#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
FLVCR1	28982	broad.mit.edu	37	1	213061902	213061903	+	Frame_Shift_Ins	INS	-	-	TACT			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr1:213061902_213061903insTACT	ENST00000366971.4	+	7	1577_1578	c.1379_1380insTACT	c.(1378-1383)ggtactfs	p.-461fs	FLVCR1_ENST00000483790.1_3'UTR	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1						blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		GAATCTGAAGGTACTTCATCTG	0.361																																					Esophageal Squamous(199;2235 2952 19233 26256)	ENST00000366971.4	0.630000	3.700000e-01	0.550000	4.200000e-01	0.480000	0.498290	0.480000	0.480000																										0				12						c.(1378-1383)ggtactfs		feline leukemia virus subgroup C cellular receptor 1																																				SO:0001589	frameshift_variant	28982	0	0					g.chr1:213061902_213061903insTACT	AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.1380_1383dupTACT	chr1.hg19:g.213061903_213061906dupTACT	ENSP00000355938:p.Thr461fs	1					FLVCR1_ENST00000483790.1_3'UTR	p.-461fs	NM_014053.3	NP_054772.1	1	2	3	2.627803	Q9Y5Y0	FLVC1_HUMAN		7	1577_1578	+			Q1HE16|Q86XY9|Q9NVR9	Frame_Shift_Ins	INS	ENST00000366971.4	0	1	hg19	c.1379_1380insTACT	CCDS1510.1	0																																																																																								0.672948		TCGA-3A-A9IU-01A-11D-A397-08	0.361	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	1	0	1		2	2		0	0	0	0	64	0	64	64	1	1.910000	-2.665581	1	0.580000	NM_014053		0	63	75	0	509	506	0	0	1	0		0	0	64	0	0	1	4.713168e-01		0	0	14	0	63	509
ARHGAP21	57584	broad.mit.edu	37	10	24874291	24874291	+	Missense_Mutation	SNP	C	C	T	rs1143061		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr10:24874291C>T	ENST00000396432.2	-	26	5413	c.4927G>A	c.(4927-4929)Gtg>Atg	p.V1643M		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1642	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GTGGGGAACACGGGAAACTCG	0.532																																						ENST00000396432.2	0.110000	2.000000e-02	0.090000	4.000000e-02	0.050000	0.067177	0.050000	0.060000																										0				78						c.(4927-4929)Gtg>Atg		Rho GTPase activating protein 21							71.0	75.0	73.0					10																	24874291		2203	4299	6502	SO:0001583	missense	57584	1	121412	30				g.chr10:24874291C>T	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4927G>A	chr10.hg19:g.24874291C>T	ENSP00000379709:p.Val1643Met	1						p.V1643M	NM_020824.3	NP_065875.3	0	1	1	1.504508	Q5T5U3	RHG21_HUMAN		26	5413	-			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	0	1	hg19	c.4927G>A	CCDS7144.2	0	.	.	.	.	.	.	.	.	.	.	C	3.155	-0.173447	0.06421	.	.	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.13901	2.55	5.19	-0.0832	0.13695	5.19	-0.0832	0.13695	.	0.329273	0.31797	N	0.007043	T	0.07999	0.0200	L	0.55834	1.745	0.22754	N	0.998774	P	0.39352	0.669	B	0.27076	0.076	T	0.25117	-1.0141	10	0.46703	T	0.11	.	1.9574	0.03379	0.1301:0.4116:0.2524:0.206	rs1143061;rs3206462	1642	Q5T5U3	RHG21_HUMAN	M	1643;1092	ENSP00000379709:V1643M	ENSP00000379709:V1643M	V	-	1	0	0	ARHGAP21	24914297	24914297	0.810000	0.29049	0.000000	0.03702	0.007000	0.05969	1.633000	0.37113	-0.062000	0.13088	-0.974000	0.02594	GTG	0.413244		TCGA-3A-A9IU-01A-11D-A397-08	0.532	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	0	0	1	2	2	2	2	0	0	0	0	64	0	64	67	1	1.910000	-3.200000	1	0.580000	NM_020824		0	9	9	0	355	351	0		1	1		0	0	64	0	0	9.940669e-01	6.638481e-01	0	3	0	85	0	9	355
PTPRJ	5795	broad.mit.edu	37	11	48186036	48186036	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr11:48186036G>T	ENST00000418331.2	+	24	4176	c.3824G>T	c.(3823-3825)cGa>cTa	p.R1275L		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1275	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TATGACCTTCGAATGCATAGG	0.428																																						ENST00000418331.2	0.130000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.064980	0.050000	0.060000																										0				52						c.(3823-3825)cGa>cTa		protein tyrosine phosphatase, receptor type, J							194.0	168.0	177.0					11																	48186036		2201	4298	6499	SO:0001583	missense	5795	0	0					g.chr11:48186036G>T	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3824G>T	chr11.hg19:g.48186036G>T	ENSP00000400010:p.Arg1275Leu	0						p.R1275L	NM_002843.3	NP_002834.3	1	2	3	2.062343	Q12913	PTPRJ_HUMAN		24	4176	+			Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	0	1	hg19	c.3824G>T	CCDS7945.1	0	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976142	0.92982	.	.	ENSG00000149177	ENST00000418331	D	0.91521	-2.86	4.53	4.53	0.55603	4.53	4.53	0.55603	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	.	.	.	.	D	0.97114	0.9057	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98523	1.0624	9	0.87932	D	0	.	15.133	0.72539	0.0:0.0:1.0:0.0	.	1275	Q12913	PTPRJ_HUMAN	L	1275	ENSP00000400010:R1275L	ENSP00000400010:R1275L	R	+	2	0	0	PTPRJ	48142612	48142612	1.000000	0.71417	0.885000	0.34714	0.992000	0.81027	9.735000	0.98825	2.237000	0.73441	0.650000	0.86243	CGA	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.428	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1	0	0	1	2	2	2	2	0	0	0	0	33	0	33	32	1	1.910000	-2.903911	1	0.580000			0	4	4	0	259	245	0		1	0		0	0	33	0	0	8.777365e-01	1.351853e-01	0	0	0	33	0	4	259
ARAP1	116985	broad.mit.edu	37	11	72408662	72408662	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr11:72408662C>T	ENST00000393609.3	-	20	2972	c.2770G>A	c.(2770-2772)Gtg>Atg	p.V924M	ARAP1_ENST00000334211.8_Missense_Mutation_p.V679M|ARAP1_ENST00000429686.1_Missense_Mutation_p.V618M|ARAP1_ENST00000393605.3_Missense_Mutation_p.V684M|ARAP1_ENST00000426523.1_Missense_Mutation_p.V679M|ARAP1_ENST00000495878.1_5'UTR|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.V924M|ARAP1_ENST00000359373.5_Missense_Mutation_p.V924M	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	924					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TCCACCAGCACCAGCACCTGG	0.637																																					Ovarian(102;1198 1520 13195 17913 37529)	ENST00000393609.3	1.000000	6.800000e-01	0.920000	7.500000e-01	0.830000	0.839080	0.830000	0.840000																										0				27						c.(2770-2772)Gtg>Atg		ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1							108.0	94.0	99.0					11																	72408662		2200	4293	6493	SO:0001583	missense	116985	0	0					g.chr11:72408662C>T	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2770G>A	chr11.hg19:g.72408662C>T	ENSP00000377233:p.Val924Met	0					ARAP1_ENST00000429686.1_Missense_Mutation_p.V618M|ARAP1_ENST00000426523.1_Missense_Mutation_p.V679M|ARAP1_ENST00000334211.8_Missense_Mutation_p.V679M|ARAP1_ENST00000393605.3_Missense_Mutation_p.V684M|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.V924M|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000359373.5_Missense_Mutation_p.V924M	p.V924M	NM_001040118.2	NP_001035207.1	1	2	3	2.066243	Q96P48	ARAP1_HUMAN		20	2972	-			A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	1	1	hg19	c.2770G>A	CCDS41687.1	0	.	.	.	.	.	.	.	.	.	.	C	26.0	4.694061	0.88735	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000427971;ENST00000452383	T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.93	4.93	0.64822	4.93	4.93	0.64822	Pleckstrin homology domain (1);	0.133016	0.49916	D	0.000132	T	0.48926	0.1527	L	0.54323	1.7	0.41335	D	0.987265	P;D;P;P;P	0.69078	0.843;0.997;0.881;0.843;0.903	P;P;P;P;P	0.61533	0.779;0.845;0.746;0.677;0.89	T	0.52019	-0.8631	10	0.87932	D	0	.	17.0897	0.86618	0.0:1.0:0.0:0.0	.	679;618;924;924;684	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	M	924;924;684;679;924;679;618;212;212	ENSP00000352332:V924M;ENSP00000390461:V924M;ENSP00000377230:V684M;ENSP00000335506:V679M;ENSP00000377233:V924M;ENSP00000392264:V679M;ENSP00000403127:V618M;ENSP00000411452:V212M;ENSP00000399118:V212M	ENSP00000335506:V679M	V	-	1	0	0	ARAP1	72086310	72086310	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.823000	0.48081	2.435000	0.82474	0.563000	0.77884	GTG	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.637	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	1	0	1	2	2	2	2	0	0	0	0	64	0	64	64	1	1.910000	-20.000000	1	0.580000	NM_001040118		0	82	81	0	257	255	1		1	1		0	0	64	0	0	1	1	0	32	0	115	0	82	257
TYR	7299	broad.mit.edu	37	11	88924443	88924443	+	Missense_Mutation	SNP	G	G	A	rs148815276		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr11:88924443G>A	ENST00000263321.5	+	2	1395	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	298					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GGACCTTTACGGCGTAATCCT	0.468																																						ENST00000263321.5	1.000000	8.800000e-01	1.000000	9.400000e-01	0.990000	0.981930	0.990000	1.000000																										0				48						c.(892-894)cGg>cAg		tyrosinase	Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	G	GLN/ARG	1,4401	2.1+/-5.4	0,1,2200	134.0	125.0	128.0		893	0.5	0.0	11	dbSNP_134	128	0,8598		0,0,4299	no	missense	TYR	NM_000372.4	43	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	298/530	88924443	1,12999	2201	4299	6500	SO:0001583	missense	7299	6	121400	42				g.chr11:88924443G>A	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.893G>A	chr11.hg19:g.88924443G>A	ENSP00000263321:p.Arg298Gln	0					TYR_ENST00000526139.1_3'UTR	p.R298Q	NM_000372.4	NP_000363.1	1	2	3	2.066243	P14679	TYRO_HUMAN		2	1395	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	1	1	hg19	c.893G>A	CCDS8284.1	1	.	.	.	.	.	.	.	.	.	.	G	7.767	0.706604	0.15239	2.27E-4	0.0	ENSG00000077498	ENST00000263321	D	0.97114	-4.25	5.59	0.524	0.17066	5.59	0.524	0.17066	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.354131	0.29205	N	0.012826	D	0.91576	0.7339	L	0.39020	1.185	0.09310	N	1	P	0.40230	0.708	B	0.33750	0.169	D	0.84793	0.0780	9	.	.	.	.	7.2211	0.25988	0.3203:0.0:0.2284:0.4513	.	298	P14679	TYRO_HUMAN	Q	298	ENSP00000263321:R298Q	.	R	+	2	0	0	TYR	88564091	88564091	0.004000	0.15560	0.033000	0.17914	0.384000	0.30261	1.222000	0.32515	-0.154000	0.11118	-2.213000	0.00299	CGG	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.468	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	1	0	1	2	2	2	2	0	0	0	0	37	0	37	36	1	1.910000	-9.488467	1	0.580000	NM_000372		0	150	148	0	358	348	1		1			0	0	37	0	0	1	0	0	0	0	0	0	150	358
PRH2	5555	broad.mit.edu	37	12	11083320	11083320	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr12:11083320C>G	ENST00000396400.3	+	3	198	c.160C>G	c.(160-162)Cag>Gag	p.Q54E	PRH2_ENST00000381847.3_Missense_Mutation_p.Q54E|PRR4_ENST00000536668.1_Intron	NM_001110213.1	NP_001103683.1	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 2	54						extracellular space (GO:0005615)				breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	13						TTTGGGAGGACAGCAATCTCA	0.552																																						ENST00000396400.3	0.090000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.052834	0.040000	0.050000																										0				13						c.(160-162)Cag>Gag		proline-rich protein HaeIII subfamily 2							117.0	132.0	127.0					12																	11083320		2203	4300	6503	SO:0001583	missense	5555	0	0					g.chr12:11083320C>G		CCDS8636.1	12p13.2	2012-10-02				ENSG00000134551			9367	protein-coding gene	gene with protein product	"""parotid proline-rich protein"", ""acidic salivary proline-rich protein, HaeIII type, 2"""	168790				3009472	Standard	NM_005042		Approved	Pr	uc001qzi.4	P02810		ENST00000396400.3:c.160C>G	chr12.hg19:g.11083320C>G	ENSP00000379682:p.Gln54Glu	0					PRH2_ENST00000381847.3_Missense_Mutation_p.Q54E|PRR4_ENST00000536668.1_Intron	p.Q54E	NM_001110213.1	NP_001103683.1	0	0	0	2.002191	P02810	PRPC_HUMAN		3	198	+			A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Missense_Mutation	SNP	ENST00000396400.3	0	1	hg19	c.160C>G	CCDS8636.1	0	.	.	.	.	.	.	.	.	.	.	C	0.588	-0.834193	0.02713	.	.	ENSG00000134551	ENST00000381847;ENST00000396400	T;T	0.16457	2.34;2.34	1.11	0.126	0.14722	1.11	0.126	0.14722	.	5.544330	0.01935	N	0.041536	T	0.09905	0.0243	N	0.12182	0.205	0.09310	N	1	B	0.24426	0.103	B	0.17722	0.019	T	0.23476	-1.0187	10	0.44086	T	0.13	.	3.5402	0.07808	0.0:0.713:0.0:0.287	.	54	P02810	PRPC_HUMAN	E	54	ENSP00000371271:Q54E;ENSP00000379682:Q54E	ENSP00000371271:Q54E	Q	+	1	0	0	PRH2	10974587	10974587	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-1.025000	0.03600	0.041000	0.15688	0.194000	0.17425	CAG	0.570025		TCGA-3A-A9IU-01A-11D-A397-08	0.552	PRH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400231.1	0	0	1	2	2	2	2	0	0	0	0	87	0	87	87	1	1.910000	-2.925302	1	0.580000	NM_001110213		0	8	8	0	564	554	0		1			0	0	87	0	0	9.887433e-01	0	0	0	0	0	0	8	564
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.980000	6.600000e-01	0.910000	7.300000e-01	0.810000	0.825014	0.810000	0.820000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.002191	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.570025		TCGA-3A-A9IU-01A-11D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	19	2	2	2	0	10	0	0	38	8009	38	38	1	1.910000	-20.000000	1	0.580000	NM_033360		2786	72	71	5228	223	223	1	1	1	1	1	0	0	38	198	1	1	9.901401e-01	1	10	85	14	245	72	223
NELL2	4753	broad.mit.edu	37	12	45105106	45105106	+	Silent	SNP	G	G	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr12:45105106G>T	ENST00000429094.2	-	11	1662	c.1158C>A	c.(1156-1158)acC>acA	p.T386T	NELL2_ENST00000437801.2_Silent_p.T436T|NELL2_ENST00000333837.4_Silent_p.T409T|NELL2_ENST00000395487.2_Silent_p.T385T|NELL2_ENST00000551601.1_Silent_p.T385T|NELL2_ENST00000452445.2_Silent_p.T386T|NELL2_ENST00000549027.1_Silent_p.T385T	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	386						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TGTGAGACAAGGTTATCTGAT	0.398																																						ENST00000429094.2	0.920000	6.000000e-01	0.840000	6.700000e-01	0.750000	0.761861	0.750000	0.760000																										0				65						c.(1156-1158)acC>acA		NEL-like 2 (chicken)							126.0	114.0	118.0					12																	45105106		2203	4300	6503	SO:0001819	synonymous_variant	4753	0	0					g.chr12:45105106G>T	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1158C>A	chr12.hg19:g.45105106G>T		0					NELL2_ENST00000437801.2_Silent_p.T436T|NELL2_ENST00000549027.1_Silent_p.T385T|NELL2_ENST00000452445.2_Silent_p.T386T|NELL2_ENST00000395487.2_Silent_p.T385T|NELL2_ENST00000333837.4_Silent_p.T409T|NELL2_ENST00000551601.1_Silent_p.T385T	p.T386T	NM_001145108.1	NP_001138580.1	0	0	0	2.002191	Q99435	NELL2_HUMAN		11	1662	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000429094.2	1	1	hg19	c.1158C>A	CCDS8746.1	0	.	.	.	.	.	.	.	.	.	.	G	8.433	0.849108	0.17034	.	.	ENSG00000184613	ENST00000550313	.	.	.	5.79	-1.97	0.07503	5.79	-1.97	0.07503	.	.	.	.	.	T	0.39332	0.1074	.	.	.	0.58432	D	0.99999	.	.	.	.	.	.	T	0.31558	-0.9939	4	.	.	.	-8.8524	1.4208	0.02311	0.3427:0.0865:0.3107:0.2601	.	.	.	.	H	130	.	.	P	-	2	0	0	NELL2	43391373	43391373	0.938000	0.31826	0.982000	0.44146	0.983000	0.72400	-0.010000	0.12743	-0.109000	0.12044	-0.126000	0.14955	CCT	0.570025		TCGA-3A-A9IU-01A-11D-A397-08	0.398	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	1	0	1	2	2	2	2	0	0	0	0	30	0	30	30	1	1.910000	-3.583185	1	0.580000	NM_006159		0	65	64	0	224	224	1		1	0		0	0	30	0	0	1	5.168545e-02	0	0	0	2	0	65	224
IL26	55801	broad.mit.edu	37	12	68619408	68619408	+	Silent	SNP	G	G	A	rs572120709		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr12:68619408G>A	ENST00000229134.4	-	1	193	c.129C>T	c.(127-129)gaC>gaT	p.D43D	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	43					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		TATAGAGAGCGTCAACAGCTT	0.438																																						ENST00000229134.4	0.060000	0	0.040000	1.000000e-02	0.020000	0.030569	0.020000	0.020000																										0				12						c.(127-129)gaC>gaT		interleukin 26							281.0	247.0	259.0					12																	68619408		2203	4300	6503	SO:0001819	synonymous_variant	55801	2	121412	39				g.chr12:68619408G>A	AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.129C>T	chr12.hg19:g.68619408G>A		0					IFNG-AS1_ENST00000536914.1_RNA	p.D43D	NM_018402.1	NP_060872.1	0	0	0	2.002191	Q9NPH9	IL26_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	1	193	-				Silent	SNP	ENST00000229134.4	0	1	hg19	c.129C>T	CCDS8981.1	0																																																																																								0.570025		TCGA-3A-A9IU-01A-11D-A397-08	0.438	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402302.1	0	0	1	2	2	2	2	0	0	0	0	96	0	96	96	1	1.910000	-2.554088	1	0.580000	NM_018402		0	6	6	0	741	733	0		1			0	0	96	0	0	9.638753e-01	0	0	0	0	0	0	6	741
FANCM	57697	broad.mit.edu	37	14	45665470	45665470	+	Silent	SNP	G	G	A	rs377630399		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr14:45665470G>A	ENST00000267430.5	+	21	5521	c.5436G>A	c.(5434-5436)ccG>ccA	p.P1812P	FANCM_ENST00000542564.2_Silent_p.P1786P	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1812	Interaction with FAAP24 and EME1.		P -> A (in dbSNP:rs3736772). {ECO:0000269|PubMed:10997877}.		DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TTAGACTTCCGCAGGAAGGAA	0.438								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													ENST00000267430.5	0.070000	0	0.060000	1.000000e-02	0.030000	0.040047	0.030000	0.040000																										0				85						c.(5434-5436)ccG>ccA	Involved in tolerance or repair of DNA crosslinks	Fanconi anemia, complementation group M		G		1,4405	2.1+/-5.4	0,1,2202	126.0	123.0	124.0		5436	-1.8	0.0	14		124	0,8600		0,0,4300	no	coding-synonymous	FANCM	NM_020937.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1812/2049	45665470	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57697	3	121412	40	Fanconi Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	g.chr14:45665470G>A	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5436G>A	chr14.hg19:g.45665470G>A		0					FANCM_ENST00000542564.2_Silent_p.P1786P	p.P1812P	NM_020937.2	NP_065988.1	0	0	0	2.059044	Q8IYD8	FANCM_HUMAN		21	5521	+			B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	0	1	hg19	c.5436G>A	CCDS32070.1	0	.	.	.	.	.	.	.	.	.	.	G	6.510	0.462289	0.12342	2.27E-4	0.0	ENSG00000187790	ENST00000554809	.	.	.	5.27	-1.83	0.07833	5.27	-1.83	0.07833	.	.	.	.	.	T	0.18800	0.0451	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25082	-1.0142	4	.	.	.	.	1.3233	0.02121	0.293:0.1242:0.3414:0.2414	.	.	.	.	T	780	.	.	A	+	1	0	0	FANCM	44735220	44735220	0.000000	0.05858	0.008000	0.14137	0.362000	0.29581	-0.041000	0.12084	-0.216000	0.10048	-0.414000	0.06135	GCA	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.438	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	0	0	1	2	2	2	2	0	0	0	0	78	0	78	78	1	1.910000	-2.373405	0	0.580000	XM_048128		0	6	7	0	589	587	0		1	0		0	0	78	0	0	9.649367e-01	1.522051e-03	0	0	0	5	0	6	589
EML1	2009	broad.mit.edu	37	14	100405582	100405582	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr14:100405582G>A	ENST00000262233.6	+	21	2379	c.2240G>A	c.(2239-2241)cGg>cAg	p.R747Q	EML1_ENST00000327921.9_Missense_Mutation_p.R735Q|EML1_ENST00000334192.4_Missense_Mutation_p.R766Q	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	747	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R766Q(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				GCCGTCTGTCGGGCCCATGAG	0.552																																						ENST00000262233.6	0.120000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.062318	0.050000	0.060000																										1	Substitution - Missense(1)	p.R766Q(1)	large_intestine(1)	42						c.(2239-2241)cGg>cAg		echinoderm microtubule associated protein like 1							125.0	112.0	116.0					14																	100405582		2203	4300	6503	SO:0001583	missense	2009	3	121412	36				g.chr14:100405582G>A	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.2240G>A	chr14.hg19:g.100405582G>A	ENSP00000262233:p.Arg747Gln	0					EML1_ENST00000327921.9_Missense_Mutation_p.R735Q|EML1_ENST00000334192.4_Missense_Mutation_p.R766Q	p.R747Q	NM_004434.2	NP_004425.2	0	0	0	2.059044	O00423	EMAL1_HUMAN		21	2379	+		Melanoma(154;0.0879)|all_epithelial(191;0.216)	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	ENST00000262233.6	0	1	hg19	c.2240G>A	CCDS32155.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117755	0.77323	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.17854	2.25;2.25;2.25	4.56	4.56	0.56223	4.56	4.56	0.56223	.	0.051684	0.64402	D	0.000001	T	0.47710	0.1460	M	0.90082	3.085	0.80722	D	1	P;D;D	0.71674	0.926;0.998;0.959	B;P;B	0.61397	0.388;0.888;0.293	T	0.62205	-0.6903	10	0.87932	D	0	-22.3911	17.6609	0.88193	0.0:0.0:1.0:0.0	.	735;747;766	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	Q	735;747;766;766	ENSP00000327384:R735Q;ENSP00000262233:R747Q;ENSP00000334314:R766Q	ENSP00000262233:R747Q	R	+	2	0	0	EML1	99475335	99475335	1.000000	0.71417	0.997000	0.53966	0.556000	0.35491	7.627000	0.83176	2.240000	0.73641	0.561000	0.74099	CGG	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.552	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	0	0	1	2	2	2	2	0	0	0	0	58	0	58	55	1	1.910000	-2.900681	1	0.580000	NM_001008707		0	5	6	0	324	323	0		1	0		0	0	58	0	0	9.380017e-01	8.043302e-02	0	1	0	24	0	5	324
ATP10A	57194	broad.mit.edu	37	15	25953374	25953374	+	Missense_Mutation	SNP	T	T	G			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr15:25953374T>G	ENST00000356865.6	-	11	2529	c.2418A>C	c.(2416-2418)gaA>gaC	p.E806D		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	806					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGCGCAGGCCTTCCGCCGCAT	0.577																																						ENST00000356865.6	1.000000	7.300000e-01	0.960000	8.000000e-01	0.880000	0.884204	0.880000	1.000000																										0				103						c.(2416-2418)gaA>gaC		ATPase, class V, type 10A							127.0	108.0	114.0					15																	25953374		2203	4300	6503	SO:0001583	missense	57194	0	0					g.chr15:25953374T>G	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2418A>C	chr15.hg19:g.25953374T>G	ENSP00000349325:p.Glu806Asp	0						p.E806D	NM_024490.3	NP_077816.1	1	2	3	2.066352	O60312	AT10A_HUMAN		11	2529	-		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	1	1	hg19	c.2418A>C	CCDS32178.1	1	.	.	.	.	.	.	.	.	.	.	T	7.022	0.558919	0.13436	.	.	ENSG00000206190	ENST00000356865	D	0.82433	-1.61	4.84	-4.91	0.03085	4.84	-4.91	0.03085	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.093232	0.64402	N	0.000001	T	0.53578	0.1805	N	0.12920	0.275	0.46317	D	0.998986	B	0.06786	0.001	B	0.15484	0.013	T	0.51764	-0.8664	10	0.02654	T	1	-23.9456	2.2901	0.04136	0.283:0.4025:0.0988:0.2157	.	806	O60312	AT10A_HUMAN	D	806	ENSP00000349325:E806D	ENSP00000349325:E806D	E	-	3	2	2	ATP10A	23504467	23504467	1.000000	0.71417	0.792000	0.32020	0.854000	0.48673	1.151000	0.31651	-0.677000	0.05231	0.533000	0.62120	GAA	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.577	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	1	0	1	2	2	2	2	0	0	0	0	102	0	102	102	1	1.910000	-20.000000	1	0.580000	NM_024490		0	102	99	0	297	293	1		1	0		0	0	102	0	0	1	8.500320e-01	0	0	0	12	0	102	297
VPS33B	26276	broad.mit.edu	37	15	91557033	91557033	+	Splice_Site	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr15:91557033C>T	ENST00000333371.3	-	5	711		c.e5+1		VPS33B_ENST00000535843.1_Splice_Site|VPS33B_ENST00000557358.1_Intron|VPS33B_ENST00000535906.1_Splice_Site	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)						lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					TCCAAACTCACCTTTTGAGGG	0.522																																						ENST00000333371.3	1.000000	7.200000e-01	0.940000	7.900000e-01	0.860000	0.866016	0.860000	0.860000																										0				16						c.e5+1		vacuolar protein sorting 33 homolog B (yeast)							158.0	138.0	145.0					15																	91557033		2198	4298	6496	SO:0001630	splice_region_variant	26276	0	0					g.chr15:91557033C>T	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.357+1G>A	chr15.hg19:g.91557033C>T		0					VPS33B_ENST00000557358.1_Intron|VPS33B_ENST00000535906.1_Splice_Site|VPS33B_ENST00000535843.1_Splice_Site		NM_018668.3	NP_061138.3	1	2	3	2.064462	Q9H267	VP33B_HUMAN		5	711	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Splice_Site	SNP	ENST00000333371.3	1	1	hg19		CCDS10369.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600940	0.87055	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	.	.	.	5.62	5.62	0.85841	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2545	0.93940	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	VPS33B	89358037	89358037	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.902000	0.69869	2.647000	0.89833	0.650000	0.86243	.	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.522	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	1	0	1	2	2	2	2	0	0	0	0	68	0	68	67	1	1.910000	-20.000000	1	0.580000	NM_018668	Intron	0	110	109	0	330	327	1		1	0		0	0	68	0	0	1	6.349141e-02	0	1	0	1	0	110	330
SSTR5	6755	broad.mit.edu	37	16	1129924	1129924	+	Silent	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr16:1129924C>T	ENST00000293897.4	+	1	1144	c.1056C>T	c.(1054-1056)cgC>cgT	p.R352R	SSTR5_ENST00000562758.1_Intron|SSTR5_ENST00000397547.2_Silent_p.R352R|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	352				PPAHR -> RPRT (in Ref. 1; AAA20828). {ECO:0000305}.	G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CCGCGCACCGCGCCGCAGCCA	0.711																																						ENST00000293897.4	1.000000	3.400000e-01	0.900000	4.900000e-01	0.670000	0.690285	0.670000	1.000000																										0				9						c.(1054-1056)cgC>cgT		somatostatin receptor 5	Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)						14.0	14.0	14.0					16																	1129924		2162	4262	6424	SO:0001819	synonymous_variant	6755	1	119194	29				g.chr16:1129924C>T	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.1056C>T	chr16.hg19:g.1129924C>T		0					SSTR5_ENST00000397547.2_Silent_p.R352R|SSTR5_ENST00000562758.1_Intron|SSTR5-AS1_ENST00000569832.1_RNA	p.R352R	NM_001053.3	NP_001044.1	1	2	3	2.102201	P35346	SSR5_HUMAN		1	1144	+		Hepatocellular(780;0.00369)	P34988|Q541E0|Q9UJI5	Silent	SNP	ENST00000293897.4	0	1	hg19	c.1056C>T	CCDS10429.1	0																																																																																								0.584816		TCGA-3A-A9IU-01A-11D-A397-08	0.711	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1	0	0	1	2	2	2	2	0	0	0	0	14	0	14	13	1	1.910000	-19.995970	1	0.580000			0	9	9	0	39	38	0		1			0	0	14	0	0	9.952899e-01	0	0	0	0	0	0	9	39
PKD1	5310	broad.mit.edu	37	16	2156826	2156826	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr16:2156826T>C	ENST00000262304.4	-	17	7397	c.7189A>G	c.(7189-7191)Agc>Ggc	p.S2397G	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.S2397G	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2397	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GAGCCGCTGCTGCAATTGAGG	0.662																																						ENST00000262304.4	1.000000	1.400000e-01	0.470000	2.200000e-01	0.320000	0.360419	0.320000	0.310000																										0				72						c.(7189-7191)Agc>Ggc		polycystic kidney disease 1 (autosomal dominant)							4.0	6.0	5.0					16																	2156826		1156	2279	3435	SO:0001583	missense	5310	0	0					g.chr16:2156826T>C	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7189A>G	chr16.hg19:g.2156826T>C	ENSP00000262304:p.Ser2397Gly	0					PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.S2397G	p.S2397G	NM_001009944.2	NP_001009944	1	2	3	2.102201	P98161	PKD1_HUMAN		17	7397	-			Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	0	1	hg19	c.7189A>G	CCDS32369.1	0	.	.	.	.	.	.	.	.	.	.	t	2.685	-0.274485	0.05679	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.69926	-0.44;-0.44	4.22	3.11	0.35812	4.22	3.11	0.35812	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.607624	0.18369	N	0.143312	T	0.54679	0.1873	L	0.51422	1.61	0.22754	N	0.998778	B;B	0.18610	0.029;0.016	B;B	0.23852	0.049;0.026	T	0.38672	-0.9650	10	0.19590	T	0.45	.	5.6771	0.17755	0.0:0.1065:0.3359:0.5576	.	2397;2397	P98161-3;P98161	.;PKD1_HUMAN	G	2397;2397;1748;676	ENSP00000262304:S2397G;ENSP00000399501:S2397G	ENSP00000262304:S2397G	S	-	1	0	0	PKD1	2096827	2096827	1.000000	0.71417	0.960000	0.40013	0.494000	0.33585	2.464000	0.45067	0.782000	0.33613	0.445000	0.29226	AGC	0.584816		TCGA-3A-A9IU-01A-11D-A397-08	0.662	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1	0	0	1	2	2	2	2	0	0	0	0	14	0	14	19	1	1.910000	-13.122090	1	0.580000			0	7	5	0	72	24	0		1	0		0	0	14	0	0	7.484324e-01	1.174952e-01	0	1	0	5	0	7	72
ADCY9	115	broad.mit.edu	37	16	4016903	4016903	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr16:4016903C>T	ENST00000294016.3	-	11	3473	c.2935G>A	c.(2935-2937)Ggc>Agc	p.G979S		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	979					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						ACCTCCTGGCCGATGAGGCTG	0.582																																						ENST00000294016.3	1.000000	8.500000e-01	1.000000	9.200000e-01	0.990000	0.970957	0.990000	1.000000																										0				47						c.(2935-2937)Ggc>Agc		adenylate cyclase 9							59.0	69.0	65.0					16																	4016903		2195	4300	6495	SO:0001583	missense	115	2	121400	38				g.chr16:4016903C>T	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2935G>A	chr16.hg19:g.4016903C>T	ENSP00000294016:p.Gly979Ser	0						p.G979S	NM_001116.3	NP_001107.2	1	2	3	2.102201	O60503	ADCY9_HUMAN		11	3473	-			A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	1	1	hg19	c.2935G>A	CCDS32382.1	1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041963	0.55003	.	.	ENSG00000162104	ENST00000294016	D	0.83250	-1.7	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.149249	0.64402	D	0.000011	D	0.82337	0.5015	N	0.22421	0.69	0.51767	D	0.999931	D	0.76494	0.999	P	0.59115	0.852	T	0.76348	-0.2992	10	0.08837	T	0.75	.	19.7084	0.96083	0.0:1.0:0.0:0.0	.	979	O60503	ADCY9_HUMAN	S	979	ENSP00000294016:G979S	ENSP00000294016:G979S	G	-	1	0	0	ADCY9	3956904	3956904	0.998000	0.40836	0.970000	0.41538	0.455000	0.32408	3.763000	0.55257	2.739000	0.93911	0.561000	0.74099	GGC	0.584816		TCGA-3A-A9IU-01A-11D-A397-08	0.582	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1	1	0	1	2	2	2	2	0	0	0	0	88	0	88	87	1	1.910000	-7.874103	1	0.580000			0	124	121	0	309	304	1		1	1		0	0	88	0	0	1	9.846138e-01	0	2	0	17	0	124	309
HSDL1	83693	broad.mit.edu	37	16	84164829	84164829	+	Missense_Mutation	SNP	G	G	A	rs143907842		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr16:84164829G>A	ENST00000219439.4	-	3	274	c.98C>T	c.(97-99)aCg>aTg	p.T33M	HSDL1_ENST00000434463.3_Missense_Mutation_p.T33M	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	33	Required for mitochondria translocation.					mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						TTTTCTGGCCGTATACCAGGC	0.493																																						ENST00000219439.4	1.000000	0	0.060000	1.000000e-02	0.030000	0.072915	0.030000	0.040000																										0				7						c.(97-99)aCg>aTg		hydroxysteroid dehydrogenase like 1		G	MET/THR,MET/THR	0,4400		0,0,2200	122.0	118.0	119.0		98,98	5.8	1.0	16	dbSNP_134	119	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense	HSDL1	NM_001146051.1,NM_031463.4	81,81	0,5,6495	AA,AG,GG		0.0581,0.0,0.0385	possibly-damaging,possibly-damaging	33/276,33/331	84164829	5,12995	2200	4300	6500	SO:0001583	missense	83693	39	121412	50				g.chr16:84164829G>A	AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.98C>T	chr16.hg19:g.84164829G>A	ENSP00000219439:p.Thr33Met	0					HSDL1_ENST00000434463.3_Missense_Mutation_p.T33M	p.T33M	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	1	2	3	2.108988	Q3SXM5	HSDL1_HUMAN		3	274	-			B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Missense_Mutation	SNP	ENST00000219439.4	0	1	hg19	c.98C>T	CCDS10942.1	0	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883945	0.51908	0.0	5.81E-4	ENSG00000103160	ENST00000434463;ENST00000219439	T;D	0.83163	-1.11;-1.69	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.185252	0.47852	D	0.000218	T	0.74581	0.3735	N	0.17082	0.46	0.42561	D	0.993148	D;P	0.64830	0.994;0.812	P;B	0.45449	0.481;0.137	T	0.77161	-0.2689	10	0.45353	T	0.12	-18.6731	14.306	0.66384	0.0706:0.0:0.9294:0.0	.	33;33	B4DSL2;Q3SXM5	.;HSDL1_HUMAN	M	33	ENSP00000407437:T33M;ENSP00000219439:T33M	ENSP00000219439:T33M	T	-	2	0	0	HSDL1	82722330	82722330	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.371000	0.66150	2.765000	0.95021	0.655000	0.94253	ACG	0.586003		TCGA-3A-A9IU-01A-11D-A397-08	0.493	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269076.3	0	0	1	2	2	2	2	0	0	0	0	122	0	122	122	1	1.910000	-2.208772	0	0.580000	NM_031463		0	6	6	0	654	655	0		1	0		0	0	122	0	0	9.652566e-01	2.889622e-02	0	0	0	24	0	6	654
TP53	7157	broad.mit.edu	37	17	7579473	7579473	+	Missense_Mutation	SNP	G	G	C	rs587782769		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr17:7579473G>C	ENST00000269305.4	-	4	403	c.214C>G	c.(214-216)Ccc>Gcc	p.P72A	TP53_ENST00000420246.2_Missense_Mutation_p.P72A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P72A|TP53_ENST00000455263.2_Missense_Mutation_p.P72A|TP53_ENST00000445888.2_Missense_Mutation_p.P72A|TP53_ENST00000359597.4_Missense_Mutation_p.P72A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	72	Interaction with HRMT1L2.|Interaction with WWOX.		P -> C (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> G (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in a sporadic cancer; somatic mutation).|P -> R (in dbSNP:rs1042522). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:16131611, ECO:0000269|PubMed:1999338, ECO:0000269|Ref.17}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G59fs*23(3)|p.R72fs*51(2)|p.R72C(2)|p.E68fs*76(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCACGGGGGGAGCAGCC	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.200000e-01	0.970000	8.700000e-01	0.920000	0.922150	0.920000	0.930000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		21	Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Missense(2)|Complex - frameshift(2)|Deletion - In frame(1)	p.0?(8)|p.G59fs*23(3)|p.R72fs*51(2)|p.R72C(2)|p.E68fs*76(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)	breast(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|urinary_tract(1)|lung(1)|prostate(1)	24185						c.(214-216)Ccc>Gcc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						90.0	98.0	96.0					17																	7579473		2203	4300	6503	SO:0001583	missense	7157	1	121404	41	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7579473G>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.214C>G	chr17.hg19:g.7579473G>C	ENSP00000269305:p.Pro72Ala	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.P72A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P72A|TP53_ENST00000420246.2_Missense_Mutation_p.P72A|TP53_ENST00000359597.4_Missense_Mutation_p.P72A|TP53_ENST00000413465.2_Missense_Mutation_p.P72A	p.P72A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.504503	P04637	P53_HUMAN		4	403	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	0	hg19	c.214C>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	2.042	-0.419843	0.04734	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99287	-5.17;-5.69;-5.4;-5.68;-5.68;-5.4;-4.05;-1.96	3.66	0.238	0.15480	3.66	0.238	0.15480	.	2.010640	0.04441	U	0.370853	D	0.95500	0.8538	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.10296	0.0;0.0;0.0;0.0;0.003	B;B;B;B;B	0.08055	0.0;0.001;0.001;0.0;0.003	D	0.93649	0.6971	10	0.26408	T	0.33	.	7.4166	0.27048	0.1022:0.4057:0.492:0.0	.	72;72;72;72;72	E7EMR6;P04637-2;P04637-3;P04637;E7EQX7	.;.;.;P53_HUMAN;.	A	72	ENSP00000410739:P72A;ENSP00000352610:P72A;ENSP00000269305:P72A;ENSP00000398846:P72A;ENSP00000391127:P72A;ENSP00000391478:P72A;ENSP00000424104:P72A;ENSP00000426252:P72A	ENSP00000269305:P72A	P	-	1	0	0	TP53	7520198	7520198	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.284000	0.08422	0.102000	0.17638	-0.264000	0.10439	CCC	0.408451		TCGA-3A-A9IU-01A-11D-A397-08	0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	0	2	14	2	2	0	0	0	1	135	0	135	132	1	1.910000	-19.999790	1	0.580000	NM_000546		0	194	222	0	315	291	0		1	0	1	0	0	135	192	0	1	9.998652e-01	1	0	78	25	171	194	315
TP53	7157	broad.mit.edu	37	17	7579479	7579479	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr17:7579479C>T	ENST00000269305.4	-	4	397	c.208G>A	c.(208-210)Gct>Act	p.A70T	TP53_ENST00000420246.2_Missense_Mutation_p.A70T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.A70T|TP53_ENST00000455263.2_Missense_Mutation_p.A70T|TP53_ENST00000445888.2_Missense_Mutation_p.A70T|TP53_ENST00000359597.4_Missense_Mutation_p.A70T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	70	Interaction with HRMT1L2.|Interaction with WWOX.		A -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G59fs*23(3)|p.E68fs*76(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.A70T(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACGGGGGGAGCAGCCTCTGGC	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	9.100000e-01	1.000000	9.400000e-01	0.970000	0.975482	0.970000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		19	Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(2)|Substitution - Missense(1)|Complex - frameshift(1)	p.0?(8)|p.G59fs*23(3)|p.E68fs*76(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.A70T(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)	breast(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	24185						c.(208-210)Gct>Act	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						99.0	107.0	104.0					17																	7579479		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7579479C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.208G>A	chr17.hg19:g.7579479C>T	ENSP00000269305:p.Ala70Thr	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.A70T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.A70T|TP53_ENST00000420246.2_Missense_Mutation_p.A70T|TP53_ENST00000359597.4_Missense_Mutation_p.A70T|TP53_ENST00000413465.2_Missense_Mutation_p.A70T	p.A70T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.504503	P04637	P53_HUMAN		4	397	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.208G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	9.093	1.002269	0.19121	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99376	-5.28;-5.79;-5.51;-5.79;-5.79;-5.51;-4.19;-2.14	3.66	-2.27	0.06846	3.66	-2.27	0.06846	.	4.481350	0.01345	N	0.011694	D	0.95092	0.8410	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B	0.27971	0.079;0.049;0.196;0.013;0.031;0.025;0.0	B;B;B;B;B;B;B	0.29785	0.031;0.026;0.107;0.017;0.034;0.022;0.0	D	0.97004	0.9731	10	0.09843	T	0.71	.	1.4508	0.02374	0.1962:0.3205:0.3268:0.1566	.	31;70;70;70;70;70;70	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	70	ENSP00000410739:A70T;ENSP00000352610:A70T;ENSP00000269305:A70T;ENSP00000398846:A70T;ENSP00000391127:A70T;ENSP00000391478:A70T;ENSP00000424104:A70T;ENSP00000426252:A70T	ENSP00000269305:A70T	A	-	1	0	0	TP53	7520204	7520204	0.016000	0.18221	0.000000	0.03702	0.001000	0.01503	-0.099000	0.11007	-0.331000	0.08501	-1.242000	0.01536	GCT	0.408451		TCGA-3A-A9IU-01A-11D-A397-08	0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	0	2	2	2	2	0	0	0	0	146	0	146	144	1	1.910000	-20.000000	1	0.580000	NM_000546		0	239	242	0	320	320	1		1	0	1	0	0	146	219	0	1	9.999616e-01	1	0	99	24	192	239	320
QRICH2	84074	broad.mit.edu	37	17	74288916	74288916	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr17:74288916G>A	ENST00000262765.5	-	4	1573	c.1394C>T	c.(1393-1395)gCc>gTc	p.A465V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	465	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						accaggttgggccaaaccaga	0.557																																						ENST00000262765.5	1.000000	3.000000e-02	0.180000	6.000000e-02	0.100000	0.145024	0.100000	0.100000																										0				62						c.(1393-1395)gCc>gTc		glutamine rich 2							102.0	89.0	93.0					17																	74288916		2203	4300	6503	SO:0001583	missense	84074	0	0					g.chr17:74288916G>A	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1394C>T	chr17.hg19:g.74288916G>A	ENSP00000262765:p.Ala465Val	0						p.A465V	NM_032134.1	NP_115510.1	1	2	3	2.101218	Q9H0J4	QRIC2_HUMAN		4	1573	-			A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	0	1	hg19	c.1394C>T	CCDS32741.1	0	.	.	.	.	.	.	.	.	.	.	-	9.875	1.200097	0.22121	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.08370	3.1	5.38	-5.83	0.02325	5.38	-5.83	0.02325	.	.	.	.	.	T	0.01730	0.0055	N	0.00621	-1.32	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43734	-0.9373	9	0.27082	T	0.32	-3.7961	2.3937	0.04385	0.3394:0.2868:0.2749:0.0989	.	465;465	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	465	ENSP00000262765:A465V	ENSP00000262765:A465V	A	-	2	0	0	QRICH2	71800511	71800511	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.107000	0.03316	-0.983000	0.03511	-0.272000	0.10252	GCC	0.584816		TCGA-3A-A9IU-01A-11D-A397-08	0.557	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	0	0	1	2	2	2	2	0	0	0	0	11	0	11	11	1	1.910000	-3.328154	1	0.580000	NM_032134		0	4	4	0	139	137	0		1			0	0	11	0	0	8.881317e-01	0	0	0	0	0	0	4	139
NPLOC4	55666	broad.mit.edu	37	17	79556050	79556050	+	Silent	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr17:79556050G>A	ENST00000331134.6	-	12	1416	c.1201C>T	c.(1201-1203)Ctg>Ttg	p.L401L	NPLOC4_ENST00000539314.1_Silent_p.L240L|NPLOC4_ENST00000374747.5_Silent_p.L401L	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	401					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TTGCATGGCAGCAAACACTCA	0.498																																						ENST00000331134.6	1.000000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.089843	0.050000	0.060000																										0				11						c.(1201-1203)Ctg>Ttg		nuclear protein localization 4 homolog (S. cerevisiae)							89.0	93.0	92.0					17																	79556050		2072	4226	6298	SO:0001819	synonymous_variant	55666	0	0					g.chr17:79556050G>A	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1201C>T	chr17.hg19:g.79556050G>A		0					NPLOC4_ENST00000374747.5_Silent_p.L401L|NPLOC4_ENST00000539314.1_Silent_p.L240L	p.L401L	NM_017921.2	NP_060391.2	1	2	3	2.101218	Q8TAT6	NPL4_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)	12	1416	-	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Silent	SNP	ENST00000331134.6	0	1	hg19	c.1201C>T	CCDS45812.1	0																																																																																								0.584816		TCGA-3A-A9IU-01A-11D-A397-08	0.498	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1	0	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	1.910000	-2.459651	0	0.580000			0	5	5	0	325	321	0		1	0		0	0	54	0	0	9.354747e-01	4.603752e-01	0	0	0	90	0	5	325
CELF4	56853	broad.mit.edu	37	18	34901802	34901802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr18:34901802G>A	ENST00000591282.1	-	3	411	c.412C>T	c.(412-414)Cga>Tga	p.R138*	CELF4_ENST00000591287.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000334919.5_Nonsense_Mutation_p.R138*|CELF4_ENST00000412753.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000601019.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000588597.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000603232.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000361795.5_Nonsense_Mutation_p.R138*|CELF4_ENST00000420428.2_Nonsense_Mutation_p.R138*			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	138	Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						CTACCTCCTCGGCTCTCGCTG	0.647											OREG0024927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000591282.1	0.980000	6.300000e-01	0.920000	7.200000e-01	0.820000	0.825013	0.820000	0.830000																										0				44						c.(412-414)Cga>Tga		CUGBP, Elav-like family member 4							62.0	51.0	55.0					18																	34901802		2203	4300	6503	SO:0001587	stop_gained	56853	0	0					g.chr18:34901802G>A	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.412C>T	chr18.hg19:g.34901802G>A	ENSP00000464794:p.Arg138*	1		OREG0024927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	851	CELF4_ENST00000601019.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000420428.2_Nonsense_Mutation_p.R138*|CELF4_ENST00000334919.5_Nonsense_Mutation_p.R138*|CELF4_ENST00000603232.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000588597.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000361795.5_Nonsense_Mutation_p.R138*|CELF4_ENST00000591287.1_Nonsense_Mutation_p.R138*|CELF4_ENST00000412753.1_Nonsense_Mutation_p.R138*	p.R138*			0	1	1	1.486081	Q9BZC1	CELF4_HUMAN		3	411	-			Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Nonsense_Mutation	SNP	ENST00000591282.1	0	1	hg19	c.412C>T	CCDS32818.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.838326|8.838326	0.98972|0.98972	.|.	.|.	ENSG00000101489|ENSG00000101489	ENST00000361683|ENST00000361795;ENST00000412753;ENST00000420428;ENST00000334919	.|.	.|.	.|.	5.19|5.19	5.19|5.19	0.71726|0.71726	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.085967	.|0.47455	.|D	.|0.000223	T|.	0.38214|.	0.1032|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31280|.	-0.9949|.	4|.	0.51188|0.02654	T|T	0.08|1	-2.4113|-2.4113	16.1974|16.1974	0.82040|0.82040	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	32|138	.|.	ENSP00000355189:P32L|ENSP00000335631:R138X	P|R	-|-	2|1	0|2	0|2	CELF4|CELF4	33155800|33155800	33155800|33155800	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.015000|3.015000	0.49599|0.49599	2.413000|2.413000	0.81919|0.81919	0.484000|0.484000	0.47621|0.47621	CCG|CGA	0.410857		TCGA-3A-A9IU-01A-11D-A397-08	0.647	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	1	0	1	2	2	2	2	0	0	0	0	21	0	21	21	1	1.910000	-20.000000	1	0.580000	NM_020180		0	43	42	0	83	81	1		1			0	0	21	0	0	1	0	0	0	0	0	0	43	83
PPP4R1	9989	broad.mit.edu	37	18	9583116	9583116	+	Splice_Site	SNP	C	C	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr18:9583116C>A	ENST00000400556.3	-	9	990	c.917G>T	c.(916-918)tGg>tTg	p.W306L	PPP4R1_ENST00000400555.3_Splice_Site_p.W289L|PPP4R1_ENST00000580583.1_Intron	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	306					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						AAACCCTACCCAACGTGAAGG	0.328																																					Melanoma(188;1232 2082 5061 11948 35994)	ENST00000400556.3	0.140000	1.000000e-02	0.110000	3.000000e-02	0.060000	0.074128	0.060000	0.060000																										0				3						c.(916-918)tGg>tTg		protein phosphatase 4, regulatory subunit 1							53.0	50.0	51.0					18																	9583116		1814	4076	5890	SO:0001630	splice_region_variant	9989	0	0					g.chr18:9583116C>A	AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.918+1G>T	chr18.hg19:g.9583116C>A		0					PPP4R1_ENST00000580583.1_Intron|PPP4R1_ENST00000400555.3_Splice_Site_p.W289L	p.W306L	NM_001042388.2	NP_001035847.1	0	0	0	2.028010	Q8TF05	PP4R1_HUMAN		9	990	-			Q99774|Q9UNQ7	Splice_Site	SNP	ENST00000400556.3	0	1	hg19	c.917G>T	CCDS42412.1	0	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856783	0.91433	.	.	ENSG00000154845	ENST00000400556;ENST00000400555;ENST00000285124	T;T	0.17854	2.25;2.25	5.65	5.65	0.86999	5.65	5.65	0.86999	Armadillo-like helical (1);Armadillo-type fold (1);	0.309004	0.33040	N	0.005343	T	0.43743	0.1261	M	0.71206	2.165	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76575	0.973;0.988	T	0.05305	-1.0893	9	.	.	.	-13.8309	19.5069	0.95121	0.0:1.0:0.0:0.0	.	306;289	Q8TF05;Q8TF05-2	PP4R1_HUMAN;.	L	306;289;217	ENSP00000383402:W306L;ENSP00000383401:W289L	.	W	-	2	0	0	PPP4R1	9573116	9573116	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.294000	0.78760	2.941000	0.99782	0.655000	0.94253	TGG	0.575071		TCGA-3A-A9IU-01A-11D-A397-08	0.328	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1	0	0	1	2	2	2	2	0	0	0	0	32	0	32	32	1	1.910000	-3.124691	1	0.580000	NM_005134	Missense_Mutation	0	4	4	0	223	221	0		1	0		0	0	32	0	0	8.890625e-01	3.986485e-01	0	0	0	65	0	4	223
DSEL	92126	broad.mit.edu	37	18	65180274	65180275	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr18:65180274_65180275CT>AA	ENST00000310045.7	-	2	3074_3075	c.1601_1602AG>TT	c.(1600-1602)cAG>cTT	p.Q534L	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	524					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				ACTTAAGCCACTGCGCACATTC	0.515																																						ENST00000310045.7	1.000000	9.100000e-01	1.000000	9.500000e-01	0.980000	0.981811|0.982048	0.980000	1.000000																										0				74						c.(1600-1602)caG>caT|c.(1600-1602)cAg>cTg		dermatan sulfate epimerase-like																																				SO:0001583	missense	92126	0	0					g.chr18:65180274C>A|g.chr18:65180275T>A	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1601_1602delinsAA	chr18.hg19:g.65180274_65180275delinsAA	ENSP00000310565:p.Gln534Leu	1					CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	p.Q534H|p.Q534L	NM_032160.2	NP_115536.1	0	1	1	1.503831	Q8IZU8	DSEL_HUMAN		2	3075|3074	-		Esophageal squamous(42;0.129)	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	1	1	hg19	c.1602G>T|c.1601A>T	CCDS11995.1	1																									5.67	2.89|5.67	0.33648|0.87782																																												2|0			63331254|63331255														0.410857		TCGA-3A-A9IU-01A-11D-A397-08	0.515	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	1	0	1	2	2	2	2	0	0	0	0	75	0	78|75	76|73	1	1.910000	-20.000000	1	0.580000	NM_032160		0	118|119	114|115	0	133|134	133|134	1		1	0		0	0	78|75	0	0	1	9.126792e-01|9.128961e-01	0	0	0	7	0	118	133
ABHD8	79575	broad.mit.edu	37	19	17405196	17405196	+	Silent	SNP	G	G	A	rs536645024		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr19:17405196G>A	ENST00000247706.3	-	4	1289	c.1050C>T	c.(1048-1050)ggC>ggT	p.G350G	CTD-2278I10.4_ENST00000594077.1_RNA|MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000600434.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	350							hydrolase activity (GO:0016787)	p.G350G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						AGACCTCGTCGCCCTCGGGCC	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		16753	0.001		0.0	False		,,,				2504	0.0				Ovarian(156;1368 2543 15275 41187)	ENST00000247706.3	1.000000	8.500000e-01	0.990000	9.100000e-01	0.950000	0.954827	0.950000	0.990000																										1	Substitution - coding silent(1)	p.G350G(1)	lung(1)	9						c.(1048-1050)ggC>ggT		abhydrolase domain containing 8							125.0	98.0	107.0					19																	17405196		2203	4300	6503	SO:0001819	synonymous_variant	79575	1	121412	27				g.chr19:17405196G>A	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.1050C>T	chr19.hg19:g.17405196G>A		1					CTD-2278I10.4_ENST00000594077.1_RNA|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	p.G350G	NM_024527.4	NP_078803.4	0	1	1	1.500903	Q96I13	ABHD8_HUMAN		4	1289	-			Q9HAE9	Silent	SNP	ENST00000247706.3	1	1	hg19	c.1050C>T	CCDS12355.1	1																																																																																								0.408451		TCGA-3A-A9IU-01A-11D-A397-08	0.612	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1	1	0	1	2	2	2	2	0	0	0	0	98	0	98	97	1	1.910000	-19.854080	1	0.580000	NM_024527		0	122	122	0	169	166	1		1	1		0	0	98	0	0	1	9.999997e-01	0	15	0	21	0	122	169
RASIP1	54922	broad.mit.edu	37	19	49232704	49232704	+	Silent	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr19:49232704G>A	ENST00000222145.4	-	5	1527	c.1323C>T	c.(1321-1323)cgC>cgT	p.R441R	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	441					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CAGGGCCCGCGCGCACTGTGC	0.741																																						ENST00000222145.4	1.000000	3.200000e-01	1.000000	5.100000e-01	0.780000	0.765730	0.780000	1.000000																										0				21						c.(1321-1323)cgC>cgT		Ras interacting protein 1							7.0	7.0	7.0					19																	49232704		2143	4164	6307	SO:0001819	synonymous_variant	54922	2	117836	33				g.chr19:49232704G>A	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1323C>T	chr19.hg19:g.49232704G>A		1					RASIP1_ENST00000594232.1_5'Flank	p.R441R	NM_017805.2	NP_060275.2	1	2	3	2.708686	Q5U651	RAIN_HUMAN		5	1527	-		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	Q6U676	Silent	SNP	ENST00000222145.4	0	1	hg19	c.1323C>T	CCDS12731.1	0																																																																																								0.674419		TCGA-3A-A9IU-01A-11D-A397-08	0.741	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	1	0	1	2	2	2	2	0	0	0	0	8	0	8	8	1	1.910000	-14.364150	1	0.580000	NM_017805		0	5	5	0	25	25	0		1	0		0	0	8	0	0	9.433425e-01	1.006016e-01	0	0	0	3	0	5	25
A1BG	1	broad.mit.edu	37	19	58862886	58862886	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr19:58862886G>A	ENST00000263100.3	-	5	842	c.781C>T	c.(781-783)Cgc>Tgc	p.R261C	CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000600379.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	261	Ig-like V-type 3.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		AAGAAGATGCGATCTGGGCTG	0.637																																						ENST00000263100.3	1.000000	9.000000e-01	1.000000	9.900000e-01	0.990000	0.992676	0.990000	1.000000																										0				15						c.(781-783)Cgc>Tgc		alpha-1-B glycoprotein							85.0	72.0	76.0					19																	58862886		2203	4300	6503	SO:0001583	missense	1	1	121410	35				g.chr19:58862886G>A		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.781C>T	chr19.hg19:g.58862886G>A	ENSP00000263100:p.Arg261Cys	1					CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000593960.1_RNA	p.R261C	NM_130786.3	NP_570602.2	1	2	3	2.696253	P04217	A1BG_HUMAN		5	842	-		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)	A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	ENST00000263100.3	1	1	hg19	c.781C>T	CCDS12976.1	1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772683	0.49680	.	.	ENSG00000121410	ENST00000263100;ENST00000453054	T	0.13089	2.62	4.08	0.302	0.15786	4.08	0.302	0.15786	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.104360	0.07058	N	0.833228	T	0.37652	0.1011	M	0.77820	2.39	0.09310	N	1	D	0.89917	1.0	D	0.74023	0.982	T	0.28902	-1.0029	10	0.72032	D	0.01	.	11.1079	0.48214	0.0:0.0:0.5207:0.4793	.	261	P04217	A1BG_HUMAN	C	261;139	ENSP00000263100:R261C	ENSP00000263100:R261C	R	-	1	0	0	A1BG	63554698	63554698	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.465000	0.22004	0.042000	0.15717	0.462000	0.41574	CGC	0.674419		TCGA-3A-A9IU-01A-11D-A397-08	0.637	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	1	0	1	2	2	2	2	0	0	0	0	68	0	68	67	1	1.910000	-20.000000	1	0.580000	NM_130786		0	81	80	0	244	242	1		1	0		0	0	68	0	0	1	6.345566e-02	0	0	0	2	0	81	244
C1orf43	25912	broad.mit.edu	37	1	154192337	154192337	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr1:154192337A>T	ENST00000368521.5	-	2	341	c.143T>A	c.(142-144)gTc>gAc	p.V48D	UBAP2L_ENST00000343815.6_5'Flank|C1orf43_ENST00000368518.1_Missense_Mutation_p.V48D|UBAP2L_ENST00000428931.1_5'Flank|C1orf43_ENST00000368519.1_Missense_Mutation_p.V48D|C1orf43_ENST00000362076.4_Intron|UBAP2L_ENST00000271877.7_5'Flank|C1orf43_ENST00000350592.3_Intron|C1orf43_ENST00000368516.1_Intron	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	48						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					TCCCACAGGGACATGAGGTCC	0.428																																						ENST00000368521.5	1.000000	7.400000e-01	1.000000	8.300000e-01	0.920000	0.915880	0.920000	1.000000																										0				10						c.(142-144)gTc>gAc		chromosome 1 open reading frame 43							64.0	62.0	63.0					1																	154192337		1859	4100	5959	SO:0001583	missense	25912	0	0					g.chr1:154192337A>T	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.143T>A	chr1.hg19:g.154192337A>T	ENSP00000357507:p.Val48Asp	1					C1orf43_ENST00000350592.3_Intron|UBAP2L_ENST00000271877.7_5'Flank|UBAP2L_ENST00000343815.6_5'Flank|C1orf43_ENST00000362076.4_Intron|UBAP2L_ENST00000428931.1_5'Flank|C1orf43_ENST00000368516.1_Intron|C1orf43_ENST00000368519.1_Missense_Mutation_p.V48D|C1orf43_ENST00000368518.1_Missense_Mutation_p.V48D	p.V48D	NM_001098616.1	NP_001092086.1	1	2	3	2.611330	Q9BWL3	CA043_HUMAN		2	341	-	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)		A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Missense_Mutation	SNP	ENST00000368521.5	1	1	hg19	c.143T>A	CCDS41404.1	1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.736629	0.89482	.	.	ENSG00000143612	ENST00000368521;ENST00000368519;ENST00000368518	.	.	.	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.054326	0.64402	D	0.000001	T	0.72479	0.3465	M	0.75615	2.305	0.80722	D	1	D;D	0.62365	0.982;0.991	P;P	0.62184	0.682;0.899	T	0.76515	-0.2931	9	0.72032	D	0.01	-18.2699	16.0034	0.80327	1.0:0.0:0.0:0.0	.	48;48	Q9BWL3-5;Q9BWL3	.;CA043_HUMAN	D	48	.	ENSP00000357504:V48D	V	-	2	0	0	C1orf43	152458961	152458961	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.842000	0.69417	2.371000	0.80710	0.533000	0.62120	GTC	0.670717		TCGA-3A-A9IU-01A-11D-A397-08	0.428	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087664.2	1	0	1	2	2	2	2	0	0	0	0	65	0	65	65	1	1.910000	-20.000000	1	0.580000	NM_015449		0	82	82	0	311	311	1		1	1		0	0	65	0	0	1	1	0	121	0	262	0	82	311
TMEM79	84283	broad.mit.edu	37	1	156256255	156256255	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr1:156256255C>T	ENST00000405535.2	+	3	1133	c.962C>T	c.(961-963)gCc>gTc	p.A321V	TMEM79_ENST00000357501.2_Silent_p.C82C|TMEM79_ENST00000295694.5_Missense_Mutation_p.A321V|TMEM79_ENST00000495881.1_3'UTR	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	321					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					GGTCTCTTTGCCGTCTCCCGG	0.562																																						ENST00000405535.2	1.000000	0	0.070000	2.000000e-02	0.040000	0.084190	0.040000	0.040000																										0				21						c.(961-963)gCc>gTc		transmembrane protein 79							101.0	104.0	103.0					1																	156256255		2203	4300	6503	SO:0001583	missense	84283	0	0					g.chr1:156256255C>T	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.962C>T	chr1.hg19:g.156256255C>T	ENSP00000384748:p.Ala321Val	1					TMEM79_ENST00000495881.1_3'UTR|TMEM79_ENST00000295694.5_Missense_Mutation_p.A321V|TMEM79_ENST00000357501.2_Silent_p.C82C	p.A321V	NM_032323.2	NP_115699.1	1	2	3	2.611330	Q9BSE2	TMM79_HUMAN		3	1133	+	Hepatocellular(266;0.158)		B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	0	1	hg19	c.962C>T	CCDS1138.1	0	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663832	0.67700	.	.	ENSG00000163472	ENST00000295694;ENST00000405535	T;T	0.50277	0.75;0.75	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.169075	0.52532	D	0.000061	T	0.29684	0.0741	N	0.11427	0.14	0.58432	D	0.999999	P	0.51537	0.946	P	0.52646	0.705	T	0.10989	-1.0606	10	0.30854	T	0.27	-1.5462	16.3903	0.83532	0.0:1.0:0.0:0.0	.	321	Q9BSE2	TMM79_HUMAN	V	321	ENSP00000295694:A321V;ENSP00000384748:A321V	ENSP00000295694:A321V	A	+	2	0	0	TMEM79	154522879	154522879	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	4.836000	0.62789	2.645000	0.89757	0.462000	0.41574	GCC	0.670717		TCGA-3A-A9IU-01A-11D-A397-08	0.562	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	0	0	1	2	2	2	2	0	0	0	0	73	0	73	72	1	1.910000	-2.140398	0	0.580000	NM_032323		0	6	6	0	616	612	0		1	0		0	0	73	0	0	9.644004e-01	7.890499e-02	0	0	0	40	0	6	616
KCNJ9	3765	broad.mit.edu	37	1	160054516	160054516	+	Silent	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr1:160054516C>T	ENST00000368088.3	+	2	938	c.696C>T	c.(694-696)ttC>ttT	p.F232F		NM_004983.2	NP_004974.2	Q92806	KCNJ9_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 9	232					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			biliary_tract(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(2)	16	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCGTGGGCTTCGACACGGGAG	0.682																																						ENST00000368088.3	1.000000	8.000000e-02	0.480000	1.600000e-01	0.280000	0.332260	0.280000	0.230000																										0				16						c.(694-696)ttC>ttT		potassium inwardly-rectifying channel, subfamily J, member 9							12.0	11.0	12.0					1																	160054516		2199	4289	6488	SO:0001819	synonymous_variant	3765	0	0					g.chr1:160054516C>T	U52152	CCDS1194.1	1q23.2	2011-07-05			ENSG00000162728	ENSG00000162728		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6270	protein-coding gene	gene with protein product		600932				8575783, 16382105	Standard	NM_004983		Approved	Kir3.3, GIRK3	uc001fuy.1	Q92806	OTTHUMG00000024072	ENST00000368088.3:c.696C>T	chr1.hg19:g.160054516C>T		1						p.F232F	NM_004983.2	NP_004974.2	1	2	3	2.611330	Q92806	KCNJ9_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)	2	938	+	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		Q5JW75	Silent	SNP	ENST00000368088.3	0	1	hg19	c.696C>T	CCDS1194.1	0																																																																																								0.670717		TCGA-3A-A9IU-01A-11D-A397-08	0.682	KCNJ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060628.1	0	0	1	2	2	2	2	0	0	0	0	10	0	10	10	1	1.910000	-7.238686	1	0.580000	NM_004983		0	3	3	0	52	52	0		1			0	0	10	0	0	8.125789e-01	0	0	0	0	0	0	3	52
DNMT3B	1789	broad.mit.edu	37	20	31388677	31388677	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr20:31388677G>A	ENST00000328111.2	+	18	2263	c.1942G>A	c.(1942-1944)Gga>Aga	p.G648R	DNMT3B_ENST00000443239.3_Missense_Mutation_p.G586R|DNMT3B_ENST00000348286.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000456297.2_Missense_Mutation_p.G552R|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000353855.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000201963.3_Missense_Mutation_p.G640R|DNMT3B_ENST00000344505.4_Missense_Mutation_p.G628R	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	648	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTGATTGGCGGAAGCCCATG	0.522																																						ENST00000328111.2	0.050000	0	0.040000	0	0.010000	0.024952	0.010000	0.020000																										0				39						c.(1942-1944)Gga>Aga		DNA (cytosine-5-)-methyltransferase 3 beta							185.0	187.0	186.0					20																	31388677		2203	4300	6503	SO:0001583	missense	1789	0	0					g.chr20:31388677G>A		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.1942G>A	chr20.hg19:g.31388677G>A	ENSP00000328547:p.Gly648Arg	0					DNMT3B_ENST00000348286.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000353855.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000344505.4_Missense_Mutation_p.G628R|DNMT3B_ENST00000456297.2_Missense_Mutation_p.G552R|DNMT3B_ENST00000443239.3_Missense_Mutation_p.G586R|DNMT3B_ENST00000201963.3_Missense_Mutation_p.G640R	p.G648R	NM_006892.3	NP_008823.1	0	1	1	2.044812	Q9UBC3	DNM3B_HUMAN		18	2263	+			A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	0	1	hg19	c.1942G>A	CCDS13205.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.691842	0.96793	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.98172	0.9396	H	0.97635	4.045	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.996;0.988;1.0;0.997;1.0;1.0	D	0.98850	1.0758	10	0.87932	D	0	-22.4387	19.2231	0.93806	0.0:0.0:1.0:0.0	.	552;586;347;640;628;628;648	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	R	648;628;628;586;552;628;640	ENSP00000328547:G648R;ENSP00000313397:G628R;ENSP00000337764:G628R;ENSP00000403169:G586R;ENSP00000412305:G552R;ENSP00000345105:G628R;ENSP00000201963:G640R	ENSP00000201963:G640R	G	+	1	0	0	DNMT3B	30852338	30852338	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.779000	0.99018	2.885000	0.99019	0.655000	0.94253	GGA	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.522	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	0	0	1	2	19	2	2	1	0	1	1	147	0	147	146	1	1.910000	-1.781598	0	0.580000	NM_006892		0	5	5	0	804	799	0		0	0		1	0	147	0	0	2.948121e-03	6.362132e-05	0	0	0	2	0	5	804
OGFR	11054	broad.mit.edu	37	20	61444872	61444872	+	Silent	SNP	C	C	T	rs369721570		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr20:61444872C>T	ENST00000290291.6	+	7	1930	c.1905C>T	c.(1903-1905)gcC>gcT	p.A635A	OGFR_ENST00000370461.1_Silent_p.A583A	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	635	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					ACGAGCCAGCCGAGAGCCCAT	0.736																																						ENST00000290291.6	0.110000	0	0.080000	2.000000e-02	0.040000	0.054451	0.040000	0.040000																										0				17						c.(1903-1905)gcC>gcT		opioid growth factor receptor							11.0	14.0	13.0					20																	61444872		2110	4209	6319	SO:0001819	synonymous_variant	11054	0	0					g.chr20:61444872C>T	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1905C>T	chr20.hg19:g.61444872C>T		0					OGFR_ENST00000370461.1_Silent_p.A583A	p.A635A	NM_007346.2	NP_031372.2	0	1	1	2.044812	Q9NZT2	OGFR_HUMAN		7	1930	+	Breast(26;3.65e-08)		O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	0	1	hg19	c.1905C>T	CCDS13504.1	0																																																																																								0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.736	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1	0	0	0	2	2	2	2	0	0	0	0	60	0	60	0	1	1.910000	-5.006299	1	0.580000			0	4	0	0	308	0	0			0		0	0	60	0	0	0	1.213840e-02	0	0	0	10	0	4	308
GMEB2	26205	broad.mit.edu	37	20	62250746	62250746	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr20:62250746G>A	ENST00000266068.1	-	1	483	c.5C>T	c.(4-6)gCg>gTg	p.A2V	GMEB2_ENST00000370077.1_Missense_Mutation_p.A2V			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	2					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			GTCGGGAGTCGCCATGGCTCA	0.632																																						ENST00000266068.1	0.180000	2.000000e-02	0.140000	5.000000e-02	0.080000	0.098365	0.080000	0.080000																										0				18						c.(4-6)gCg>gTg		glucocorticoid modulatory element binding protein 2							114.0	70.0	85.0					20																	62250746		2203	4300	6503	SO:0001583	missense	26205	1	121412	29				g.chr20:62250746G>A	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.5C>T	chr20.hg19:g.62250746G>A	ENSP00000266068:p.Ala2Val	0					GMEB2_ENST00000370077.1_Missense_Mutation_p.A2V	p.A2V			0	1	1	2.044812	Q9UKD1	GMEB2_HUMAN	Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)	1	483	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	ENST00000266068.1	0	1	hg19	c.5C>T	CCDS13528.1	0	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509854	0.64522	.	.	ENSG00000101216	ENST00000370077;ENST00000266068	T;T	0.67345	-0.26;-0.26	4.57	4.57	0.56435	4.57	4.57	0.56435	.	0.150819	0.43260	D	0.000590	T	0.74007	0.3660	L	0.32530	0.975	0.43137	D	0.994882	D	0.76494	0.999	D	0.70716	0.97	T	0.78448	-0.2200	10	0.87932	D	0	-3.3315	17.3087	0.87202	0.0:0.0:1.0:0.0	.	2	Q9UKD1	GMEB2_HUMAN	V	2	ENSP00000359094:A2V;ENSP00000266068:A2V	ENSP00000266068:A2V	A	-	2	0	0	GMEB2	61721190	61721190	1.000000	0.71417	0.970000	0.41538	0.153000	0.21895	6.679000	0.74513	2.239000	0.73571	0.462000	0.41574	GCG	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.632	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	0	0	1	2	2	2	2	0	0	0	0	46	0	46	45	1	1.910000	-3.710251	1	0.580000	NM_012384		0	5	5	0	202	200	0		1	0		0	0	46	0	0	9.367036e-01	2.890168e-02	0	0	0	9	0	5	202
ZBED4	9889	broad.mit.edu	37	22	50279783	50279783	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr22:50279783G>A	ENST00000216268.5	+	2	2950	c.2473G>A	c.(2473-2475)Gtg>Atg	p.V825M		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	825						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GCACTCGAGCGTGCAGTGCTT	0.627																																						ENST00000216268.5	1.000000	7.000000e-01	0.980000	8.000000e-01	0.900000	0.895051	0.900000	1.000000																										0				44						c.(2473-2475)Gtg>Atg		zinc finger, BED-type containing 4							37.0	37.0	37.0					22																	50279783		2202	4300	6502	SO:0001583	missense	9889	0	0					g.chr22:50279783G>A	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2473G>A	chr22.hg19:g.50279783G>A	ENSP00000216268:p.Val825Met	1						p.V825M	NM_014838.2	NP_055653.2	0	1	1	1.534266	O75132	ZBED4_HUMAN		2	2950	+		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	1	1	hg19	c.2473G>A	CCDS33677.1	1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611814	0.46631	.	.	ENSG00000100426	ENST00000216268	T	0.28069	1.63	5.57	4.56	0.56223	5.57	4.56	0.56223	Ribonuclease H-like (1);	0.118290	0.53938	D	0.000043	T	0.27866	0.0686	L	0.38175	1.15	0.48087	D	0.999586	D	0.57257	0.979	P	0.44518	0.452	T	0.02144	-1.1206	10	0.31617	T	0.26	-40.5602	14.3766	0.66881	0.071:0.0:0.929:0.0	.	825	O75132	ZBED4_HUMAN	M	825	ENSP00000216268:V825M	ENSP00000216268:V825M	V	+	1	0	0	ZBED4	48665787	48665787	1.000000	0.71417	0.995000	0.50966	0.809000	0.45718	2.802000	0.47916	1.345000	0.45676	0.655000	0.94253	GTG	0.410857		TCGA-3A-A9IU-01A-11D-A397-08	0.627	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	1	0	1	2	2	2	2	0	0	0	0	24	0	24	24	1	1.910000	-20.000000	1	0.580000	NM_014838		0	36	36	0	55	53	1		1	1		0	0	24	0	0	1	9.914573e-01	0	6	0	9	0	36	55
ROCK2	9475	broad.mit.edu	37	2	11337396	11337396	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:11337396G>A	ENST00000315872.6	-	27	3806	c.3358C>T	c.(3358-3360)Cgg>Tgg	p.R1120W	ROCK2_ENST00000401753.1_Missense_Mutation_p.R877W	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1120					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		AGTTGTGACCGCAGCTGCTCA	0.438																																						ENST00000315872.6	0.100000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.054021	0.040000	0.040000																										0				43						c.(3358-3360)Cgg>Tgg		Rho-associated, coiled-coil containing protein kinase 2							125.0	119.0	121.0					2																	11337396		1980	4166	6146	SO:0001583	missense	9475	0	0					g.chr2:11337396G>A	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3358C>T	chr2.hg19:g.11337396G>A	ENSP00000317985:p.Arg1120Trp	0					ROCK2_ENST00000401753.1_Missense_Mutation_p.R877W	p.R1120W	NM_004850.3	NP_004841.2	0	0	0	2.053432	O75116	ROCK2_HUMAN		27	3806	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	0	1	hg19	c.3358C>T	CCDS42654.1	0	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302523	0.81136	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.64803	-0.12;0.93	5.72	4.85	0.62838	5.72	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.77322	0.4113	M	0.71581	2.175	0.58432	D	0.999994	D	0.89917	1.0	D	0.71414	0.973	T	0.80453	-0.1376	10	0.87932	D	0	.	14.8283	0.70130	0.0692:0.0:0.9308:0.0	.	1120	O75116	ROCK2_HUMAN	W	1120;877;478	ENSP00000317985:R1120W;ENSP00000385509:R877W	ENSP00000317985:R1120W	R	-	1	2	2	ROCK2	11254847	11254847	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	3.726000	0.54977	1.418000	0.47098	0.563000	0.77884	CGG	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.438	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3	0	0	1	2	2	2	2	0	0	0	0	59	0	59	58	1	1.910000	-2.392674	0	0.580000			0	6	5	0	438	434	0		1	0		0	0	59	0	0	9.639671e-01	9.475727e-02	0	0	0	32	0	6	438
NMS	129521	broad.mit.edu	37	2	101089991	101089991	+	Missense_Mutation	SNP	G	G	A	rs201102943		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:101089991G>A	ENST00000376865.1	+	3	180	c.173G>A	c.(172-174)cGc>cAc	p.R58H		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	58					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						CCTCTTTCTCGCCAACCTAAG	0.343													G|||	1	0.000199681	0.0	0.0014	5008	,	,		9711	0.0		0.0	False		,,,				2504	0.0					ENST00000376865.1	1.000000	6.200000e-01	0.960000	7.200000e-01	0.830000	0.839517	0.830000	1.000000																										0				14						c.(172-174)cGc>cAc		neuromedin S							47.0	46.0	46.0					2																	101089991		2177	4298	6475	SO:0001583	missense	129521	20	121220	39				g.chr2:101089991G>A	AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.173G>A	chr2.hg19:g.101089991G>A	ENSP00000366061:p.Arg58His	0						p.R58H	NM_001011717.1	NP_001011717.1	0	1	1	2.043824	Q5H8A3	NMS_HUMAN		3	180	+				Missense_Mutation	SNP	ENST00000376865.1	1	1	hg19	c.173G>A	CCDS33259.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	3.177	-0.168837	0.06461	.	.	ENSG00000204640	ENST00000376865	T	0.23754	1.89	3.81	-3.39	0.04868	3.81	-3.39	0.04868	.	1.207740	0.05936	N	0.636093	T	0.16428	0.0395	L	0.44542	1.39	0.09310	N	1	P	0.46220	0.874	B	0.35971	0.215	T	0.25222	-1.0138	10	0.45353	T	0.12	3.2782	4.8169	0.13371	0.5921:0.0:0.2415:0.1664	.	58	Q5H8A3	NMS_HUMAN	H	58	ENSP00000366061:R58H	ENSP00000366061:R58H	R	+	2	0	0	NMS	100456423	100456423	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.190000	0.09615	-0.676000	0.05238	0.650000	0.86243	CGC	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.343	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329737.1	1	0	1	2	2	2	2	0	0	0	0	15	0	15	15	1	1.910000	-4.184800	1	0.580000	NM_001011717		0	39	39	0	121	120	1		1			0	0	15	0	0	1	0	0	0	0	0	0	39	121
SMPD4	55627	broad.mit.edu	37	2	130910653	130910653	+	Missense_Mutation	SNP	C	C	T	rs369700397		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:130910653C>T	ENST00000409031.1	-	19	3382	c.2234G>A	c.(2233-2235)cGc>cAc	p.R745H	SMPD4_ENST00000443958.2_Missense_Mutation_p.R409H|SMPD4_ENST00000452225.2_Missense_Mutation_p.R486H|SMPD4_ENST00000426662.2_Missense_Mutation_p.R381H|SMPD4_ENST00000473720.1_5'Flank|SMPD4_ENST00000431183.2_Missense_Mutation_p.R643H|SMPD4_ENST00000339679.7_Missense_Mutation_p.R603H|SMPD4_ENST00000453750.1_Missense_Mutation_p.R494H|SMPD4_ENST00000351288.6_Missense_Mutation_p.R716H	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	706					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	AAAGAGTGTGCGGACCAAGCT	0.582																																						ENST00000409031.1	0.090000	0	0.070000	2.000000e-02	0.030000	0.046817	0.030000	0.040000																										0				29						c.(2233-2235)cGc>cAc		sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	Phosphatidylserine(DB00144)	C	HIS/ARG,HIS/ARG,HIS/ARG	1,4405		0,1,2202	78.0	88.0	84.0		1928,2147,2234	4.1	0.9	2		84	0,8600		0,0,4300	no	missense,missense,missense	SMPD4	NM_001171083.2,NM_017751.4,NM_017951.4	29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	643/765,716/838,745/867	130910653	1,13005	2203	4300	6503	SO:0001583	missense	55627	2	121412	36				g.chr2:130910653C>T	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.2234G>A	chr2.hg19:g.130910653C>T	ENSP00000386531:p.Arg745His	0					SMPD4_ENST00000339679.7_Missense_Mutation_p.R603H|SMPD4_ENST00000443958.2_Missense_Mutation_p.R409H|SMPD4_ENST00000453750.1_Missense_Mutation_p.R494H|SMPD4_ENST00000351288.6_Missense_Mutation_p.R716H|SMPD4_ENST00000426662.2_Missense_Mutation_p.R381H|SMPD4_ENST00000452225.2_Missense_Mutation_p.R486H|SMPD4_ENST00000431183.2_Missense_Mutation_p.R643H|SMPD4_ENST00000473720.1_5'Flank	p.R745H	NM_017951.4	NP_060421.2	0	1	1	2.043824	Q9NXE4	NSMA3_HUMAN		19	3382	-	Colorectal(110;0.1)		B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	0	1	hg19	c.2234G>A	CCDS42751.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	18.14|18.14	3.557063|3.557063	0.65425|0.65425	2.27E-4|2.27E-4	0.0|0.0	ENSG00000136699|ENSG00000136699	ENST00000439886|ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662	.|.	.|.	.|.	4.09|4.09	4.09|4.09	0.47781|0.47781	4.09|4.09	4.09|4.09	0.47781|0.47781	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79604|0.79604	0.4474|0.4474	M|M	0.82323|0.82323	2.585|2.585	0.54753|0.54753	D|D	0.99998|0.99998	.|D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;0.997;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D	.|0.85130	.|0.984;0.987;0.995;0.989;0.997;0.937;0.959;0.997;0.993;0.984	T|T	0.83285|0.83285	-0.0036|-0.0036	5|9	.|0.72032	.|D	.|0.01	.|.	13.8586|13.8586	0.63545|0.63545	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|381;486;643;603;494;677;706;745;752;277	.|B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4;Q9NXE4-5	.|.;.;.;.;.;.;NSMA3_HUMAN;.;.;.	T|H	620|716;745;643;494;409;603;486;381	.|.	.|ENSP00000339721:R603H	A|R	-|-	1|2	0|0	0|0	SMPD4|SMPD4	130627123|130627123	130627123|130627123	1.000000|1.000000	0.71417|0.71417	0.871000|0.871000	0.34182|0.34182	0.066000|0.066000	0.16364|0.16364	7.434000|7.434000	0.80377|0.80377	1.820000|1.820000	0.53075|0.53075	0.549000|0.549000	0.68633|0.68633	GCA|CGC	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.582	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	0	0	1	2	2	2	2	0	0	0	0	109	0	109	108	1	1.910000	-1.770476	0	0.580000	NM_017751		0	5	5	0	431	429	0		1	0		0	0	109	0	0	9.371228e-01	6.516198e-01	0	0	0	179	0	5	431
ITGA6	3655	broad.mit.edu	37	2	173333951	173333951	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:173333951G>T	ENST00000264106.6	+	4	689	c.486G>T	c.(484-486)agG>agT	p.R162S	ITGA6_ENST00000409080.1_Missense_Mutation_p.R162S|ITGA6_ENST00000343713.4_Missense_Mutation_p.R162S|ITGA6_ENST00000409532.1_Missense_Mutation_p.R48S|ITGA6_ENST00000264107.7_Missense_Mutation_p.R162S|ITGA6_ENST00000375221.2_Missense_Mutation_p.R162S			P23229	ITA6_HUMAN	integrin, alpha 6	162					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AGAATCTCAGGATTGAAGACG	0.473																																						ENST00000264106.6	0.100000	2.000000e-02	0.080000	3.000000e-02	0.050000	0.058132	0.050000	0.060000																										0				44						c.(484-486)agG>agT		integrin, alpha 6							179.0	172.0	175.0					2																	173333951		2203	4300	6503	SO:0001583	missense	3655	0	0					g.chr2:173333951G>T		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.486G>T	chr2.hg19:g.173333951G>T	ENSP00000264106:p.Arg162Ser	0					ITGA6_ENST00000409532.1_Missense_Mutation_p.R48S|ITGA6_ENST00000264107.7_Missense_Mutation_p.R162S|ITGA6_ENST00000409080.1_Missense_Mutation_p.R162S|ITGA6_ENST00000375221.2_Missense_Mutation_p.R162S|ITGA6_ENST00000343713.4_Missense_Mutation_p.R162S	p.R162S			0	1	1	2.043824	P23229	ITA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0979)	4	689	+			B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	ENST00000264106.6	0	1	hg19	c.486G>T		0	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653589	0.29425	.	.	ENSG00000091409	ENST00000412899;ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44	6.17	-0.233	0.13078	6.17	-0.233	0.13078	.	0.138320	0.64402	D	0.000003	T	0.23370	0.0565	N	0.01152	-0.98	0.36788	D	0.884674	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.004;0.004;0.004	T	0.18555	-1.0333	10	0.06365	T	0.9	.	0.6097	0.00759	0.3751:0.2013:0.241:0.1826	.	162;162;162	P23229-4;G5E9H1;P23229-2	.;.;.	S	48;48;162;162;162;162;162;162;162	ENSP00000413470:R48S;ENSP00000386614:R48S;ENSP00000264107:R162S;ENSP00000264106:R162S;ENSP00000364369:R162S;ENSP00000341078:R162S;ENSP00000386896:R162S;ENSP00000406694:R162S;ENSP00000394169:R162S	ENSP00000264106:R162S	R	+	3	2	2	ITGA6	173042197	173042197	0.334000	0.24739	1.000000	0.80357	0.995000	0.86356	0.224000	0.17738	0.471000	0.27319	0.655000	0.94253	AGG	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.473	ITGA6-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	96	0	96	96	1	1.910000	-2.885254	1	0.580000			0	10	10	0	638	635	0		1	0		0	0	96	0	0	9.968389e-01	4.999536e-01	0	0	0	102	0	10	638
FOSL2	2355	broad.mit.edu	37	2	28635275	28635275	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:28635275C>T	ENST00000264716.4	+	4	1804	c.941C>T	c.(940-942)tCa>tTa	p.S314L	FOSL2_ENST00000379619.1_Missense_Mutation_p.S306L|FOSL2_ENST00000545753.1_Missense_Mutation_p.S275L	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	314					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					GGGGACCAATCATCAGACTCC	0.622																																						ENST00000264716.4	1.000000	7.200000e-01	1.000000	8.100000e-01	0.920000	0.913582	0.920000	1.000000																										0				14						c.(940-942)tCa>tTa		FOS-like antigen 2							53.0	50.0	51.0					2																	28635275		2203	4300	6503	SO:0001583	missense	2355	0	0					g.chr2:28635275C>T		CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.941C>T	chr2.hg19:g.28635275C>T	ENSP00000264716:p.Ser314Leu	0					FOSL2_ENST00000379619.1_Missense_Mutation_p.S306L|FOSL2_ENST00000545753.1_Missense_Mutation_p.S275L	p.S314L	NM_005253.3	NP_005244.1	0	0	0	2.053432	P15408	FOSL2_HUMAN		4	1804	+	Acute lymphoblastic leukemia(172;0.155)		B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	ENST00000264716.4	1	1	hg19	c.941C>T	CCDS1766.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.217527	0.95104	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000545753	D;T;D	0.86497	-2.06;-1.13;-2.13	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.88518	0.6458	M	0.77616	2.38	0.80722	D	1	P	0.47762	0.9	B	0.40602	0.334	D	0.90308	0.4335	10	0.87932	D	0	-0.9556	19.8481	0.96728	0.0:1.0:0.0:0.0	.	314	P15408	FOSL2_HUMAN	L	306;314;275	ENSP00000368939:S306L;ENSP00000264716:S314L;ENSP00000439303:S275L	ENSP00000264716:S314L	S	+	2	0	0	FOSL2	28488779	28488779	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	4.804000	0.62554	2.693000	0.91896	0.655000	0.94253	TCA	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.622	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	1	0	1	2	2	2	2	0	0	0	0	41	0	41	41	1	1.910000	-20.000000	1	0.580000	NM_005253		0	54	54	0	147	146	1		1	1		0	0	41	0	0	1	1	0	42	0	191	0	54	147
TTC27	55622	broad.mit.edu	37	2	33003024	33003024	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:33003024C>T	ENST00000317907.4	+	14	1987	c.1756C>T	c.(1756-1758)Cgc>Tgc	p.R586C		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	586			R -> H (in dbSNP:rs17012268).							breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						GGCATTTCAGCGCTGTGTGAC	0.438																																						ENST00000317907.4	0.130000	1.000000e-02	0.100000	3.000000e-02	0.050000	0.067856	0.050000	0.060000																										0				38						c.(1756-1758)Cgc>Tgc		tetratricopeptide repeat domain 27							202.0	187.0	192.0					2																	33003024		2203	4300	6503	SO:0001583	missense	55622	2	121412	36				g.chr2:33003024C>T	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.1756C>T	chr2.hg19:g.33003024C>T	ENSP00000313953:p.Arg586Cys	0						p.R586C	NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	0	0	0	2.053432	Q6P3X3	TTC27_HUMAN		14	1987	+			A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	0	1	hg19	c.1756C>T	CCDS33176.1	0	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557601	0.65425	.	.	ENSG00000018699	ENST00000317907	T	0.61859	0.07	5.32	5.32	0.75619	5.32	5.32	0.75619	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.049606	0.64402	D	0.000001	D	0.85230	0.5649	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.90675	0.4601	10	0.87932	D	0	-9.9189	19.0041	0.92843	0.0:1.0:0.0:0.0	.	586	Q6P3X3	TTC27_HUMAN	C	586	ENSP00000313953:R586C	ENSP00000313953:R586C	R	+	1	0	0	TTC27	32856528	32856528	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	4.480000	0.60243	2.465000	0.83290	0.557000	0.71058	CGC	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.438	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	0	0	1	2	2	2	2	0	0	0	0	42	0	42	42	1	1.910000	-2.975077	1	0.580000	NM_017735		0	4	4	0	247	243	0		1	0		0	0	42	0	0	8.872906e-01	2.125085e-01	0	0	0	43	0	4	247
LMAN2L	81562	broad.mit.edu	37	2	97400208	97400208	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:97400208C>G	ENST00000264963.4	-	3	384	c.362G>C	c.(361-363)gGa>gCa	p.G121A	LMAN2L_ENST00000377079.4_Missense_Mutation_p.G121A|LMAN2L_ENST00000426463.2_Missense_Mutation_p.E4Q|LMAN2L_ENST00000534882.1_Missense_Mutation_p.E4Q|LMAN2L_ENST00000537039.1_5'UTR	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	121	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						ATTCTTCTTTCCTTGTCCATG	0.468																																						ENST00000264963.4	1.000000	8.200000e-01	1.000000	9.000000e-01	0.990000	0.965253	0.990000	1.000000																										0				7						c.(361-363)gGa>gCa		lectin, mannose-binding 2-like							236.0	210.0	219.0					2																	97400208		2203	4300	6503	SO:0001583	missense	81562	0	0					g.chr2:97400208C>G	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.362G>C	chr2.hg19:g.97400208C>G	ENSP00000264963:p.Gly121Ala	0					LMAN2L_ENST00000426463.2_Missense_Mutation_p.E4Q|LMAN2L_ENST00000537039.1_5'UTR|LMAN2L_ENST00000534882.1_Missense_Mutation_p.E4Q|LMAN2L_ENST00000377079.4_Missense_Mutation_p.G121A	p.G121A	NM_030805.3	NP_110432.1	0	1	1	2.043824	Q9H0V9	LMA2L_HUMAN		3	384	-			B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	ENST00000264963.4	1	1	hg19	c.362G>C	CCDS2023.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.011148|4.011148	0.75046|0.75046	.|.	.|.	ENSG00000114988|ENSG00000114988	ENST00000426463;ENST00000534882|ENST00000264963;ENST00000377079	T;T|T;T	0.78924|0.63255	-1.22;-1.16|-0.03;-0.03	5.95|5.95	5.95|5.95	0.96441|0.96441	5.95|5.95	5.95|5.95	0.96441|0.96441	.|Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81828|0.81828	0.4905|0.4905	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	B;B|D;D	0.20550|0.89917	0.046;0.046|0.986;1.0	B;B|P;D	0.22386|0.91635	0.039;0.039|0.768;0.999	T|T	0.82348|0.82348	-0.0502|-0.0502	9|10	0.39692|0.56958	T|D	0.17|0.05	.|.	19.1527|19.1527	0.93495|0.93495	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4;4|121;121	B4DVH1;B4DSH3|Q9H0V9-2;Q9H0V9	.;.|.;LMA2L_HUMAN	Q|A	4|121	ENSP00000396391:E4Q;ENSP00000438501:E4Q|ENSP00000264963:G121A;ENSP00000366280:G121A	ENSP00000396391:E4Q|ENSP00000264963:G121A	E|G	-|-	1|2	0|0	0|0	LMAN2L|LMAN2L	96763935|96763935	96763935|96763935	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	7.468000|7.468000	0.80943|0.80943	2.821000|2.821000	0.97095|0.97095	0.650000|0.650000	0.86243|0.86243	GAA|GGA	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.468	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	1	0	1	2	2	2	2	0	0	0	0	64	0	64	63	1	1.910000	-20.000000	1	0.580000	NM_030805		0	85	83	0	207	205	1		1	1		0	0	64	0	0	1	9.995103e-01	0	9	0	22	0	85	207
CHRNA1	1134	broad.mit.edu	37	2	175612881	175612881	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr2:175612881G>A	ENST00000261007.5	-	10	1486	c.1420C>T	c.(1420-1422)Cga>Tga	p.R474*	CHRNA1_ENST00000409542.1_Nonsense_Mutation_p.R367*|CHRNA1_ENST00000409219.1_Nonsense_Mutation_p.R369*|CHRNA1_ENST00000348749.5_Nonsense_Mutation_p.R449*|AC018890.6_ENST00000442996.1_RNA	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	474					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TCAATGAGTCGACCTGCAAAC	0.502																																						ENST00000261007.5	0.130000	1.000000e-02	0.100000	3.000000e-02	0.050000	0.068220	0.050000	0.060000																										0				37						c.(1420-1422)Cga>Tga		cholinergic receptor, nicotinic, alpha 1 (muscle)	Galantamine(DB00674)						97.0	89.0	92.0					2																	175612881		2203	4300	6503	SO:0001587	stop_gained	1134	0	0					g.chr2:175612881G>A	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1420C>T	chr2.hg19:g.175612881G>A	ENSP00000261007:p.Arg474*	0					CHRNA1_ENST00000409542.1_Nonsense_Mutation_p.R367*|CHRNA1_ENST00000409219.1_Nonsense_Mutation_p.R369*|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000348749.5_Nonsense_Mutation_p.R449*	p.R474*	NM_001039523.2	NP_001034612.1	0	1	1	2.043824	P02708	ACHA_HUMAN		10	1486	-			B4DRV6|D3DPE8	Nonsense_Mutation	SNP	ENST00000261007.5	0	1	hg19	c.1420C>T	CCDS33331.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.913560	0.97099	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	.	.	.	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.159217	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	19.1987	0.93701	0.0:0.0:1.0:0.0	.	.	.	.	X	449;474;367;369	.	ENSP00000261007:R474X	R	-	1	2	2	CHRNA1	175321127	175321127	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.397000	0.73239	2.607000	0.88179	0.655000	0.94253	CGA	0.578778		TCGA-3A-A9IU-01A-11D-A397-08	0.502	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1	0	0	1	2	2	2	2	0	0	0	0	25	0	25	25	1	1.910000	-5.306639	1	0.580000			0	4	4	0	245	243	0		1	0		0	0	25	0	0	8.892017e-01	6.607742e-03	0	0	0	6	0	4	245
ILDR1	286676	broad.mit.edu	37	3	121720701	121720701	+	Silent	SNP	G	G	A	rs202089487		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr3:121720701G>A	ENST00000344209.5	-	4	516	c.390C>T	c.(388-390)ctC>ctT	p.L130L	ILDR1_ENST00000462014.1_Silent_p.L142L|ILDR1_ENST00000273691.3_Silent_p.L130L|ILDR1_ENST00000393631.1_Intron|ILDR1_ENST00000460554.1_5'UTR	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	130	Ig-like V-type.				positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		CATTTATCACGAGATCTGCTC	0.517																																						ENST00000344209.5	1.000000	7.500000e-01	1.000000	8.400000e-01	0.950000	0.934903	0.950000	1.000000																										0				25						c.(388-390)ctC>ctT		immunoglobulin-like domain containing receptor 1							149.0	139.0	142.0					3																	121720701		2203	4300	6503	SO:0001819	synonymous_variant	286676	1	121412	27				g.chr3:121720701G>A	BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.390C>T	chr3.hg19:g.121720701G>A		0					ILDR1_ENST00000273691.3_Silent_p.L130L|ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000393631.1_Intron|ILDR1_ENST00000462014.1_Silent_p.L142L	p.L130L	NM_001199799.1	NP_001186728.1	0	0	0	2.055893	Q86SU0	ILDR1_HUMAN		4	516	-			Q6ZP61|Q7Z578	Silent	SNP	ENST00000344209.5	1	1	hg19	c.390C>T	CCDS56271.1	1																																																																																								0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.517	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355666.1	1	0	1	2	2	2	2	0	0	0	0	25	0	25	25	1	1.910000	-5.535798	1	0.580000	NM_175924		0	58	58	0	151	148	1		1	1		0	0	25	0	0	1	9.083933e-01	0	3	0	10	0	58	151
TNIK	23043	broad.mit.edu	37	3	170786732	170786732	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr3:170786732C>T	ENST00000436636.2	-	30	3948	c.3604G>A	c.(3604-3606)Ggt>Agt	p.G1202S	TNIK_ENST00000475336.1_Missense_Mutation_p.G1110S|TNIK_ENST00000460047.1_Missense_Mutation_p.G1139S|TNIK_ENST00000488470.1_Missense_Mutation_p.G1147S|TNIK_ENST00000284483.8_Missense_Mutation_p.G1194S|TNIK_ENST00000341852.6_Missense_Mutation_p.G1118S|TNIK_ENST00000470834.1_Missense_Mutation_p.G1165S|TNIK_ENST00000538048.1_Missense_Mutation_p.G1154S|TNIK_ENST00000369326.5_Missense_Mutation_p.G1180S|TNIK_ENST00000357327.5_Missense_Mutation_p.G1173S	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	1202	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			AATCTTTGACCTTCTTCTACC	0.388																																						ENST00000436636.2	1.000000	7.900000e-01	1.000000	8.600000e-01	0.930000	0.934338	0.930000	1.000000																										0				62						c.(3604-3606)Ggt>Agt		TRAF2 and NCK interacting kinase							160.0	156.0	157.0					3																	170786732		1853	4092	5945	SO:0001583	missense	23043	0	0					g.chr3:170786732C>T	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.3604G>A	chr3.hg19:g.170786732C>T	ENSP00000399511:p.Gly1202Ser	0					TNIK_ENST00000538048.1_Missense_Mutation_p.G1154S|TNIK_ENST00000341852.6_Missense_Mutation_p.G1118S|TNIK_ENST00000470834.1_Missense_Mutation_p.G1165S|TNIK_ENST00000460047.1_Missense_Mutation_p.G1139S|TNIK_ENST00000475336.1_Missense_Mutation_p.G1110S|TNIK_ENST00000369326.5_Missense_Mutation_p.G1180S|TNIK_ENST00000488470.1_Missense_Mutation_p.G1147S|TNIK_ENST00000357327.5_Missense_Mutation_p.G1173S|TNIK_ENST00000284483.8_Missense_Mutation_p.G1194S	p.G1202S	NM_015028.2	NP_055843.1	0	0	0	2.055893	Q9UKE5	TNIK_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	30	3948	-	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	1	1	hg19	c.3604G>A	CCDS46956.1	1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954878	0.92726	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.75154	-0.89;-0.88;-0.9;-0.9;-0.89;-0.89;-0.9;-0.9;-0.91;-0.89	6.06	6.06	0.98353	6.06	6.06	0.98353	Citron-like (3);	0.000000	0.85682	D	0.000000	D	0.86108	0.5854	M	0.77616	2.38	0.80722	D	1	D;P;P;P;P;D;P;P;D	0.61080	0.979;0.748;0.863;0.884;0.748;0.986;0.936;0.884;0.989	P;B;B;B;B;P;B;B;P	0.61003	0.882;0.319;0.437;0.41;0.319;0.8;0.437;0.41;0.874	D	0.86263	0.1656	10	0.72032	D	0.01	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1154;1110;1165;1139;1118;1194;1173;1147;1202	F5H5M9;Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;.;TNIK_HUMAN	S	1202;1180;1154;1118;1194;1110;1173;1139;1147;1165	ENSP00000399511:G1202S;ENSP00000358332:G1180S;ENSP00000443278:G1154S;ENSP00000345352:G1118S;ENSP00000284483:G1194S;ENSP00000418156:G1110S;ENSP00000349880:G1173S;ENSP00000418916:G1139S;ENSP00000418378:G1147S;ENSP00000419990:G1165S	ENSP00000284483:G1194S	G	-	1	0	0	TNIK	172269426	172269426	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	5.920000	0.70017	2.882000	0.98803	0.655000	0.94253	GGT	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.388	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	1	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	1.910000	-20.000000	1	0.580000	XM_039796		0	114	113	0	303	301	1		1	1		0	0	54	0	0	1	9.052270e-01	0	5	0	8	0	114	303
GRM2	2912	broad.mit.edu	37	3	51743211	51743211	+	Missense_Mutation	SNP	G	G	A	rs200502357		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr3:51743211G>A	ENST00000395052.3	+	2	446	c.212G>A	c.(211-213)cGc>cAc	p.R71H	GRM2_ENST00000442933.2_Missense_Mutation_p.R71H|GRM2_ENST00000475478.1_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	71					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCACTGGACCGCATCAACCGT	0.632																																						ENST00000395052.3	0.070000	0	0.050000	1.000000e-02	0.020000	0.034823	0.020000	0.040000																										0				33						c.(211-213)cGc>cAc		glutamate receptor, metabotropic 2							127.0	115.0	119.0					3																	51743211		2203	4300	6503	SO:0001583	missense	2912	0	0					g.chr3:51743211G>A	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.212G>A	chr3.hg19:g.51743211G>A	ENSP00000378492:p.Arg71His	0					GRM2_ENST00000442933.2_Missense_Mutation_p.R71H|GRM2_ENST00000475478.1_Intron	p.R71H	NM_000839.3	NP_000830.2	0	0	0	2.055893	Q14416	GRM2_HUMAN		2	446	+			B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	0	1	hg19	c.212G>A	CCDS2834.1	0	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247197	0.80024	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.86497	-2.13;-2.13	5.28	4.41	0.53225	5.28	4.41	0.53225	Extracellular ligand-binding receptor (1);	0.167226	0.46758	D	0.000274	T	0.81093	0.4751	L	0.56199	1.76	0.42153	D	0.991563	B	0.28419	0.211	B	0.21917	0.037	T	0.78252	-0.2276	10	0.62326	D	0.03	.	5.1701	0.15105	0.2123:0.1632:0.6245:0.0	.	71	Q14416	GRM2_HUMAN	H	71	ENSP00000378492:R71H;ENSP00000408906:R71H	ENSP00000296479:R71H	R	+	2	0	0	GRM2	51718251	51718251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.691000	0.54720	1.245000	0.43885	-0.137000	0.14449	CGC	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.632	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1	0	0	1	2	2	2	2	0	0	0	0	148	0	148	147	1	1.910000	-1.831932	0	0.580000			0	6	6	0	671	667	0		1			0	0	148	0	0	9.644367e-01	0	0	0	0	0	0	6	671
STAB1	23166	broad.mit.edu	37	3	52555958	52555958	+	Missense_Mutation	SNP	G	G	A	rs386660931|rs144247661		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr3:52555958G>A	ENST00000321725.6	+	58	6338	c.6262G>A	c.(6262-6264)Gtg>Atg	p.V2088M		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2088	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.V2088L(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGATGGCCGTGTGTGTACAGG	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20757	0.0		0.0	False		,,,				2504	0.0					ENST00000321725.6	1.000000	7.700000e-01	1.000000	8.600000e-01	0.960000	0.943979	0.960000	1.000000																										1	Substitution - Missense(1)	p.V2088L(1)	endometrium(1)	76						c.(6262-6264)Gtg>Atg		stabilin 1		G	MET/VAL	3,4401	2.1+/-5.4	0,3,2199	122.0	117.0	119.0		6262	-2.3	0.0	3	dbSNP_134	119	0,8600		0,0,4300	yes	missense	STAB1	NM_015136.2	21	0,3,6499	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	2088/2571	52555958	3,13001	2202	4300	6502	SO:0001583	missense	23166	24	121220	45				g.chr3:52555958G>A	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6262G>A	chr3.hg19:g.52555958G>A	ENSP00000312946:p.Val2088Met	0						p.V2088M	NM_015136.2	NP_055951.2	0	0	0	2.055893	Q9NY15	STAB1_HUMAN		58	6338	+			A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	1	1	hg19	c.6262G>A	CCDS33768.1	1	.	.	.	.	.	.	.	.	.	.	G	7.022	0.558925	0.13436	6.81E-4	0.0	ENSG00000010327	ENST00000321725	D	0.87571	-2.27	5.75	-2.33	0.06724	5.75	-2.33	0.06724	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	1.447070	0.03638	N	0.239087	T	0.71005	0.3289	N	0.08118	0	0.09310	N	1	P	0.38148	0.62	B	0.36885	0.235	T	0.64597	-0.6370	10	0.66056	D	0.02	.	0.7708	0.01024	0.384:0.1181:0.262:0.2359	.	2088	Q9NY15	STAB1_HUMAN	M	2088	ENSP00000312946:V2088M	ENSP00000312946:V2088M	V	+	1	0	0	STAB1	52530998	52530998	0.000000	0.05858	0.003000	0.11579	0.000000	0.00434	0.653000	0.24902	-0.277000	0.09193	-1.130000	0.01982	GTG	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	1	0	1	2	2	2	2	0	0	0	0	50	0	50	50	1	1.910000	-20.000000	1	0.580000	NM_015136		0	66	65	0	169	167	1		1	0		0	0	50	0	0	1	9.986905e-01	0	0	0	29	0	66	169
PCYT1A	5130	broad.mit.edu	37	3	195975170	195975170	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr3:195975170G>A	ENST00000292823.2	-	5	414	c.242C>T	c.(241-243)gCc>gTc	p.A81V	AC069257.8_ENST00000608995.1_RNA|AC069257.8_ENST00000425275.1_RNA|PCYT1A_ENST00000419333.1_Missense_Mutation_p.A81V|RP11-447L10.1_ENST00000431391.1_3'UTR|PCYT1A_ENST00000431016.1_Missense_Mutation_p.A81V|PCYT1A_ENST00000491544.1_5'UTR	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	81					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	TATTCCATCGGCATAAACTCT	0.383																																						ENST00000292823.2	0.110000	1.000000e-02	0.080000	2.000000e-02	0.050000	0.058442	0.050000	0.050000																										0				18						c.(241-243)gCc>gTc		phosphate cytidylyltransferase 1, choline, alpha	Choline(DB00122)|Lamivudine(DB00709)						83.0	83.0	83.0					3																	195975170		2203	4300	6503	SO:0001583	missense	5130	0	0					g.chr3:195975170G>A	L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.242C>T	chr3.hg19:g.195975170G>A	ENSP00000292823:p.Ala81Val	0					PCYT1A_ENST00000419333.1_Missense_Mutation_p.A81V|RP11-447L10.1_ENST00000431391.1_3'UTR|AC069257.8_ENST00000425275.1_RNA|PCYT1A_ENST00000431016.1_Missense_Mutation_p.A81V|AC069257.8_ENST00000608995.1_RNA|PCYT1A_ENST00000491544.1_5'UTR	p.A81V	NM_005017.2	NP_005008.2	1	2	3	2.065867	P49585	PCY1A_HUMAN	Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	5	414	-	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		A9LYK9|D3DXB1|Q86Y88	Missense_Mutation	SNP	ENST00000292823.2	0	1	hg19	c.242C>T	CCDS3315.1	0	.	.	.	.	.	.	.	.	.	.	g	26.8	4.769299	0.90020	.	.	ENSG00000161217	ENST00000441879;ENST00000419333;ENST00000292823;ENST00000416798;ENST00000431016;ENST00000411591;ENST00000430755;ENST00000412869;ENST00000443555	D;D;D;D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17;-4.17;-4.17;-4.17	5.67	5.67	0.87782	5.67	5.67	0.87782	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.044612	0.85682	D	0.000000	D	0.97334	0.9128	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98016	1.0368	10	0.87932	D	0	-4.6307	18.8171	0.92081	0.0:0.0:1.0:0.0	.	81	P49585	PCY1A_HUMAN	V	81;81;81;42;81;81;15;81;81	ENSP00000392397:A81V;ENSP00000390968:A81V;ENSP00000292823:A81V;ENSP00000394617:A81V;ENSP00000400430:A81V;ENSP00000402283:A15V;ENSP00000402015:A81V;ENSP00000393341:A81V	ENSP00000292823:A81V	A	-	2	0	0	PCYT1A	197459567	197459567	1.000000	0.71417	0.998000	0.56505	0.423000	0.31445	9.472000	0.97709	2.686000	0.91538	0.645000	0.84053	GCC	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.383	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	0	0	1	2	2	2	2	0	0	0	0	74	0	74	73	1	1.910000	-2.659890	1	0.580000	NM_005017		0	5	5	0	347	344	0		1	0		0	0	74	0	0	9.365585e-01	1.301313e-01	0	0	0	36	0	5	347
SORCS2	57537	broad.mit.edu	37	4	7533314	7533314	+	Silent	SNP	C	C	T	rs371851041		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr4:7533314C>T	ENST00000507866.2	+	3	715	c.606C>T	c.(604-606)acC>acT	p.T202T	SORCS2_ENST00000329016.9_Silent_p.T30T|SORCS2_ENST00000511199.1_3'UTR	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	202					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GTGTCACCACCGTCATCGACA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		20651	0.0		0.0	False		,,,				2504	0.001					ENST00000507866.2	1.000000	7.500000e-01	1.000000	8.500000e-01	0.970000	0.941796	0.970000	1.000000																										0				42						c.(604-606)acC>acT		sortilin-related VPS10 domain containing receptor 2		C		1,4201		0,1,2100	90.0	102.0	98.0		606	-7.2	0.4	4		98	0,8404		0,0,4202	no	coding-synonymous	SORCS2	NM_020777.2		0,1,6302	TT,TC,CC		0.0,0.0238,0.0079		202/1160	7533314	1,12605	2101	4202	6303	SO:0001819	synonymous_variant	57537	50	121052	45				g.chr4:7533314C>T	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.606C>T	chr4.hg19:g.7533314C>T		0					SORCS2_ENST00000511199.1_3'UTR|SORCS2_ENST00000329016.9_Silent_p.T30T	p.T202T	NM_020777.2	NP_065828.2	1	2	3	2.100555	Q96PQ0	SORC2_HUMAN		3	715	+			Q9P2L7	Silent	SNP	ENST00000507866.2	1	1	hg19	c.606C>T	CCDS47008.1	1																																																																																								0.584816		TCGA-3A-A9IU-01A-11D-A397-08	0.602	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	1	0	1	2	23	3	2	1	0	1	1	20	0	20	20	1	1.910000	-5.351211	1	0.580000	NM_020777		0	49	49	0	127	125	0		1	0		1	0	20	0	0	9.997850e-01	3.997764e-01	0	0	0	8	0	49	127
ACOT12	134526	broad.mit.edu	37	5	80667586	80667586	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr5:80667586A>G	ENST00000307624.3	-	3	269	c.241T>C	c.(241-243)Ttc>Ctc	p.F81L	ACOT12_ENST00000513751.1_Missense_Mutation_p.F81L	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	81	Acyl coenzyme A hydrolase 1.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		CTTGTGCTGAATGCTCTAGTA	0.393																																						ENST00000307624.3	1.000000	7.300000e-01	1.000000	8.200000e-01	0.910000	0.912756	0.910000	1.000000																										0				23						c.(241-243)Ttc>Ctc		acyl-CoA thioesterase 12							220.0	180.0	193.0					5																	80667586		2203	4300	6503	SO:0001583	missense	134526	0	0					g.chr5:80667586A>G	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.241T>C	chr5.hg19:g.80667586A>G	ENSP00000303246:p.Phe81Leu	0					ACOT12_ENST00000513751.1_Missense_Mutation_p.F81L	p.F81L	NM_130767.2	NP_570123.1	1	2	3	2.074995	Q8WYK0	ACO12_HUMAN		3	269	-		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	1	1	hg19	c.241T>C	CCDS4055.1	1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.532595	0.85812	.	.	ENSG00000172497	ENST00000307624;ENST00000513751	T;T	0.21734	1.99;1.99	5.8	5.8	0.92144	5.8	5.8	0.92144	Thioesterase superfamily (1);	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	M	0.90650	3.135	0.52099	D	0.999946	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.60120	-0.7325	10	0.46703	T	0.11	-10.442	13.6838	0.62504	1.0:0.0:0.0:0.0	.	81;81	Q5FWE9;Q8WYK0	.;ACO12_HUMAN	L	81	ENSP00000303246:F81L;ENSP00000421628:F81L	ENSP00000303246:F81L	F	-	1	0	0	ACOT12	80703342	80703342	1.000000	0.71417	0.982000	0.44146	0.992000	0.81027	5.817000	0.69229	2.227000	0.72691	0.460000	0.39030	TTC	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.393	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	1	0	1	2	2	2	2	0	0	0	0	25	0	25	25	1	1.910000	-20.000000	1	0.580000	NM_130767		0	64	64	0	176	176	1		1			0	0	25	0	0	1	0	0	0	0	0	0	64	176
GPR98	84059	broad.mit.edu	37	5	90046453	90046453	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr5:90046453G>A	ENST00000405460.2	+	53	11156	c.11060G>A	c.(11059-11061)cGt>cAt	p.R3687H		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3687	Calx-beta 24. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACATATGGCCGTATAACCATA	0.343																																						ENST00000405460.2	0.070000	0	0.050000	1.000000e-02	0.020000	0.033299	0.020000	0.030000																										0				269						c.(11059-11061)cGt>cAt		G protein-coupled receptor 98							188.0	186.0	186.0					5																	90046453		1869	4103	5972	SO:0001583	missense	84059	8	120822	41				g.chr5:90046453G>A	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11060G>A	chr5.hg19:g.90046453G>A	ENSP00000384582:p.Arg3687His	0						p.R3687H	NM_032119.3	NP_115495.3	1	2	3	2.074995	Q8WXG9	GPR98_HUMAN		53	11156	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	0	1	hg19	c.11060G>A	CCDS47246.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.95|12.95	2.092138|2.092138	0.36952|0.36952	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.27720|.	1.65|.	5.52|5.52	1.66|1.66	0.24008|0.24008	5.52|5.52	1.66|1.66	0.24008|0.24008	.|.	0.152878|.	0.64402|.	N|.	0.000017|.	T|T	0.55097|0.55097	0.1899|0.1899	L|L	0.45051|0.45051	1.395|1.395	0.80722|0.80722	D|D	1|1	B;B|.	0.26483|.	0.15;0.101|.	B;B|.	0.18561|.	0.022;0.01|.	T|T	0.43653|0.43653	-0.9378|-0.9378	10|5	0.37606|.	T|.	0.19|.	.|.	11.2443|11.2443	0.48987|0.48987	0.2377:0.0:0.7623:0.0|0.2377:0.0:0.7623:0.0	.|.	3687;3687|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	H|I	3687|1253	ENSP00000384582:R3687H|.	ENSP00000296619:R3687H|.	R|V	+|+	2|1	0|0	0|0	GPR98|GPR98	90082209|90082209	90082209|90082209	0.096000|0.096000	0.21769|0.21769	0.050000|0.050000	0.19076|0.19076	0.779000|0.779000	0.44077|0.44077	0.982000|0.982000	0.29539|0.29539	0.028000|0.028000	0.15324|0.15324	-0.123000|-0.123000	0.14984|0.14984	CGT|GTA	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.343	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	0	0	1	2	2	2	2	0	0	0	0	72	0	72	72	1	1.910000	-1.922761	0	0.580000	NM_032119		0	5	5	0	602	599	0		1			0	0	72	0	0	9.369563e-01	0	0	0	0	0	0	5	602
LNPEP	4012	broad.mit.edu	37	5	96342191	96342191	+	Silent	SNP	A	A	G	rs541171362		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr5:96342191A>G	ENST00000231368.5	+	11	2699	c.2007A>G	c.(2005-2007)caA>caG	p.Q669Q	LNPEP_ENST00000395770.3_Silent_p.Q655Q	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	669					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CAAAATATCAATCGGTATCAT	0.308													A|||	1	0.000199681	0.0	0.0	5008	,	,		18782	0.001		0.0	False		,,,				2504	0.0					ENST00000231368.5	1.000000	7.800000e-01	1.000000	8.500000e-01	0.930000	0.930317	0.930000	1.000000																										0				34						c.(2005-2007)caA>caG		leucyl/cystinyl aminopeptidase							52.0	54.0	54.0					5																	96342191		2203	4296	6499	SO:0001819	synonymous_variant	4012	5	121386	36				g.chr5:96342191A>G	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2007A>G	chr5.hg19:g.96342191A>G		0					LNPEP_ENST00000395770.3_Silent_p.Q655Q	p.Q669Q	NM_005575.2	NP_005566.2	1	2	3	2.074995	Q9UIQ6	LCAP_HUMAN		11	2699	+		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Silent	SNP	ENST00000231368.5	1	1	hg19	c.2007A>G	CCDS4087.1	1																																																																																								0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.308	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	1	0	1	2	2	2	2	0	0	0	0	35	0	35	34	1	1.910000	-20.000000	1	0.580000	NM_005575		0	101	100	0	271	270	1		1	1		0	0	35	0	0	1	7.476668e-01	0	3	0	6	0	101	271
ELOVL2	54898	broad.mit.edu	37	6	10984107	10984107	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr6:10984107C>A	ENST00000354666.3	-	8	881	c.798G>T	c.(796-798)atG>atT	p.M266I		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	266					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			GTGGCTCTTGCATATCTTTCT	0.353																																						ENST00000354666.3	1.000000	6.900000e-01	0.970000	7.700000e-01	0.860000	0.871958	0.860000	1.000000																										0				14						c.(796-798)atG>atT		ELOVL fatty acid elongase 2							179.0	161.0	167.0					6																	10984107		2202	4300	6502	SO:0001583	missense	54898	0	0					g.chr6:10984107C>A	AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.798G>T	chr6.hg19:g.10984107C>A	ENSP00000346693:p.Met266Ile	0						p.M266I	NM_017770.3	NP_060240.3	0	0	0	2.026811	Q9NXB9	ELOV2_HUMAN	Epithelial(50;0.176)	8	881	-	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Q6P9E1|Q86W94	Missense_Mutation	SNP	ENST00000354666.3	1	1	hg19	c.798G>T	CCDS4518.1	1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622984	0.28889	.	.	ENSG00000197977	ENST00000354666	T	0.21191	2.02	5.2	1.35	0.21983	5.2	1.35	0.21983	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44847	-0.9301	9	0.38643	T	0.18	1.9891	4.5775	0.12241	0.0:0.4456:0.1567:0.3977	.	266	Q9NXB9	ELOV2_HUMAN	I	266	ENSP00000346693:M266I	ENSP00000346693:M266I	M	-	3	0	0	ELOVL2	11092093	11092093	0.000000	0.05858	0.000000	0.03702	0.709000	0.40893	-0.408000	0.07169	0.020000	0.15106	0.650000	0.86243	ATG	0.575071		TCGA-3A-A9IU-01A-11D-A397-08	0.353	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1	1	0	1	2	2	2	2	0	0	0	0	41	0	41	41	1	1.910000	-20.000000	1	0.580000			0	64	63	0	186	183	1		1	0		0	0	41	0	0	1	1.663651e-01	0	0	0	3	0	64	186
ABCA13	154664	broad.mit.edu	37	7	48411864	48411864	+	Missense_Mutation	SNP	G	G	A	rs570952854		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr7:48411864G>A	ENST00000435803.1	+	33	10927	c.10903G>A	c.(10903-10905)Gtt>Att	p.V3635I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3635					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V3635I(1)|p.V3580I(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCTGGCCATCGTTCTGAAAAC	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18714	0.0		0.0	False		,,,				2504	0.0					ENST00000435803.1	1.000000	7.900000e-01	1.000000	8.600000e-01	0.940000	0.936633	0.940000	1.000000																										2	Substitution - Missense(2)	p.V3635I(1)|p.V3580I(1)	large_intestine(2)	270						c.(10903-10905)Gtt>Att		ATP-binding cassette, sub-family A (ABC1), member 13							230.0	226.0	227.0					7																	48411864		2060	4204	6264	SO:0001583	missense	154664	0	0					g.chr7:48411864G>A	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10903G>A	chr7.hg19:g.48411864G>A	ENSP00000411096:p.Val3635Ile	0						p.V3635I	NM_152701.3	NP_689914.2	1	2	3	2.071627	Q86UQ4	ABCAD_HUMAN		33	10927	+			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	1	1	hg19	c.10903G>A	CCDS47584.1	1	.	.	.	.	.	.	.	.	.	.	G	1.351	-0.591282	0.03799	.	.	ENSG00000179869	ENST00000435803	D	0.87491	-2.26	5.77	-1.16	0.09678	5.77	-1.16	0.09678	.	0.381500	0.22125	N	0.064274	T	0.55114	0.1900	N	0.00801	-1.175	0.49582	D	0.999804	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.54543	-0.8278	10	0.02654	T	1	.	6.8687	0.24108	0.4762:0.128:0.3958:0.0	.	1337;3635	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	I	3635	ENSP00000411096:V3635I	ENSP00000411096:V3635I	V	+	1	0	0	ABCA13	48382410	48382410	0.853000	0.29707	0.008000	0.14137	0.914000	0.54420	0.853000	0.27777	-0.342000	0.08363	-0.294000	0.09567	GTT	0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.468	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	1	0	1	2	2	2	2	0	0	0	0	49	0	49	48	1	1.910000	-20.000000	1	0.580000	NM_152701		0	110	109	0	292	291	1		1	0		0	0	49	0	0	1	0	0	0	0	1	0	110	292
TYW1	55253	broad.mit.edu	37	7	66479413	66479413	+	Silent	SNP	T	T	C			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr7:66479413T>C	ENST00000359626.5	+	5	599	c.435T>C	c.(433-435)acT>acC	p.T145T		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	145	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.T145T(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				GCCTACCAACTGAAAGTGCAG	0.428																																						ENST00000359626.5	0.080000	0	0.060000	2.000000e-02	0.030000	0.044739	0.030000	0.040000																										1	Substitution - coding silent(1)	p.T145T(1)	urinary_tract(1)	46						c.(433-435)acT>acC		tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)																																				SO:0001819	synonymous_variant	55253	80	121412	43				g.chr7:66479413T>C	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.435T>C	chr7.hg19:g.66479413T>C		0						p.T145T	NM_018264.2	NP_060734.2	1	2	3	2.071627	Q9NV66	TYW1_HUMAN		5	599	+		Lung NSC(55;0.0846)|all_lung(88;0.183)	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Silent	SNP	ENST00000359626.5	0	1	hg19	c.435T>C	CCDS5538.1	0																																																																																								0.581214		TCGA-3A-A9IU-01A-11D-A397-08	0.428	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	0	0	1	2	2	2	2	0	0	0	0	101	0	101	100	1	1.910000	-1.820533	0	0.580000	NM_018264		0	7	7	0	609	601	0		1	0		0	0	101	0	0	9.797682e-01	5.418782e-02	0	0	0	28	0	7	609
TNKS	8658	broad.mit.edu	37	8	9609296	9609296	+	Missense_Mutation	SNP	G	G	A	rs370349163		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr8:9609296G>A	ENST00000310430.6	+	19	3036	c.3010G>A	c.(3010-3012)Gta>Ata	p.V1004I	TNKS_ENST00000518281.1_Missense_Mutation_p.V767I	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1004					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		AGAGTTGGCCGTAGGAGGAGC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		15309	0.001		0.0	False		,,,				2504	0.0					ENST00000310430.6	0.080000	0	0.060000	2.000000e-02	0.030000	0.045001	0.030000	0.040000																										0				49						c.(3010-3012)Gta>Ata		tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase		G	ILE/VAL	0,4406		0,0,2203	78.0	82.0	81.0		3010	5.7	0.9	8		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	TNKS	NM_003747.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1004/1328	9609296	1,13005	2203	4300	6503	SO:0001583	missense	8658	3	121412	37				g.chr8:9609296G>A	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3010G>A	chr8.hg19:g.9609296G>A	ENSP00000311579:p.Val1004Ile	0					TNKS_ENST00000518281.1_Missense_Mutation_p.V767I	p.V1004I	NM_003747.2	NP_003738.2	0	0	0	2.055610	O95271	TNKS1_HUMAN		19	3036	+			O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	0	1	hg19	c.3010G>A	CCDS5974.1	0	.	.	.	.	.	.	.	.	.	.	G	9.102	1.004279	0.19199	0.0	1.16E-4	ENSG00000173273	ENST00000310430;ENST00000518281	T;T	0.61859	0.07;0.14	5.73	5.73	0.89815	5.73	5.73	0.89815	.	0.331114	0.32055	N	0.006645	T	0.45034	0.1322	N	0.19112	0.55	0.54753	D	0.999982	B	0.16396	0.017	B	0.09377	0.004	T	0.29941	-0.9995	10	0.18276	T	0.48	.	19.9054	0.97006	0.0:0.0:1.0:0.0	.	1004	O95271	TNKS1_HUMAN	I	1004;767	ENSP00000311579:V1004I;ENSP00000429890:V767I	ENSP00000311579:V1004I	V	+	1	0	0	TNKS	9646706	9646706	1.000000	0.71417	0.901000	0.35422	0.191000	0.23601	6.449000	0.73473	2.698000	0.92095	0.655000	0.94253	GTA	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.542	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	0	0	1	2	2	2	2	0	0	0	0	75	0	75	74	1	1.910000	-2.164740	0	0.580000	NM_003747		0	6	6	0	526	517	0		1	0		0	0	75	0	0	9.632581e-01	1.353191e-02	0	0	0	13	0	6	526
RALYL	138046	broad.mit.edu	37	8	85774611	85774611	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr8:85774611C>T	ENST00000521268.1	+	6	1599	c.494C>T	c.(493-495)aCg>aTg	p.T165M	RALYL_ENST00000517638.1_Missense_Mutation_p.T178M|RALYL_ENST00000522455.1_Missense_Mutation_p.T165M|RALYL_ENST00000521376.1_Missense_Mutation_p.T76M|RALYL_ENST00000523850.1_Missense_Mutation_p.T92M|RALYL_ENST00000518566.1_Missense_Mutation_p.T154M|RALYL_ENST00000521695.1_Missense_Mutation_p.T165M	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	165							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GCAGTCACAACGACTCGCAGG	0.483																																						ENST00000521268.1	1.000000	7.300000e-01	1.000000	8.500000e-01	0.980000	0.944361	0.980000	1.000000																										0				24						c.(493-495)aCg>aTg		RALY RNA binding protein-like							56.0	61.0	59.0					8																	85774611		1929	4136	6065	SO:0001583	missense	138046	3	120836	28				g.chr8:85774611C>T		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.494C>T	chr8.hg19:g.85774611C>T	ENSP00000430367:p.Thr165Met	0					RALYL_ENST00000518566.1_Missense_Mutation_p.T154M|RALYL_ENST00000521376.1_Missense_Mutation_p.T76M|RALYL_ENST00000522455.1_Missense_Mutation_p.T165M|RALYL_ENST00000523850.1_Missense_Mutation_p.T92M|RALYL_ENST00000521695.1_Missense_Mutation_p.T165M|RALYL_ENST00000517638.1_Missense_Mutation_p.T178M	p.T165M	NM_173848.5	NP_776247.3	0	0	0	2.055610	Q86SE5	RALYL_HUMAN		6	1599	+			B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	1	1	hg19	c.494C>T	CCDS55253.1	1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526572	0.64860	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.18657	2.83;2.83;2.83;2.85;2.83;2.42;2.2	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.214143	0.49305	D	0.000143	T	0.35941	0.0949	M	0.61703	1.905	0.09310	N	1	P;D;P;P;D	0.60160	0.791;0.987;0.939;0.93;0.987	B;P;B;P;P	0.51016	0.336;0.588;0.337;0.656;0.588	T	0.19192	-1.0313	10	0.62326	D	0.03	-3.4988	18.8851	0.92375	0.0:1.0:0.0:0.0	.	154;165;92;178;165	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	M	165;165;165;154;178;92;76	ENSP00000430394:T165M;ENSP00000428667:T165M;ENSP00000430367:T165M;ENSP00000430065:T154M;ENSP00000430128:T178M;ENSP00000428807:T92M;ENSP00000428310:T76M	ENSP00000430128:T178M	T	+	2	0	0	RALYL	85937166	85937166	0.679000	0.27596	0.011000	0.14972	0.798000	0.45092	5.613000	0.67688	2.511000	0.84671	0.551000	0.68910	ACG	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.483	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1	1	0	1	2	2	2	2	0	0	0	0	18	0	18	18	1	1.910000	-20.000000	1	0.580000			0	36	36	0	89	85	1		1			0	0	18	0	0	1	0	0	0	0	0	0	36	89
TG	7038	broad.mit.edu	37	8	133923730	133923730	+	Missense_Mutation	SNP	C	C	T	rs372280039		TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr8:133923730C>T	ENST00000220616.4	+	19	4151	c.4111C>T	c.(4111-4113)Cgg>Tgg	p.R1371W	TG_ENST00000377869.1_Missense_Mutation_p.R1371W	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1371					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGGAAATCACGGCTTGAGGA	0.478													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20223	0.0		0.0	False		,,,				2504	0.0					ENST00000220616.4	0.090000	1.000000e-02	0.070000	3.000000e-02	0.040000	0.054226	0.040000	0.050000																										0				168						c.(4111-4113)Cgg>Tgg		thyroglobulin		C	TRP/ARG	0,4406		0,0,2203	239.0	213.0	222.0		4111	5.5	0.0	8		222	1,8599	1.2+/-3.3	0,1,4299	no	missense	TG	NM_003235.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1371/2769	133923730	1,13005	2203	4300	6503	SO:0001583	missense	7038	5	121412	41				g.chr8:133923730C>T	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4111C>T	chr8.hg19:g.133923730C>T	ENSP00000220616:p.Arg1371Trp	0					TG_ENST00000377869.1_Missense_Mutation_p.R1371W	p.R1371W	NM_003235.4	NP_003226.4	0	0	0	2.055610	P01266	THYG_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000701)	19	4151	+	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	0	1	hg19	c.4111C>T	CCDS34944.1	0	.	.	.	.	.	.	.	.	.	.	C	21.8	4.209064	0.79240	0.0	1.16E-4	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	T;T	0.64803	-0.11;-0.12	5.51	5.51	0.81932	5.51	5.51	0.81932	.	1.131830	0.06509	N	0.737751	T	0.58495	0.2126	L	0.40543	1.245	0.09310	N	1	D	0.69078	0.997	B	0.40534	0.332	T	0.57774	-0.7753	10	0.72032	D	0.01	.	14.9365	0.70960	0.0:1.0:0.0:0.0	.	1371	P01266	THYG_HUMAN	W	1371;177;1371	ENSP00000367100:R1371W;ENSP00000220616:R1371W	ENSP00000220616:R1371W	R	+	1	2	2	TG	133992912	133992912	0.036000	0.19791	0.006000	0.13384	0.514000	0.34195	3.406000	0.52637	2.582000	0.87167	0.557000	0.71058	CGG	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.478	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	0	0	1	2	2	2	2	0	0	0	0	71	0	71	70	1	1.910000	-2.301031	0	0.580000	NM_003235		0	9	9	0	625	613	0		1			0	0	71	0	0	9.937437e-01	0	0	0	0	0	0	9	625
TNC	3371	broad.mit.edu	37	9	117848514	117848514	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr9:117848514C>T	ENST00000350763.4	-	3	1907	c.1496G>A	c.(1495-1497)cGc>cAc	p.R499H	TNC_ENST00000542877.1_Missense_Mutation_p.R499H|TNC_ENST00000535648.1_Missense_Mutation_p.R499H|TNC_ENST00000537320.1_Missense_Mutation_p.R499H|TNC_ENST00000345230.3_Missense_Mutation_p.R499H|TNC_ENST00000340094.3_Missense_Mutation_p.R499H|TNC_ENST00000341037.4_Missense_Mutation_p.R499H|TNC_ENST00000346706.3_Missense_Mutation_p.R499H|TNC_ENST00000423613.2_Missense_Mutation_p.R499H	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	499	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.R499H(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GGGGCATTGGCGATCCCGGCA	0.597																																						ENST00000350763.4	0.080000	0	0.060000	1.000000e-02	0.030000	0.041898	0.030000	0.040000																										1	Substitution - Missense(1)	p.R499H(1)	central_nervous_system(1)	120						c.(1495-1497)cGc>cAc		tenascin C							116.0	109.0	112.0					9																	117848514		2203	4300	6503	SO:0001583	missense	3371	2	121412	38				g.chr9:117848514C>T		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1496G>A	chr9.hg19:g.117848514C>T	ENSP00000265131:p.Arg499His	0					TNC_ENST00000535648.1_Missense_Mutation_p.R499H|TNC_ENST00000346706.3_Missense_Mutation_p.R499H|TNC_ENST00000345230.3_Missense_Mutation_p.R499H|TNC_ENST00000423613.2_Missense_Mutation_p.R499H|TNC_ENST00000340094.3_Missense_Mutation_p.R499H|TNC_ENST00000341037.4_Missense_Mutation_p.R499H|TNC_ENST00000542877.1_Missense_Mutation_p.R499H|TNC_ENST00000537320.1_Missense_Mutation_p.R499H	p.R499H	NM_002160.3	NP_002151.2	0	0	0	2.054451	P24821	TENA_HUMAN		3	1907	-			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	0	1	hg19	c.1496G>A	CCDS6811.1	0	.	.	.	.	.	.	.	.	.	.	C	8.572	0.880360	0.17467	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.03524	3.9;3.9;3.9;3.9;3.9;3.9;3.9;3.9;3.9	5.82	-2.57	0.06248	5.82	-2.57	0.06248	.	0.783888	0.11926	N	0.516193	T	0.03959	0.0111	L	0.59436	1.845	0.09310	N	1	B;B	0.15719	0.014;0.001	B;B	0.08055	0.003;0.001	T	0.37407	-0.9707	10	0.59425	D	0.04	.	4.1099	0.10053	0.5463:0.2293:0.0677:0.1566	.	499;499	E9PC84;P24821	.;TENA_HUMAN	H	499	ENSP00000344400:R499H;ENSP00000438152:R499H;ENSP00000344555:R499H;ENSP00000345861:R499H;ENSP00000265131:R499H;ENSP00000339553:R499H;ENSP00000411406:R499H;ENSP00000443478:R499H;ENSP00000442242:R499H	ENSP00000344400:R499H	R	-	2	0	0	TNC	116888335	116888335	0.000000	0.05858	0.001000	0.08648	0.323000	0.28346	-0.002000	0.12924	-0.330000	0.08514	0.462000	0.41574	CGC	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.597	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	0	0	1	2	2	2	11	0	0	0	0	101	0	101	98	1	1.910000	-2.068723	0	0.580000	NM_002160		0	6	6	0	564	561	0		1	0	0	0	1	101	279	0	9.645545e-01	7.643824e-02	2.951098e-01	0	2	35	702	6	564
KDM4C	23081	broad.mit.edu	37	9	7049110	7049110	+	Silent	SNP	C	C	T			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr9:7049110C>T	ENST00000381309.3	+	17	2899	c.2334C>T	c.(2332-2334)tgC>tgT	p.C778C	KDM4C_ENST00000543771.1_Silent_p.C778C|KDM4C_ENST00000442236.2_Silent_p.C523C|KDM4C_ENST00000428870.2_Silent_p.C465C|KDM4C_ENST00000536108.1_Intron|KDM4C_ENST00000381306.3_Silent_p.C778C|KDM4C_ENST00000535193.1_Silent_p.C800C	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	778					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATGTCATGTGCGCCGTTGCGG	0.433																																						ENST00000381309.3	0.990000	7.200000e-01	0.950000	7.900000e-01	0.870000	0.873098	0.870000	0.890000																										0				43						c.(2332-2334)tgC>tgT		lysine (K)-specific demethylase 4C							93.0	93.0	93.0					9																	7049110		2203	4300	6503	SO:0001819	synonymous_variant	23081	3	121410	34				g.chr9:7049110C>T	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2334C>T	chr9.hg19:g.7049110C>T		1					KDM4C_ENST00000536108.1_Intron|KDM4C_ENST00000442236.2_Silent_p.C523C|KDM4C_ENST00000381306.3_Silent_p.C778C|KDM4C_ENST00000535193.1_Silent_p.C800C|KDM4C_ENST00000543771.1_Silent_p.C778C|KDM4C_ENST00000428870.2_Silent_p.C465C	p.C778C	NM_015061.3	NP_055876.2	0	1	1	1.459422	Q9H3R0	KDM4C_HUMAN		17	2899	+			B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	ENST00000381309.3	1	1	hg19	c.2334C>T	CCDS6471.1	1																																																																																								0.408451		TCGA-3A-A9IU-01A-11D-A397-08	0.433	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	1	0	1	2	2	2	2	0	0	0	0	32	0	32	32	1	1.910000	-10.332930	1	0.580000	NM_015061		0	71	69	0	124	124	1		1	1		0	0	32	0	0	1	9.985734e-01	0	11	0	10	0	71	124
CDKN2A	1029	broad.mit.edu	37	9	21971000	21971000	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr9:21971000C>A	ENST00000304494.5	-	2	628	c.358G>T	c.(358-360)Gag>Tag	p.E120*	CDKN2A_ENST00000579755.1_3'UTR|CDKN2A_ENST00000530628.2_3'UTR|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.E120*|CDKN2A_ENST00000361570.3_3'UTR|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.E120*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.E120*|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.E69*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	120			E -> A (in non-small cell lung carcinoma). {ECO:0000269|PubMed:8060323}.|E -> K (in non-small cell lung carcinoma). {ECO:0000269|PubMed:8060323}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(13)|p.E120*(9)|p.E120K(4)|p.0(1)|p.A118fs*10(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGGCCCAGCTCCTCAGCCAGG	0.726		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	7.200000e-01	0.970000	8.100000e-01	0.890000	0.894260	0.890000	0.940000		17																								1343	Whole gene deletion(1316)|Unknown(13)|Substitution - Nonsense(9)|Substitution - Missense(4)|Deletion - Frameshift(1)	p.0?(1315)|p.?(13)|p.E120*(9)|p.E120K(4)|p.0(1)|p.A118fs*10(1)	haematopoietic_and_lymphoid_tissue(278)|skin(168)|central_nervous_system(164)|lung(150)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(51)|upper_aerodigestive_tract(50)|oesophagus(49)|ovary(34)|kidney(30)|pancreas(30)|breast(30)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	4199	GRCh37	CD972119	CDKN2A	D		c.(358-360)Gag>Tag		cyclin-dependent kinase inhibitor 2A							24.0	27.0	26.0					9																	21971000		2202	4298	6500	SO:0001587	stop_gained	1029	0	0					g.chr9:21971000C>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.358G>T	chr9.hg19:g.21971000C>A	ENSP00000307101:p.Glu120*	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_3'UTR|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.E120*|CDKN2A_ENST00000579755.1_3'UTR|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.E120*|CDKN2A_ENST00000361570.3_3'UTR|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.E69*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.E120*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.E69*	p.E120*	NM_000077.4	NP_000068.1	0	1	1	1.459422	P42771	CD2A1_HUMAN		2	628	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.358G>T	CCDS6510.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.320898	0.97471	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	.	.	.	5.93	5.03	0.67393	5.93	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-15.0988	14.364	0.66792	0.0:0.8518:0.1482:0.0	.	.	.	.	X	120	.	ENSP00000307101:E120X	E	-	1	0	0	CDKN2A	21961000	21961000	0.585000	0.26774	1.000000	0.80357	0.613000	0.37349	1.323000	0.33701	1.489000	0.48450	0.655000	0.94253	GAG	0.408451		TCGA-3A-A9IU-01A-11D-A397-08	0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	55	0	55	55	1	1.910000	-20.000000	1	0.580000	NM_000077		0	51	51	0	81	79	0		1	1	1	0	0	55	269	0	1	1	1	81	84	14	151	51	81
RORB	6096	broad.mit.edu	37	9	77282784	77282784	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr9:77282784G>A	ENST00000396204.2	+	8	1111	c.1111G>A	c.(1111-1113)Gct>Act	p.A371T	RORB_ENST00000376896.3_Missense_Mutation_p.A360T			Q92753	RORB_HUMAN	RAR-related orphan receptor B	371	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	GGAGGAGATCGCTTTGTTCTC	0.388																																						ENST00000396204.2	1.000000	8.400000e-01	1.000000	9.000000e-01	0.970000	0.961213	0.970000	1.000000																										0				12						c.(1111-1113)Gct>Act		RAR-related orphan receptor B	Melatonin(DB01065)						207.0	180.0	189.0					9																	77282784		2203	4300	6503	SO:0001583	missense	6096	0	0					g.chr9:77282784G>A	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1111G>A	chr9.hg19:g.77282784G>A	ENSP00000379507:p.Ala371Thr	0					RORB_ENST00000376896.3_Missense_Mutation_p.A360T	p.A371T			0	0	0	2.054451	Q92753	RORB_HUMAN		8	1111	+			Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	1	1	hg19	c.1111G>A		1	.	.	.	.	.	.	.	.	.	.	G	36	5.715486	0.96830	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.97575	-4.44;-4.44	6.17	6.17	0.99709	6.17	6.17	0.99709	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.092611	0.64402	D	0.000001	D	0.98689	0.9560	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.98965	1.0799	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	371;360	Q92753;Q58EY0	RORB_HUMAN;.	T	360;371	ENSP00000366093:A360T;ENSP00000379507:A371T	ENSP00000366093:A360T	A	+	1	0	0	RORB	76472604	76472604	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.775000	0.98995	2.941000	0.99782	0.655000	0.94253	GCT	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.388	RORB-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	59	0	59	58	1	1.910000	-20.000000	1	0.580000			0	150	148	0	379	376	1		1			0	0	59	0	0	1	0	0	0	0	0	0	150	379
CERCAM	51148	broad.mit.edu	37	9	131193524	131193524	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chr9:131193524G>A	ENST00000372838.4	+	9	1543	c.1145G>A	c.(1144-1146)cGc>cAc	p.R382H	CERCAM_ENST00000372842.1_Missense_Mutation_p.R304H|RP11-339B21.10_ENST00000610052.1_RNA	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	382					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						TACTCGGGCCGCACTCTGACC	0.627																																						ENST00000372838.4	0.110000	1.000000e-02	0.080000	3.000000e-02	0.050000	0.058204	0.050000	0.050000																										0				20						c.(1144-1146)cGc>cAc		cerebral endothelial cell adhesion molecule							85.0	85.0	85.0					9																	131193524		2203	4300	6503	SO:0001583	missense	51148	0	0					g.chr9:131193524G>A	AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.1145G>A	chr9.hg19:g.131193524G>A	ENSP00000361929:p.Arg382His	0					RP11-339B21.10_ENST00000610052.1_RNA|CERCAM_ENST00000372842.1_Missense_Mutation_p.R304H	p.R382H	NM_016174.4	NP_057258.3	0	0	0	2.054451	Q5T4B2	GT253_HUMAN		9	1543	+			A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	0	1	hg19	c.1145G>A	CCDS6901.2	0	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789219	0.70337	.	.	ENSG00000167123	ENST00000372842;ENST00000372838;ENST00000413863	T;T	0.80653	-1.37;-1.4	5.02	4.1	0.47936	5.02	4.1	0.47936	.	0.055960	0.64402	N	0.000001	D	0.86293	0.5898	M	0.74546	2.27	0.80722	D	1	D	0.59767	0.986	P	0.57679	0.825	D	0.87600	0.2496	10	0.72032	D	0.01	-20.9121	12.8845	0.58036	0.0818:0.0:0.9182:0.0	.	382	Q5T4B2	GT253_HUMAN	H	304;382;335	ENSP00000361933:R304H;ENSP00000361929:R382H	ENSP00000361929:R382H	R	+	2	0	0	CERCAM	130233345	130233345	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	7.668000	0.83897	1.197000	0.43143	0.491000	0.48974	CGC	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.627	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	0	0	1	2	2	2	2	0	0	0	0	71	0	71	70	1	1.910000	-2.041438	0	0.580000	NM_016174		0	6	6	0	406	405	0		1	0		0	0	71	0	0	9.649787e-01	8.631611e-01	0	0	0	244	0	6	406
GPR112	139378	broad.mit.edu	37	X	135429875	135429875	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IU-01A-11D-A397-08	TCGA-3A-A9IU-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	912bafe3-1218-44c3-ba4e-16aeac4f598e	c7a38788-c7eb-42b3-a1f2-75d82c600d91	g.chrX:135429875C>A	ENST00000394143.1	+	6	4301	c.4010C>A	c.(4009-4011)aCa>aAa	p.T1337K	GPR112_ENST00000287534.4_Missense_Mutation_p.T1274K|GPR112_ENST00000394141.1_Missense_Mutation_p.T1132K|GPR112_ENST00000412101.1_Missense_Mutation_p.T1132K|GPR112_ENST00000370652.1_Missense_Mutation_p.T1337K	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1337					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCTGGAAGCACACAGATTACA	0.463																																						ENST00000394143.1	0.990000	8.000000e-01	0.960000	8.500000e-01	0.900000	0.911088	0.900000	0.920000																										0				199						c.(4009-4011)aCa>aAa		G protein-coupled receptor 112							122.0	105.0	111.0					X																	135429875		2203	4300	6503	SO:0001583	missense	139378	0	0					g.chrX:135429875C>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4010C>A	chrX.hg19:g.135429875C>A	ENSP00000377699:p.Thr1337Lys						GPR112_ENST00000412101.1_Missense_Mutation_p.T1132K|GPR112_ENST00000370652.1_Missense_Mutation_p.T1337K|GPR112_ENST00000394141.1_Missense_Mutation_p.T1132K|GPR112_ENST00000287534.4_Missense_Mutation_p.T1274K	p.T1337K	NM_153834.3	NP_722576.3	0	1	1		Q8IZF6	GP112_HUMAN		6	4301	+	Acute lymphoblastic leukemia(192;0.000127)		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	1	1	hg19	c.4010C>A	CCDS35409.1	1	.	.	.	.	.	.	.	.	.	.	c	3.929	-0.016606	0.07681	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.31510	1.53;1.53;1.49;1.62;1.49	2.81	-0.405	0.12392	2.81	-0.405	0.12392	.	.	.	.	.	T	0.16811	0.0404	L	0.29908	0.895	0.09310	N	1	P;P;B	0.45827	0.867;0.642;0.421	B;B;B	0.38020	0.263;0.26;0.081	T	0.12066	-1.0562	9	0.54805	T	0.06	.	3.1011	0.06327	0.2101:0.5296:0.0:0.2603	.	1274;1132;1337	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	K	1337;1337;1132;1274;1132	ENSP00000377699:T1337K;ENSP00000359686:T1337K;ENSP00000416526:T1132K;ENSP00000287534:T1274K;ENSP00000377697:T1132K	ENSP00000287534:T1274K	T	+	2	0	0	GPR112	135257541	135257541	0.001000	0.12720	0.001000	0.08648	0.070000	0.16714	0.046000	0.14035	-0.387000	0.07809	0.525000	0.51046	ACA	0.580000		TCGA-3A-A9IU-01A-11D-A397-08	0.463	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1	1	0	1	2	2	2	2	0	0	0	0	24	0	24	24	1	1.910000	-20.000000	1	0.580000			0	121	121	0	105	105	1		1			0	0	24	0	0	1	0	0	0	0	0	0	121	105
