#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SFXN3	81855	broad.mit.edu	37	10	102795364	102795364	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr10:102795364G>A	ENST00000224807.5	+	4	740	c.284G>A	c.(283-285)cGc>cAc	p.R95H	SFXN3_ENST00000393459.1_Missense_Mutation_p.R91H	NM_030971.3	NP_112233.2	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	95					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	cation transmembrane transporter activity (GO:0008324)	p.R95H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CTGATTGGCCGCATGTCAGCC	0.587																																						ENST00000224807.5	1.000000	2.000000e-02	1.600000e-01	5.000000e-02	0.090000	0.133924	0.090000	0.090000																										1	Substitution - Missense(1)	p.R95H(1)	lung(1)	9						c.(283-285)cGc>cAc		sideroflexin 3							122.0	92.0	102.0					10																	102795364		2203	4300	6503	SO:0001583	missense	81855	2	121412	30				g.chr10:102795364G>A	AK074707	CCDS7508.2	10q24.32	2008-09-04			ENSG00000107819	ENSG00000107819		"""Sideroflexins"""	16087	protein-coding gene	gene with protein product		615571					Standard	NM_030971		Approved	SFX3	uc001ksp.3	Q9BWM7	OTTHUMG00000018921	ENST00000224807.5:c.284G>A	chr10.hg19:g.102795364G>A	ENSP00000224807:p.Arg95His	0					SFXN3_ENST00000393459.1_Missense_Mutation_p.R91H	p.R95H	NM_030971.3	NP_112233.2	1	2	3	2.133133	Q9BWM7	SFXN3_HUMAN		4	740	+		Colorectal(252;0.234)	Q8NCJ0|Q9NTP4	Missense_Mutation	SNP	ENST00000224807.5	0	1	hg19	c.284G>A	CCDS7508.2	0	.	.	.	.	.	.	.	.	.	.	G	31	5.093229	0.94149	.	.	ENSG00000107819	ENST00000393459;ENST00000224807	T;T	0.57595	0.39;0.39	5.11	4.19	0.49359	5.11	4.19	0.49359	.	0.103262	0.64402	D	0.000005	T	0.80237	0.4586	H	0.96080	3.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.995	D	0.86037	0.1517	10	0.87932	D	0	-15.974	14.1571	0.65424	0.0737:0.0:0.9262:0.0	.	95;95;95	B4DRS6;A6NCZ6;Q9BWM7	.;.;SFXN3_HUMAN	H	91;95	ENSP00000377103:R91H;ENSP00000224807:R95H	ENSP00000224807:R95H	R	+	2	0	0	SFXN3	102785354	102785354	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.802000	0.85969	2.652000	0.90054	0.561000	0.74099	CGC	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.587	SFXN3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	45	0	45	45	1	1.830000	-2.814175	1	0.510000	NM_030971		0	4	4	0	176	173	0		1	0		0	0	45	0	0	0.887304	9.298228e-01	0	0	0	217	0	4	176
LRRC27	80313	broad.mit.edu	37	10	134155718	134155718	+	Splice_Site	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr10:134155718C>T	ENST00000368614.3	+	4	448	c.343C>T	c.(343-345)Cat>Tat	p.H115Y	LRRC27_ENST00000392638.2_Splice_Site_p.H115Y|LRRC27_ENST00000368615.3_Splice_Site_p.H115Y|LRRC27_ENST00000356571.4_Intron|LRRC27_ENST00000344079.5_Splice_Site_p.H115Y|LRRC27_ENST00000368610.3_Splice_Site_p.H53Y|LRRC27_ENST00000368612.1_Splice_Site_p.H53Y|LRRC27_ENST00000432555.2_5'UTR|LRRC27_ENST00000368613.4_Splice_Site_p.H115Y	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	115										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GCTTTAAAGGCATTTGAAAAC	0.264																																						ENST00000368614.3	1.000000	6.600000e-01	1	8.100000e-01	0.980000	0.927726	0.980000	1.000000																										0				18						c.(343-345)Cat>Tat		leucine rich repeat containing 27							23.0	23.0	23.0					10																	134155718		2171	4266	6437	SO:0001630	splice_region_variant	80313	0	0					g.chr10:134155718C>T	AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.342-1C>T	chr10.hg19:g.134155718C>T		0					LRRC27_ENST00000368610.3_Splice_Site_p.H53Y|LRRC27_ENST00000356571.4_Intron|LRRC27_ENST00000432555.2_5'UTR|LRRC27_ENST00000368615.3_Splice_Site_p.H115Y|LRRC27_ENST00000368612.1_Splice_Site_p.H53Y|LRRC27_ENST00000344079.5_Splice_Site_p.H115Y|LRRC27_ENST00000392638.2_Splice_Site_p.H115Y|LRRC27_ENST00000368613.4_Splice_Site_p.H115Y	p.H115Y	NM_030626.2	NP_085129.1	1	2	3	2.109540	Q9C0I9	LRC27_HUMAN		4	448	+		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)	A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Splice_Site	SNP	ENST00000368614.3	0	0	hg19	c.343C>T	CCDS31316.1	1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848731	0.32699	.	.	ENSG00000148814	ENST00000368615;ENST00000392638;ENST00000344079;ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610	T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33	4.76	2.75	0.32379	4.76	2.75	0.32379	.	0.153086	0.30999	N	0.008452	T	0.41050	0.1142	L	0.39326	1.205	0.80722	D	1	B;B;B;B	0.32350	0.113;0.166;0.263;0.366	B;B;B;B	0.27796	0.031;0.063;0.052;0.083	T	0.32025	-0.9922	10	0.44086	T	0.13	-13.2043	5.8781	0.18840	0.0:0.7451:0.0:0.2549	.	115;53;115;115	Q9C0I9-4;Q9C0I9-2;Q9C0I9;Q9C0I9-3	.;.;LRC27_HUMAN;.	Y	115;115;115;115;115;53;53	ENSP00000357604:H115Y;ENSP00000376413:H115Y;ENSP00000342641:H115Y;ENSP00000357603:H115Y;ENSP00000357602:H115Y;ENSP00000357601:H53Y;ENSP00000357599:H53Y	ENSP00000342641:H115Y	H	+	1	0	0	LRRC27	134005708	134005708	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	0.824000	0.27379	1.177000	0.42855	0.655000	0.94253	CAT	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.264	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	1	0	1	2	2	2	2	0	0	0	0	9	0	9	9	1	1.830000	-20.000000	1	0.510000	XM_290462	Missense_Mutation	0	22	22	0	66	65	1		1	0		0	0	9	0	0	1.000000	5.618123e-01	0	1	0	6	0	22	66
OR51T1	401665	broad.mit.edu	37	11	4903766	4903766	+	Missense_Mutation	SNP	G	G	A	rs139706082	byFrequency	TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr11:4903766G>A	ENST00000322049.1	+	1	637	c.637G>A	c.(637-639)Gta>Ata	p.V213I	MMP26_ENST00000380390.1_Intron|OR51T1_ENST00000380378.1_Missense_Mutation_p.V240I|MMP26_ENST00000477339.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCACTGACGTATTGTTTAT	0.438													G|||	16	0.00319489	0.0113	0.0	5008	,	,		22098	0.0		0.001	False		,,,				2504	0.0					ENST00000322049.1	1.000000	7.400000e-01	1	8.200000e-01	0.900000	0.907027	0.900000	1.000000																										0				34						c.(637-639)Gta>Ata		olfactory receptor, family 51, subfamily T, member 1		G	ILE/VAL	30,4372	36.8+/-68.6	0,30,2171	111.0	102.0	105.0		718	2.6	0.7	11	dbSNP_134	105	2,8594	2.2+/-6.3	0,2,4296	yes	missense	OR51T1	NM_001004759.1	29	0,32,6467	AA,AG,GG		0.0233,0.6815,0.2462	benign	240/355	4903766	32,12966	2201	4298	6499	SO:0001583	missense	401665	94	121408	53				g.chr11:4903766G>A	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.637G>A	chr11.hg19:g.4903766G>A	ENSP00000322679:p.Val213Ile	0					MMP26_ENST00000477339.1_Intron|OR51T1_ENST00000380378.1_Missense_Mutation_p.V240I|MMP26_ENST00000380390.1_Intron	p.V213I			1	2	3	2.127426	Q8NGJ9	O51T1_HUMAN		1	637	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	Q6IFH9	Missense_Mutation	SNP	ENST00000322049.1	1	0	hg19	c.637G>A		1	11	0.005036630036630037	11	0.022357723577235773	0	0.0	0	0.0	0	0.0	G	0.081	-1.183413	0.01620	0.006815	2.33E-4	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.37752	1.18;1.18	4.99	2.58	0.30949	4.99	2.58	0.30949	GPCR, rhodopsin-like superfamily (1);	0.230017	0.22233	N	0.062799	T	0.08846	0.0219	N	0.12831	0.26	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15378	-1.0439	10	0.27785	T	0.31	.	6.7962	0.23727	0.0:0.08:0.2905:0.6295	.	213	Q8NGJ9	O51T1_HUMAN	I	240;213	ENSP00000369738:V240I;ENSP00000322679:V213I	ENSP00000322679:V213I	V	+	1	0	0	OR51T1	4860342	4860342	0.000000	0.05858	0.685000	0.30070	0.043000	0.13939	-0.071000	0.11505	0.363000	0.24346	-0.749000	0.03505	GTA	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.438	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	1	0	1	2	2	2	2	0	0	0	0	50	0	50	49	1	1.830000	-2.749776	1	0.510000	NM_001004759		0	88	88	0	296	291	1		1			0	0	50	0	0	1.000000	0	0	0	0	0	0	88	296
OR52A4	390053	broad.mit.edu	37	11	5142557	5142557	+	RNA	SNP	C	C	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr11:5142557C>A	ENST00000498233.1	-	0	841							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		TATCAAGCATCTTGGGCACAA	0.438																																						ENST00000498233.1	1.000000	8.400000e-01	1	9.300000e-01	0.990000	0.977580	0.990000	1.000000																										0				22								olfactory receptor, family 52, subfamily A, member 4							57.0	55.0	55.0					11																	5142557		2201	4298	6499			390053	0	0					g.chr11:5142557C>A			11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		chr11.hg19:g.5142557C>A		0									1	2	3	2.127426	A6NMU1	O52A4_HUMAN		0	841	-		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		RNA	SNP	ENST00000498233.1	1	1	hg19			1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.154681	0.38021	.	.	ENSG00000248953	ENST00000380369	.	.	.	4.18	1.36	0.22044	4.18	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.32133	0.0819	.	.	.	0.23056	N	0.998369	B	0.34290	0.447	B	0.38921	0.285	T	0.38714	-0.9648	6	0.51188	T	0.08	.	3.4013	0.07324	0.0:0.378:0.2029:0.4191	.	84	A6NMU1	O52A4_HUMAN	N	84	.	ENSP00000369727:K84N	K	-	3	2	2	OR52A4	5099133	5099133	0.000000	0.05858	0.999000	0.59377	0.987000	0.75469	-3.743000	0.00378	0.647000	0.30713	0.650000	0.86243	AAG	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.438	OR52A4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000268565.1	0	0	1	2	2	2	2	0	0	0	0	27	0	27	27	1	1.830000	-20.000000	1	0.510000	NG_029079		0	70	69	0	196	196	0		1			0	0	27	0	0	1.000000	0	0	0	0	0	0	70	196
ABCC8	6833	broad.mit.edu	37	11	17415843	17415843	+	Silent	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr11:17415843G>A	ENST00000389817.3	-	37	4583	c.4515C>T	c.(4513-4515)gaC>gaT	p.D1505D	ABCC8_ENST00000302539.4_Silent_p.D1506D			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1505	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CCGTGGCCTCGTCCATGATGA	0.577																																						ENST00000389817.3	1.000000	5.900000e-01	8.000000e-01	6.500000e-01	0.720000	0.734824	0.720000	0.720000																										0				67						c.(4513-4515)gaC>gaT		ATP-binding cassette, sub-family C (CFTR/MRP), member 8	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)						74.0	72.0	73.0					11																	17415843		2200	4293	6493	SO:0001819	synonymous_variant	6833	5	121412	41				g.chr11:17415843G>A	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4515C>T	chr11.hg19:g.17415843G>A		0					ABCC8_ENST00000302539.4_Silent_p.D1506D	p.D1505D			1	2	3	2.127426	Q09428	ABCC8_HUMAN		37	4583	-			A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	ENST00000389817.3	1	1	hg19	c.4515C>T	CCDS31437.1	0																																																																																								0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.577	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	1	0	1	2	2	2	2	0	0	0	0	127	0	127	127	1	1.830000	-20.000000	1	0.510000	NM_000352		0	99	99	0	443	441	1		1	0		0	0	127	0	0	1.000000	1	0	0	0	147	0	99	443
XRRA1	143570	broad.mit.edu	37	11	74559225	74559225	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr11:74559225G>A	ENST00000340360.6	-	15	1970	c.1639C>T	c.(1639-1641)Cgc>Tgc	p.R547C	XRRA1_ENST00000527087.1_Missense_Mutation_p.R460C|RN7SL239P_ENST00000490061.2_RNA|XRRA1_ENST00000321448.8_Missense_Mutation_p.R272C	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						GGGCTGAGGCGGACAGTTGTG	0.592																																						ENST00000340360.6	1.000000	7.500000e-01	1	8.600000e-01	0.990000	0.950526	0.990000	1.000000																										0				20						c.(1639-1641)Cgc>Tgc		X-ray radiation resistance associated 1							76.0	80.0	79.0					11																	74559225		2152	4243	6395	SO:0001583	missense	143570	4	121190	37				g.chr11:74559225G>A	AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.1639C>T	chr11.hg19:g.74559225G>A	ENSP00000339918:p.Arg547Cys	0					RN7SL239P_ENST00000490061.2_RNA|XRRA1_ENST00000527087.1_Missense_Mutation_p.R460C|XRRA1_ENST00000321448.8_Missense_Mutation_p.R272C	p.R547C	NM_182969.2	NP_892014.1	1	2	3	2.127426				15	1970	-				Missense_Mutation	SNP	ENST00000340360.6	1	1	hg19	c.1639C>T	CCDS44680.1	1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575885	0.65878	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	T;T;T	0.52526	0.66;1.41;0.67	4.29	4.29	0.51040	4.29	4.29	0.51040	.	1.095810	0.06941	N	0.812752	T	0.58779	0.2146	L	0.51422	1.61	0.09310	N	0.999993	D;D;D;D;D;D;D	0.71674	0.968;0.998;0.995;0.987;0.995;0.994;0.995	B;P;P;P;P;P;P	0.56700	0.232;0.804;0.629;0.534;0.528;0.502;0.528	T	0.49184	-0.8966	10	0.42905	T	0.14	0.0617	12.5443	0.56190	0.0:0.0:1.0:0.0	.	547;149;103;460;491;157;533	Q6P2D8;B3KRF2;E9PP69;Q6P2D8-2;Q6P2D8-4;Q8TEH2;Q6P2D8-3	XRRA1_HUMAN;.;.;.;.;.;.	C	547;272;533;491;460	ENSP00000339918:R547C;ENSP00000319303:R272C;ENSP00000435838:R460C	ENSP00000319303:R272C	R	-	1	0	0	XRRA1	74236873	74236873	0.009000	0.17119	0.162000	0.22713	0.094000	0.18550	1.762000	0.38451	2.678000	0.91216	0.591000	0.81541	CGC	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.592	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384715.1	1	0	1	2	2	2	2	0	0	0	0	26	0	26	26	1	1.830000	-4.671137	1	0.510000	NM_182969		0	43	43	0	128	126	1		1	1		0	0	26	0	0	1.000000	9.886444e-01	0	12	0	12	0	43	128
FAT3	120114	broad.mit.edu	37	11	92538476	92538476	+	Silent	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr11:92538476C>T	ENST00000298047.6	+	10	9071	c.9054C>T	c.(9052-9054)agC>agT	p.S3018S	FAT3_ENST00000525166.1_Silent_p.S2868S|FAT3_ENST00000409404.2_Silent_p.S3018S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3018	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGGAAGTGAGCGTCAGTGATG	0.438										TCGA Ovarian(4;0.039)																												ENST00000298047.6	1.000000	1.900000e-01	5.000000e-01	2.700000e-01	0.370000	0.400173	0.370000	0.350000																										0				85						c.(9052-9054)agC>agT		FAT atypical cadherin 3							69.0	69.0	69.0					11																	92538476		1959	4168	6127	SO:0001819	synonymous_variant	120114	1	120870	31				g.chr11:92538476C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9054C>T	chr11.hg19:g.92538476C>T		0	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Silent_p.S2868S|FAT3_ENST00000409404.2_Silent_p.S3018S	p.S3018S			1	2	3	2.127426	Q8TDW7	FAT3_HUMAN		10	9071	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	0	1	hg19	c.9054C>T		0																																																																																								0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.438	FAT3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	21	0	21	21	1	1.830000	-5.763831	1	0.510000	NM_001008781		0	10	10	0	101	99	0		1			0	0	21	0	0	0.997053	0	0	0	0	0	0	10	101
ABCC9	10060	broad.mit.edu	37	12	22063212	22063212	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr12:22063212G>A	ENST00000261201.4	-	8	1198	c.1199C>T	c.(1198-1200)aCg>aTg	p.T400M	ABCC9_ENST00000345162.2_Missense_Mutation_p.T400M|ABCC9_ENST00000261200.4_Missense_Mutation_p.T400M	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	400	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TAAGTTAGACGTAGAGAGCCT	0.348																																						ENST00000261201.4	1.000000	7.800000e-01	1	8.500000e-01	0.930000	0.928792	0.930000	1.000000																										0				118						c.(1198-1200)aCg>aTg		ATP-binding cassette, sub-family C (CFTR/MRP), member 9	Adenosine triphosphate(DB00171)|Glyburide(DB01016)						101.0	101.0	101.0					12																	22063212		2203	4300	6503	SO:0001583	missense	10060	0	0					g.chr12:22063212G>A	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.1199C>T	chr12.hg19:g.22063212G>A	ENSP00000261201:p.Thr400Met	1					ABCC9_ENST00000345162.2_Missense_Mutation_p.T400M|ABCC9_ENST00000261200.4_Missense_Mutation_p.T400M	p.T400M	NM_005691.2	NP_005682.2	0	1	1	1.838630	O60706	ABCC9_HUMAN		8	1198	-			O60707	Missense_Mutation	SNP	ENST00000261201.4	1	1	hg19	c.1199C>T	CCDS8694.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642321	0.87859	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	5.66	5.66	0.87406	5.66	5.66	0.87406	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.70016	0.967;0.897	D	0.93643	0.6966	10	0.87932	D	0	-17.543	19.7509	0.96268	0.0:0.0:1.0:0.0	.	400;400	O60706;O60706-2	ABCC9_HUMAN;.	M	400;63;400;400	ENSP00000261200:T400M;ENSP00000440521:T63M;ENSP00000261201:T400M;ENSP00000261202:T400M	ENSP00000261200:T400M	T	-	2	0	0	ABCC9	21954479	21954479	1.000000	0.71417	0.975000	0.42487	0.954000	0.61252	9.852000	0.99516	2.664000	0.90586	0.650000	0.86243	ACG	0.416215		TCGA-3A-A9IH-01A-12D-A397-08	0.348	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	1	0	1	2	2	2	2	0	0	0	0	63	0	63	62	1	1.830000	-20.000000	1	0.510000	NM_005691		0	106	103	0	266	265	1		1	0		0	0	63	0	0	1.000000	0	0	0	0	1	0	106	266
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4			0	0					G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg		TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1					P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1		.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			TCGA-3A-A9IH-01A-12D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	21	2	2	2	0	5	0	0	64	8002	64	64	1	1.830000	-19.999920	1	0.510000	NM_033360		2550	46	44	5470	237	236	1	1	1	1	1	0	0	64	223	1	1.000000	9.674765e-01	1	16	42	15	203	46	237
RACGAP1	29127	broad.mit.edu	37	12	50410450	50410450	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr12:50410450G>A	ENST00000427314.2	-	4	272	c.49C>T	c.(49-51)Cgc>Tgc	p.R17C	RACGAP1_ENST00000547905.1_Missense_Mutation_p.R17C|RACGAP1_ENST00000434422.1_Missense_Mutation_p.R17C|RACGAP1_ENST00000454520.2_Missense_Mutation_p.R17C|RACGAP1_ENST00000551016.1_Missense_Mutation_p.R17C|RACGAP1_ENST00000312377.5_Missense_Mutation_p.R17C	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						TCCACCCGGCGCACAAGCTGC	0.438																																						ENST00000427314.2	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.033684	0.020000	0.030000																										0				14						c.(49-51)Cgc>Tgc		Rac GTPase activating protein 1							131.0	140.0	137.0					12																	50410450		2203	4300	6503	SO:0001583	missense	29127	0	0					g.chr12:50410450G>A		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.49C>T	chr12.hg19:g.50410450G>A	ENSP00000404190:p.Arg17Cys	1					RACGAP1_ENST00000547905.1_Missense_Mutation_p.R17C|RACGAP1_ENST00000454520.2_Missense_Mutation_p.R17C|RACGAP1_ENST00000434422.1_Missense_Mutation_p.R17C|RACGAP1_ENST00000312377.5_Missense_Mutation_p.R17C|RACGAP1_ENST00000551016.1_Missense_Mutation_p.R17C	p.R17C	NM_013277.3	NP_037409.2	0	1	1	1.805806				4	272	-				Missense_Mutation	SNP	ENST00000427314.2	0	1	hg19	c.49C>T	CCDS8795.1	0	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099325	0.76983	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000552310;ENST00000548824;ENST00000548644;ENST00000546723;ENST00000552921;ENST00000546764;ENST00000551876;ENST00000549777;ENST00000550651;ENST00000552004	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.7	4.81	0.61882	5.7	4.81	0.61882	.	0.320727	0.37715	N	0.001971	T	0.76535	0.4001	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	P	0.52957	0.714	T	0.79923	-0.1598	10	0.87932	D	0	-2.9543	14.6535	0.68814	0.0695:0.0:0.9304:0.0	.	17	Q9H0H5	RGAP1_HUMAN	C	17;17;17;17;17;17;17;17;29;17;17;17;17;17;17;17	ENSP00000404190:R17C;ENSP00000309871:R17C;ENSP00000413241:R17C;ENSP00000404808:R17C;ENSP00000449374:R17C;ENSP00000449370:R17C;ENSP00000448697:R17C;ENSP00000449170:R17C;ENSP00000449620:R29C;ENSP00000449669:R17C;ENSP00000447393:R17C;ENSP00000447177:R17C;ENSP00000449186:R17C;ENSP00000448707:R17C;ENSP00000449959:R17C;ENSP00000448136:R17C	ENSP00000309871:R17C	R	-	1	0	0	RACGAP1	48696717	48696717	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.287000	0.72671	1.411000	0.46957	0.650000	0.86243	CGC	0.412646		TCGA-3A-A9IH-01A-12D-A397-08	0.438	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	0	0	1	2	2	2	2	0	0	0	0	134	0	134	130	1	1.830000	-1.797173	0	0.510000	NM_013277		0	5	5	0	573	569	0		1	0		0	0	134	0	0	0.936640	7.510071e-03	0	0	0	12	0	5	573
SRGAP1	57522	broad.mit.edu	37	12	64377799	64377799	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr12:64377799A>G	ENST00000355086.3	+	2	664	c.140A>G	c.(139-141)cAg>cGg	p.Q47R	SRGAP1_ENST00000357825.3_Missense_Mutation_p.Q47R|SRGAP1_ENST00000543397.1_Missense_Mutation_p.Q7R	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	47	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CAGCTTCTCCAGGATCTGCAA	0.433																																						ENST00000355086.3	1.000000	2.000000e-01	1	2.400000e-01	0.300000	0.460742	0.300000	0.280000																										0				65						c.(139-141)cAg>cGg		SLIT-ROBO Rho GTPase activating protein 1							106.0	111.0	109.0					12																	64377799		2203	4300	6503	SO:0001583	missense	57522	0	0					g.chr12:64377799A>G	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.140A>G	chr12.hg19:g.64377799A>G	ENSP00000347198:p.Gln47Arg	1					SRGAP1_ENST00000357825.3_Missense_Mutation_p.Q47R|SRGAP1_ENST00000543397.1_Missense_Mutation_p.Q7R	p.Q47R	NM_020762.2	NP_065813.1	1	2	3	2.456226	Q7Z6B7	SRGP1_HUMAN	GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	2	664	+			Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	1	1	hg19	c.140A>G	CCDS8967.1	0	.	.	.	.	.	.	.	.	.	.	A	25.9	4.686291	0.88639	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.42513	0.97;0.97;2.57	5.1	5.1	0.69264	5.1	5.1	0.69264	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.33691	U	0.004654	T	0.55625	0.1932	M	0.69358	2.11	0.80722	D	1	P;B;B	0.38020	0.615;0.096;0.185	P;B;B	0.50270	0.636;0.106;0.14	T	0.54111	-0.8342	9	.	.	.	.	15.199	0.73120	1.0:0.0:0.0:0.0	.	47;7;47	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	R	47;47;7	ENSP00000347198:Q47R;ENSP00000350480:Q47R;ENSP00000437948:Q7R	.	Q	+	2	0	0	SRGAP1	62664066	62664066	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.262000	0.95591	2.060000	0.61445	0.477000	0.44152	CAG	0.569306		TCGA-3A-A9IH-01A-12D-A397-08	0.433	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1	1	0	1	2	2	2	2	0	0	0	0	81	0	81	81	1	1.830000	-7.617048	1	0.510000			0	33	33	0	488	486	0		1	0		0	0	81	0	0	1.000000	1.357240e-01	0	0	0	10	0	33	488
SYT1	6857	broad.mit.edu	37	12	79679566	79679566	+	Splice_Site	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr12:79679566G>A	ENST00000261205.4	+	5	823		c.e5-1		SYT1_ENST00000393240.3_Splice_Site|SYT1_ENST00000552744.1_Splice_Site|SYT1_ENST00000457153.2_Splice_Site	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I						calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						GTTTCTTTCAGTGCCACCGTG	0.368																																						ENST00000261205.4	1.000000	5.000000e-01	8.500000e-01	5.800000e-01	0.670000	0.713237	0.670000	0.660000																										0				25						c.e5-1		synaptotagmin I							130.0	119.0	123.0					12																	79679566		2203	4300	6503	SO:0001630	splice_region_variant	6857	0	0					g.chr12:79679566G>A		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.167-1G>A	chr12.hg19:g.79679566G>A		1					SYT1_ENST00000552744.1_Splice_Site|SYT1_ENST00000393240.3_Splice_Site|SYT1_ENST00000457153.2_Splice_Site		NM_005639.2	NP_005630.1	2	2	4	2.267788	P21579	SYT1_HUMAN		5	823	+			Q6AI31	Splice_Site	SNP	ENST00000261205.4	1	1	hg19		CCDS9017.1	0	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994229	0.93167	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552074;ENST00000547046;ENST00000549671;ENST00000551304;ENST00000552744;ENST00000552624;ENST00000446242	.	.	.	5.93	5.93	0.95920	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	SYT1	78203697	78203697	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	.	0.549094		TCGA-3A-A9IH-01A-12D-A397-08	0.368	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259415.1	1	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	1.830000	-19.998250	1	0.510000	NM_005639	Intron	0	45	45	0	245	241	1		1			0	0	49	0	0	1.000000	0	0	0	0	0	0	45	245
FRY	10129	broad.mit.edu	37	13	32759255	32759255	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr13:32759255A>G	ENST00000380250.3	+	26	3785	c.3289A>G	c.(3289-3291)Atg>Gtg	p.M1097V		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1097						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TTTTAGTGCAATGGTGGCCAA	0.413																																						ENST00000380250.3	0.970000	6.400000e-01	8.800000e-01	7.100000e-01	0.790000	0.797971	0.790000	0.790000																										0				132						c.(3289-3291)Atg>Gtg		furry homolog (Drosophila)							80.0	77.0	78.0					13																	32759255		1928	4121	6049	SO:0001583	missense	10129	3	120866	36				g.chr13:32759255A>G	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.3289A>G	chr13.hg19:g.32759255A>G	ENSP00000369600:p.Met1097Val	0						p.M1097V	NM_023037.2	NP_075463.2	1	2	3	2.115587	Q5TBA9	FRY_HUMAN		26	3785	+		Lung SC(185;0.0271)	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	1	1	hg19	c.3289A>G	CCDS41875.1	0	.	.	.	.	.	.	.	.	.	.	A	15.18	2.755504	0.49362	.	.	ENSG00000073910	ENST00000380250	T	0.22134	1.97	5.37	5.37	0.77165	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.17959	0.0431	L	0.36672	1.1	0.80722	D	1	B	0.29716	0.255	B	0.26969	0.075	T	0.04242	-1.0966	10	0.24483	T	0.36	.	15.6626	0.77199	1.0:0.0:0.0:0.0	.	1097	Q5TBA9	FRY_HUMAN	V	1097	ENSP00000369600:M1097V	ENSP00000369600:M1097V	M	+	1	0	0	FRY	31657255	31657255	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	7.191000	0.77763	2.161000	0.67846	0.528000	0.53228	ATG	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.413	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	1	0	1	2	2	2	2	0	0	0	0	71	0	71	69	1	1.830000	-20.000000	1	0.510000	NM_023037		0	81	81	0	322	320	1		1	1		0	0	71	0	0	1.000000	6.814830e-01	0	5	0	6	0	81	322
TUBGCP3	10426	broad.mit.edu	37	13	113140311	113140311	+	Missense_Mutation	SNP	G	G	A	rs536973080		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr13:113140311G>A	ENST00000261965.3	-	22	2906	c.2720C>T	c.(2719-2721)aCg>aTg	p.T907M		NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	907					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CGAGCTTCACGTGTGGGAGCT	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		16352	0.0		0.0	False		,,,				2504	0.001					ENST00000261965.3	1.000000	7.100000e-01	1	8.400000e-01	0.980000	0.938381	0.980000	1.000000																										0				25						c.(2719-2721)aCg>aTg		tubulin, gamma complex associated protein 3							13.0	12.0	12.0					13																	113140311		2196	4280	6476	SO:0001583	missense	10426	6	120998	32				g.chr13:113140311G>A	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.2720C>T	chr13.hg19:g.113140311G>A	ENSP00000261965:p.Thr907Met	0						p.T907M	NM_006322.4	NP_006313.1	1	2	3	2.115587	Q96CW5	GCP3_HUMAN		22	2906	-	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)		O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	ENST00000261965.3	1	1	hg19	c.2720C>T	CCDS9525.1	1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152609	0.38021	.	.	ENSG00000126216	ENST00000261965	T	0.24350	1.86	4.64	1.7	0.24286	4.64	1.7	0.24286	.	0.391386	0.28618	N	0.014706	T	0.11324	0.0276	N	0.08118	0	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.04013	0.001;0.001	T	0.09465	-1.0673	10	0.41790	T	0.15	.	6.8525	0.24022	0.5149:0.0:0.4851:0.0	.	897;907	B4DYP7;Q96CW5	.;GCP3_HUMAN	M	907	ENSP00000261965:T907M	ENSP00000261965:T907M	T	-	2	0	0	TUBGCP3	112188312	112188312	1.000000	0.71417	0.566000	0.28421	0.740000	0.42216	3.101000	0.50283	0.420000	0.25954	0.655000	0.94253	ACG	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.597	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2	1	0	1	2	2	2	2	0	0	0	0	33	0	33	44	1	1.830000	-20.000000	1	0.510000	NM_006322		0	33	33	0	99	91	0		1	1		0	0	33	0	0	1.000000	9.843918e-01	0	6	0	17	0	33	99
DHRS4	10901	broad.mit.edu	37	14	24429144	24429144	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr14:24429144G>C	ENST00000313250.5	+	3	543	c.340G>C	c.(340-342)Gtc>Ctc	p.V114L	DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_Missense_Mutation_p.V114L|DHRS4_ENST00000308178.8_Intron|DHRS4_ENST00000397075.3_Missense_Mutation_p.V114L|DHRS4_ENST00000397074.3_Intron|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000558581.1_Intron|DHRS4_ENST00000558263.1_Missense_Mutation_p.V114L|DHRS4_ENST00000421831.1_Intron|DHRS4_ENST00000382761.3_Missense_Mutation_p.V96L	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	114					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CGATATCCTAGTCTCCAATGC	0.522																																						ENST00000313250.5	0.150000	8.000000e-02	1.400000e-01	1.000000e-01	0.110000	0.122475	0.110000	0.120000																										0				14						c.(340-342)Gtc>Ctc		dehydrogenase/reductase (SDR family) member 4	Vitamin A(DB00162)						297.0	345.0	329.0					14																	24429144		2203	4300	6503	SO:0001583	missense	10901	0	0					g.chr14:24429144G>C	AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.340G>C	chr14.hg19:g.24429144G>C	ENSP00000326219:p.Val114Leu	1					DHRS4_ENST00000397075.3_Missense_Mutation_p.V114L|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000558581.1_Intron|DHRS4_ENST00000382761.3_Missense_Mutation_p.V96L|DHRS4_ENST00000558263.1_Missense_Mutation_p.V114L|DHRS4_ENST00000421831.1_Intron|DHRS4_ENST00000397074.3_Intron|DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_Missense_Mutation_p.V114L|DHRS4_ENST00000308178.8_Intron	p.V114L	NM_021004.2	NP_066284.2	0	1	1	1.616651	Q9BTZ2	DHRS4_HUMAN		3	543	+			B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	ENST00000313250.5	1	1	hg19	c.340G>C	CCDS9605.1	0	.	.	.	.	.	.	.	.	.	.	.	12.86	2.065559	0.36470	.	.	ENSG00000157326	ENST00000313250;ENST00000382761;ENST00000397075;ENST00000543741	T;T;D;T	0.90444	0.62;1.22;-2.67;1.22	3.1	1.21	0.21127	3.1	1.21	0.21127	NAD(P)-binding domain (1);	0.130045	0.51477	D	0.000095	D	0.93595	0.7955	M	0.88979	2.995	0.45452	D	0.998421	P;P;P;P	0.41569	0.514;0.59;0.663;0.755	B;P;B;P	0.54544	0.329;0.51;0.346;0.755	D	0.91433	0.5167	10	0.66056	D	0.02	.	7.0353	0.24991	0.2376:0.0:0.7624:0.0	.	114;114;114;114	F5GWZ1;Q9BTZ2-2;Q9BTZ2-7;Q9BTZ2	.;.;.;DHRS4_HUMAN	L	114;96;114;114	ENSP00000326219:V114L;ENSP00000372209:V96L;ENSP00000380265:V114L;ENSP00000440508:V114L	ENSP00000326219:V114L	V	+	1	0	0	DHRS4	23498984	23498984	1.000000	0.71417	0.999000	0.59377	0.737000	0.42083	3.267000	0.51577	0.166000	0.19597	0.555000	0.69702	GTC	0.344525		TCGA-3A-A9IH-01A-12D-A397-08	0.522	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3	1	0	1	2	2	2	2	0	0	0	0	406	0	406	412	1	1.830000	-5.131537	1	0.510000			0	62	56	0	1442	1382	0		1	1		0	0	406	0	0	1.000000	4.171046e-01	0	3	0	31	0	62	1442
GABRB3	2562	broad.mit.edu	37	15	26866539	26866539	+	Missense_Mutation	SNP	T	T	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr15:26866539T>A	ENST00000311550.5	-	4	494	c.383A>T	c.(382-384)aAg>aTg	p.K128M	GABRB3_ENST00000541819.2_Missense_Mutation_p.K184M|GABRB3_ENST00000299267.4_Missense_Mutation_p.K128M|GABRB3_ENST00000400188.3_Missense_Mutation_p.K57M|GABRB3_ENST00000545868.1_Missense_Mutation_p.K43M	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	128					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACAAATGACTTTTTGTCATT	0.502																																						ENST00000311550.5	1.000000	9.400000e-01	1	9.900000e-01	0.990000	0.996472	0.990000	1.000000																										0				68						c.(382-384)aAg>aTg		gamma-aminobutyric acid (GABA) A receptor, beta 3	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)						142.0	127.0	132.0					15																	26866539		2203	4300	6503	SO:0001583	missense	2562	0	0					g.chr15:26866539T>A		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.383A>T	chr15.hg19:g.26866539T>A	ENSP00000308725:p.Lys128Met	0					GABRB3_ENST00000541819.2_Missense_Mutation_p.K184M|GABRB3_ENST00000299267.4_Missense_Mutation_p.K128M|GABRB3_ENST00000545868.1_Missense_Mutation_p.K43M|GABRB3_ENST00000400188.3_Missense_Mutation_p.K57M	p.K128M	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	1	2	3	2.109746	P28472	GBRB3_HUMAN		4	494	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	1	1	hg19	c.383A>T	CCDS10019.1	1	.	.	.	.	.	.	.	.	.	.	T	31	5.063482	0.93898	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868;ENST00000555094	T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	5.77	5.77	0.91146	5.77	5.77	0.91146	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.88786	0.6531	M	0.85542	2.76	0.80722	D	1	P;D;D	0.71674	0.717;0.998;0.998	P;D;D	0.70016	0.454;0.917;0.967	D	0.90410	0.4409	10	0.72032	D	0.01	.	15.3309	0.74208	0.0:0.0:0.0:1.0	.	184;128;128	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	M	128;184;128;57;43;43	ENSP00000308725:K128M;ENSP00000442408:K184M;ENSP00000299267:K128M;ENSP00000383049:K57M;ENSP00000439169:K43M;ENSP00000452272:K43M	ENSP00000299267:K128M	K	-	2	0	0	GABRB3	24417632	24417632	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.880000	0.87243	2.218000	0.71995	0.378000	0.23410	AAG	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.502	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2	1	0	1	2	2	2	2	0	0	0	0	82	0	82	80	1	1.830000	-20.000000	1	0.510000			0	130	130	0	334	330	1		1	0		0	0	82	0	0	1.000000	9.328887e-01	0	0	0	14	0	130	334
PPIP5K1	9677	broad.mit.edu	37	15	43851071	43851071	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr15:43851071G>C	ENST00000396923.3	-	28	3428	c.3307C>G	c.(3307-3309)Ctt>Gtt	p.L1103V	PPIP5K1_ENST00000360135.4_Missense_Mutation_p.L1036V|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.L1103V|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.L1079V|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.L1078V|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.L1078V|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.L1036V|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.L1099V			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1103					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						CGTAGGGAAAGGGCATTATGC	0.478																																						ENST00000396923.3			0	0																														0				1						c.(3307-3309)Ctt>Gtt		diphosphoinositol pentakisphosphate kinase 1							156.0	135.0	142.0					15																	43851071		2201	4298	6499	SO:0001583	missense	9677	0	0					g.chr15:43851071G>C	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3307C>G	chr15.hg19:g.43851071G>C	ENSP00000380129:p.Leu1103Val						PPIP5K1_ENST00000360301.4_Missense_Mutation_p.L1078V|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.L1036V|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.L1099V|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.L1103V|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.L1036V|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.L1078V|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.L1079V	p.L1103V							Q6PFW1	VIP1_HUMAN		28	3428	-			O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	ENST00000396923.3	1	1	hg19	c.3307C>G	CCDS45252.1		.	.	.	.	.	.	.	.	.	.	G	22.4	4.284077	0.80803	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806;ENST00000335092	T;T;T;T;T;T;T;T	0.58060	0.56;0.36;2.25;0.36;0.56;0.56;0.52;2.25	6.06	6.06	0.98353	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.74458	0.3719	M	0.76170	2.325	0.37898	D	0.930941	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.76410	-0.2969	10	0.59425	D	0.04	-13.5751	19.609	0.95594	0.0:0.0:1.0:0.0	.	1036;1103;1100;1078	Q6PFW1-7;Q6PFW1;Q6PFW1-2;Q6PFW1-3	.;VIP1_HUMAN;.;.	V	1099;1078;1036;1078;1103;1103;1078;1103;1079;1036;999	ENSP00000371309:L1099V;ENSP00000353446:L1078V;ENSP00000353253:L1036V;ENSP00000334779:L1078V;ENSP00000380129:L1103V;ENSP00000400887:L1103V;ENSP00000371303:L1079V;ENSP00000308773:L1036V	ENSP00000304750:L1103V	L	-	1	0	0	PPIP5K1	41638363	41638363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.430000	0.97488	2.882000	0.98803	0.655000	0.94253	CTT			TCGA-3A-A9IH-01A-12D-A397-08	0.478	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	1	0	1	2	2	2	2	0	0	0	0	81	0	81	81	1	1.830000	-2.860975	1	0.510000	NM_014659		0	64	64	0	324	321	1		1	1		0	0	81	0	0	1.000000	9.210175e-01	0	8	0	16	0	64	324
ZNF280D	54816	broad.mit.edu	37	15	56958635	56958635	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr15:56958635T>C	ENST00000267807.7	-	16	2168	c.1952A>G	c.(1951-1953)tAc>tGc	p.Y651C	ZNF280D_ENST00000559000.1_Missense_Mutation_p.Y638C|ZNF280D_ENST00000396245.1_Missense_Mutation_p.Y355C|ZNF280D_ENST00000559237.1_Missense_Mutation_p.Y638C	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	651					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		GCTAGTGTTGTATCTGCAAAA	0.358																																						ENST00000267807.7	0.830000	5.100000e-01	7.300000e-01	5.700000e-01	0.650000	0.660362	0.650000	0.650000																										0				30						c.(1951-1953)tAc>tGc		zinc finger protein 280D							109.0	105.0	106.0					15																	56958635		2192	4292	6484	SO:0001583	missense	54816	0	0					g.chr15:56958635T>C	AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.1952A>G	chr15.hg19:g.56958635T>C	ENSP00000267807:p.Tyr651Cys	0					ZNF280D_ENST00000559237.1_Missense_Mutation_p.Y638C|ZNF280D_ENST00000396245.1_Missense_Mutation_p.Y355C|ZNF280D_ENST00000559000.1_Missense_Mutation_p.Y638C	p.Y651C	NM_017661.2	NP_060131.2	1	2	3	2.113356	Q6N043	Z280D_HUMAN		16	2168	-			A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Missense_Mutation	SNP	ENST00000267807.7	1	1	hg19	c.1952A>G	CCDS32245.1	0	.	.	.	.	.	.	.	.	.	.	T	16.74	3.205782	0.58234	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000396245	T;T	0.16324	2.35;3.21	4.96	4.96	0.65561	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);	0.660622	0.11753	U	0.532867	T	0.41511	0.1162	M	0.76574	2.34	0.39244	D	0.963911	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.99	T	0.27971	-1.0058	10	0.87932	D	0	-20.1193	9.5114	0.39078	0.1573:0.0:0.0:0.8427	.	714;651	B4DHL1;Q6N043	.;Z280D_HUMAN	C	651;638;355	ENSP00000267807:Y651C;ENSP00000379545:Y355C	ENSP00000267807:Y651C	Y	-	2	0	0	ZNF280D	54745927	54745927	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.396000	0.66297	1.983000	0.57843	0.383000	0.25322	TAC	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.358	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418891.2	1	0	1	2	2	2	2	0	0	0	0	51	0	51	51	1	1.830000	-20.000000	1	0.510000	XM_370867		0	64	64	0	323	323	1		1	1		0	0	51	0	0	1.000000	7.967381e-01	0	4	0	13	0	64	323
HERC1	8925	broad.mit.edu	37	15	63908760	63908760	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr15:63908760C>A	ENST00000443617.2	-	75	13897	c.13810G>T	c.(13810-13812)Gtg>Ttg	p.V4604L		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4604	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TGCTTCCACACCAGAGGGGCC	0.502																																						ENST00000443617.2	1.000000	7.000000e-01	1	7.900000e-01	0.900000	0.899006	0.900000	1.000000																										0				132						c.(13810-13812)Gtg>Ttg		HECT and RLD domain containing E3 ubiquitin protein ligase family member 1							56.0	57.0	56.0					15																	63908760		1888	4124	6012	SO:0001583	missense	8925	0	0					g.chr15:63908760C>A	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.13810G>T	chr15.hg19:g.63908760C>A	ENSP00000390158:p.Val4604Leu	0						p.V4604L	NM_003922.3	NP_003913.3	1	2	3	2.113356	Q15751	HERC1_HUMAN		75	13897	-			Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	1	1	hg19	c.13810G>T	CCDS45277.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.104026	0.94245	.	.	ENSG00000103657	ENST00000443617	T	0.56776	0.44	5.04	5.04	0.67666	5.04	5.04	0.67666	HECT (4);	0.000000	0.64402	D	0.000003	T	0.65228	0.2671	L	0.36672	1.1	0.80722	D	1	D	0.63046	0.992	D	0.77004	0.989	T	0.66392	-0.5935	10	0.52906	T	0.07	.	18.7804	0.91930	0.0:1.0:0.0:0.0	.	4604	Q15751	HERC1_HUMAN	L	4604	ENSP00000390158:V4604L	ENSP00000390158:V4604L	V	-	1	0	0	HERC1	61695813	61695813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.491000	0.84063	0.555000	0.69702	GTG	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.502	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	1	0	1	2	2	2	2	0	0	0	0	38	0	38	38	1	1.830000	-20.000000	1	0.510000	NM_003922		0	54	53	0	181	180	1		1	1		0	0	38	0	0	1.000000	9.999894e-01	0	18	0	43	0	54	181
IDH2	3418	broad.mit.edu	37	15	90630770	90630770	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr15:90630770G>A	ENST00000330062.3	-	6	829	c.716C>T	c.(715-717)gCc>gTc	p.A239V	IDH2_ENST00000540499.2_Missense_Mutation_p.A187V|IDH2_ENST00000539790.1_Missense_Mutation_p.A109V|IDH2_ENST00000559482.1_Missense_Mutation_p.A130V	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	239					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CTTCTGGATGGCATACTGGAA	0.562			M		GBM						OREG0023466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000330062.3	0.090000	0	6.000000e-02	1.000000e-02	0.030000	0.050606	0.030000	0.040000				Dom	yes			Dom	yes		15	15q26.1	15q26.1	3418	M	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """				M	M			GBM		0				1109						c.(715-717)gCc>gTc		isocitrate dehydrogenase 2 (NADP+), mitochondrial							177.0	167.0	170.0					15																	90630770		2200	4298	6498	SO:0001583	missense	3418	0	0					g.chr15:90630770G>A		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.716C>T	chr15.hg19:g.90630770G>A	ENSP00000331897:p.Ala239Val	0		OREG0023466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1276	IDH2_ENST00000539790.1_Missense_Mutation_p.A109V|IDH2_ENST00000540499.2_Missense_Mutation_p.A187V|IDH2_ENST00000559482.1_Missense_Mutation_p.A130V	p.A239V	NM_002168.2	NP_002159.2	1	2	3	2.113356	P48735	IDHP_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)	6	829	-	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	0	1	hg19	c.716C>T	CCDS10359.1	0	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556943	0.65425	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.89485	-2.52;-2.52;-2.52	5.74	5.74	0.90152	5.74	5.74	0.90152	Isopropylmalate dehydrogenase-like domain (2);	0.101003	0.64402	D	0.000002	D	0.96738	0.8935	H	0.98005	4.125	0.49582	D	0.9998	D;D	0.76494	0.999;0.999	D;D	0.70716	0.97;0.943	D	0.97950	1.0331	10	0.87932	D	0	.	17.4143	0.87495	0.0:0.0:1.0:0.0	.	239;239	Q53GL5;P48735	.;IDHP_HUMAN	V	239;109;187	ENSP00000331897:A239V;ENSP00000438457:A109V;ENSP00000446147:A187V	ENSP00000331897:A239V	A	-	2	0	0	IDH2	88431774	88431774	1.000000	0.71417	0.978000	0.43139	0.002000	0.02628	7.797000	0.85911	2.721000	0.93114	0.491000	0.48974	GCC	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.562	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1	0	0	1	2	2	2	2	0	0	0	0	161	0	161	161	1	1.830000	-1.951001	0	0.510000			0	6	6	0	656	649	0		1	0		0	0	161	0	0	0.963920	7.881844e-01	0	0	0	315	0	6	656
UMOD	7369	broad.mit.edu	37	16	20357449	20357449	+	Splice_Site	SNP	G	G	A	rs532447307		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr16:20357449G>A	ENST00000570689.1	-	5	1327	c.1181C>T	c.(1180-1182)aCg>aTg	p.T394M	UMOD_ENST00000302509.4_Splice_Site_p.T394M|UMOD_ENST00000396142.2_Splice_Site_p.T394M|UMOD_ENST00000396138.4_Splice_Site_p.T443M|UMOD_ENST00000424589.1_Splice_Site_p.T427M|UMOD_ENST00000396134.2_Splice_Site_p.T427M			P07911	UROM_HUMAN	uromodulin	394	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.T394M(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						AGGACGTACCGTCAACACTGT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		18519	0.001		0.0	False		,,,				2504	0.0					ENST00000570689.1	1.000000	4.600000e-01	8.100000e-01	5.600000e-01	0.670000	0.689629	0.670000	0.670000																										1	Substitution - Missense(1)	p.T394M(1)	large_intestine(1)	41						c.(1180-1182)aCg>aTg		uromodulin							32.0	33.0	33.0					16																	20357449		2203	4300	6503	SO:0001630	splice_region_variant	7369	5	121412	39				g.chr16:20357449G>A	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1182+1C>T	chr16.hg19:g.20357449G>A		0					UMOD_ENST00000396134.2_Splice_Site_p.T427M|UMOD_ENST00000396142.2_Splice_Site_p.T394M|UMOD_ENST00000396138.4_Splice_Site_p.T443M|UMOD_ENST00000424589.1_Splice_Site_p.T427M|UMOD_ENST00000302509.4_Splice_Site_p.T394M	p.T394M			1	2	3	2.125779	P07911	UROM_HUMAN		5	1327	-			B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Splice_Site	SNP	ENST00000570689.1	1	0	hg19	c.1181C>T	CCDS10583.1	0	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520286	0.27211	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	4.85	1.14	0.20703	4.85	1.14	0.20703	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.386132	0.22253	N	0.062527	T	0.64461	0.2600	N	0.19112	0.55	0.26258	N	0.978613	B;B	0.30511	0.282;0.153	B;B	0.21546	0.035;0.028	T	0.55496	-0.8132	10	0.48119	T	0.1	-8.2654	4.7982	0.13282	0.2971:0.1786:0.5244:0.0	.	427;394	E9PEA4;P07911	.;UROM_HUMAN	M	394;427;427;394;372;394	ENSP00000379438:T427M;ENSP00000416346:T427M;ENSP00000306279:T394M;ENSP00000379446:T394M	ENSP00000306279:T394M	T	-	2	0	0	UMOD	20264950	20264950	0.970000	0.33590	1.000000	0.80357	0.841000	0.47740	-0.116000	0.10724	0.409000	0.25649	0.491000	0.48974	ACG	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.567	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1	1	0	1	2	2	2	2	0	0	0	0	42	0	42	42	1	1.830000	-20.000000	1	0.510000		Missense_Mutation	0	27	27	0	133	128	1		1			0	0	42	0	0	1.000000	0	0	0	0	0	0	27	133
ZNF423	23090	broad.mit.edu	37	16	49672109	49672109	+	Silent	SNP	G	G	A	rs377569533		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr16:49672109G>A	ENST00000561648.1	-	4	1007	c.954C>T	c.(952-954)caC>caT	p.H318H	ZNF423_ENST00000262383.2_Silent_p.H318H|ZNF423_ENST00000567169.1_Silent_p.H201H|ZNF423_ENST00000535559.1_Silent_p.H201H|ZNF423_ENST00000562520.1_Silent_p.H258H|ZNF423_ENST00000563137.2_Silent_p.H258H|ZNF423_ENST00000562871.1_Silent_p.H258H	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	318					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TCTGGTTGGCGTGGGCTTGGT	0.617																																						ENST00000561648.1	1.000000	8.800000e-01	1	9.700000e-01	0.990000	0.988403	0.990000	1.000000																										0				89						c.(952-954)caC>caT		zinc finger protein 423		G		0,4396		0,0,2198	120.0	87.0	98.0		954	1.9	1.0	16		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF423	NM_015069.2		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		318/1285	49672109	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	23090	5	121412	36				g.chr16:49672109G>A	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.954C>T	chr16.hg19:g.49672109G>A		0					ZNF423_ENST00000562871.1_Silent_p.H258H|ZNF423_ENST00000562520.1_Silent_p.H258H|ZNF423_ENST00000567169.1_Silent_p.H201H|ZNF423_ENST00000262383.2_Silent_p.H318H|ZNF423_ENST00000563137.2_Silent_p.H258H|ZNF423_ENST00000535559.1_Silent_p.H201H	p.H318H	NM_001271620.1	NP_001258549.1	1	2	3	2.125779	Q2M1K9	ZN423_HUMAN		4	1007	-		all_cancers(37;0.0155)	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	1	1	hg19	c.954C>T	CCDS32445.1	1																																																																																								0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.617	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	0	0	1	2	14	2	2	1	0	1	1	71	0	71	71	1	1.830000	-20.000000	1	0.510000	NM_015069		0	77	77	0	205	205	1		1	1		1	0	71	0	0	1.000000	8.772596e-01	0	3	0	9	0	77	205
KCTD19	146212	broad.mit.edu	37	16	67333434	67333434	+	Missense_Mutation	SNP	T	T	C	rs373584218		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr16:67333434T>C	ENST00000304372.5	-	6	873	c.818A>G	c.(817-819)aAg>aGg	p.K273R	KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	273					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GCGGGCCCCCTTCCCGGGGCT	0.642																																						ENST00000304372.5	1.000000	0	6.000000e-02	1.000000e-02	0.030000	0.066975	0.030000	0.040000																										0				23						c.(817-819)aAg>aGg		potassium channel tetramerization domain containing 19							63.0	70.0	68.0					16																	67333434		1887	4112	5999	SO:0001583	missense	146212	0	0					g.chr16:67333434T>C	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.818A>G	chr16.hg19:g.67333434T>C	ENSP00000305702:p.Lys273Arg	0					KCTD19_ENST00000562860.1_5'UTR	p.K273R	NM_001100915.1	NP_001094385.1	1	2	3	2.125779	Q17RG1	KCD19_HUMAN		6	873	-		Ovarian(137;0.192)	B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	0	1	hg19	c.818A>G	CCDS42179.1	0	.	.	.	.	.	.	.	.	.	.	T	14.59	2.579355	0.46006	.	.	ENSG00000168676	ENST00000304372	T	0.58940	0.3	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.173060	0.41396	D	0.000893	T	0.40670	0.1126	N	0.14661	0.345	0.30590	N	0.761602	B	0.21753	0.06	B	0.19946	0.027	T	0.41466	-0.9507	10	0.34782	T	0.22	-27.9066	12.7641	0.57383	0.0:0.0:0.0:1.0	.	273	Q17RG1	KCD19_HUMAN	R	273	ENSP00000305702:K273R	ENSP00000305702:K273R	K	-	2	0	0	KCTD19	65890935	65890935	0.994000	0.37717	0.982000	0.44146	0.313000	0.28021	3.595000	0.54016	2.326000	0.78906	0.533000	0.62120	AAG	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.642	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	0	0	1	2	2	2	2	0	0	0	0	139	0	139	139	1	1.830000	-3.119022	1	0.510000	XM_085367		0	5	5	0	589	584	0		1			0	0	139	0	0	0.936382	0	0	0	0	0	0	5	589
LRRC36	55282	broad.mit.edu	37	16	67397524	67397524	+	Silent	SNP	C	C	G			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr16:67397524C>G	ENST00000329956.6	+	6	628	c.609C>G	c.(607-609)ccC>ccG	p.P203P	LRRC36_ENST00000563189.1_Silent_p.P82P|LRRC36_ENST00000290940.7_5'UTR|LRRC36_ENST00000435835.3_Silent_p.P82P|LRRC36_ENST00000541146.1_5'UTR	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	203										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		TTCCCTTCCCCAACCGGGAAA	0.428																																						ENST00000329956.6	1.000000	8.000000e-02	1.900000e-01	1.100000e-01	0.140000	0.177797	0.140000	0.140000																										0				24						c.(607-609)ccC>ccG		leucine rich repeat containing 36							105.0	97.0	99.0					16																	67397524		2198	4300	6498	SO:0001819	synonymous_variant	55282	0	0					g.chr16:67397524C>G	BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.609C>G	chr16.hg19:g.67397524C>G		0					LRRC36_ENST00000563189.1_Silent_p.P82P|LRRC36_ENST00000541146.1_5'UTR|LRRC36_ENST00000435835.3_Silent_p.P82P|LRRC36_ENST00000290940.7_5'UTR	p.P203P	NM_018296.5	NP_060766.5	1	2	3	2.125779	Q1X8D7	LRC36_HUMAN		6	628	+		Ovarian(137;0.192)	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Silent	SNP	ENST00000329956.6	1	1	hg19	c.609C>G	CCDS32467.1	0																																																																																								0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.428	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1	0	0	1	2	2	2	2	0	0	0	0	66	0	66	66	1	1.830000	-3.153975	1	0.510000	NM_018296		0	16	16	0	420	417	0		1	0		0	0	66	0	0	0.999932	0	0	0	0	1	0	16	420
HYDIN	54768	broad.mit.edu	37	16	70902514	70902514	+	Missense_Mutation	SNP	C	C	T	rs199890203	byFrequency	TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr16:70902514C>T	ENST00000393567.2	-	66	11419	c.11269G>A	c.(11269-11271)Gta>Ata	p.V3757I	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3757					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TTTCTGGGTACGTCCACCCAC	0.527																																						ENST00000393567.2	1.000000	6.300000e-01	1	7.400000e-01	0.850000	0.859896	0.850000	1.000000																										0				43						c.(11269-11271)Gta>Ata		HYDIN, axonemal central pair apparatus protein		C	ILE/VAL	0,3784		0,0,1892	42.0	43.0	42.0		11266	-7.5	0.0	16		42	6,8214		0,6,4104	yes	missense	HYDIN	NM_032821.2	29	0,6,5996	TT,TC,CC		0.073,0.0,0.05	probably-damaging	3756/5121	70902514	6,11998	1892	4110	6002	SO:0001583	missense	54768	45	120824	46				g.chr16:70902514C>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11269G>A	chr16.hg19:g.70902514C>T	ENSP00000377197:p.Val3757Ile	0					SNORD112_ENST00000515891.1_RNA	p.V3757I	NM_001270974.1	NP_001257903.1	1	2	3	2.125779	Q4G0P3	HYDIN_HUMAN		66	11419	-		Ovarian(137;0.0654)	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	1	1	hg19	c.11269G>A	CCDS59269.1	1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992987	0.54041	0.0	7.3E-4	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00856	5.61	5.17	-7.53	0.01336	5.17	-7.53	0.01336	.	1.450790	0.06162	N	0.676024	T	0.00695	0.0023	L	0.45581	1.43	0.09310	N	1	D	0.57257	0.979	B	0.37047	0.24	T	0.46414	-0.9193	10	0.33940	T	0.23	.	1.2147	0.01912	0.2597:0.2713:0.0911:0.3779	.	3756	F8WD23	.	I	3757;3756	ENSP00000377197:V3757I	ENSP00000313052:V3756I	V	-	1	0	0	HYDIN	69460015	69460015	0.000000	0.05858	0.000000	0.03702	0.593000	0.36681	-2.004000	0.01461	-0.941000	0.03700	-0.294000	0.09567	GTA	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.527	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3	0	0	1	2	2	2	2	0	0	0	0	35	0	35	47	1	1.830000	-3.056823	1	0.510000			0	40	37	0	145	135	0		1			0	0	35	0	0	1.000000	0	0	0	0	0	0	40	145
SLC38A8	146167	broad.mit.edu	37	16	84056458	84056458	+	Missense_Mutation	SNP	G	G	A	rs369350968		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr16:84056458G>A	ENST00000299709.3	-	6	726	c.727C>T	c.(727-729)Cgc>Tgc	p.R243C		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	243					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CTCCGTTTGCGCATGCTGCAG	0.597																																						ENST00000299709.3	1.000000	5.500000e-01	9.600000e-01	6.700000e-01	0.800000	0.809432	0.800000	1.000000																										0				26						c.(727-729)Cgc>Tgc		solute carrier family 38, member 8		T	CYS/ARG	1,4399		0,1,2199	77.0	60.0	66.0		727	-3.1	0.0	16		66	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC38A8	NM_001080442.1	180	0,2,6498	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	243/436	84056458	2,12998	2200	4300	6500	SO:0001583	missense	146167	12	121410	38				g.chr16:84056458G>A		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.727C>T	chr16.hg19:g.84056458G>A	ENSP00000299709:p.Arg243Cys	0						p.R243C	NM_001080442.1	NP_001073911.1	1	2	3	2.127413	A6NNN8	S38A8_HUMAN		6	726	-				Missense_Mutation	SNP	ENST00000299709.3	1	1	hg19	c.727C>T	CCDS32495.1	0	.	.	.	.	.	.	.	.	.	.	g	13.01	2.108896	0.37242	2.27E-4	1.16E-4	ENSG00000166558	ENST00000299709	T	0.02837	4.14	5.37	-3.06	0.05379	5.37	-3.06	0.05379	.	0.766355	0.13025	N	0.419743	T	0.05318	0.0141	L	0.59436	1.845	0.21105	N	0.999789	D	0.71674	0.998	P	0.53185	0.72	T	0.16897	-1.0387	10	0.54805	T	0.06	-11.8938	5.2133	0.15329	0.2249:0.0:0.3705:0.4045	.	243	A6NNN8	S38A8_HUMAN	C	243	ENSP00000299709:R243C	ENSP00000299709:R243C	R	-	1	0	0	SLC38A8	82613959	82613959	0.704000	0.27836	0.017000	0.16124	0.002000	0.02628	0.515000	0.22801	-0.448000	0.07128	-0.233000	0.12211	CGC	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.597	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	1	0	1	2	2	2	2	0	0	0	0	23	0	23	23	1	1.830000	-3.569890	1	0.510000	NM_001080442		0	27	27	0	107	107	1		1	0		0	0	23	0	0	1.000000	4.358094e-02	0	0	0	2	0	27	107
MYH1	4619	broad.mit.edu	37	17	10398336	10398336	+	Missense_Mutation	SNP	G	G	A	rs202246274		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:10398336G>A	ENST00000226207.5	-	37	5472	c.5378C>T	c.(5377-5379)aCg>aTg	p.T1793M	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1793					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTCCTTCACCGTCTGTTCCAG	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19391	0.0		0.0	False		,,,				2504	0.0					ENST00000226207.5	1.000000	8.400000e-01	9.900000e-01	8.900000e-01	0.940000	0.943084	0.940000	0.970000																										0				176						c.(5377-5379)aCg>aTg		myosin, heavy chain 1, skeletal muscle, adult							153.0	146.0	149.0					17																	10398336		2203	4300	6503	SO:0001583	missense	4619	10	121412	44				g.chr17:10398336G>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5378C>T	chr17.hg19:g.10398336G>A	ENSP00000226207:p.Thr1793Met	1					RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	p.T1793M	NM_005963.3	NP_005954.3	0	1	1	1.616215	P12882	MYH1_HUMAN		37	5472	-			Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	1	1	hg19	c.5378C>T	CCDS11155.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126300	0.77549	.	.	ENSG00000109061	ENST00000226207	T	0.78126	-1.15	5.26	5.26	0.73747	5.26	5.26	0.73747	Myosin tail (1);	0.000000	0.44483	U	0.000455	D	0.86280	0.5895	H	0.95745	3.715	0.58432	D	0.999997	B	0.29037	0.231	B	0.31869	0.137	D	0.87462	0.2408	10	0.72032	D	0.01	.	19.2282	0.93825	0.0:0.0:1.0:0.0	.	1793	P12882	MYH1_HUMAN	M	1793	ENSP00000226207:T1793M	ENSP00000226207:T1793M	T	-	2	0	0	MYH1	10339061	10339061	1.000000	0.71417	0.998000	0.56505	0.824000	0.46624	9.809000	0.99208	2.616000	0.88540	0.561000	0.74099	ACG	0.342282		TCGA-3A-A9IH-01A-12D-A397-08	0.557	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	1	0	1	2	2	2	2	0	0	0	0	152	0	152	149	1	1.830000	-20.000000	1	0.510000	NM_005963		0	165	162	0	328	325	0		1			0	0	152	0	0	1.000000	0	0	0	0	0	0	165	328
GAS2L2	246176	broad.mit.edu	37	17	34074090	34074090	+	Missense_Mutation	SNP	G	G	A	rs373436768		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:34074090G>A	ENST00000254466.6	-	5	1057	c.1030C>T	c.(1030-1032)Cgc>Tgc	p.R344C	GAS2L2_ENST00000587565.1_Missense_Mutation_p.R328C	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	344					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGTTCCCTGCGGGGTCTGGGG	0.627																																						ENST00000254466.6	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999608	0.990000	1.000000																										0				35						c.(1030-1032)Cgc>Tgc		growth arrest-specific 2 like 2		G	CYS/ARG	0,4400		0,0,2200	23.0	28.0	26.0		1030	-4.7	0.0	17		26	1,8591		0,1,4295	no	missense	GAS2L2	NM_139285.3	180	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	benign	344/881	34074090	1,12991	2200	4296	6496	SO:0001583	missense	246176	3	121330	34				g.chr17:34074090G>A	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1030C>T	chr17.hg19:g.34074090G>A	ENSP00000254466:p.Arg344Cys	0					GAS2L2_ENST00000587565.1_Missense_Mutation_p.R328C	p.R344C	NM_139285.3	NP_644814.1	0	0	0	2.076819	Q8NHY3	GA2L2_HUMAN		5	1057	-		Ovarian(249;0.17)	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	1	1	hg19	c.1030C>T	CCDS11298.1	1	.	.	.	.	.	.	.	.	.	.	G	8.982	0.975671	0.18736	0.0	1.16E-4	ENSG00000132139	ENST00000254466	T	0.20069	2.1	4.8	-4.68	0.03309	4.8	-4.68	0.03309	.	1.579220	0.03355	N	0.196716	T	0.20170	0.0485	L	0.46157	1.445	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.35226	-0.9797	10	0.45353	T	0.12	2.3467	11.3093	0.49353	0.6232:0.0:0.3768:0.0	.	344	Q8NHY3	GA2L2_HUMAN	C	344	ENSP00000254466:R344C	ENSP00000254466:R344C	R	-	1	0	0	GAS2L2	31098203	31098203	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.031000	0.13710	-1.053000	0.03218	-0.258000	0.10820	CGC	0.507488		TCGA-3A-A9IH-01A-12D-A397-08	0.627	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	1	0	1	2	20	2	2	0	0	0	1	60	0	60	55	1	1.830000	-8.695949	1	0.510000	NM_139285		0	105	105	0	233	232	0		1	0		0	0	60	0	0	1.000000	0	0	0	0	1	0	105	233
TADA2A	6871	broad.mit.edu	37	17	35830625	35830625	+	Silent	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:35830625G>A	ENST00000394395.2	+	13	1190	c.1017G>A	c.(1015-1017)cgG>cgA	p.R339R	TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000225396.6_Silent_p.R339R	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	339					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						GGCTCCGCCGGCAAGCTGACA	0.507																																						ENST00000394395.2	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.064297	0.050000	0.060000																										0				13						c.(1015-1017)cgG>cgA		transcriptional adaptor 2A							94.0	92.0	93.0					17																	35830625		2203	4300	6503	SO:0001819	synonymous_variant	6871	0	0					g.chr17:35830625G>A	AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.1017G>A	chr17.hg19:g.35830625G>A		0					TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000225396.6_Silent_p.R339R	p.R339R	NM_001166105.1	NP_001159577.1	0	0	0	2.076819	O75478	TAD2A_HUMAN		13	1190	+			A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Silent	SNP	ENST00000394395.2	0	1	hg19	c.1017G>A	CCDS11319.1	0																																																																																								0.507488		TCGA-3A-A9IH-01A-12D-A397-08	0.507	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256677.3	0	0	1	2	2	2	2	0	0	0	0	64	0	64	62	1	1.830000	-2.583425	1	0.510000	NM_001488		0	5	5	0	356	355	0		1	0		0	0	64	0	0	0.937503	4.673532e-02	0	0	0	20	0	5	356
FBXO47	494188	broad.mit.edu	37	17	37099973	37099973	+	Silent	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:37099973C>T	ENST00000378079.2	-	8	1009	c.810G>A	c.(808-810)caG>caA	p.Q270Q		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	270										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						CTATCATTTCCTGCCAAACCA	0.388																																						ENST00000378079.2	0.950000	6.500000e-01	8.800000e-01	7.200000e-01	0.790000	0.807056	0.790000	0.810000																										0				20						c.(808-810)caG>caA		F-box protein 47							118.0	113.0	115.0					17																	37099973		2203	4300	6503	SO:0001819	synonymous_variant	494188	0	0					g.chr17:37099973C>T		CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.810G>A	chr17.hg19:g.37099973C>T		0						p.Q270Q	NM_001008777.2	NP_001008777.2	0	0	0	2.076819	Q5MNV8	FBX47_HUMAN		8	1009	-			B2RTZ4	Silent	SNP	ENST00000378079.2	1	1	hg19	c.810G>A	CCDS32639.1	0																																																																																								0.507488		TCGA-3A-A9IH-01A-12D-A397-08	0.388	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	1	0	1	2	2	2	2	0	0	0	0	85	0	85	85	1	1.830000	-3.762688	1	0.510000	NM_001008777		0	89	89	0	343	342	1		1			0	0	85	0	0	1.000000	0	0	0	0	0	0	89	343
WFIKKN2	124857	broad.mit.edu	37	17	48917431	48917431	+	Missense_Mutation	SNP	G	G	A	rs146708003		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:48917431G>A	ENST00000311378.4	+	2	1310	c.782G>A	c.(781-783)cGt>cAt	p.R261H	WFIKKN2_ENST00000426127.1_Missense_Mutation_p.R168H|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	261	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AACCATGTGCGTGGCAACGTG	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19393	0.0		0.0	False		,,,				2504	0.0					ENST00000311378.4	0.150000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.075182	0.060000	0.060000																										0				29						c.(781-783)cGt>cAt		WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2			HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	111.0	97.0	102.0		782	4.4	1.0	17	dbSNP_134	102	0,8600		0,0,4300	no	missense	WFIKKN2	NM_175575.5	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	261/577	48917431	1,13005	2203	4300	6503	SO:0001583	missense	124857	2	121412	35				g.chr17:48917431G>A	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.782G>A	chr17.hg19:g.48917431G>A	ENSP00000311184:p.Arg261His	0					WFIKKN2_ENST00000426127.1_Missense_Mutation_p.R168H|RP11-506D12.5_ENST00000572491.2_RNA	p.R261H	NM_175575.5	NP_783165.1	0	0	0	2.062199	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)	2	1310	+			Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	0	1	hg19	c.782G>A	CCDS11575.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.24	3.580087	0.65992	2.27E-4	0.0	ENSG00000173714	ENST00000426127;ENST00000311378	T;T	0.69806	-0.43;-0.43	5.44	4.41	0.53225	5.44	4.41	0.53225	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.360711	0.29126	N	0.013070	T	0.63803	0.2542	N	0.21448	0.665	0.43930	D	0.996584	D	0.54772	0.968	P	0.55871	0.786	T	0.57522	-0.7797	10	0.15952	T	0.53	.	15.6499	0.77084	0.0:0.1374:0.8626:0.0	.	261	Q8TEU8	WFKN2_HUMAN	H	168;261	ENSP00000405889:R168H;ENSP00000311184:R261H	ENSP00000311184:R261H	R	+	2	0	0	WFIKKN2	46272430	46272430	0.157000	0.22836	0.977000	0.42913	0.991000	0.79684	1.787000	0.38704	2.533000	0.85409	0.651000	0.88453	CGT	0.504950		TCGA-3A-A9IH-01A-12D-A397-08	0.617	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	0	0	1	2	2	2	2	0	0	0	0	68	0	68	66	1	1.830000	-5.189908	1	0.510000	NM_175575		0	4	4	0	251	246	0		1			0	0	68	0	0	0.886384	0	0	0	0	0	0	4	251
TP53	7157	broad.mit.edu	37	17	7578502	7578502	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:7578502A>T	ENST00000269305.4	-	5	617	c.428T>A	c.(427-429)gTg>gAg	p.V143E	TP53_ENST00000413465.2_Missense_Mutation_p.V143E|TP53_ENST00000420246.2_Missense_Mutation_p.V143E|TP53_ENST00000455263.2_Missense_Mutation_p.V143E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.V143E|TP53_ENST00000445888.2_Missense_Mutation_p.V143E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	143	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation; strong DNA binding ability at 32.5 degrees Celsius; strong reduction of transcriptional activity at 37.5 degrees Celsius; severely represses interaction with ZNF385A).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V143A(18)|p.0?(8)|p.V143E(5)|p.V11A(2)|p.V50A(2)|p.L137_W146del10(1)|p.P142_Q144delPVQ(1)|p.K139fs*4(1)|p.A138_V143delAKTCPV(1)|p.V143G(1)|p.V143_S149del(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCACAGCTGCACAGGGCAGGT	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	7.400000e-01	9.700000e-01	8.200000e-01	0.890000	0.896766	0.890000	0.930000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		42	Substitution - Missense(28)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(2)	p.V143A(18)|p.0?(8)|p.V143E(5)|p.V11A(2)|p.V50A(2)|p.L137_W146del10(1)|p.P142_Q144delPVQ(1)|p.K139fs*4(1)|p.A138_V143delAKTCPV(1)|p.V143G(1)|p.V143_S149del(1)|p.C141fs*5(1)	large_intestine(10)|stomach(7)|breast(6)|bone(4)|lung(3)|ovary(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|oesophagus(2)|vulva(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	24185						c.(427-429)gTg>gAg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						57.0	56.0	56.0					17																	7578502		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578502A>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.428T>A	chr17.hg19:g.7578502A>T	ENSP00000269305:p.Val143Glu	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.V143E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V143E|TP53_ENST00000420246.2_Missense_Mutation_p.V143E|TP53_ENST00000359597.4_Missense_Mutation_p.V143E|TP53_ENST00000413465.2_Missense_Mutation_p.V143E	p.V143E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.616215	P04637	P53_HUMAN		5	617	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.428T>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	A	13.76	2.333767	0.41297	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.48	1.94	0.25998	5.48	1.94	0.25998	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.343688	0.28219	N	0.016151	D	0.99697	0.9885	M	0.87381	2.88	0.48975	D	0.99973	D;D;D;D;D;D;D	0.89917	0.999;0.999;0.997;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.996;0.993;0.996;0.999;0.999;0.996	D	0.99035	1.0822	10	0.87932	D	0	-32.0412	3.2523	0.06819	0.6411:0.1439:0.0771:0.1378	.	104;143;143;50;143;143;143	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	143;143;143;143;143;143;132;50;11;50;11;143	ENSP00000410739:V143E;ENSP00000352610:V143E;ENSP00000269305:V143E;ENSP00000398846:V143E;ENSP00000391127:V143E;ENSP00000391478:V143E;ENSP00000425104:V11E;ENSP00000423862:V50E;ENSP00000424104:V143E	ENSP00000269305:V143E	V	-	2	0	0	TP53	7519227	7519227	1.000000	0.71417	0.664000	0.29753	0.012000	0.07955	9.264000	0.95635	0.097000	0.17492	-0.336000	0.08194	GTG	0.342282		TCGA-3A-A9IH-01A-12D-A397-08	0.587	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	58	0	58	56	1	1.830000	-20.000000	1	0.510000	NM_000546		0	70	67	0	149	147	1		1	1	1	0	0	58	1365	0	1.000000	9.999991e-01	1	28	372	21	784	70	149
PRKCA	5578	broad.mit.edu	37	17	64770147	64770147	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr17:64770147G>A	ENST00000413366.3	+	14	1593	c.1567G>A	c.(1567-1569)Gcc>Acc	p.A523T		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	523	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GGACTGGTGGGCCTATGGCGT	0.418																																						ENST00000413366.3	0.850000	5.800000e-01	7.800000e-01	6.400000e-01	0.700000	0.717233	0.700000	0.710000																										0				38						c.(1567-1569)Gcc>Acc		protein kinase C, alpha	Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)						303.0	274.0	283.0					17																	64770147		2203	4300	6503	SO:0001583	missense	5578	0	0					g.chr17:64770147G>A		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1567G>A	chr17.hg19:g.64770147G>A	ENSP00000408695:p.Ala523Thr	0						p.A523T	NM_002737.2	NP_002728	0	0	0	2.045659	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)	14	1593	+			B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	1	0	hg19	c.1567G>A	CCDS11664.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.975659	0.97162	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	T	0.31769	1.48	5.61	5.61	0.85477	5.61	5.61	0.85477	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.56731	0.2005	M	0.71296	2.17	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.70487	0.969;0.969	T	0.58624	-0.7604	10	0.87932	D	0	.	18.4403	0.90664	0.0:0.0:1.0:0.0	.	523;434	P17252;Q59FI5	KPCA_HUMAN;.	T	523;430	ENSP00000408695:A523T	ENSP00000284384:A430T	A	+	1	0	0	PRKCA	62200609	62200609	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.932000	0.75869	2.643000	0.89663	0.643000	0.83706	GCC	0.494533		TCGA-3A-A9IH-01A-12D-A397-08	0.418	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1	1	0	1	2	2	2	2	0	0	0	0	75	0	75	74	1	1.830000	-2.693634	1	0.510000			0	89	89	0	385	380	1		1	0		0	0	75	0	0	1.000000	9.996456e-01	0	0	0	53	0	89	385
MIB1	57534	broad.mit.edu	37	18	19429284	19429284	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr18:19429284T>C	ENST00000261537.6	+	17	2785	c.2521T>C	c.(2521-2523)Tct>Cct	p.S841P	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	841					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TGCTACCTGTTCTTTATGTTC	0.343																																						ENST00000261537.6	0.600000	3.800000e-01	5.500000e-01	4.300000e-01	0.480000	0.492857	0.480000	0.490000																										0				27						c.(2521-2523)Tct>Cct		mindbomb E3 ubiquitin protein ligase 1							166.0	154.0	158.0					18																	19429284		2203	4300	6503	SO:0001583	missense	57534	0	0					g.chr18:19429284T>C	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2521T>C	chr18.hg19:g.19429284T>C	ENSP00000261537:p.Ser841Pro	1					MIB1_ENST00000578646.1_3'UTR	p.S841P	NM_020774.2	NP_065825.1	0	0	0	1.748838	Q86YT6	MIB1_HUMAN	STAD - Stomach adenocarcinoma(5;0.212)	17	2785	+			B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	1	1	hg19	c.2521T>C	CCDS11871.1	0	.	.	.	.	.	.	.	.	.	.	T	18.12	3.554016	0.65425	.	.	ENSG00000101752	ENST00000261537	T	0.79554	-1.28	5.33	5.33	0.75918	5.33	5.33	0.75918	Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.88422	0.6432	M	0.77103	2.36	0.80722	D	1	P	0.49961	0.93	P	0.62184	0.899	D	0.88191	0.2877	10	0.40728	T	0.16	-11.9712	15.3214	0.74124	0.0:0.0:0.0:1.0	.	841	Q86YT6	MIB1_HUMAN	P	841	ENSP00000261537:S841P	ENSP00000261537:S841P	S	+	1	0	0	MIB1	17683282	17683282	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.019000	0.59389	0.477000	0.44152	TCT	0.414436		TCGA-3A-A9IH-01A-12D-A397-08	0.343	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	1	0	1	2	2	2	2	0	0	0	0	102	0	102	102	1	1.830000	-20.000000	1	0.510000	NM_020774		0	68	67	0	388	387	1		1	1		0	0	102	0	0	1.000000	4.555024e-01	0	3	0	7	0	68	388
SMAD4	4089	broad.mit.edu	37	18	48575093	48575093	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr18:48575093C>A	ENST00000342988.3	+	3	825	c.287C>A	c.(286-288)gCc>gAc	p.A96D	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000452201.2_Missense_Mutation_p.A96D|SMAD4_ENST00000398417.2_Missense_Mutation_p.A96D|SMAD4_ENST00000588745.1_Missense_Mutation_p.A96D	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	96	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GTGATCTATGCCCGTCTCTGG	0.368																																						ENST00000342988.3	0.700000	3.900000e-01	6.300000e-01	4.600000e-01	0.530000	0.547014	0.530000	0.540000																										40	Whole gene deletion(36)|Unknown(4)	p.0?(36)|p.?(4)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	454						c.(286-288)gCc>gAc		SMAD family member 4							155.0	142.0	147.0					18																	48575093		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48575093C>A	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.287C>A	chr18.hg19:g.48575093C>A	ENSP00000341551:p.Ala96Asp	1					SMAD4_ENST00000452201.2_Missense_Mutation_p.A96D|SMAD4_ENST00000588745.1_Missense_Mutation_p.A96D|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.A96D	p.A96D	NM_005359.5	NP_005350.1	0	1	1	1.509155	Q13485	SMAD4_HUMAN		3	825	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.287C>A	CCDS11950.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.107210	0.94292	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	T;T;T	0.78246	-1.16;-1.16;-1.16	5.32	5.32	0.75619	5.32	5.32	0.75619	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.86973	0.6062	M	0.70595	2.14	0.80722	D	1	D	0.71674	0.998	D	0.66497	0.944	D	0.88383	0.3003	10	0.87932	D	0	.	17.7655	0.88476	0.0:1.0:0.0:0.0	.	96	Q13485	SMAD4_HUMAN	D	96	ENSP00000409551:A96D;ENSP00000341551:A96D;ENSP00000381452:A96D	ENSP00000341551:A96D	A	+	2	0	0	SMAD4	46829091	46829091	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.064000	0.71169	2.463000	0.83235	0.585000	0.79938	GCC	0.344525		TCGA-3A-A9IH-01A-12D-A397-08	0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	57	0	57	57	1	1.830000	-19.884910	1	0.510000	NM_005359		0	35	35	0	154	151	1		1	1	1	0	0	57	286	0	1.000000	9.714005e-01	1	8	57	20	193	35	154
DCC	1630	broad.mit.edu	37	18	50450207	50450207	+	Silent	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr18:50450207C>T	ENST00000442544.2	+	4	1444	c.828C>T	c.(826-828)ggC>ggT	p.G276G	DCC_ENST00000412726.1_Silent_p.G124G	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	276	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGTTACGAGGCGAGGAAGTCA	0.373																																						ENST00000442544.2	0.920000	6.400000e-01	8.500000e-01	7.000000e-01	0.770000	0.785232	0.770000	0.780000																										0				148						c.(826-828)ggC>ggT		DCC netrin 1 receptor							123.0	101.0	108.0					18																	50450207		2203	4300	6503	SO:0001819	synonymous_variant	1630	0	0					g.chr18:50450207C>T	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.828C>T	chr18.hg19:g.50450207C>T		1					DCC_ENST00000412726.1_Silent_p.G124G	p.G276G	NM_005215.3	NP_005206.2	0	1	1	1.509155	P43146	DCC_HUMAN		4	1444	+		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Silent	SNP	ENST00000442544.2	1	1	hg19	c.828C>T	CCDS11952.1	0																																																																																								0.344525		TCGA-3A-A9IH-01A-12D-A397-08	0.373	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	1	0	1	2	2	2	2	0	0	0	0	55	0	55	55	1	1.830000	-20.000000	1	0.510000	NM_005215		0	85	85	0	232	231	1		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	85	232
ZNF569	148266	broad.mit.edu	37	19	37905084	37905084	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr19:37905084A>T	ENST00000316950.6	-	6	1033	c.476T>A	c.(475-477)cTt>cAt	p.L159H	ZNF569_ENST00000392150.2_5'UTR|ZNF569_ENST00000392149.2_Missense_Mutation_p.L159H	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTTCTCATAAGGCATTTCAC	0.333																																						ENST00000316950.6	0.720000	4.100000e-01	6.400000e-01	4.700000e-01	0.550000	0.564391	0.550000	0.560000																										0				40						c.(475-477)cTt>cAt		zinc finger protein 569							87.0	84.0	85.0					19																	37905084		2203	4300	6503	SO:0001583	missense	148266	0	0					g.chr19:37905084A>T	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.476T>A	chr19.hg19:g.37905084A>T	ENSP00000325018:p.Leu159His	0					ZNF569_ENST00000392150.2_5'UTR|ZNF569_ENST00000392149.2_Missense_Mutation_p.L159H	p.L159H	NM_152484.2	NP_689697.2	0	0	0	1.993156	Q5MCW4	ZN569_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	6	1033	-			A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	1	1	hg19	c.476T>A	CCDS12503.1	0	.	.	.	.	.	.	.	.	.	.	A	0.031	-1.332860	0.01298	.	.	ENSG00000196437	ENST00000316950	T	0.07688	3.17	3.37	1.09	0.20402	3.37	1.09	0.20402	.	1.309050	0.05886	N	0.627427	T	0.04588	0.0125	N	0.24115	0.695	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.39272	-0.9622	10	0.02654	T	1	.	2.6069	0.04880	0.4596:0.0:0.1298:0.4106	.	159	Q5MCW4	ZN569_HUMAN	H	159	ENSP00000325018:L159H	ENSP00000325018:L159H	L	-	2	0	0	ZNF569	42596924	42596924	0.000000	0.05858	0.000000	0.03702	0.834000	0.47266	0.045000	0.14013	0.060000	0.16281	0.482000	0.46254	CTT	0.486427		TCGA-3A-A9IH-01A-12D-A397-08	0.333	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	1	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	1.830000	-19.857770	1	0.510000	NM_152484		0	42	42	0	240	240	1		1	0		0	0	46	0	0	1.000000	6.277014e-02	0	0	0	3	0	42	240
ZNF175	7728	broad.mit.edu	37	19	52091537	52091537	+	Silent	SNP	G	G	A	rs551032620		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr19:52091537G>A	ENST00000262259.2	+	5	2311	c.1953G>A	c.(1951-1953)tcG>tcA	p.S651S	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	651					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		GTGGGAAATCGTTCAGTAAGA	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		20296	0.0		0.0	False		,,,				2504	0.001					ENST00000262259.2	1.000000	6.700000e-01	9.300000e-01	7.500000e-01	0.830000	0.841983	0.830000	1.000000																										0				24						c.(1951-1953)tcG>tcA		zinc finger protein 175							83.0	77.0	79.0					19																	52091537		2203	4300	6503	SO:0001819	synonymous_variant	7728	4	121412	40				g.chr19:52091537G>A	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1953G>A	chr19.hg19:g.52091537G>A		0					ZNF175_ENST00000436511.2_Intron	p.S651S	NM_007147.2	NP_009078.1	0	0	0	2.074281	Q9Y473	ZN175_HUMAN		5	2311	+		all_neural(266;0.0299)	A8K9H2	Silent	SNP	ENST00000262259.2	1	1	hg19	c.1953G>A	CCDS12837.1	0																																																																																								0.507488		TCGA-3A-A9IH-01A-12D-A397-08	0.438	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	1	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	1.830000	-20.000000	1	0.510000	NM_007147		0	71	70	0	259	257	1		1	1		0	0	49	0	0	1.000000	6.690577e-01	0	2	0	8	0	71	259
PEG3	5178	broad.mit.edu	37	19	57328017	57328017	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr19:57328017C>T	ENST00000326441.9	-	10	2156	c.1793G>A	c.(1792-1794)cGt>cAt	p.R598H	PEG3_ENST00000593695.1_Missense_Mutation_p.R472H|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.R474H|PEG3_ENST00000423103.2_Missense_Mutation_p.R598H	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	598					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R598H(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ttcacgttcacgttcatgttc	0.458																																						ENST00000326441.9	0.200000	3.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.106352	0.090000	0.090000																										2	Substitution - Missense(2)	p.R598H(2)	ovary(2)	170						c.(1792-1794)cGt>cAt		paternally expressed 3							106.0	83.0	91.0					19																	57328017		2203	4300	6503	SO:0001583	missense	5178	0	0					g.chr19:57328017C>T	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1793G>A	chr19.hg19:g.57328017C>T	ENSP00000326581:p.Arg598His	0					PEG3_ENST00000598410.1_Missense_Mutation_p.R474H|PEG3_ENST00000423103.2_Missense_Mutation_p.R598H|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R472H|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron	p.R598H	NM_006210.2	NP_006201.1	0	0	0	2.056173	Q9GZU2	PEG3_HUMAN		10	2156	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	0	1	hg19	c.1793G>A	CCDS12948.1	0	.	.	.	.	.	.	.	.	.	.	C	0.743	-0.775804	0.02951	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02863	4.13;4.13	1.08	-0.0769	0.13721	1.08	-0.0769	0.13721	.	.	.	.	.	T	0.02193	0.0068	L	0.50333	1.59	.	.	.	B;B;P	0.40107	0.055;0.291;0.703	B;B;B	0.23150	0.001;0.013;0.044	T	0.41251	-0.9519	8	0.56958	D	0.05	.	3.4582	0.07523	0.0:0.7126:0.0:0.2874	.	474;598;533	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	H	598	ENSP00000326581:R598H;ENSP00000403051:R598H	ENSP00000326581:R598H	R	-	2	0	0	ZIM2	62019829	62019829	0.000000	0.05858	0.010000	0.14722	0.165000	0.22458	-0.044000	0.12023	0.063000	0.16370	0.525000	0.51046	CGT	0.504950		TCGA-3A-A9IH-01A-12D-A397-08	0.458	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2	0	0	1	2	2	2	2	0	0	0	0	40	0	40	39	1	1.830000	-3.214203	1	0.510000			0	5	5	0	211	208	0		1			0	0	40	0	0	0.935956	0	0	0	0	0	0	5	211
CTSS	1520	broad.mit.edu	37	1	150722622	150722622	+	Missense_Mutation	SNP	T	T	G			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr1:150722622T>G	ENST00000368985.3	-	6	913	c.653A>C	c.(652-654)aAa>aCa	p.K218T	CTSS_ENST00000480760.1_Intron|CTSS_ENST00000448301.2_Missense_Mutation_p.K168T	NM_001199739.1|NM_004079.4	NP_001186668.1|NP_004070.3	P25774	CATS_HUMAN	cathepsin S	218					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|basement membrane disassembly (GO:0034769)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of inflammatory response (GO:0050729)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	15	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			AGCACGATATTTTGAGTCATA	0.393																																						ENST00000368985.3	1.000000	7.800000e-01	1	8.700000e-01	0.960000	0.946323	0.960000	1.000000																										0				15						c.(652-654)aAa>aCa		cathepsin S							104.0	89.0	94.0					1																	150722622		2203	4300	6503	SO:0001583	missense	1520	0	0					g.chr1:150722622T>G	M90696	CCDS968.1, CCDS55634.1	1q21	2008-02-05			ENSG00000163131	ENSG00000163131	3.4.22.27	"""Cathepsins"""	2545	protein-coding gene	gene with protein product		116845				1373132	Standard	NM_001199739		Approved		uc001evn.3	P25774	OTTHUMG00000035010	ENST00000368985.3:c.653A>C	chr1.hg19:g.150722622T>G	ENSP00000357981:p.Lys218Thr	0					CTSS_ENST00000480760.1_Intron|CTSS_ENST00000448301.2_Missense_Mutation_p.K168T	p.K218T	NM_001199739.1|NM_004079.4	NP_001186668.1|NP_004070.3	1	2	3	2.139769	P25774	CATS_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)	6	913	-	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		B4DWC9|D3DV05|Q5T5I0|Q6FHS5|Q9BUG3	Missense_Mutation	SNP	ENST00000368985.3	1	1	hg19	c.653A>C	CCDS968.1	1	.	.	.	.	.	.	.	.	.	.	T	5.005	0.186606	0.09547	.	.	ENSG00000163131	ENST00000448301;ENST00000368985	D;T	0.97598	-4.45;1.98	5.45	3.18	0.36537	5.45	3.18	0.36537	Peptidase C1A, papain C-terminal (2);	0.409268	0.29668	N	0.011514	T	0.78534	0.4298	N	0.02213	-0.635	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.14023	0.005;0.01	T	0.73107	-0.4087	10	0.20046	T	0.44	.	6.2497	0.20839	0.0:0.0981:0.3428:0.5592	.	168;218	B4DWC9;P25774	.;CATS_HUMAN	T	168;218	ENSP00000408414:K168T;ENSP00000357981:K218T	ENSP00000357981:K218T	K	-	2	0	0	CTSS	148989246	148989246	0.000000	0.05858	0.088000	0.20740	0.438000	0.31896	0.260000	0.18424	0.910000	0.36722	0.383000	0.25322	AAA	0.517384		TCGA-3A-A9IH-01A-12D-A397-08	0.393	CTSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084737.1	1	0	1	2	2	2	2	0	0	0	0	56	0	56	54	1	1.830000	-20.000000	1	0.510000	NM_004079		0	82	82	0	257	254	1		1	1		0	0	56	0	0	1.000000	1	0	291	0	360	0	82	257
ASH1L	55870	broad.mit.edu	37	1	155449582	155449582	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr1:155449582C>T	ENST00000368346.3	-	3	3718	c.3079G>A	c.(3079-3081)Gcc>Acc	p.A1027T	ASH1L_ENST00000392403.3_Missense_Mutation_p.A1027T			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1027					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CCAAATGTGGCAGCAAGACTT	0.368																																						ENST00000368346.3	1.000000	8.600000e-01	1	9.400000e-01	0.990000	0.980335	0.990000	1.000000																										0				124						c.(3079-3081)Gcc>Acc		ash1 (absent, small, or homeotic)-like (Drosophila)							71.0	74.0	73.0					1																	155449582		2203	4300	6503	SO:0001583	missense	55870	0	0					g.chr1:155449582C>T	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3079G>A	chr1.hg19:g.155449582C>T	ENSP00000357330:p.Ala1027Thr	0					ASH1L_ENST00000392403.3_Missense_Mutation_p.A1027T	p.A1027T			1	2	3	2.145639	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)	3	3718	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	1	1	hg19	c.3079G>A		1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.732582	0.69189	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.91464	-2.85;-2.85	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.88760	0.6524	N	0.11560	0.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.89864	0.4018	10	0.41790	T	0.15	.	18.7909	0.91974	0.0:1.0:0.0:0.0	.	1027;1027	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	T	1027	ENSP00000357330:A1027T;ENSP00000376204:A1027T	ENSP00000357330:A1027T	A	-	1	0	0	ASH1L	153716206	153716206	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.773000	0.95371	0.655000	0.94253	GCC	0.517384		TCGA-3A-A9IH-01A-12D-A397-08	0.368	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	1	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	1.830000	-20.000000	1	0.510000	NM_018489		0	104	102	0	298	294	1		1	0		0	0	54	0	0	1.000000	5.777290e-01	0	1	0	6	0	104	298
EPB41	2035	broad.mit.edu	37	1	29314224	29314224	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr1:29314224C>A	ENST00000343067.4	+	2	402	c.275C>A	c.(274-276)tCt>tAt	p.S92Y	EPB41_ENST00000349460.4_5'UTR|EPB41_ENST00000356093.2_Missense_Mutation_p.S92Y|EPB41_ENST00000398863.2_Missense_Mutation_p.S92Y|EPB41_ENST00000347529.3_Missense_Mutation_p.S92Y|EPB41_ENST00000373797.1_Missense_Mutation_p.S92Y|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000373798.1_Missense_Mutation_p.S92Y|EPB41_ENST00000373800.3_5'UTR	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	92					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		AGGCCCAAATCTCAGGTGTCC	0.443																																						ENST00000343067.4	1.000000	8.700000e-01	1	9.400000e-01	0.990000	0.982372	0.990000	1.000000																										0				14						c.(274-276)tCt>tAt		erythrocyte membrane protein band 4.1							126.0	122.0	124.0					1																	29314224		2203	4300	6503	SO:0001583	missense	2035	0	0					g.chr1:29314224C>A	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.275C>A	chr1.hg19:g.29314224C>A	ENSP00000345259:p.Ser92Tyr	0					EPB41_ENST00000398863.2_Missense_Mutation_p.S92Y|EPB41_ENST00000373797.1_Missense_Mutation_p.S92Y|EPB41_ENST00000349460.4_5'UTR|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000356093.2_Missense_Mutation_p.S92Y|EPB41_ENST00000347529.3_Missense_Mutation_p.S92Y|EPB41_ENST00000373798.1_Missense_Mutation_p.S92Y|EPB41_ENST00000373800.3_5'UTR	p.S92Y	NM_001166005.1	NP_001159477.1	1	2	3	2.131992	P11171	41_HUMAN		2	402	+		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	1	1	hg19	c.275C>A	CCDS53288.1	1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817592	0.70912	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D	0.89270	-2.39;-2.35;-2.23;-2.49;-2.39;-2.4	5.6	4.69	0.59074	5.6	4.69	0.59074	.	0.246899	0.35646	N	0.003068	D	0.91181	0.7222	L	0.32530	0.975	0.41562	D	0.988632	D;D;D;D;D	0.89917	0.999;0.997;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.983;0.998;0.999;0.998	D	0.92387	0.5918	10	0.72032	D	0.01	.	15.2268	0.73357	0.1417:0.8583:0.0:0.0	.	92;92;92;92;92	C9JTS2;P11171;P11171-2;P11171-7;P11171-5	.;41_HUMAN;.;.;.	Y	109;92;92;92;92;92;92;92;92	ENSP00000345259:S92Y;ENSP00000348397:S92Y;ENSP00000381839:S92Y;ENSP00000290100:S92Y;ENSP00000362904:S92Y;ENSP00000362903:S92Y	ENSP00000345259:S92Y	S	+	2	0	0	EPB41	29186811	29186811	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	3.161000	0.50747	1.375000	0.46248	-0.133000	0.14855	TCT	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.443	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	1	0	1	2	2	2	2	0	0	0	0	79	0	79	76	1	1.830000	-20.000000	1	0.510000	NM_203342		0	134	131	0	383	377	1		1	1		0	0	79	0	0	1.000000	9.789110e-01	0	9	0	11	0	134	383
OR2G2	81470	broad.mit.edu	37	1	247751947	247751947	+	Missense_Mutation	SNP	G	G	A	rs372540193		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr1:247751947G>A	ENST00000320065.1	+	1	286	c.286G>A	c.(286-288)Gcc>Acc	p.A96T	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GAAAACTATCGCCTATGGTGG	0.527																																						ENST00000320065.1	1.000000	5.100000e-01	7.100000e-01	5.700000e-01	0.630000	0.649909	0.630000	0.630000																										0				45						c.(286-288)Gcc>Acc		olfactory receptor, family 2, subfamily G, member 2		A	THR/ALA	0,4406		0,0,2203	194.0	157.0	169.0		286	-1.9	0.8	1		169	1,8599	819.2+/-406.8	0,1,4299	no	missense	OR2G2	NM_001001915.1	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	96/318	247751947	1,13005	2203	4300	6503	SO:0001583	missense	81470	2	121412	41				g.chr1:247751947G>A	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.286G>A	chr1.hg19:g.247751947G>A	ENSP00000326349:p.Ala96Thr	0					RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	p.A96T	NM_001001915.1	NP_001001915.1	1	2	3	2.131603	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)	1	286	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	1	1	hg19	c.286G>A	CCDS31092.1	0	.	.	.	.	.	.	.	.	.	.	A	3.757	-0.050345	0.07407	0.0	1.16E-4	ENSG00000177489	ENST00000320065	T	0.01084	5.36	4.29	-1.92	0.07618	4.29	-1.92	0.07618	GPCR, rhodopsin-like superfamily (1);	0.226724	0.21845	N	0.068280	T	0.00384	0.0012	N	0.00303	-1.675	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45760	-0.9239	10	0.33141	T	0.24	.	6.2696	0.20947	0.29:0.0:0.086:0.624	.	96	Q8NGZ5	OR2G2_HUMAN	T	96	ENSP00000326349:A96T	ENSP00000326349:A96T	A	+	1	0	0	OR2G2	245818570	245818570	0.000000	0.05858	0.761000	0.31378	0.087000	0.18053	0.484000	0.22308	-0.476000	0.06842	-0.333000	0.08304	GCC	0.514948		TCGA-3A-A9IH-01A-12D-A397-08	0.527	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1	1	0	1	2	2	2	2	0	0	0	0	50	0	50	50	1	1.830000	-20.000000	1	0.510000			0	81	81	0	424	419	1		1			0	0	50	0	0	1.000000	0	0	0	0	0	0	81	424
PAX1	5075	broad.mit.edu	37	20	21687488	21687488	+	Silent	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr20:21687488G>A	ENST00000398485.2	+	2	753	c.699G>A	c.(697-699)ccG>ccA	p.P233P	PAX1_ENST00000460221.1_Intron|PAX1_ENST00000444366.2_Silent_p.P209P	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	233					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						AGCCCGGACCGTACGAGGCAA	0.642																																						ENST00000398485.2	1.000000	2.000000e-02	1	4.000000e-02	0.070000	0.229816	0.070000	0.060000																										0				38						c.(697-699)ccG>ccA		paired box 1							37.0	44.0	41.0					20																	21687488		2202	4299	6501	SO:0001819	synonymous_variant	5075	0	0					g.chr20:21687488G>A		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.699G>A	chr20.hg19:g.21687488G>A		1					PAX1_ENST00000460221.1_Intron|PAX1_ENST00000444366.2_Silent_p.P209P	p.P233P	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	0	2	2	2.139153	P15863	PAX1_HUMAN		2	753	+			B4E0D6|Q642X9|Q6NTC0|Q9Y558	Silent	SNP	ENST00000398485.2	0	1	hg19	c.699G>A	CCDS13146.2	0																																																																																								0.510000		TCGA-3A-A9IH-01A-12D-A397-08	0.642	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3	0	0	1	2	2	2	2	0	0	0	0	77	0	77	72	1	1.830000	-3.089679	1	0.510000			0	5	5	0	288	287	0		1			0	0	77	0	0	0.937504	0	0	0	0	0	0	5	288
BCAS1	8537	broad.mit.edu	37	20	52570062	52570062	+	Missense_Mutation	SNP	G	G	A	rs201134866	byFrequency	TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr20:52570062G>A	ENST00000395961.3	-	11	1755	c.1589C>T	c.(1588-1590)aCg>aTg	p.T530M	BCAS1_ENST00000371440.3_Missense_Mutation_p.T539M|BCAS1_ENST00000371435.2_Missense_Mutation_p.T452M|BCAS1_ENST00000434986.2_Missense_Mutation_p.T196M	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	530						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CGTGTCCACCGTGGCCTGCTC	0.562													G|||	6	0.00119808	0.0	0.0	5008	,	,		18474	0.006		0.0	False		,,,				2504	0.0					ENST00000395961.3	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.061241	0.050000	0.060000																										0				37						c.(1588-1590)aCg>aTg		breast carcinoma amplified sequence 1							240.0	187.0	205.0					20																	52570062		2203	4300	6503	SO:0001583	missense	8537	51	121410	50				g.chr20:52570062G>A	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.1589C>T	chr20.hg19:g.52570062G>A	ENSP00000379290:p.Thr530Met	0					BCAS1_ENST00000371435.2_Missense_Mutation_p.T452M|BCAS1_ENST00000434986.2_Missense_Mutation_p.T196M|BCAS1_ENST00000371440.3_Missense_Mutation_p.T539M	p.T530M	NM_003657.2	NP_003648.2	1	2	3	2.097570	O75363	BCAS1_HUMAN	STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)	11	1755	-	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	0	1	hg19	c.1589C>T	CCDS13444.1	0	3|3	0.0013736263736263737|0.0013736263736263737	0|0	0.0|0.0	0|0	0.0|0.0	3|3	0.005244755244755245|0.005244755244755245	0|0	0.0|0.0	G|G	13.51|13.51	2.259581|2.259581	0.39995|0.39995	.|.	.|.	ENSG00000064787|ENSG00000064787	ENST00000422805|ENST00000448484;ENST00000371440;ENST00000448710;ENST00000395961;ENST00000371435;ENST00000434986	.|T;T;T;T;T	.|0.32515	.|2.15;2.41;2.45;2.41;1.45	5.17|5.17	-10.3|-10.3	0.00346|0.00346	5.17|5.17	-10.3|-10.3	0.00346|0.00346	.|.	.|1.843200	.|0.02444	.|N	.|0.084842	T|T	0.16685|0.16685	0.0401|0.0401	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B;B;B;D;D	.|0.64830	.|0.067;0.209;0.067;0.239;0.994;0.994	.|B;B;B;B;P;P	.|0.51833	.|0.016;0.055;0.016;0.057;0.681;0.681	T|T	0.50448|0.50448	-0.8827|-0.8827	5|10	.|0.44086	.|T	.|0.13	2.3235|2.3235	4.623|4.623	0.12465|0.12465	0.5131:0.2359:0.1717:0.0793|0.5131:0.2359:0.1717:0.0793	.|.	.|530;196;539;452;530;530	.|B2RCQ5;B4DFL4;O75363-2;G3XAF7;A0AVG7;O75363	.|.;.;.;.;.;BCAS1_HUMAN	W|M	193|401;539;330;530;452;196	.|ENSP00000396361:T401M;ENSP00000360495:T539M;ENSP00000379290:T530M;ENSP00000360490:T452M;ENSP00000409956:T196M	.|ENSP00000360490:T452M	R|T	-|-	1|2	2|0	2|0	BCAS1|BCAS1	52003469|52003469	52003469|52003469	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.022000|0.022000	0.10575|0.10575	-1.697000|-1.697000	0.01910|0.01910	-2.036000|-2.036000	0.00922|0.00922	-0.228000|-0.228000	0.12330|0.12330	CGG|ACG	0.511246		TCGA-3A-A9IH-01A-12D-A397-08	0.562	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	0	0	1	2	2	2	2	0	0	0	0	48	0	48	47	1	1.830000	-2.780121	1	0.510000	NM_003657		0	5	5	0	377	375	0		1	0		0	0	48	0	0	0.937069	9.116354e-01	0	0	0	332	0	5	377
CABIN1	23523	broad.mit.edu	37	22	24447387	24447387	+	Missense_Mutation	SNP	C	C	T	rs200916276	byFrequency	TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr22:24447387C>T	ENST00000398319.2	+	8	1142	c.757C>T	c.(757-759)Cgg>Tgg	p.R253W	CABIN1_ENST00000263119.5_Missense_Mutation_p.R253W|CABIN1_ENST00000405822.2_Intron	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	253					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCTGATTGTGCGGGAGAAGGA	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		19052	0.001		0.0	False		,,,				2504	0.001					ENST00000398319.2	0.110000	1.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.059045	0.050000	0.050000																										0				65						c.(757-759)Cgg>Tgg		calcineurin binding protein 1							114.0	99.0	104.0					22																	24447387		2203	4300	6503	SO:0001583	missense	23523	23	121412	44				g.chr22:24447387C>T	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.757C>T	chr22.hg19:g.24447387C>T	ENSP00000381364:p.Arg253Trp	1					CABIN1_ENST00000263119.5_Missense_Mutation_p.R253W|CABIN1_ENST00000405822.2_Intron	p.R253W	NM_001199281.1	NP_001186210.1	0	1	1	2.005203	Q9Y6J0	CABIN_HUMAN		8	1142	+			G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	0	1	hg19	c.757C>T	CCDS13823.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.86	3.492173	0.64074	.	.	ENSG00000099991	ENST00000454754;ENST00000263119;ENST00000445422;ENST00000398319;ENST00000536026	T;T;T;T	0.62364	0.38;0.03;0.38;0.03	5.32	3.11	0.35812	5.32	3.11	0.35812	.	0.176588	0.51477	D	0.000099	T	0.65396	0.2687	L	0.50333	1.59	0.80722	D	1	D;D;D	0.65815	0.995;0.994;0.987	P;P;B	0.51945	0.685;0.606;0.394	T	0.68526	-0.5385	10	0.72032	D	0.01	.	13.6165	0.62110	0.2825:0.7175:0.0:0.0	.	208;253;253	C9J068;F5H5W5;Q9Y6J0	.;.;CABIN_HUMAN	W	208;253;208;253;253	ENSP00000394209:R208W;ENSP00000263119:R253W;ENSP00000412389:R208W;ENSP00000381364:R253W	ENSP00000263119:R253W	R	+	1	2	2	CABIN1	22777387	22777387	1.000000	0.71417	0.517000	0.27799	0.631000	0.37964	2.925000	0.48884	0.672000	0.31204	0.551000	0.68910	CGG	0.344525		TCGA-3A-A9IH-01A-12D-A397-08	0.552	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	0	0	1	2	2	2	2	0	0	0	0	61	0	61	61	1	1.830000	-2.616011	1	0.510000	NM_012295		0	5	5	0	289	287	0		1	0		0	0	61	0	0	0.936940	1.774236e-01	0	0	0	37	0	5	289
MYO18B	84700	broad.mit.edu	37	22	26173732	26173733	+	Missense_Mutation	DNP	GG	GG	AC			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr22:26173732_26173733GG>AC	ENST00000407587.2	+	8	2221_2222	c.2052_2053GG>AC	c.(2050-2055)gtGGat>gtACat	p.D685H	MYO18B_ENST00000335473.7_Missense_Mutation_p.D685H|MYO18B_ENST00000536101.1_Missense_Mutation_p.D685H			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	685	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CAGGCAGTGTGGATGGCAGGGT	0.589																																						ENST00000407587.2			0	0																														0				146						c.(2050-2052)gtG>gtA|c.(2053-2055)Gat>Cat		myosin XVIIIB																																				SO:0001583	missense	84700	0	0					g.chr22:26173732G>A|g.chr22:26173733G>C	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	Exception_encountered	chr22.hg19:g.26173732_26173733delinsAC	ENSP00000386096:p.Asp685His						MYO18B_ENST00000335473.7_Silent_p.V684V|MYO18B_ENST00000536101.1_Silent_p.V684V|MYO18B_ENST00000335473.7_Missense_Mutation_p.D685H|MYO18B_ENST00000536101.1_Missense_Mutation_p.D685H	p.V684V|p.D685H							Q8IUG5	MY18B_HUMAN		8	2221|2222	+			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent|Missense_Mutation	SNP	ENST00000407587.2	1	1	hg19	c.2052G>A|c.2053G>C																											|5.41	|4.39	|0.52855																																												|0			|24503733																TCGA-3A-A9IH-01A-12D-A397-08	0.589	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	1	0	1	2	2	2	2	0	0	0	0	114	0	114|115	111|112	1	1.830000	-3.143323|-20.000000	1	0.510000	NM_032608		0	57	55	0	345|339	338|332	1		1			0	0	114|115	0	0	1.000000	0	0	0	0	0	0	57	339
BIRC6	57448	broad.mit.edu	37	2	32582309	32582309	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr2:32582309G>A	ENST00000421745.2	+	1	214	c.80G>A	c.(79-81)cGg>cAg	p.R27Q		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	27					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGCGCAGGCCGGAAGATGGCG	0.746																																					Pancreas(94;175 1509 16028 18060 45422)	ENST00000421745.2	1.000000	8.300000e-01	1	9.900000e-01	0.990000	0.989252	0.990000	1.000000																										0				172						c.(79-81)cGg>cAg		baculoviral IAP repeat containing 6							2.0	2.0	2.0					2																	32582309		1620	3581	5201	SO:0001583	missense	57448	0	0					g.chr2:32582309G>A	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.80G>A	chr2.hg19:g.32582309G>A	ENSP00000393596:p.Arg27Gln	0						p.R27Q	NM_016252.3	NP_057336	0	0	0	2.047096	Q9NR09	BIRC6_HUMAN		1	214	+	Acute lymphoblastic leukemia(172;0.155)		Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	0	1	hg19	c.80G>A	CCDS33175.2	1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653258	0.88056	.	.	ENSG00000115760	ENST00000421745	T	0.74947	-0.89	3.94	3.94	0.45596	3.94	3.94	0.45596	.	.	.	.	.	T	0.58623	0.2135	N	0.08118	0	0.30688	N	0.75164	D	0.63880	0.993	B	0.44108	0.441	T	0.63839	-0.6546	9	0.62326	D	0.03	.	13.3635	0.60669	0.0:0.0:1.0:0.0	.	27	Q9NR09	BIRC6_HUMAN	Q	27	ENSP00000393596:R27Q	ENSP00000393596:R27Q	R	+	2	0	0	BIRC6	32435813	32435813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.268000	0.51585	2.198000	0.70561	0.563000	0.77884	CGG	0.499796		TCGA-3A-A9IH-01A-12D-A397-08	0.746	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	1	0	1	2	2	2	2	0	0	0	0	8	0	8	8	1	1.830000	-20.000000	1	0.510000	NM_016252		0	11	11	0	18	18	0		1	0		0	0	8	0	0	0.999351	0	0	0	0	1	0	11	18
RETSAT	54884	broad.mit.edu	37	2	85571747	85571747	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr2:85571747T>C	ENST00000295802.4	-	7	1338	c.1226A>G	c.(1225-1227)tAt>tGt	p.Y409C	RETSAT_ENST00000457495.2_Missense_Mutation_p.Y348C|RETSAT_ENST00000475624.2_Intron|RETSAT_ENST00000263854.6_Missense_Mutation_p.Y409C	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	409					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	ATAGTAAACATAGTAGTTGGT	0.567																																						ENST00000295802.4	0.990000	6.200000e-01	9.000000e-01	7.100000e-01	0.800000	0.811984	0.800000	0.810000																										0				30						c.(1225-1227)tAt>tGt		retinol saturase (all-trans-retinol 13,14-reductase)	Vitamin A(DB00162)						132.0	107.0	116.0					2																	85571747		2203	4300	6503	SO:0001583	missense	54884	0	0					g.chr2:85571747T>C	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1226A>G	chr2.hg19:g.85571747T>C	ENSP00000295802:p.Tyr409Cys	0					RETSAT_ENST00000475624.2_Intron|RETSAT_ENST00000457495.2_Missense_Mutation_p.Y348C|RETSAT_ENST00000263854.6_Missense_Mutation_p.Y409C	p.Y409C	NM_017750.3	NP_060220.3	0	0	0	2.047096	Q6NUM9	RETST_HUMAN		7	1338	-			A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	1	1	hg19	c.1226A>G	CCDS1972.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.11|16.11	3.031158|3.031158	0.54790|0.54790	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000449375|ENST00000295802;ENST00000263854;ENST00000457495	.|T;T	.|0.23754	.|1.92;1.89	4.62|4.62	0.301|0.301	0.15781|0.15781	4.62|4.62	0.301|0.301	0.15781|0.15781	.|.	.|0.505894	.|0.23504	.|N	.|0.047471	T|T	0.35189|0.35189	0.0923|0.0923	L|L	0.60455|0.60455	1.87|1.87	0.31918|0.31918	N|N	0.613849|0.613849	.|D;D;D	.|0.62365	.|0.991;0.967;0.985	.|P;P;P	.|0.57324	.|0.818;0.818;0.571	T|T	0.43393|0.43393	-0.9394|-0.9394	5|10	.|0.52906	.|T	.|0.07	-5.281|-5.281	8.9397|8.9397	0.35722|0.35722	0.5511:0.0:0.0:0.4489|0.5511:0.0:0.0:0.4489	.|.	.|348;348;409	.|G5E9N3;B4DKE1;Q6NUM9	.|.;.;RETST_HUMAN	V|C	198|409;409;348	.|ENSP00000295802:Y409C;ENSP00000405040:Y348C	.|ENSP00000263854:Y409C	M|Y	-|-	1|2	0|0	0|0	RETSAT|RETSAT	85425258|85425258	85425258|85425258	0.005000|0.005000	0.15991|0.15991	0.987000|0.987000	0.45799|0.45799	0.861000|0.861000	0.49209|0.49209	0.074000|0.074000	0.14662|0.14662	0.197000|0.197000	0.20387|0.20387	0.459000|0.459000	0.35465|0.35465	ATG|TAT	0.499796		TCGA-3A-A9IH-01A-12D-A397-08	0.567	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	1	0	1	2	2	2	2	0	0	0	0	74	0	74	72	1	1.830000	-20.000000	1	0.510000	NM_017750		0	57	57	0	214	211	1		1	1		0	0	74	0	0	1.000000	1	0	116	0	182	0	57	214
INPP4A	3631	broad.mit.edu	37	2	99163121	99163121	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr2:99163121G>A	ENST00000523221.1	+	11	1127	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H	INPP4A_ENST00000409851.3_Missense_Mutation_p.R376H|INPP4A_ENST00000074304.5_Missense_Mutation_p.R376H|INPP4A_ENST00000409540.3_Missense_Mutation_p.R376H|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409016.4_Missense_Mutation_p.R376H|INPP4A_ENST00000545415.1_Missense_Mutation_p.R376H			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	376					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GGAGGTCTCCGCAAAAAGCTG	0.458																																						ENST00000523221.1	0.190000	2.000000e-02	1.400000e-01	5.000000e-02	0.080000	0.098463	0.080000	0.080000																										0				43						c.(1126-1128)cGc>cAc		inositol polyphosphate-4-phosphatase, type I, 107kDa							64.0	64.0	64.0					2																	99163121		1903	4124	6027	SO:0001583	missense	3631	1	120826	27				g.chr2:99163121G>A	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1127G>A	chr2.hg19:g.99163121G>A	ENSP00000427722:p.Arg376His	0					INPP4A_ENST00000545415.1_Missense_Mutation_p.R376H|INPP4A_ENST00000409851.3_Missense_Mutation_p.R376H|INPP4A_ENST00000409540.3_Missense_Mutation_p.R376H|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409016.4_Missense_Mutation_p.R376H|INPP4A_ENST00000074304.5_Missense_Mutation_p.R376H	p.R376H			0	0	0	2.030307	Q96PE3	INP4A_HUMAN		11	1127	+			O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	0	1	hg19	c.1127G>A	CCDS46369.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.523740	0.96431	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17	5.3	5.3	0.74995	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	L	0.61387	1.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.999;0.999	T	0.43637	-0.9379	10	0.12430	T	0.62	-21.0946	18.117	0.89559	0.0:0.0:1.0:0.0	.	376;376;376;376	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	H	376	ENSP00000386704:R376H;ENSP00000386777:R376H;ENSP00000074304:R376H;ENSP00000442149:R376H;ENSP00000387294:R376H;ENSP00000427722:R376H	ENSP00000074304:R376H	R	+	2	0	0	INPP4A	98529553	98529553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.592000	0.98245	2.757000	0.94681	0.655000	0.94253	CGC	0.494533		TCGA-3A-A9IH-01A-12D-A397-08	0.458	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	0	0	1	2	2	2	2	0	0	0	0	36	0	36	35	1	1.830000	-2.712395	1	0.510000	NM_001566		0	4	4	0	186	184	0		1	0		0	0	36	0	0	0.888755	6.273457e-02	0	0	0	15	0	4	186
STAT1	6772	broad.mit.edu	37	2	191859900	191859900	+	Silent	SNP	A	A	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr2:191859900A>T	ENST00000361099.3	-	10	1218	c.831T>A	c.(829-831)ctT>ctA	p.L277L	STAT1_ENST00000392323.2_Silent_p.L279L|STAT1_ENST00000392322.3_Silent_p.L277L|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Silent_p.L277L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	277					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CCAACTTTTTAAGCTGCTGCC	0.458																																						ENST00000361099.3	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.064798	0.050000	0.060000																										0				39						c.(829-831)ctT>ctA		signal transducer and activator of transcription 1, 91kDa							153.0	131.0	138.0					2																	191859900		2203	4300	6503	SO:0001819	synonymous_variant	6772	0	0					g.chr2:191859900A>T		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.831T>A	chr2.hg19:g.191859900A>T		0					STAT1_ENST00000392322.3_Silent_p.L277L|STAT1_ENST00000409465.1_Silent_p.L277L|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000392323.2_Silent_p.L279L	p.L277L	NM_007315.3	NP_009330.1	0	0	0	2.030307	P42224	STAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)	10	1218	-			A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Silent	SNP	ENST00000361099.3	0	1	hg19	c.831T>A	CCDS2309.1	0																																																																																								0.494533		TCGA-3A-A9IH-01A-12D-A397-08	0.458	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	0	0	0	2	2	2	2	0	0	0	0	53	0	53	53	1	1.830000	-5.865498	1	0.510000	NM_007315		0	5	0	0	344	342	0		0	0		0	0	53	0	0	0.934595	9.142193e-01	0	0	0	307	0	5	344
GHRL	51738	broad.mit.edu	37	3	10331548	10331548	+	Silent	SNP	C	C	T	rs146899970		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr3:10331548C>T	ENST00000335542.8	-	4	993	c.123G>A	c.(121-123)tcG>tcA	p.S41S	GHRL_ENST00000287656.7_Silent_p.S40S|GHRL_ENST00000430179.1_Silent_p.S40S|GHRL_ENST00000429122.1_Silent_p.S41S|GHRLOS_ENST00000603771.1_RNA|GHRL_ENST00000476283.1_5'Flank|GHRL_ENST00000449238.2_Silent_p.S28S|GHRL_ENST00000457360.1_Silent_p.S41S|GHRLOS_ENST00000439539.3_RNA|GHRL_ENST00000449554.2_Silent_p.S40S|GHRL_ENST00000422159.1_Silent_p.S41S|GHRL_ENST00000437422.2_Silent_p.S29S|GHRLOS_ENST00000605014.1_RNA|GHRL_ENST00000446937.2_Intron|GHRL_ENST00000450603.1_Silent_p.S41S|GHRLOS_ENST00000605105.1_RNA|GHRL_ENST00000439975.2_Intron			Q9UBU3	GHRL_HUMAN	ghrelin/obestatin prepropeptide	41					actin polymerization or depolymerization (GO:0008154)|activation of MAPK activity (GO:0000187)|adult feeding behavior (GO:0008343)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|cortisol secretion (GO:0043400)|decidualization (GO:0046697)|dendrite development (GO:0016358)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|glucose metabolic process (GO:0006006)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of locomotion (GO:0040013)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of synapse assembly (GO:0051965)|regulation of cell proliferation (GO:0042127)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to estrogen (GO:0043627)|response to hormone (GO:0009725)	axon (GO:0030424)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|ghrelin receptor binding (GO:0031768)|growth hormone-releasing hormone activity (GO:0016608)|protein tyrosine kinase activator activity (GO:0030296)			breast(2)|large_intestine(1)|lung(1)|ovary(1)	5						GTGGCTTCTTCGACTCCTTTC	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		16947	0.001		0.0	False		,,,				2504	0.0					ENST00000335542.8	0.830000	6.000000e-01	7.800000e-01	6.500000e-01	0.710000	0.719581	0.710000	0.710000																										0				5						c.(121-123)tcG>tcA		ghrelin/obestatin prepropeptide		C	,,,,	1,4405	2.1+/-5.4	0,1,2202	119.0	127.0	124.0		120,87,84,,123	4.0	1.0	3	dbSNP_134	124	4,8596	4.3+/-15.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous	GHRL	NM_001134941.1,NM_001134944.1,NM_001134945.1,NM_001134946.1,NM_016362.3	,,,,	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	,,,,	40/117,29/106,28/105,,41/118	10331548	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	51738	58	121412	53				g.chr3:10331548C>T	AF296558	CCDS33700.1, CCDS46747.1, CCDS46748.1, CCDS46749.1, CCDS46750.1	3p26-p25	2013-02-26	2008-07-02		ENSG00000157017	ENSG00000157017		"""Endogenous ligands"""	18129	protein-coding gene	gene with protein product	"""prepro-appetite regulatory hormone"""	605353	"""ghrelin, growth hormone secretagogue receptor ligand"""			10930375, 10604470, 16284174	Standard	NR_024133		Approved	MTLRP, ghrelin, obestatin	uc010hdj.2	Q9UBU3	OTTHUMG00000155360	ENST00000335542.8:c.123G>A	chr3.hg19:g.10331548C>T		0					GHRLOS_ENST00000605105.1_RNA|GHRL_ENST00000449238.2_Silent_p.S28S|GHRL_ENST00000422159.1_Silent_p.S41S|GHRL_ENST00000450603.1_Silent_p.S41S|GHRL_ENST00000437422.2_Silent_p.S29S|GHRL_ENST00000446937.2_Intron|GHRLOS_ENST00000439539.3_RNA|GHRL_ENST00000476283.1_5'Flank|GHRL_ENST00000439975.2_Intron|GHRL_ENST00000457360.1_Silent_p.S41S|GHRLOS_ENST00000605014.1_RNA|GHRL_ENST00000430179.1_Silent_p.S40S|GHRLOS_ENST00000603771.1_RNA|GHRL_ENST00000429122.1_Silent_p.S41S|GHRL_ENST00000287656.7_Silent_p.S40S|GHRL_ENST00000449554.2_Silent_p.S40S	p.S41S			0	0	0	2.049854	Q9UBU3	GHRL_HUMAN		4	993	-			A8CF34|A8CF38|A8CF42|A8DN29|A8DN30|Q86YP8|Q8TAT9|Q9H3R3	Silent	SNP	ENST00000335542.8	1	1	hg19	c.123G>A	CCDS33700.1	0																																																																																								0.499796		TCGA-3A-A9IH-01A-12D-A397-08	0.572	GHRL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000339625.1	1	0	1	2	17	2	2	0	0	0	1	141	0	141	138	1	1.830000	-3.535820	1	0.510000	NM_016362		0	126	126	0	549	542	1		1	0		0	0	141	0	0	1.000000	9.973731e-01	0	0	0	41	0	126	549
EIF2B5	8893	broad.mit.edu	37	3	183860631	183860631	+	Silent	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr3:183860631G>A	ENST00000273783.3	+	11	1733	c.1611G>A	c.(1609-1611)gaG>gaA	p.E537E	EIF2B5_ENST00000444495.1_Silent_p.E537E	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	537					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			ATTCTGAGGAGCCGGACAGCC	0.483																																						ENST00000273783.3	1.000000	4.300000e-01	8.700000e-01	5.500000e-01	0.700000	0.714134	0.700000	1.000000																										0				27						c.(1609-1611)gaG>gaA		eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa							34.0	39.0	38.0					3																	183860631		2202	4300	6502	SO:0001819	synonymous_variant	8893	0	0					g.chr3:183860631G>A	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.1611G>A	chr3.hg19:g.183860631G>A		0					EIF2B5_ENST00000444495.1_Silent_p.E537E	p.E537E	NM_003907.2	NP_003898.2	0	0	0	2.049854	Q13144	EI2BE_HUMAN	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)	11	1733	+	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Q541Z1|Q96D04	Silent	SNP	ENST00000273783.3	1	1	hg19	c.1611G>A	CCDS3252.1	0																																																																																								0.499796		TCGA-3A-A9IH-01A-12D-A397-08	0.483	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1	1	0	1	2	2	2	2	0	0	0	0	22	0	22	22	1	1.830000	-20.000000	1	0.510000			0	16	16	0	72	72	1		1	1		0	0	22	0	0	0.999962	9.999949e-01	0	27	0	83	0	16	72
SPOCK3	50859	broad.mit.edu	37	4	167713399	167713399	+	Missense_Mutation	SNP	G	G	A	rs560446612		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr4:167713399G>A	ENST00000357154.3	-	8	777	c.640C>T	c.(640-642)Cgg>Tgg	p.R214W	SPOCK3_ENST00000512648.1_Missense_Mutation_p.R211W|SPOCK3_ENST00000511269.1_Missense_Mutation_p.R211W|SPOCK3_ENST00000512681.1_Missense_Mutation_p.R116W|SPOCK3_ENST00000504953.1_Missense_Mutation_p.R211W|SPOCK3_ENST00000502330.1_Missense_Mutation_p.R214W|SPOCK3_ENST00000421836.2_Missense_Mutation_p.R163W|SPOCK3_ENST00000510741.1_Intron|SPOCK3_ENST00000511531.1_Missense_Mutation_p.R214W|SPOCK3_ENST00000357545.4_Missense_Mutation_p.R211W|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000506886.1_Missense_Mutation_p.R214W|SPOCK3_ENST00000534949.1_Missense_Mutation_p.R118W|SPOCK3_ENST00000541637.1_Missense_Mutation_p.R116W|SPOCK3_ENST00000535728.1_Intron|SPOCK3_ENST00000541354.1_Missense_Mutation_p.R94W	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	214					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AACCAGTCCCGCAATCTGTTT	0.393																																						ENST00000357154.3	1.000000	7.500000e-01	1	8.300000e-01	0.920000	0.922021	0.920000	1.000000																										0				38						c.(640-642)Cgg>Tgg		sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3							105.0	90.0	95.0					4																	167713399		2203	4300	6503	SO:0001583	missense	50859	1	121412	27				g.chr4:167713399G>A	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.640C>T	chr4.hg19:g.167713399G>A	ENSP00000349677:p.Arg214Trp	0					SPOCK3_ENST00000511269.1_Missense_Mutation_p.R211W|SPOCK3_ENST00000534949.1_Missense_Mutation_p.R118W|SPOCK3_ENST00000535728.1_Intron|SPOCK3_ENST00000541637.1_Missense_Mutation_p.R116W|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000502330.1_Missense_Mutation_p.R214W|SPOCK3_ENST00000541354.1_Missense_Mutation_p.R94W|SPOCK3_ENST00000421836.2_Missense_Mutation_p.R163W|SPOCK3_ENST00000512681.1_Missense_Mutation_p.R116W|SPOCK3_ENST00000510741.1_Intron|SPOCK3_ENST00000511531.1_Missense_Mutation_p.R214W|SPOCK3_ENST00000506886.1_Missense_Mutation_p.R214W|SPOCK3_ENST00000512648.1_Missense_Mutation_p.R211W|SPOCK3_ENST00000357545.4_Missense_Mutation_p.R211W|SPOCK3_ENST00000504953.1_Missense_Mutation_p.R211W	p.R214W	NM_016950.2	NP_058646.2	1	2	3	2.122969	Q9BQ16	TICN3_HUMAN		8	777	-	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	1	1	hg19	c.640C>T	CCDS54817.1	1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668665	0.67814	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000421836;ENST00000541637;ENST00000534949;ENST00000512648;ENST00000510403	T;T;T;T;T;T;T;T;T;T;T;T;T;D	0.88586	1.42;1.43;1.43;1.42;1.42;1.42;1.35;0.83;1.43;1.23;0.83;1.12;2.14;-2.4	5.33	3.57	0.40892	5.33	3.57	0.40892	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.124274	0.51477	N	0.000082	D	0.93501	0.7926	M	0.82193	2.58	0.50313	D	0.999869	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.991;0.996;0.995;0.998;0.996;0.997;0.998	D	0.92483	0.5994	10	0.72032	D	0.01	-2.4622	8.3992	0.32574	0.0729:0.0:0.5389:0.3881	.	116;118;163;223;214;211;214	B4DGK5;F5H099;B4DHB4;B4DFW5;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	W	214;211;211;214;214;214;94;116;211;163;116;118;211;93	ENSP00000349677:R214W;ENSP00000350153:R211W;ENSP00000425570:R211W;ENSP00000420920:R214W;ENSP00000423421:R214W;ENSP00000423606:R214W;ENSP00000444789:R94W;ENSP00000426318:R116W;ENSP00000425502:R211W;ENSP00000411344:R163W;ENSP00000445430:R116W;ENSP00000438142:R118W;ENSP00000426177:R211W;ENSP00000423176:R93W	ENSP00000349677:R214W	R	-	1	2	2	SPOCK3	167949974	167949974	0.995000	0.38212	0.833000	0.33012	0.952000	0.60782	1.388000	0.34442	0.714000	0.32081	0.563000	0.77884	CGG	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.393	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1	1	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	1.830000	-4.429371	1	0.510000			0	74	73	0	239	238	1		1	0		0	0	46	0	0	1.000000	2.425404e-01	0	0	0	4	0	74	239
HMGB2	3148	broad.mit.edu	37	4	174253329	174253329	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr4:174253329G>A	ENST00000296503.5	-	5	1405	c.532C>T	c.(532-534)Cca>Tca	p.P178S	HMGB2_ENST00000446922.2_Missense_Mutation_p.P178S|HMGB2_ENST00000438704.2_Missense_Mutation_p.P178S|RP11-798M19.3_ENST00000507803.1_RNA			P26583	HMGB2_HUMAN	high mobility group box 2	178					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		GAGCCTGTTGGCCTGCCAGGG	0.433																																						ENST00000296503.5	0.930000	6.000000e-01	8.300000e-01	6.700000e-01	0.740000	0.756823	0.740000	0.750000																										0				14						c.(532-534)Cca>Tca		high mobility group box 2							175.0	158.0	164.0					4																	174253329		2203	4300	6503	SO:0001583	missense	3148	0	0					g.chr4:174253329G>A		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.532C>T	chr4.hg19:g.174253329G>A	ENSP00000296503:p.Pro178Ser	0					RP11-798M19.3_ENST00000507803.1_RNA|HMGB2_ENST00000446922.2_Missense_Mutation_p.P178S|HMGB2_ENST00000438704.2_Missense_Mutation_p.P178S	p.P178S			1	2	3	2.122969	P26583	HMGB2_HUMAN		5	1405	-		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	ENST00000296503.5	1	1	hg19	c.532C>T	CCDS3816.1	0	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946710	0.34377	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704	D;D;D	0.94758	-3.51;-3.51;-3.51	5.9	4.2	0.49525	5.9	4.2	0.49525	.	0.105398	0.42682	N	0.000667	D	0.88340	0.6410	L	0.28192	0.835	0.54753	D	0.999982	B	0.12013	0.005	B	0.06405	0.002	T	0.81147	-0.1065	10	0.22109	T	0.4	.	9.8684	0.41160	0.2071:0.0:0.7929:0.0	.	178	P26583	HMGB2_HUMAN	S	178	ENSP00000296503:P178S;ENSP00000393448:P178S;ENSP00000404912:P178S	ENSP00000296503:P178S	P	-	1	0	0	HMGB2	174489904	174489904	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.668000	0.68074	0.841000	0.35020	-0.145000	0.13849	CCA	0.512486		TCGA-3A-A9IH-01A-12D-A397-08	0.433	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362362.1	1	0	1	2	2	2	2	0	0	0	0	66	0	66	64	1	1.830000	-20.000000	1	0.510000	NM_001130688		0	79	78	0	336	334	1		1	1		0	0	66	0	0	1.000000	1	0	171	0	348	0	79	336
APC	324	broad.mit.edu	37	5	112170693	112170693	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr5:112170693G>A	ENST00000457016.1	+	15	2169	c.1789G>A	c.(1789-1791)Gca>Aca	p.A597T	APC_ENST00000257430.4_Missense_Mutation_p.A597T|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.A597T			P25054	APC_HUMAN	adenomatous polyposis coli	597	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAATTTGTCAGCACATTGCAC	0.398		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	ENST00000457016.1	1.000000	1.000000e-02	9.000000e-02	2.000000e-02	0.050000	0.092749	0.050000	0.050000		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	5q21	324	D, Mis, N, F, S	adenomatous polyposis of the colon gene				"""E, M, O"""	E, M, O		colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS	colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS		1	Unknown(1)	p.?(1)	skin(1)	3261						c.(1789-1791)Gca>Aca		adenomatous polyposis coli							198.0	163.0	175.0					5																	112170693		2202	4300	6502	SO:0001583	missense	324	0	0		Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	g.chr5:112170693G>A	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1789G>A	chr5.hg19:g.112170693G>A	ENSP00000413133:p.Ala597Thr	0	TSP Lung(16;0.13)				APC_ENST00000508376.2_Missense_Mutation_p.A597T|APC_ENST00000257430.4_Missense_Mutation_p.A597T|CTC-554D6.1_ENST00000520401.1_Intron	p.A597T			1	2	3	2.137110	P25054	APC_HUMAN		15	2169	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	0	1	hg19	c.1789G>A	CCDS4107.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.859311	0.97036	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.95171	-2.91;-3.63;-2.91;-2.91;-3.09	5.93	5.93	0.95920	5.93	5.93	0.95920	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	D	0.97492	1.0054	10	0.87932	D	0	-19.1568	20.3409	0.98764	0.0:0.0:1.0:0.0	.	599;597	Q4LE70;P25054	.;APC_HUMAN	T	597;579;597;597;597	ENSP00000413133:A597T;ENSP00000423224:A579T;ENSP00000257430:A597T;ENSP00000427089:A597T;ENSP00000423828:A597T	ENSP00000257430:A597T	A	+	1	0	0	APC	112198592	112198592	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.814000	0.96858	0.655000	0.94253	GCA	0.516169		TCGA-3A-A9IH-01A-12D-A397-08	0.398	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	0	0	1	2	2	2	2	0	0	0	0	58	0	58	57	1	1.830000	-2.916433	1	0.510000	NM_000038		0	5	5	0	410	408	0		1	0		0	0	58	0	0	0.937104	3.434690e-03	0	0	0	6	0	5	410
ATG10	83734	broad.mit.edu	37	5	81474399	81474399	+	Missense_Mutation	SNP	C	C	T	rs548892230		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr5:81474399C>T	ENST00000282185.3	+	5	740	c.446C>T	c.(445-447)aCg>aTg	p.T149M	ATG10_ENST00000514253.2_3'UTR|ATG10_ENST00000513634.1_Missense_Mutation_p.T149M|ATG10_ENST00000458350.3_Missense_Mutation_p.T149M	NM_031482.4	NP_113670.1	Q9H0Y0	ATG10_HUMAN	autophagy related 10	149					autophagy (GO:0006914)|autophagy in response to ER overload (GO:0034263)|positive regulation of protein modification process (GO:0031401)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	Atg12 ligase activity (GO:0019777)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(2)	9		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		GACACTATTACGCAACAGGTT	0.433													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19557	0.0		0.0	False		,,,				2504	0.0					ENST00000282185.3	1.000000	4.000000e-02	1.800000e-01	7.000000e-02	0.110000	0.158813	0.110000	0.110000																										0				9						c.(445-447)aCg>aTg		autophagy related 10							180.0	156.0	164.0					5																	81474399		2203	4300	6503	SO:0001583	missense	83734	11	121412	43				g.chr5:81474399C>T	AK024016	CCDS4057.1	5q14.1	2014-02-12	2012-06-06	2005-09-11	ENSG00000152348	ENSG00000152348			20315	protein-coding gene	gene with protein product		610800	"""APG10 autophagy 10-like (S. cerevisiae)"", ""ATG10 autophagy related 10 homolog (S. cerevisiae)"""	APG10L			Standard	NM_031482		Approved	DKFZP586I0418, FLJ13954	uc003khr.3	Q9H0Y0	OTTHUMG00000119041	ENST00000282185.3:c.446C>T	chr5.hg19:g.81474399C>T	ENSP00000282185:p.Thr149Met	0					ATG10_ENST00000458350.3_Missense_Mutation_p.T149M|ATG10_ENST00000513634.1_Missense_Mutation_p.T149M|ATG10_ENST00000514253.2_3'UTR	p.T149M	NM_031482.4	NP_113670.1	1	2	3	2.137110	Q9H0Y0	ATG10_HUMAN		5	740	+		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)	B2RE09|Q6PIX1|Q9H842	Missense_Mutation	SNP	ENST00000282185.3	0	1	hg19	c.446C>T	CCDS4057.1	0	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431692	0.43122	.	.	ENSG00000152348	ENST00000282185;ENST00000458350;ENST00000513634	T;T;T	0.55413	1.58;1.58;0.52	5.37	3.55	0.40652	5.37	3.55	0.40652	Autophagy-related protein 3 (1);	0.159978	0.53938	D	0.000049	T	0.74481	0.3722	M	0.90145	3.09	0.42169	D	0.991636	D;D	0.89917	1.0;0.996	D;P	0.75484	0.986;0.863	T	0.77672	-0.2500	10	0.87932	D	0	-3.6582	10.2806	0.43537	0.0:0.7898:0.1361:0.0741	.	149;149	D6RDX3;Q9H0Y0	.;ATG10_HUMAN	M	149	ENSP00000282185:T149M;ENSP00000404938:T149M;ENSP00000425225:T149M	ENSP00000282185:T149M	T	+	2	0	0	ATG10	81510155	81510155	0.996000	0.38824	0.685000	0.30070	0.300000	0.27592	3.737000	0.55060	0.725000	0.32318	0.305000	0.20034	ACG	0.516169		TCGA-3A-A9IH-01A-12D-A397-08	0.433	ATG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239252.2	0	0	1	2	2	2	2	0	0	0	0	36	0	36	36	1	1.830000	-3.539786	1	0.510000	NM_001131028		0	7	7	0	243	240	0		1	0		0	0	36	0	0	0.980187	2.138463e-01	0	0	0	27	0	7	243
PCDHGA2	56113	broad.mit.edu	37	5	140719009	140719009	+	Silent	SNP	G	G	A	rs151023570		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr5:140719009G>A	ENST00000394576.2	+	1	471	c.471G>A	c.(469-471)gcG>gcA	p.A157A	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	157	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTAAGAATGCGCATGATGCAG	0.498																																						ENST00000394576.2	1.000000	5.000000e-02	1.500000e-01	7.000000e-02	0.100000	0.145395	0.100000	0.100000																										0				77						c.(469-471)gcG>gcA		protocadherin gamma subfamily A, 2							82.0	80.0	81.0					5																	140719009		2203	4300	6503	SO:0001819	synonymous_variant	56113	0	0					g.chr5:140719009G>A	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.471G>A	chr5.hg19:g.140719009G>A		0					PCDHGA1_ENST00000517417.1_Intron	p.A157A	NM_018915.2	NP_061738.1	1	2	3	2.137110	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	471	+			Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	1	1	hg19	c.471G>A	CCDS47289.1	0																																																																																								0.516169		TCGA-3A-A9IH-01A-12D-A397-08	0.498	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	0	0	1	2	2	2	2	0	0	0	0	119	0	119	117	1	1.830000	-2.800669	1	0.510000	NM_018915		0	13	13	0	482	479	0		1	0		0	0	119	0	0	0.999525	4.856798e-03	0	0	0	4	0	13	482
HIST1H2BE	8344	broad.mit.edu	37	6	26184241	26184241	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr6:26184241G>A	ENST00000356530.3	+	1	284	c.218G>A	c.(217-219)cGc>cAc	p.R73H		NM_003523.2	NP_003514.2	P62807	H2B1C_HUMAN	histone cluster 1, H2be	73					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(1)	4						ATCTTCGAGCGCATCGCCGGC	0.597																																						ENST00000356530.3	0.060000	0	4.000000e-02	1.000000e-02	0.020000	0.031628	0.020000	0.030000																										0				4						c.(217-219)cGc>cAc		histone cluster 1, H2be							119.0	116.0	117.0					6																	26184241		2203	4300	6503	SO:0001583	missense	8344	0	0					g.chr6:26184241G>A	Z80780	CCDS4588.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197697	ENSG00000274290		"""Histones / Replication-dependent"""	4753	protein-coding gene	gene with protein product		602805	"""H2B histone family, member H"", ""histone 1, H2be"""	H2BFH		9119399, 12408966	Standard	NM_003523		Approved	H2B/h, H2B.h	uc003ngt.3	P62807	OTTHUMG00000014427	ENST00000356530.3:c.218G>A	chr6.hg19:g.26184241G>A	ENSP00000348924:p.Arg73His	1						p.R73H	NM_003523.2	NP_003514.2	0	1	1	1.599230	P62807	H2B1C_HUMAN		1	284	+			P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000356530.3	0	1	hg19	c.218G>A	CCDS4588.1	0	.	.	.	.	.	.	.	.	.	.	.	14.91	2.676040	0.47886	.	.	ENSG00000197697	ENST00000356530	T	0.69561	-0.41	4.96	4.96	0.65561	4.96	4.96	0.65561	.	0.000000	0.34555	U	0.003862	T	0.73560	0.3602	.	.	.	0.52501	D	0.999953	.	.	.	.	.	.	T	0.74734	-0.3565	7	0.49607	T	0.09	.	17.6163	0.88068	0.0:0.0:1.0:0.0	.	.	.	.	H	73	ENSP00000348924:R73H	ENSP00000348924:R73H	R	+	2	0	0	HIST1H2BE	26292220	26292220	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	7.562000	0.82300	2.479000	0.83701	0.537000	0.68136	CGC	0.344525		TCGA-3A-A9IH-01A-12D-A397-08	0.597	HIST1H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040090.1	0	0	1	2	12	2	2	1	0	1	1	175	0	175	177	1	1.830000	-1.789810	0	0.510000	NM_003523		0	5	5	0	547	538	0		0	0		1	0	175	0	0	0.065207	1.361073e-04	0	0	0	2	0	5	547
NOTCH4	4855	broad.mit.edu	37	6	32171920	32171920	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr6:32171920G>C	ENST00000375023.3	-	19	3250	c.3112C>G	c.(3112-3114)Cac>Gac	p.H1038D		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1038	EGF-like 26. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TCACCTGTGTGTCCAGGCAGA	0.622																																						ENST00000375023.3	1.000000	6.900000e-01	9.800000e-01	8.000000e-01	0.900000	0.894196	0.900000	1.000000																										0				100						c.(3112-3114)Cac>Gac		notch 4							53.0	39.0	44.0					6																	32171920		1510	2707	4217	SO:0001583	missense	4855	0	0					g.chr6:32171920G>C		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3112C>G	chr6.hg19:g.32171920G>C	ENSP00000364163:p.His1038Asp	1						p.H1038D	NM_004557.3	NP_004548.3	0	1	1	1.616394	Q99466	NOTC4_HUMAN		19	3250	-			B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	1	1	hg19	c.3112C>G	CCDS34420.1	1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359258	0.41801	.	.	ENSG00000204301	ENST00000375023	D	0.87334	-2.24	4.77	0.511	0.16989	4.77	0.511	0.16989	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.469254	0.18037	N	0.153753	T	0.65386	0.2686	L	0.41492	1.28	0.80722	D	1	B	0.31599	0.33	B	0.19148	0.024	T	0.62595	-0.6821	10	0.72032	D	0.01	.	6.776	0.23621	0.5687:0.0:0.4313:0.0	.	1038	Q99466	NOTC4_HUMAN	D	1038	ENSP00000364163:H1038D	ENSP00000364163:H1038D	H	-	1	0	0	NOTCH4	32279898	32279898	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	3.363000	0.52321	0.202000	0.20498	0.561000	0.74099	CAC	0.344525		TCGA-3A-A9IH-01A-12D-A397-08	0.622	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2	1	0	1	2	2	2	2	0	0	0	0	27	0	27	25	1	1.830000	-20.000000	1	0.510000			0	32	32	0	62	62	1		1	0		0	0	27	0	0	1.000000	6.621619e-01	0	0	0	6	0	32	62
T	6862	broad.mit.edu	37	6	166572035	166572035	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr6:166572035G>A	ENST00000296946.2	-	9	1544	c.1076C>T	c.(1075-1077)aCc>aTc	p.T359I	T_ENST00000366871.3_Missense_Mutation_p.T301I	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	359					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GGAGCCCGGGGTGACGGCGCC	0.687									Chordoma, Familial Clustering of																													ENST00000296946.2	1.000000	6.400000e-01	9.700000e-01	7.700000e-01	0.880000	0.873415	0.880000	0.990000																										0				39						c.(1075-1077)aCc>aTc		T, brachyury homolog (mouse)							14.0	18.0	17.0					6																	166572035		2197	4290	6487	SO:0001583	missense	6862	0	0		Chordoma, Familial Clustering of	Familial Cancer Database		g.chr6:166572035G>A	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1076C>T	chr6.hg19:g.166572035G>A	ENSP00000296946:p.Thr359Ile	1					T_ENST00000366871.3_Missense_Mutation_p.T301I	p.T359I	NM_003181.3	NP_003172.1	0	1	1	1.613336	O15178	BRAC_HUMAN		9	1544	-		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	1	1	hg19	c.1076C>T	CCDS5290.1	1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983254	0.35036	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83914	-1.78;-1.78	4.92	4.03	0.46877	4.92	4.03	0.46877	.	0.368313	0.26109	N	0.026292	T	0.71736	0.3375	M	0.65975	2.015	0.48087	D	0.999585	P;B;P	0.36392	0.551;0.005;0.551	B;B;B	0.36885	0.235;0.017;0.235	T	0.71248	-0.4649	10	0.23891	T	0.37	.	12.083	0.53682	0.084:0.0:0.916:0.0	.	301;359;301	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	I	359;359;301	ENSP00000296946:T359I;ENSP00000355836:T301I	ENSP00000296946:T359I	T	-	2	0	0	T	166492025	166492025	1.000000	0.71417	0.002000	0.10522	0.387000	0.30353	5.408000	0.66368	2.406000	0.81754	0.655000	0.94253	ACC	0.342282		TCGA-3A-A9IH-01A-12D-A397-08	0.687	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	1	0	1	2	2	2	2	0	0	0	0	19	0	19	19	1	1.830000	-20.000000	1	0.510000	NM_003181		0	22	22	0	41	41	0		1			0	0	19	0	0	1.000000	0	0	0	0	0	0	22	41
IGF2BP3	10643	broad.mit.edu	37	7	23458413	23458413	+	Silent	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr7:23458413C>T	ENST00000258729.3	-	3	623	c.267G>A	c.(265-267)ccG>ccA	p.P89P	IGF2BP3_ENST00000491719.1_5'UTR	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	89	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						GTAAATGAGGCGGGATATTTC	0.313																																						ENST00000258729.3	0.800000	3.500000e-01	6.900000e-01	4.500000e-01	0.560000	0.573266	0.560000	0.550000																										0				34						c.(265-267)ccG>ccA		insulin-like growth factor 2 mRNA binding protein 3							38.0	37.0	37.0					7																	23458413		2199	4293	6492	SO:0001819	synonymous_variant	10643	0	0					g.chr7:23458413C>T	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.267G>A	chr7.hg19:g.23458413C>T		0					IGF2BP3_ENST00000491719.1_5'UTR	p.P89P	NM_006547.2	NP_006538.2	0	0	0	2.046661	O00425	IF2B3_HUMAN		3	623	-			A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Silent	SNP	ENST00000258729.3	1	1	hg19	c.267G>A	CCDS5382.1	0																																																																																								0.499796		TCGA-3A-A9IH-01A-12D-A397-08	0.313	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	1	0	1	2	2	2	2	0	0	0	0	27	0	27	27	1	1.830000	-11.813570	1	0.510000	NM_006547		0	19	19	0	112	110	1		1			0	0	27	0	0	0.999993	0	0	0	0	0	0	19	112
ZNF804B	219578	broad.mit.edu	37	7	88965553	88965553	+	Missense_Mutation	SNP	C	C	T	rs141579525	byFrequency	TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr7:88965553C>T	ENST00000333190.4	+	4	3866	c.3257C>T	c.(3256-3258)aCt>aTt	p.T1086I		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1086							metal ion binding (GO:0046872)	p.T1086N(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ACTGGTGTGACTGATTCAACA	0.353										HNSCC(36;0.09)			C|||	2	0.000399361	0.0	0.0014	5008	,	,		19325	0.0		0.001	False		,,,				2504	0.0					ENST00000333190.4	1.000000	8.300000e-01	1	9.200000e-01	0.990000	0.974809	0.990000	1.000000																										1	Substitution - Missense(1)	p.T1086N(1)	lung(1)	144						c.(3256-3258)aCt>aTt		zinc finger protein 804B		C	ILE/THR	7,4397	12.9+/-30.5	0,7,2195	55.0	54.0	54.0		3257	1.9	0.0	7	dbSNP_134	54	37,8561	24.6+/-71.5	0,37,4262	yes	missense	ZNF804B	NM_181646.2	89	0,44,6457	TT,TC,CC		0.4303,0.1589,0.3384	benign	1086/1350	88965553	44,12958	2202	4299	6501	SO:0001583	missense	219578	353	121412	56				g.chr7:88965553C>T	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3257C>T	chr7.hg19:g.88965553C>T	ENSP00000329638:p.Thr1086Ile	0	HNSCC(36;0.09)					p.T1086I	NM_181646.2	NP_857597.1	0	0	0	2.058970	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)	4	3866	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	1	0	hg19	c.3257C>T	CCDS5613.1	1	.	.	.	.	.	.	.	.	.	.	C	5.703	0.314232	0.10789	0.001589	0.004303	ENSG00000182348	ENST00000333190	T	0.05025	3.51	4.77	1.94	0.25998	4.77	1.94	0.25998	.	0.887861	0.09842	N	0.748721	T	0.03695	0.0105	N	0.14661	0.345	0.09310	N	1	B	0.21381	0.055	B	0.18263	0.021	T	0.43605	-0.9381	10	0.37606	T	0.19	0.0263	3.5384	0.07802	0.1322:0.5672:0.1461:0.1545	.	1086	A4D1E1	Z804B_HUMAN	I	1086	ENSP00000329638:T1086I	ENSP00000329638:T1086I	T	+	2	0	0	ZNF804B	88803489	88803489	0.102000	0.21896	0.038000	0.18304	0.675000	0.39556	0.870000	0.28010	0.702000	0.31825	0.655000	0.94253	ACT	0.504950		TCGA-3A-A9IH-01A-12D-A397-08	0.353	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	1	0	1	2	2	2	2	0	0	0	0	32	0	32	31	1	1.830000	-2.232032	0	0.510000	NM_181646		0	76	75	0	210	208	1		1			0	0	32	0	0	1.000000	0	0	0	0	0	0	76	210
ST18	9705	broad.mit.edu	37	8	53045690	53045690	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr8:53045690C>T	ENST00000276480.7	-	21	3054	c.2371G>A	c.(2371-2373)Gga>Aga	p.G791R		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	791					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CGAGGGCATCCGGACAAGCTG	0.463																																						ENST00000276480.7	1.000000	7.500000e-01	9.600000e-01	8.200000e-01	0.880000	0.894026	0.880000	1.000000																										0				85						c.(2371-2373)Gga>Aga		suppression of tumorigenicity 18, zinc finger							115.0	112.0	113.0					8																	53045690		2203	4300	6503	SO:0001583	missense	9705	0	0					g.chr8:53045690C>T	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2371G>A	chr8.hg19:g.53045690C>T	ENSP00000276480:p.Gly791Arg	0						p.G791R	NM_014682.2	NP_055497.1	0	0	0	2.040484	O60284	ST18_HUMAN		21	3054	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	1	1	hg19	c.2371G>A	CCDS6149.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.217661	0.95104	.	.	ENSG00000147488	ENST00000276480	T	0.69685	-0.42	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.86142	0.5862	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.87848	0.2656	10	0.87932	D	0	-21.3142	20.2985	0.98592	0.0:1.0:0.0:0.0	.	791	O60284	ST18_HUMAN	R	791	ENSP00000276480:G791R	ENSP00000276480:G791R	G	-	1	0	0	ST18	53208243	53208243	1.000000	0.71417	0.992000	0.48379	0.777000	0.43975	7.818000	0.86416	2.793000	0.96121	0.655000	0.94253	GGA	0.497178		TCGA-3A-A9IH-01A-12D-A397-08	0.463	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1	1	0	1	2	2	2	2	0	0	0	0	104	0	104	103	1	1.830000	-4.171717	1	0.510000			0	128	126	0	419	414	1		1	0		0	0	104	0	0	1.000000	0	0	0	0	1	0	128	419
KCNB2	9312	broad.mit.edu	37	8	73848252	73848252	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr8:73848252C>T	ENST00000523207.1	+	3	1250	c.662C>T	c.(661-663)aCg>aTg	p.T221M		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	221					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CTGCAGGAAACGGACGAATTT	0.473																																						ENST00000523207.1	0.190000	5.000000e-02	1.500000e-01	7.000000e-02	0.100000	0.116977	0.100000	0.110000																										0				85						c.(661-663)aCg>aTg		potassium voltage-gated channel, Shab-related subfamily, member 2	Dalfampridine(DB06637)						196.0	177.0	184.0					8																	73848252		2203	4300	6503	SO:0001583	missense	9312	7	121412	42				g.chr8:73848252C>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.662C>T	chr8.hg19:g.73848252C>T	ENSP00000430846:p.Thr221Met	0						p.T221M	NM_004770.2	NP_004761.2	0	0	0	2.040484	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)	3	1250	+	Breast(64;0.137)		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	0	1	hg19	c.662C>T	CCDS6209.1	0	.	.	.	.	.	.	.	.	.	.	C	3.822	-0.037564	0.07497	.	.	ENSG00000182674	ENST00000523207	D	0.97480	-4.4	5.93	-10.1	0.00402	5.93	-10.1	0.00402	.	1.616920	0.03742	N	0.255128	D	0.90027	0.6886	N	0.11756	0.17	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.81671	-0.0827	10	0.44086	T	0.13	.	7.1553	0.25635	0.2329:0.3187:0.0:0.4484	.	221	Q92953	KCNB2_HUMAN	M	221	ENSP00000430846:T221M	ENSP00000430846:T221M	T	+	2	0	0	KCNB2	74010806	74010806	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-0.989000	0.03736	-1.915000	0.01077	-0.274000	0.10170	ACG	0.497178		TCGA-3A-A9IH-01A-12D-A397-08	0.473	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	0	0	1	2	2	2	2	0	0	0	0	60	0	60	60	1	1.830000	-2.987159	1	0.510000	NM_004770		0	11	11	0	378	374	0		1	0		0	0	60	0	0	0.998292	1.012619e-03	0	0	0	2	0	11	378
CDH17	1015	broad.mit.edu	37	8	95178163	95178163	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr8:95178163C>T	ENST00000027335.3	-	10	1232	c.1108G>A	c.(1108-1110)Gaa>Aaa	p.E370K	CDH17_ENST00000441892.2_Missense_Mutation_p.E156K|CDH17_ENST00000450165.2_Missense_Mutation_p.E370K	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			GCAGTATTTTCTTCATCCCTG	0.418																																						ENST00000027335.3	0.150000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.077009	0.060000	0.060000																										0				52						c.(1108-1110)Gaa>Aaa		cadherin 17, LI cadherin (liver-intestine)							89.0	89.0	89.0					8																	95178163		2203	4300	6503	SO:0001583	missense	1015	0	0					g.chr8:95178163C>T	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1108G>A	chr8.hg19:g.95178163C>T	ENSP00000027335:p.Glu370Lys	0					CDH17_ENST00000441892.2_Missense_Mutation_p.E156K|CDH17_ENST00000450165.2_Missense_Mutation_p.E370K	p.E370K	NM_004063.3	NP_004054.3	0	0	0	2.040484	Q12864	CAD17_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)	10	1232	-	Breast(36;4.65e-06)		Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	0	1	hg19	c.1108G>A	CCDS6260.1	0	.	.	.	.	.	.	.	.	.	.	C	8.643	0.896470	0.17686	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.59502	0.26;4.6;0.26	5.89	0.741	0.18336	5.89	0.741	0.18336	Cadherin (4);Cadherin-like (1);	0.629868	0.14169	N	0.336864	T	0.44138	0.1279	L	0.56124	1.755	0.39255	D	0.964112	B;B	0.28026	0.198;0.019	B;B	0.24269	0.05;0.052	T	0.22556	-1.0213	10	0.13470	T	0.59	-9.1691	7.0442	0.25037	0.0:0.5545:0.2333:0.2122	.	156;370	E7EN24;Q12864	.;CAD17_HUMAN	K	370;156;370	ENSP00000027335:E370K;ENSP00000392811:E156K;ENSP00000401468:E370K	ENSP00000027335:E370K	E	-	1	0	0	CDH17	95247339	95247339	0.655000	0.27376	0.866000	0.34008	0.051000	0.14879	0.052000	0.14163	0.391000	0.25143	0.561000	0.74099	GAA	0.497178		TCGA-3A-A9IH-01A-12D-A397-08	0.418	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	0	0	0	2	2	2	2	0	0	0	0	34	0	34	34	1	1.830000	-5.245192	1	0.510000	NM_004063		0	4	1	0	241	240	0		0	0		0	0	34	0	0	0.887207	2.687242e-02	0	0	0	12	0	4	241
OR13F1	138805	broad.mit.edu	37	9	107267379	107267379	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr9:107267379C>T	ENST00000334726.2	+	1	925	c.836C>T	c.(835-837)gCc>gTc	p.A279V		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TTGGTGTATGCCGGACAAACC	0.418																																						ENST00000334726.2	0.130000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.072905	0.060000	0.060000																										0				31						c.(835-837)gCc>gTc		olfactory receptor, family 13, subfamily F, member 1							74.0	73.0	74.0					9																	107267379		2203	4300	6503	SO:0001583	missense	138805	0	0					g.chr9:107267379C>T		CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.836C>T	chr9.hg19:g.107267379C>T	ENSP00000334452:p.Ala279Val	0						p.A279V	NM_001004485.1	NP_001004485.1	0	0	0	2.039692	Q8NGS4	O13F1_HUMAN		1	925	+			Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	0	1	hg19	c.836C>T	CCDS35087.1	0	.	.	.	.	.	.	.	.	.	.	C	8.314	0.822838	0.16678	.	.	ENSG00000186881	ENST00000334726	T	0.00063	8.78	4.3	2.44	0.29823	4.3	2.44	0.29823	GPCR, rhodopsin-like superfamily (1);	1.231740	0.05909	N	0.631330	T	0.00210	0.0006	L	0.45137	1.4	0.09310	N	1	B	0.18013	0.025	B	0.26770	0.073	T	0.49418	-0.8942	10	0.72032	D	0.01	.	12.8128	0.57649	0.0:0.6638:0.3362:0.0	.	279	Q8NGS4	O13F1_HUMAN	V	279	ENSP00000334452:A279V	ENSP00000334452:A279V	A	+	2	0	0	OR13F1	106307200	106307200	0.000000	0.05858	0.501000	0.27601	0.197000	0.23852	0.950000	0.29122	0.740000	0.32651	0.655000	0.94253	GCC	0.497178		TCGA-3A-A9IH-01A-12D-A397-08	0.418	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1	0	0	1	2	2	2	2	0	0	0	0	68	0	68	67	1	1.830000	-2.515882	1	0.510000			0	6	6	0	358	355	0		1			0	0	68	0	0	0.964390	0	0	0	0	0	0	6	358
AQP7	364	broad.mit.edu	37	9	33386077	33386077	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr9:33386077C>T	ENST00000537089.1	-	5	565	c.247G>A	c.(247-249)Gag>Aag	p.E83K	AQP7_ENST00000541274.1_Intron|AQP7_ENST00000377425.4_Missense_Mutation_p.E118K|AQP7_ENST00000539936.1_Missense_Mutation_p.E175K			O14520	AQP7_HUMAN	aquaporin 7	175					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CCACTGACCTCATTCAGGAAG	0.592																																						ENST00000537089.1	0.260000	6.000000e-02	2.000000e-01	9.000000e-02	0.140000	0.154386	0.140000	0.140000																										0				17						c.(247-249)Gag>Aag		aquaporin 7							50.0	46.0	48.0					9																	33386077		2203	4300	6503	SO:0001583	missense	364	0	0					g.chr9:33386077C>T	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.247G>A	chr9.hg19:g.33386077C>T	ENSP00000441619:p.Glu83Lys	0					AQP7_ENST00000541274.1_Intron|AQP7_ENST00000377425.4_Missense_Mutation_p.E118K|AQP7_ENST00000539936.1_Missense_Mutation_p.E175K	p.E83K			0	0	0	2.039692	O14520	AQP7_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00788)	5	565	-			Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	0	1	hg19	c.247G>A		0	.	.	.	.	.	.	.	.	.	.	N	24.0	4.485614	0.84854	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	3.98	3.98	0.46160	3.98	3.98	0.46160	Aquaporin-like (2);	0.106561	0.64402	D	0.000003	T	0.67618	0.2912	H	0.98238	4.18	0.44789	D	0.997793	P;D;P;D	0.63046	0.9;0.992;0.948;0.982	P;D;P;P	0.70227	0.643;0.968;0.771;0.752	T	0.78526	-0.2170	10	0.87932	D	0	-26.5908	11.903	0.52694	0.0:1.0:0.0:0.0	.	174;175;118;175	Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;AQP7_HUMAN	K	83;174;43;175;118;83;174;175;111	ENSP00000441619:E83K;ENSP00000368821:E174K;ENSP00000412868:E43K;ENSP00000297988:E175K;ENSP00000396111:E118K;ENSP00000410138:E83K;ENSP00000368820:E174K;ENSP00000439534:E175K;ENSP00000368817:E111K	ENSP00000297988:E175K	E	-	1	0	0	AQP7	33376077	33376077	0.998000	0.40836	0.999000	0.59377	0.984000	0.73092	1.723000	0.38053	2.507000	0.84556	0.645000	0.84053	GAG	0.497178		TCGA-3A-A9IH-01A-12D-A397-08	0.592	AQP7-202	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	44	0	44	44	1	1.830000	-2.505617	1	0.510000	NM_001170		0	7	6	0	188	183	0		1	0		0	0	44	0	0	0.978953	1.667886e-02	0	0	0	5	0	7	188
GOLGA1	2800	broad.mit.edu	37	9	127651788	127651788	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chr9:127651788C>T	ENST00000373555.4	-	17	1858	c.1525G>A	c.(1525-1527)Gag>Aag	p.E509K	RNU4-82P_ENST00000362443.1_RNA	NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	509	Gln-rich.				protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)		p.E509K(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TGTTCCTTCTCGTCTATTATG	0.512																																						ENST00000373555.4	0.750000	5.100000e-01	6.900000e-01	5.600000e-01	0.620000	0.633391	0.620000	0.630000																										1	Substitution - Missense(1)	p.E509K(1)	large_intestine(1)	20						c.(1525-1527)Gag>Aag		golgin A1							236.0	223.0	227.0					9																	127651788		2203	4300	6503	SO:0001583	missense	2800	2	121412	35				g.chr9:127651788C>T	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.1525G>A	chr9.hg19:g.127651788C>T	ENSP00000362656:p.Glu509Lys	0					RNU4-82P_ENST00000362443.1_RNA	p.E509K	NM_002077.3	NP_002068	0	0	0	2.039692	Q92805	GOGA1_HUMAN		17	1858	-			Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	1	1	hg19	c.1525G>A	CCDS6860.1	0	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691632	0.48097	.	.	ENSG00000136935	ENST00000373555	T	0.35789	1.29	5.22	3.38	0.38709	5.22	3.38	0.38709	.	0.000000	0.47093	D	0.000241	T	0.28234	0.0697	L	0.47716	1.5	0.29653	N	0.843775	D	0.58620	0.983	B	0.39299	0.296	T	0.16012	-1.0417	10	0.31617	T	0.26	-1.372	11.536	0.50636	0.0:0.8667:0.0:0.1333	.	509	Q92805	GOGA1_HUMAN	K	509	ENSP00000362656:E509K	ENSP00000362656:E509K	E	-	1	0	0	GOLGA1	126691609	126691609	0.505000	0.26131	0.581000	0.28614	0.206000	0.24218	0.853000	0.27777	0.698000	0.31739	0.448000	0.29417	GAG	0.497178		TCGA-3A-A9IH-01A-12D-A397-08	0.512	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	1	0	1	2	2	2	2	0	0	0	0	139	0	139	134	1	1.830000	-2.888403	1	0.510000	NM_002077		0	89	89	0	451	448	1		1	1		0	0	139	0	0	1.000000	9.667841e-01	0	4	0	26	0	89	451
NRK	203447	broad.mit.edu	37	X	105183982	105183982	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chrX:105183982A>G	ENST00000243300.9	+	23	4219	c.3916A>G	c.(3916-3918)Aaa>Gaa	p.K1306E	NRK_ENST00000428173.2_Missense_Mutation_p.K1307E	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1306	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GGAAGCCTGCAAAGCTATTGA	0.388										HNSCC(51;0.14)																												ENST00000243300.9	0.600000	1.000000e-01	4.400000e-01	1.700000e-01	0.290000	0.316271	0.290000	0.260000																										0				76						c.(3916-3918)Aaa>Gaa		Nik related kinase							80.0	74.0	76.0					X																	105183982		1865	4093	5958	SO:0001583	missense	203447	0	0					g.chrX:105183982A>G	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3916A>G	chrX.hg19:g.105183982A>G	ENSP00000434830:p.Lys1306Glu		HNSCC(51;0.14)				NRK_ENST00000428173.2_Missense_Mutation_p.K1307E	p.K1306E	NM_198465.2	NP_940867.2	0	1	1		Q7Z2Y5	NRK_HUMAN		23	4219	+			Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	0	1	hg19	c.3916A>G		0	.	.	.	.	.	.	.	.	.	.	A	13.34	2.206676	0.39003	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.04758	3.56;3.56	4.96	4.96	0.65561	4.96	4.96	0.65561	Citron-like (2);	0.000000	0.49916	D	0.000135	T	0.04815	0.0130	L	0.36672	1.1	0.80722	D	1	B;P	0.42078	0.372;0.77	B;B	0.40782	0.053;0.34	T	0.38908	-0.9639	10	0.54805	T	0.06	.	5.4621	0.16622	0.8038:0.0:0.1962:0.0	.	974;1306	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	E	1306;1307	ENSP00000434830:K1306E;ENSP00000438378:K1307E	ENSP00000434830:K1306E	K	+	1	0	0	NRK	105070638	105070638	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	3.190000	0.50973	1.943000	0.56356	0.441000	0.28932	AAA	0.510000		TCGA-3A-A9IH-01A-12D-A397-08	0.388	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	1	0	1	2	2	2	2	0	0	0	0	9	0	9	9	1	1.830000	-10.601380	1	0.510000	NM_198465		0	4	4	0	55	55	0		1	0		0	0	9	0	0	0.892714	2.203420e-02	0	0	0	3	0	4	55
DMD	1756	broad.mit.edu	37	X	32591647	32591647	+	Splice_Site	SNP	G	G	A	rs140919039		TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chrX:32591647G>A	ENST00000357033.4	-	15	2018	c.1812C>T	c.(1810-1812)gcC>gcT	p.A604A	DMD_ENST00000378677.2_Splice_Site_p.A600A|DMD_ENST00000288447.4_Splice_Site_p.A596A	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	604					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAGTACATACGGCCAGTTTTT	0.308													G|||	3	0.000794702	0.0023	0.0	3775	,	,		12424	0.0		0.0	False		,,,				2504	0.0					ENST00000357033.4	1.000000	8.100000e-01	1	9.000000e-01	0.990000	0.966489	0.990000	1.000000																										0				77						c.(1810-1812)gcC>gcT		dystrophin		G	,,,,	4,3827		0,3,1,1627,570	87.0	79.0	82.0		1788,1812,1443,1800,1443	-4.1	0.0	X	dbSNP_134	82	0,6727		0,0,0,2428,1871	yes	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	DMD	NM_000109.3,NM_004006.2,NM_004007.2,NM_004009.3,NM_004010.3	,,,,	0,3,1,4055,2441	AA,AG,A,GG,G		0.0,0.1044,0.0379	,,,,	596/3678,604/3686,481/3563,600/3682,481/3563	32591647	4,10554	2201	4299	6500	SO:0001630	splice_region_variant	1756	41	121382	46				g.chrX:32591647G>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1812+1C>T	chrX.hg19:g.32591647G>A							DMD_ENST00000288447.4_Splice_Site_p.A596A|DMD_ENST00000378677.2_Splice_Site_p.A600A	p.A604A	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	0	1	1		P11532	DMD_HUMAN		15	2018	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	ENST00000357033.4	1	0	hg19	c.1812C>T	CCDS14233.1	1																																																																																								0.510000		TCGA-3A-A9IH-01A-12D-A397-08	0.308	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	1	0	1	2	2	2	2	0	0	0	0	37	0	37	37	1	1.830000	-3.316126	1	0.510000	NM_004006	Silent	0	72	72	0	207	205	1		1	0		0	0	37	0	0	1.000000	0	0	0	0	1	0	72	207
ZXDB	158586	broad.mit.edu	37	X	57619818	57619818	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chrX:57619818G>A	ENST00000374888.1	+	1	1550	c.1337G>A	c.(1336-1338)cGg>cAg	p.R446Q		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	446	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						ATTCACCTGCGGAGTCACACC	0.488																																						ENST00000374888.1	1.000000	8.200000e-01	1	9.000000e-01	0.970000	0.960536	0.970000	1.000000																										0				27						c.(1336-1338)cGg>cAg		zinc finger, X-linked, duplicated B							63.0	61.0	62.0					X																	57619818		2203	4300	6503	SO:0001583	missense	158586	0	0					g.chrX:57619818G>A	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1337G>A	chrX.hg19:g.57619818G>A	ENSP00000364023:p.Arg446Gln							p.R446Q	NM_007157.3	NP_009088.1	0	1	1		P98169	ZXDB_HUMAN		1	1550	+			A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	1	1	hg19	c.1337G>A	CCDS35313.1	1	.	.	.	.	.	.	.	.	.	.	.	17.27	3.346960	0.61183	.	.	ENSG00000198455	ENST00000374888	T	0.18810	2.19	3.64	2.77	0.32553	3.64	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.35393	0.0930	L	0.52126	1.63	0.52501	D	0.999956	D	0.76494	0.999	D	0.80764	0.994	T	0.05632	-1.0873	10	0.87932	D	0	.	8.2851	0.31924	0.1245:0.0:0.8755:0.0	.	446	P98169	ZXDB_HUMAN	Q	446	ENSP00000364023:R446Q	ENSP00000364023:R446Q	R	+	2	0	0	ZXDB	57636543	57636543	1.000000	0.71417	0.998000	0.56505	0.771000	0.43674	8.599000	0.90856	0.714000	0.32081	0.483000	0.47432	CGG	0.510000		TCGA-3A-A9IH-01A-12D-A397-08	0.488	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	1	0	1	2	2	2	2	0	0	0	0	107	0	107	108	1	1.830000	-5.211927	1	0.510000	NM_007157		0	109	105	0	325	307	0		1	0		0	0	107	0	0	1.000000	8.040892e-01	0	0	0	11	0	109	325
USP26	83844	broad.mit.edu	37	X	132159668	132159668	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IH-01A-12D-A397-08	TCGA-3A-A9IH-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e796e7c6-8b2b-41ac-98ec-f9e0f2912ceb	e7c1d24a-f6f5-4a28-ac25-d549fcac82ff	g.chrX:132159668G>A	ENST00000511190.1	-	6	3050	c.2581C>T	c.(2581-2583)Cgg>Tgg	p.R861W	USP26_ENST00000406273.1_Missense_Mutation_p.R861W|USP26_ENST00000370832.1_Missense_Mutation_p.R861W	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	861	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CCTAACACCCGCATATCATCG	0.438																																					NSCLC(104;342 1621 36940 47097 52632)	ENST00000511190.1	0.130000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.067586	0.050000	0.060000																										0				60						c.(2581-2583)Cgg>Tgg		ubiquitin specific peptidase 26							139.0	117.0	125.0					X																	132159668		2203	4300	6503	SO:0001583	missense	83844	1	121400	38				g.chrX:132159668G>A	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2581C>T	chrX.hg19:g.132159668G>A	ENSP00000423390:p.Arg861Trp						USP26_ENST00000406273.1_Missense_Mutation_p.R861W|USP26_ENST00000370832.1_Missense_Mutation_p.R861W	p.R861W	NM_031907.1	NP_114113.1	0	1	1		Q9BXU7	UBP26_HUMAN		6	3050	-	Acute lymphoblastic leukemia(192;0.000127)		B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	0	1	hg19	c.2581C>T	CCDS14635.1	0	.	.	.	.	.	.	.	.	.	.	G	15.47	2.844003	0.51164	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.33216	1.42;1.42;1.42	3.91	1.06	0.20224	3.91	1.06	0.20224	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.646050	0.04079	N	0.309366	T	0.28200	0.0696	N	0.14661	0.345	0.09310	N	1	D	0.56746	0.977	P	0.51453	0.67	T	0.21827	-1.0234	10	0.66056	D	0.02	5.8655	6.3523	0.21383	0.0:0.3293:0.3298:0.341	.	861	Q9BXU7	UBP26_HUMAN	W	861	ENSP00000359869:R861W;ENSP00000423390:R861W;ENSP00000384360:R861W	ENSP00000359869:R861W	R	-	1	2	2	USP26	131987334	131987334	0.004000	0.15560	0.000000	0.03702	0.226000	0.24999	0.920000	0.28705	0.086000	0.17137	-0.324000	0.08512	CGG	0.510000		TCGA-3A-A9IH-01A-12D-A397-08	0.438	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	0	0	1	2	21	2	2	1	0	1	1	54	0	54	50	1	1.830000	-2.441146	0	0.510000	NM_031907		0	5	5	0	340	336	0		0			1	0	54	0	0	0.000913	0	0	0	0	0	0	5	340
