-A9IB-01A-21D-A397-08	0.443	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1	1	0	1	2	2	2	2	0	0	0	0	25	0	25	25	1	1.970000	-3.320514	1	0.380000			0	13	13	0	109	109	0		1	0		0	0	25	0	0	0.999633	2.712908e-01	0	1	0	8	0	13	109
TAOK1	57551	broad.mit.edu	37	17	27869675	27869675	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr17:27869675G>C	ENST00000261716.3	+	20	3160	c.2641G>C	c.(2641-2643)Gaa>Caa	p.E881Q	TAOK1_ENST00000536202.1_Missense_Mutation_p.E733Q	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	881					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			TTTTGACTCTGAAAGCATGAG	0.473																																						ENST00000261716.3	1.000000	6.800000e-01	0.940000	0.750000	0.830000	0.848375	0.830000	0.830000																										0				28						c.(2641-2643)Gaa>Caa		TAO kinase 1							158.0	154.0	156.0					17																	27869675		2203	4300	6503	SO:0001583	missense	57551	0	0					g.chr17:27869675G>C	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.2641G>C	chr17.hg19:g.27869675G>C	ENSP00000261716:p.Glu881Gln	0					TAOK1_ENST00000536202.1_Missense_Mutation_p.E733Q	p.E881Q	NM_020791.2	NP_065842.1	1	2	3	2.071362	Q7L7X3	TAOK1_HUMAN	Colorectal(6;0.198)	20	3160	+			A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	1	1	hg19	c.2641G>C	CCDS32601.1	0	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650537	0.87958	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.57752	0.38;0.38	5.57	5.57	0.84162	5.57	5.57	0.84162	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77226	0.4099	M	0.86178	2.8	0.27873	N	0.939969	D;D	0.89917	0.981;1.0	D;D	0.85130	0.932;0.997	T	0.73304	-0.4025	10	0.72032	D	0.01	.	19.5531	0.95330	0.0:0.0:1.0:0.0	.	733;881	B7ZLV6;Q7L7X3	.;TAOK1_HUMAN	Q	881;733	ENSP00000261716:E881Q;ENSP00000438819:E733Q	ENSP00000261716:E881Q	E	+	1	0	0	TAOK1	24893801	24893801	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.809000	0.99208	2.623000	0.88846	0.561000	0.74099	GAA	0.390424		TCGA-3A-A9IB-01A-21D-A397-08	0.473	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	0	0	0	2	2	2	2	0	0	0	0	129	0	129	129	1	1.970000	-20.000000	1	0.380000	NM_020791		0	92	92	0	499	493	1		1	1		0	0	129	0	0	1.000000	5.317937e-01	0	5	0	6	0	92	499
TMEM132E	124842	broad.mit.edu	37	17	32953589	32953589	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr17:32953589C>T	ENST00000321639.5	+	2	839	c.511C>T	c.(511-513)Cgg>Tgg	p.R171W		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	171						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCATGCCTTCCGGGATGCCCG	0.711																																						ENST00000321639.5	1.000000	6.200000e-01	1.000000	0.800000	0.990000	0.925301	0.990000	1.000000																										0				57						c.(511-513)Cgg>Tgg		transmembrane protein 132E							11.0	13.0	13.0					17																	32953589		2171	4243	6414	SO:0001583	missense	124842	0	0					g.chr17:32953589C>T	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.511C>T	chr17.hg19:g.32953589C>T	ENSP00000316532:p.Arg171Trp	0						p.R171W	NM_207313.1	NP_997196.1	1	2	3	2.071362	Q6IEE7	T132E_HUMAN		2	839	+			Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	1	1	hg19	c.511C>T	CCDS11283.1	1	.	.	.	.	.	.	.	.	.	.	c	18.86	3.713777	0.68730	.	.	ENSG00000181291	ENST00000321639	T	0.13420	2.59	5.17	1.84	0.25277	5.17	1.84	0.25277	.	0.120858	0.56097	D	0.000034	T	0.24812	0.0602	L	0.48877	1.53	0.31168	N	0.703569	D	0.89917	1.0	D	0.67548	0.952	T	0.07790	-1.0754	10	0.56958	D	0.05	-14.7201	9.9255	0.41489	0.2791:0.5861:0.1348:0.0	.	171	Q6IEE7	T132E_HUMAN	W	171	ENSP00000316532:R171W	ENSP00000316532:R171W	R	+	1	2	2	TMEM132E	29977702	29977702	0.999000	0.42202	0.993000	0.49108	0.971000	0.66376	0.741000	0.26202	0.545000	0.28902	-0.294000	0.09567	CGG	0.390424		TCGA-3A-A9IB-01A-21D-A397-08	0.711	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	1	0	1	2	2	2	2	0	0	0	0	25	0	25	25	1	1.970000	-20.000000	1	0.380000	NM_207313		0	17	16	0	75	75	0		1	0		0	0	25	0	0	0.999980	3.829787e-02	0	0	0	2	0	17	75
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.200000e-01	1.000000	0.900000	0.970000	0.959510	0.970000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	24185	GRCh37	CM015378|CM951227	TP53	M	rs121912666	c.(658-660)tAt>tGt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						102.0	94.0	97.0					17																	7578190		2203	4300	6503	SO:0001583	missense	7157	3	121412	37	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578190T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	chr17.hg19:g.7578190T>C	ENSP00000269305:p.Tyr220Cys	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C	p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.688645	P04637	P53_HUMAN		6	848	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.659A>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	0	TP53	7518915	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	0.238142		TCGA-3A-A9IB-01A-21D-A397-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	34	0	34	34	1	1.970000	-20.000000	1	0.380000	NM_000546		0	41	40	0	94	93	1		1	1	1	0	0	34	518	0	1.000000	9.999921e-01	1	21	231	26	668	41	94
CRHR1	1394	broad.mit.edu	37	17	43907805	43907805	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr17:43907805C>T	ENST00000398285.3	+	8	665	c.665C>T	c.(664-666)gCc>gTc	p.A222V	CRHR1_ENST00000339069.5_Missense_Mutation_p.A92V|CRHR1_ENST00000293493.7_Missense_Mutation_p.A18V|CRHR1_ENST00000314537.5_Missense_Mutation_p.A193V|CRHR1_ENST00000352855.5_Missense_Mutation_p.A153V|CRHR1_ENST00000577353.1_Missense_Mutation_p.A193V	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	222					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TTGGTGACAGCCGCCTACAAC	0.632																																					Ovarian(110;57 1568 10207 38216 49865)	ENST00000398285.3	1.000000	2.000000e-02	0.140000	0.040000	0.080000	0.152653	0.080000	0.070000																										0				24						c.(664-666)gCc>gTc		corticotropin releasing hormone receptor 1							58.0	62.0	61.0					17																	43907805		2195	4300	6495	SO:0001583	missense	1394	0	0					g.chr17:43907805C>T	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.665C>T	chr17.hg19:g.43907805C>T	ENSP00000381333:p.Ala222Val	0					CRHR1_ENST00000314537.5_Missense_Mutation_p.A193V|CRHR1_ENST00000293493.7_Missense_Mutation_p.A18V|CRHR1_ENST00000339069.5_Missense_Mutation_p.A92V|CRHR1_ENST00000577353.1_Missense_Mutation_p.A193V|CRHR1_ENST00000352855.5_Missense_Mutation_p.A153V	p.A222V	NM_001145146.1	NP_001138618.1	1	2	3	2.071362	P34998	CRFR1_HUMAN		8	665	+	Colorectal(2;0.0416)		B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	0	1	hg19	c.665C>T	CCDS45712.1	0	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750172	0.49257	.	.	ENSG00000120088	ENST00000293493;ENST00000339069;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T;T	0.39406	1.19;1.08;1.19;1.19;1.19	5.27	5.27	0.74061	5.27	5.27	0.74061	GPCR, family 2-like (1);	0.099034	0.64402	D	0.000001	T	0.25938	0.0632	N	0.04297	-0.235	0.50467	D	0.999875	B;B;B;P;B;B	0.42871	0.268;0.201;0.122;0.792;0.268;0.268	B;B;B;P;B;B	0.46419	0.26;0.088;0.082;0.516;0.135;0.192	T	0.06935	-1.0799	10	0.23891	T	0.37	.	9.92	0.41459	0.0:0.9073:0.0:0.0927	.	193;222;92;92;153;193	P34998-4;P34998;B3TIK8;B4DMR5;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.;.;.	V	18;92;222;193;193;153	ENSP00000293493:A18V;ENSP00000340522:A92V;ENSP00000381333:A222V;ENSP00000326060:A193V;ENSP00000344068:A153V	ENSP00000293493:A18V	A	+	2	0	0	CRHR1	41263586	41263586	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	6.091000	0.71406	2.462000	0.83206	0.561000	0.74099	GCC	0.390424		TCGA-3A-A9IB-01A-21D-A397-08	0.632	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3	0	0	1	2	2	2	2	0	0	0	0	76	0	76	75	1	1.970000	-2.697745	1	0.380000			0	5	6	0	364	361	0		1	0		0	0	76	0	0	0.937054	0	0	0	0	1	0	5	364
ZNF175	7728	broad.mit.edu	37	19	52090881	52090881	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr19:52090881A>G	ENST00000262259.2	+	5	1655	c.1297A>G	c.(1297-1299)Aca>Gca	p.T433A	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	433					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CCAGAAGTCAACACTCAGCTT	0.473																																						ENST00000262259.2	1.000000	8.000000e-01	1.000000	0.930000	0.990000	0.975252	0.990000	1.000000																										0				24						c.(1297-1299)Aca>Gca		zinc finger protein 175							69.0	66.0	67.0					19																	52090881		2203	4299	6502	SO:0001583	missense	7728	0	0					g.chr19:52090881A>G	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1297A>G	chr19.hg19:g.52090881A>G	ENSP00000262259:p.Thr433Ala	0					ZNF175_ENST00000436511.2_Intron	p.T433A	NM_007147.2	NP_009078.1	1	2	3	2.052867	Q9Y473	ZN175_HUMAN		5	1655	+		all_neural(266;0.0299)	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	1	1	hg19	c.1297A>G	CCDS12837.1	1	.	.	.	.	.	.	.	.	.	.	A	7.325	0.617711	0.14129	.	.	ENSG00000105497	ENST00000262259	T	0.35421	1.31	2.39	-1.01	0.10169	2.39	-1.01	0.10169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11537	0.0281	N	0.03238	-0.38	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.30650	-0.9971	9	0.08381	T	0.77	.	3.2726	0.06887	0.3719:0.0:0.4173:0.2107	.	433	Q9Y473	ZN175_HUMAN	A	433	ENSP00000262259:T433A	ENSP00000262259:T433A	T	+	1	0	0	ZNF175	56782693	56782693	0.000000	0.05858	0.677000	0.29947	0.993000	0.82548	-1.388000	0.02533	-0.348000	0.08286	-0.290000	0.09829	ACA	0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.473	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	1	0	1	2	2	2	2	0	0	0	0	26	0	26	25	1	1.970000	-20.000000	1	0.380000	NM_007147		0	44	43	0	175	174	1		1	0		0	0	26	0	0	1.000000	5.045139e-01	0	0	0	8	0	44	175
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																						ENST00000397910.4	1.000000	2.000000e-02	0.140000	0.040000	0.080000	0.127432	0.080000	0.080000																										0				590						c.(982-984)ccT>ccC		mucin 16, cell surface associated							96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9090831A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	chr19.hg19:g.9090831A>G		0						p.P328P	NM_024690.2	NP_078966.2	1	2	3	2.043449	Q8WXI7	MUC16_HUMAN		1	1187	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.984T>C	CCDS54212.1	0																																																																																								0.385835		TCGA-3A-A9IB-01A-21D-A397-08	0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	42	0	42	39	1	1.970000	-2.334638	0	0.380000	NM_024690		0	4	4	0	278	275	0		1			0	0	42	0	0	0.888528	0	0	0	0	0	0	4	278
ZNF528	84436	broad.mit.edu	37	19	52919334	52919334	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr19:52919334G>C	ENST00000360465.3	+	7	1655	c.1229G>C	c.(1228-1230)gGa>gCa	p.G410A	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AGACCTTATGGATGCAGTCAG	0.403																																						ENST00000360465.3	1.000000	7.000000e-01	1.000000	0.790000	0.900000	0.897071	0.900000	1.000000																										0				39						c.(1228-1230)gGa>gCa		zinc finger protein 528							75.0	76.0	76.0					19																	52919334		2203	4300	6503	SO:0001583	missense	84436	0	0					g.chr19:52919334G>C	AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1229G>C	chr19.hg19:g.52919334G>C	ENSP00000353652:p.Gly410Ala	0					ZNF528_ENST00000391788.2_3'UTR	p.G410A	NM_032423.2	NP_115799.2	1	2	3	2.049780	Q3MIS6	ZN528_HUMAN		7	1655	+			B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	1	1	hg19	c.1229G>C	CCDS33091.1	1	.	.	.	.	.	.	.	.	.	.	G	7.716	0.696068	0.15106	.	.	ENSG00000167555	ENST00000360465	T	0.35048	1.33	2.08	0.998	0.19857	2.08	0.998	0.19857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09949	0.0244	N	0.00637	-1.305	0.09310	N	1	B	0.30709	0.291	B	0.29663	0.105	T	0.17806	-1.0357	9	0.44086	T	0.13	.	3.0495	0.06165	0.5844:0.2488:0.1668:0.0	.	410	Q3MIS6	ZN528_HUMAN	A	410	ENSP00000353652:G410A	ENSP00000353652:G410A	G	+	2	0	0	ZNF528	57611146	57611146	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.943000	0.03917	0.074000	0.16767	-0.302000	0.09304	GGA	0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.403	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	1	0	1	2	2	2	2	0	0	0	0	62	0	62	60	1	1.970000	-20.000000	1	0.380000	NM_032423		0	58	57	0	286	283	1		1	0		0	0	62	0	0	1.000000	2.948477e-02	0	0	0	2	0	58	286
AMPD2	271	broad.mit.edu	37	1	110172959	110172959	+	Silent	SNP	G	G	A	rs368213563		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr1:110172959G>A	ENST00000256578.3	+	16	2610	c.2250G>A	c.(2248-2250)ccG>ccA	p.P750P	AMPD2_ENST00000528454.1_Silent_p.P632P|AMPD2_ENST00000393688.3_Silent_p.P631P|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Silent_p.P669P|AMPD2_ENST00000528667.1_Silent_p.P750P|AMPD2_ENST00000526301.1_3'UTR|AMPD2_ENST00000358729.4_Silent_p.P675P	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	750					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		ATCCGCTACCGGAGTACCTGT	0.617																																						ENST00000256578.3	1.000000	8.200000e-01	1.000000	0.900000	0.970000	0.960572	0.970000	1.000000																										0				7						c.(2248-2250)ccG>ccA		adenosine monophosphate deaminase 2							155.0	158.0	157.0					1																	110172959		2203	4300	6503	SO:0001819	synonymous_variant	271	0	0					g.chr1:110172959G>A	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2250G>A	chr1.hg19:g.110172959G>A		0					AMPD2_ENST00000393688.3_Silent_p.P631P|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000528454.1_Silent_p.P632P|AMPD2_ENST00000528667.1_Silent_p.P750P|AMPD2_ENST00000526301.1_3'UTR|AMPD2_ENST00000358729.4_Silent_p.P675P|AMPD2_ENST00000342115.4_Silent_p.P669P	p.P750P	NM_004037.7	NP_004028.3	0	0	0	1.996625	Q01433	AMPD2_HUMAN		16	2610	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Silent	SNP	ENST00000256578.3	1	1	hg19	c.2250G>A	CCDS805.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.875|6.875	0.530795|0.530795	0.13127|0.13127	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000476688	.|.	.|.	.|.	4.66|4.66	-4.93|-4.93	0.03066|0.03066	4.66|4.66	-4.93|-4.93	0.03066|0.03066	.|.	.|.	.|.	.|.	.|.	T|T	0.17959|0.17959	0.0431|0.0431	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38735|0.38735	-0.9647|-0.9647	4|4	.|.	.|.	.|.	-21.0222|-21.0222	0.507|0.507	0.00589|0.00589	0.205:0.284:0.2159:0.2951|0.205:0.284:0.2159:0.2951	.|.	.|.	.|.	.|.	R|Q	721|139	.|.	.|.	G|R	+|+	1|2	0|0	0|0	AMPD2|AMPD2	109974482|109974482	109974482|109974482	0.000000|0.000000	0.05858|0.05858	0.630000|0.630000	0.29268|0.29268	0.705000|0.705000	0.40729|0.40729	-3.213000|-3.213000	0.00555|0.00555	-1.228000|-1.228000	0.02568|0.02568	-2.079000|-2.079000	0.00380|0.00380	GGA|CGG	0.375252		TCGA-3A-A9IB-01A-21D-A397-08	0.617	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1	0	0	1	2	2	2	2	0	0	0	0	158	0	158	153	1	1.970000	-2.891062	1	0.380000			0	125	125	0	539	539	0		1	1		0	0	158	0	0	1.000000	1	0	37	0	92	0	125	539
GPR161	23432	broad.mit.edu	37	1	168066276	168066276	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr1:168066276G>A	ENST00000367838.1	-	5	882	c.569C>T	c.(568-570)gCc>gTc	p.A190V	GPR161_ENST00000367836.1_Missense_Mutation_p.A58V|GPR161_ENST00000537209.1_Missense_Mutation_p.A210V|GPR161_ENST00000361697.2_Missense_Mutation_p.A190V|GPR161_ENST00000367835.1_Missense_Mutation_p.A190V|GPR161_ENST00000546300.1_Missense_Mutation_p.A76V|GPR161_ENST00000271357.5_Missense_Mutation_p.A190V|GPR161_ENST00000539777.1_Missense_Mutation_p.A112V	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	190					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					CTGCCAGAAGGCCGTGTAGCC	0.592																																						ENST00000367838.1	1.000000	6.100000e-01	1.000000	0.750000	0.900000	0.885921	0.900000	1.000000																										0				26						c.(568-570)gCc>gTc		G protein-coupled receptor 161							71.0	60.0	64.0					1																	168066276		2203	4300	6503	SO:0001583	missense	23432	0	0					g.chr1:168066276G>A	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.569C>T	chr1.hg19:g.168066276G>A	ENSP00000356812:p.Ala190Val	0					GPR161_ENST00000537209.1_Missense_Mutation_p.A210V|GPR161_ENST00000367836.1_Missense_Mutation_p.A58V|GPR161_ENST00000539777.1_Missense_Mutation_p.A112V|GPR161_ENST00000361697.2_Missense_Mutation_p.A190V|GPR161_ENST00000367835.1_Missense_Mutation_p.A190V|GPR161_ENST00000271357.5_Missense_Mutation_p.A190V|GPR161_ENST00000546300.1_Missense_Mutation_p.A76V	p.A190V	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	0	0	0	1.989927	Q8N6U8	GP161_HUMAN		5	882	-	all_hematologic(923;0.215)		B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	1	1	hg19	c.569C>T	CCDS1268.1	1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.032295	0.35893	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.07	4.14	0.48551	5.07	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.102442	0.64402	N	0.000003	T	0.30665	0.0772	N	0.16098	0.37	0.38353	D	0.944394	B;B;B;B;B;B	0.13145	0.001;0.007;0.006;0.002;0.001;0.001	B;B;B;B;B;B	0.17722	0.003;0.019;0.018;0.006;0.001;0.005	T	0.08146	-1.0736	9	0.30078	T	0.28	-16.4128	12.5826	0.56399	0.0834:0.0:0.9166:0.0	.	210;76;112;210;190;190	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	V	190;190;58;190;76;112;210;190	ENSP00000356812:A190V;ENSP00000271357:A190V;ENSP00000356810:A58V;ENSP00000356809:A190V;ENSP00000444348:A76V;ENSP00000437576:A112V;ENSP00000441039:A210V;ENSP00000355194:A190V	ENSP00000271357:A190V	A	-	2	0	0	GPR161	166332900	166332900	1.000000	0.71417	0.922000	0.36590	0.974000	0.67602	4.756000	0.62205	1.242000	0.43836	0.561000	0.74099	GCC	0.375252		TCGA-3A-A9IB-01A-21D-A397-08	0.592	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	1	0	1	2	2	2	2	0	0	0	0	21	0	21	21	1	1.970000	-20.000000	1	0.380000	NM_007369		0	24	24	0	114	111	1		1	1		0	0	21	0	0	1.000000	7.286607e-01	0	2	0	12	0	24	114
EPHX1	2052	broad.mit.edu	37	1	226032215	226032215	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr1:226032215G>A	ENST00000366837.4	+	8	1253	c.1057G>A	c.(1057-1059)Gac>Aac	p.D353N	EPHX1_ENST00000272167.5_Missense_Mutation_p.D353N|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	353					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CTCCCTGGACGACCTGCTGAC	0.552																																						ENST00000366837.4	1.000000	7.300000e-01	1.000000	0.830000	0.950000	0.930073	0.950000	1.000000																										0				28						c.(1057-1059)Gac>Aac		epoxide hydrolase 1, microsomal (xenobiotic)							130.0	108.0	115.0					1																	226032215		2203	4300	6503	SO:0001583	missense	2052	3	121412	35				g.chr1:226032215G>A	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1057G>A	chr1.hg19:g.226032215G>A	ENSP00000355802:p.Asp353Asn	0					RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.D353N	p.D353N	NM_000120.3	NP_000111.1	0	0	0	1.989927	P07099	HYEP_HUMAN		8	1253	+	Breast(184;0.197)		B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	1	1	hg19	c.1057G>A	CCDS1547.1	1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973433	0.92919	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.75704	-0.96;-0.96	5.37	5.37	0.77165	5.37	5.37	0.77165	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	D	0.88400	0.6426	M	0.90814	3.15	0.80722	D	1	D	0.60160	0.987	P	0.62649	0.905	D	0.90256	0.4297	10	0.72032	D	0.01	-22.9316	19.464	0.94931	0.0:0.0:1.0:0.0	.	353	P07099	HYEP_HUMAN	N	353	ENSP00000272167:D353N;ENSP00000355802:D353N	ENSP00000272167:D353N	D	+	1	0	0	EPHX1	224098838	224098838	1.000000	0.71417	0.800000	0.32199	0.506000	0.33950	7.817000	0.86213	2.686000	0.91538	0.561000	0.74099	GAC	0.375252		TCGA-3A-A9IB-01A-21D-A397-08	0.552	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	1	0	1	2	2	2	2	0	0	0	0	56	0	56	54	1	1.970000	-20.000000	1	0.380000	NM_000120		0	53	53	0	237	234	1		1	1		0	0	56	0	0	1.000000	1	0	95	0	234	0	53	237
SLC32A1	140679	broad.mit.edu	37	20	37356232	37356232	+	Silent	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr20:37356232C>T	ENST00000217420.1	+	2	791	c.528C>T	c.(526-528)gaC>gaT	p.D176D		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	176					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	AGAATGAAGACGGCGAGGTGG	0.647																																						ENST00000217420.1	1.000000	8.000000e-01	1.000000	0.920000	0.990000	0.972440	0.990000	1.000000																										0				38						c.(526-528)gaC>gaT		solute carrier family 32 (GABA vesicular transporter), member 1	Glycine(DB00145)						77.0	62.0	67.0					20																	37356232		2203	4300	6503	SO:0001819	synonymous_variant	140679	1	121408	31				g.chr20:37356232C>T	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.528C>T	chr20.hg19:g.37356232C>T		1						p.D176D	NM_080552.2	NP_542119.1	0	2	2	2.053610	Q9H598	VIAAT_HUMAN		2	791	+		Myeloproliferative disorder(115;0.00878)	Q8N489	Silent	SNP	ENST00000217420.1	1	1	hg19	c.528C>T	CCDS13307.1	1																																																																																								0.380000		TCGA-3A-A9IB-01A-21D-A397-08	0.647	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	1	0	1	2	2	2	2	0	0	0	0	72	0	72	72	1	1.970000	-20.000000	1	0.380000	NM_080552		0	48	48	0	191	191	1		1			0	0	72	0	0	1.000000	0	0	0	0	0	0	48	191
RBM38	55544	broad.mit.edu	37	20	55966783	55966783	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr20:55966783C>A	ENST00000356208.5	+	1	321	c.146C>A	c.(145-147)tCg>tAg	p.S49*	RBM38_ENST00000371219.2_5'Flank|RBM38_ENST00000440234.2_Nonsense_Mutation_p.S49*|RP4-800J21.3_ENST00000417346.1_RNA	NM_017495.5	NP_059965.2	Q9H0Z9	RBM38_HUMAN	RNA binding motif protein 38	49	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell cycle (GO:0007049)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|regulation of myotube differentiation (GO:0010830)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			ACCGACGCCTCGCTCAGGAAG	0.677																																						ENST00000356208.5	1.000000	5.200000e-01	1.000000	0.760000	0.990000	0.913715	0.990000	1.000000																										0				9						c.(145-147)tCg>tAg		RNA binding motif protein 38							14.0	19.0	17.0					20																	55966783		1946	4113	6059	SO:0001587	stop_gained	55544	0	0					g.chr20:55966783C>A	X75314	CCDS46617.1, CCDS46618.1	20q13.31	2013-02-12	2006-07-11	2006-07-11	ENSG00000132819	ENSG00000132819		"""RNA binding motif (RRM) containing"""	15818	protein-coding gene	gene with protein product		612428	"""RNA-binding region (RNP1, RRM) containing 1"""	RNPC1			Standard	NM_017495		Approved	HSRNASEB, SEB4D, seb4B, dJ800J21.2	uc010zzj.2	Q9H0Z9	OTTHUMG00000032820	ENST00000356208.5:c.146C>A	chr20.hg19:g.55966783C>A	ENSP00000348538:p.Ser49*	1					RBM38_ENST00000440234.2_Nonsense_Mutation_p.S49*|RP4-800J21.3_ENST00000417346.1_RNA|RBM38_ENST00000371219.2_5'Flank	p.S49*	NM_017495.5	NP_059965.2	0	2	2	2.053610	Q9H0Z9	RBM38_HUMAN	BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)	1	321	+	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		A6NDK1|A6NMU6|Q15350|Q15351|Q9BYK3|Q9BYK4	Nonsense_Mutation	SNP	ENST00000356208.5	0	1	hg19	c.146C>A	CCDS46617.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322144	0.81580	.	.	ENSG00000132819	ENST00000356208;ENST00000440234	.	.	.	3.49	3.49	0.39957	3.49	3.49	0.39957	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6071	13.737	0.62824	0.0:1.0:0.0:0.0	.	.	.	.	X	49	.	ENSP00000343718:S49X	S	+	2	0	0	RBM38	55400189	55400189	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	1.488000	0.35551	1.500000	0.48636	0.442000	0.29010	TCG	0.380000		TCGA-3A-A9IB-01A-21D-A397-08	0.677	RBM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079843.4	1	0	1	2	2	2	2	0	0	0	0	23	0	23	22	1	1.970000	-16.818390	1	0.380000	NM_183425		0	8	8	0	32	32	0		1	0		0	0	23	0	0	0.991943	9.098666e-01	0	1	0	19	0	8	32
ISX	91464	broad.mit.edu	37	22	35463185	35463185	+	Silent	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr22:35463185G>A	ENST00000308700.6	+	1	1057	c.105G>A	c.(103-105)gcG>gcA	p.A35A	ISX_ENST00000404699.2_Silent_p.A35A|RP1-272J12.1_ENST00000448318.4_RNA	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	35					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						CCATTGAGGCGATCCTAAAGA	0.602																																						ENST00000308700.6	1.000000	7.500000e-01	1.000000	0.950000	0.990000	0.974937	0.990000	1.000000																										0				26						c.(103-105)gcG>gcA		intestine-specific homeobox							39.0	40.0	40.0					22																	35463185		2203	4300	6503	SO:0001819	synonymous_variant	91464	3	121394	31				g.chr22:35463185G>A	AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.105G>A	chr22.hg19:g.35463185G>A		1					RP1-272J12.1_ENST00000448318.4_RNA|ISX_ENST00000404699.2_Silent_p.A35A	p.A35A	NM_001008494.1	NP_001008494.1	1	2	3	2.018648	Q2M1V0	ISX_HUMAN		1	1057	+			Q68DJ5	Silent	SNP	ENST00000308700.6	0	1	hg19	c.105G>A	CCDS33640.1	1																																																																																								0.411318		TCGA-3A-A9IB-01A-21D-A397-08	0.602	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	1	0	1	2	2	2	2	0	0	0	0	8	0	8	8	1	1.970000	-20.000000	1	0.380000	NM_001008494		0	18	19	0	69	69	0		1			0	0	8	0	0	0.999992	0	0	0	0	0	0	18	69
BUB1	699	broad.mit.edu	37	2	111425242	111425242	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:111425242C>T	ENST00000302759.6	-	8	779	c.661G>A	c.(661-663)Gtg>Atg	p.V221M	BUB1_ENST00000409311.1_Missense_Mutation_p.V221M|BUB1_ENST00000535254.1_Missense_Mutation_p.V201M	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	221					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V221_S227>S(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		GATGAGTGCACAGAATATTCT	0.368																																						ENST00000302759.6	1.000000	6.800000e-01	0.980000	0.770000	0.860000	0.872973	0.860000	1.000000																										1	Complex - deletion inframe(1)	p.V221_S227>S(1)	kidney(1)	45						c.(661-663)Gtg>Atg		BUB1 mitotic checkpoint serine/threonine kinase							95.0	96.0	95.0					2																	111425242		2203	4300	6503	SO:0001583	missense	699	0	0					g.chr2:111425242C>T	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.661G>A	chr2.hg19:g.111425242C>T	ENSP00000302530:p.Val221Met	0					BUB1_ENST00000535254.1_Missense_Mutation_p.V201M|BUB1_ENST00000409311.1_Missense_Mutation_p.V221M	p.V221M	NM_004336.3	NP_004327.1	1	2	3	2.037772	O43683	BUB1_HUMAN		8	779	-		Ovarian(717;0.0822)	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	1	1	hg19	c.661G>A	CCDS33273.1	1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797928	0.50208	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	T;T;T	0.32272	2.2;1.46;2.46	5.72	0.743	0.18347	5.72	0.743	0.18347	.	1.042200	0.07470	N	0.902057	T	0.32496	0.0831	L	0.40543	1.245	0.09310	N	1	P;D;P	0.54047	0.955;0.964;0.874	P;P;B	0.53593	0.73;0.547;0.346	T	0.16571	-1.0398	10	0.32370	T	0.25	0.1037	3.7315	0.08495	0.293:0.4713:0.0:0.2356	.	201;221;221	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	M	201;221;221;221	ENSP00000441013:V201M;ENSP00000386701:V221M;ENSP00000302530:V221M	ENSP00000302530:V221M	V	-	1	0	0	BUB1	111141713	111141713	0.020000	0.18652	0.002000	0.10522	0.926000	0.56050	0.091000	0.15046	-0.140000	0.11394	0.650000	0.86243	GTG	0.384676		TCGA-3A-A9IB-01A-21D-A397-08	0.368	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	1	0	1	2	2	2	2	0	0	0	0	70	0	70	70	1	1.970000	-20.000000	1	0.380000	NM_004336		0	68	68	0	347	347	1		1	1		0	0	70	0	0	1.000000	4.520284e-01	0	3	0	6	0	68	347
SCN3A	6328	broad.mit.edu	37	2	165950907	165950907	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:165950907G>C	ENST00000360093.3	-	26	5004	c.4513C>G	c.(4513-4515)Cag>Gag	p.Q1505E	SCN3A_ENST00000409101.3_Missense_Mutation_p.Q1456E|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000283254.7_Missense_Mutation_p.Q1505E|SCN3A_ENST00000540861.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1505					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGGGTTTCTGAGGTTTCTTG	0.388																																						ENST00000360093.3	0.940000	7.000000e-01	0.890000	0.750000	0.810000	0.825914	0.810000	0.820000																										0				120						c.(4513-4515)Cag>Gag		sodium channel, voltage-gated, type III, alpha subunit	Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)						351.0	336.0	341.0					2																	165950907		2203	4300	6503	SO:0001583	missense	6328	0	0					g.chr2:165950907G>C	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4513C>G	chr2.hg19:g.165950907G>C	ENSP00000353206:p.Gln1505Glu	0					SCN3A_ENST00000540861.1_5'Flank|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000283254.7_Missense_Mutation_p.Q1505E|SCN3A_ENST00000409101.3_Missense_Mutation_p.Q1456E	p.Q1505E	NM_001081677.1	NP_001075146.1	0	0	0	1.981250	Q9NY46	SCN3A_HUMAN		26	5004	-			Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	1	1	hg19	c.4513C>G		0	.	.	.	.	.	.	.	.	.	.	G	16.64	3.178549	0.57692	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101	D;D;D	0.96104	-3.91;-3.91;-3.84	4.71	4.71	0.59529	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000001	D	0.97192	0.9082	H	0.94808	3.585	0.80722	D	1	P;P;B	0.47841	0.901;0.502;0.005	P;B;B	0.45881	0.496;0.118;0.019	D	0.98609	1.0662	10	0.72032	D	0.01	.	18.2045	0.89850	0.0:0.0:1.0:0.0	.	1456;1456;1505	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	E	1505;1505;1456	ENSP00000353206:Q1505E;ENSP00000283254:Q1505E;ENSP00000386726:Q1456E	ENSP00000283254:Q1505E	Q	-	1	0	0	SCN3A	165659153	165659153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.556000	0.98127	2.613000	0.88420	0.655000	0.94253	CAG	0.370431		TCGA-3A-A9IB-01A-21D-A397-08	0.388	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	167	0	167	164	1	1.970000	-20.000000	1	0.380000	NM_006922		0	147	146	0	778	766	1		1			0	0	167	0	0	1.000000	0	0	0	0	0	0	147	778
OSR1	130497	broad.mit.edu	37	2	19552943	19552943	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:19552943G>T	ENST00000272223.2	-	2	968	c.624C>A	c.(622-624)tgC>tgA	p.C208*	OSR1_ENST00000536433.1_Nonsense_Mutation_p.C208*	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	208					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				AGGCTTTGTGGCAGATGTCAC	0.597																																						ENST00000272223.2	1.000000	3.000000e-02	0.150000	0.060000	0.090000	0.133105	0.090000	0.100000																										0				8						c.(622-624)tgC>tgA		odd-skipped related transciption factor 1							95.0	93.0	94.0					2																	19552943		2203	4300	6503	SO:0001587	stop_gained	130497	0	0					g.chr2:19552943G>T	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.624C>A	chr2.hg19:g.19552943G>T	ENSP00000272223:p.Cys208*	0					OSR1_ENST00000536433.1_Nonsense_Mutation_p.C208*	p.C208*	NM_145260.2	NP_660303.1	1	2	3	2.037772	Q8TAX0	OSR1_HUMAN		2	968	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)	B3KV97|D6W521	Nonsense_Mutation	SNP	ENST00000272223.2	0	1	hg19	c.624C>A	CCDS1694.1	0	.	.	.	.	.	.	.	.	.	.	G	39	7.611580	0.98390	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	.	.	.	6.04	4.19	0.49359	6.04	4.19	0.49359	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.081	8.9124	0.35561	0.2346:0.0:0.7654:0.0	.	.	.	.	X	208	.	.	C	-	3	2	2	OSR1	19416424	19416424	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.198000	0.32223	0.838000	0.34948	0.650000	0.86243	TGC	0.384676		TCGA-3A-A9IB-01A-21D-A397-08	0.597	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	0	0	1	2	2	2	2	0	0	0	0	107	0	107	107	1	1.970000	-3.368486	1	0.380000	NM_145260		0	6	6	0	336	331	0		1	0		0	0	107	0	0	0.963700	4.975124e-02	0	0	0	17	0	6	336
LRP2	4036	broad.mit.edu	37	2	170115538	170115538	+	Missense_Mutation	SNP	G	G	A	rs369600443		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:170115538G>A	ENST00000263816.3	-	17	2795	c.2510C>T	c.(2509-2511)gCc>gTc	p.A837V	LRP2_ENST00000443831.1_Missense_Mutation_p.A700V	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	837					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACTTACCCGGCAAAAGGATG	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15832	0.0		0.0	False		,,,				2504	0.0					ENST00000263816.3	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.068237	0.050000	0.060000																										0				315						c.(2509-2511)gCc>gTc		low density lipoprotein receptor-related protein 2	"""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"						117.0	114.0	115.0					2																	170115538		2203	4300	6503	SO:0001583	missense	4036	2	121402	32				g.chr2:170115538G>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2510C>T	chr2.hg19:g.170115538G>A	ENSP00000263816:p.Ala837Val	0					LRP2_ENST00000443831.1_Missense_Mutation_p.A700V	p.A837V	NM_004525.2	NP_004516.2	0	0	0	1.981250	P98164	LRP2_HUMAN		17	2795	-			O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	0	1	hg19	c.2510C>T	CCDS2232.1	0	.	.	.	.	.	.	.	.	.	.	G	9.483	1.098743	0.20552	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.91295	-2.82;-2.82	5.77	3.73	0.42828	5.77	3.73	0.42828	Six-bladed beta-propeller, TolB-like (1);	0.770796	0.12440	N	0.468797	D	0.86239	0.5885	M	0.67953	2.075	0.27234	N	0.959321	B;B	0.29552	0.248;0.209	B;B	0.28553	0.091;0.035	T	0.75777	-0.3198	10	0.33141	T	0.24	.	1.5273	0.02528	0.4359:0.0:0.2681:0.296	.	700;837	E9PC35;P98164	.;LRP2_HUMAN	V	837;700	ENSP00000263816:A837V;ENSP00000409813:A700V	ENSP00000263816:A837V	A	-	2	0	0	LRP2	169823784	169823784	0.999000	0.42202	0.452000	0.26994	0.191000	0.23601	3.640000	0.54350	0.669000	0.31146	0.591000	0.81541	GCC	0.370431		TCGA-3A-A9IB-01A-21D-A397-08	0.403	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	0	0	1	2	2	2	2	0	0	0	0	52	0	52	52	1	1.970000	-2.141562	0	0.380000	NM_004525		0	5	5	0	447	440	0		1			0	0	52	0	0	0.935277	0	0	0	0	0	0	5	447
LTBP1	4052	broad.mit.edu	37	2	33487847	33487847	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:33487847C>T	ENST00000404816.2	+	14	2830	c.2477C>T	c.(2476-2478)tCt>tTt	p.S826F	LTBP1_ENST00000418533.2_Missense_Mutation_p.S500F|LTBP1_ENST00000354476.3_Missense_Mutation_p.S826F|LTBP1_ENST00000402934.1_Missense_Mutation_p.S447F|LTBP1_ENST00000407925.1_Missense_Mutation_p.S500F|LTBP1_ENST00000390003.4_Missense_Mutation_p.S500F|LTBP1_ENST00000404525.1_Missense_Mutation_p.S447F			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	826					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CCCCAGCTGTCTCCAGGCATT	0.398																																						ENST00000404816.2	1.000000	4.300000e-01	0.810000	0.530000	0.660000	0.676794	0.660000	0.650000																										0				108						c.(2476-2478)tCt>tTt		latent transforming growth factor beta binding protein 1							78.0	79.0	79.0					2																	33487847		2203	4300	6503	SO:0001583	missense	4052	0	0					g.chr2:33487847C>T		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2477C>T	chr2.hg19:g.33487847C>T	ENSP00000386043:p.Ser826Phe	0					LTBP1_ENST00000407925.1_Missense_Mutation_p.S500F|LTBP1_ENST00000390003.4_Missense_Mutation_p.S500F|LTBP1_ENST00000404525.1_Missense_Mutation_p.S447F|LTBP1_ENST00000402934.1_Missense_Mutation_p.S447F|LTBP1_ENST00000354476.3_Missense_Mutation_p.S826F|LTBP1_ENST00000418533.2_Missense_Mutation_p.S500F	p.S826F			1	2	3	2.037772	Q14766	LTBP1_HUMAN		14	2830	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	0	1	hg19	c.2477C>T	CCDS33177.2	0	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372043	0.82573	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000413303;ENST00000468091	D;T;T;T;T;T;T;T;T	0.81659	-1.52;-1.48;-1.42;-1.39;-1.4;-1.39;-1.4;1.66;0.2	5.29	5.29	0.74685	5.29	5.29	0.74685	.	.	.	.	.	D	0.87030	0.6076	L	0.50333	1.59	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.995;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.979;0.999;0.947;0.999;0.999;0.999	D	0.85468	0.1171	9	0.35671	T	0.21	.	18.0174	0.89246	0.0:1.0:0.0:0.0	.	826;500;447;500;500;826	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	F	826;826;500;500;447;447;500;154;143	ENSP00000386043:S826F;ENSP00000346467:S826F;ENSP00000374653:S500F;ENSP00000393057:S500F;ENSP00000384373:S447F;ENSP00000385359:S447F;ENSP00000384091:S500F;ENSP00000415412:S154F;ENSP00000417591:S143F	ENSP00000346467:S826F	S	+	2	0	0	LTBP1	33341351	33341351	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.160000	0.71862	2.490000	0.84030	0.650000	0.86243	TCT	0.384676		TCGA-3A-A9IB-01A-21D-A397-08	0.398	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	1	0	1	2	2	2	2	0	0	0	0	18	0	18	18	1	1.970000	-20.000000	1	0.380000	NM_206943		0	23	23	0	164	163	1		1	1		0	0	18	0	0	1.000000	9.999971e-01	0	20	0	137	0	23	164
GPAT2	150763	broad.mit.edu	37	2	96690527	96690527	+	Silent	SNP	A	A	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:96690527A>G	ENST00000434632.1	-	15	1881	c.1422T>C	c.(1420-1422)caT>caC	p.H474H	GPAT2_ENST00000377137.3_Silent_p.H474H|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Silent_p.H403H|GPAT2_ENST00000359548.4_Silent_p.H474H			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	474					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTACCTTCTGATGCTTGAAGA	0.652																																						ENST00000434632.1	1.000000	1.200000e-01	0.240000	0.150000	0.180000	0.218568	0.180000	0.190000																										0				16						c.(1420-1422)caT>caC		glycerol-3-phosphate acyltransferase 2, mitochondrial							120.0	130.0	126.0					2																	96690527		2044	4171	6215	SO:0001819	synonymous_variant	150763	0	0					g.chr2:96690527A>G	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1422T>C	chr2.hg19:g.96690527A>G		0					GPAT2_ENST00000453542.1_Silent_p.H403H|GPAT2_ENST00000359548.4_Silent_p.H474H|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000377137.3_Silent_p.H474H	p.H474H			1	2	3	2.037772	Q6NUI2	GPAT2_HUMAN		15	1881	-			Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Silent	SNP	ENST00000434632.1	1	1	hg19	c.1422T>C	CCDS42714.1	0																																																																																								0.384676		TCGA-3A-A9IB-01A-21D-A397-08	0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	0	0	1	2	2	2	2	0	0	0	0	163	0	163	157	1	1.970000	-19.995140	1	0.380000	NM_207328		0	25	23	0	677	663	0		1	0		0	0	163	0	0	1.000000	6.138825e-02	0	0	0	11	0	25	677
CNGA3	1261	broad.mit.edu	37	2	99012788	99012788	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:99012788C>G	ENST00000272602.2	+	7	1194	c.1155C>G	c.(1153-1155)ttC>ttG	p.F385L	CNGA3_ENST00000409937.1_Missense_Mutation_p.F389L|CNGA3_ENST00000436404.2_Missense_Mutation_p.F367L|CNGA3_ENST00000393504.1_Missense_Mutation_p.F385L			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	385					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TCGTAGACTTCTTGGTGGGTG	0.498																																						ENST00000272602.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999159	0.990000	1.000000																										0				49						c.(1153-1155)ttC>ttG		cyclic nucleotide gated channel alpha 3							79.0	81.0	80.0					2																	99012788		2203	4300	6503	SO:0001583	missense	1261	0	0					g.chr2:99012788C>G	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1155C>G	chr2.hg19:g.99012788C>G	ENSP00000272602:p.Phe385Leu	0					CNGA3_ENST00000393504.1_Missense_Mutation_p.F385L|CNGA3_ENST00000409937.1_Missense_Mutation_p.F389L|CNGA3_ENST00000436404.2_Missense_Mutation_p.F367L	p.F385L			1	2	3	2.037772	Q16281	CNGA3_HUMAN		7	1194	+			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	1	1	hg19	c.1155C>G	CCDS2034.1	1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727449	0.30593	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96	5.05	5.05	0.67936	5.05	5.05	0.67936	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97021	0.9027	M	0.73598	2.24	0.58432	D	0.999997	B;B;B	0.31752	0.091;0.338;0.203	B;B;B	0.38194	0.147;0.267;0.255	D	0.94382	0.7605	10	0.32370	T	0.25	.	7.4961	0.27490	0.0:0.8252:0.0:0.1748	.	389;367;385	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	L	385;367;385;389	ENSP00000377140:F385L;ENSP00000410070:F367L;ENSP00000272602:F385L;ENSP00000386761:F389L	ENSP00000272602:F385L	F	+	3	2	2	CNGA3	98379220	98379220	0.995000	0.38212	1.000000	0.80357	0.983000	0.72400	0.525000	0.22956	2.620000	0.88729	0.563000	0.77884	TTC	0.384676		TCGA-3A-A9IB-01A-21D-A397-08	0.498	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	1	0	1	2	2	2	2	0	0	0	0	41	0	41	40	1	1.970000	-20.000000	1	0.380000	NM_001298		0	72	71	0	234	231	1		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	72	234
PTPRN	5798	broad.mit.edu	37	2	220162054	220162054	+	Silent	SNP	G	G	A	rs17847405	byFrequency	TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr2:220162054G>A	ENST00000295718.2	-	14	2229	c.1989C>T	c.(1987-1989)gaC>gaT	p.D663D	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000409251.3_Silent_p.D634D|PTPRN_ENST00000423636.2_Silent_p.D573D|PTPRN_ENST00000497977.1_5'Flank	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	663					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CCTGGGCTGCGTCGCTGAACT	0.652													G|||	320	0.0638978	0.0953	0.0086	5008	,	,		16504	0.0804		0.0209	False		,,,				2504	0.0879					ENST00000295718.2	1.000000	7.400000e-01	1.000000	0.820000	0.920000	0.916653	0.920000	1.000000																										0				65						c.(1987-1989)gaC>gaT		protein tyrosine phosphatase, receptor type, N		G	,,	378,4028	190.2+/-216.2	20,338,1845	68.0	68.0	68.0		1902,1719,1989	-3.2	0.9	2	dbSNP_123	68	123,8477	63.5+/-125.6	0,123,4177	no	coding-synonymous,coding-synonymous,coding-synonymous	PTPRN	NM_001199763.1,NM_001199764.1,NM_002846.3	,,	20,461,6022	AA,AG,GG		1.4302,8.5792,3.8521	,,	634/951,573/890,663/980	220162054	501,12505	2203	4300	6503	SO:0001819	synonymous_variant	5798	4133	121412	69				g.chr2:220162054G>A		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1989C>T	chr2.hg19:g.220162054G>A		0					PTPRN_ENST00000497977.1_5'Flank|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Silent_p.D573D|PTPRN_ENST00000409251.3_Silent_p.D634D	p.D663D	NM_002846.3	NP_002837.1	0	1	1	2.010617	Q16849	PTPRN_HUMAN		14	2229	-		Renal(207;0.0474)	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	1	0	hg19	c.1989C>T	CCDS2440.1	1																																																																																								0.378820		TCGA-3A-A9IB-01A-21D-A397-08	0.652	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2	0	0	1	2	2	2	2	0	0	0	0	120	0	120	118	1	1.970000	-2.124767	0	0.380000			0	72	72	0	336	333	1		1	0		0	0	120	0	0	1.000000	4.932440e-01	0	0	0	9	0	72	336
FBXO40	51725	broad.mit.edu	37	3	121341863	121341863	+	Silent	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr3:121341863G>A	ENST00000338040.4	+	3	2001	c.1587G>A	c.(1585-1587)ggG>ggA	p.G529G		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	529					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		GTCCCCCAGGGCAAAAGGCAA	0.498																																						ENST00000338040.4	0.250000	4.000000e-02	0.190000	0.070000	0.120000	0.133683	0.120000	0.120000																										0				46						c.(1585-1587)ggG>ggA		F-box protein 40							54.0	52.0	53.0					3																	121341863		2203	4300	6503	SO:0001819	synonymous_variant	51725	0	0					g.chr3:121341863G>A	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1587G>A	chr3.hg19:g.121341863G>A		1						p.G529G	NM_016298.3	NP_057382.2	1	2	3	2.443204	Q9UH90	FBX40_HUMAN		3	2001	+			B2RAX7|Q32M70|Q9ULM5	Silent	SNP	ENST00000338040.4	0	1	hg19	c.1587G>A	CCDS33835.1	0																																																																																								0.478992		TCGA-3A-A9IB-01A-21D-A397-08	0.498	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	0	0	1	2	2	2	2	0	0	0	0	39	0	39	37	1	1.970000	-2.988766	1	0.380000	NM_016298		0	5	5	0	273	270	0		1			0	0	39	0	0	0.936305	0	0	0	0	0	0	5	273
TMCC1	23023	broad.mit.edu	37	3	129370592	129370592	+	Missense_Mutation	SNP	T	T	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr3:129370592T>A	ENST00000393238.3	-	6	2034	c.1694A>T	c.(1693-1695)cAg>cTg	p.Q565L	TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L|TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	565						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CTGCTGCTGCTGCAGCTCCAT	0.572																																						ENST00000393238.3	0.170000	1.000000e-02	0.120000	0.040000	0.070000	0.089162	0.070000	0.080000																									PLXND1/TMCC1(4)	0				25						c.(1693-1695)cAg>cTg		transmembrane and coiled-coil domain family 1							79.0	76.0	77.0					3																	129370592		2203	4300	6503	SO:0001583	missense	23023	0	0					g.chr3:129370592T>A	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1694A>T	chr3.hg19:g.129370592T>A	ENSP00000376930:p.Gln565Leu	1					TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L|TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L	p.Q565L	NM_001017395.3	NP_001017395.2	1	2	3	2.443204	O94876	TMCC1_HUMAN		6	2034	-			A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	0	1	hg19	c.1694A>T	CCDS33855.1	0	.	.	.	.	.	.	.	.	.	.	T	20.6	4.009576	0.75046	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	L	0.46614	1.455	0.80722	D	1	D;D	0.67145	0.996;0.985	D;D	0.85130	0.997;0.973	T	0.58278	-0.7664	10	0.33940	T	0.23	-18.4911	15.1509	0.72696	0.0:0.0:0.0:1.0	.	386;565	B4DE04;O94876	.;TMCC1_HUMAN	L	241;565;451;386	ENSP00000404711:Q241L;ENSP00000376930:Q565L;ENSP00000389892:Q451L;ENSP00000327349:Q386L	ENSP00000327349:Q386L	Q	-	2	0	0	TMCC1	130853282	130853282	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.735000	0.84939	2.172000	0.68678	0.533000	0.62120	CAG	0.478992		TCGA-3A-A9IB-01A-21D-A397-08	0.572	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	0	0	1	2	2	2	2	0	0	0	0	54	0	54	56	1	1.970000	-2.081405	0	0.380000	NM_015008		0	5	4	0	413	426	0		1	0		0	0	54	0	0	0.942391	2.343875e-01	0	0	0	64	0	5	413
ACAP2	23527	broad.mit.edu	37	3	195027329	195027329	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr3:195027329C>T	ENST00000326793.6	-	13	1257	c.1027G>A	c.(1027-1029)Gca>Aca	p.A343T		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	343	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TCGGAATCTGCCTGGAGCATG	0.403																																						ENST00000326793.6	0.720000	4.200000e-01	0.650000	0.480000	0.560000	0.571402	0.560000	0.570000																										0				27						c.(1027-1029)Gca>Aca		ArfGAP with coiled-coil, ankyrin repeat and PH domains 2							126.0	126.0	126.0					3																	195027329		2203	4300	6503	SO:0001583	missense	23527	0	0					g.chr3:195027329C>T		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1027G>A	chr3.hg19:g.195027329C>T	ENSP00000324287:p.Ala343Thr	1						p.A343T	NM_012287.5	NP_036419.3	1	2	3	2.443204	Q15057	ACAP2_HUMAN		13	1257	-			A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	1	1	hg19	c.1027G>A	CCDS33924.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.136760|5.136760	0.94517|0.94517	.|.	.|.	ENSG00000114331|ENSG00000114331	ENST00000326793|ENST00000439758	T|.	0.78126|.	-1.15|.	5.68|5.68	5.68|5.68	0.88126|0.88126	5.68|5.68	5.68|5.68	0.88126|0.88126	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84552|0.84552	0.5497|0.5497	M|M	0.89095|0.89095	3.005|3.005	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.86482|0.86482	0.1792|0.1792	10|5	0.87932|.	D|.	0|.	.|.	18.7846|18.7846	0.91949|0.91949	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	343|.	Q15057|.	ACAP2_HUMAN|.	T|D	343|217	ENSP00000324287:A343T|.	ENSP00000324287:A343T|.	A|G	-|-	1|2	0|0	0|0	ACAP2|ACAP2	196508618|196508618	196508618|196508618	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.818000|7.818000	0.86416|0.86416	2.662000|2.662000	0.90505|0.90505	0.609000|0.609000	0.83330|0.83330	GCA|GGC	0.478992		TCGA-3A-A9IB-01A-21D-A397-08	0.403	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	1	0	1	2	2	2	2	0	0	0	0	63	0	63	63	1	1.970000	-13.516650	1	0.380000	NM_012287		0	48	48	0	486	485	0		1	1		0	0	63	0	0	1.000000	4.663170e-01	0	2	0	15	0	48	486
LRCH3	84859	broad.mit.edu	37	3	197562598	197562598	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr3:197562598G>C	ENST00000425562.2	+	9	1156	c.1156G>C	c.(1156-1158)Gag>Cag	p.E386Q	LRCH3_ENST00000438796.2_Missense_Mutation_p.E386Q|LRCH3_ENST00000334859.4_Missense_Mutation_p.E386Q|LRCH3_ENST00000441090.2_Missense_Mutation_p.E260Q|LRCH3_ENST00000414675.2_Missense_Mutation_p.E386Q|LRCH3_ENST00000536618.1_5'UTR			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	386	Poly-Glu.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		CGCAGAGGAAGAGGAGGCCGA	0.502																																						ENST00000425562.2	0.710000	3.700000e-01	0.620000	0.440000	0.520000	0.537485	0.520000	0.530000																										0				29						c.(1156-1158)Gag>Cag		leucine-rich repeats and calponin homology (CH) domain containing 3							142.0	124.0	130.0					3																	197562598		2203	4300	6503	SO:0001583	missense	84859	0	0					g.chr3:197562598G>C	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1156G>C	chr3.hg19:g.197562598G>C	ENSP00000393579:p.Glu386Gln	1					LRCH3_ENST00000536618.1_5'UTR|LRCH3_ENST00000334859.4_Missense_Mutation_p.E386Q|LRCH3_ENST00000438796.2_Missense_Mutation_p.E386Q|LRCH3_ENST00000414675.2_Missense_Mutation_p.E386Q|LRCH3_ENST00000441090.2_Missense_Mutation_p.E260Q	p.E386Q			1	2	3	2.436954	Q96II8	LRCH3_HUMAN	Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	9	1156	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	1	1	hg19	c.1156G>C		0	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481581	0.84747	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.38401	1.89;1.14;1.91;2.14;1.91	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.057940	0.64402	D	0.000004	T	0.40222	0.1108	L	0.34521	1.04	0.80722	D	1	D;D;P;B	0.60160	0.987;0.958;0.817;0.27	P;P;P;B	0.52424	0.698;0.697;0.686;0.398	T	0.04621	-1.0938	10	0.16420	T	0.52	-10.8516	19.2996	0.94138	0.0:0.0:1.0:0.0	.	260;386;386;386	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	Q	386;260;386;386;386	ENSP00000399751:E386Q;ENSP00000394609:E260Q;ENSP00000394965:E386Q;ENSP00000334375:E386Q;ENSP00000393579:E386Q	ENSP00000334375:E386Q	E	+	1	0	0	LRCH3	199046995	199046995	1.000000	0.71417	0.957000	0.39632	0.888000	0.51559	8.533000	0.90617	2.642000	0.89623	0.644000	0.83932	GAG	0.478158		TCGA-3A-A9IB-01A-21D-A397-08	0.502	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	1	0	1	2	2	2	2	0	0	0	0	58	0	58	57	1	1.970000	-3.017764	1	0.380000	NM_032773		0	37	35	0	402	399	0		1	1		0	0	58	0	0	1.000000	8.759212e-01	0	3	0	39	0	37	402
CCDC149	91050	broad.mit.edu	37	4	24839847	24839847	+	Silent	SNP	G	G	A	rs370337373		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr4:24839847G>A	ENST00000389609.4	-	6	563	c.420C>T	c.(418-420)atC>atT	p.I140I	CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000428116.2_Intron|CCDC149_ENST00000504487.1_Silent_p.I140I	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	85										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				GTCGCACGCCGATTGCTTCGT	0.483																																						ENST00000389609.4	0.100000	1.000000e-02	0.070000	0.020000	0.040000	0.053294	0.040000	0.050000																										0				7						c.(418-420)atC>atT		coiled-coil domain containing 149		G	,	0,4406		0,0,2203	149.0	134.0	139.0		420,420	-4.9	0.5	4		139	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CCDC149	NM_001130726.2,NM_173463.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	140/530,140/530	24839847	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	91050	6	121412	42				g.chr4:24839847G>A		CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.420C>T	chr4.hg19:g.24839847G>A		1					CCDC149_ENST00000428116.2_Intron|CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000504487.1_Silent_p.I140I	p.I140I	NM_173463.4	NP_775734.2	0	1	1	1.760189	Q6ZUS6	CC149_HUMAN		6	563	-		Breast(46;0.173)	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Silent	SNP	ENST00000389609.4	0	1	hg19	c.420C>T	CCDS33967.2	0																																																																																								0.238142		TCGA-3A-A9IB-01A-21D-A397-08	0.483	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360157.1	0	0	1	2	18	2	2	0	0	0	1	92	0	92	88	1	1.970000	-2.237863	0	0.380000	NM_173463		0	5	5	0	472	465	0		0	0		0	0	92	0	0	0.004322	3.120933e-02	0	0	0	21	0	5	472
CHRNA9	55584	broad.mit.edu	37	4	40351405	40351405	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr4:40351405C>T	ENST00000310169.2	+	4	1011	c.872C>T	c.(871-873)cCg>cTg	p.P291L		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	291					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	GAAATCATGCCGGCCTCAGAA	0.512																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)	ENST00000310169.2	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.057306	0.040000	0.050000																										0				33						c.(871-873)cCg>cTg		cholinergic receptor, nicotinic, alpha 9 (neuronal)	Galantamine(DB00674)|Nicotine(DB00184)						70.0	76.0	74.0					4																	40351405		2202	4300	6502	SO:0001583	missense	55584	1	121398	36				g.chr4:40351405C>T	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.872C>T	chr4.hg19:g.40351405C>T	ENSP00000312663:p.Pro291Leu	1						p.P291L	NM_017581.3	NP_060051.2	0	1	1	1.725719	Q9UGM1	ACHA9_HUMAN		4	1011	+			Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	0	1	hg19	c.872C>T	CCDS3459.1	0	.	.	.	.	.	.	.	.	.	.	C	22.9	4.355172	0.82243	.	.	ENSG00000174343	ENST00000310169	D	0.99382	-5.8	5.6	5.6	0.85130	5.6	5.6	0.85130	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97219	0.9876	10	0.87932	D	0	.	19.6143	0.95626	0.0:1.0:0.0:0.0	.	291	Q9UGM1	ACHA9_HUMAN	L	291	ENSP00000312663:P291L	ENSP00000312663:P291L	P	+	2	0	0	CHRNA9	40046162	40046162	1.000000	0.71417	0.979000	0.43373	0.662000	0.39071	7.818000	0.86416	2.640000	0.89533	0.561000	0.74099	CCG	0.234568		TCGA-3A-A9IB-01A-21D-A397-08	0.512	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1	0	0	1	2	2	2	2	0	0	0	0	69	0	69	67	1	1.970000	-2.456322	0	0.380000			0	5	6	0	436	433	0		1			0	0	69	0	0	0.937128	0	0	0	0	0	0	5	436
UBA6	55236	broad.mit.edu	37	4	68501258	68501258	+	Silent	SNP	T	T	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr4:68501258T>C	ENST00000322244.5	-	20	1814	c.1755A>G	c.(1753-1755)ctA>ctG	p.L585L		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	585					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						AAAGAGGCCTTAGATTTGCTA	0.358																																						ENST00000322244.5	1.000000	2.000000e-02	1.000000	0.040000	0.080000	0.260391	0.080000	0.070000																										0				44						c.(1753-1755)ctA>ctG		ubiquitin-like modifier activating enzyme 6							103.0	96.0	98.0					4																	68501258		2203	4300	6503	SO:0001819	synonymous_variant	55236	0	0					g.chr4:68501258T>C	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1755A>G	chr4.hg19:g.68501258T>C		0						p.L585L	NM_018227.5	NP_060697.4	1	2	3	2.063709	A0AVT1	UBA6_HUMAN		20	1814	-			A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Silent	SNP	ENST00000322244.5	0	1	hg19	c.1755A>G	CCDS3516.1	0																																																																																								0.411318		TCGA-3A-A9IB-01A-21D-A397-08	0.358	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	0	0	0	2	2	2	2	0	0	0	0	87	0	87	86	1	1.970000	-5.101528	1	0.380000	NM_018227		0	4	4	0	327	326	0		1	0		0	0	87	0	0	0.890272	1.280853e-01	0	0	0	40	0	4	327
PCDHB7	56129	broad.mit.edu	37	5	140554443	140554443	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr5:140554443C>T	ENST00000231137.3	+	1	2201	c.2027C>T	c.(2026-2028)gCg>gTg	p.A676V	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	676					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCCGGAGGCGGCCCCGGAC	0.692																																						ENST00000231137.3	1.000000	4.700000e-01	0.690000	0.530000	0.600000	0.624188	0.600000	0.600000																										0				119						c.(2026-2028)gCg>gTg		protocadherin beta 7							48.0	79.0	68.0					5																	140554443		2185	4283	6468	SO:0001583	missense	56129	0	0					g.chr5:140554443C>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2027C>T	chr5.hg19:g.140554443C>T	ENSP00000231137:p.Ala676Val	0					PCDHB8_ENST00000239444.2_5'Flank	p.A676V	NM_018940.2	NP_061763.1	1	2	3	2.051129	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	2201	+			A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	1	1	hg19	c.2027C>T	CCDS4249.1	0	.	.	.	.	.	.	.	.	.	.	C	4.037	0.004475	0.07866	.	.	ENSG00000113212	ENST00000231137	T	0.51817	0.69	3.77	-3.6	0.04570	3.77	-3.6	0.04570	.	.	.	.	.	T	0.17704	0.0425	N	0.10707	0.03	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.31641	-0.9936	9	0.02654	T	1	.	4.7814	0.13204	0.0:0.2545:0.3902:0.3553	.	676	Q9Y5E2	PCDB7_HUMAN	V	676	ENSP00000231137:A676V	ENSP00000231137:A676V	A	+	2	0	0	PCDHB7	140534627	140534627	0.000000	0.05858	0.077000	0.20336	0.306000	0.27790	-0.419000	0.07071	-0.428000	0.07339	0.449000	0.29647	GCG	0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.692	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	1	0	1	2	2	2	2	0	0	0	0	259	0	259	252	1	1.970000	-3.318794	1	0.380000	NM_018940		0	72	72	0	566	562	1		1	1		0	0	259	2	0	1.000000	1.436596e-01	0	2	0	4	0	72	566
GEMIN5	25929	broad.mit.edu	37	5	154292538	154292538	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr5:154292538G>A	ENST00000285873.7	-	14	1991	c.1916C>T	c.(1915-1917)aCg>aTg	p.T639M		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	639					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AATCTTGGCCGTATGCCCTGA	0.522																																						ENST00000285873.7	1.000000	3.000000e-02	0.150000	0.050000	0.090000	0.143414	0.090000	0.080000																										0				38						c.(1915-1917)aCg>aTg		gem (nuclear organelle) associated protein 5							116.0	101.0	106.0					5																	154292538		2203	4300	6503	SO:0001583	missense	25929	5	121412	34				g.chr5:154292538G>A	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.1916C>T	chr5.hg19:g.154292538G>A	ENSP00000285873:p.Thr639Met	0						p.T639M	NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	1	2	3	2.051129	Q8TEQ6	GEMI5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)	14	1991	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	0	1	hg19	c.1916C>T	CCDS4330.1	0	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766113	0.69878	.	.	ENSG00000082516	ENST00000285873	T	0.65549	-0.16	5.37	5.37	0.77165	5.37	5.37	0.77165	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80742	0.4681	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82647	-0.0354	10	0.87932	D	0	-17.564	19.0919	0.93229	0.0:0.0:1.0:0.0	.	638;639	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	M	639	ENSP00000285873:T639M	ENSP00000285873:T639M	T	-	2	0	0	GEMIN5	154272731	154272731	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	8.881000	0.92415	2.667000	0.90743	0.561000	0.74099	ACG	0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.522	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1	0	0	1	2	2	2	2	0	0	0	0	55	0	55	54	1	1.970000	-2.742634	1	0.380000			0	5	5	0	307	303	0		1	0		0	0	55	0	0	0.935895	5.492174e-02	0	0	0	19	0	5	307
DOCK2	1794	broad.mit.edu	37	5	169446049	169446049	+	Silent	SNP	C	C	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr5:169446049C>A	ENST00000256935.8	+	33	3398	c.3318C>A	c.(3316-3318)gcC>gcA	p.A1106A	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Silent_p.A598A|DOCK2_ENST00000540750.1_Silent_p.A167A	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1106	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCGGAAAGCCACCATACCAA	0.453																																						ENST00000256935.8	1.000000	7.400000e-01	0.960000	0.810000	0.870000	0.884334	0.870000	0.880000																										0				160						c.(3316-3318)gcC>gcA		dedicator of cytokinesis 2							197.0	195.0	196.0					5																	169446049		2203	4300	6503	SO:0001819	synonymous_variant	1794	0	0					g.chr5:169446049C>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3318C>A	chr5.hg19:g.169446049C>A		0					DOCK2_ENST00000520908.1_Silent_p.A598A|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Silent_p.A167A	p.A1106A	NM_004946.2	NP_004937.1	1	2	3	2.051129	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	33	3398	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	1	1	hg19	c.3318C>A	CCDS4371.1	1																																																																																								0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.453	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	1	0	1	2	2	2	2	0	0	0	0	113	0	113	108	1	1.970000	-20.000000	1	0.380000	NM_004946		0	148	148	0	750	746	1		1	0		0	0	113	0	0	1.000000	7.667690e-01	0	0	0	16	0	148	750
CDHR2	54825	broad.mit.edu	37	5	176003158	176003158	+	Missense_Mutation	SNP	T	T	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr5:176003158T>A	ENST00000510636.1	+	12	1440	c.1166T>A	c.(1165-1167)cTc>cAc	p.L389H	CDHR2_ENST00000506348.1_Missense_Mutation_p.L389H|CDHR2_ENST00000261944.5_Missense_Mutation_p.L389H	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	389	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						ATCGATGACCTCACCATGGTG	0.667																																						ENST00000510636.1	1.000000	5.900000e-01	0.960000	0.690000	0.810000	0.821819	0.810000	1.000000																										0				56						c.(1165-1167)cTc>cAc		cadherin-related family member 2							66.0	57.0	60.0					5																	176003158		2203	4300	6503	SO:0001583	missense	54825	0	0					g.chr5:176003158T>A	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.1166T>A	chr5.hg19:g.176003158T>A	ENSP00000424565:p.Leu389His	0					CDHR2_ENST00000506348.1_Missense_Mutation_p.L389H|CDHR2_ENST00000261944.5_Missense_Mutation_p.L389H	p.L389H	NM_001171976.1	NP_001165447.1	1	2	3	2.051129	Q9BYE9	CDHR2_HUMAN		12	1440	+			A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	1	1	hg19	c.1166T>A	CCDS34297.1	0	.	.	.	.	.	.	.	.	.	.	T	19.26	3.792906	0.70452	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.63255	-0.03;-0.03;-0.03	4.54	4.54	0.55810	4.54	4.54	0.55810	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.79879	0.4522	M	0.91972	3.26	0.53688	D	0.999978	D	0.67145	0.996	P	0.60345	0.873	D	0.84655	0.0703	9	0.87932	D	0	-24.7678	12.2853	0.54789	0.0:0.0:0.0:1.0	.	389	Q9BYE9	CDHR2_HUMAN	H	389	ENSP00000424565:L389H;ENSP00000261944:L389H;ENSP00000421078:L389H	ENSP00000261944:L389H	L	+	2	0	0	CDHR2	175935764	175935764	1.000000	0.71417	0.971000	0.41717	0.555000	0.35460	4.560000	0.60802	1.910000	0.55303	0.448000	0.29417	CTC	0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.667	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	1	0	1	2	2	2	2	0	0	0	0	65	0	65	65	1	1.970000	-20.000000	1	0.380000	NM_017675		0	39	37	0	218	215	1		1	1		0	0	65	0	0	1.000000	1	0	83	0	88	0	39	218
AKAP12	9590	broad.mit.edu	37	6	151671524	151671524	+	Silent	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr6:151671524G>A	ENST00000253332.1	+	3	2187	c.1998G>A	c.(1996-1998)ccG>ccA	p.P666P	AKAP12_ENST00000402676.2_Silent_p.P666P|AKAP12_ENST00000359755.5_Silent_p.P561P|AKAP12_ENST00000354675.6_Silent_p.P568P			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	666					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AGCCAAAGCCGGAAGAACCAA	0.493																																					Melanoma(141;1616 1805 10049 24534 51979)	ENST00000253332.1	0.210000	2.000000e-02	0.150000	0.050000	0.090000	0.107006	0.090000	0.090000																										0				68						c.(1996-1998)ccG>ccA		A kinase (PRKA) anchor protein 12							84.0	80.0	81.0					6																	151671524		2203	4300	6503	SO:0001819	synonymous_variant	9590	4	121412	37				g.chr6:151671524G>A	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.1998G>A	chr6.hg19:g.151671524G>A		1					AKAP12_ENST00000402676.2_Silent_p.P666P|AKAP12_ENST00000359755.5_Silent_p.P561P|AKAP12_ENST00000354675.6_Silent_p.P568P	p.P666P			0	1	1	1.896966	Q02952	AKA12_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.175)	3	2187	+		Ovarian(120;0.125)	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	0	1	hg19	c.1998G>A	CCDS5229.1	0																																																																																								0.339864		TCGA-3A-A9IB-01A-21D-A397-08	0.493	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1	0	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	1.970000	-2.965700	1	0.380000			0	4	4	0	223	221	0		1	0		0	0	46	0	0	0.889062	4.490937e-01	0	0	0	73	0	4	223
NUP153	9972	broad.mit.edu	37	6	17669530	17669530	+	Silent	SNP	C	C	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr6:17669530C>T	ENST00000262077.2	-	7	1007	c.1008G>A	c.(1006-1008)ctG>ctA	p.L336L	NUP153_ENST00000537253.1_Silent_p.L336L	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	336					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TTACAGAATTCAGAGGAGAAG	0.328																																						ENST00000262077.2	1.000000	7.800000e-01	1.000000	0.870000	0.960000	0.946405	0.960000	1.000000																										0				53						c.(1006-1008)ctG>ctA		nucleoporin 153kDa							50.0	55.0	53.0					6																	17669530		2202	4297	6499	SO:0001819	synonymous_variant	9972	0	0					g.chr6:17669530C>T	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.1008G>A	chr6.hg19:g.17669530C>T		0					NUP153_ENST00000537253.1_Silent_p.L336L	p.L336L	NM_005124.2	NP_005115.2	0	0	0	1.948105	P49790	NU153_HUMAN	all cancers(50;0.0981)|Epithelial(50;0.112)	7	1007	-	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Silent	SNP	ENST00000262077.2	1	1	hg19	c.1008G>A	CCDS4541.1	1																																																																																								0.358045		TCGA-3A-A9IB-01A-21D-A397-08	0.328	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1	1	0	1	2	2	2	2	0	0	0	0	74	0	74	73	1	1.970000	-3.393051	1	0.380000			0	85	84	0	361	354	1		1	1		0	0	74	0	0	1.000000	9.274229e-01	0	3	0	18	0	85	361
TAP1	6890	broad.mit.edu	37	6	32818230	32818230	+	Missense_Mutation	SNP	G	G	A	rs147332077		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr6:32818230G>A	ENST00000354258.4	-	5	1456	c.1295C>T	c.(1294-1296)tCg>tTg	p.S432L	PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_Missense_Mutation_p.S171L	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	432	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	AGGCATGGCCGACAGAGCCTC	0.532													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20882	0.0		0.0	False		,,,				2504	0.0					ENST00000354258.4	0.230000	3.000000e-02	0.170000	0.060000	0.100000	0.118308	0.100000	0.100000																										0				21						c.(1294-1296)tCg>tTg		transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	Lapatinib(DB01259)	G	LEU/SER	6,4400	9.9+/-24.2	0,6,2197	80.0	84.0	82.0		1295	5.7	1.0	6	dbSNP_134	82	0,8600		0,0,4300	yes	missense	TAP1	NM_000593.5	145	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	possibly-damaging	432/809	32818230	6,13000	2203	4300	6503	SO:0001583	missense	6890	14	121412	42				g.chr6:32818230G>A		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.1295C>T	chr6.hg19:g.32818230G>A	ENSP00000346206:p.Ser432Leu	0					PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_Missense_Mutation_p.S171L	p.S432L	NM_000593.5	NP_000584.2	0	0	0	1.948105	Q03518	TAP1_HUMAN		5	1456	-			Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	0	1	hg19	c.1295C>T	CCDS4758.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	35	5.420836	0.96111	0.001362	0.0	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.91068	-2.78;-2.78	5.72	5.72	0.89469	5.72	5.72	0.89469	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.38436	N	0.001686	D	0.92734	0.7690	M	0.79805	2.47	0.80722	D	1	P	0.52842	0.956	P	0.52189	0.692	D	0.93356	0.6722	10	0.72032	D	0.01	-5.2332	17.381	0.87405	0.0:0.0:1.0:0.0	.	432	Q03518	TAP1_HUMAN	L	432;171	ENSP00000346206:S432L;ENSP00000401919:S171L	ENSP00000346206:S432L	S	-	2	0	0	TAP1	32926208	32926208	1.000000	0.71417	0.994000	0.49952	0.935000	0.57460	5.503000	0.66962	2.706000	0.92434	0.643000	0.83706	TCG	0.358045		TCGA-3A-A9IB-01A-21D-A397-08	0.532	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	0	0	1	2	2	2	2	0	0	0	0	39	0	39	38	1	1.970000	-3.333864	1	0.380000	NM_000593		0	4	4	0	207	207	0		1	0		0	0	39	0	0	0.891188	9.810162e-01	0	0	0	412	0	4	207
DDX43	55510	broad.mit.edu	37	6	74115486	74115486	+	Silent	SNP	C	C	T	rs369730596		TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr6:74115486C>T	ENST00000370336.4	+	6	893	c.735C>T	c.(733-735)gaC>gaT	p.D245D	DDX43_ENST00000539829.1_3'UTR	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	245					ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CATTTGATGACGCCTTTCAAT	0.353																																						ENST00000370336.4	1.000000	7.200000e-01	1.000000	0.840000	0.970000	0.937276	0.970000	1.000000																										0				24						c.(733-735)gaC>gaT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 43		C		0,4406		0,0,2203	93.0	86.0	88.0		735	1.4	1.0	6		88	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DDX43	NM_018665.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		245/649	74115486	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55510	1	121412	35				g.chr6:74115486C>T		CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.735C>T	chr6.hg19:g.74115486C>T		0					DDX43_ENST00000539829.1_3'UTR	p.D245D	NM_018665.2	NP_061135.2	0	0	0	1.948105	Q9NXZ2	DDX43_HUMAN		6	893	+			B4E0C8|Q6NXR1	Silent	SNP	ENST00000370336.4	1	1	hg19	c.735C>T	CCDS4977.1	1																																																																																								0.358045		TCGA-3A-A9IB-01A-21D-A397-08	0.353	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	1	0	1	2	2	2	2	0	0	0	0	34	0	34	34	1	1.970000	-20.000000	1	0.380000	NM_018665		0	43	43	0	181	179	0		1			0	0	34	0	0	1.000000	0	0	0	0	0	0	43	181
TTK	7272	broad.mit.edu	37	6	80720617	80720617	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr6:80720617A>T	ENST00000369798.2	+	5	667	c.556A>T	c.(556-558)Aat>Tat	p.N186Y	TTK_ENST00000509894.1_Missense_Mutation_p.N186Y|TTK_ENST00000230510.3_Missense_Mutation_p.N186Y	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	186					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TGCCCTGCGGAATTTAAACCT	0.363																																						ENST00000369798.2	0.780000	4.800000e-01	0.700000	0.550000	0.620000	0.631765	0.620000	0.620000																										0				53						c.(556-558)Aat>Tat		TTK protein kinase							60.0	69.0	66.0					6																	80720617		2203	4300	6503	SO:0001583	missense	7272	0	0					g.chr6:80720617A>T		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.556A>T	chr6.hg19:g.80720617A>T	ENSP00000358813:p.Asn186Tyr	0					TTK_ENST00000509894.1_Missense_Mutation_p.N186Y|TTK_ENST00000230510.3_Missense_Mutation_p.N186Y	p.N186Y	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	0	0	0	1.948105	P33981	TTK_HUMAN		5	667	+		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	1	1	hg19	c.556A>T	CCDS4993.1	0	.	.	.	.	.	.	.	.	.	.	A	23.4	4.415177	0.83449	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	D;D;D	0.89123	-2.47;-2.47;-2.47	4.95	4.95	0.65309	4.95	4.95	0.65309	.	0.090404	0.85682	D	0.000000	D	0.92061	0.7484	M	0.68952	2.095	0.50171	D	0.999852	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.987	D	0.93268	0.6649	10	0.87932	D	0	.	14.0796	0.64912	1.0:0.0:0.0:0.0	.	186;186	P33981;A8K8U5	TTK_HUMAN;.	Y	186	ENSP00000422936:N186Y;ENSP00000230510:N186Y;ENSP00000358813:N186Y	ENSP00000230510:N186Y	N	+	1	0	0	TTK	80777336	80777336	1.000000	0.71417	0.899000	0.35326	0.986000	0.74619	8.060000	0.89464	1.982000	0.57802	0.459000	0.35465	AAT	0.358045		TCGA-3A-A9IB-01A-21D-A397-08	0.363	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2	1	0	1	2	2	2	2	0	0	0	0	90	0	90	90	1	1.970000	-20.000000	1	0.380000			0	60	60	0	427	425	1		1	1		0	0	90	0	0	1.000000	3.118787e-01	0	3	0	6	0	60	427
FNDC1	84624	broad.mit.edu	37	6	159646578	159646578	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			T	C	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr6:159646578T>C	ENST00000297267.9	+	8	1096	c.896T>C	c.(895-897)gTg>gCg	p.V299A	FNDC1_ENST00000480856.1_3'UTR|FNDC1_ENST00000340366.6_Missense_Mutation_p.V299A	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	299	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CAGTACACCGTGCGCTATCGA	0.463																																						ENST00000297267.9	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.994605	0.990000	1.000000																										0				93						c.(895-897)gTg>gCg		fibronectin type III domain containing 1							238.0	236.0	237.0					6																	159646578		1976	4164	6140	SO:0001583	missense	84624	0	0					g.chr6:159646578T>C	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.896T>C	chr6.hg19:g.159646578T>C	ENSP00000297267:p.Val299Ala	1					FNDC1_ENST00000480856.1_3'UTR|FNDC1_ENST00000340366.6_Missense_Mutation_p.V299A	p.V299A	NM_032532.2	NP_115921.2	0	1	1	1.896966	Q4ZHG4	FNDC1_HUMAN		8	1096	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	1	1	hg19	c.896T>C	CCDS47512.1	1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.101834	0.76983	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.68624	-0.34;-0.34	5.84	5.84	0.93424	5.84	5.84	0.93424	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81083	0.4749	M	0.86028	2.79	0.53688	D	0.999972	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.84681	0.0717	10	0.87932	D	0	-20.4318	16.2108	0.82158	0.0:0.0:0.0:1.0	.	299;299	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	A	299	ENSP00000297267:V299A;ENSP00000342460:V299A	ENSP00000297267:V299A	V	+	2	0	0	FNDC1	159566566	159566566	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.603000	0.82811	2.232000	0.73038	0.533000	0.62120	GTG	0.339864		TCGA-3A-A9IB-01A-21D-A397-08	0.463	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	1	0	1	2	2	2	2	0	0	0	0	148	0	148	148	1	1.970000	-20.000000	1	0.380000	NM_032532		0	139	138	0	493	490	1		1	0		0	0	148	0	0	1.000000	1	0	0	0	109	0	139	493
DLD	1738	broad.mit.edu	37	7	107546792	107546792	+	Silent	SNP	A	A	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr7:107546792A>C	ENST00000205402.5	+	8	944	c.663A>C	c.(661-663)gcA>gcC	p.A221A	DLD_ENST00000537148.1_Silent_p.A122A|DLD_ENST00000440410.1_Silent_p.A198A|DLD_ENST00000437604.2_Silent_p.A173A	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	221					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	TTATTGGTGCAGGAGTAATAG	0.348																																						ENST00000205402.5	1.000000	1.800000e-01	0.500000	0.260000	0.360000	0.405996	0.360000	0.330000																										0				20						c.(661-663)gcA>gcC		dihydrolipoamide dehydrogenase	Flavin adenine dinucleotide(DB03147)						146.0	157.0	153.0					7																	107546792		2203	4300	6503	SO:0001819	synonymous_variant	1738	0	0					g.chr7:107546792A>C	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.663A>C	chr7.hg19:g.107546792A>C		0					DLD_ENST00000537148.1_Silent_p.A122A|DLD_ENST00000440410.1_Silent_p.A198A|DLD_ENST00000437604.2_Silent_p.A173A	p.A221A	NM_000108.3	NP_000099.2	1	2	3	2.067162	P09622	DLDH_HUMAN		8	944	+			B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Silent	SNP	ENST00000205402.5	1	1	hg19	c.663A>C	CCDS5749.1	0																																																																																								0.389283		TCGA-3A-A9IB-01A-21D-A397-08	0.348	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	1	0	1	2	2	2	2	0	0	0	0	36	0	36	35	1	1.970000	-5.165075	1	0.380000	NM_000108		0	11	11	0	161	159	1		1	1		0	0	36	0	0	0.998403	9.928027e-01	0	18	0	109	0	11	161
ZNF789	285989	broad.mit.edu	37	7	99084376	99084376	+	Silent	SNP	C	C	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr7:99084376C>G	ENST00000331410.5	+	5	813	c.543C>G	c.(541-543)ccC>ccG	p.P181P	ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000448667.1_3'UTR	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					ATGGCAAACCCTTCAATCAAA	0.428																																						ENST00000331410.5	1.000000	6.000000e-02	0.180000	0.090000	0.130000	0.176878	0.130000	0.120000																										0				11						c.(541-543)ccC>ccG		zinc finger protein 789							108.0	102.0	104.0					7																	99084376		2203	4300	6503	SO:0001819	synonymous_variant	285989	0	0					g.chr7:99084376C>G	AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.543C>G	chr7.hg19:g.99084376C>G		0					ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000448667.1_3'UTR	p.P181P	NM_213603.2	NP_998768.2	1	2	3	2.053263	Q5FWF6	ZN789_HUMAN		5	813	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		A4D282|A6NH61|Q6ZMZ9	Silent	SNP	ENST00000331410.5	1	1	hg19	c.543C>G	CCDS34693.1	0																																																																																								0.386988		TCGA-3A-A9IB-01A-21D-A397-08	0.428	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336266.1	0	0	1	2	2	2	2	0	0	0	0	71	0	71	69	1	1.970000	-2.669539	1	0.380000	NM_213603		0	11	10	0	454	448	0		1	0		0	0	71	0	0	0.998228	3.867456e-02	0	0	0	12	0	11	454
FOXP2	93986	broad.mit.edu	37	7	114303542	114303542	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr7:114303542G>T	ENST00000393494.2	+	15	2086	c.1807G>T	c.(1807-1809)Ggc>Tgc	p.G603C	FOXP2_ENST00000408937.3_Missense_Mutation_p.G628C|FOXP2_ENST00000393498.2_Missense_Mutation_p.G582C|FOXP2_ENST00000393491.3_Missense_Mutation_p.G418C|FOXP2_ENST00000350908.4_Missense_Mutation_p.G603C|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000403559.4_Missense_Mutation_p.G620C|FOXP2_ENST00000393489.3_Missense_Mutation_p.G511C			O15409	FOXP2_HUMAN	forkhead box P2	603					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TACCAGTTTAGGCTATGGAGC	0.303																																						ENST00000393494.2	1.000000	2.000000e-02	0.140000	0.050000	0.080000	0.150415	0.080000	0.080000																										0				52						c.(1807-1809)Ggc>Tgc		forkhead box P2							98.0	98.0	98.0					7																	114303542		2203	4300	6503	SO:0001583	missense	93986	0	0					g.chr7:114303542G>T	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1807G>T	chr7.hg19:g.114303542G>T	ENSP00000377132:p.Gly603Cys	0					FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000393498.2_Missense_Mutation_p.G582C|FOXP2_ENST00000350908.4_Missense_Mutation_p.G603C|FOXP2_ENST00000393491.3_Missense_Mutation_p.G418C|FOXP2_ENST00000403559.4_Missense_Mutation_p.G620C|FOXP2_ENST00000408937.3_Missense_Mutation_p.G628C|FOXP2_ENST00000393489.3_Missense_Mutation_p.G511C	p.G603C			1	2	3	2.067162	O15409	FOXP2_HUMAN		15	2086	+			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	0	1	hg19	c.1807G>T	CCDS5760.1	0	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853517	0.51270	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	D;D;D;D;D;D	0.92099	-2.71;-2.7;-2.71;-2.71;-2.79;-2.97	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.95001	0.8382	L	0.50333	1.59	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.87578	0.996;0.996;0.959;0.996;0.998	D	0.95345	0.8441	10	0.72032	D	0.01	.	19.0298	0.92952	0.0:0.0:1.0:0.0	.	602;620;418;603;628	B7ZLK5;B4DLD9;Q0PRL4;O15409;O15409-4	.;.;.;FOXP2_HUMAN;.	C	603;628;620;603;580;511;418	ENSP00000377132:G603C;ENSP00000386200:G628C;ENSP00000385069:G620C;ENSP00000265436:G603C;ENSP00000377129:G511C;ENSP00000377130:G418C	ENSP00000265436:G603C	G	+	1	0	0	FOXP2	114090778	114090778	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.624000	0.98398	2.486000	0.83907	0.650000	0.86243	GGC	0.389283		TCGA-3A-A9IB-01A-21D-A397-08	0.303	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	0	0	1	2	2	2	2	0	0	0	0	57	0	57	55	1	1.970000	-2.629297	1	0.380000	NM_014491		0	6	6	0	397	395	0		1	0		0	0	57	0	0	0.964709	0	0	0	0	1	0	6	397
BHLHE22	27319	broad.mit.edu	37	8	65493724	65493724	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr8:65493724G>C	ENST00000321870.1	+	1	911	c.377G>C	c.(376-378)tGc>tCc	p.C126S	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	126	Gly-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						GCCGCCCTTTGCCTCAAGTAC	0.746																																					Colon(113;104 1586 2865 9855 18065)	ENST00000321870.1	1.000000	1.400000e-01	0.750000	0.270000	0.470000	0.513552	0.470000	1.000000																										0				5						c.(376-378)tGc>tCc		basic helix-loop-helix family, member e22							4.0	5.0	5.0					8																	65493724		1552	3322	4874	SO:0001583	missense	27319	0	0					g.chr8:65493724G>C	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.377G>C	chr8.hg19:g.65493724G>C	ENSP00000318799:p.Cys126Ser	1					RP11-21C4.1_ENST00000517909.1_RNA	p.C126S	NM_152414.4	NP_689627.1	0	3	3	2.422574	Q8NFJ8	BHE22_HUMAN		1	911	+				Missense_Mutation	SNP	ENST00000321870.1	0	1	hg19	c.377G>C	CCDS6179.1	0	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029659	0.54790	.	.	ENSG00000180828	ENST00000321870	D	0.98747	-5.11	3.19	3.19	0.36642	3.19	3.19	0.36642	.	0.153691	0.43747	U	0.000527	D	0.98065	0.9362	L	0.29908	0.895	0.50039	D	0.999844	D	0.71674	0.998	D	0.73708	0.981	D	0.98433	1.0583	10	0.59425	D	0.04	.	14.4812	0.67585	0.0:0.0:1.0:0.0	.	126	Q8NFJ8	BHE22_HUMAN	S	126	ENSP00000318799:C126S	ENSP00000318799:C126S	C	+	2	0	0	BHLHE22	65656278	65656278	1.000000	0.71417	0.998000	0.56505	0.712000	0.41017	5.668000	0.68074	1.787000	0.52448	0.455000	0.32223	TGC	0.478992		TCGA-3A-A9IB-01A-21D-A397-08	0.746	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	0	0	1	2	2	2	2	0	0	0	0	10	0	10	10	1	1.970000	-7.854897	1	0.380000	NM_152414		0	3	3	0	42	42	0		1	0		0	0	10	0	0	0.812618	0	0	0	0	1	0	3	42
GRHL2	79977	broad.mit.edu	37	8	102585988	102585988	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr8:102585988A>G	ENST00000251808.3	+	6	1165	c.827A>G	c.(826-828)tAt>tGt	p.Y276C	GRHL2_ENST00000395927.1_Missense_Mutation_p.Y260C	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	276					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			GGACAGTTCTATGCCATAACA	0.507																																						ENST00000251808.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				28						c.(826-828)tAt>tGt		grainyhead-like 2 (Drosophila)							93.0	76.0	82.0					8																	102585988		2203	4300	6503	SO:0001583	missense	79977	0	0					g.chr8:102585988A>G	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.827A>G	chr8.hg19:g.102585988A>G	ENSP00000251808:p.Tyr276Cys	1					GRHL2_ENST00000395927.1_Missense_Mutation_p.Y260C	p.Y276C	NM_024915.3	NP_079191.2	0	3	3	2.429079	Q6ISB3	GRHL2_HUMAN	Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)	6	1165	+	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	ENST00000251808.3	1	1	hg19	c.827A>G	CCDS34931.1	1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.501570	0.85176	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.38401	1.14;1.14	5.7	5.7	0.88788	5.7	5.7	0.88788	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.69441	0.3111	M	0.92412	3.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78107	-0.2333	10	0.87932	D	0	-14.6055	15.9541	0.79871	1.0:0.0:0.0:0.0	.	276;276	B4DL28;Q6ISB3	.;GRHL2_HUMAN	C	276;260;276	ENSP00000251808:Y276C;ENSP00000379260:Y260C	ENSP00000251808:Y276C	Y	+	2	0	0	GRHL2	102655164	102655164	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.307000	0.96226	2.167000	0.68274	0.528000	0.53228	TAT	0.478992		TCGA-3A-A9IB-01A-21D-A397-08	0.507	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1	1	0	1	2	2	2	2	0	0	0	0	45	0	45	43	1	1.970000	-20.000000	1	0.380000	NM_024915		0	133	132	0	148	145	1		1	1		0	0	45	0	0	1.000000	1	0	42	0	2	0	133	148
DOCK8	81704	broad.mit.edu	37	9	376273	376273	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chr9:376273G>C	ENST00000453981.1	+	19	2285	c.2173G>C	c.(2173-2175)Gaa>Caa	p.E725Q	DOCK8_ENST00000432829.2_Missense_Mutation_p.E657Q|DOCK8_ENST00000382331.1_Missense_Mutation_p.E27Q|DOCK8_ENST00000469391.1_Missense_Mutation_p.E657Q|DOCK8_ENST00000382329.1_Missense_Mutation_p.E192Q			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	725	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ATTTAATATTGAAGTGCAAGC	0.408																																						ENST00000453981.1	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.062334	0.050000	0.050000																										0				65						c.(2173-2175)Gaa>Caa		dedicator of cytokinesis 8							140.0	136.0	137.0					9																	376273		2203	4300	6503	SO:0001583	missense	81704	0	0					g.chr9:376273G>C	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2173G>C	chr9.hg19:g.376273G>C	ENSP00000408464:p.Glu725Gln	1					DOCK8_ENST00000432829.2_Missense_Mutation_p.E657Q|DOCK8_ENST00000382331.1_Missense_Mutation_p.E27Q|DOCK8_ENST00000382329.1_Missense_Mutation_p.E192Q|DOCK8_ENST00000469391.1_Missense_Mutation_p.E657Q	p.E725Q			0	1	1	1.677924	Q8NF50	DOCK8_HUMAN		19	2285	+		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	0	1	hg19	c.2173G>C	CCDS6440.2	0	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176915	0.78564	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.65069	0.2656	L	0.56769	1.78	0.80722	D	1	D;B;P;B	0.76494	0.999;0.255;0.534;0.361	D;B;B;B	0.66847	0.947;0.314;0.369;0.393	T	0.58059	-0.7703	10	0.27785	T	0.31	.	19.8078	0.96537	0.0:0.0:1.0:0.0	.	27;657;192;725	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	Q	725;725;657;657;27;192	ENSP00000408464:E725Q;ENSP00000394888:E657Q;ENSP00000419438:E657Q;ENSP00000371768:E27Q;ENSP00000371766:E192Q	ENSP00000287364:E725Q	E	+	1	0	0	DOCK8	366273	366273	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.675000	0.98638	2.661000	0.90470	0.650000	0.86243	GAA	0.243441		TCGA-3A-A9IB-01A-21D-A397-08	0.408	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	0	0	1	2	2	2	2	0	0	0	0	65	0	65	64	1	1.970000	-2.624229	1	0.380000	XM_036307		0	5	5	0	405	400	0		1	0		0	0	65	0	0	0.935876	4.837524e-03	0	0	0	7	0	5	405
RPS6KA6	27330	broad.mit.edu	37	X	83319323	83319323	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3A-A9IB-01A-21D-A397-08	TCGA-3A-A9IB-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8d01d1e0-82fd-4a98-a3ba-da1df31dafc6	45996250-51de-4620-9821-7944ed970774	g.chrX:83319323G>A	ENST00000262752.2	-	22	2207	c.2200C>T	c.(2200-2202)Cga>Tga	p.R734*	RPS6KA6_ENST00000543399.1_Nonsense_Mutation_p.R734*	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	734					axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						ATGCTCCGTCGCTGGGCTAAG	0.458																																						ENST00000262752.2	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.995502	0.990000	1.000000																										0				46						c.(2200-2202)Cga>Tga		ribosomal protein S6 kinase, 90kDa, polypeptide 6							97.0	78.0	84.0					X																	83319323		2203	4300	6503	SO:0001587	stop_gained	27330	0	0					g.chrX:83319323G>A	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.2200C>T	chrX.hg19:g.83319323G>A	ENSP00000262752:p.Arg734*						RPS6KA6_ENST00000543399.1_Nonsense_Mutation_p.R734*	p.R734*	NM_014496.4	NP_055311.1	0	1	1		Q9UK32	KS6A6_HUMAN		22	2207	-			B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Nonsense_Mutation	SNP	ENST00000262752.2	0	1	hg19	c.2200C>T	CCDS14451.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.373426	0.95923	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	.	.	.	5.11	2.15	0.27550	5.11	2.15	0.27550	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2327	0.59953	0.0:0.0:0.5813:0.4187	.	.	.	.	X	734	.	ENSP00000262752:R734X	R	-	1	2	2	RPS6KA6	83205979	83205979	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	3.126000	0.50477	0.011000	0.14865	0.600000	0.82982	CGA	0.380000		TCGA-3A-A9IB-01A-21D-A397-08	0.458	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	1	0	1	2	2	2	2	0	0	0	0	26	0	26	25	1	1.970000	-19.999960	1	0.380000	NM_014496		0	33	33	0	103	103	1		1	0		0	0	26	0	0	1.000000	0	0	0	0	1	0	33	103
