#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
RBP3	5949	broad.mit.edu	37	10	48389530	48389530	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr10:48389530C>T	ENST00000224600.4	-	1	1461	c.1348G>A	c.(1348-1350)Gcc>Acc	p.A450T	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	450	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	AGGACGGAGGCGTCAGCAAAA	0.617																																						ENST00000224600.4	0.950000	0.180000	0.710000	0.310000	0.480000	0.516249	0.480000	1.000000																										0				59						c.(1348-1350)Gcc>Acc		retinol binding protein 3, interstitial	Vitamin A(DB00162)						66.0	57.0	60.0					10																	48389530		2203	4300	6503	SO:0001583	missense	5949	2	121410	32				g.chr10:48389530C>T	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1348G>A	chr10.hg19:g.48389530C>T	ENSP00000224600:p.Ala450Thr	0					AL731561.2_ENST00000581861.1_RNA	p.A450T	NM_002900.2	NP_002891.1	0	0	0	1.974433	P10745	RET3_HUMAN		1	1461	-			Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	0	1	hg19	c.1348G>A	CCDS7218.1	0	.	.	.	.	.	.	.	.	.	.	C	13.12	2.143091	0.37825	.	.	ENSG00000107618	ENST00000224600	T	0.64260	-0.09	5.29	4.29	0.51040	5.290000	4.290000	0.510400	Interphotoreceptor retinol-binding (2);	0.373325	0.28296	N	0.015863	T	0.67392	0.2888	N	0.21545	0.675	0.33964	D	0.645929	D	0.89917	1.0	D	0.81914	0.995	T	0.76498	-0.2937	10	0.59425	D	0.04	-20.5537	15.7345	0.77831	0.1457:0.8543:0.0:0.0	.	450	P10745	RET3_HUMAN	T	450	ENSP00000224600:A450T	ENSP00000224600:A450T	A	-	1	0	0	RBP3	48009536	48009536	0.604000	0.26932	0.052000	0.19188	0.192000	0.23643	1.115000	0.31209	2.483000	0.83821	0.561000	0.74099	GCC	0.082569		TCGA-3A-A9IX-01A-11D-A40W-08	0.617	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	0	0	1		2	2	2	0		0	0	40		40	37	1	2	-6.695076	1	0.100000	NM_002900			5	5		208	204	0		1			0	0	40	0		9.351301e-01	0	0	0	0	0	0	5	208
PLEKHA7	144100	broad.mit.edu	37	11	16872763	16872763	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr11:16872763C>T	ENST00000355661.3	-	8	681	c.671G>A	c.(670-672)cGc>cAc	p.R224H	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.R224H|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.R224H			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	224	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)	p.R224H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						GCGGCTTATGCGATCCTCAGG	0.483																																						ENST00000355661.3	1.000000	0.130000	0.670000	0.220000	0.360000	0.445346	0.360000	0.310000																										1	Substitution - Missense(1)	p.R224H(1)	prostate(1)	37						c.(670-672)cGc>cAc		pleckstrin homology domain containing, family A member 7							105.0	98.0	100.0					11																	16872763		2200	4294	6494	SO:0001583	missense	144100	1	121412	31				g.chr11:16872763C>T	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.671G>A	chr11.hg19:g.16872763C>T	ENSP00000347883:p.Arg224His	0					PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.R224H|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.R224H	p.R224H			1	2	3	2.008178	Q6IQ23	PKHA7_HUMAN		8	681	-			B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	0	1	hg19	c.671G>A	CCDS31434.1	0	.	.	.	.	.	.	.	.	.	.	C	8.567	0.879093	0.17395	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080;ENST00000528376	T;T;T;T	0.75821	-0.97;-0.97;-0.97;2.73	5.51	5.51	0.81932	5.510000	5.510000	0.819320	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.095653	0.64402	D	0.000001	T	0.57021	0.2025	N	0.25094	0.71	0.43047	D	0.99464	B;B	0.23442	0.006;0.085	B;B	0.22880	0.006;0.042	T	0.53725	-0.8398	10	0.02654	T	1	-20.3034	13.6784	0.62469	0.0:0.9262:0.0:0.0738	.	224;224	E9PKC0;Q6IQ23	.;PKHA7_HUMAN	H	224;224;224;118	ENSP00000435389:R224H;ENSP00000347883:R224H;ENSP00000416895:R224H;ENSP00000435806:R118H	ENSP00000347883:R224H	R	-	2	0	0	PLEKHA7	16829339	16829339	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.732000	0.55021	2.605000	0.88082	0.655000	0.94253	CGC	0.107586		TCGA-3A-A9IX-01A-11D-A40W-08	0.483	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	0	0	1		2	2	2	0		0	0	47		47	47	1	2	-2.131004	0	0.100000	NM_175058			5	5		320	314	0		1	0		0	0	47	0		9.349077e-01	1.105713e-01	0	0	0	30	0	5	320
PIK3C2A	5286	broad.mit.edu	37	11	17190613	17190613	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr11:17190613G>C	ENST00000265970.7	-	1	675	c.676C>G	c.(676-678)Cta>Gta	p.L226V	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	226					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TTGTCAAATAGTTTTGCCATG	0.378																																						ENST00000265970.7	1.000000	0.230000	1.000000	0.380000	0.620000	0.656152	0.620000	1.000000																										0				58						c.(676-678)Cta>Gta		phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha							61.0	58.0	59.0					11																	17190613		2200	4293	6493	SO:0001583	missense	5286	0	0					g.chr11:17190613G>C	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.676C>G	chr11.hg19:g.17190613G>C	ENSP00000265970:p.Leu226Val	0					PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Intron	p.L226V	NM_002645.2	NP_002636.2	1	2	3	2.008178	O00443	P3C2A_HUMAN		1	675	-			B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	0	1	hg19	c.676C>G	CCDS7824.1	0	.	.	.	.	.	.	.	.	.	.	G	10.19	1.283209	0.23392	.	.	ENSG00000011405	ENST00000265970;ENST00000544896	T	0.68903	-0.36	5.53	4.62	0.57501	5.530000	4.620000	0.575010	.	0.150075	0.46145	N	0.000306	T	0.45458	0.1343	N	0.24115	0.695	0.80722	D	1	P;B	0.36683	0.565;0.058	B;B	0.25884	0.064;0.017	T	0.41395	-0.9511	10	0.30078	T	0.28	-7.8251	10.3363	0.43852	0.0778:0.1736:0.7486:0.0	.	226;226	F5H5W9;O00443	.;P3C2A_HUMAN	V	226	ENSP00000265970:L226V	ENSP00000265970:L226V	L	-	1	2	2	PIK3C2A	17147189	17147189	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.116000	0.50399	1.335000	0.45486	-0.218000	0.12543	CTA	0.107586		TCGA-3A-A9IX-01A-11D-A40W-08	0.378	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	0	0	0		2	2	2	0		0	0	58		58	0	1	2	-7.283241	1	0.100000	NM_002645			5	0		181	0	0			0		0	0	58	0		0	1.605707e-01	0	0	0	22	0	5	181
OR52M1	119772	broad.mit.edu	37	11	4566917	4566917	+	Missense_Mutation	SNP	G	G	A	rs529200501		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr11:4566917G>A	ENST00000360213.1	+	1	497	c.497G>A	c.(496-498)cGc>cAc	p.R166H		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTGATGATCCGCCTGCGGCTG	0.522													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18716	0.0		0.0	False		,,,				2504	0.0					ENST00000360213.1	1.000000	0.280000	0.860000	0.390000	0.550000	0.603431	0.550000	0.500000																										0				18						c.(496-498)cGc>cAc		olfactory receptor, family 52, subfamily M, member 1							102.0	103.0	103.0					11																	4566917		2201	4298	6499	SO:0001583	missense	119772	7	121408	41				g.chr11:4566917G>A	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.497G>A	chr11.hg19:g.4566917G>A	ENSP00000353343:p.Arg166His	0						p.R166H	NM_001004137.1	NP_001004137.1	1	2	3	2.008178	Q8NGK5	O52M1_HUMAN		1	497	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Missense_Mutation	SNP	ENST00000360213.1	0	1	hg19	c.497G>A	CCDS31353.1	0	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315172	0.23908	.	.	ENSG00000197790	ENST00000360213	T	0.00137	8.68	4.98	2.09	0.27110	4.980000	2.090000	0.271100	GPCR, rhodopsin-like superfamily (1);	0.142760	0.32593	N	0.005884	T	0.00144	0.0004	L	0.55834	1.745	0.09310	N	0.999994	B	0.17852	0.024	B	0.16722	0.016	T	0.40979	-0.9534	10	0.62326	D	0.03	.	4.9553	0.14036	0.3208:0.143:0.5362:0.0	.	166	Q8NGK5	O52M1_HUMAN	H	166	ENSP00000353343:R166H	ENSP00000353343:R166H	R	+	2	0	0	OR52M1	4523493	4523493	0.000000	0.05858	0.122000	0.21767	0.864000	0.49448	-1.025000	0.03600	0.389000	0.25086	-0.133000	0.14855	CGC	0.107586		TCGA-3A-A9IX-01A-11D-A40W-08	0.522	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	0	0	1		2	2	2	0		0	0	64		64	62	1	2	-2.576260	1	0.100000	NM_001004137			11	11		424	415	0		1			0	0	64	0		9.981770e-01	0	0	0	0	0	0	11	424
KCNA4	3739	broad.mit.edu	37	11	30033662	30033662	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr11:30033662C>G	ENST00000328224.6	-	2	1797	c.564G>C	c.(562-564)gaG>gaC	p.E188D	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	188					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	TCATTTGGGTCTCAAAGCGTA	0.493																																						ENST00000328224.6	1.000000	0.420000	1.000000	0.590000	0.820000	0.806259	0.820000	1.000000																										0				78						c.(562-564)gaG>gaC		potassium voltage-gated channel, shaker-related subfamily, member 4	Dalfampridine(DB06637)						65.0	65.0	65.0					11																	30033662		2020	4160	6180	SO:0001583	missense	3739	0	0					g.chr11:30033662C>G	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.564G>C	chr11.hg19:g.30033662C>G	ENSP00000328511:p.Glu188Asp	0					KCNA4_ENST00000526518.1_5'Flank	p.E188D	NM_002233.3	NP_002224.1	1	2	3	2.008178	P22459	KCNA4_HUMAN		2	1797	-				Missense_Mutation	SNP	ENST00000328224.6	1	1	hg19	c.564G>C	CCDS41629.1	0	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967116	0.53507	.	.	ENSG00000182255	ENST00000328224	T	0.78246	-1.16	4.81	3.88	0.44766	4.810000	3.880000	0.447660	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.83510	0.5270	H	0.96398	3.815	0.58432	D	0.999993	P	0.43938	0.822	B	0.41135	0.348	D	0.85507	0.1195	10	0.87932	D	0	.	9.2552	0.37579	0.0:0.7634:0.0:0.2366	.	188	P22459	KCNA4_HUMAN	D	188	ENSP00000328511:E188D	ENSP00000328511:E188D	E	-	3	2	2	KCNA4	29990238	29990238	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.176000	0.31957	1.001000	0.39076	0.561000	0.74099	GAG	0.107586		TCGA-3A-A9IX-01A-11D-A40W-08	0.493	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	0	0	1		2	2	2	0		0	0	49		49	48	1	2	-12.382310	1	0.100000	NM_002233			11	11		279	276	0		1			0	0	49	0		9.983250e-01	0	0	0	0	0	0	11	279
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.260000	1.000000	0.420000	0.640000	0.672448	0.640000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.001631	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.105812		TCGA-3A-A9IX-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1		2	2	2	0		0	0	74		74	73	1	2	-3.682514	1	0.100000	NM_033360			6	6		201	199	0		1	0	1	0	0	74	264		9.645832e-01	1.835716e-01	9.946456e-01	0	11	23	335	6	201
MBNL2	10150	broad.mit.edu	37	13	97999092	97999092	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr13:97999092G>A	ENST00000376673.3	+	5	1356	c.575G>A	c.(574-576)cGg>cAg	p.R192Q	MBNL2_ENST00000343600.4_Missense_Mutation_p.R192Q|MBNL2_ENST00000445661.2_Intron|MBNL2_ENST00000345429.6_Missense_Mutation_p.R192Q|MBNL2_ENST00000397601.1_Missense_Mutation_p.R192Q			Q5VZF2	MBNL2_HUMAN	muscleblind-like splicing regulator 2	192					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			AACTGTGCCCGGGGAGAGACC	0.607																																						ENST00000376673.3	1.000000	0.560000	1.000000	0.780000	0.990000	0.921307	0.990000	1.000000																										0				17						c.(574-576)cGg>cAg		muscleblind-like splicing regulator 2							70.0	65.0	67.0					13																	97999092		2203	4300	6503	SO:0001583	missense	10150	0	0					g.chr13:97999092G>A	AF061261	CCDS9483.1, CCDS9484.1	13q31.1	2013-01-18	2012-02-23		ENSG00000139793	ENSG00000139793		"""Zinc fingers, CCCH-type domain containing"""	16746	protein-coding gene	gene with protein product		607327	"""muscleblind-like 2 (Drosophila)"""			11929853	Standard	NM_207304		Approved	MBLL, MBLL39	uc001vmz.4	Q5VZF2	OTTHUMG00000017239	ENST00000376673.3:c.575G>A	chr13.hg19:g.97999092G>A	ENSP00000365861:p.Arg192Gln	0					MBNL2_ENST00000445661.2_Intron|MBNL2_ENST00000343600.4_Missense_Mutation_p.R192Q|MBNL2_ENST00000397601.1_Missense_Mutation_p.R192Q|MBNL2_ENST00000345429.6_Missense_Mutation_p.R192Q	p.R192Q			1	2	3	2.003966	Q5VZF2	MBNL2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.218)	5	1356	+	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		Q3SXY5|Q58F19|Q8NEV3|Q8TD82	Missense_Mutation	SNP	ENST00000376673.3	1	1	hg19	c.575G>A		1	.	.	.	.	.	.	.	.	.	.	G	37	6.122025	0.97300	.	.	ENSG00000139793	ENST00000397601;ENST00000343600;ENST00000345429;ENST00000376673	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.95	5.95	0.96441	5.950000	5.950000	0.964410	Zinc finger, CCCH-type (3);	0.053503	0.85682	D	0.000000	T	0.77308	0.4111	M	0.91090	3.175	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.997	D;D;P	0.78314	0.991;0.92;0.898	T	0.81185	-0.1048	10	0.87932	D	0	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	192;192;192	Q5VZF2;A2A3S3;Q5VZF2-2	MBNL2_HUMAN;.;.	Q	192	ENSP00000380726:R192Q;ENSP00000344214:R192Q;ENSP00000267287:R192Q;ENSP00000365861:R192Q	ENSP00000344214:R192Q	R	+	2	0	0	MBNL2	96797093	96797093	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.854000	0.99522	2.827000	0.97445	0.650000	0.86243	CGG	0.106256		TCGA-3A-A9IX-01A-11D-A40W-08	0.607	MBNL2-202	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	51		51	50	1	2	-2.886213	1	0.100000	NM_144778			11	11		207	199	0		1	1		0	0	51	0		9.981042e-01	9.885337e-01	0	7	0	139	0	11	207
TEP1	7011	broad.mit.edu	37	14	20858856	20858856	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr14:20858856G>A	ENST00000262715.5	-	15	2358	c.2318C>T	c.(2317-2319)gCt>gTt	p.A773V	TEP1_ENST00000556935.1_Missense_Mutation_p.A665V	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	773					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCTTTGGCCAGCCAGAGACAG	0.438																																						ENST00000262715.5	1.000000	0.170000	0.870000	0.300000	0.480000	0.544652	0.480000	0.400000																										0				96						c.(2317-2319)gCt>gTt		telomerase-associated protein 1							88.0	82.0	84.0					14																	20858856		2203	4300	6503	SO:0001583	missense	7011	1	121412	27				g.chr14:20858856G>A		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.2318C>T	chr14.hg19:g.20858856G>A	ENSP00000262715:p.Ala773Val	0					TEP1_ENST00000556935.1_Missense_Mutation_p.A665V	p.A773V	NM_007110.4	NP_009041.2	1	2	3	2.006638	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	15	2358	-	all_cancers(95;0.00123)	all_lung(585;0.235)	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	0	1	hg19	c.2318C>T	CCDS9548.1	0	.	.	.	.	.	.	.	.	.	.	G	4.876	0.162909	0.09287	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.44482	0.96;0.92	4.98	4.09	0.47781	4.980000	4.090000	0.477810	.	0.560122	0.19177	N	0.120783	T	0.28928	0.0718	L	0.45137	1.4	0.80722	D	1	B;B;B	0.20261	0.043;0.008;0.025	B;B;B	0.18263	0.021;0.01;0.009	T	0.04855	-1.0922	10	0.07175	T	0.84	-3.4708	8.5875	0.33666	0.1009:0.0:0.8991:0.0	.	665;123;773	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	V	773;773;665	ENSP00000262715:A773V;ENSP00000452574:A665V	ENSP00000262715:A773V	A	-	2	0	0	TEP1	19928696	19928696	0.995000	0.38212	0.997000	0.53966	0.950000	0.60333	2.649000	0.46656	2.756000	0.94617	0.655000	0.94253	GCT	0.107143		TCGA-3A-A9IX-01A-11D-A40W-08	0.438	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	0	0	1		2	2	2	0		0	0	46		46	46	1	2	-3.105264	1	0.100000	NM_007110			5	5		236	233	0		1	0		0	0	46	0		9.361185e-01	3.210462e-02	0	0	0	11	0	5	236
NOVA1	4857	broad.mit.edu	37	14	27064659	27064659	+	Silent	SNP	A	A	T	rs115769795	byFrequency	TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr14:27064659A>T	ENST00000344429.5	-	2	240	c.237T>A	c.(235-237)acT>acA	p.T79T	NOVA1-AS1_ENST00000547786.1_RNA|NOVA1_ENST00000551754.1_5'UTR|NOVA1_ENST00000267422.7_5'UTR|NOVA1_ENST00000539517.2_Silent_p.T79T|NOVA1_ENST00000574031.1_Silent_p.T79T|NOVA1_ENST00000547619.1_Silent_p.T79T|RP11-483C6.1_ENST00000572358.1_RNA|NOVA1_ENST00000465357.2_Silent_p.T79T	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	79	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		TGGTGGCTCCAGTTTCTTTTT	0.423																																						ENST00000344429.5	1.000000	0.110000	0.510000	0.180000	0.290000	0.381975	0.290000	0.260000																										0				40						c.(235-237)acT>acA		neuro-oncological ventral antigen 1							165.0	155.0	158.0					14																	27064659		2203	4300	6503	SO:0001819	synonymous_variant	4857	0	0					g.chr14:27064659A>T	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.237T>A	chr14.hg19:g.27064659A>T		0					NOVA1-AS1_ENST00000547786.1_RNA|NOVA1_ENST00000267422.7_5'UTR|RP11-483C6.1_ENST00000572358.1_RNA|NOVA1_ENST00000465357.2_Silent_p.T79T|NOVA1_ENST00000551754.1_5'UTR|NOVA1_ENST00000574031.1_Silent_p.T79T|NOVA1_ENST00000539517.2_Silent_p.T79T|NOVA1_ENST00000547619.1_Silent_p.T79T	p.T79T	NM_006491.2	NP_006482.1	1	2	3	2.006638	P51513	NOVA1_HUMAN		2	240	-			A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000344429.5	0	1	hg19	c.237T>A	CCDS9635.1	0																																																																																								0.107143		TCGA-3A-A9IX-01A-11D-A40W-08	0.423	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276557.1	0	0	1		2	2	2	0		0	0	101		101	98	1	2	-3.080077	1	0.100000	NM_006491			6	6		465	461	0		1	0		0	0	101	0		9.642567e-01	5.259571e-02	0	0	0	24	0	6	465
PSMC6	5706	broad.mit.edu	37	14	53194224	53194224	+	Silent	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr14:53194224C>T	ENST00000606149.1	+	14	1075	c.1059C>T	c.(1057-1059)ttC>ttT	p.F353F	PSMC6_ENST00000445930.2_Silent_p.F367F|STYX_ENST00000442123.2_5'Flank|STYX_ENST00000354586.4_5'Flank|PSMC6_ENST00000557557.1_3'UTR	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	353					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					CAGGTATGTTCGCAATTCGTG	0.323																																						ENST00000606149.1	1.000000	0.300000	1.000000	0.490000	0.750000	0.747895	0.750000	1.000000																										0				19						c.(1057-1059)ttC>ttT		proteasome (prosome, macropain) 26S subunit, ATPase, 6							62.0	56.0	58.0					14																	53194224		2203	4300	6503	SO:0001819	synonymous_variant	5706	9	121408	35				g.chr14:53194224C>T		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.1059C>T	chr14.hg19:g.53194224C>T		0					PSMC6_ENST00000445930.2_Silent_p.F367F|PSMC6_ENST00000557557.1_3'UTR|STYX_ENST00000354586.4_5'Flank|STYX_ENST00000442123.2_5'Flank	p.F353F	NM_002806.3	NP_002797.3	1	2	3	2.006638	P62333	PRS10_HUMAN		14	1075	+	Breast(41;0.176)		B2R975|P49719|Q6IBU3|Q92524	Silent	SNP	ENST00000606149.1	0	1	hg19	c.1059C>T		0																																																																																								0.107143		TCGA-3A-A9IX-01A-11D-A40W-08	0.323	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1	0	0	1		2	2	2	0		0	0	41		41	40	1	2	-3.494015	1	0.100000	NM_002806			6	6		173	167	0		1	1		0	0	41	0		9.619456e-01	9.888699e-01	0	34	0	214	0	6	173
KCNH5	27133	broad.mit.edu	37	14	63269191	63269191	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr14:63269191G>A	ENST00000322893.7	-	9	1946	c.1678C>T	c.(1678-1680)Cgc>Tgc	p.R560C	KCNH5_ENST00000420622.2_Missense_Mutation_p.R560C|KCNH5_ENST00000394968.1_Missense_Mutation_p.R502C	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	560					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GCCAAGGCGCGCAGACACCCA	0.512																																						ENST00000322893.7	1.000000	0.470000	1.000000	0.630000	0.840000	0.827074	0.840000	1.000000																										0				99						c.(1678-1680)Cgc>Tgc		potassium voltage-gated channel, subfamily H (eag-related), member 5							82.0	77.0	79.0					14																	63269191		2203	4300	6503	SO:0001583	missense	27133	0	0					g.chr14:63269191G>A	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1678C>T	chr14.hg19:g.63269191G>A	ENSP00000321427:p.Arg560Cys	0					KCNH5_ENST00000420622.2_Missense_Mutation_p.R560C|KCNH5_ENST00000394968.1_Missense_Mutation_p.R502C	p.R560C	NM_139318.3	NP_647479.2	1	2	3	2.010425	Q8NCM2	KCNH5_HUMAN		9	1946	-			C9JP98	Missense_Mutation	SNP	ENST00000322893.7	1	1	hg19	c.1678C>T	CCDS9756.1	0	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948501	0.73787	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968	D;D;D	0.96940	-4.18;-4.18;-4.18	5.13	4.22	0.49857	5.130000	4.220000	0.498570	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.98413	0.9472	M	0.91038	3.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99564	1.0969	10	0.87932	D	0	.	15.7242	0.77740	0.0:0.1373:0.8627:0.0	.	502;560;560	Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;KCNH5_HUMAN	C	560;560;502	ENSP00000321427:R560C;ENSP00000395439:R560C;ENSP00000378419:R502C	ENSP00000321427:R560C	R	-	1	0	0	KCNH5	62338944	62338944	1.000000	0.71417	0.977000	0.42913	0.897000	0.52465	5.628000	0.67791	1.265000	0.44215	0.563000	0.77884	CGC	0.108028		TCGA-3A-A9IX-01A-11D-A40W-08	0.512	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	0	0	1		2	2	2	0		0	0	48		48	45	1	2	-3.012310	1	0.100000	NM_139318			14	14		342	337	0		1			0	0	48	0		9.997434e-01	0	0	0	0	0	0	14	342
THBS1	7057	broad.mit.edu	37	15	39884787	39884787	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr15:39884787C>T	ENST00000260356.5	+	17	2716	c.2551C>T	c.(2551-2553)Cgc>Tgc	p.R851C	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	851					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TGACTCAGACCGCATTGGAGA	0.453																																						ENST00000260356.5	1.000000	0.290000	1.000000	0.510000	0.820000	0.782319	0.820000	1.000000																										0				53						c.(2551-2553)Cgc>Tgc		thrombospondin 1							48.0	42.0	44.0					15																	39884787		2200	4297	6497	SO:0001583	missense	7057	0	0					g.chr15:39884787C>T		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2551C>T	chr15.hg19:g.39884787C>T	ENSP00000260356:p.Arg851Cys	0					CTD-2033D15.1_ENST00000560769.1_RNA	p.R851C	NM_003246.2	NP_003237.2	0	1	1	1.986317	P07996	TSP1_HUMAN		17	2716	+		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	0	1	hg19	c.2551C>T	CCDS32194.1	0	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345471	0.82022	.	.	ENSG00000137801	ENST00000260356	D	0.98400	-4.91	5.0	5.0	0.66597	5.000000	5.000000	0.665970	.	0.492001	0.15344	N	0.267319	D	0.98510	0.9503	L	0.58101	1.795	0.58432	D	0.999996	B;D	0.89917	0.151;1.0	B;D	0.63381	0.075;0.914	D	0.99748	1.1017	10	0.66056	D	0.02	-5.5658	18.6342	0.91371	0.0:1.0:0.0:0.0	.	766;851	B4E3J7;P07996	.;TSP1_HUMAN	C	851	ENSP00000260356:R851C	ENSP00000260356:R851C	R	+	1	0	0	THBS1	37672079	37672079	0.997000	0.39634	0.999000	0.59377	0.996000	0.88848	6.081000	0.71309	2.474000	0.83562	0.655000	0.94253	CGC	0.091368		TCGA-3A-A9IX-01A-11D-A40W-08	0.453	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	0	0	1		2	2	2	0		0	0	18		18	17	1	2	-4.070278	1	0.100000	NM_003246			4	4		94	94	0		1	1		0	0	18	0		8.918450e-01	9.999965e-01	0	30	0	1585	0	4	94
RHBDF1	64285	broad.mit.edu	37	16	108512	108512	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr16:108512G>A	ENST00000262316.6	-	18	2537	c.2395C>T	c.(2395-2397)Cgg>Tgg	p.R799W		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	799					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				CAGCGTTTCCGGTACAGGTCG	0.552																																						ENST00000262316.6	1.000000	0.690000	1.000000	0.850000	0.990000	0.946080	0.990000	1.000000																										0				18						c.(2395-2397)Cgg>Tgg		rhomboid 5 homolog 1 (Drosophila)							148.0	160.0	156.0					16																	108512		2203	4300	6503	SO:0001583	missense	64285	1	121410	33				g.chr16:108512G>A	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.2395C>T	chr16.hg19:g.108512G>A	ENSP00000262316:p.Arg799Trp	0						p.R799W	NM_022450.3	NP_071895.3	1	2	3	2.013518	Q96CC6	RHDF1_HUMAN		18	2537	-		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	1	1	hg19	c.2395C>T	CCDS32344.1	1	.	.	.	.	.	.	.	.	.	.	.	15.51	2.856054	0.51376	.	.	ENSG00000007384	ENST00000262316	T	0.55930	0.49	5.07	4.11	0.48088	5.070000	4.110000	0.480880	.	0.052909	0.85682	D	0.000000	T	0.53465	0.1798	M	0.81942	2.565	0.80722	D	1	P	0.51449	0.945	B	0.42188	0.379	T	0.60875	-0.7176	10	0.87932	D	0	-26.6161	8.6392	0.33968	0.0821:0.0:0.7579:0.16	.	799	Q96CC6	RHDF1_HUMAN	W	799	ENSP00000262316:R799W	ENSP00000262316:R799W	R	-	1	2	2	RHBDF1	48512	48512	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	7.637000	0.83313	1.270000	0.44297	-0.229000	0.12294	CGG	0.108470		TCGA-3A-A9IX-01A-11D-A40W-08	0.552	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	1	0	1		2	2	2	0		0	0	120		120	116	1	2	-2.737383	1	0.100000	NM_022450			29	29		556	549	1		1	1		0	0	120	0		1	9.643132e-01	0	13	0	93	0	29	556
SEPHS2	22928	broad.mit.edu	37	16	30456632	30456632	+	Missense_Mutation	SNP	G	G	T	rs202134725		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr16:30456632G>T	ENST00000478753.2	-	1	870	c.417C>A	c.(415-417)ttC>ttA	p.F139L	SEPHS2_ENST00000542752.1_Missense_Mutation_p.F82L|SEPHS2_ENST00000500504.2_Missense_Mutation_p.F139L			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	139					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						AGGGGTAAAAGAAGTCCGTGG	0.602																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)	ENST00000478753.2	1.000000	0.470000	1.000000	0.670000	0.940000	0.866430	0.940000	1.000000																										0				10						c.(415-417)ttC>ttA		selenophosphate synthetase 2							51.0	52.0	52.0					16																	30456632		2009	4152	6161	SO:0001583	missense	22928	0	0					g.chr16:30456632G>T	BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.417C>A	chr16.hg19:g.30456632G>T	ENSP00000418669:p.Phe139Leu	0					SEPHS2_ENST00000500504.2_Missense_Mutation_p.F139L|SEPHS2_ENST00000542752.1_Missense_Mutation_p.F82L	p.F139L			1	2	3	2.013518	Q99611	SPS2_HUMAN		1	870	-			Q9BUQ2	Missense_Mutation	SNP	ENST00000478753.2	1	1	hg19	c.417C>A		1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831271	0.71258	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.28666	1.6;1.6;1.6	5.46	3.49	0.39957	5.460000	3.490000	0.399570	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.000000	0.85682	D	0.000000	T	0.43366	0.1244	M	0.82056	2.57	0.80722	D	1	P;P	0.40144	0.704;0.582	P;B	0.49085	0.6;0.331	T	0.42531	-0.9446	10	0.62326	D	0.03	-18.3451	6.8368	0.23941	0.2644:0.0:0.7356:0.0	.	139;82	Q99611;F5H8F9	SPS2_HUMAN;.	L	139;82;90;139	ENSP00000418669:F139L;ENSP00000443601:F82L;ENSP00000426234:F139L	ENSP00000390233:F90L	F	-	3	2	2	SEPHS2	30364133	30364133	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.645000	0.37238	1.450000	0.47717	0.655000	0.94253	TTC	0.108470		TCGA-3A-A9IX-01A-11D-A40W-08	0.602	SEPHS2-001	KNOWN	basic|seleno	protein_coding	protein_coding	OTTHUMT00000109640.11	0	0	1		2	2	2	0		0	0	63		63	62	1	2	-12.371280	1	0.100000	NM_012248			10	10		222	220	0		1	1	1	0	0	63	302		9.969325e-01	9.510197e-01	9.998711e-01	19	22	99	372	10	222
HERPUD1	9709	broad.mit.edu	37	16	56973198	56973198	+	Missense_Mutation	SNP	G	G	A	rs373182203		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr16:56973198G>A	ENST00000439977.2	+	5	678	c.481G>A	c.(481-483)Ggt>Agt	p.G161S	HERPUD1_ENST00000344114.4_Intron|HERPUD1_ENST00000300302.5_Missense_Mutation_p.G160S|HERPUD1_ENST00000379792.2_Missense_Mutation_p.G136S|HERPUD1_ENST00000570273.1_3'UTR|RP11-325K4.3_ENST00000565861.1_RNA|RP11-325K4.2_ENST00000570210.1_RNA	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	161					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						TGGTTTCTCCGGTTACACACC	0.493			T	ERG	prostate								G|||	1	0.000199681	0.0	0.0	5008	,	,		19903	0.001		0.0	False		,,,				2504	0.0					ENST00000439977.2	1.000000	0.700000	1.000000	0.820000	0.980000	0.933878	0.980000	1.000000				Dom	yes			Dom	yes		16	16q12.2-q13	16q12.2-q13	9709	T	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""				E	E	ERG		prostate		0				11						c.(481-483)Ggt>Agt		homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1		G	SER/GLY,SER/GLY,SER/GLY	0,4396		0,0,2198	170.0	181.0	177.0		478,406,481	5.0	1.0	16		177	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	HERPUD1	NM_001010989.1,NM_001010990.1,NM_014685.2	56,56,56	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	160/391,136/367,161/392	56973198	1,12995	2198	4300	6498	SO:0001583	missense	9709	3	121412	40				g.chr16:56973198G>A	AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.481G>A	chr16.hg19:g.56973198G>A	ENSP00000409555:p.Gly161Ser	0					RP11-325K4.2_ENST00000570210.1_RNA|HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000379792.2_Missense_Mutation_p.G136S|RP11-325K4.3_ENST00000565861.1_RNA|HERPUD1_ENST00000300302.5_Missense_Mutation_p.G160S|HERPUD1_ENST00000344114.4_Intron	p.G161S	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	1	2	3	2.013518	Q15011	HERP1_HUMAN		5	678	+			E9PGD1|O60644|Q6IAN8|Q96D92	Missense_Mutation	SNP	ENST00000439977.2	1	1	hg19	c.481G>A	CCDS10771.1	1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737940	0.49045	0.0	1.16E-4	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302	T	0.28666	1.6	5.97	5.02	0.67125	5.970000	5.020000	0.671250	.	0.312317	0.37577	N	0.002021	T	0.35008	0.0917	L	0.44542	1.39	0.20074	N	0.999937	D;P;D;P	0.69078	0.997;0.745;0.997;0.751	P;B;P;B	0.54100	0.712;0.067;0.742;0.153	T	0.20773	-1.0265	10	0.08381	T	0.77	-6.0487	14.0339	0.64634	0.0719:0.0:0.9281:0.0	.	161;136;160;161	A4UAE9;E9PGD1;Q15011-2;Q15011	.;.;.;HERP1_HUMAN	S	160;136;161	ENSP00000369118:G136S	ENSP00000300302:G161S	G	+	1	0	0	HERPUD1	55530699	55530699	0.674000	0.27549	0.967000	0.41034	0.965000	0.64279	2.328000	0.43867	1.527000	0.49086	0.585000	0.79938	GGT	0.108470		TCGA-3A-A9IX-01A-11D-A40W-08	0.493	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257056.5	1	0	1		2	2	2	0		0	0	198		198	193	1	2	-2.872668	1	0.100000				40	39		806	796	0		1	1		0	0	198	0		1	1	0	24	0	601	0	40	806
PHF12	57649	broad.mit.edu	37	17	27239855	27239855	+	Silent	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr17:27239855C>T	ENST00000332830.4	-	9	2544	c.1734G>A	c.(1732-1734)cgG>cgA	p.R578R	PHF12_ENST00000582655.1_5'UTR|PHF12_ENST00000577226.1_Silent_p.R578R|PHF12_ENST00000268756.3_Silent_p.R578R	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			GCCAGCCTTGCCGGTGTGAGA	0.637																																						ENST00000332830.4	1.000000	0.150000	1.000000	0.240000	0.390000	0.487731	0.390000	0.320000																										0				30						c.(1732-1734)cgG>cgA		PHD finger protein 12							43.0	48.0	46.0					17																	27239855		2203	4300	6503	SO:0001819	synonymous_variant	57649	0	0					g.chr17:27239855C>T	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.1734G>A	chr17.hg19:g.27239855C>T		0					PHF12_ENST00000582655.1_5'UTR|PHF12_ENST00000577226.1_Silent_p.R578R|PHF12_ENST00000268756.3_Silent_p.R578R	p.R578R	NM_001033561.1	NP_001028733.1	1	2	3	2.025542			Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)	9	2544	-	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)			Silent	SNP	ENST00000332830.4	0	1	hg19	c.1734G>A	CCDS32598.1	0																																																																																								0.111111		TCGA-3A-A9IX-01A-11D-A40W-08	0.637	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255941.1	0	0	1		2	2	2	0		0	0	82		82	75	1	2	-2.600466	1	0.100000	NM_020889			6	6		361	335	0		1	0		0	0	82	0		9.565625e-01	3.982890e-01	0	0	0	74	0	6	361
CYB561	1534	broad.mit.edu	37	17	61513435	61513435	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr17:61513435G>A	ENST00000392976.1	-	3	580	c.281C>T	c.(280-282)gCg>gTg	p.A94V	CYB561_ENST00000448884.2_Missense_Mutation_p.A94V|CYB561_ENST00000584031.1_Missense_Mutation_p.A94V|CYB561_ENST00000392975.2_Missense_Mutation_p.A94V|CYB561_ENST00000582297.1_Missense_Mutation_p.A94V|CYB561_ENST00000581163.1_5'UTR|CYB561_ENST00000581573.1_Missense_Mutation_p.A94V|CYB561_ENST00000582034.1_Missense_Mutation_p.A65V|CYB561_ENST00000542042.1_Missense_Mutation_p.A161V|CYB561_ENST00000582997.1_Missense_Mutation_p.A101V|CYB561_ENST00000360793.3_Missense_Mutation_p.A94V	NM_001017916.1	NP_001017916.1	P49447	CY561_HUMAN	cytochrome b561	94	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				electron transport chain (GO:0022900)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|transmembrane electron transfer carrier (GO:0022865)			lung(2)|ovary(1)|prostate(1)	4				READ - Rectum adenocarcinoma(1115;0.0689)		GATGACGAGCGCAAAGATGTG	0.612																																						ENST00000392976.1	0.640000	0.120000	0.480000	0.200000	0.320000	0.348222	0.320000	0.290000																										0				4						c.(280-282)gCg>gTg		cytochrome b561							141.0	118.0	126.0					17																	61513435		2203	4300	6503	SO:0001583	missense	1534	3	121410	34				g.chr17:61513435G>A		CCDS11636.1	17q23.3	2013-03-14	2013-03-14		ENSG00000008283	ENSG00000008283		"""Cytochrome b genes"""	2571	protein-coding gene	gene with protein product	"""ferric-chelate reductase 2"", ""cytochrome b561 family, member A1"""	600019				7959749, 23249217	Standard	XM_005257091		Approved	FRRS2, CYB561A1	uc002jas.3	P49447		ENST00000392976.1:c.281C>T	chr17.hg19:g.61513435G>A	ENSP00000376702:p.Ala94Val	0					CYB561_ENST00000360793.3_Missense_Mutation_p.A94V|CYB561_ENST00000581573.1_Missense_Mutation_p.A94V|CYB561_ENST00000448884.2_Missense_Mutation_p.A94V|CYB561_ENST00000542042.1_Missense_Mutation_p.A161V|CYB561_ENST00000582297.1_Missense_Mutation_p.A94V|CYB561_ENST00000582034.1_Missense_Mutation_p.A65V|CYB561_ENST00000581163.1_5'UTR|CYB561_ENST00000582997.1_Missense_Mutation_p.A101V|CYB561_ENST00000584031.1_Missense_Mutation_p.A94V|CYB561_ENST00000392975.2_Missense_Mutation_p.A94V	p.A94V	NM_001017916.1	NP_001017916.1	0	1	1	1.945631	P49447	CY561_HUMAN		3	580	-			B2RE96|B7Z775|D3DU11|Q5BJG9|Q9BU05|Q9BWR9	Missense_Mutation	SNP	ENST00000392976.1	0	1	hg19	c.281C>T	CCDS11636.1	0	.	.	.	.	.	.	.	.	.	.	G	10.73	1.431165	0.25726	.	.	ENSG00000008283	ENST00000360793;ENST00000392976;ENST00000392975;ENST00000448884;ENST00000542042	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	4.34	4.34	0.51931	4.340000	4.340000	0.519310	Cytochrome b561, eukaryote (1);Cytochrome b561/ferric reductase transmembrane (2);	0.055735	0.64402	D	0.000001	T	0.71500	0.3347	M	0.78285	2.405	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;0.998;0.984	P;D;P;P	0.91635	0.893;0.999;0.827;0.68	T	0.74702	-0.3576	10	0.54805	T	0.06	-16.3975	13.7194	0.62717	0.0:0.0:1.0:0.0	.	94;94;161;94	B7Z775;B3KTA1;F5H757;P49447	.;.;.;CY561_HUMAN	V	94;94;94;94;161	ENSP00000354028:A94V;ENSP00000376702:A94V;ENSP00000376701:A94V;ENSP00000400350:A94V;ENSP00000442773:A161V	ENSP00000354028:A94V	A	-	2	0	0	CYB561	58867167	58867167	1.000000	0.71417	0.095000	0.20976	0.024000	0.10985	7.913000	0.87471	2.244000	0.73946	0.561000	0.74099	GCG	0.052632		TCGA-3A-A9IX-01A-11D-A40W-08	0.612	CYB561-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444843.1	0	0	1		2	2	2	0		0	0	53		53	53	1	2	-2.718022	1	0.100000	NM_001915			5	5		301	296	0		1	0		0	0	53	0		9.353054e-01	5.117696e-01	0	0	0	93	0	5	301
SMAD4	4089	broad.mit.edu	37	18	48591918	48591918	+	Missense_Mutation	SNP	C	C	T	rs80338963		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr18:48591918C>T	ENST00000342988.3	+	9	1619	c.1081C>T	c.(1081-1083)Cgc>Tgc	p.R361C	SMAD4_ENST00000588745.1_Missense_Mutation_p.R265C|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361C	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361C(3)|p.R361S(2)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGGAGGAGATCGCTTTTGTTT	0.413																																						ENST00000342988.3	1.000000	0.340000	0.900000	0.490000	0.670000	0.690535	0.670000	1.000000																										43	Whole gene deletion(36)|Substitution - Missense(5)|Unknown(2)	p.0?(36)|p.R361C(3)|p.R361S(2)|p.?(2)	pancreas(26)|large_intestine(4)|lung(3)|breast(3)|stomach(2)|small_intestine(2)|upper_aerodigestive_tract(1)|biliary_tract(1)|oesophagus(1)	454	GRCh37	CM040450|CM041789|CM981228	SMAD4	M	rs80338963	c.(1081-1083)Cgc>Tgc		SMAD family member 4							179.0	149.0	159.0					18																	48591918		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48591918C>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1081C>T	chr18.hg19:g.48591918C>T	ENSP00000341551:p.Arg361Cys	0					SMAD4_ENST00000588745.1_Missense_Mutation_p.R265C|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361C	p.R361C	NM_005359.5	NP_005350.1	0	1	1	1.992419	Q13485	SMAD4_HUMAN		9	1619	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1081C>T	CCDS11950.1	0	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820743	0.90873	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98164	-4.76;-4.76	5.86	5.86	0.93980	5.860000	5.860000	0.939800	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99275	0.9747	M	0.94021	3.485	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99157	1.0860	9	0.87932	D	0	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	361	Q13485	SMAD4_HUMAN	C	361	ENSP00000341551:R361C;ENSP00000381452:R361C	ENSP00000341551:R361C	R	+	1	0	0	SMAD4	46845916	46845916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.718000	0.61930	2.771000	0.95319	0.563000	0.77884	CGC	0.092284		TCGA-3A-A9IX-01A-11D-A40W-08	0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	0	0	1		2	2	2	0		0	0	90		90	86	1	2	-3.130658	1	0.100000	NM_005359			10	10		289	285	0		1	0	1	0	0	90	689		9.968003e-01	7.954160e-01	9.999948e-01	1	11	87	789	10	289
SLC7A9	11136	broad.mit.edu	37	19	33334838	33334838	+	Missense_Mutation	SNP	G	G	A	rs121908484		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr19:33334838G>A	ENST00000023064.4	-	10	1188	c.997C>T	c.(997-999)Cgg>Tgg	p.R333W	SLC7A9_ENST00000587772.1_Missense_Mutation_p.R333W|SLC7A9_ENST00000590341.1_Missense_Mutation_p.R333W	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	333			R -> W (in CSNU; frequent mutation; severe loss of amino acid transport activity). {ECO:0000269|PubMed:11157794}.		amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	TGACCCTCCCGGCCCGCCACG	0.567																																					GBM(181;1335 2108 9644 44178 46689)	ENST00000023064.4	1.000000	0.200000	0.990000	0.340000	0.560000	0.604751	0.560000	1.000000																										0				32	GRCh37	CM010449	SLC7A9	M	rs121908484	c.(997-999)Cgg>Tgg		solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	L-Cystine(DB00138)	G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	54.0	55.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	997,997	3.2	1.0	19	dbSNP_133	55	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	SLC7A9	NM_001126335.1,NM_014270.4	101,101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	333/488,333/488	33334838	2,13004	2203	4300	6503	SO:0001583	missense	11136	11	121412	40				g.chr19:33334838G>A	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.997C>T	chr19.hg19:g.33334838G>A	ENSP00000023064:p.Arg333Trp	0					SLC7A9_ENST00000587772.1_Missense_Mutation_p.R333W|SLC7A9_ENST00000590341.1_Missense_Mutation_p.R333W	p.R333W	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	1	2	3	2.007608	P82251	BAT1_HUMAN		10	1188	-	Esophageal squamous(110;0.137)		B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	0	1	hg19	c.997C>T	CCDS12425.1	0	.	.	.	.	.	.	.	.	.	.	G	17.82	3.484195	0.63962	2.27E-4	1.16E-4	ENSG00000021488	ENST00000023064	D	0.91792	-2.91	5.37	3.17	0.36434	5.370000	3.170000	0.364340	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.96806	0.8957	M	0.93808	3.46	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98100	1.0414	9	0.87932	D	0	.	13.9854	0.64331	0.0:0.0:0.7234:0.2766	.	333;333	Q53FY4;P82251	.;BAT1_HUMAN	W	333	ENSP00000023064:R333W	ENSP00000023064:R333W	R	-	1	2	2	SLC7A9	38026678	38026678	1.000000	0.71417	0.997000	0.53966	0.663000	0.39108	3.879000	0.56138	0.597000	0.29811	-0.182000	0.12963	CGG	0.107143		TCGA-3A-A9IX-01A-11D-A40W-08	0.567	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1	0	0	1		2	2	2	0		0	0	49		49	48	1	2	-6.435171	1	0.100000				5	5		203	194	0		1			0	0	49	0		9.307665e-01	0	0	0	0	0	0	5	203
ALDH16A1	126133	broad.mit.edu	37	19	49964157	49964157	+	Splice_Site	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr19:49964157G>A	ENST00000293350.4	+	5	740		c.e5+1		CTD-3148I10.9_ENST00000599536.1_5'Flank|ALDH16A1_ENST00000433981.2_Splice_Site|ALDH16A1_ENST00000540132.1_Splice_Site|ALDH16A1_ENST00000455361.2_Splice_Site	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1							extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CTGGCTGTGGGTAAATGATGG	0.557																																						ENST00000293350.4	1.000000	0.340000	1.000000	0.490000	0.700000	0.724217	0.700000	1.000000																										0				20						c.e5+1		aldehyde dehydrogenase 16 family, member A1							88.0	82.0	84.0					19																	49964157		2203	4300	6503	SO:0001630	splice_region_variant	126133	0	0					g.chr19:49964157G>A	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.577+1G>A	chr19.hg19:g.49964157G>A		0					CTD-3148I10.9_ENST00000599536.1_5'Flank|ALDH16A1_ENST00000540132.1_Splice_Site|ALDH16A1_ENST00000455361.2_Splice_Site|ALDH16A1_ENST00000433981.2_Splice_Site		NM_153329.3	NP_699160.2	1	2	3	2.021362	Q8IZ83	A16A1_HUMAN		5	740	+		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Splice_Site	SNP	ENST00000293350.4	1	1	hg19		CCDS12766.1	0	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966777	0.74131	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	.	.	.	5.38	5.38	0.77491	5.380000	5.380000	0.774910	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0276	0.71682	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ALDH16A1	54655969	54655969	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.134000	0.50538	2.704000	0.92352	0.585000	0.79938	.	0.110232		TCGA-3A-A9IX-01A-11D-A40W-08	0.557	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	0	0	1		13	2	2	1		1	1	94		94	92	1	2	-3.578888	1	0.100000	NM_153329	Intron		10	10		309	306	0		0	1		1	0	94	0		3.247227e-01	1.177558e-02	0	3	0	2	0	10	309
POLD1	5424	broad.mit.edu	37	19	50909518	50909518	+	Missense_Mutation	SNP	C	C	T	rs376711125		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr19:50909518C>T	ENST00000440232.2	+	11	1375	c.1322C>T	c.(1321-1323)aCg>aTg	p.T441M	POLD1_ENST00000599857.1_Missense_Mutation_p.T441M|POLD1_ENST00000595904.1_Missense_Mutation_p.T441M	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	441					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		TCCAAGCAGACGGGCCGGCGG	0.622								DNA polymerases (catalytic subunits)																														ENST00000440232.2	1.000000	0.140000	1.000000	0.220000	0.360000	0.458568	0.360000	0.300000																										0				39						c.(1321-1323)aCg>aTg	DNA polymerases (catalytic subunits)	polymerase (DNA directed), delta 1, catalytic subunit		C	MET/THR	0,4406		0,0,2203	68.0	72.0	70.0		1322	-2.9	0.7	19		70	2,8598	2.2+/-6.3	0,2,4298	no	missense	POLD1	NM_002691.2	81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	441/1108	50909518	2,13004	2203	4300	6503	SO:0001583	missense	5424	10	121410	44				g.chr19:50909518C>T		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.1322C>T	chr19.hg19:g.50909518C>T	ENSP00000406046:p.Thr441Met	0					POLD1_ENST00000599857.1_Missense_Mutation_p.T441M|POLD1_ENST00000595904.1_Missense_Mutation_p.T441M	p.T441M	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	1	2	3	2.021362	P28340	DPOD1_HUMAN		11	1375	+		all_neural(266;0.0571)	Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	0	1	hg19	c.1322C>T	CCDS12795.1	0	.	.	.	.	.	.	.	.	.	.	C	2.450	-0.326515	0.05350	0.0	2.33E-4	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.16073	2.37	4.54	-2.9	0.05648	4.540000	-2.900000	0.056480	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.206121	0.46758	N	0.000280	T	0.01835	0.0058	N	0.00061	-2.33	0.23010	N	0.998434	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.43196	-0.9406	10	0.02654	T	1	-18.2908	6.7083	0.23262	0.1254:0.5005:0.0:0.3741	.	441;441	E7EVW0;P28340	.;DPOD1_HUMAN	M	441;442	ENSP00000406046:T441M	ENSP00000366129:T442M	T	+	2	0	0	POLD1	55601330	55601330	0.997000	0.39634	0.675000	0.29917	0.992000	0.81027	1.237000	0.32695	-0.404000	0.07610	-0.302000	0.09304	ACG	0.110232		TCGA-3A-A9IX-01A-11D-A40W-08	0.622	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1	0	0	1		2	2	2	0		0	0	84		84	82	1	2	-2.764564	1	0.100000				6	6		390	379	0		1	1		0	0	84	0		9.620938e-01	1.429178e-01	0	2	0	35	0	6	390
SLC27A3	11000	broad.mit.edu	37	1	153747855	153747855	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr1:153747855G>A	ENST00000368661.3	+	1	88	c.23G>A	c.(22-24)cGc>cAc	p.R8H	SLC27A3_ENST00000484014.1_3'UTR|SLC27A3_ENST00000271857.2_Missense_Mutation_p.R89H	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	8					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAGCGCACGCGCGCTCCCTGG	0.677																																						ENST00000368661.3	1.000000	0.730000	1.000000	0.930000	0.990000	0.971580	0.990000	1.000000																										0				14						c.(22-24)cGc>cAc		solute carrier family 27 (fatty acid transporter), member 3							52.0	58.0	56.0					1																	153747855		2203	4300	6503	SO:0001583	missense	11000	0	0					g.chr1:153747855G>A	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.23G>A	chr1.hg19:g.153747855G>A	ENSP00000357650:p.Arg8His	0					SLC27A3_ENST00000271857.2_Missense_Mutation_p.R89H|SLC27A3_ENST00000484014.1_3'UTR	p.R8H	NM_024330.1	NP_077306.1	1	2	3	2.003783	Q5K4L6	S27A3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)	1	88	+	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	1	1	hg19	c.23G>A	CCDS1053.1	1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541870	0.65198	.	.	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.62105	0.05;0.2	4.32	4.32	0.51571	4.320000	4.320000	0.515710	.	.	.	.	.	T	0.42810	0.1219	N	0.08118	0	0.28144	N	0.929672	D	0.76494	0.999	P	0.56751	0.805	T	0.46965	-0.9153	9	0.87932	D	0	-3.5406	12.3256	0.55009	0.0:0.0:1.0:0.0	.	8	Q5K4L6	S27A3_HUMAN	H	89;8	ENSP00000271857:R89H;ENSP00000357650:R8H	ENSP00000271857:R89H	R	+	2	0	0	SLC27A3	152014479	152014479	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	1.460000	0.35244	1.973000	0.57446	0.462000	0.41574	CGC	0.106256		TCGA-3A-A9IX-01A-11D-A40W-08	0.677	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	76		76	76	1	2	-19.996570	1	0.100000	NM_024330			20	20		331	323	0		1	0		0	0	76	0		9.999946e-01	2.246043e-01	0	1	0	14	0	20	331
ZNF496	84838	broad.mit.edu	37	1	247473673	247473673	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr1:247473673T>C	ENST00000294753.4	-	6	1201	c.737A>G	c.(736-738)tAt>tGt	p.Y246C	ZNF496_ENST00000366498.2_Missense_Mutation_p.Y282C|ZNF496_ENST00000462139.1_5'UTR	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	246	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GAACTCTCCATAGAAGCCAGT	0.507																																						ENST00000294753.4	1.000000	0.560000	1.000000	0.760000	0.990000	0.910698	0.990000	1.000000																										0				36						c.(736-738)tAt>tGt		zinc finger protein 496							77.0	67.0	70.0					1																	247473673		2203	4300	6503	SO:0001583	missense	84838	0	0					g.chr1:247473673T>C	BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.737A>G	chr1.hg19:g.247473673T>C	ENSP00000294753:p.Tyr246Cys	0					ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.Y282C	p.Y246C	NM_032752.1	NP_116141.1	1	2	3	2.013004	Q96IT1	ZN496_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00703)	6	1201	-	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		Q8TBS2	Missense_Mutation	SNP	ENST00000294753.4	1	1	hg19	c.737A>G	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	T	16.37	3.103212	0.56183	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.07021	3.23;3.23	3.65	3.65	0.41850	3.650000	3.650000	0.418500	Krueppel-associated box (4);	0.000000	0.38897	N	0.001537	T	0.27559	0.0677	M	0.84156	2.68	0.35851	D	0.826793	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.30090	-0.9990	10	0.56958	D	0.05	-23.0442	8.8913	0.35434	0.0:0.0:0.0:1.0	.	282;246	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	C	246;282	ENSP00000294753:Y246C;ENSP00000355454:Y282C	ENSP00000294753:Y246C	Y	-	2	0	0	ZNF496	245540296	245540296	0.987000	0.35691	0.963000	0.40424	0.966000	0.64601	3.047000	0.49854	1.672000	0.50884	0.533000	0.62120	TAT	0.108470		TCGA-3A-A9IX-01A-11D-A40W-08	0.507	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098655.2	1	0	1		2	2	2	0		0	0	83		83	81	1	2	-15.967410	1	0.100000	NM_032752			14	14		282	282	0		1	0		0	0	83	0		9.997732e-01	4.092516e-01	0	1	0	27	0	14	282
MAVS	57506	broad.mit.edu	37	20	3844972	3844972	+	Missense_Mutation	SNP	G	G	A	rs201823260		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr20:3844972G>A	ENST00000428216.2	+	6	823	c.695G>A	c.(694-696)cGt>cAt	p.R232H	MAVS_ENST00000416600.2_Missense_Mutation_p.R91H|MAVS_ENST00000358134.6_3'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	232					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CCCCTGGCCCGTTCCACCCCC	0.622																																						ENST00000428216.2	1.000000	0.120000	0.520000	0.200000	0.310000	0.391332	0.310000	0.280000																										0				14						c.(694-696)cGt>cAt		mitochondrial antiviral signaling protein		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	71.0	68.0	69.0		272,695	4.7	0.8	20		69	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	MAVS	NM_001206491.1,NM_020746.4	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	91/400,232/541	3844972	1,13005	2203	4300	6503	SO:0001583	missense	57506	13	121410	43				g.chr20:3844972G>A	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.695G>A	chr20.hg19:g.3844972G>A	ENSP00000401980:p.Arg232His	0					MAVS_ENST00000358134.6_3'UTR|MAVS_ENST00000416600.2_Missense_Mutation_p.R91H	p.R232H	NM_020746.4	NP_065797.2	1	2	3	2.000526	Q7Z434	MAVS_HUMAN		6	823	+			A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	0	1	hg19	c.695G>A	CCDS33437.1	0	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437866	0.83885	0.0	1.16E-4	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.55760	0.5;1.96	4.72	4.72	0.59763	4.720000	4.720000	0.597630	.	0.780557	0.11868	N	0.521739	T	0.63450	0.2512	L	0.46157	1.445	0.30885	N	0.731009	D	0.76494	0.999	P	0.61003	0.882	T	0.62243	-0.6895	10	0.59425	D	0.04	-5.5757	13.4262	0.61026	0.0:0.0:1.0:0.0	.	232	Q7Z434	MAVS_HUMAN	H	91;232	ENSP00000413749:R91H;ENSP00000401980:R232H	ENSP00000413749:R91H	R	+	2	0	0	MAVS	3792972	3792972	0.901000	0.30685	0.753000	0.31225	0.997000	0.91878	4.000000	0.57039	2.634000	0.89283	0.650000	0.86243	CGT	0.105812		TCGA-3A-A9IX-01A-11D-A40W-08	0.622	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	0	0	1		2	2	2	0		0	0	98		98	93	1	2	-2.467075	0	0.100000	NM_020746			6	6		423	409	0		1	0		0	0	98	0		9.614733e-01	3.702087e-02	0	0	0	18	0	6	423
TMPRSS15	5651	broad.mit.edu	37	21	19653400	19653400	+	Silent	SNP	G	G	A	rs148756781		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr21:19653400G>A	ENST00000284885.3	-	22	2658	c.2625C>T	c.(2623-2625)aaC>aaT	p.N875N		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	875	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TGGCAATGTCGTTGTCCTTTC	0.348																																						ENST00000284885.3	0.420000	0.100000	0.330000	0.150000	0.230000	0.246350	0.230000	0.210000																										0				85						c.(2623-2625)aaC>aaT		transmembrane protease, serine 15		G		2,4404	4.2+/-10.8	0,2,2201	201.0	190.0	194.0		2625	0.3	0.2	21	dbSNP_134	194	0,8600		0,0,4300	no	coding-synonymous	TMPRSS15	NM_002772.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		875/1020	19653400	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	5651	0	0					g.chr21:19653400G>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2625C>T	chr21.hg19:g.19653400G>A		0						p.N875N	NM_002772.2	NP_002763	0	0	0	1.951454	P98073	ENTK_HUMAN		22	2658	-			Q2NKL7	Silent	SNP	ENST00000284885.3	0	1	hg19	c.2625C>T	CCDS13571.1	0																																																																																								0.071207		TCGA-3A-A9IX-01A-11D-A40W-08	0.348	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	0	0	1		13	2	2	1		1	1	177		177	176	1	2	-2.506517	1	0.100000	NM_002772			7	6		607	597	0		0			1	0	177	0		1.211669e-01	0	0	0	0	0	0	7	607
KCNJ6	3763	broad.mit.edu	37	21	39087258	39087258	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr21:39087258C>T	ENST00000609713.1	-	3	791	c.202G>A	c.(202-204)Ggc>Agc	p.G68S	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.G68S	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	68					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	CTCACGTTGCCGTGATGAACA	0.488																																					Pancreas(48;379 1118 2936 19024 28214)	ENST00000609713.1	1.000000	0.490000	0.920000	0.610000	0.750000	0.766745	0.750000	1.000000																										0				22						c.(202-204)Ggc>Agc		potassium inwardly-rectifying channel, subfamily J, member 6	Halothane(DB01159)						262.0	246.0	251.0					21																	39087258		2047	4181	6228	SO:0001583	missense	3763	0	0					g.chr21:39087258C>T	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.202G>A	chr21.hg19:g.39087258C>T	ENSP00000477437:p.Gly68Ser	0					KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.G68S	p.G68S	NM_002240.3	NP_002231.1	0	0	0	1.951454	P48051	KCNJ6_HUMAN		3	791	-			Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	1	1	hg19	c.202G>A	CCDS42927.1	0	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941544	0.73557	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.93659	-3.26;-3.26	5.95	5.95	0.96441	5.950000	5.950000	0.964410	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.96463	0.8846	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94767	0.7941	10	0.33141	T	0.24	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	68	P48051	IRK6_HUMAN	S	68	ENSP00000383330:G68S;ENSP00000288309:G68S	ENSP00000288309:G68S	G	-	1	0	0	KCNJ6	38009128	38009128	1.000000	0.71417	0.994000	0.49952	0.624000	0.37722	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	GGC	0.071207		TCGA-3A-A9IX-01A-11D-A40W-08	0.488	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	0	0	1		2	2	2	0		0	0	110		110	104	1	2	-2.676352	1	0.100000	NM_002240			23	23		563	554	0		1			0	0	110	0		9.999992e-01	0	0	0	0	0	0	23	563
GREB1	9687	broad.mit.edu	37	2	11772081	11772081	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr2:11772081G>A	ENST00000381486.2	+	27	4958	c.4658G>A	c.(4657-4659)cGt>cAt	p.R1553H	GREB1_ENST00000396123.1_Missense_Mutation_p.R551H|GREB1_ENST00000234142.5_Missense_Mutation_p.R1553H	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1553						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ACCACCGGCCGTCACGAACAT	0.443																																					Ovarian(39;850 945 2785 23371 33093)	ENST00000381486.2	1.000000	0.500000	1.000000	0.680000	0.920000	0.869836	0.920000	1.000000																										0				30						c.(4657-4659)cGt>cAt		growth regulation by estrogen in breast cancer 1							98.0	95.0	96.0					2																	11772081		1927	4125	6052	SO:0001583	missense	9687	0	0					g.chr2:11772081G>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4658G>A	chr2.hg19:g.11772081G>A	ENSP00000370896:p.Arg1553His	0					GREB1_ENST00000234142.5_Missense_Mutation_p.R1553H|GREB1_ENST00000396123.1_Missense_Mutation_p.R551H	p.R1553H	NM_014668.3	NP_055483.2	1	2	3	2.007829	Q4ZG55	GREB1_HUMAN		27	4958	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	1	1	hg19	c.4658G>A	CCDS42655.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554458	0.86231	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.55930	0.49;0.49;0.49	5.48	5.48	0.80851	5.480000	5.480000	0.808510	.	0.000000	0.85682	D	0.000000	T	0.74230	0.3689	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76591	-0.2903	10	0.72032	D	0.01	-21.4125	19.3358	0.94319	0.0:0.0:1.0:0.0	.	1553	Q4ZG55	GREB1_HUMAN	H	1553;1553;551	ENSP00000370896:R1553H;ENSP00000234142:R1553H;ENSP00000379429:R551H	ENSP00000234142:R1553H	R	+	2	0	0	GREB1	11689532	11689532	1.000000	0.71417	0.963000	0.40424	0.471000	0.32888	9.343000	0.97047	2.573000	0.86826	0.557000	0.71058	CGT	0.107143		TCGA-3A-A9IX-01A-11D-A40W-08	0.443	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	1	0	1		2	2	2	0		0	0	92		92	90	1	2	-4.061748	1	0.100000	NM_014668			13	12		287	283	0		1	0		0	0	92	0		9.995122e-01	2.294931e-03	0	0	0	2	0	13	287
FIGN	55137	broad.mit.edu	37	2	164466403	164466403	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr2:164466403G>A	ENST00000333129.3	-	3	2253	c.1939C>T	c.(1939-1941)Cga>Tga	p.R647*	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	647					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						ATTAAAAGTCGTTTCATGAAG	0.443																																						ENST00000333129.3	1.000000	0.770000	1.000000	0.970000	0.990000	0.978355	0.990000	1.000000																										0				47						c.(1939-1941)Cga>Tga		fidgetin							99.0	97.0	98.0					2																	164466403		2014	4168	6182	SO:0001587	stop_gained	55137	0	0					g.chr2:164466403G>A	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1939C>T	chr2.hg19:g.164466403G>A	ENSP00000333836:p.Arg647*	0					FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	p.R647*	NM_018086.2	NP_060556.2	1	2	3	2.007829	Q5HY92	FIGN_HUMAN		3	2253	-			B3KWM0|Q9H6M5|Q9NVZ9	Nonsense_Mutation	SNP	ENST00000333129.3	0	1	hg19	c.1939C>T	CCDS2221.2	1	.	.	.	.	.	.	.	.	.	.	G	39	7.338110	0.98221	.	.	ENSG00000182263	ENST00000333129	.	.	.	5.77	4.87	0.63330	5.770000	4.870000	0.633300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.9622	13.5518	0.61736	0.0:0.0:0.708:0.292	.	.	.	.	X	647	.	ENSP00000333836:R647X	R	-	1	2	2	FIGN	164174649	164174649	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.912000	0.56386	1.382000	0.46385	0.467000	0.42956	CGA	0.107143		TCGA-3A-A9IX-01A-11D-A40W-08	0.443	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	0	0	1		23	2	2	1		1	1	53		53	49	1	2	-19.999970	1	0.100000	NM_018086			22	22		356	353	0		0	0		1	0	53	0		4.852906e-01	8.211089e-02	0	0	0	8	0	22	356
CASP10	843	broad.mit.edu	37	2	202073970	202073970	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr2:202073970C>T	ENST00000272879.5	+	9	1284	c.1100C>T	c.(1099-1101)tCg>tTg	p.S367L	CASP10_ENST00000346817.5_Missense_Mutation_p.S324L|CASP10_ENST00000286186.6_Missense_Mutation_p.S367L|CASP10_ENST00000360132.3_3'UTR|CASP10_ENST00000313728.7_Missense_Mutation_p.S300L|CASP10_ENST00000492363.1_3'UTR|CASP10_ENST00000448480.1_Missense_Mutation_p.S324L	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase	367					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						GTCTACTCTTCGGATGAGGCC	0.527																																						ENST00000272879.5	1.000000	0.160000	1.000000	0.250000	0.370000	0.466462	0.370000	0.330000																										0				27						c.(1099-1101)tCg>tTg		caspase 10, apoptosis-related cysteine peptidase							155.0	140.0	145.0					2																	202073970		2203	4300	6503	SO:0001583	missense	843	1	121412	32				g.chr2:202073970C>T	U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.1100C>T	chr2.hg19:g.202073970C>T	ENSP00000272879:p.Ser367Leu	0					CASP10_ENST00000346817.5_Missense_Mutation_p.S324L|CASP10_ENST00000492363.1_3'UTR|CASP10_ENST00000313728.7_Missense_Mutation_p.S300L|CASP10_ENST00000360132.3_3'UTR|CASP10_ENST00000448480.1_Missense_Mutation_p.S324L|CASP10_ENST00000286186.6_Missense_Mutation_p.S367L	p.S367L	NM_032974.4	NP_116756.2	1	2	3	2.019140	Q92851	CASPA_HUMAN		9	1284	+			Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Missense_Mutation	SNP	ENST00000272879.5	0	1	hg19	c.1100C>T	CCDS2338.1	0	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299455	0.60195	.	.	ENSG00000003400	ENST00000286186;ENST00000272879;ENST00000346817;ENST00000313728;ENST00000448480	T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08	5.05	5.05	0.67936	5.050000	5.050000	0.679360	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.342415	0.29087	N	0.013181	T	0.49440	0.1557	M	0.89353	3.025	0.31327	N	0.68525	D;D;D;D;D	0.89917	0.978;1.0;1.0;0.994;0.995	P;D;D;P;P	0.72982	0.759;0.947;0.979;0.772;0.768	T	0.61242	-0.7102	10	0.52906	T	0.07	.	10.695	0.45894	0.1465:0.7121:0.1414:0.0	.	300;324;367;324;367	Q92851-6;Q92851-5;Q92851;Q92851-2;Q92851-4	.;.;CASPA_HUMAN;.;.	L	367;367;324;300;324	ENSP00000286186:S367L;ENSP00000272879:S367L;ENSP00000237865:S324L;ENSP00000314599:S300L;ENSP00000396835:S324L	ENSP00000272879:S367L	S	+	2	0	0	CASP10	201782215	201782215	0.000000	0.05858	0.017000	0.16124	0.020000	0.10135	0.844000	0.27654	2.361000	0.80049	0.650000	0.86243	TCG	0.109792		TCGA-3A-A9IX-01A-11D-A40W-08	0.527	CASP10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256273.1	0	0	1		2	2	2	0		0	0	82		82	79	1	2	-2.756312	1	0.100000	NM_032977			8	8		484	477	0		1	1		0	0	82	0		9.887528e-01	1.013487e-01	0	2	0	27	0	8	484
PID1	55022	broad.mit.edu	37	2	229890686	229890686	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr2:229890686G>A	ENST00000354069.6	-	3	445	c.415C>T	c.(415-417)Cgg>Tgg	p.R139W	PID1_ENST00000482518.2_Intron|PID1_ENST00000392054.3_Missense_Mutation_p.R137W|PID1_ENST00000409462.1_Missense_Mutation_p.R57W|PID1_ENST00000392055.3_Missense_Mutation_p.R106W			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	139	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		TGGAATGGCCGGATTTCCAGG	0.567																																						ENST00000354069.6	1.000000	0.630000	1.000000	0.850000	0.990000	0.946587	0.990000	1.000000																										0				26						c.(415-417)Cgg>Tgg		phosphotyrosine interaction domain containing 1							94.0	91.0	92.0					2																	229890686		2203	4300	6503	SO:0001583	missense	55022	2	121410	33				g.chr2:229890686G>A	AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.415C>T	chr2.hg19:g.229890686G>A	ENSP00000283937:p.Arg139Trp	0					PID1_ENST00000482518.2_Intron|PID1_ENST00000392054.3_Missense_Mutation_p.R137W|PID1_ENST00000409462.1_Missense_Mutation_p.R57W|PID1_ENST00000392055.3_Missense_Mutation_p.R106W	p.R139W			1	2	3	2.019140	Q7Z2X4	PCLI1_HUMAN		3	445	-		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)	B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Missense_Mutation	SNP	ENST00000354069.6	1	1	hg19	c.415C>T		1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010246	0.75046	.	.	ENSG00000153823	ENST00000392054;ENST00000409462;ENST00000392055;ENST00000542363;ENST00000354069	.	.	.	5.55	5.55	0.83447	5.550000	5.550000	0.834470	Pleckstrin homology-type (1);	0.124895	0.56097	D	0.000030	T	0.68622	0.3021	L	0.36672	1.1	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.968;0.968;0.999;0.998	T	0.64508	-0.6391	8	.	.	.	-10.0864	18.8642	0.92285	0.0:0.0:1.0:0.0	.	57;106;137;139	Q7Z2X4-3;Q7Z2X4-4;Q7Z2X4-2;Q7Z2X4	.;.;.;PCLI1_HUMAN	W	137;57;106;139;139	.	.	R	-	1	2	2	PID1	229598930	229598930	1.000000	0.71417	0.994000	0.49952	0.952000	0.60782	7.240000	0.78192	2.768000	0.95171	0.655000	0.94253	CGG	0.109792		TCGA-3A-A9IX-01A-11D-A40W-08	0.567	PID1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000331810.2	1	0	1		2	2	2	0		0	0	45		45	45	1	2	-3.076744	1	0.100000	NM_017933			14	13		252	250	0		1	0		0	0	45	0		9.997579e-01	8.276573e-01	0	1	0	59	0	14	252
CNTN6	27255	broad.mit.edu	37	3	1418745	1418745	+	Missense_Mutation	SNP	G	G	A	rs140014929		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr3:1418745G>A	ENST00000446702.2	+	17	2779	c.2152G>A	c.(2152-2154)Gtc>Atc	p.V718I	CNTN6_ENST00000539053.1_Missense_Mutation_p.V646I|CNTN6_ENST00000350110.2_Missense_Mutation_p.V718I			Q9UQ52	CNTN6_HUMAN	contactin 6	718	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.V718I(2)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GTCTGAACTCGTCATTACGTG	0.373																																						ENST00000446702.2	1.000000	0.390000	1.000000	0.530000	0.720000	0.742233	0.720000	1.000000																										2	Substitution - Missense(2)	p.V718I(2)	large_intestine(1)|pancreas(1)	90						c.(2152-2154)Gtc>Atc		contactin 6		G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	188.0	178.0	182.0		2152	-0.1	1.0	3	dbSNP_134	182	1,8599	1.2+/-3.3	0,1,4299	no	missense	CNTN6	NM_014461.2	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	718/1029	1418745	2,13004	2203	4300	6503	SO:0001583	missense	27255	8	121412	43				g.chr3:1418745G>A	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2152G>A	chr3.hg19:g.1418745G>A	ENSP00000407822:p.Val718Ile	0					CNTN6_ENST00000350110.2_Missense_Mutation_p.V718I|CNTN6_ENST00000539053.1_Missense_Mutation_p.V646I	p.V718I			1	2	3	2.017085	Q9UQ52	CNTN6_HUMAN		17	2779	+		all_cancers(2;0.000164)|all_epithelial(2;0.107)	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	1	1	hg19	c.2152G>A	CCDS2557.1	0	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392335	0.42410	2.27E-4	1.16E-4	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.53857	0.6;0.6;0.6	5.76	-0.13	0.13498	5.760000	-0.130000	0.134980	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.235772	0.29684	N	0.011465	T	0.40372	0.1114	L	0.43152	1.355	0.44395	D	0.997306	B	0.15930	0.015	B	0.10450	0.005	T	0.20405	-1.0276	10	0.32370	T	0.25	.	11.0846	0.48080	0.3437:0.0:0.6563:0.0	.	718	Q9UQ52	CNTN6_HUMAN	I	718;646;718	ENSP00000407822:V718I;ENSP00000442791:V646I;ENSP00000341882:V718I	ENSP00000341882:V718I	V	+	1	0	0	CNTN6	1393745	1393745	1.000000	0.71417	0.989000	0.46669	0.998000	0.95712	3.636000	0.54317	0.098000	0.17522	0.655000	0.94253	GTC	0.109352		TCGA-3A-A9IX-01A-11D-A40W-08	0.373	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	0	0	1		2	2	2	0		0	0	55		55	54	1	2	-13.100220	1	0.100000	NM_014461			14	14		409	405	0		1			0	0	55	0		9.997472e-01	0	0	0	0	0	0	14	409
MST1R	4486	broad.mit.edu	37	3	49932714	49932714	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr3:49932714G>A	ENST00000296474.3	-	14	3184	c.3157C>T	c.(3157-3159)Cgg>Tgg	p.R1053W	MST1R_ENST00000344206.4_Missense_Mutation_p.R1004W	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1053					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GACTCTTTCCGCAGCAGTGGC	0.567																																						ENST00000296474.3	1.000000	0.110000	0.530000	0.160000	0.250000	0.366250	0.250000	0.220000																										0				37						c.(3157-3159)Cgg>Tgg		macrophage stimulating 1 receptor (c-met-related tyrosine kinase)							150.0	144.0	146.0					3																	49932714		2203	4300	6503	SO:0001583	missense	4486	14	121410	47				g.chr3:49932714G>A	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.3157C>T	chr3.hg19:g.49932714G>A	ENSP00000296474:p.Arg1053Trp	0					MST1R_ENST00000344206.4_Missense_Mutation_p.R1004W	p.R1053W	NM_002447.2	NP_002438	1	2	3	2.017085	Q04912	RON_HUMAN		14	3184	-			B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	0	1	hg19	c.3157C>T	CCDS2807.1	0	.	.	.	.	.	.	.	.	.	.	g	13.76	2.332890	0.41297	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.10288	2.89;2.89	5.84	1.71	0.24356	5.840000	1.710000	0.243560	.	0.615148	0.17959	N	0.156241	T	0.18173	0.0436	M	0.61703	1.905	0.09310	N	1	D	0.71674	0.998	P	0.53185	0.72	T	0.04065	-1.0980	10	0.62326	D	0.03	-2.2724	8.0852	0.30769	0.1508:0.0:0.6705:0.1787	.	1053	Q04912	RON_HUMAN	W	1053;1004	ENSP00000296474:R1053W;ENSP00000341325:R1004W	ENSP00000296474:R1053W	R	-	1	2	2	MST1R	49907718	49907718	0.000000	0.05858	0.363000	0.25875	0.029000	0.11900	0.091000	0.15046	0.826000	0.34661	-0.215000	0.12644	CGG	0.109352		TCGA-3A-A9IX-01A-11D-A40W-08	0.567	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1	0	0	1		2	2	2	0		0	0	166		166	161	1	2	-2.415515	0	0.100000				8	8		716	707	0		1	0		0	0	166	0		9.887909e-01	9.558859e-02	0	0	0	41	0	8	716
WDR82	80335	broad.mit.edu	37	3	52292632	52292632	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr3:52292632C>A	ENST00000296490.3	-	8	1113	c.832G>T	c.(832-834)Gat>Tat	p.D278Y		NM_025222.3	NP_079498.2	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	278					histone H3-K4 methylation (GO:0051568)	chromatin (GO:0000785)|histone methyltransferase complex (GO:0035097)|PTW/PP1 phosphatase complex (GO:0072357)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)								BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		TGTTTACCATCCAACACAGCT	0.448																																						ENST00000296490.3	1.000000	0.840000	1.000000	0.990000	0.990000	0.988995	0.990000	1.000000																										0										c.(832-834)Gat>Tat		WD repeat domain 82							171.0	159.0	163.0					3																	52292632		1955	4145	6100	SO:0001583	missense	80335	0	0					g.chr3:52292632C>A	AF132207	CCDS2851.2	3p21.2	2013-01-10	2007-07-04	2007-07-04	ENSG00000164091	ENSG00000164091		"""WD repeat domain containing"""	28826	protein-coding gene	gene with protein product		611059	"""transmembrane protein 113"""	TMEM113		17355966	Standard	NM_025222		Approved	PRO2730, MST107, MSTP107, PRO34047, WDR82A, SWD2	uc003ddl.2	Q6UXN9	OTTHUMG00000150391	ENST00000296490.3:c.832G>T	chr3.hg19:g.52292632C>A	ENSP00000296490:p.Asp278Tyr	0						p.D278Y	NM_025222.3	NP_079498.2	1	2	3	2.017085	Q6UXN9	WDR82_HUMAN		8	1113	-			A8K5R5|Q8TEB2	Missense_Mutation	SNP	ENST00000296490.3	1	1	hg19	c.832G>T	CCDS2851.2	1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143216	0.77888	.	.	ENSG00000164091	ENST00000296490	T	0.18502	2.21	5.87	5.87	0.94306	5.870000	5.870000	0.943060	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.30103	0.0754	L	0.31065	0.9	0.80722	D	1	P	0.45531	0.86	P	0.57009	0.811	T	0.00708	-1.1600	10	0.66056	D	0.02	-12.5223	20.1957	0.98242	0.0:1.0:0.0:0.0	.	278	Q6UXN9	WDR82_HUMAN	Y	278	ENSP00000296490:D278Y	ENSP00000296490:D278Y	D	-	1	0	0	WDR82	52267672	52267672	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.581000	0.82535	2.780000	0.95670	0.563000	0.77884	GAT	0.109352		TCGA-3A-A9IX-01A-11D-A40W-08	0.448	WDR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317919.1	1	0	1		2	2	2	0		0	0	87		87	85	1	2	-6.673204	1	0.100000	NM_025222			31	31		490	482	0		1	1		0	0	87	0		1	9.974851e-01	0	7	0	139	0	31	490
ROBO2	6092	broad.mit.edu	37	3	77600066	77600066	+	Missense_Mutation	SNP	C	C	T	rs199705591		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr3:77600066C>T	ENST00000461745.1	+	8	2057	c.1157C>T	c.(1156-1158)gCg>gTg	p.A386V	ROBO2_ENST00000487694.3_Missense_Mutation_p.A402V|ROBO2_ENST00000332191.8_Missense_Mutation_p.A386V	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	386	Ig-like C2-type 4.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CGTTCCGACGCGGGTTACTAC	0.473																																						ENST00000461745.1	1.000000	0.630000	1.000000	0.840000	0.990000	0.945664	0.990000	1.000000																										0				117						c.(1156-1158)gCg>gTg		roundabout, axon guidance receptor, homolog 2 (Drosophila)							79.0	78.0	78.0					3																	77600066		1933	4145	6078	SO:0001583	missense	6092	17	120850	44				g.chr3:77600066C>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1157C>T	chr3.hg19:g.77600066C>T	ENSP00000417164:p.Ala386Val	0					ROBO2_ENST00000487694.3_Missense_Mutation_p.A402V|ROBO2_ENST00000332191.8_Missense_Mutation_p.A386V	p.A386V	NM_002942.4	NP_002933.1	1	2	3	2.023999	Q9HCK4	ROBO2_HUMAN		8	2057	+			O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	0	1	hg19	c.1157C>T	CCDS43109.1	1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.406025	0.42715	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.68479	-0.33;-0.33;-0.33	5.49	4.55	0.56014	5.490000	4.550000	0.560140	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000351	T	0.75072	0.3800	L	0.50919	1.6	0.39718	D	0.971425	D;D;D	0.69078	0.995;0.997;0.995	D;D;D	0.67231	0.938;0.942;0.95	T	0.72398	-0.4306	9	0.26408	T	0.33	.	16.0733	0.80951	0.0:0.866:0.134:0.0	.	402;386;386	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	V	402;402;406;386;386;107	ENSP00000417335:A402V;ENSP00000417164:A386V;ENSP00000327536:A386V	ENSP00000327536:A386V	A	+	2	0	0	ROBO2	77682756	77682756	1.000000	0.71417	0.225000	0.23894	0.113000	0.19764	6.001000	0.70685	2.742000	0.94016	0.591000	0.81541	GCG	0.121951		TCGA-3A-A9IX-01A-11D-A40W-08	0.473	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	1	0	1		2	2	2	0		0	0	26		26	24	1	2	-3.221883	1	0.100000	XM_031246			15	14		284	274	0		1	0		0	0	26	0		9.998439e-01	2.992233e-03	0	0	0	2	0	15	284
SI	6476	broad.mit.edu	37	3	164786914	164786914	+	Missense_Mutation	SNP	C	C	T	rs149498200		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr3:164786914C>T	ENST00000264382.3	-	4	387	c.325G>A	c.(325-327)Gtt>Att	p.V109I		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	109	P-type 1. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGATTATCAACGAAGAAGCAC	0.363										HNSCC(35;0.089)																												ENST00000264382.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999612	0.990000	1.000000																										0				218						c.(325-327)Gtt>Att		sucrase-isomaltase (alpha-glucosidase)	Acarbose(DB00284)|Scopolamine(DB00747)	C	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	71.0	69.0	70.0		325	5.9	0.2	3	dbSNP_134	70	0,8600		0,0,4300	no	missense	SI	NM_001041.3	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	109/1828	164786914	2,13004	2203	4300	6503	SO:0001583	missense	6476	7	121392	41				g.chr3:164786914C>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.325G>A	chr3.hg19:g.164786914C>T	ENSP00000264382:p.Val109Ile	0	HNSCC(35;0.089)					p.V109I	NM_001041.3	NP_001032.2	1	2	3	2.011289	P14410	SUIS_HUMAN		4	387	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	1	1	hg19	c.325G>A	CCDS3196.1	1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.146805	0.37923	4.54E-4	0.0	ENSG00000090402	ENST00000264382	D	0.85171	-1.95	5.91	5.91	0.95273	5.910000	5.910000	0.952730	Glycoside hydrolase-type carbohydrate-binding (1);P-type trefoil (3);	0.720617	0.14150	N	0.338066	T	0.82116	0.4967	L	0.57536	1.79	0.09310	N	1	P	0.35363	0.497	B	0.30029	0.11	T	0.77469	-0.2576	10	0.66056	D	0.02	.	13.0201	0.58781	0.2008:0.7992:0.0:0.0	.	109	P14410	SUIS_HUMAN	I	109	ENSP00000264382:V109I	ENSP00000264382:V109I	V	-	1	0	0	SI	166269608	166269608	0.005000	0.15991	0.209000	0.23619	0.343000	0.28985	1.081000	0.30791	2.802000	0.96397	0.655000	0.94253	GTT	0.108028		TCGA-3A-A9IX-01A-11D-A40W-08	0.363	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	1	0	1		2	2	2	0		0	0	46		46	45	1	2	-8.339670	1	0.100000	NM_001041			20	20		199	195	0		1			0	0	46	0		9.999956e-01	0	0	0	0	0	0	20	199
FAM71B	153745	broad.mit.edu	37	5	156592698	156592698	+	Missense_Mutation	SNP	C	C	A	rs146865558		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr5:156592698C>A	ENST00000302938.4	-	1	577	c.482G>T	c.(481-483)cGg>cTg	p.R161L		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	161						nucleus (GO:0005634)		p.R161L(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGATCTTCCCGTGTGTCAGA	0.498																																						ENST00000302938.4	1.000000	0.290000	0.760000	0.390000	0.520000	0.578811	0.520000	0.500000																										1	Substitution - Missense(1)	p.R161L(1)	lung(1)	68						c.(481-483)cGg>cTg		family with sequence similarity 71, member B							129.0	132.0	131.0					5																	156592698		2203	4300	6503	SO:0001583	missense	153745	0	0					g.chr5:156592698C>A		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.482G>T	chr5.hg19:g.156592698C>A	ENSP00000305596:p.Arg161Leu	0						p.R161L	NM_130899.2	NP_570969.2	1	2	3	2.004622	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	1	577	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	1	1	hg19	c.482G>T	CCDS4335.1	0	.	.	.	.	.	.	.	.	.	.	C	15.63	2.888978	0.52014	.	.	ENSG00000170613	ENST00000302938	T	0.17054	2.3	4.56	4.56	0.56223	4.560000	4.560000	0.562230	.	0.345278	0.24813	N	0.035395	T	0.36853	0.0982	M	0.62154	1.92	0.09310	N	1	D	0.65815	0.995	D	0.69479	0.964	T	0.06807	-1.0806	10	0.54805	T	0.06	-3.8761	13.5619	0.61795	0.0:1.0:0.0:0.0	.	161	Q8TC56	FA71B_HUMAN	L	161	ENSP00000305596:R161L	ENSP00000305596:R161L	R	-	2	0	0	FAM71B	156525276	156525276	0.027000	0.19231	0.010000	0.14722	0.624000	0.37722	1.032000	0.30178	2.469000	0.83416	0.655000	0.94253	CGG	0.106700		TCGA-3A-A9IX-01A-11D-A40W-08	0.498	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	0	0	1		2	2	2	0		0	0	127		127	125	1	2	-1.667355	0	0.100000	NM_130899			15	15		592	580	0		1			0	0	127	0		9.998501e-01	0	0	0	0	0	0	15	592
RELN	5649	broad.mit.edu	37	7	103474008	103474008	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr7:103474008G>A	ENST00000428762.1	-	3	608	c.449C>T	c.(448-450)gCg>gTg	p.A150V	RELN_ENST00000424685.2_Missense_Mutation_p.A150V|RELN_ENST00000343529.5_Missense_Mutation_p.A150V	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	150	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCCTGTGCCCGCAGGTGGAGC	0.473																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	1.000000	0.550000	1.000000	0.730000	0.960000	0.896708	0.960000	1.000000																										0				227						c.(448-450)gCg>gTg		reelin							108.0	98.0	101.0					7																	103474008		2203	4300	6503	SO:0001583	missense	5649	1	121408	30				g.chr7:103474008G>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.449C>T	chr7.hg19:g.103474008G>A	ENSP00000392423:p.Ala150Val	0					RELN_ENST00000343529.5_Missense_Mutation_p.A150V|RELN_ENST00000424685.2_Missense_Mutation_p.A150V	p.A150V	NM_005045.3	NP_005036.2	0	0	0	1.975038	P78509	RELN_HUMAN		3	608	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	1	1	hg19	c.449C>T	CCDS47680.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172734	0.78452	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.28454	1.61;1.61;1.61	5.33	5.33	0.75918	5.330000	5.330000	0.759180	Reeler domain (2);	0.060775	0.64402	D	0.000002	T	0.31513	0.0799	N	0.14661	0.345	0.54753	D	0.999989	D;D	0.56035	0.968;0.974	P;P	0.50708	0.516;0.648	T	0.19549	-1.0302	10	0.72032	D	0.01	.	19.3931	0.94592	0.0:0.0:1.0:0.0	.	150;150	P78509-2;P78509	.;RELN_HUMAN	V	150	ENSP00000392423:A150V;ENSP00000345694:A150V;ENSP00000388446:A150V	ENSP00000345694:A150V	A	-	2	0	0	RELN	103261244	103261244	1.000000	0.71417	0.875000	0.34327	0.980000	0.70556	5.819000	0.69243	2.634000	0.89283	0.650000	0.86243	GCG	0.082569		TCGA-3A-A9IX-01A-11D-A40W-08	0.473	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	1	0	1		2	2	2	0		0	0	33		33	32	1	2	-3.200436	1	0.100000	NM_005045			13	13		248	245	0		1	0		0	0	33	0		9.995367e-01	9.889227e-02	0	0	0	10	0	13	248
SDK1	221935	broad.mit.edu	37	7	4119186	4119186	+	Silent	SNP	G	G	A	rs377121090		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr7:4119186G>A	ENST00000404826.2	+	22	3433	c.3294G>A	c.(3292-3294)acG>acA	p.T1098T	SDK1_ENST00000389531.3_Silent_p.T1098T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1098	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACGGGAAAACGTCCATCTCCA	0.572																																						ENST00000404826.2	1.000000	0.140000	1.000000	0.230000	0.360000	0.492967	0.360000	0.290000																										0				153						c.(3292-3294)acG>acA		sidekick cell adhesion molecule 1							147.0	127.0	134.0					7																	4119186		2203	4300	6503	SO:0001819	synonymous_variant	221935	8	121412	47				g.chr7:4119186G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3294G>A	chr7.hg19:g.4119186G>A		0					SDK1_ENST00000389531.3_Silent_p.T1098T	p.T1098T	NM_152744.3	NP_689957.3	1	2	3	2.065582	Q7Z5N4	SDK1_HUMAN		22	3433	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	0	1	hg19	c.3294G>A	CCDS34590.1	0																																																																																								0.119804		TCGA-3A-A9IX-01A-11D-A40W-08	0.572	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	0	0	1		2	2	2	0		0	0	108		108	108	1	2	-2.889120	1	0.100000	NM_152744			7	7		475	465	0		1	0		0	0	108	0		9.792567e-01	7.243544e-02	0	0	0	26	0	7	475
ATP6V0A4	50617	broad.mit.edu	37	7	138434008	138434008	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr7:138434008C>A	ENST00000310018.2	-	12	1366	c.1084G>T	c.(1084-1086)Gcc>Tcc	p.A362S	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.A362S|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.A362S	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	362					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GTGGGAGGGGCTGTTTTAGAT	0.453																																						ENST00000310018.2	0.600000	0.170000	0.470000	0.240000	0.340000	0.365108	0.340000	0.340000																										0				36						c.(1084-1086)Gcc>Tcc		ATPase, H+ transporting, lysosomal V0 subunit a4							104.0	105.0	105.0					7																	138434008		2203	4300	6503	SO:0001583	missense	50617	0	0					g.chr7:138434008C>A	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.1084G>T	chr7.hg19:g.138434008C>A	ENSP00000308122:p.Ala362Ser	0					ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.A362S|ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.A362S	p.A362S	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	0	0	0	1.975038	Q9HBG4	VPP4_HUMAN		12	1366	-			A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	0	1	hg19	c.1084G>T	CCDS5849.1	0	.	.	.	.	.	.	.	.	.	.	C	5.791	0.330340	0.10956	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.85629	-2.01;-2.01;-2.01	5.13	4.04	0.47022	5.130000	4.040000	0.470220	.	0.458554	0.21405	N	0.075080	T	0.76572	0.4006	N	0.20445	0.575	0.29415	N	0.860951	B	0.28584	0.216	B	0.34038	0.174	T	0.69412	-0.5152	10	0.25751	T	0.34	-4.7235	14.5017	0.67727	0.0:0.9161:0.0:0.0839	.	362	Q9HBG4	VPP4_HUMAN	S	362	ENSP00000308122:A362S;ENSP00000376774:A362S;ENSP00000253856:A362S	ENSP00000308122:A362S	A	-	1	0	0	ATP6V0A4	138084548	138084548	0.985000	0.35326	0.722000	0.30670	0.078000	0.17371	0.936000	0.28938	2.398000	0.81561	0.561000	0.74099	GCC	0.082569		TCGA-3A-A9IX-01A-11D-A40W-08	0.453	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	0	0	1		2	2	2	0		0	0	144		144	138	1	2	-2.633148	1	0.100000	NM_020632			9	10		515	512	0		1	0		0	0	144	0		9.941926e-01	0	0	0	0	1	0	9	515
CSMD1	64478	broad.mit.edu	37	8	3263557	3263557	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr8:3263557C>T	ENST00000520002.1	-	16	2816	c.2261G>A	c.(2260-2262)cGc>cAc	p.R754H	CSMD1_ENST00000537824.1_Missense_Mutation_p.R753H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R754H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R754H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R753H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R754H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R753H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	754	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACCTTCACAGCGGGGCACGGT	0.532																																						ENST00000520002.1	1.000000	0.700000	1.000000	0.980000	0.990000	0.973887	0.990000	1.000000																										0				25						c.(2260-2262)cGc>cAc		CUB and Sushi multiple domains 1							48.0	50.0	49.0					8																	3263557		1996	4177	6173	SO:0001583	missense	64478	2	120896	32				g.chr8:3263557C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2261G>A	chr8.hg19:g.3263557C>T	ENSP00000430733:p.Arg754His	0					CSMD1_ENST00000542608.1_Missense_Mutation_p.R753H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R754H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R753H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R754H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R754H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R753H	p.R754H			1	2	3	2.060781	Q96PZ7	CSMD1_HUMAN		16	2816	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	0	1	hg19	c.2261G>A		1	.	.	.	.	.	.	.	.	.	.	C	31	5.072882	0.93950	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.36	5.36	0.76844	5.360000	5.360000	0.768440	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.72309	0.3444	L	0.42008	1.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.65364	-0.6186	10	0.15066	T	0.55	.	19.0906	0.93225	0.0:1.0:0.0:0.0	.	754;754	E5RIG2;Q96PZ7	.;CSMD1_HUMAN	H	754;754;616;753;753;753	ENSP00000383047:R754H;ENSP00000430733:R754H;ENSP00000441462:R753H;ENSP00000446243:R753H;ENSP00000441675:R753H	ENSP00000320445:R616H	R	-	2	0	0	CSMD1	3250964	3250964	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.287000	0.78681	2.486000	0.83907	0.591000	0.81541	CGC	0.131274		TCGA-3A-A9IX-01A-11D-A40W-08	0.532	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	1	0	1		2	2	2	0		0	0	26		26	25	1	2	-14.306650	1	0.100000	NM_033225			11	11		171	169	0		1			0	0	26	0		9.983973e-01	0	0	0	0	0	0	11	171
FNBP1	23048	broad.mit.edu	37	9	132662311	132662311	+	Silent	SNP	G	G	A	rs138991769	byFrequency	TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr9:132662311G>A	ENST00000446176.2	-	15	1806	c.1620C>T	c.(1618-1620)gaC>gaT	p.D540D	FNBP1_ENST00000420781.1_Silent_p.D531D|FNBP1_ENST00000478129.1_5'UTR|FNBP1_ENST00000443566.2_Silent_p.D168D|FNBP1_ENST00000355681.3_Silent_p.D511D	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	540	Interaction with DNM1 and DNM3.|Interaction with PDE6G. {ECO:0000250}.|Interaction with RND2. {ECO:0000250}.|Required for interaction with TNKS.|Required for self-association and induction of membrane tubulation.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		CAAACTCGTCGTCAAAATCCG	0.507			T	MLL	AML								G|||	15	0.00299521	0.0113	0.0	5008	,	,		15608	0.0		0.0	False		,,,				2504	0.0					ENST00000446176.2	1.000000	0.150000	0.670000	0.240000	0.370000	0.456070	0.370000	0.330000				Dom	yes			Dom	yes		9	9q23	9q23	23048	T	formin binding protein 1 (FBP17)				L	L	MLL		AML		0										c.(1618-1620)gaC>gaT		formin binding protein 1		G		25,4059		0,25,2017	123.0	124.0	124.0		1620	-4.3	0.2	9	dbSNP_134	124	1,8385		0,1,4192	no	coding-synonymous	FNBP1	NM_015033.2		0,26,6209	AA,AG,GG		0.0119,0.6121,0.2085		540/618	132662311	26,12444	2042	4193	6235	SO:0001819	synonymous_variant	23048	90	120952	53				g.chr9:132662311G>A	AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1620C>T	chr9.hg19:g.132662311G>A		0					FNBP1_ENST00000478129.1_5'UTR|FNBP1_ENST00000355681.3_Silent_p.D511D|FNBP1_ENST00000420781.1_Silent_p.D531D|FNBP1_ENST00000443566.2_Silent_p.D168D	p.D540D	NM_015033.2	NP_055848.1	1	2	3	2.009769	Q96RU3	FNBP1_HUMAN		15	1806	-		Ovarian(14;0.000536)	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Silent	SNP	ENST00000446176.2	0	1	hg19	c.1620C>T	CCDS48040.1	0	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	7.682	0.689202	0.14973	0.006121	1.19E-4	ENSG00000187239	ENST00000449089	.	.	.	4.98	-4.27	0.03744	4.980000	-4.270000	0.037440	.	.	.	.	.	T	0.55049	0.1896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61608	-0.7028	4	.	.	.	-27.8124	14.3521	0.66711	0.641:0.0:0.359:0.0	.	.	.	.	M	492	.	.	T	-	2	0	0	FNBP1	131702132	131702132	0.000000	0.05858	0.181000	0.23098	0.939000	0.58152	-1.892000	0.01610	-0.781000	0.04548	-0.390000	0.06520	ACG	0.107586		TCGA-3A-A9IX-01A-11D-A40W-08	0.507	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2	0	0	1		2	2	2	0		0	0	76		76	73	1	2	-1.537296	0	0.100000				6	6		362	351	0		1	0		0	0	76	0		9.618739e-01	5.641922e-01	0	0	0	106	0	6	362
CARD9	64170	broad.mit.edu	37	9	139265516	139265516	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chr9:139265516G>A	ENST00000371732.5	-	4	569	c.404C>T	c.(403-405)gCg>gTg	p.A135V	CARD9_ENST00000371734.3_Missense_Mutation_p.A135V|CARD9_ENST00000315908.7_Missense_Mutation_p.A135V	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	135					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GCTCAGCAGCGCGGTCAGGTC	0.612																																						ENST00000371732.5	1.000000	0.770000	1.000000	0.990000	0.990000	0.983632	0.990000	1.000000																										0				15						c.(403-405)gCg>gTg		caspase recruitment domain family, member 9							44.0	39.0	41.0					9																	139265516		2199	4297	6496	SO:0001583	missense	64170	6	121150	35				g.chr9:139265516G>A	AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.404C>T	chr9.hg19:g.139265516G>A	ENSP00000360797:p.Ala135Val	0					CARD9_ENST00000371734.3_Missense_Mutation_p.A135V|CARD9_ENST00000315908.7_Missense_Mutation_p.A135V	p.A135V	NM_052813.4	NP_434700.2	1	2	3	2.009769	Q9H257	CARD9_HUMAN		4	569	-		Myeloproliferative disorder(178;0.0511)	Q5SXM5|Q5SXM6|Q9H854	Missense_Mutation	SNP	ENST00000371732.5	1	1	hg19	c.404C>T	CCDS6997.1	1	.	.	.	.	.	.	.	.	.	.	G	5.443	0.266829	0.10294	.	.	ENSG00000187796	ENST00000371734;ENST00000371732;ENST00000315908	T;T;T	0.35421	1.31;1.31;1.31	4.72	1.27	0.21489	4.720000	1.270000	0.214890	.	0.911173	0.09365	N	0.812180	T	0.19446	0.0467	N	0.17838	0.53	0.09310	N	1	B;B;B;B	0.20261	0.043;0.003;0.01;0.01	B;B;B;B	0.14578	0.011;0.008;0.002;0.002	T	0.24657	-1.0154	10	0.30078	T	0.28	-20.6527	2.4605	0.04540	0.297:0.0:0.2608:0.4422	.	31;135;135;135	B4DIK5;Q9H257-2;Q5SXM5;Q9H257	.;.;.;CARD9_HUMAN	V	135	ENSP00000360799:A135V;ENSP00000360797:A135V;ENSP00000323719:A135V	ENSP00000323719:A135V	A	-	2	0	0	CARD9	138385337	138385337	0.000000	0.05858	0.178000	0.23040	0.090000	0.18270	0.365000	0.20348	0.393000	0.25203	-0.253000	0.11424	GCG	0.107586		TCGA-3A-A9IX-01A-11D-A40W-08	0.612	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055053.1	0	0	1		2	2	2	0		0	0	60		60	60	1	2	-15.422610	1	0.100000	NM_052813			11	11		147	144	0		1	0		0	0	60	0		9.983553e-01	2.557842e-01	0	0	0	13	0	11	147
WWC3	55841	broad.mit.edu	37	X	10102530	10102530	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chrX:10102530A>G	ENST00000380861.4	+	19	3048	c.2657A>G	c.(2656-2658)aAg>aGg	p.K886R	WWC3_ENST00000454666.1_Missense_Mutation_p.K886R	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	886					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						AGCCTCGTGAAGGAGCGGCCC	0.547																																						ENST00000380861.4	1.000000	0.740000	0.980000	0.840000	0.920000	0.916217	0.920000	0.990000																										0				52						c.(2656-2658)aAg>aGg		WWC family member 3							103.0	108.0	106.0					X																	10102530		2203	4300	6503	SO:0001583	missense	55841	0	0					g.chrX:10102530A>G	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2657A>G	chrX.hg19:g.10102530A>G	ENSP00000370242:p.Lys886Arg						WWC3_ENST00000454666.1_Missense_Mutation_p.K886R	p.K886R	NM_015691.3	NP_056506.2	0	1	1		Q9ULE0	WWC3_HUMAN		19	3048	+			A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	1	1	hg19	c.2657A>G	CCDS14136.1	1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002383	0.74932	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.58060	0.36;0.36	5.71	5.71	0.89125	5.710000	5.710000	0.891250	.	0.089123	0.85682	D	0.000000	T	0.66723	0.2818	M	0.86651	2.83	0.54753	D	0.999982	P	0.47106	0.89	P	0.48304	0.573	T	0.72646	-0.4230	9	.	.	.	-38.9372	15.0307	0.71705	1.0:0.0:0.0:0.0	.	886	Q9ULE0	WWC3_HUMAN	R	886;886;381	ENSP00000370242:K886R;ENSP00000399584:K886R	.	K	+	2	0	0	WWC3	10062530	10062530	1.000000	0.71417	0.957000	0.39632	0.066000	0.16364	8.837000	0.92110	1.932000	0.55993	0.425000	0.28330	AAG	0.100000		TCGA-3A-A9IX-01A-11D-A40W-08	0.547	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	1	0	1		13	2	2	0		0	1	121		121	119	1	2	-20.000000	1	0.100000	NM_015691			46	45		379	372	1		1	1		0	0	121	0		9.999982e-01	9.463763e-01	0	9	0	33	0	46	379
BRWD3	254065	broad.mit.edu	37	X	79971717	79971717	+	Missense_Mutation	SNP	T	T	A	rs146207659		TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chrX:79971717T>A	ENST00000373275.4	-	20	2480	c.2264A>T	c.(2263-2265)gAc>gTc	p.D755V	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	755					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GATTTCTATGTCACCTTTTGC	0.323																																						ENST00000373275.4	0.950000	0.400000	0.830000	0.520000	0.670000	0.682103	0.670000	0.670000																										0				87						c.(2263-2265)gAc>gTc		bromodomain and WD repeat domain containing 3							178.0	152.0	161.0					X																	79971717		2202	4300	6502	SO:0001583	missense	254065	0	0					g.chrX:79971717T>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.2264A>T	chrX.hg19:g.79971717T>A	ENSP00000362372:p.Asp755Val						BRWD3_ENST00000473691.1_5'UTR	p.D755V	NM_153252.4	NP_694984	0	1	1		Q6RI45	BRWD3_HUMAN		20	2480	-			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	1	1	hg19	c.2264A>T	CCDS14447.1	0	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388054	0.82902	.	.	ENSG00000165288	ENST00000373275	T	0.32753	1.44	5.17	5.17	0.71159	5.170000	5.170000	0.711590	.	0.093262	0.64402	D	0.000001	T	0.39384	0.1076	L	0.46614	1.455	0.80722	D	1	P	0.52692	0.955	P	0.52793	0.709	T	0.10405	-1.0631	9	.	.	.	-18.5315	14.1257	0.65219	0.0:0.0:0.0:1.0	.	755	Q6RI45	BRWD3_HUMAN	V	755	ENSP00000362372:D755V	.	D	-	2	0	0	BRWD3	79858373	79858373	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	6.301000	0.72782	1.910000	0.55303	0.441000	0.28932	GAC	0.100000		TCGA-3A-A9IX-01A-11D-A40W-08	0.323	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	1	0	0		2	2	2	0		0	0	51		51	51	1	2	-6.139802	1	0.100000	NM_153252			15	15		202	199	0		1	1		0	0	51	0		9.998770e-01	1.652521e-01	0	2	0	8	0	15	202
BRWD3	254065	broad.mit.edu	37	X	79971738	79971738	+	Missense_Mutation	SNP	T	T	A			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chrX:79971738T>A	ENST00000373275.4	-	20	2459	c.2243A>T	c.(2242-2244)gAa>gTa	p.E748V	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	748					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AGTTCGACATTCTTCCTGTAC	0.299																																						ENST00000373275.4	0.980000	0.440000	0.890000	0.580000	0.730000	0.737319	0.730000	0.750000																										0				87						c.(2242-2244)gAa>gTa		bromodomain and WD repeat domain containing 3							148.0	127.0	134.0					X																	79971738		2202	4298	6500	SO:0001583	missense	254065	0	0					g.chrX:79971738T>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.2243A>T	chrX.hg19:g.79971738T>A	ENSP00000362372:p.Glu748Val						BRWD3_ENST00000473691.1_5'UTR	p.E748V	NM_153252.4	NP_694984	0	1	1		Q6RI45	BRWD3_HUMAN		20	2459	-			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	1	1	hg19	c.2243A>T	CCDS14447.1	0	.	.	.	.	.	.	.	.	.	.	T	15.04	2.715517	0.48622	.	.	ENSG00000165288	ENST00000373275	T	0.32515	1.45	5.17	5.17	0.71159	5.170000	5.170000	0.711590	.	0.046697	0.85682	D	0.000000	T	0.36331	0.0963	M	0.74258	2.255	0.48762	D	0.999702	B	0.27068	0.167	B	0.29598	0.104	T	0.15636	-1.0430	9	.	.	.	-9.7094	14.1257	0.65219	0.0:0.0:0.0:1.0	.	748	Q6RI45	BRWD3_HUMAN	V	748	ENSP00000362372:E748V	.	E	-	2	0	0	BRWD3	79858394	79858394	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.488000	0.60300	1.910000	0.55303	0.441000	0.28932	GAA	0.100000		TCGA-3A-A9IX-01A-11D-A40W-08	0.299	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	1	0	0		2	2	2	0		0	0	48		48	47	1	2	-6.866793	1	0.100000	NM_153252			15	15		178	175	0		1	1		0	0	48	0		9.998788e-01	2.591098e-01	0	5	0	7	0	15	178
CENPI	2491	broad.mit.edu	37	X	100357364	100357364	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9IX-01A-11D-A40W-08	TCGA-3A-A9IX-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c89b7e9-17d2-4c9c-9d18-525ec4ee555e	d2d39866-9aa7-4bd7-875d-cd3f1337f21c	g.chrX:100357364G>T	ENST00000372927.1	+	3	605	c.328G>T	c.(328-330)Gat>Tat	p.D110Y	CENPI_ENST00000423383.1_Missense_Mutation_p.D110Y|CENPI_ENST00000372926.1_Missense_Mutation_p.D110Y|CENPI_ENST00000218507.5_Missense_Mutation_p.D110Y	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	110					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						AGAAGAAATTGATATTCTATT	0.313																																						ENST00000372927.1	0.370000	0.090000	0.290000	0.140000	0.200000	0.220999	0.200000	0.200000																										0				30						c.(328-330)Gat>Tat		centromere protein I							105.0	110.0	109.0					X																	100357364		2203	4299	6502	SO:0001583	missense	2491	0	0					g.chrX:100357364G>T	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.328G>T	chrX.hg19:g.100357364G>T	ENSP00000362018:p.Asp110Tyr						CENPI_ENST00000218507.5_Missense_Mutation_p.D110Y|CENPI_ENST00000372926.1_Missense_Mutation_p.D110Y|CENPI_ENST00000423383.1_Missense_Mutation_p.D110Y	p.D110Y	NM_006733.2	NP_006724.2	0	1	1		Q92674	CENPI_HUMAN		3	605	+			Q5JWZ9|Q96ED0	Missense_Mutation	SNP	ENST00000372927.1	0	1	hg19	c.328G>T	CCDS14479.1	0	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375305	0.42105	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372926;ENST00000372927	.	.	.	5.17	5.17	0.71159	5.170000	5.170000	0.711590	.	0.166479	0.56097	D	0.000022	T	0.72145	0.3424	M	0.73598	2.24	0.41511	D	0.988343	P;P	0.36144	0.539;0.539	P;P	0.48704	0.587;0.587	T	0.74780	-0.3549	9	0.54805	T	0.06	-13.5932	12.7388	0.57239	0.0:0.1604:0.8396:0.0	.	110;110	B4DZL4;Q92674	.;CENPI_HUMAN	Y	110	.	ENSP00000218507:D110Y	D	+	1	0	0	CENPI	100244020	100244020	0.915000	0.31059	1.000000	0.80357	0.481000	0.33189	2.439000	0.44846	2.276000	0.75962	0.538000	0.68166	GAT	0.100000		TCGA-3A-A9IX-01A-11D-A40W-08	0.313	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	0	0	1		2	2	2	0		0	0	77		77	76	1	2	-2.790907	1	0.100000	NM_006733			8	8		388	378	0		1	0		0	0	77	0		9.882635e-01	0	0	0	0	1	0	8	388
