#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ATRNL1	26033	broad.mit.edu	37	10	117221467	117221474	+	Frame_Shift_Del	DEL	TTATCAAT	TTATCAAT	-			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr10:117221467_117221474delTTATCAAT	ENST00000355044.3	+	22	3465_3472	c.3339_3346delTTATCAAT	c.(3337-3348)gattatcaatttfs	p.YQF1114fs	ATRNL1_ENST00000423111.2_Frame_Shift_Del_p.YQF165fs|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1114					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TTTTGATTGATTATCAATTTACCTTCAG	0.322																																						ENST00000355044.3	1.000000	3.900000e-01	0.600000	0.450000	0.510000	0.537446	0.510000	0.510000																										0				95						c.(3337-3348)gattatcaatttfs		attractin-like 1																																				SO:0001589	frameshift_variant	26033	0	0					g.chr10:117221467_117221474delTTATCAAT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3339_3346delTTATCAAT	chr10.hg19:g.117221467_117221474delTTATCAAT	ENSP00000347152:p.Tyr1114fs	0					ATRNL1_ENST00000303745.7_Intron|ATRNL1_ENST00000423111.2_Frame_Shift_Del_p.YQF165fs	p.YQF1114fs	NM_207303.2	NP_997186.1	1	2	3	2.067555	Q5VV63	ATRN1_HUMAN		22	3465_3472	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Frame_Shift_Del	DEL	ENST00000355044.3	1	1	hg19	c.3339_3346delTTATCAAT	CCDS7592.1	0																																																																																								0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.322	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	1	0	1		22			0		0	1	57		57	58	1	1.960000	-20.000000	1	0.560000	XM_049349			49	73		293	324	0		1		0	0	0	57	0		0.999985		0	0	0	0	0	49	293
ABCC6	368	broad.mit.edu	37	16	16284067	16284068	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr16:16284067_16284068insGG	ENST00000205557.7	-	12	1617_1618	c.1588_1589insCC	c.(1588-1590)ctcfs	p.L530fs	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	530	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	AGAGAAGAGGAGGCCGGAGGTC	0.594																																						ENST00000205557.7	1.000000	3.800000e-01	0.550000	0.430000	0.480000	0.506017	0.480000	0.490000																										0				43						c.(1588-1590)ctcfs		ATP-binding cassette, sub-family C (CFTR/MRP), member 6	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)																																			SO:0001589	frameshift_variant	368	0	0					g.chr16:16284067_16284068insGG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1587_1588dupCC	chr16.hg19:g.16284068_16284069dupGG	ENSP00000205557:p.Leu530fs	0					ABCC6_ENST00000574094.1_5'UTR	p.L530fs	NM_001171.5	NP_001162	1	2	3	2.060149	O95255	MRP6_HUMAN		12	1617_1618	-			A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Frame_Shift_Ins	INS	ENST00000205557.7	0	1	hg19	c.1588_1589insCC	CCDS10568.1	0																																																																																								0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.594	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2	1	0	1		2	2		0		0	0	74		74	66	1	1.960000	-20.000000	1	0.560000				67	68		430	424	0		1	0	0	0	0	74	0		1.000000	0	0	0	0	1	0	67	430
SLC6A3	6531	broad.mit.edu	37	5	1432653	1432653	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:1432653delA	ENST00000270349.9	-	4	706	c.579delT	c.(577-579)catfs	p.H193fs	SLC6A3_ENST00000453492.2_Frame_Shift_Del_p.H193fs	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	193					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AGTCACCAGGATGGGCATCCG	0.597																																						ENST00000270349.9	1.000000	4.700000e-01	1.000000	0.530000	0.620000	0.697064	0.620000	0.600000																										0				38						c.(577-579)catfs		solute carrier family 6 (neurotransmitter transporter), member 3	Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)						121.0	106.0	111.0					5																	1432653		2203	4300	6503	SO:0001589	frameshift_variant	6531	0	0					g.chr5:1432653delA		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.579delT	chr5.hg19:g.1432653delA	ENSP00000270349:p.His193fs	1					SLC6A3_ENST00000453492.2_Frame_Shift_Del_p.H193fs	p.H193fs	NM_001044.4	NP_001035.1	1	3	4	2.612569	Q01959	SC6A3_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)	4	706	-			A2RUN4|Q14996	Frame_Shift_Del	DEL	ENST00000270349.9	1	1	hg19	c.579delT	CCDS3863.1	0																																																																																								0.666465		TCGA-3A-A9IZ-01A-12D-A40W-08	0.597	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	1	0	1		2	2		0		0	0	44		44	41	1	1.960000	-20.000000	1	0.560000	NM_001044			62	61		428	423	0		1	0	0	0	0	44	0		1.000000	1.740601e-01	0	0	0	6	0	62	428
SESN1	27244	broad.mit.edu	37	6	109309803	109309828	+	Frame_Shift_Del	DEL	TTCAGGAGTGCAAACAACAGTTTTGA	TTCAGGAGTGCAAACAACAGTTTTGA	-	rs551629218		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr6:109309803_109309828delTTCAGGAGTGCAAACAACAGTTTTGA	ENST00000356644.7	-	9	1404_1429	c.1310_1335delTCAAAACTGTTGTTTGCACTCCTGAA	c.(1309-1335)atcaaaactgttgtttgcactcctgaafs	p.IKTVVCTPE437fs	SESN1_ENST00000302071.2_Frame_Shift_Del_p.IKTVVCTPE371fs|SESN1_ENST00000436639.2_Frame_Shift_Del_p.IKTVVCTPE496fs	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	437					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)		p.E504Q(1)		cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		TGGTAACCTTTTCAGGAGTGCAAACAACAGTTTTGATATAAACTTT	0.341																																						ENST00000356644.7	0.680000	2.700000e-01	0.570000	0.360000	0.450000	0.471471	0.450000	0.450000																										1	Substitution - Missense(1)	p.E504Q(1)	urinary_tract(1)	10						c.(1309-1335)atcaaaactgttgtttgcactcctgaafs		sestrin 1																																				SO:0001589	frameshift_variant	27244	0	0					g.chr6:109309803_109309828delTTCAGGAGTGCAAACAACAGTTTTGA	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.1310_1335delTCAAAACTGTTGTTTGCACTCCTGAA	chr6.hg19:g.109309803_109309828delTTCAGGAGTGCAAACAACAGTTTTGA	ENSP00000349061:p.Ile437fs	1					SESN1_ENST00000436639.2_Frame_Shift_Del_p.IKTVVCTPE496fs|SESN1_ENST00000302071.2_Frame_Shift_Del_p.IKTVVCTPE371fs	p.IKTVVCTPE437fs	NM_001199933.1	NP_001186862.1	0	1	1	1.488837	Q9Y6P5	SESN1_HUMAN		9	1404_1429	-		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Frame_Shift_Del	DEL	ENST00000356644.7	0	1	hg19	c.1310_1335delTCAAAACTGTTGTTTGCACTCCTGAA	CCDS56445.1	0																																																																																								0.391256		TCGA-3A-A9IZ-01A-12D-A40W-08	0.341	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	1	0	1		16	2		0		0	1	28		28	30	1	1.960000	-20.000000	1	0.560000	NM_014454			15	48		69	104	0		1	0	0	0	0	28	0		0.959038	6.656172e-01	0	0	0	12	0	15	69
CUBN	8029	broad.mit.edu	37	10	16882333	16882333	+	Missense_Mutation	SNP	G	G	A	rs150358307	byFrequency	TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr10:16882333G>A	ENST00000377833.4	-	62	10093	c.10028C>T	c.(10027-10029)cCg>cTg	p.P3343L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3343	CUB 25. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTTACCTGCGGTGAGTCCTG	0.423													G|||	5	0.000998403	0.0	0.0	5008	,	,		16306	0.001		0.0	False		,,,				2504	0.0041					ENST00000377833.4	1.000000	7.200000e-01	1.000000	0.810000	0.910000	0.908974	0.910000	1.000000																										0				241						c.(10027-10029)cCg>cTg		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	G	LEU/PRO	0,4406		0,0,2203	94.0	80.0	85.0		10028	0.6	0.1	10	dbSNP_134	85	4,8596	3.7+/-12.6	0,4,4296	yes	missense	CUBN	NM_001081.3	98	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	3343/3624	16882333	4,13002	2203	4300	6503	SO:0001583	missense	8029	37	121412	46				g.chr10:16882333G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10028C>T	chr10.hg19:g.16882333G>A	ENSP00000367064:p.Pro3343Leu	0						p.P3343L	NM_001081.3	NP_001072.2	1	2	3	2.043907	O60494	CUBN_HUMAN		62	10093	-			B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	1	1	hg19	c.10028C>T	CCDS7113.1	1	.	.	.	.	.	.	.	.	.	.	G	6.344	0.431511	0.12045	0.0	4.65E-4	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.17054	2.3	4.74	0.6	0.17524	4.74	0.6	0.17524	CUB (5);	0.659654	0.12465	N	0.466572	T	0.16085	0.0387	M	0.71581	2.175	0.09310	N	0.999999	P	0.46912	0.886	B	0.40410	0.328	T	0.14755	-1.0461	10	0.36615	T	0.2	.	3.4857	0.07618	0.1517:0.1351:0.5736:0.1397	.	3343	O60494	CUBN_HUMAN	L	3343;184	ENSP00000367064:P3343L	ENSP00000367064:P3343L	P	-	2	0	0	CUBN	16922339	16922339	0.602000	0.26916	0.058000	0.19502	0.142000	0.21351	1.757000	0.38400	0.061000	0.16311	0.561000	0.74099	CCG	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.423	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	1	0	1		2	2	2	0		0	0	51		51	50	1	1.960000	-3.971141	1	0.560000	NM_001081			58	56		169	168	1		1			0	0	51	0		1.000000	0	0	0	0	0	0	58	169
ARHGAP19	84986	broad.mit.edu	37	10	99024599	99024599	+	Silent	SNP	A	A	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr10:99024599A>T	ENST00000358531.4	-	3	415	c.387T>A	c.(385-387)atT>atA	p.I129I	ARHGAP19-SLIT1_ENST00000316676.8_Silent_p.I129I|ARHGAP19-SLIT1_ENST00000453547.2_Silent_p.I129I|ARHGAP19_ENST00000355366.5_Silent_p.I120I|ARHGAP19_ENST00000371027.1_Silent_p.I120I|ARHGAP19-SLIT1_ENST00000358308.3_Silent_p.I129I	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	129	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GTAGATACTCAATCAGTTGGT	0.368																																						ENST00000358531.4	1.000000	7.700000e-01	0.990000	0.850000	0.920000	0.924139	0.920000	1.000000																										0				13						c.(385-387)atT>atA		Rho GTPase activating protein 19							97.0	95.0	96.0					10																	99024599		2203	4300	6503	SO:0001819	synonymous_variant	84986	0	0					g.chr10:99024599A>T	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.387T>A	chr10.hg19:g.99024599A>T		1					ARHGAP19-SLIT1_ENST00000358308.3_Silent_p.I129I|ARHGAP19_ENST00000371027.1_Silent_p.I120I|ARHGAP19-SLIT1_ENST00000453547.2_Silent_p.I129I|ARHGAP19_ENST00000355366.5_Silent_p.I120I|ARHGAP19-SLIT1_ENST00000316676.8_Silent_p.I129I	p.I129I	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	0	1	1	1.493332	Q14CB8	RHG19_HUMAN		3	415	-		Colorectal(252;0.0854)	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Silent	SNP	ENST00000358531.4	1	0	hg19	c.387T>A	CCDS7454.2	1																																																																																								0.391256		TCGA-3A-A9IZ-01A-12D-A40W-08	0.368	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	1	0	1		2	2	2	0		0	0	64		64	64	1	1.960000	-20.000000	1	0.560000	NM_032900			68	68		111	109	1		1	0		0	0	64	0		1.000000	0	0	1	0	0	0	68	111
C10orf76	79591	broad.mit.edu	37	10	103792843	103792843	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr10:103792843G>C	ENST00000370033.4	-	4	365	c.246C>G	c.(244-246)ttC>ttG	p.F82L	C10orf76_ENST00000311122.5_Missense_Mutation_p.F82L	NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	82						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TGCAGTGTTGGAATAAGCAAT	0.453																																						ENST00000370033.4	0.140000	3.000000e-02	0.110000	0.050000	0.070000	0.086685	0.070000	0.080000																										0				24						c.(244-246)ttC>ttG		chromosome 10 open reading frame 76							115.0	109.0	111.0					10																	103792843		1924	4139	6063	SO:0001583	missense	79591	0	0					g.chr10:103792843G>C	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.246C>G	chr10.hg19:g.103792843G>C	ENSP00000359050:p.Phe82Leu	1					C10orf76_ENST00000311122.5_Missense_Mutation_p.F82L	p.F82L	NM_024541.2	NP_078817.2	0	1	1	1.493332	Q5T2E6	CJ076_HUMAN		4	365	-		Colorectal(252;0.123)	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	1	1	hg19	c.246C>G	CCDS41563.1	0	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339757	0.60963	.	.	ENSG00000120029	ENST00000370033;ENST00000311122	T;T	0.61274	0.12;2.32	6.15	2.25	0.28309	6.15	2.25	0.28309	.	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	L	0.56124	1.755	0.80722	D	1	P;D	0.71674	0.528;0.998	B;D	0.76071	0.128;0.987	T	0.62765	-0.6785	10	0.45353	T	0.12	-17.9247	8.6237	0.33877	0.5511:0.0:0.4489:0.0	.	82;82	Q5T2E6;Q5T2E7	CJ076_HUMAN;.	L	82	ENSP00000359050:F82L;ENSP00000312408:F82L	ENSP00000312408:F82L	F	-	3	2	2	C10orf76	103782833	103782833	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.090000	0.30902	0.455000	0.26910	-0.366000	0.07423	TTC	0.391256		TCGA-3A-A9IZ-01A-12D-A40W-08	0.453	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	0	0	1		2	2	2	0		0	0	88		88	86	1	1.960000	-3.159045	1	0.560000	NM_024541			10	10		314	309	0		1	1		0	0	88	0		0.996751	1.144774e-01	0	2	0	15	0	10	314
OR51A7	119687	broad.mit.edu	37	11	4928955	4928955	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:4928955C>A	ENST00000359350.4	+	1	356	c.356C>A	c.(355-357)tCt>tAt	p.S119Y	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTAATTATGTCTTTGGACCGC	0.403																																						ENST00000359350.4	1.000000	8.600000e-01	0.990000	0.910000	0.960000	0.958966	0.960000	0.990000																										0				33						c.(355-357)tCt>tAt		olfactory receptor, family 51, subfamily A, member 7							108.0	101.0	103.0					11																	4928955		2201	4298	6499	SO:0001583	missense	119687	0	0					g.chr11:4928955C>A	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.356C>A	chr11.hg19:g.4928955C>A	ENSP00000352305:p.Ser119Tyr	1					MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	p.S119Y	NM_001004749.1	NP_001004749.1	0	1	1	1.475442	Q8NH64	O51A7_HUMAN		1	356	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	1	1	hg19	c.356C>A	CCDS31364.1	1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377814	0.61735	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.81415	-1.49	5.02	5.02	0.67125	5.02	5.02	0.67125	GPCR, rhodopsin-like superfamily (1);	0.145141	0.32328	N	0.006243	D	0.92463	0.7607	H	0.94808	3.585	0.31719	N	0.6385	D	0.89917	1.0	D	0.76575	0.988	D	0.93516	0.6857	10	0.87932	D	0	.	17.069	0.86568	0.0:1.0:0.0:0.0	.	119	Q8NH64	O51A7_HUMAN	Y	119;119;108	ENSP00000352305:S119Y	ENSP00000352305:S119Y	S	+	2	0	0	OR51A7	4885531	4885531	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	5.325000	0.65869	2.596000	0.87737	0.655000	0.94253	TCT	0.388889		TCGA-3A-A9IZ-01A-12D-A40W-08	0.403	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	0	0	1		2	2	2	0		0	0	139		139	138	1	1.960000	-20.000000	1	0.560000	NM_001004749			141	141		211	209	1		1			0	0	139	0		1.000000	0	0	0	0	0	0	141	211
KCNA4	3739	broad.mit.edu	37	11	30032887	30032887	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:30032887G>A	ENST00000328224.6	-	2	2572	c.1339C>T	c.(1339-1341)Cgt>Tgt	p.R447C	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	447					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CGGACCAGACGAATGATTCTG	0.587																																						ENST00000328224.6	0.210000	6.000000e-02	0.170000	0.090000	0.120000	0.136109	0.120000	0.130000																										0				78						c.(1339-1341)Cgt>Tgt		potassium voltage-gated channel, shaker-related subfamily, member 4	Dalfampridine(DB06637)						68.0	66.0	67.0					11																	30032887		2055	4222	6277	SO:0001583	missense	3739	0	0					g.chr11:30032887G>A	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1339C>T	chr11.hg19:g.30032887G>A	ENSP00000328511:p.Arg447Cys	1					KCNA4_ENST00000526518.1_5'Flank	p.R447C	NM_002233.3	NP_002224.1	0	1	1	1.475442	P22459	KCNA4_HUMAN		2	2572	-				Missense_Mutation	SNP	ENST00000328224.6	1	1	hg19	c.1339C>T	CCDS41629.1	0	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745893	0.69418	.	.	ENSG00000182255	ENST00000328224	D	0.99259	-5.64	5.32	5.32	0.75619	5.32	5.32	0.75619	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.99897	4.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96415	0.9307	10	0.87932	D	0	.	19.003	0.92841	0.0:0.0:1.0:0.0	.	447	P22459	KCNA4_HUMAN	C	447	ENSP00000328511:R447C	ENSP00000328511:R447C	R	-	1	0	0	KCNA4	29989463	29989463	1.000000	0.71417	0.889000	0.34880	0.979000	0.70002	9.869000	0.99810	2.491000	0.84063	0.650000	0.86243	CGT	0.388889		TCGA-3A-A9IZ-01A-12D-A40W-08	0.587	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	1	0	1		2	2	2	0		0	0	72		72	71	1	1.960000	-3.333451	1	0.560000	NM_002233			12	12		230	228	0		1			0	0	72	0		0.999142	0	0	0	0	0	0	12	230
OR9Q2	219957	broad.mit.edu	37	11	57958767	57958767	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:57958767G>A	ENST00000311591.3	+	1	862	c.805G>A	c.(805-807)Gag>Aag	p.E269K		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E269K(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				CCAGTCCTCCGAGGGAGACCG	0.552																																						ENST00000311591.3	0.940000	6.200000e-01	0.860000	0.690000	0.770000	0.780191	0.770000	0.780000																										1	Substitution - Missense(1)	p.E269K(1)	large_intestine(1)	41						c.(805-807)Gag>Aag		olfactory receptor, family 9, subfamily Q, member 2							101.0	93.0	96.0					11																	57958767		2201	4296	6497	SO:0001583	missense	219957	0	0					g.chr11:57958767G>A	AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.805G>A	chr11.hg19:g.57958767G>A	ENSP00000308714:p.Glu269Lys	0						p.E269K	NM_001005283.2	NP_001005283.1	1	2	3	2.032037	Q8NGE9	OR9Q2_HUMAN		1	862	+		Breast(21;0.0589)		Missense_Mutation	SNP	ENST00000311591.3	1	1	hg19	c.805G>A	CCDS31544.1	0	.	.	.	.	.	.	.	.	.	.	G	9.517	1.107203	0.20714	.	.	ENSG00000186513	ENST00000311591	T	0.00099	8.73	5.09	2.85	0.33270	5.09	2.85	0.33270	GPCR, rhodopsin-like superfamily (1);	0.463064	0.18027	N	0.154059	T	0.00109	0.0003	N	0.25825	0.765	0.09310	N	1	B	0.27932	0.194	B	0.22601	0.04	T	0.21042	-1.0257	10	0.59425	D	0.04	-9.1453	9.2658	0.37641	0.0947:0.1872:0.7181:0.0	.	269	Q8NGE9	OR9Q2_HUMAN	K	269	ENSP00000308714:E269K	ENSP00000308714:E269K	E	+	1	0	0	OR9Q2	57715343	57715343	0.006000	0.16342	0.072000	0.20136	0.347000	0.29111	1.109000	0.31135	1.338000	0.45544	0.655000	0.94253	GAG	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.552	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	1	0	1		2	2	2	0		0	0	75		75	73	1	1.960000	-3.544887	1	0.560000	NM_001005283			80	81		289	286	1		1			0	0	75	0		1.000000	0	0	0	0	0	0	80	289
ZNF215	7762	broad.mit.edu	37	11	6953847	6953847	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:6953847A>G	ENST00000278319.5	+	3	932	c.344A>G	c.(343-345)aAc>aGc	p.N115S	ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000529903.1_Missense_Mutation_p.N115S|ZNF215_ENST00000414517.2_Missense_Mutation_p.N115S	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	115	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CATCCAAACAACAGTAAAGAT	0.378																																						ENST00000278319.5	0.570000	2.900000e-01	0.500000	0.350000	0.420000	0.432058	0.420000	0.420000																										0				32						c.(343-345)aAc>aGc		zinc finger protein 215							59.0	63.0	61.0					11																	6953847		2201	4296	6497	SO:0001583	missense	7762	1	121412	33				g.chr11:6953847A>G	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.344A>G	chr11.hg19:g.6953847A>G	ENSP00000278319:p.Asn115Ser	1					ZNF215_ENST00000414517.2_Missense_Mutation_p.N115S|ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000529903.1_Missense_Mutation_p.N115S	p.N115S	NM_013250.2	NP_037382.2	0	1	1	1.475442	Q9UL58	ZN215_HUMAN		3	932	+			Q96C84	Missense_Mutation	SNP	ENST00000278319.5	1	1	hg19	c.344A>G	CCDS7775.1	0	.	.	.	.	.	.	.	.	.	.	A	6.216	0.407981	0.11754	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.04015	3.73;3.73;3.73	4.14	0.197	0.15164	4.14	0.197	0.15164	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.168848	0.28166	N	0.016350	T	0.02342	0.0072	N	0.13352	0.335	0.22903	N	0.998588	B;B;B	0.32409	0.248;0.37;0.181	B;B;B	0.35770	0.112;0.21;0.074	T	0.44682	-0.9312	10	0.05959	T	0.93	-7.9422	6.3872	0.21568	0.6446:0.0:0.3554:0.0	.	115;115;115	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	S	115	ENSP00000278319:N115S;ENSP00000393202:N115S;ENSP00000432306:N115S	ENSP00000278319:N115S	N	+	2	0	0	ZNF215	6910423	6910423	0.062000	0.20869	0.987000	0.45799	0.144000	0.21451	-0.089000	0.11180	0.022000	0.15160	0.533000	0.62120	AAC	0.388889		TCGA-3A-A9IZ-01A-12D-A40W-08	0.378	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1	1	0	1		2	2	2	0		0	0	47		47	45	1	1.960000	-20.000000	1	0.560000				28	28		141	139	1		1	0		0	0	47	0		1.000000	0	0	1	0	0	0	28	141
OR1S2	219958	broad.mit.edu	37	11	57970714	57970714	+	Silent	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:57970714G>A	ENST00000302592.6	-	1	939	c.940C>T	c.(940-942)Ctg>Ttg	p.L314L		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				AGCTTTCTCAGGGCACCTTTC	0.418																																						ENST00000302592.6	0.080000	0	0.060000	0.020000	0.030000	0.043963	0.030000	0.040000																										0				46						c.(940-942)Ctg>Ttg		olfactory receptor, family 1, subfamily S, member 2							135.0	137.0	136.0					11																	57970714		2201	4294	6495	SO:0001819	synonymous_variant	219958	0	0					g.chr11:57970714G>A	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.940C>T	chr11.hg19:g.57970714G>A		0						p.L314L	NM_001004459.1	NP_001004459.1	1	2	3	2.032037	Q8NGQ3	OR1S2_HUMAN		1	939	-		Breast(21;0.0589)	Q6IFG5|Q96R85	Silent	SNP	ENST00000302592.6	0	1	hg19	c.940C>T	CCDS31545.1	0																																																																																								0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.418	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	0	0	1		2	2	2	0		0	0	144		144	147	1	1.960000	-2.101409	0	0.560000	NM_001004459			7	7		642	601	0		1			0	0	144	0		0.975668	0	0	0	0	0	0	7	642
PLEKHB1	58473	broad.mit.edu	37	11	73364058	73364058	+	Splice_Site	SNP	C	C	G	rs376023362		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:73364058C>G	ENST00000354190.5	+	5	820	c.389C>G	c.(388-390)cCg>cGg	p.P130R	PLEKHB1_ENST00000398492.4_Splice_Site_p.P130R|PLEKHB1_ENST00000543085.1_Splice_Site_p.P60R|PLEKHB1_ENST00000535129.1_Splice_Site_p.P111R|PLEKHB1_ENST00000398494.4_Splice_Site_p.P111R|PLEKHB1_ENST00000227214.6_Splice_Site_p.P111R	NM_021200.2	NP_067023.1	Q9UF11	PKHB1_HUMAN	pleckstrin homology domain containing, family B (evectins) member 1	130					multicellular organismal development (GO:0007275)|phototransduction (GO:0007602)|regulation of cell differentiation (GO:0045595)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	7						AACTCCACCCCGGTGAGTCTC	0.582																																						ENST00000354190.5	0.540000	1.500000e-01	0.410000	0.220000	0.300000	0.322510	0.300000	0.300000																										0				7						c.(388-390)cCg>cGg		pleckstrin homology domain containing, family B (evectins) member 1							73.0	87.0	83.0					11																	73364058		1944	4134	6078	SO:0001630	splice_region_variant	58473	0	0					g.chr11:73364058C>G	AF081583	CCDS44672.1, CCDS44673.1, CCDS44674.1, CCDS44675.1	11q13.5-q14.1	2013-01-10	2002-11-04	2002-11-08	ENSG00000021300	ENSG00000021300		"""Pleckstrin homology (PH) domain containing"""	19079	protein-coding gene	gene with protein product		607651	"""PH domain containing, retinal 1"""	PHRET1		10585447	Standard	NM_021200		Approved	PHR1, KPL1	uc001ouc.3	Q9UF11	OTTHUMG00000168030	ENST00000354190.5:c.390+1C>G	chr11.hg19:g.73364058C>G		1					PLEKHB1_ENST00000398494.4_Splice_Site_p.P111R|PLEKHB1_ENST00000227214.6_Splice_Site_p.P111R|PLEKHB1_ENST00000535129.1_Splice_Site_p.P111R|PLEKHB1_ENST00000398492.4_Splice_Site_p.P130R|PLEKHB1_ENST00000543085.1_Splice_Site_p.P60R	p.P130R	NM_021200.2	NP_067023.1	1	2	3	2.567761	Q9UF11	PKHB1_HUMAN		5	820	+			A8K0Q5|B2RBP1|B7Z716|Q9UBF5|Q9UI37|Q9UI44	Splice_Site	SNP	ENST00000354190.5	0	1	hg19	c.389C>G	CCDS44672.1	0	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668309	0.29604	.	.	ENSG00000021300	ENST00000354190;ENST00000398492;ENST00000227214;ENST00000398494;ENST00000543085;ENST00000539157;ENST00000546251;ENST00000535582;ENST00000538227;ENST00000539549;ENST00000542185;ENST00000543524;ENST00000541597;ENST00000535129;ENST00000542389;ENST00000540431	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58	4.53	3.62	0.41486	4.53	3.62	0.41486	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.176334	0.50627	D	0.000115	T	0.41236	0.1150	L	0.38175	1.15	0.39250	D	0.964026	D;D;D;P	0.89917	0.975;1.0;1.0;0.954	D;D;D;P	0.91635	0.943;0.999;0.999;0.819	T	0.35325	-0.9793	10	0.54805	T	0.06	-18.4952	8.962	0.35854	0.0:0.901:0.0:0.099	.	111;134;130;130	F5GXN2;Q59EU5;Q9UF11-2;Q9UF11	.;.;.;PKHB1_HUMAN	R	130;130;111;111;60;118;111;111;111;111;111;111;111;111;111;118	ENSP00000346127:P130R;ENSP00000381505:P130R;ENSP00000227214:P111R;ENSP00000381507:P111R;ENSP00000441224:P60R;ENSP00000445990:P118R;ENSP00000439714:P111R;ENSP00000438809:P111R;ENSP00000445807:P111R;ENSP00000444453:P111R;ENSP00000442136:P111R;ENSP00000442616:P111R;ENSP00000440102:P111R;ENSP00000441558:P118R	ENSP00000227214:P111R	P	+	2	0	0	PLEKHB1	73041706	73041706	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	1.837000	0.39201	1.517000	0.48917	-0.133000	0.14855	CCG	0.654739		TCGA-3A-A9IZ-01A-12D-A40W-08	0.582	PLEKHB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397593.1	0	0	1		2	2	2	0		0	0	21		21	21	1	1.960000	-3.021303	1	0.560000		Missense_Mutation		10	10		146	140	0		1	1		0	0	21	0		0.996554	4.913512e-01	0	3	0	21	0	10	146
PANX1	24145	broad.mit.edu	37	11	93911725	93911725	+	Missense_Mutation	SNP	C	C	T	rs543769570		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr11:93911725C>T	ENST00000227638.3	+	3	897	c.512C>T	c.(511-513)tCa>tTa	p.S171L	PANX1_ENST00000436171.2_Missense_Mutation_p.S171L	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	171					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	GGAGCCTGCTCAGTTCCAGGT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		20536	0.0		0.0	False		,,,				2504	0.001					ENST00000227638.3	1.000000	8.500000e-01	1.000000	0.940000	0.990000	0.981167	0.990000	1.000000																										0				20						c.(511-513)tCa>tTa		pannexin 1	Probenecid(DB01032)						74.0	65.0	68.0					11																	93911725		2201	4298	6499	SO:0001583	missense	24145	12	121412	42				g.chr11:93911725C>T	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.512C>T	chr11.hg19:g.93911725C>T	ENSP00000227638:p.Ser171Leu	1					PANX1_ENST00000436171.2_Missense_Mutation_p.S171L	p.S171L	NM_015368.3	NP_056183.2	1	2	3	2.567761	Q96RD7	PANX1_HUMAN		3	897	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	1	1	hg19	c.512C>T	CCDS8296.1	1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.789449	0.31685	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.26957	1.7;1.7	5.05	5.05	0.67936	5.05	5.05	0.67936	.	0.838115	0.11120	N	0.597512	T	0.21427	0.0516	N	0.25647	0.755	0.09310	N	1	B;B	0.20164	0.042;0.034	B;B	0.25506	0.061;0.036	T	0.14035	-1.0487	10	0.25106	T	0.35	-1.3263	13.7438	0.62863	0.0:0.9231:0.0:0.0769	.	171;171	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	L	171	ENSP00000227638:S171L;ENSP00000411461:S171L	ENSP00000227638:S171L	S	+	2	0	0	PANX1	93551373	93551373	0.002000	0.14202	0.154000	0.22540	0.125000	0.20455	1.502000	0.35704	2.342000	0.79632	0.563000	0.77884	TCA	0.654739		TCGA-3A-A9IZ-01A-12D-A40W-08	0.483	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	1	0	1		2	2	2	0		0	0	62		62	62	1	1.960000	-4.285428	1	0.560000	NM_015368			87	85		292	288	1		1	1		0	0	62	0		1.000000	9.998076e-01	0	5	0	40	0	87	292
PRMT8	56341	broad.mit.edu	37	12	3649855	3649855	+	Silent	SNP	C	C	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr12:3649855C>A	ENST00000382622.3	+	2	549	c.159C>A	c.(157-159)ccC>ccA	p.P53P	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Silent_p.P44P	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	53					histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CCACTCAACCCAGCTGCCCAG	0.602																																						ENST00000382622.3	1.000000	9.000000e-01	1.000000	0.960000	0.990000	0.987565	0.990000	1.000000																										0				37						c.(157-159)ccC>ccA		protein arginine methyltransferase 8							186.0	190.0	189.0					12																	3649855		2203	4300	6503	SO:0001819	synonymous_variant	56341	0	0					g.chr12:3649855C>A	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.159C>A	chr12.hg19:g.3649855C>A		0					PRMT8_ENST00000452611.2_Silent_p.P44P|PRMT8_ENST00000261252.4_3'UTR	p.P53P	NM_019854.4	NP_062828.3	1	2	3	2.122144	Q9NR22	ANM8_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)	2	549	+			B2RDP0|Q8TBJ8	Silent	SNP	ENST00000382622.3	1	1	hg19	c.159C>A	CCDS8521.2	1																																																																																								0.570815		TCGA-3A-A9IZ-01A-12D-A40W-08	0.602	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	1	0	1		2	2	2	0		0	0	157		157	152	1	1.960000	-11.201150	1	0.560000	NM_019854			251	249		651	638	1		1			0	0	157	0		1.000000	0	0	0	0	0	0	251	651
EPS8	2059	broad.mit.edu	37	12	15807213	15807213	+	Silent	SNP	T	T	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr12:15807213T>G	ENST00000281172.5	-	13	1552	c.1116A>C	c.(1114-1116)acA>acC	p.T372T	EPS8_ENST00000540613.1_Silent_p.T112T|EPS8_ENST00000543523.1_Silent_p.T372T|EPS8_ENST00000542903.1_Silent_p.T112T|EPS8_ENST00000543612.1_Silent_p.T372T	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	372					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CAGGACCTCCTGTTGCCTGCA	0.373																																						ENST00000281172.5	0.310000	1.200000e-01	0.260000	0.160000	0.200000	0.217894	0.200000	0.210000																										0				33						c.(1114-1116)acA>acC		epidermal growth factor receptor pathway substrate 8							84.0	76.0	78.0					12																	15807213		2203	4300	6503	SO:0001819	synonymous_variant	2059	0	0					g.chr12:15807213T>G	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1116A>C	chr12.hg19:g.15807213T>G		0					EPS8_ENST00000543612.1_Silent_p.T372T|EPS8_ENST00000540613.1_Silent_p.T112T|EPS8_ENST00000542903.1_Silent_p.T112T|EPS8_ENST00000543523.1_Silent_p.T372T	p.T372T	NM_004447.5	NP_004438.3	0	0	0	2.023893	Q12929	EPS8_HUMAN		13	1552	-		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Silent	SNP	ENST00000281172.5	1	1	hg19	c.1116A>C	CCDS31753.1	0																																																																																								0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.373	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1	1	0	1		2	2	2	0		0	0	79		79	77	1	1.960000	-19.994040	1	0.560000				19	19		306	302	0		1	1		0	0	79	0		0.999991	9.825060e-01	0	7	0	101	0	19	306
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	7.500000e-01	1.000000	0.850000	0.960000	0.939583	0.960000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.023893	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	59		59	57	1	1.960000	-20.000000	1	0.560000	NM_033360			56	54		151	150	1		1	1	1	0	0	59	274		1.000000	9.980812e-01	1	19	74	10	273	56	151
CEP83	51134	broad.mit.edu	37	12	94761622	94761622	+	Missense_Mutation	SNP	G	G	A	rs111647062	byFrequency	TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr12:94761622G>A	ENST00000397809.5	-	11	1840	c.1291C>T	c.(1291-1293)Cgg>Tgg	p.R431W	CCDC41_ENST00000549352.1_5'Flank|CCDC41_ENST00000339839.5_Missense_Mutation_p.R431W|CCDC41_ENST00000397807.2_Missense_Mutation_p.R398W	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		423					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						TGTGAAGCCCGCAATTTCTCT	0.373													G|||	3	0.000599042	0.0008	0.0	5008	,	,		17571	0.0		0.002	False		,,,				2504	0.0					ENST00000397809.5	0.050000	0	0.040000	0.010000	0.020000	0.027161	0.020000	0.020000																										0				27						c.(1291-1293)Cgg>Tgg				G	TRP/ARG,TRP/ARG	1,3709		0,1,1854	149.0	137.0	141.0		1291,1291	4.9	1.0	12	dbSNP_132	141	2,8212		0,2,4105	yes	missense,missense	CCDC41	NM_001042399.1,NM_016122.2	101,101	0,3,5959	AA,AG,GG		0.0243,0.027,0.0252	probably-damaging,probably-damaging	431/702,431/702	94761622	3,11921	1855	4107	5962	SO:0001583	missense	0	50	120824	52				g.chr12:94761622G>A																												ENST00000397809.5:c.1291C>T	chr12.hg19:g.94761622G>A	ENSP00000380911:p.Arg431Trp	1					CCDC41_ENST00000549352.1_5'Flank|CCDC41_ENST00000397807.2_Missense_Mutation_p.R398W|CCDC41_ENST00000339839.5_Missense_Mutation_p.R431W	p.R431W	NM_016122.2	NP_057206.2	0	1	1	2.002778	Q9Y592	CEP83_HUMAN		11	1840	-			A4FVB1|Q08AP1	Missense_Mutation	SNP	ENST00000397809.5	0	1	hg19	c.1291C>T	CCDS41820.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.11	2.438221	0.43326	2.7E-4	2.43E-4	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807	T;T;T	0.53857	1.94;1.94;0.6	5.83	4.94	0.65067	5.83	4.94	0.65067	.	.	.	.	.	T	0.56761	0.2007	L	0.56769	1.78	0.36865	D	0.888618	D;D	0.76494	0.999;0.993	P;P	0.50896	0.653;0.534	T	0.67515	-0.5651	9	0.87932	D	0	-8.5225	10.5268	0.44954	0.0683:0.0:0.7969:0.1348	.	398;423	Q9Y592-2;Q9Y592	.;CCD41_HUMAN	W	431;431;398	ENSP00000344655:R431W;ENSP00000380911:R431W;ENSP00000380909:R398W	ENSP00000344655:R431W	R	-	1	2	2	CCDC41	93285753	93285753	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	6.105000	0.71505	1.461000	0.47929	-0.181000	0.13052	CGG	0.388889		TCGA-3A-A9IZ-01A-12D-A40W-08	0.373	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3	0	0	1		2	2	2	0		0	0	157		157	152	1	1.960000	-1.808643	0	0.560000				6	4		653	645	0		1	0		0	0	157	0		0.963397	7.719552e-03	0	0	0	12	0	6	653
WSB2	55884	broad.mit.edu	37	12	118481162	118481162	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr12:118481162G>C	ENST00000315436.3	-	3	344	c.203C>G	c.(202-204)gCc>gGc	p.A68G	WSB2_ENST00000544233.1_Intron|WSB2_ENST00000535496.1_Missense_Mutation_p.A70G|WSB2_ENST00000542304.1_5'UTR|WSB2_ENST00000441406.2_Missense_Mutation_p.A85G|WSB2_ENST00000536738.1_5'UTR	NM_001278557.1|NM_018639.3	NP_001265486.1|NP_061109.1	Q9NYS7	WSB2_HUMAN	WD repeat and SOCS box containing 2	68					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCGGCTTTTGGCTTCAAACCC	0.493																																						ENST00000315436.3	0.120000	4.000000e-02	0.100000	0.050000	0.070000	0.083712	0.070000	0.080000																										0				17						c.(202-204)gCc>gGc		WD repeat and SOCS box containing 2							121.0	128.0	126.0					12																	118481162		2203	4300	6503	SO:0001583	missense	55884	0	0					g.chr12:118481162G>C	AF038187	CCDS9186.1, CCDS61251.1, CCDS61252.1	12q24.23	2013-01-09	2011-01-25		ENSG00000176871	ENSG00000176871		"""WD repeat domain containing"""	19222	protein-coding gene	gene with protein product			"""WD repeat and SOCS box-containing 2"""			12076535	Standard	NM_018639		Approved	SBA2, MGC10210	uc001twr.2	Q9NYS7	OTTHUMG00000168885	ENST00000315436.3:c.203C>G	chr12.hg19:g.118481162G>C	ENSP00000319474:p.Ala68Gly	1					WSB2_ENST00000536738.1_5'UTR|WSB2_ENST00000441406.2_Missense_Mutation_p.A85G|WSB2_ENST00000535496.1_Missense_Mutation_p.A70G|WSB2_ENST00000542304.1_5'UTR|WSB2_ENST00000544233.1_Intron	p.A68G	NM_001278557.1|NM_018639.3	NP_001265486.1|NP_061109.1	0	1	1	2.002778	Q9NYS7	WSB2_HUMAN		3	344	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		B4DIE6|B4DPV6|Q9NRX9	Missense_Mutation	SNP	ENST00000315436.3	1	1	hg19	c.203C>G	CCDS9186.1	0	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813241	0.32053	.	.	ENSG00000176871	ENST00000315436;ENST00000441406;ENST00000535496;ENST00000537945	T;T;T;T	0.61510	0.33;0.35;0.37;0.1	5.24	5.24	0.73138	5.24	5.24	0.73138	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.647108	0.14669	N	0.305457	T	0.39145	0.1067	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16247	-1.0409	10	0.02654	T	1	-15.2412	14.0586	0.64786	0.0:0.152:0.848:0.0	.	68	Q9NYS7	WSB2_HUMAN	G	68;85;70;70	ENSP00000319474:A68G;ENSP00000409131:A85G;ENSP00000439450:A70G;ENSP00000440386:A70G	ENSP00000319474:A68G	A	-	2	0	0	WSB2	116965545	116965545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.925000	0.56484	2.731000	0.93534	0.650000	0.86243	GCC	0.388889		TCGA-3A-A9IZ-01A-12D-A40W-08	0.493	WSB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401515.1	0	0	1		2	2	2	0		0	0	108		108	104	1	1.960000	-3.257625	1	0.560000	NM_018639			18	18		562	555	0		1	1		0	0	108	0		0.999980	8.188137e-01	0	5	0	95	0	18	562
SLC15A1	6564	broad.mit.edu	37	13	99339977	99339977	+	Splice_Site	SNP	T	T	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr13:99339977T>C	ENST00000376503.5	-	21	1740	c.1685A>G	c.(1684-1686)aAt>aGt	p.N562S		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	562					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GCAGCTGTCATTCTGCAGCAG	0.408																																						ENST00000376503.5	1.000000	7.900000e-01	0.990000	0.860000	0.920000	0.925466	0.920000	1.000000																										0				30						c.(1684-1686)aAt>aGt		solute carrier family 15 (oligopeptide transporter), member 1	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)						85.0	78.0	80.0					13																	99339977		2203	4300	6503	SO:0001630	splice_region_variant	6564	0	0					g.chr13:99339977T>C	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1684-1A>G	chr13.hg19:g.99339977T>C		1						p.N562S	NM_005073.3	NP_005064.1	0	1	1	1.506971	P46059	S15A1_HUMAN		21	1740	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		Q5VW82	Splice_Site	SNP	ENST00000376503.5	1	0	hg19	c.1685A>G	CCDS9489.1	1	.	.	.	.	.	.	.	.	.	.	T	0.258	-1.001780	0.02128	.	.	ENSG00000088386	ENST00000376503	T	0.01998	4.51	5.45	-5.68	0.02436	5.45	-5.68	0.02436	Major facilitator superfamily domain, general substrate transporter (1);	1.941670	0.01609	N	0.022434	T	0.00936	0.0031	N	0.02120	-0.675	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45205	-0.9277	10	0.02654	T	1	-29.6666	8.1832	0.31324	0.0:0.3927:0.3876:0.2197	.	562	P46059	S15A1_HUMAN	S	562	ENSP00000365686:N562S	ENSP00000365686:N562S	N	-	2	0	0	SLC15A1	98137978	98137978	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.980000	0.03770	-1.882000	0.01122	-0.460000	0.05396	AAT	0.391256		TCGA-3A-A9IZ-01A-12D-A40W-08	0.408	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	1	0	1		2	2	2	0		0	0	79		79	78	1	1.960000	-20.000000	1	0.560000	NM_005073	Missense_Mutation		85	84		142	139	1		1	1		0	0	79	0		1.000000	7.207349e-01	0	5	0	1	0	85	142
PSMB11	122706	broad.mit.edu	37	14	23511502	23511502	+	Missense_Mutation	SNP	G	G	C	rs201995713		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr14:23511502G>C	ENST00000408907.2	+	1	127	c.68G>C	c.(67-69)cGg>cCg	p.R23P		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	23					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		CACCTGCCTCGGGCTGGCGGC	0.637																																						ENST00000408907.2	0.120000	2.000000e-02	0.090000	0.040000	0.060000	0.069305	0.060000	0.060000																										0				7						c.(67-69)cGg>cCg		proteasome (prosome, macropain) subunit, beta type, 11							67.0	79.0	75.0					14																	23511502		2088	4215	6303	SO:0001583	missense	122706	0	0					g.chr14:23511502G>C		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.68G>C	chr14.hg19:g.23511502G>C	ENSP00000386212:p.Arg23Pro	0						p.R23P	NM_001099780.1	NP_001093250.1	1	2	3	2.030033	A5LHX3	PSB11_HUMAN		1	127	+	all_cancers(95;3.3e-05)			Missense_Mutation	SNP	ENST00000408907.2	0	1	hg19	c.68G>C	CCDS41923.1	0	.	.	.	.	.	.	.	.	.	.	G	1.987	-0.432710	0.04669	.	.	ENSG00000222028	ENST00000408907	T	0.27890	1.64	5.53	-11.1	0.00147	5.53	-11.1	0.00147	.	1.913640	0.03285	N	0.186696	T	0.12774	0.0310	N	0.12961	0.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08617	-1.0713	10	0.27082	T	0.32	-1.412	4.21	0.10507	0.2548:0.2667:0.3906:0.088	.	23	A5LHX3	PSB11_HUMAN	P	23	ENSP00000386212:R23P	ENSP00000386212:R23P	R	+	2	0	0	PSMB11	22581342	22581342	0.000000	0.05858	0.000000	0.03702	0.230000	0.25150	-2.830000	0.00744	-2.417000	0.00567	-1.044000	0.02363	CGG	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.637	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408294.1	0	0	1		2	2	2	0		0	0	91		91	88	1	1.960000	-2.268914	0	0.560000	NM_001099780			9	9		505	491	0		1			0	0	91	0		0.993532	0	0	0	0	0	0	9	505
RCOR1	23186	broad.mit.edu	37	14	103180896	103180896	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr14:103180896C>T	ENST00000570597.1	+	8	986	c.986C>T	c.(985-987)aCt>aTt	p.T329I	RCOR1_ENST00000262241.6_Missense_Mutation_p.T332I			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	329	Interaction with KDM1A.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						GCCAATGCCACTGCTGCTACC	0.413																																						ENST00000570597.1	0.150000	2.000000e-02	0.110000	0.040000	0.060000	0.077685	0.060000	0.070000																										0				12						c.(985-987)aCt>aTt		REST corepressor 1							104.0	93.0	97.0					14																	103180896		2203	4300	6503	SO:0001583	missense	23186	0	0					g.chr14:103180896C>T	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.986C>T	chr14.hg19:g.103180896C>T	ENSP00000459789:p.Thr329Ile	0					RCOR1_ENST00000262241.6_Missense_Mutation_p.T332I	p.T329I			1	2	3	2.030033	Q9UKL0	RCOR1_HUMAN		8	986	+			Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	0	1	hg19	c.986C>T		0	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412066	0.62511	.	.	ENSG00000089902	ENST00000262241	.	.	.	6.07	5.16	0.70880	6.07	5.16	0.70880	.	0.206697	0.50627	D	0.000108	T	0.35998	0.0951	N	0.22421	0.69	0.51233	D	0.999914	P	0.40032	0.699	B	0.33620	0.167	T	0.26155	-1.0111	9	0.46703	T	0.11	-16.8936	12.052	0.53511	0.1363:0.7327:0.131:0.0	.	329	Q9UKL0	RCOR1_HUMAN	I	329	.	ENSP00000262241:T329I	T	+	2	0	0	RCOR1	102250649	102250649	0.999000	0.42202	0.981000	0.43875	0.985000	0.73830	4.443000	0.59994	1.516000	0.48900	0.655000	0.94253	ACT	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.413	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	0		2	2	2	0		0	0	63		63	61	1	1.960000	-6.541969	1	0.560000	NM_015156			6	5		314	311	0		1	0		0	0	63	0		0.963978	1.797436e-01	0	0	0	35	0	6	314
FBN1	2200	broad.mit.edu	37	15	48766481	48766481	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			C	G	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr15:48766481C>G	ENST00000316623.5	-	34	4636	c.4181G>C	c.(4180-4182)gGa>gCa	p.G1394A		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1394	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		Missing (in MFS). {ECO:0000269|PubMed:14695540}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACCTGTGTATCCTTCCTTGCA	0.473																																						ENST00000316623.5	1.000000	9.500000e-01	1.000000	0.990000	0.990000	0.997664	0.990000	1.000000																										0				139						c.(4180-4182)gGa>gCa		fibrillin 1							145.0	117.0	126.0					15																	48766481		2198	4296	6494	SO:0001583	missense	2200	0	0					g.chr15:48766481C>G	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4181G>C	chr15.hg19:g.48766481C>G	ENSP00000325527:p.Gly1394Ala	0						p.G1394A	NM_000138.4	NP_000129	0	1	1	2.015215	P35555	FBN1_HUMAN		34	4636	-		all_lung(180;0.00279)	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	1	1	hg19	c.4181G>C	CCDS32232.1	1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049649	0.55218	.	.	ENSG00000166147	ENST00000316623;ENST00000544030	D	0.92595	-3.07	5.29	5.29	0.74685	5.29	5.29	0.74685	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.097281	0.64402	D	0.000001	D	0.97636	0.9225	H	0.96604	3.85	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.98621	1.0667	10	0.87932	D	0	.	18.7133	0.91666	0.0:1.0:0.0:0.0	.	1394	P35555	FBN1_HUMAN	A	1394;284	ENSP00000325527:G1394A	ENSP00000325527:G1394A	G	-	2	0	0	FBN1	46553773	46553773	1.000000	0.71417	0.972000	0.41901	0.983000	0.72400	7.597000	0.82733	2.753000	0.94483	0.650000	0.86243	GGA	0.558765		TCGA-3A-A9IZ-01A-12D-A40W-08	0.473	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1	1	0	1		2	2	2	0		0	0	60		60	58	1	1.960000	-20.000000	1	0.560000				73	73		148	147	1		1	0		0	0	60	0		1.000000	9.999978e-01	0	0	0	44	0	73	148
CYP1A1	1543	broad.mit.edu	37	15	75014944	75014944	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr15:75014944C>A	ENST00000379727.3	-	2	693	c.495G>T	c.(493-495)aaG>aaT	p.K165N	CYP1A1_ENST00000567032.1_Missense_Mutation_p.K165N|CYP1A1_ENST00000395048.2_Missense_Mutation_p.K165N|CYP1A1_ENST00000395049.4_Missense_Mutation_p.K165N|CYP1A1_ENST00000564596.1_Intron			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	165					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	CCTCAGCCTCCTTGCTCACAT	0.572									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																													ENST00000379727.3	1.000000	8.800000e-01	1.000000	0.960000	0.990000	0.987405	0.990000	1.000000																										0				34						c.(493-495)aaG>aaT		cytochrome P450, family 1, subfamily A, polypeptide 1	Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)						79.0	76.0	77.0					15																	75014944		2197	4296	6493	SO:0001583	missense	1543	0	0		Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	g.chr15:75014944C>A	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.495G>T	chr15.hg19:g.75014944C>A	ENSP00000369050:p.Lys165Asn	1					CYP1A1_ENST00000395048.2_Missense_Mutation_p.K165N|CYP1A1_ENST00000564596.1_Intron|CYP1A1_ENST00000567032.1_Missense_Mutation_p.K165N|CYP1A1_ENST00000395049.4_Missense_Mutation_p.K165N	p.K165N			0	5	5	2.437396	P04798	CP1A1_HUMAN		2	693	-			A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	1	1	hg19	c.495G>T	CCDS10268.1	1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580074	0.28180	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.69561	-0.41;-0.41;-0.41	4.91	-1.8	0.07907	4.91	-1.8	0.07907	.	0.245514	0.46758	D	0.000263	T	0.63486	0.2515	M	0.77712	2.385	0.42656	D	0.993469	B;B	0.30664	0.289;0.171	B;B	0.40477	0.33;0.22	T	0.55023	-0.8205	10	0.52906	T	0.07	.	2.396	0.04390	0.1025:0.3183:0.1675:0.4117	.	165;165	E7EMT5;P04798	.;CP1A1_HUMAN	N	165	ENSP00000369050:K165N;ENSP00000378488:K165N;ENSP00000378489:K165N	ENSP00000268062:K165N	K	-	3	2	2	CYP1A1	72801997	72801997	0.191000	0.23288	0.983000	0.44433	0.772000	0.43724	-0.386000	0.07370	-0.412000	0.07519	-0.379000	0.06801	AAG	0.633822		TCGA-3A-A9IZ-01A-12D-A40W-08	0.572	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	1	0	1		2	2	2	0		0	0	63		63	60	1	1.960000	-4.871128	1	0.560000	NM_000499			125	122		391	384	1		1			0	0	63	0		1.000000	0	0	0	0	0	0	125	391
PRM1	5619	broad.mit.edu	37	16	11374992	11374992	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr16:11374992C>G	ENST00000312511.3	-	1	215	c.104G>C	c.(103-105)aGa>aCa	p.R35T	RMI2_ENST00000572173.1_Intron	NM_002761.2	NP_002752.1	P04553	HSP1_HUMAN	protamine 1	35					cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)	DNA binding (GO:0003677)	p.0?(1)		large_intestine(2)|skin(2)	4						ACTCATGGCTCTCCTCCGTGT	0.617																																						ENST00000312511.3	1.000000	1.000000e-02	0.080000	0.030000	0.050000	0.085558	0.050000	0.060000																										1	Whole gene deletion(1)	p.0?(1)	haematopoietic_and_lymphoid_tissue(1)	4						c.(103-105)aGa>aCa		protamine 1							117.0	109.0	112.0					16																	11374992		2197	4300	6497	SO:0001583	missense	5619	0	0					g.chr16:11374992C>G		CCDS10547.1	16p13.2	2009-08-06			ENSG00000175646	ENSG00000175646			9447	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 1"""	182880					Standard	NM_002761		Approved	CT94.1	uc002dav.3	P04553	OTTHUMG00000090521	ENST00000312511.3:c.104G>C	chr16.hg19:g.11374992C>G	ENSP00000310515:p.Arg35Thr	0					RMI2_ENST00000572173.1_Intron	p.R35T	NM_002761.2	NP_002752.1	1	2	3	2.060149	P04553	HSP1_HUMAN		1	215	-				Missense_Mutation	SNP	ENST00000312511.3	0	1	hg19	c.104G>C	CCDS10547.1	0	.	.	.	.	.	.	.	.	.	.	C	5.402	0.259367	0.10239	.	.	ENSG00000175646	ENST00000312511	.	.	.	3.2	2.23	0.28157	3.2	2.23	0.28157	.	0.610754	0.13387	N	0.391708	T	0.30198	0.0757	.	.	.	0.09310	N	1	P	0.44139	0.827	B	0.42087	0.375	T	0.14420	-1.0473	8	0.87932	D	0	1.6873	6.2261	0.20708	0.0:0.8559:0.0:0.1441	.	35	P04553	HSP1_HUMAN	T	35	.	ENSP00000310515:R35T	R	-	2	0	0	PRM1	11282493	11282493	0.006000	0.16342	0.004000	0.12327	0.055000	0.15305	0.194000	0.17135	0.560000	0.29169	0.430000	0.28490	AGA	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.617	PRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207010.1	0	0	1		2	2	2	0		0	0	107		107	106	1	1.960000	-2.974678	1	0.560000				7	6		485	472	0		1			0	0	107	0		0.978659	0	0	0	0	0	0	7	485
HAGH	3029	broad.mit.edu	37	16	1869148	1869148	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr16:1869148G>A	ENST00000397356.3	-	5	915	c.509C>T	c.(508-510)cCc>cTc	p.P170L	HAGH_ENST00000397353.2_Missense_Mutation_p.P122L|HAGH_ENST00000455446.2_Intron|HAGH_ENST00000566709.1_Missense_Mutation_p.P122L	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	170					glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	CGAGCCTCCGGGCTTGCTCAC	0.627																																					Pancreas(55;1048 1176 25227 40124 41333)	ENST00000397356.3	1.000000	8.100000e-01	1.000000	0.940000	0.990000	0.978133	0.990000	1.000000																										0				5						c.(508-510)cCc>cTc		hydroxyacylglutathione hydrolase	Glutathione(DB00143)						44.0	45.0	44.0					16																	1869148		2198	4300	6498	SO:0001583	missense	3029	0	0					g.chr16:1869148G>A	X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.509C>T	chr16.hg19:g.1869148G>A	ENSP00000380514:p.Pro170Leu	0					HAGH_ENST00000455446.2_Intron|HAGH_ENST00000566709.1_Missense_Mutation_p.P122L|HAGH_ENST00000397353.2_Missense_Mutation_p.P122L	p.P170L	NM_005326.4	NP_005317.2	1	2	3	2.060149	Q16775	GLO2_HUMAN		5	915	-		Hepatocellular(780;0.00335)	A8K290|B4DP33|B4DRA7|E7EN93	Missense_Mutation	SNP	ENST00000397356.3	1	1	hg19	c.509C>T	CCDS10447.2	1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010153	0.35415	.	.	ENSG00000063854	ENST00000397356;ENST00000397353	D;D	0.95622	-3.76;-3.76	4.92	4.92	0.64577	4.92	4.92	0.64577	Beta-lactamase-like (2);	0.232302	0.44285	D	0.000476	D	0.90587	0.7049	N	0.25201	0.72	0.80722	D	1	P;B;P	0.39717	0.536;0.099;0.684	B;B;B	0.34824	0.067;0.023;0.19	D	0.90163	0.4229	10	0.30078	T	0.28	-11.5709	17.4781	0.87666	0.0:0.0:1.0:0.0	.	167;122;170	B4DT01;Q16775-2;Q16775	.;.;GLO2_HUMAN	L	170;122	ENSP00000380514:P170L;ENSP00000380511:P122L	ENSP00000380511:P122L	P	-	2	0	0	HAGH	1809149	1809149	1.000000	0.71417	0.945000	0.38365	0.042000	0.13812	6.522000	0.73783	2.435000	0.82474	0.555000	0.69702	CCC	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.627	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250548.2	1	0	1		2	2	2	0		0	0	22		22	22	1	1.960000	-20.000000	1	0.560000	NM_005326			36	36		83	81	1		1	1		0	0	22	0		1.000000	9.999974e-01	0	3	0	50	0	36	83
C16orf45	89927	broad.mit.edu	37	16	15677014	15677014	+	Splice_Site	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr16:15677014G>C	ENST00000300006.4	+	5	780	c.421G>C	c.(421-423)Gag>Cag	p.E141Q	C16orf45_ENST00000452191.2_Splice_Site_p.E124Q|C16orf45_ENST00000565913.1_3'UTR|C16orf45_ENST00000566490.1_Intron|C16orf45_ENST00000561692.1_Splice_Site_p.E93Q	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	141										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						CTTTCACAGGGAGCAAGAAGA	0.378																																						ENST00000300006.4	1.000000	2.400000e-01	0.390000	0.280000	0.330000	0.356368	0.330000	0.330000																										0				11						c.(421-423)Gag>Cag		chromosome 16 open reading frame 45							122.0	120.0	121.0					16																	15677014		2197	4300	6497	SO:0001630	splice_region_variant	89927	0	0					g.chr16:15677014G>C	AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.420-1G>C	chr16.hg19:g.15677014G>C		0					C16orf45_ENST00000561692.1_Splice_Site_p.E93Q|C16orf45_ENST00000452191.2_Splice_Site_p.E124Q|C16orf45_ENST00000566490.1_Intron|C16orf45_ENST00000565913.1_3'UTR	p.E141Q	NM_033201.2	NP_149978.1	1	2	3	2.060149	Q96MC5	CP045_HUMAN		5	780	+			O00223|O75769|Q8IZ36|Q96H25	Splice_Site	SNP	ENST00000300006.4	1	0	hg19	c.421G>C	CCDS10561.1	0	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921388	0.92249	.	.	ENSG00000166780	ENST00000300006;ENST00000452191	T;T	0.59224	0.28;0.28	5.27	5.27	0.74061	5.27	5.27	0.74061	Domain of unknown function DUF3585 (1);	0.000000	0.85682	D	0.000000	T	0.79082	0.4386	M	0.84082	2.675	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.83275	0.995;0.996	T	0.82452	-0.0450	10	0.87932	D	0	-19.9858	18.4883	0.90838	0.0:0.0:1.0:0.0	.	85;141	B4DE25;Q96MC5	.;CP045_HUMAN	Q	141;124	ENSP00000300006:E141Q;ENSP00000408976:E124Q	ENSP00000300006:E141Q	E	+	1	0	0	C16orf45	15584515	15584515	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.318000	0.89990	2.434000	0.82447	0.650000	0.86243	GAG	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.378	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	1	0	1		2	2	2	0		0	0	120		120	120	1	1.960000	-14.256170	1	0.560000	NM_033201	Missense_Mutation		51	50		503	497	0		1	1		0	0	120	0		1.000000	9.383021e-01	0	2	0	46	0	51	503
CDR2	1039	broad.mit.edu	37	16	22385600	22385600	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr16:22385600C>G	ENST00000268383.2	-	1	338	c.31G>C	c.(31-33)Gag>Cag	p.E11Q	CDR2_ENST00000569045.1_Intron|RP11-21M24.2_ENST00000567158.1_RNA|RP11-21M24.2_ENST00000568827.1_RNA	NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	11						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		TCCTTCATCTCAAACTCCTCT	0.736																																						ENST00000268383.2	1.000000	7.300000e-01	0.970000	0.800000	0.880000	0.887525	0.880000	1.000000																										0				11						c.(31-33)Gag>Cag		cerebellar degeneration-related protein 2, 62kDa							53.0	55.0	55.0					16																	22385600		2197	4300	6497	SO:0001583	missense	1039	0	0					g.chr16:22385600C>G	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.31G>C	chr16.hg19:g.22385600C>G	ENSP00000268383:p.Glu11Gln	0					RP11-21M24.2_ENST00000567158.1_RNA|RP11-21M24.2_ENST00000568827.1_RNA|CDR2_ENST00000569045.1_Intron	p.E11Q	NM_001802.1	NP_001793.1	1	2	3	2.060149	Q01850	CDR2_HUMAN		1	338	-			A8K8A8|Q13977	Missense_Mutation	SNP	ENST00000268383.2	1	1	hg19	c.31G>C	CCDS32404.1	1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323911	0.60634	.	.	ENSG00000140743	ENST00000268383	T	0.30981	1.51	4.23	4.23	0.50019	4.23	4.23	0.50019	.	0.055975	0.64402	U	0.000001	T	0.45538	0.1347	L	0.52364	1.645	0.50171	D	0.999852	D	0.71674	0.998	D	0.66351	0.943	T	0.28396	-1.0045	10	0.14656	T	0.56	-17.8946	16.6203	0.84928	0.0:1.0:0.0:0.0	.	11	Q01850	CDR2_HUMAN	Q	11	ENSP00000268383:E11Q	ENSP00000268383:E11Q	E	-	1	0	0	CDR2	22293101	22293101	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	4.673000	0.61604	1.899000	0.54978	0.462000	0.41574	GAG	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.736	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430081.1	1	0	1		2	2	2	0		0	0	72		72	70	1	1.960000	-20.000000	1	0.560000				105	104		324	319	0		1	1		0	0	72	0		1.000000	9.976890e-01	0	13	0	18	0	105	324
PKD1L2	114780	broad.mit.edu	37	16	81232548	81232548	+	RNA	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr16:81232548C>G	ENST00000525539.1	-	0	1261				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GCGGTGCCTCCCAGGGCCCAT	0.567																																						ENST00000525539.1	0.940000	6.800000e-01	0.880000	0.740000	0.810000	0.817323	0.810000	0.810000																										0				44								polycystic kidney disease 1-like 2							159.0	161.0	161.0					16																	81232548		1975	4150	6125			114780	0	0					g.chr16:81232548C>G	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		chr16.hg19:g.81232548C>G		0					PKD1L2_ENST00000337114.4_RNA		NM_052892.3	NP_443124.3	0	0	0	2.008269	Q7Z442	PK1L2_HUMAN		0	1261	-			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000525539.1	1	0	hg19			0	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229880	0.39399	.	.	ENSG00000166473	ENST00000337114	T	0.11495	2.77	5.25	4.31	0.51392	5.25	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.33059	0.0850	.	.	.	0.29345	N	0.865728	P;D	0.89917	0.906;1.0	P;D	0.75020	0.81;0.985	T	0.25328	-1.0135	9	0.87932	D	0	-25.724	15.4173	0.74980	0.1403:0.8597:0.0:0.0	.	421;421	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	A	421	ENSP00000337397:G421A	ENSP00000337397:G421A	G	-	2	0	0	PKD1L2	79790049	79790049	0.983000	0.35010	0.253000	0.24343	0.069000	0.16628	3.157000	0.50716	1.237000	0.43756	-0.235000	0.12190	GGG	0.557522		TCGA-3A-A9IZ-01A-12D-A40W-08	0.567	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2	1	0	1		2	2	2	0		0	0	119		119	118	1	1.960000	-20.000000	1	0.560000				126	120		423	414	1		1			0	0	119	0		1.000000	0	0	0	0	0	0	126	423
SLC4A1	6521	broad.mit.edu	37	17	42336630	42336630	+	Silent	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr17:42336630C>T	ENST00000262418.6	-	9	932	c.777G>A	c.(775-777)ccG>ccA	p.P259P	SLC4A1_ENST00000471005.1_5'Flank|AC003043.1_ENST00000597382.1_Intron	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	259	Globular.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.P259P(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GTATAGGCACCGGCAGCTCCA	0.652																																						ENST00000262418.6	1.000000	8.800000e-01	1.000000	0.980000	0.990000	0.989696	0.990000	1.000000																										1	Substitution - coding silent(1)	p.P259P(1)	lung(1)	40						c.(775-777)ccG>ccA		solute carrier family 4 (anion exchanger), member 1 (Diego blood group)							32.0	34.0	33.0					17																	42336630		2203	4300	6503	SO:0001819	synonymous_variant	6521	3	121410	35				g.chr17:42336630C>T		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.777G>A	chr17.hg19:g.42336630C>T		0					AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	p.P259P	NM_000342.3	NP_000333.1	1	2	3	2.052408	P02730	B3AT_HUMAN		9	932	-		Breast(137;0.014)|Prostate(33;0.0181)	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	ENST00000262418.6	1	1	hg19	c.777G>A	CCDS11481.1	1																																																																																								0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.652	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	1	0	1		2	2	2	0		0	0	49		49	48	1	1.960000	-7.160123	1	0.560000	NM_000342			69	68		157	153	1		1			0	0	49	0		1.000000	0	0	0	0	0	0	69	157
TP53	7157	broad.mit.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	T	rs397516437|rs28934573		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr17:7577559G>T	ENST00000269305.4	-	7	911	c.722C>A	c.(721-723)tCc>tAc	p.S241Y	TP53_ENST00000420246.2_Missense_Mutation_p.S241Y|TP53_ENST00000455263.2_Missense_Mutation_p.S241Y|TP53_ENST00000445888.2_Missense_Mutation_p.S241Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.S241Y|TP53_ENST00000413465.2_Missense_Mutation_p.S241Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	7.900000e-01	0.990000	0.870000	0.940000	0.934798	0.940000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	24185	GRCh37	CM920673	TP53	M	rs28934573	c.(721-723)tCc>tAc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						139.0	108.0	118.0					17																	7577559		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577559G>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>A	chr17.hg19:g.7577559G>T	ENSP00000269305:p.Ser241Tyr	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.S241Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.S241Y|TP53_ENST00000420246.2_Missense_Mutation_p.S241Y|TP53_ENST00000359597.4_Missense_Mutation_p.S241Y|TP53_ENST00000413465.2_Missense_Mutation_p.S241Y	p.S241Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.519349	P04637	P53_HUMAN		7	911	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.722C>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341685	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.52501	D	0.999952	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96551	0.9408	10	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	.	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241Y;ENSP00000352610:S241Y;ENSP00000269305:S241Y;ENSP00000398846:S241Y;ENSP00000391127:S241Y;ENSP00000391478:S241Y;ENSP00000425104:S109Y;ENSP00000423862:S148Y	ENSP00000269305:S241Y	S	-	2	0	0	TP53	7518284	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC	0.391256		TCGA-3A-A9IZ-01A-12D-A40W-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	45		45	45	1	1.960000	-20.000000	1	0.560000	NM_000546			74	69		117	114	1		1	1	1	0	0	45	615		1.000000	9.999669e-01	1	17	198	12	386	74	117
PFAS	5198	broad.mit.edu	37	17	8170106	8170106	+	Missense_Mutation	SNP	G	G	A	rs561030492		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr17:8170106G>A	ENST00000314666.6	+	23	2990	c.2857G>A	c.(2857-2859)Gtg>Atg	p.V953M	PFAS_ENST00000545834.1_Missense_Mutation_p.V529M	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	953					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GCCAGGCCTCGTGCTGGAGGT	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		19676	0.0		0.0	False		,,,				2504	0.001					ENST00000314666.6	1.000000	7.900000e-01	0.990000	0.860000	0.930000	0.932439	0.930000	1.000000																										0				35						c.(2857-2859)Gtg>Atg		phosphoribosylformylglycinamidine synthase	L-Glutamine(DB00130)						54.0	51.0	52.0					17																	8170106		2203	4300	6503	SO:0001583	missense	5198	2	121412	32				g.chr17:8170106G>A	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.2857G>A	chr17.hg19:g.8170106G>A	ENSP00000313490:p.Val953Met	1					PFAS_ENST00000545834.1_Missense_Mutation_p.V529M	p.V953M	NM_012393.2	NP_036525.1	0	1	1	1.519349	O15067	PUR4_HUMAN		23	2990	+			A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	1	1	hg19	c.2857G>A	CCDS11136.1	1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799131	0.90538	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.39997	1.05;1.05	5.24	5.24	0.73138	5.24	5.24	0.73138	AIR synthase-related protein, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.73521	0.3597	H	0.94542	3.55	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.69479	0.964;0.964	T	0.81758	-0.0786	10	0.87932	D	0	-17.4026	16.6687	0.85260	0.0:0.0:1.0:0.0	.	953;953	A8K8N7;O15067	.;PUR4_HUMAN	M	529;953;362	ENSP00000441706:V529M;ENSP00000313490:V953M	ENSP00000313490:V953M	V	+	1	0	0	PFAS	8110831	8110831	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	6.109000	0.71528	2.605000	0.88082	0.561000	0.74099	GTG	0.391256		TCGA-3A-A9IZ-01A-12D-A40W-08	0.662	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2	1	0	1		2	2	2	0		0	0	47		47	44	1	1.960000	-20.000000	1	0.560000				69	67		109	108	1		1	0		0	0	47	0		1.000000	1.508712e-01	0	1	0	1	0	69	109
SDK2	54549	broad.mit.edu	37	17	71381998	71381998	+	Silent	SNP	T	T	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr17:71381998T>A	ENST00000392650.3	-	32	4557	c.4557A>T	c.(4555-4557)ctA>ctT	p.L1519L	SDK2_ENST00000388726.3_Silent_p.L1519L	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1519	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCCATCGGATTAGCACGGAGG	0.647																																						ENST00000392650.3	1.000000	6.800000e-01	1.000000	0.840000	0.990000	0.941241	0.990000	1.000000																										0				86						c.(4555-4557)ctA>ctT		sidekick cell adhesion molecule 2							73.0	62.0	66.0					17																	71381998		2203	4299	6502	SO:0001819	synonymous_variant	54549	0	0					g.chr17:71381998T>A	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4557A>T	chr17.hg19:g.71381998T>A		0					SDK2_ENST00000388726.3_Silent_p.L1519L	p.L1519L	NM_001144952.1	NP_001138424.1	1	2	3	2.119855	Q58EX2	SDK2_HUMAN		32	4557	-			A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	1	1	hg19	c.4557A>T	CCDS45769.1	1																																																																																								0.570815		TCGA-3A-A9IZ-01A-12D-A40W-08	0.647	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	1	0	1		2	2	2	0		0	0	16		16	15	1	1.960000	-20.000000	1	0.560000	NM_019064			23	21		61	58	1		1		0	0	0	16	2		1.000000	0	3.131725e-01	0	0	0	4	23	61
DSG2	1829	broad.mit.edu	37	18	29116237	29116237	+	Missense_Mutation	SNP	T	T	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr18:29116237T>G	ENST00000261590.8	+	11	1705	c.1496T>G	c.(1495-1497)cTg>cGg	p.L499R		NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	499	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TGTCCCACACTGATAGAGCCT	0.428																																						ENST00000261590.8	1.000000	6.000000e-02	0.170000	0.090000	0.120000	0.159462	0.120000	0.120000																										0				49						c.(1495-1497)cTg>cGg		desmoglein 2							96.0	88.0	91.0					18																	29116237		1956	4164	6120	SO:0001583	missense	1829	0	0					g.chr18:29116237T>G	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1496T>G	chr18.hg19:g.29116237T>G	ENSP00000261590:p.Leu499Arg	0						p.L499R	NM_001943.3	NP_001934.2	1	2	3	2.065193	Q14126	DSG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0068)	11	1705	+			Q4KKU6	Missense_Mutation	SNP	ENST00000261590.8	1	1	hg19	c.1496T>G	CCDS42423.1	0	.	.	.	.	.	.	.	.	.	.	T	15.21	2.764658	0.49574	.	.	ENSG00000046604	ENST00000261590	T	0.63913	-0.07	5.89	5.89	0.94794	5.89	5.89	0.94794	Cadherin (2);Cadherin-like (1);	0.143841	0.32218	N	0.006411	D	0.82513	0.5053	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.85990	0.1488	10	0.87932	D	0	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	499	Q14126	DSG2_HUMAN	R	499	ENSP00000261590:L499R	ENSP00000261590:L499R	L	+	2	0	0	DSG2	27370235	27370235	1.000000	0.71417	0.757000	0.31301	0.015000	0.08874	6.161000	0.71868	2.246000	0.74042	0.533000	0.62120	CTG	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.428	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	0	0	1		2	2	2	0		0	0	76		76	74	1	1.960000	-13.243290	1	0.560000	NM_001943			13	13		360	354	0		1	1		0	0	76	0		0.999503	9.647442e-01	0	12	0	146	0	13	360
FCGBP	8857	broad.mit.edu	37	19	40424379	40424379	+	Silent	SNP	G	G	A	rs201855763		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr19:40424379G>A	ENST00000221347.6	-	4	1831	c.1824C>T	c.(1822-1824)tgC>tgT	p.C608C		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	608	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACACAGCCCGCACACCTGGT	0.617																																						ENST00000221347.6	1.000000	1.000000e-02	0.100000	0.030000	0.050000	0.100887	0.050000	0.060000																										0				165						c.(1822-1824)tgC>tgT		Fc fragment of IgG binding protein		G		0,4406		0,0,2203	81.0	82.0	82.0		1824	-0.7	1.0	19		82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FCGBP	NM_003890.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		608/5406	40424379	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8857	20	121412	47				g.chr19:40424379G>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1824C>T	chr19.hg19:g.40424379G>A		0						p.C608C	NM_003890.2	NP_003881.2	1	2	3	2.072647	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)	4	1831	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		O95784	Silent	SNP	ENST00000221347.6	0	1	hg19	c.1824C>T	CCDS12546.1	0																																																																																								0.566075		TCGA-3A-A9IZ-01A-12D-A40W-08	0.617	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	0	0	1		2	2	2	0		0	0	53		53	52	1	1.960000	-2.334176	0	0.560000	NM_003890			6	6		379	374	0		1			0	0	53	0		0.963830	0	0	0	0	0	0	6	379
IZUMO1	284359	broad.mit.edu	37	19	49245529	49245529	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr19:49245529G>C	ENST00000332955.2	-	7	1084	c.537C>G	c.(535-537)atC>atG	p.I179M	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	179	Ig-like C2-type.				cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CACAGTCCAGGATCATGTCTT	0.478																																						ENST00000332955.2	1.000000	0	0.070000	0.010000	0.030000	0.079458	0.030000	0.040000																										0				17						c.(535-537)atC>atG		izumo sperm-egg fusion 1							178.0	162.0	167.0					19																	49245529		2203	4300	6503	SO:0001583	missense	284359	0	0					g.chr19:49245529G>C	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.537C>G	chr19.hg19:g.49245529G>C	ENSP00000327786:p.Ile179Met	0					RASIP1_ENST00000222145.4_5'Flank	p.I179M	NM_182575.2	NP_872381.2	1	2	3	2.072647	Q8IYV9	IZUM1_HUMAN		7	1084	-		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	ENST00000332955.2	0	1	hg19	c.537C>G	CCDS12732.1	0	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401774	0.42613	.	.	ENSG00000182264	ENST00000332955	D	0.84070	-1.8	4.67	2.5	0.30297	4.67	2.5	0.30297	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.764345	0.11908	N	0.517951	T	0.77718	0.4172	N	0.24115	0.695	0.23519	N	0.997503	P	0.40794	0.729	P	0.48400	0.576	T	0.66586	-0.5886	10	0.54805	T	0.06	-19.8514	7.5894	0.28012	0.1976:0.0:0.8024:0.0	.	179	Q8IYV9	IZUM1_HUMAN	M	179	ENSP00000327786:I179M	ENSP00000327786:I179M	I	-	3	3	3	IZUMO1	53937341	53937341	0.907000	0.30839	0.774000	0.31636	0.682000	0.39822	0.508000	0.22692	0.697000	0.31718	0.561000	0.74099	ATC	0.566075		TCGA-3A-A9IZ-01A-12D-A40W-08	0.478	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	0	0	1		2	2	2	0		0	0	105		105	102	1	1.960000	-2.872003	1	0.560000	NM_182575			5	6		492	486	0		1			0	0	105	0		0.936161	0	0	0	0	0	0	5	492
VAV1	7409	broad.mit.edu	37	19	6829851	6829851	+	Silent	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr19:6829851C>G	ENST00000602142.1	+	14	1402	c.1320C>G	c.(1318-1320)tcC>tcG	p.S440S	VAV1_ENST00000596764.1_Silent_p.S408S|VAV1_ENST00000304076.2_Silent_p.S440S|VAV1_ENST00000539284.1_Silent_p.S343S|VAV1_ENST00000599806.1_Silent_p.S385S	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	440	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GGGGAGACTCCTATGACCTCA	0.527																																						ENST00000602142.1	0.270000	1.100000e-01	0.230000	0.140000	0.180000	0.194873	0.180000	0.190000																										0				62						c.(1318-1320)tcC>tcG		vav 1 guanine nucleotide exchange factor							156.0	127.0	137.0					19																	6829851		2203	4300	6503	SO:0001819	synonymous_variant	7409	0	0					g.chr19:6829851C>G		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1320C>G	chr19.hg19:g.6829851C>G		1					VAV1_ENST00000599806.1_Silent_p.S385S|VAV1_ENST00000539284.1_Silent_p.S343S|VAV1_ENST00000304076.2_Silent_p.S440S|VAV1_ENST00000596764.1_Silent_p.S408S	p.S440S	NM_005428.3	NP_005419.2	0	1	1	1.533322	P15498	VAV_HUMAN		14	1402	+			B4DVK9|M0QXX6|Q15860	Silent	SNP	ENST00000602142.1	1	1	hg19	c.1320C>G	CCDS12174.1	0																																																																																								0.393605		TCGA-3A-A9IZ-01A-12D-A40W-08	0.527	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1	1	0	1		2	2	2	0		0	0	79		79	77	1	1.960000	-3.017728	1	0.560000				21	21		268	266	0		1	0		0	0	79	0		0.999998	5.954903e-03	0	0	0	2	0	21	268
SHANK1	50944	broad.mit.edu	37	19	51200361	51200361	+	Silent	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr19:51200361G>A	ENST00000293441.1	-	14	1974	c.1956C>T	c.(1954-1956)ggC>ggT	p.G652G	SHANK1_ENST00000391814.1_Silent_p.G652G|SHANK1_ENST00000359082.3_Intron	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	652					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACCTCCCTGGGCCAATCCCAT	0.647																																						ENST00000293441.1	1.000000	1.000000e-02	0.100000	0.030000	0.060000	0.102722	0.060000	0.060000																										0				64						c.(1954-1956)ggC>ggT		SH3 and multiple ankyrin repeat domains 1							110.0	97.0	101.0					19																	51200361		2203	4300	6503	SO:0001819	synonymous_variant	50944	0	0					g.chr19:51200361G>A	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.1956C>T	chr19.hg19:g.51200361G>A		0					SHANK1_ENST00000391814.1_Silent_p.G652G|SHANK1_ENST00000359082.3_Intron	p.G652G	NM_016148.2	NP_057232.2	1	2	3	2.072647	Q9Y566	SHAN1_HUMAN		14	1974	-		all_neural(266;0.057)	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	0	1	hg19	c.1956C>T	CCDS12799.1	0																																																																																								0.566075		TCGA-3A-A9IZ-01A-12D-A40W-08	0.647	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	0	0	1		19	2	2	1		1	1	62		62	60	1	1.960000	-2.313953	0	0.560000	NM_016148			6	6		368	352	0		0			1	0	62	0		0.004675	0	0	0	0	0	0	6	368
DENND2D	79961	broad.mit.edu	37	1	111730759	111730759	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:111730759G>C	ENST00000357640.4	-	11	1562	c.1333C>G	c.(1333-1335)Cct>Gct	p.P445A	DENND2D_ENST00000369752.5_Missense_Mutation_p.P442A	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	445					positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		GTACCTGCAGGAGGATTCTTG	0.468																																						ENST00000357640.4	1.000000	4.000000e-02	0.160000	0.070000	0.100000	0.140212	0.100000	0.100000																										0				25						c.(1333-1335)Cct>Gct		DENN/MADD domain containing 2D							66.0	65.0	65.0					1																	111730759		2203	4300	6503	SO:0001583	missense	79961	0	0					g.chr1:111730759G>C		CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.1333C>G	chr1.hg19:g.111730759G>C	ENSP00000350266:p.Pro445Ala	0					DENND2D_ENST00000369752.5_Missense_Mutation_p.P442A	p.P445A	NM_024901.3	NP_079177.2	1	2	3	2.063257	Q9H6A0	DEN2D_HUMAN		11	1562	-		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	ENST00000357640.4	1	1	hg19	c.1333C>G	CCDS831.1	0	.	.	.	.	.	.	.	.	.	.	G	3.119	-0.180963	0.06380	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.12569	2.67;2.67	5.76	5.76	0.90799	5.76	5.76	0.90799	.	0.169277	0.52532	D	0.000071	T	0.02380	0.0073	N	0.14661	0.345	0.27874	N	0.939913	B;B	0.34015	0.43;0.435	B;B	0.30179	0.112;0.057	T	0.32214	-0.9915	10	0.02654	T	1	-14.1137	15.8146	0.78589	0.0:0.0:1.0:0.0	.	442;445	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	A	445;442	ENSP00000350266:P445A;ENSP00000358767:P442A	ENSP00000350266:P445A	P	-	1	0	0	DENND2D	111532282	111532282	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	4.599000	0.61076	2.882000	0.98803	0.655000	0.94253	CCT	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.468	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1	0	0	1		2	2	2	0		0	0	63		63	63	1	1.960000	-3.289091	1	0.560000	NM_024901			9	8		303	302	0		1	1		0	0	63	0		0.994228	5.661327e-01	0	4	0	58	0	9	303
NGF	4803	broad.mit.edu	37	1	115828736	115828736	+	Silent	SNP	C	C	T	rs565497625		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:115828736C>T	ENST00000369512.2	-	3	849	c.681G>A	c.(679-681)acG>acA	p.T227T	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	227					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	ACACACAGGCCGTATCTATCC	0.587																																						ENST00000369512.2	1.000000	7.000000e-02	0.190000	0.100000	0.140000	0.175429	0.140000	0.140000																										0				13						c.(679-681)acG>acA		nerve growth factor (beta polypeptide)	Clenbuterol(DB01407)						71.0	75.0	73.0					1																	115828736		2203	4300	6503	SO:0001819	synonymous_variant	4803	7	121410	40				g.chr1:115828736C>T		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.681G>A	chr1.hg19:g.115828736C>T		0					RP4-663N10.1_ENST00000425449.1_RNA	p.T227T	NM_002506.2	NP_002497.2	1	2	3	2.063257	P01138	NGF_HUMAN		3	849	-	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)	A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Silent	SNP	ENST00000369512.2	1	1	hg19	c.681G>A	CCDS882.1	0																																																																																								0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.587	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	0	0	1		18	2	2	1		1	1	63		63	62	1	1.960000	-2.778537	1	0.560000	NM_002506			14	14		342	332	0		0	0		1	0	63	0		0.263347	0	0	0	0	1	0	14	342
PDE4DIP	9659	broad.mit.edu	37	1	144994654	144994654	+	Missense_Mutation	SNP	G	G	C	rs147804991	byFrequency	TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:144994654G>C	ENST00000369354.3	-	1	267	c.78C>G	c.(76-78)atC>atG	p.I26M	PDE4DIP_ENST00000313382.9_Missense_Mutation_p.I92M|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.I26M|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.I163M|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.I163M|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.I26M|PDE4DIP_ENST00000369347.4_Missense_Mutation_p.I26M|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.I163M|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.I26M			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	26					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAGGAAGTAGATGCGCAGCT	0.582			T	PDGFRB	MPD																																	ENST00000369354.3	0.280000	1.500000e-01	0.250000	0.180000	0.210000	0.217975	0.210000	0.210000				Dom	yes			Dom	yes		1	1q12	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)				L	L	PDGFRB		MPD		0				176						c.(76-78)atC>atG		phosphodiesterase 4D interacting protein							175.0	148.0	157.0					1																	144994654		2203	4300	6503	SO:0001583	missense	9659	0	0					g.chr1:144994654G>C	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.78C>G	chr1.hg19:g.144994654G>C	ENSP00000358360:p.Ile26Met	0					PDE4DIP_ENST00000369359.4_Missense_Mutation_p.I163M|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.I163M|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.I26M|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.I163M|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.I26M|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.I26M|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.I92M|PDE4DIP_ENST00000369347.4_Missense_Mutation_p.I26M	p.I26M			0	1	1	1.975425	Q5VU43	MYOME_HUMAN		1	267	-			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	1	0	hg19	c.78C>G	CCDS30824.1	0	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743780	0.89663	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000530078;ENST00000534536;ENST00000369347;ENST00000369348;ENST00000531369	T;T;T;T;T;T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35	5.78	4.86	0.63082	5.78	4.86	0.63082	Spindle associated (1);	.	.	.	.	T	0.57770	0.2076	M	0.88979	2.995	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;1.0;0.999;0.999	T	0.64271	-0.6447	9	0.87932	D	0	.	11.8519	0.52415	0.0836:0.0:0.9164:0.0	.	26;92;26;163;92;29;26	Q5VU43-7;Q5VU43-3;Q5VU43;E9PJ64;E9PQH9;E9PS60;Q5VU43-10	.;.;MYOME_HUMAN;.;.;.;.	M	92;26;26;163;163;26;26;92;29;26;163;93	ENSP00000327209:I92M;ENSP00000358360:I26M;ENSP00000358363:I26M;ENSP00000435654:I163M;ENSP00000358366:I163M;ENSP00000358357:I26M;ENSP00000358355:I26M;ENSP00000435920:I29M;ENSP00000358353:I26M;ENSP00000358354:I163M;ENSP00000435616:I93M	ENSP00000327209:I92M	I	-	3	3	3	PDE4DIP	143706011	143706011	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.787000	0.62432	2.731000	0.93534	0.650000	0.86243	ATC	0.424686		TCGA-3A-A9IZ-01A-12D-A40W-08	0.582	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	1	0	1		2	2	2	0		0	0	115		115	113	1	1.960000	-1.263798	0	0.560000	NM_022359			43	42		505	501	0		1	0		0	0	115	0		1.000000	7.796182e-02	0	0	0	6	0	43	505
FLG	2312	broad.mit.edu	37	1	152275642	152275642	+	Missense_Mutation	SNP	C	C	T	rs554551056		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:152275642C>T	ENST00000368799.1	-	3	11755	c.11720G>A	c.(11719-11721)cGc>cAc	p.R3907H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3907	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCTGTATCGCGGTGAGAGGA	0.502									Ichthyosis				C|||	1	0.000199681	0.0008	0.0	5008	,	,		21058	0.0		0.0	False		,,,				2504	0.0					ENST00000368799.1	0.340000	1.400000e-01	0.290000	0.180000	0.230000	0.240531	0.230000	0.230000																										0				424						c.(11719-11721)cGc>cAc		filaggrin							96.0	96.0	96.0					1																	152275642		2203	4300	6503	SO:0001583	missense	2312	8	121412	42	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152275642C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11720G>A	chr1.hg19:g.152275642C>T	ENSP00000357789:p.Arg3907His	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.R3907H	NM_002016.1	NP_002007.1	0	0	0	2.018049	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	11755	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	1	1	hg19	c.11720G>A	CCDS30860.1	0	.	.	.	.	.	.	.	.	.	.	C	3.195	-0.164938	0.06502	.	.	ENSG00000143631	ENST00000368799	T	0.01705	4.68	2.27	-4.54	0.03452	2.27	-4.54	0.03452	.	.	.	.	.	T	0.00210	0.0006	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42120	-0.9470	9	0.39692	T	0.17	.	4.5721	0.12216	0.1364:0.5422:0.1378:0.1835	.	3907	P20930	FILA_HUMAN	H	3907	ENSP00000357789:R3907H	ENSP00000357789:R3907H	R	-	2	0	0	FLG	150542266	150542266	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.243000	0.08915	-3.346000	0.00182	-3.949000	0.00015	CGC	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.502	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	1	0	1		2	2	2	0		0	0	77		77	77	1	1.960000	-5.705387	1	0.560000	NM_002016			20	20		289	282	0		1			0	0	77	0		0.999995	0	0	0	0	0	0	20	289
FLG	2312	broad.mit.edu	37	1	152282178	152282178	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:152282178C>A	ENST00000368799.1	-	3	5219	c.5184G>T	c.(5182-5184)gaG>gaT	p.E1728D	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1728	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGTGTCTGACTCTTCTGAGT	0.597									Ichthyosis																													ENST00000368799.1	1.000000	9.000000e-01	1.000000	0.940000	0.990000	0.981097	0.990000	1.000000																										0				424						c.(5182-5184)gaG>gaT		filaggrin							223.0	222.0	223.0					1																	152282178		2203	4300	6503	SO:0001583	missense	2312	0	0		Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152282178C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5184G>T	chr1.hg19:g.152282178C>A	ENSP00000357789:p.Glu1728Asp	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.E1728D	NM_002016.1	NP_002007.1	0	0	0	2.018049	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	5219	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	1	1	hg19	c.5184G>T	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	0.079	-1.187332	0.01620	.	.	ENSG00000143631	ENST00000368799	T	0.00832	5.64	3.81	-4.15	0.03881	3.81	-4.15	0.03881	.	.	.	.	.	T	0.00073	0.0002	N	0.00690	-1.25	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.27606	-1.0069	9	0.12103	T	0.63	.	1.4188	0.02307	0.3032:0.163:0.4043:0.1295	.	1728	P20930	FILA_HUMAN	D	1728	ENSP00000357789:E1728D	ENSP00000357789:E1728D	E	-	3	2	2	FLG	150548802	150548802	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.340000	0.00506	-1.071000	0.03145	-1.906000	0.00525	GAG	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	1	0	1		2	2	2	0		0	0	274		274	269	1	1.960000	-20.000000	1	0.560000	NM_002016			348	342		897	880	0		1			0	0	274	0		1.000000	0	0	0	0	0	0	348	897
TBX19	9095	broad.mit.edu	37	1	168262442	168262442	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:168262442G>C	ENST00000367821.3	+	3	580	c.529G>C	c.(529-531)Gcc>Ccc	p.A177P		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	177					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					TGTTGGAAGTGCCCATCGAAT	0.463																																						ENST00000367821.3	0.200000	4.000000e-02	0.160000	0.070000	0.110000	0.122046	0.110000	0.120000																										0				34						c.(529-531)Gcc>Ccc		T-box 19							128.0	108.0	115.0					1																	168262442		2203	4300	6503	SO:0001583	missense	9095	0	0					g.chr1:168262442G>C	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.529G>C	chr1.hg19:g.168262442G>C	ENSP00000356795:p.Ala177Pro	1						p.A177P	NM_005149.2	NP_005140.1	1	2	3	2.595994	O60806	TBX19_HUMAN		3	580	+	all_hematologic(923;0.215)		Q52M53	Missense_Mutation	SNP	ENST00000367821.3	0	1	hg19	c.529G>C	CCDS1272.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.307|2.307	-0.358921|-0.358921	0.05138|0.05138	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000367821;ENST00000367828|ENST00000431969	D|.	0.88124|.	-2.34|.	5.02|5.02	0.2|0.2	0.15181|0.15181	5.02|5.02	0.2|0.2	0.15181|0.15181	p53-like transcription factor, DNA-binding (1);|.	0.552786|.	0.18396|.	N|.	0.142516|.	T|T	0.02230|0.02230	0.0069|0.0069	N|N	0.02420|0.02420	-0.555|-0.555	.|.	.|.	.|.	B;B|.	0.10296|.	0.001;0.003|.	B;B|.	0.08055|.	0.002;0.003|.	T|T	0.40683|0.40683	-0.9550|-0.9550	9|4	0.27785|.	T|.	0.31|.	.|.	0.0479|0.0479	0.00011|0.00011	0.2718:0.1897:0.2341:0.3044|0.2718:0.1897:0.2341:0.3044	.|.	177;108|.	O60806;B3KRD9|.	TBX19_HUMAN;.|.	P|S	177;117|109	ENSP00000356795:A177P|.	ENSP00000356795:A177P|.	A|C	+|+	1|2	0|0	0|0	TBX19|TBX19	166529066|166529066	166529066|166529066	0.000000|0.000000	0.05858|0.05858	0.588000|0.588000	0.28705|0.28705	0.461000|0.461000	0.32589|0.32589	0.244000|0.244000	0.18124|0.18124	0.447000|0.447000	0.26695|0.26695	0.563000|0.563000	0.77884|0.77884	GCC|TGC	0.656250		TCGA-3A-A9IZ-01A-12D-A40W-08	0.463	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	0	0	1		2	2	2	0		0	0	47		47	45	1	1.960000	-3.484213	1	0.560000	NM_005149			9	9		363	357	0		1	0		0	0	47	0		0.993919	4.508221e-03	0	0	0	4	0	9	363
ZSCAN20	7579	broad.mit.edu	37	1	33957115	33957115	+	Silent	SNP	T	T	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:33957115T>C	ENST00000361328.3	+	6	1410	c.1257T>C	c.(1255-1257)gaT>gaC	p.D419D	ZSCAN20_ENST00000373413.2_Silent_p.D365D	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	419					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAGCCACAGATGGCCCAGGAG	0.607																																						ENST00000361328.3	1.000000	7.100000e-01	1.000000	0.800000	0.910000	0.905407	0.910000	1.000000																										0				31						c.(1255-1257)gaT>gaC		zinc finger and SCAN domain containing 20							56.0	63.0	61.0					1																	33957115		1931	4133	6064	SO:0001819	synonymous_variant	7579	0	0					g.chr1:33957115T>C	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1257T>C	chr1.hg19:g.33957115T>C		0					ZSCAN20_ENST00000373413.2_Silent_p.D365D	p.D419D	NM_145238.3	NP_660281	1	2	3	2.063257	P17040	ZSC20_HUMAN		6	1410	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	1	1	hg19	c.1257T>C	CCDS41300.1	1																																																																																								0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.607	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	1	0	1		2	2	2	0		0	0	42		42	42	1	1.960000	-20.000000	1	0.560000	NM_145238			55	54		163	157	1		1	0		0	0	42	0		1.000000	1.626513e-01	0	1	0	2	0	55	163
CSMD2	114784	broad.mit.edu	37	1	34383705	34383705	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:34383705A>T	ENST00000373381.4	-	5	1086	c.910T>A	c.(910-912)Tcc>Acc	p.S304T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	264	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAGAGGGAGGAGCCTTCTGTC	0.537																																						ENST00000373381.4	1.000000	6.400000e-01	1.000000	0.740000	0.860000	0.864874	0.860000	1.000000																										0				246						c.(910-912)Tcc>Acc		CUB and Sushi multiple domains 2							95.0	84.0	88.0					1																	34383705		2203	4300	6503	SO:0001583	missense	114784	0	0					g.chr1:34383705A>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.910T>A	chr1.hg19:g.34383705A>T	ENSP00000362479:p.Ser304Thr	0						p.S304T	NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	1	2	3	2.063257	Q7Z408	CSMD2_HUMAN		5	1086	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	1	1	hg19	c.910T>A		1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.276798	0.23307	.	.	ENSG00000121904	ENST00000373381	D	0.87650	-2.28	5.48	4.36	0.52297	5.48	4.36	0.52297	CUB (5);	0.072866	0.56097	D	0.000029	T	0.80237	0.4586	N	0.20483	0.58	0.80722	D	1	P;B	0.36183	0.542;0.354	P;B	0.44921	0.464;0.183	T	0.74668	-0.3588	10	0.14656	T	0.56	.	10.0631	0.42286	0.9216:0.0:0.0784:0.0	.	264;304	Q7Z408;E7EUA6	CSMD2_HUMAN;.	T	304	ENSP00000362479:S304T	ENSP00000241312:S264T	S	-	1	0	0	CSMD2	34156292	34156292	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.738000	0.55067	2.095000	0.63458	0.391000	0.25812	TCC	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.537	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	23		23	23	1	1.960000	-20.000000	1	0.560000	NM_052896			38	37		121	120	0		1	0		0	0	23	0		1.000000	1.444715e-01	0	0	0	3	0	38	121
ZCCHC11	23318	broad.mit.edu	37	1	52933891	52933891	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:52933891A>G	ENST00000371544.3	-	15	3189	c.2927T>C	c.(2926-2928)tTa>tCa	p.L976S	ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.L976S	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	976					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						CAAGCCAATTAAAATTTGCTC	0.308																																						ENST00000371544.3	1.000000	1.000000e-02	0.120000	0.030000	0.060000	0.104075	0.060000	0.060000																										0				58						c.(2926-2928)tTa>tCa		zinc finger, CCHC domain containing 11							64.0	62.0	62.0					1																	52933891		2203	4293	6496	SO:0001583	missense	23318	0	0					g.chr1:52933891A>G	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.2927T>C	chr1.hg19:g.52933891A>G	ENSP00000360599:p.Leu976Ser	0					ZCCHC11_ENST00000257177.4_Missense_Mutation_p.L976S|ZCCHC11_ENST00000371541.1_5'UTR	p.L976S	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	1	2	3	2.063257	Q5TAX3	TUT4_HUMAN		15	3189	-			A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	0	1	hg19	c.2927T>C	CCDS30716.1	0	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157006	0.78114	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.076139	0.53938	D	0.000052	T	0.66346	0.2780	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.91635	0.946;0.999	T	0.64980	-0.6279	10	0.34782	T	0.22	.	15.5436	0.76077	1.0:0.0:0.0:0.0	.	735;976	E9PKX1;Q5TAX3	.;TUT4_HUMAN	S	976;976;905;735	ENSP00000257177:L976S;ENSP00000360599:L976S;ENSP00000433486:L905S;ENSP00000435256:L735S	ENSP00000257177:L976S	L	-	2	0	0	ZCCHC11	52706479	52706479	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.449000	0.80643	2.076000	0.62316	0.378000	0.23410	TTA	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.308	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	0	0	0		2	2	2	0		0	0	46		46	45	1	1.960000	-6.044622	1	0.560000	XM_038288			4	4		226	224	0		1	0		0	0	46	0		0.889083	3.009883e-02	0	0	0	12	0	4	226
ST6GALNAC5	81849	broad.mit.edu	37	1	77528872	77528872	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:77528872A>G	ENST00000477717.1	+	5	1227	c.992A>G	c.(991-993)gAg>gGg	p.E331G		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	331					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						AATCATCCTGAGAATAAACCT	0.433																																						ENST00000477717.1	1.000000	7.500000e-01	1.000000	0.840000	0.940000	0.931131	0.940000	1.000000																										0				18						c.(991-993)gAg>gGg		ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5							90.0	85.0	86.0					1																	77528872		2203	4300	6503	SO:0001583	missense	81849	0	0					g.chr1:77528872A>G		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.992A>G	chr1.hg19:g.77528872A>G	ENSP00000417583:p.Glu331Gly	0						p.E331G	NM_030965.1	NP_112227.1	1	2	3	2.063257	Q9BVH7	SIA7E_HUMAN		5	1227	+			B1AK82	Missense_Mutation	SNP	ENST00000477717.1	1	1	hg19	c.992A>G	CCDS673.1	1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.826269	0.32329	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.34667	1.35	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.501717	0.22376	N	0.060873	T	0.14960	0.0361	L	0.36672	1.1	0.36892	D	0.889957	B	0.21606	0.058	B	0.23419	0.046	T	0.08146	-1.0736	10	0.23302	T	0.38	-11.5623	11.4604	0.50206	0.8657:0.0:0.0:0.1343	.	331	Q9BVH7	SIA7E_HUMAN	G	331;241	ENSP00000417583:E331G	ENSP00000406658:E241G	E	+	2	0	0	ST6GALNAC5	77301460	77301460	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	3.139000	0.50577	2.267000	0.75376	0.533000	0.62120	GAG	0.564873		TCGA-3A-A9IZ-01A-12D-A40W-08	0.433	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	1	0	1		2	2	2	0		0	0	47		47	47	1	1.960000	-20.000000	1	0.560000	NM_030965			69	65		195	194	1		1	0		0	0	47	0		1.000000	3.926561e-01	0	0	0	5	0	69	195
XCL2	6846	broad.mit.edu	37	1	168510202	168510202	+	Silent	SNP	G	G	A	rs149372418	byFrequency	TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr1:168510202G>A	ENST00000367819.2	-	3	365	c.333C>T	c.(331-333)acC>acT	p.T111T		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	111					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.T111T(1)		large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					AGCCAGTCAGGGTCACAGCTG	0.498													G|||	2	0.000399361	0.0	0.0	5008	,	,		15935	0.001		0.0	False		,,,				2504	0.001					ENST00000367819.2	0.250000	5.000000e-02	0.200000	0.090000	0.130000	0.148240	0.130000	0.130000																										1	Substitution - coding silent(1)	p.T111T(1)	lung(1)	8						c.(331-333)acC>acT		chemokine (C motif) ligand 2		G		1,4405		0,1,2202	299.0	234.0	256.0		333	1.4	0.2	1	dbSNP_134	256	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	XCL2	NM_003175.3		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		111/115	168510202	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	6846	46	121390	36				g.chr1:168510202G>A	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.333C>T	chr1.hg19:g.168510202G>A		1						p.T111T	NM_003175.3	NP_003166.1	1	2	3	2.595994	Q9UBD3	XCL2_HUMAN		3	365	-	all_hematologic(923;0.215)			Silent	SNP	ENST00000367819.2	0	1	hg19	c.333C>T	CCDS1273.1	0																																																																																								0.656250		TCGA-3A-A9IZ-01A-12D-A40W-08	0.498	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	0	0	1		22	2	2	1		1	1	36		36	36	1	1.960000	-2.050794	0	0.560000	NM_003175			8	8		267	265	0		0			1	0	36	0		0.006145	0	0	0	0	0	0	8	267
RBM12	10137	broad.mit.edu	37	20	34241168	34241168	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr20:34241168G>A	ENST00000374114.3	-	3	2340	c.2077C>T	c.(2077-2079)Ccc>Tcc	p.P693S	CPNE1_ENST00000352393.4_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P693S|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.P693S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	693	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CCTGCACTGGGCATTCCCGCA	0.557																																						ENST00000374114.3	0.110000	1.000000e-02	0.090000	0.030000	0.050000	0.063263	0.050000	0.060000																										0				36						c.(2077-2079)Ccc>Tcc		RNA binding motif protein 12							49.0	47.0	48.0					20																	34241168		2199	4292	6491	SO:0001583	missense	10137	0	0					g.chr20:34241168G>A	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2077C>T	chr20.hg19:g.34241168G>A	ENSP00000363228:p.Pro693Ser	0					CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P693S|RBM12_ENST00000359646.1_Missense_Mutation_p.P693S|CPNE1_ENST00000397445.1_Intron	p.P693S	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	0	0	0	2.022515	Q9NTZ6	RBM12_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00953)	3	2340	-	Lung NSC(9;0.00608)|all_lung(11;0.00918)		B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	0	1	hg19	c.2077C>T	CCDS13261.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.653504	0.96724	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.22336	1.96;1.96;1.96	4.03	4.03	0.46877	4.03	4.03	0.46877	.	0.000000	0.64402	D	0.000018	T	0.27663	0.0680	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.02365	-1.1170	10	0.19590	T	0.45	-3.377	14.4866	0.67622	0.0:0.0:1.0:0.0	.	693	Q9NTZ6	RBM12_HUMAN	S	693;693;693;492	ENSP00000363228:P693S;ENSP00000352668:P693S;ENSP00000363217:P693S	ENSP00000339879:P492S	P	-	1	0	0	RBM12	33704582	33704582	0.002000	0.14202	0.997000	0.53966	0.903000	0.53119	-0.160000	0.10041	2.528000	0.85240	0.563000	0.77884	CCC	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.557	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	0	0	1		2	2	2	0		0	0	141		141	138	1	1.960000	-2.191687	0	0.560000	NM_006047			7	7		442	435	0		1	0		0	0	141	0		0.979506	2.841551e-01	0	0	0	59	0	7	442
WDR33	55339	broad.mit.edu	37	2	128471486	128471486	+	Silent	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:128471486G>A	ENST00000322313.4	-	18	3137	c.2979C>T	c.(2977-2979)ggC>ggT	p.G993G		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	993					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TGCAGTCCTGGCCACCCCGGA	0.662																																						ENST00000322313.4	0.180000	6.000000e-02	0.150000	0.080000	0.110000	0.118802	0.110000	0.120000																										0				39						c.(2977-2979)ggC>ggT		WD repeat domain 33							60.0	69.0	66.0					2																	128471486		2203	4300	6503	SO:0001819	synonymous_variant	55339	0	0					g.chr2:128471486G>A		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2979C>T	chr2.hg19:g.128471486G>A		0						p.G993G	NM_018383.4	NP_060853.3	1	2	3	2.031267	Q9C0J8	WDR33_HUMAN		18	3137	-	Colorectal(110;0.1)		Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	ENST00000322313.4	1	1	hg19	c.2979C>T	CCDS2150.1	0																																																																																								0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.662	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	0	0	1		2	2	2	0		0	0	118		118	116	1	1.960000	-3.165678	1	0.560000	NM_018383			18	17		552	544	0		1	0		0	0	118	0		0.999980	2.794856e-02	0	0	0	8	0	18	552
POTEE	445582	broad.mit.edu	37	2	131984442	131984442	+	Missense_Mutation	SNP	A	A	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:131984442A>C	ENST00000356920.5	+	4	951	c.857A>C	c.(856-858)cAa>cCa	p.Q286P	RNU6-127P_ENST00000390897.1_RNA|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.Q296P|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	286					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CAAAAACAGCAAGTCGTGAAA	0.328																																						ENST00000356920.5	0.240000	1.200000e-01	0.200000	0.140000	0.170000	0.176745	0.170000	0.180000																										0										c.(856-858)cAa>cCa		POTE ankyrin domain family, member E							96.0	113.0	107.0					2																	131984442		1503	2704	4207	SO:0001583	missense	445582	0	0					g.chr2:131984442A>C	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.857A>C	chr2.hg19:g.131984442A>C	ENSP00000439189:p.Gln286Pro	0					POTEE_ENST00000358087.5_Missense_Mutation_p.Q296P|RNU6-127P_ENST00000390897.1_RNA|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	p.Q286P	NM_001083538.1	NP_001077007.1	1	2	3	2.031267	Q6S8J3	POTEE_HUMAN		4	951	+			Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	0	1	hg19	c.857A>C	CCDS46414.1	0	.	.	.	.	.	.	.	.	.	.	.	10.33	1.320219	0.23994	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.63744	0.63;-0.06	1.16	1.16	0.20824	1.16	1.16	0.20824	Ankyrin repeat-containing domain (4);	3.765040	0.01962	U	0.043420	T	0.60495	0.2273	L	0.33668	1.02	0.09310	N	1	D	0.63880	0.993	P	0.51355	0.667	T	0.51371	-0.8714	10	0.87932	D	0	.	4.5417	0.12061	1.0:0.0:0.0:0.0	.	286	Q6S8J3	POTEE_HUMAN	P	286;296	ENSP00000439189:Q286P;ENSP00000443049:Q296P	ENSP00000439189:Q286P	Q	+	2	0	0	AC131180.1	131700912	131700912	0.229000	0.23729	0.024000	0.17045	0.083000	0.17756	1.857000	0.39399	0.784000	0.33661	0.136000	0.15936	CAA	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.328	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	169		169	180	1	1.960000	-20.000000	1	0.560000	NM_001083538			40	30		788	595	0		1			0	0	169	0		1.000000	0	0	0	0	0	0	40	788
GALNT5	11227	broad.mit.edu	37	2	158157419	158157419	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:158157419C>G	ENST00000259056.4	+	7	2832	c.2347C>G	c.(2347-2349)Ctg>Gtg	p.L783V	GALNT5_ENST00000463418.1_3'UTR|RN7SKP281_ENST00000410472.1_RNA	NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	783					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						GCAAAGGGAGCTGCGAAAGAA	0.498																																						ENST00000259056.4	1.000000	8.100000e-01	1.000000	0.910000	0.990000	0.971169	0.990000	1.000000																										0				56						c.(2347-2349)Ctg>Gtg		polypeptide N-acetylgalactosaminyltransferase 5							103.0	97.0	99.0					2																	158157419		2203	4300	6503	SO:0001583	missense	11227	0	0					g.chr2:158157419C>G	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.2347C>G	chr2.hg19:g.158157419C>G	ENSP00000259056:p.Leu783Val	0					GALNT5_ENST00000463418.1_3'UTR|RN7SKP281_ENST00000410472.1_RNA	p.L783V	NM_014568.1	NP_055383.1	1	2	3	2.031267	Q7Z7M9	GALT5_HUMAN		7	2832	+			A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	1	1	hg19	c.2347C>G	CCDS2203.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296112	0.81025	.	.	ENSG00000136542	ENST00000259056	T	0.57907	0.37	5.54	4.65	0.58169	5.54	4.65	0.58169	.	0.069082	0.56097	D	0.000030	T	0.69646	0.3134	M	0.79011	2.435	0.53688	D	0.999977	D	0.63880	0.993	P	0.62435	0.902	T	0.74293	-0.3712	10	0.87932	D	0	.	13.1441	0.59450	0.0:0.921:0.0:0.079	.	783	Q7Z7M9	GALT5_HUMAN	V	783	ENSP00000259056:L783V	ENSP00000259056:L783V	L	+	1	2	2	GALNT5	157865665	157865665	0.998000	0.40836	0.970000	0.41538	0.994000	0.84299	3.340000	0.52143	1.305000	0.44909	0.563000	0.77884	CTG	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.498	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	1	0	1		2	2	2	0		0	0	31		31	31	1	1.960000	-20.000000	1	0.560000	NM_014568			52	50		127	127	1		1	1		0	0	31	0		1.000000	9.999784e-01	0	21	0	22	0	52	127
ATAD2B	54454	broad.mit.edu	37	2	24051724	24051724	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:24051724C>T	ENST00000238789.5	-	15	2157	c.1814G>A	c.(1813-1815)tGt>tAt	p.C605Y	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	605						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCACCAACACATTTTTCAGC	0.368																																						ENST00000238789.5	1.000000	8.300000e-01	1.000000	0.930000	0.990000	0.975261	0.990000	1.000000																										0				1						c.(1813-1815)tGt>tAt		ATPase family, AAA domain containing 2B							111.0	107.0	108.0					2																	24051724		1860	4107	5967	SO:0001583	missense	54454	0	0					g.chr2:24051724C>T	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1814G>A	chr2.hg19:g.24051724C>T	ENSP00000238789:p.Cys605Tyr	0					ATAD2B_ENST00000474583.1_5'UTR	p.C605Y	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	1	2	3	2.029649	Q9ULI0	ATD2B_HUMAN		15	2157	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	1	1	hg19	c.1814G>A	CCDS46227.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287448	0.80803	.	.	ENSG00000119778	ENST00000238789;ENST00000458510	D;D	0.94862	-3.54;-1.68	4.85	4.85	0.62838	4.85	4.85	0.62838	.	.	.	.	.	D	0.96784	0.8950	M	0.82056	2.57	0.80722	D	1	P	0.52170	0.951	P	0.58077	0.832	D	0.97225	0.9880	9	0.72032	D	0.01	.	18.8549	0.92247	0.0:1.0:0.0:0.0	.	605	Q9ULI0	ATD2B_HUMAN	Y	605;43	ENSP00000238789:C605Y;ENSP00000392764:C43Y	ENSP00000238789:C605Y	C	-	2	0	0	ATAD2B	23905228	23905228	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.730000	0.84881	2.632000	0.89209	0.650000	0.86243	TGT	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.368	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	1	0	1		2	2	2	0		0	0	36		36	36	1	1.960000	-20.000000	1	0.560000	NM_017552			62	62		151	150	0		1	0		0	0	36	0		1.000000	3.364988e-01	0	0	0	4	0	62	151
DNMT3A	1788	broad.mit.edu	37	2	25468126	25468126	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:25468126C>G	ENST00000264709.3	-	13	1887	c.1550G>C	c.(1549-1551)tGc>tCc	p.C517S	DNMT3A_ENST00000321117.5_Missense_Mutation_p.C517S|DNMT3A_ENST00000380746.4_Missense_Mutation_p.C328S|DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000402667.1_Missense_Mutation_p.C294S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	517	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTACCTTGCAGTTTTGGCA	0.597			"""Mis, F, N, S"""		AML																																	ENST00000264709.3	1.000000	6.500000e-01	1.000000	0.770000	0.900000	0.893152	0.900000	1.000000				Rec	yes			Rec	yes		2	2p23	2p23	1788	Mis, F, N, S	DNA (cytosine-5-)-methyltransferase 3 alpha				L	L			AML		0				1021						c.(1549-1551)tGc>tCc		DNA (cytosine-5-)-methyltransferase 3 alpha							100.0	96.0	98.0					2																	25468126		2203	4300	6503	SO:0001583	missense	1788	0	0					g.chr2:25468126C>G		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1550G>C	chr2.hg19:g.25468126C>G	ENSP00000264709:p.Cys517Ser	0					DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000380746.4_Missense_Mutation_p.C328S|DNMT3A_ENST00000402667.1_Missense_Mutation_p.C294S|DNMT3A_ENST00000321117.5_Missense_Mutation_p.C517S	p.C517S	NM_175629.2	NP_783328.1	1	2	3	2.029649	Q9Y6K1	DNM3A_HUMAN		13	1887	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	1	1	hg19	c.1550G>C	CCDS33157.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.078236	0.94000	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.095869	0.64402	D	0.000001	T	0.57932	0.2087	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.97110	1.0;0.981	T	0.61048	-0.7141	10	0.72032	D	0.01	-8.9535	16.4462	0.83935	0.0:1.0:0.0:0.0	.	517;328	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	S	328;517;517;294	ENSP00000370122:C328S;ENSP00000324375:C517S;ENSP00000264709:C517S;ENSP00000384237:C294S	ENSP00000264709:C517S	C	-	2	0	0	DNMT3A	25321630	25321630	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.788000	0.69020	2.735000	0.93741	0.655000	0.94253	TGC	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.597	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	1	0	1		2	2	2	0		0	0	13		13	13	1	1.960000	-20.000000	1	0.560000	NM_022552			30	29		88	85	1		1	1		0	0	13	0		1.000000	9.336265e-01	0	3	0	13	0	30	88
STON1	11037	broad.mit.edu	37	2	48808480	48808480	+	Silent	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:48808480C>T	ENST00000406226.1	+	3	903	c.708C>T	c.(706-708)ctC>ctT	p.L236L	STON1_ENST00000309835.3_Silent_p.L236L|STON1-GTF2A1L_ENST00000394754.1_Silent_p.L236L|STON1-GTF2A1L_ENST00000309827.2_Silent_p.L236L|STON1-GTF2A1L_ENST00000402114.2_Silent_p.L236L|STON1-GTF2A1L_ENST00000394751.3_Silent_p.L236L|STON1-GTF2A1L_ENST00000405008.1_Silent_p.L236L|STON1_ENST00000404752.1_Silent_p.L236L	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	236					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTGAACATCTCCAGTCAGCTG	0.413																																						ENST00000406226.1	0.610000	3.300000e-01	0.530000	0.390000	0.450000	0.469748	0.450000	0.450000																										0				37						c.(706-708)ctC>ctT		stonin 1							86.0	79.0	82.0					2																	48808480		2203	4300	6503	SO:0001819	synonymous_variant	11037	0	0					g.chr2:48808480C>T	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.708C>T	chr2.hg19:g.48808480C>T		1					STON1_ENST00000404752.1_Silent_p.L236L|STON1-GTF2A1L_ENST00000394751.3_Silent_p.L236L|STON1-GTF2A1L_ENST00000405008.1_Silent_p.L236L|STON1-GTF2A1L_ENST00000394754.1_Silent_p.L236L|STON1-GTF2A1L_ENST00000402114.2_Silent_p.L236L|STON1_ENST00000309835.3_Silent_p.L236L|STON1-GTF2A1L_ENST00000309827.2_Silent_p.L236L	p.L236L	NM_001198595.1	NP_001185524.1	1	2	3	2.596143	Q9Y6Q2	STON1_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)	3	903	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	ENST00000406226.1	1	1	hg19	c.708C>T	CCDS1841.1	0																																																																																								0.654739		TCGA-3A-A9IZ-01A-12D-A40W-08	0.413	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	1	0	1		2	2	2	0		0	0	92		92	91	1	1.960000	-3.142702	1	0.560000	NM_006873			46	46		412	405	0		1	0		0	0	92	0		1.000000	1.059244e-02	0	0	0	2	0	46	412
GRB14	2888	broad.mit.edu	37	2	165353909	165353909	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr2:165353909G>A	ENST00000263915.3	-	10	1734	c.1196C>T	c.(1195-1197)gCg>gTg	p.A399V	GRB14_ENST00000543549.1_Missense_Mutation_p.A312V|GRB14_ENST00000497306.1_5'Flank	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	399					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TTCTTCAACCGCAACTGAAAG	0.393																																						ENST00000263915.3	0.080000	0	0.060000	0.010000	0.030000	0.041869	0.030000	0.040000																										0				32						c.(1195-1197)gCg>gTg		growth factor receptor-bound protein 14							98.0	100.0	99.0					2																	165353909		2203	4300	6503	SO:0001583	missense	2888	1	121412	31				g.chr2:165353909G>A		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1196C>T	chr2.hg19:g.165353909G>A	ENSP00000263915:p.Ala399Val	0					GRB14_ENST00000497306.1_5'Flank|GRB14_ENST00000543549.1_Missense_Mutation_p.A312V	p.A399V	NM_004490.2	NP_004481.2	1	2	3	2.031267	Q14449	GRB14_HUMAN		10	1734	-			B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	0	1	hg19	c.1196C>T	CCDS2222.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.400675	0.96030	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;T	0.39229	1.67;1.75;1.09	5.81	5.81	0.92471	5.81	5.81	0.92471	BPS (Between PH and SH2) domain (1);	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	M	0.79475	2.455	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.67900	0.954;0.954	T	0.68051	-0.5511	10	0.59425	D	0.04	-15.2997	20.0825	0.97783	0.0:0.0:1.0:0.0	.	312;399	B7Z7F9;Q14449	.;GRB14_HUMAN	V	399;312;354	ENSP00000263915:A399V;ENSP00000443699:A312V;ENSP00000416786:A354V	ENSP00000263915:A399V	A	-	2	0	0	GRB14	165062155	165062155	1.000000	0.71417	0.996000	0.52242	0.875000	0.50365	9.869000	0.99810	2.746000	0.94184	0.655000	0.94253	GCG	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.393	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2	0	0	1		18	2	2	1		1	1	95		95	95	1	1.960000	-2.049023	0	0.560000				5	5		501	492	0		0	0		1	0	95	0		0.004254	2.327568e-03	0	0	0	6	0	5	501
XPC	7508	broad.mit.edu	37	3	14209834	14209834	+	Silent	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr3:14209834G>A	ENST00000285021.7	-	4	673	c.459C>T	c.(457-459)ttC>ttT	p.F153F	XPC_ENST00000449060.2_Intron	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	153	Glu-rich (acidic).				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGATCGAGAGAAGGCTGTAC	0.418			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													ENST00000285021.7	1.000000	6.100000e-01	0.910000	0.700000	0.800000	0.809842	0.800000	1.000000			yes	Rec		Xeroderma pigmentosum (C)	yes	Rec		Xeroderma pigmentosum (C)	3	3p25	3p25	7508	Mis, N, F, S	"""xeroderma pigmentosum, complementation group C"""				E	E		skin basal cell, skin squamous cell, melanoma			0				22						c.(457-459)ttC>ttT	Nucleotide excision repair (NER)	xeroderma pigmentosum, complementation group C							60.0	60.0	60.0					3																	14209834		1923	4141	6064	SO:0001819	synonymous_variant	7508	0	0		Xeroderma Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	g.chr3:14209834G>A		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.459C>T	chr3.hg19:g.14209834G>A		0					XPC_ENST00000449060.2_Intron	p.F153F	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	0	0	0	2.025163	Q01831	XPC_HUMAN		4	673	-			B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Silent	SNP	ENST00000285021.7	1	1	hg19	c.459C>T	CCDS46763.1	0																																																																																								0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.418	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3	1	0	1		2	2	2	0		0	0	36		36	36	1	1.960000	-4.093461	1	0.560000	NM_004628			46	45		158	156	1		1	1		0	0	36	0		1.000000	9.006246e-01	0	4	0	12	0	46	158
MYH15	22989	broad.mit.edu	37	3	108149680	108149680	+	Splice_Site	SNP	T	T	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr3:108149680T>G	ENST00000273353.3	-	27	3427	c.3371A>C	c.(3370-3372)cAg>cCg	p.Q1124P		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1124						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ATTGATTACCTGAAGCTCTTT	0.368																																						ENST00000273353.3	1.000000	8.600000e-01	1.000000	0.950000	0.990000	0.983167	0.990000	1.000000																										0				105						c.(3370-3372)cAg>cCg		myosin, heavy chain 15							97.0	89.0	92.0					3																	108149680		1830	4093	5923	SO:0001630	splice_region_variant	22989	0	0					g.chr3:108149680T>G	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3372+1A>C	chr3.hg19:g.108149680T>G		0						p.Q1124P	NM_014981.1	NP_055796.1	0	0	0	2.022823	Q9Y2K3	MYH15_HUMAN		27	3427	-				Splice_Site	SNP	ENST00000273353.3	1	0	hg19	c.3371A>C	CCDS43127.1	1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.116301	0.37339	.	.	ENSG00000144821	ENST00000273353	T	0.80214	-1.35	5.35	1.36	0.22044	5.35	1.36	0.22044	Myosin tail (1);	.	.	.	.	D	0.88844	0.6547	M	0.89534	3.04	0.42303	D	0.992189	D	0.89917	1.0	D	0.97110	1.0	D	0.86321	0.1692	9	0.87932	D	0	.	5.6809	0.17776	0.2619:0.0733:0.0:0.6647	.	1124	Q9Y2K3	MYH15_HUMAN	P	1124	ENSP00000273353:Q1124P	ENSP00000273353:Q1124P	Q	-	2	0	0	MYH15	109632370	109632370	1.000000	0.71417	0.061000	0.19648	0.016000	0.09150	3.060000	0.49955	0.412000	0.25729	0.528000	0.53228	CAG	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.368	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	1	0	1		2	2	2	0		0	0	65		65	63	1	1.960000	-20.000000	1	0.560000	XM_036988	Missense_Mutation		82	81		196	193	1		1			0	0	65	0		1.000000	0	0	0	0	0	0	82	196
RPL15	6138	broad.mit.edu	37	3	23959499	23959499	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr3:23959499G>C	ENST00000307839.5	+	2	788	c.149G>C	c.(148-150)cGa>cCa	p.R50P	NKIRAS1_ENST00000437230.1_5'Flank|NKIRAS1_ENST00000443659.2_5'Flank|RPL15_ENST00000415719.1_Missense_Mutation_p.R50P|RPL15_ENST00000354811.5_Missense_Mutation_p.R50P|RPL15_ENST00000413699.1_Missense_Mutation_p.R50P|RPL15_ENST00000435882.1_Missense_Mutation_p.R50P|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000416026.2_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank|RPL15_ENST00000456530.2_Missense_Mutation_p.R50P|NKIRAS1_ENST00000412028.1_5'Flank|NKIRAS1_ENST00000415901.2_5'Flank	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	50					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						AAAGCGCGCCGACTGGGCTAC	0.557																																						ENST00000307839.5	0.190000	3.000000e-02	0.140000	0.050000	0.090000	0.102615	0.090000	0.080000																										0				7						c.(148-150)cGa>cCa		ribosomal protein L15							34.0	37.0	36.0					3																	23959499		2203	4300	6503	SO:0001583	missense	6138	0	0					g.chr3:23959499G>C	AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.149G>C	chr3.hg19:g.23959499G>C	ENSP00000309334:p.Arg50Pro	0					NKIRAS1_ENST00000437230.1_5'Flank|NKIRAS1_ENST00000412028.1_5'Flank|RPL15_ENST00000435882.1_Missense_Mutation_p.R50P|RPL15_ENST00000415719.1_Missense_Mutation_p.R50P|NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000416026.2_5'Flank|NKIRAS1_ENST00000388759.3_5'Flank|RPL15_ENST00000456530.2_Missense_Mutation_p.R50P|NKIRAS1_ENST00000425478.2_5'Flank|RPL15_ENST00000354811.5_Missense_Mutation_p.R50P|RPL15_ENST00000413699.1_Missense_Mutation_p.R50P|NKIRAS1_ENST00000443659.2_5'Flank	p.R50P	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	0	0	0	2.025163	P61313	RL15_HUMAN		2	788	+			P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Missense_Mutation	SNP	ENST00000307839.5	0	1	hg19	c.149G>C	CCDS2640.1	0	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133108	0.77662	.	.	ENSG00000174748	ENST00000307839;ENST00000422218;ENST00000434031;ENST00000413699;ENST00000456530;ENST00000412097;ENST00000510788;ENST00000435882;ENST00000415719;ENST00000354811	.	.	.	5.77	5.77	0.91146	5.77	5.77	0.91146	Ribosomal protein L15e, conserved site (1);Ribosomal protein L23/L15e (1);	0.000000	0.85682	U	0.000000	D	0.90068	0.6898	H	0.96720	3.87	0.80722	D	1	B;D;B;D	0.60160	0.013;0.987;0.092;0.965	B;D;B;D	0.71656	0.094;0.97;0.155;0.974	D	0.92718	0.6189	9	0.87932	D	0	.	20.0007	0.97408	0.0:0.0:1.0:0.0	.	50;50;50;50	B4DEN1;B4DLP4;Q642I1;P61313	.;.;.;RL15_HUMAN	P	50	.	ENSP00000309334:R50P	R	+	2	0	0	RPL15	23934503	23934503	1.000000	0.71417	0.995000	0.50966	0.515000	0.34225	7.956000	0.87863	2.726000	0.93360	0.650000	0.86243	CGA	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.557	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252885.3	0	0	0		2	2	2	0		0	0	36		36	39	1	1.960000	-6.459283	1	0.560000	NM_002948			5	4		201	195	0		1	1		0	0	36	0		0.932476	9.999850e-01	0	31	0	1533	0	5	201
SEMA3G	56920	broad.mit.edu	37	3	52471991	52471991	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr3:52471991C>G	ENST00000231721.2	-	14	1733	c.1734G>C	c.(1732-1734)caG>caC	p.Q578H		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	578	Ig-like C2-type.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		ACTCACCTTCCTGGCTCTGGC	0.672																																						ENST00000231721.2	0.280000	4.000000e-02	0.200000	0.070000	0.120000	0.143070	0.120000	0.120000																										0				18						c.(1732-1734)caG>caC		sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G							17.0	18.0	18.0					3																	52471991		2171	4252	6423	SO:0001583	missense	56920	0	0					g.chr3:52471991C>G		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1734G>C	chr3.hg19:g.52471991C>G	ENSP00000231721:p.Gln578His	0						p.Q578H	NM_020163.1	NP_064548.1	0	0	0	2.022823	Q9NS98	SEM3G_HUMAN		14	1733	-			Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	0	1	hg19	c.1734G>C	CCDS2856.1	0	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809149	0.31961	.	.	ENSG00000010319	ENST00000231721	T	0.30714	1.52	5.09	3.22	0.36961	5.09	3.22	0.36961	Immunoglobulin-like (1);	0.329295	0.29225	N	0.012777	T	0.15565	0.0375	N	0.08118	0	0.22266	N	0.999244	B	0.02656	0.0	B	0.10450	0.005	T	0.17561	-1.0365	10	0.38643	T	0.18	.	10.4033	0.44241	0.0:0.7738:0.146:0.0801	.	578	Q9NS98	SEM3G_HUMAN	H	578	ENSP00000231721:Q578H	ENSP00000231721:Q578H	Q	-	3	2	2	SEMA3G	52447031	52447031	0.001000	0.12720	0.978000	0.43139	0.977000	0.68977	0.311000	0.19380	1.388000	0.46506	0.655000	0.94253	CAG	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.672	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	1	0	1		2	2	2	0		0	0	24		24	23	1	1.960000	-6.992705	1	0.560000	NM_020163			4	4		118	116	0		1	0		0	0	24	0		0.885718	1.060836e-02	0	1	0	3	0	4	118
FNDC3B	64778	broad.mit.edu	37	3	172028627	172028627	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr3:172028627G>C	ENST00000336824.4	+	11	1309	c.1210G>C	c.(1210-1212)Gac>Cac	p.D404H	FNDC3B_ENST00000415807.2_Missense_Mutation_p.D404H|FNDC3B_ENST00000416957.1_Missense_Mutation_p.D404H	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	404	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		GGCACCAATTGACAACGGTTC	0.343																																						ENST00000336824.4	0.250000	1.100000e-01	0.220000	0.140000	0.170000	0.186221	0.170000	0.180000																										0				69						c.(1210-1212)Gac>Cac		fibronectin type III domain containing 3B							210.0	221.0	217.0					3																	172028627		2203	4300	6503	SO:0001583	missense	64778	0	0					g.chr3:172028627G>C	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1210G>C	chr3.hg19:g.172028627G>C	ENSP00000338523:p.Asp404His	1					FNDC3B_ENST00000415807.2_Missense_Mutation_p.D404H|FNDC3B_ENST00000416957.1_Missense_Mutation_p.D404H	p.D404H	NM_001135095.1	NP_001128567.1	1	2	3	2.633929	Q53EP0	FND3B_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	11	1309	+	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	1	1	hg19	c.1210G>C	CCDS3217.1	0	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754948	0.89843	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.58940	0.3;0.3;0.3	5.9	5.9	0.94986	5.9	5.9	0.94986	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81950	0.4931	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.987	D	0.84606	0.0675	10	0.87932	D	0	-29.8321	19.8634	0.96793	0.0:0.0:1.0:0.0	.	404;404	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	H	404	ENSP00000411242:D404H;ENSP00000338523:D404H;ENSP00000389094:D404H	ENSP00000338523:D404H	D	+	1	0	0	FNDC3B	173511321	173511321	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.709000	0.91379	2.800000	0.96347	0.591000	0.81541	GAC	0.656250		TCGA-3A-A9IZ-01A-12D-A40W-08	0.343	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	0	0	1		22	6	2	1		1	1	117		117	113	1	1.960000	-4.086988	1	0.560000	NM_022763			31	31		752	743	0		1	0		1	0	117	0		0.911797	3.389468e-01	0	4	0	112	0	31	752
SLC12A2	6558	broad.mit.edu	37	5	127488461	127488461	+	Missense_Mutation	SNP	G	G	A	rs373411636		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:127488461G>A	ENST00000262461.2	+	15	2516	c.2327G>A	c.(2326-2328)cGt>cAt	p.R776H	SLC12A2_ENST00000343225.4_Missense_Mutation_p.R776H	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	776					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	CATTCAATTCGTCTTTCTGGA	0.413																																						ENST00000262461.2	1.000000	7.100000e-01	0.950000	0.790000	0.860000	0.872082	0.860000	1.000000																										0				48						c.(2326-2328)cGt>cAt		solute carrier family 12 (sodium/potassium/chloride transporter), member 2	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	121.0	114.0	117.0		2327	5.3	1.0	5		117	0,8600		0,0,4300	no	missense	SLC12A2	NM_001046.2	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	776/1213	127488461	2,13004	2203	4300	6503	SO:0001583	missense	6558	3	121412	38				g.chr5:127488461G>A		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2327G>A	chr5.hg19:g.127488461G>A	ENSP00000262461:p.Arg776His	0					SLC12A2_ENST00000343225.4_Missense_Mutation_p.R776H	p.R776H	NM_001046.2	NP_001037.1	1	2	3	2.046659	P55011	S12A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	15	2516	+		all_cancers(142;0.0972)|Prostate(80;0.151)	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	1	1	hg19	c.2327G>A	CCDS4144.1	1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070173	0.55539	4.54E-4	0.0	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98792	-5.14;-5.14	5.27	5.27	0.74061	5.27	5.27	0.74061	Amino acid permease domain (1);	0.215343	0.46758	D	0.000270	D	0.97383	0.9144	L	0.56199	1.76	0.58432	D	0.999999	B;B	0.19445	0.029;0.036	B;B	0.19148	0.014;0.024	D	0.95103	0.8232	10	0.42905	T	0.14	.	19.0718	0.93140	0.0:0.0:1.0:0.0	.	776;776	P55011-3;P55011	.;S12A2_HUMAN	H	776	ENSP00000262461:R776H;ENSP00000340878:R776H	ENSP00000262461:R776H	R	+	2	0	0	SLC12A2	127516360	127516360	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.777000	0.55364	2.746000	0.94184	0.460000	0.39030	CGT	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.413	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	1	0	1		2	2	2	0		0	0	84		84	82	1	1.960000	-20.000000	1	0.560000	NM_001046			93	91		291	286	1		1	1		0	0	84	0		1.000000	9.999978e-01	0	27	0	34	0	93	291
PCDHGB7	56099	broad.mit.edu	37	5	140799066	140799066	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:140799066G>C	ENST00000398594.2	+	1	1640	c.1640G>C	c.(1639-1641)aGc>aCc	p.S547T	PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	547	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAATGTGAGCCTGCGCGTG	0.711																																						ENST00000398594.2	1.000000	7.200000e-01	1.000000	0.810000	0.910000	0.908974	0.910000	1.000000																										0				56						c.(1639-1641)aGc>aCc		protocadherin gamma subfamily B, 7							27.0	33.0	31.0					5																	140799066		2079	4193	6272	SO:0001583	missense	56099	0	0					g.chr5:140799066G>C	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1640G>C	chr5.hg19:g.140799066G>C	ENSP00000381594:p.Ser547Thr	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank	p.S547T	NM_018927.3	NP_061750.1	1	2	3	2.046659	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1640	+			Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	1	1	hg19	c.1640G>C	CCDS47293.1	1	.	.	.	.	.	.	.	.	.	.	g	8.119	0.780447	0.16120	.	.	ENSG00000254122	ENST00000398594	T	0.46819	0.86	5.38	4.49	0.54785	5.38	4.49	0.54785	Cadherin (5);Cadherin-like (1);	0.234553	0.20219	U	0.096729	T	0.20170	0.0485	N	0.01424	-0.875	0.21325	N	0.999726	P;B	0.35107	0.484;0.208	B;B	0.38225	0.268;0.108	T	0.13845	-1.0494	10	0.16896	T	0.51	.	8.4342	0.32778	0.0:0.3785:0.4932:0.1283	.	547;547	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	T	547	ENSP00000381594:S547T	ENSP00000381594:S547T	S	+	2	0	0	PCDHGB7	140779250	140779250	0.000000	0.05858	1.000000	0.80357	0.968000	0.65278	0.243000	0.18106	2.513000	0.84729	0.491000	0.48974	AGC	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.711	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	1	0	1		2	2	2	0		0	0	55		55	53	1	1.960000	-20.000000	1	0.560000	NM_018927			58	58		169	166	1		1	0		0	0	55	0		1.000000	0	0	0	0	1	0	58	169
DOCK2	1794	broad.mit.edu	37	5	169267840	169267840	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:169267840G>A	ENST00000256935.8	+	27	2863	c.2783G>A	c.(2782-2784)cGg>cAg	p.R928Q	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.R420Q	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	928					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCATGGGCCGGGATCACATT	0.453																																						ENST00000256935.8	1.000000	6.200000e-01	0.980000	0.730000	0.840000	0.849328	0.840000	1.000000																										0				160						c.(2782-2784)cGg>cAg		dedicator of cytokinesis 2							124.0	107.0	113.0					5																	169267840		2203	4300	6503	SO:0001583	missense	1794	2	121402	29				g.chr5:169267840G>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2783G>A	chr5.hg19:g.169267840G>A	ENSP00000256935:p.Arg928Gln	0					DOCK2_ENST00000520908.1_Missense_Mutation_p.R420Q|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_5'UTR	p.R928Q	NM_004946.2	NP_004937.1	1	2	3	2.046659	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	27	2863	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	1	1	hg19	c.2783G>A	CCDS4371.1	0	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350030	0.82132	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908;ENST00000519628	T;T	0.68331	-0.32;-0.32	5.28	5.28	0.74379	5.28	5.28	0.74379	.	0.120890	0.56097	D	0.000022	T	0.65481	0.2695	M	0.71036	2.16	0.80722	D	1	P;P	0.52061	0.95;0.67	B;B	0.40864	0.342;0.098	T	0.67597	-0.5630	10	0.30854	T	0.27	.	15.8081	0.78531	0.0:0.0:1.0:0.0	.	420;928	E7ERW7;Q92608	.;DOCK2_HUMAN	Q	928;309;420;132	ENSP00000256935:R928Q;ENSP00000429283:R420Q	ENSP00000256935:R928Q	R	+	2	0	0	DOCK2	169200418	169200418	1.000000	0.71417	0.998000	0.56505	0.726000	0.41606	6.268000	0.72552	2.460000	0.83146	0.585000	0.79938	CGG	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.453	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	1	0	1		2	2	2	0		0	0	30		30	30	1	1.960000	-3.899043	1	0.560000	NM_004946			38	37		123	122	1		1	0		0	0	30	0		1.000000	5.835703e-02	0	0	0	2	0	38	123
SLC9A3	6550	broad.mit.edu	37	5	476656	476656	+	Splice_Site	SNP	A	A	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:476656A>G	ENST00000264938.3	-	12	1900		c.e12+1		CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|SLC9A3_ENST00000514375.1_Splice_Site	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGCAGTGCCCACCTCCTGCCG	0.701																																						ENST00000264938.3	0.460000	1.200000e-01	0.360000	0.180000	0.260000	0.275145	0.260000	0.240000																										0				37						c.e12+1		solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3							32.0	33.0	32.0					5																	476656		2203	4299	6502	SO:0001630	splice_region_variant	6550	0	0					g.chr5:476656A>G		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1890+1T>C	chr5.hg19:g.476656A>G		1					CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|SLC9A3_ENST00000514375.1_Splice_Site|CTD-2228K2.7_ENST00000606288.1_RNA		NM_004174.2	NP_004165.2	1	2	3	2.603320	P48764	SL9A3_HUMAN	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)	12	1900	-			B7ZKR2|E9PF67|Q3MIW3	Splice_Site	SNP	ENST00000264938.3	1	1	hg19		CCDS3855.1	0	.	.	.	.	.	.	.	.	.	.	A	11.92	1.781915	0.31502	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	.	.	.	4.8	4.8	0.61643	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0046	0.64456	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	SLC9A3	529656	529656	1.000000	0.71417	0.988000	0.46212	0.288000	0.27193	4.943000	0.63554	1.799000	0.52666	0.459000	0.35465	.	0.656250		TCGA-3A-A9IZ-01A-12D-A40W-08	0.701	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	0	0	1		2	2	2	0		0	0	22		22	21	1	1.960000	-12.020620	1	0.560000	NM_004174	Intron		8	7		139	133	0		1	0		0	0	22	0		0.987794	8.434371e-02	0	0	0	8	0	8	139
ADAMTS12	81792	broad.mit.edu	37	5	33881302	33881302	+	Silent	SNP	G	G	A	rs200507261		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:33881302G>A	ENST00000504830.1	-	2	746	c.411C>T	c.(409-411)ccC>ccT	p.P137P	ADAMTS12_ENST00000352040.3_Silent_p.P137P|ADAMTS12_ENST00000515401.1_Silent_p.P137P	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	137					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GATGGCAGAGGGGGGCAGAGG	0.532										HNSCC(64;0.19)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		19188	0.0		0.0	False		,,,				2504	0.0					ENST00000504830.1	0.190000	2.000000e-02	0.130000	0.040000	0.080000	0.099910	0.080000	0.080000																										0				216						c.(409-411)ccC>ccT		ADAM metallopeptidase with thrombospondin type 1 motif, 12							66.0	65.0	65.0					5																	33881302		2203	4300	6503	SO:0001819	synonymous_variant	81792	2	121412	35				g.chr5:33881302G>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.411C>T	chr5.hg19:g.33881302G>A		0	HNSCC(64;0.19)				ADAMTS12_ENST00000352040.3_Silent_p.P137P|ADAMTS12_ENST00000515401.1_Silent_p.P137P	p.P137P	NM_030955.2	NP_112217.2	1	2	3	2.049225	P58397	ATS12_HUMAN		2	746	-			A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	0	1	hg19	c.411C>T	CCDS34140.1	0																																																																																								0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.532	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	0	0	1		2	2	2	0		0	0	46		46	44	1	1.960000	-3.287924	1	0.560000	NM_030955			5	5		229	223	0		1	0		0	0	46	0		0.933862	1.467768e-01	0	0	0	26	0	5	229
NIPBL	25836	broad.mit.edu	37	5	37022228	37022228	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:37022228G>A	ENST00000282516.8	+	28	5903	c.5404G>A	c.(5404-5406)Gta>Ata	p.V1802I	NIPBL_ENST00000448238.2_Missense_Mutation_p.V1802I	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1802					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GGTTGTTGCTGTAGACCCCAG	0.358																																						ENST00000282516.8	0.200000	2.000000e-02	0.140000	0.050000	0.080000	0.106880	0.080000	0.080000																										0				128						c.(5404-5406)Gta>Ata		Nipped-B homolog (Drosophila)							124.0	114.0	117.0					5																	37022228		2203	4300	6503	SO:0001583	missense	25836	0	0					g.chr5:37022228G>A	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5404G>A	chr5.hg19:g.37022228G>A	ENSP00000282516:p.Val1802Ile	0					NIPBL_ENST00000448238.2_Missense_Mutation_p.V1802I	p.V1802I	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	1	2	3	2.049225	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)	28	5903	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	0	1	hg19	c.5404G>A	CCDS3920.1	0	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353414	0.82243	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.87334	-2.24;-2.24	5.24	4.35	0.52113	5.24	4.35	0.52113	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89818	0.6825	L	0.40543	1.245	0.58432	D	0.999992	D;D	0.64830	0.992;0.994	D;D	0.68483	0.958;0.948	D	0.88745	0.3246	10	0.34782	T	0.22	.	16.1087	0.81244	0.0:0.1342:0.8658:0.0	.	1802;1802	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	I	1802	ENSP00000282516:V1802I;ENSP00000406266:V1802I	ENSP00000282516:V1802I	V	+	1	0	0	NIPBL	37057985	37057985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.384000	0.97219	1.300000	0.44818	0.650000	0.86243	GTA	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.358	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	0	0	1		2	2	2	0		0	0	50		50	47	1	1.960000	-3.336058	1	0.560000	NM_015384			5	5		212	211	0		1	0		0	0	50	0		0.937507	2.500449e-01	0	0	0	35	0	5	212
HCN1	348980	broad.mit.edu	37	5	45262090	45262090	+	Missense_Mutation	SNP	C	C	T	rs372807250		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:45262090C>T	ENST00000303230.4	-	8	2663	c.2606G>A	c.(2605-2607)aGa>aAa	p.R869K		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	869					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GGAAGATTCTCTTGGAAGAGC	0.537																																						ENST00000303230.4	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.997852	0.990000	1.000000																										0				156						c.(2605-2607)aGa>aAa		hyperpolarization activated cyclic nucleotide-gated potassium channel 1		C	LYS/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	90.0	85.0		2606	4.9	1.0	5		85	0,8600		0,0,4300	no	missense	HCN1	NM_021072.3	26	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	869/891	45262090	1,13005	2203	4300	6503	SO:0001583	missense	348980	3	121412	38				g.chr5:45262090C>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2606G>A	chr5.hg19:g.45262090C>T	ENSP00000307342:p.Arg869Lys	0						p.R869K	NM_021072.3	NP_066550.2	1	2	3	2.049225	O60741	HCN1_HUMAN		8	2663	-				Missense_Mutation	SNP	ENST00000303230.4	1	1	hg19	c.2606G>A	CCDS3952.1	1	.	.	.	.	.	.	.	.	.	.	c	9.791	1.177962	0.21787	2.27E-4	0.0	ENSG00000164588	ENST00000303230	D	0.97575	-4.44	4.87	4.87	0.63330	4.87	4.87	0.63330	.	0.082787	0.49305	D	0.000148	D	0.90865	0.7130	N	0.04880	-0.145	0.36584	D	0.873737	B	0.09022	0.002	B	0.09377	0.004	D	0.88891	0.3346	10	0.36615	T	0.2	.	11.8404	0.52350	0.0:0.9193:0.0:0.0807	.	869	O60741	HCN1_HUMAN	K	869	ENSP00000307342:R869K	ENSP00000307342:R869K	R	-	2	0	0	HCN1	45297847	45297847	1.000000	0.71417	0.996000	0.52242	0.361000	0.29550	1.995000	0.40767	2.399000	0.81585	0.651000	0.88453	AGA	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.537	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	1	0	1		2	2	2	0		0	0	105		105	101	1	1.960000	-11.834740	1	0.560000	NM_021072			173	170		392	382	1		1			0	0	105	0		1.000000	0	0	0	0	0	0	173	392
ADAMTS2	9509	broad.mit.edu	37	5	178585787	178585787	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr5:178585787C>T	ENST00000251582.7	-	6	1170	c.1069G>A	c.(1069-1071)Gat>Aat	p.D357N	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.D357N	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	357	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGGTATTCATCGTGGCCCGTG	0.612																																						ENST00000251582.7	1.000000	8.300000e-01	1.000000	0.910000	0.990000	0.967202	0.990000	1.000000																										0				72						c.(1069-1071)Gat>Aat		ADAM metallopeptidase with thrombospondin type 1 motif, 2							151.0	130.0	137.0					5																	178585787		2203	4300	6503	SO:0001583	missense	9509	5	121412	39				g.chr5:178585787C>T	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1069G>A	chr5.hg19:g.178585787C>T	ENSP00000251582:p.Asp357Asn	0					ADAMTS2_ENST00000274609.5_Missense_Mutation_p.D357N	p.D357N	NM_014244.4	NP_055059.2	1	2	3	2.046659	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	6	1170	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)		Missense_Mutation	SNP	ENST00000251582.7	1	1	hg19	c.1069G>A	CCDS4444.1	1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780745	0.31502	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.62788	0.0;0.0	5.73	5.73	0.89815	5.73	5.73	0.89815	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.373747	0.22328	N	0.061514	T	0.51686	0.1689	L	0.31476	0.935	0.41488	D	0.988209	D;P	0.56035	0.974;0.874	B;B	0.39503	0.301;0.254	T	0.54200	-0.8329	10	0.35671	T	0.21	.	18.8826	0.92362	0.0:1.0:0.0:0.0	.	357;357	O95450-2;O95450	.;ATS2_HUMAN	N	357	ENSP00000251582:D357N;ENSP00000274609:D357N	ENSP00000251582:D357N	D	-	1	0	0	ADAMTS2	178518393	178518393	1.000000	0.71417	0.556000	0.28293	0.068000	0.16541	5.858000	0.69532	2.695000	0.91970	0.650000	0.86243	GAT	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.612	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	1	0	0		2	2	2	0		0	0	73		73	70	1	1.960000	-7.055285	1	0.560000	NM_014244			105	100		273	269	1		1	1		0	0	73	0		1.000000	9.999998e-01	0	2	0	60	0	105	273
KIAA0319	9856	broad.mit.edu	37	6	24582552	24582552	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr6:24582552C>T	ENST00000378214.3	-	6	1640	c.1116G>A	c.(1114-1116)tgG>tgA	p.W372*	KIAA0319_ENST00000430948.2_Nonsense_Mutation_p.W327*|KIAA0319_ENST00000535378.1_Nonsense_Mutation_p.W363*|KIAA0319_ENST00000537886.1_Nonsense_Mutation_p.W372*|KIAA0319_ENST00000543707.1_Nonsense_Mutation_p.W372*	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	372	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TTATTAAATTCCATTCATAGT	0.388																																						ENST00000378214.3	1.000000	8.300000e-01	1.000000	0.900000	0.970000	0.960227	0.970000	1.000000																										0				53						c.(1114-1116)tgG>tgA		KIAA0319							264.0	253.0	257.0					6																	24582552		2203	4300	6503	SO:0001587	stop_gained	9856	0	0					g.chr6:24582552C>T	AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1116G>A	chr6.hg19:g.24582552C>T	ENSP00000367459:p.Trp372*	0					KIAA0319_ENST00000430948.2_Nonsense_Mutation_p.W327*|KIAA0319_ENST00000535378.1_Nonsense_Mutation_p.W363*|KIAA0319_ENST00000543707.1_Nonsense_Mutation_p.W372*|KIAA0319_ENST00000537886.1_Nonsense_Mutation_p.W372*	p.W372*	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	0	0	0	2.023190	Q5VV43	K0319_HUMAN		6	1640	-			A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Nonsense_Mutation	SNP	ENST00000378214.3	0	1	hg19	c.1116G>A	CCDS34348.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.560686	0.98358	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	.	.	.	4.22	4.22	0.49857	4.22	4.22	0.49857	.	0.084787	0.50627	D	0.000107	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3723	16.7793	0.85559	0.0:1.0:0.0:0.0	.	.	.	.	X	372;363;327;372;372	.	ENSP00000367459:W372X	W	-	3	0	0	KIAA0319	24690531	24690531	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.029000	0.70895	2.156000	0.67533	0.484000	0.47621	TGG	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.388	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	1	0	1		2	2	2	0		0	0	95		95	91	1	1.960000	-20.000000	1	0.560000	NM_014809			134	133		355	351	0		1			0	0	95	0		1.000000	0	0	0	0	0	0	134	355
CREB5	9586	broad.mit.edu	37	7	28610110	28610110	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr7:28610110C>A	ENST00000357727.2	+	5	809	c.419C>A	c.(418-420)tCc>tAc	p.S140Y	CREB5_ENST00000409603.1_Missense_Mutation_p.S107Y|CREB5_ENST00000396300.2_Missense_Mutation_p.S133Y|CREB5_ENST00000396299.2_Missense_Mutation_p.S107Y	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	140					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						TCGCCTCAGTCCAGCTCTGTC	0.622																																						ENST00000357727.2	1.000000	7.600000e-01	1.000000	0.840000	0.930000	0.928154	0.930000	1.000000																										0				32						c.(418-420)tCc>tAc		cAMP responsive element binding protein 5							116.0	100.0	105.0					7																	28610110		2203	4300	6503	SO:0001583	missense	9586	0	0					g.chr7:28610110C>A	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.419C>A	chr7.hg19:g.28610110C>A	ENSP00000350359:p.Ser140Tyr	0					CREB5_ENST00000396300.2_Missense_Mutation_p.S133Y|CREB5_ENST00000409603.1_Missense_Mutation_p.S107Y|CREB5_ENST00000396299.2_Missense_Mutation_p.S107Y	p.S140Y	NM_182898.2	NP_878901.2	1	2	3	2.035720	Q02930	CREB5_HUMAN		5	809	+			A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	1	1	hg19	c.419C>A	CCDS5417.1	1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916836	0.73098	.	.	ENSG00000146592	ENST00000396299;ENST00000357727;ENST00000396300;ENST00000409603	T;T;T;T	0.66460	-0.21;-0.21;-0.2;-0.21	5.45	5.45	0.79879	5.45	5.45	0.79879	.	0.100681	0.64402	D	0.000001	D	0.82318	0.5011	M	0.73962	2.25	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.83827	0.0250	10	0.72032	D	0.01	-14.944	19.2936	0.94112	0.0:1.0:0.0:0.0	.	140	Q02930	CREB5_HUMAN	Y	107;140;133;107	ENSP00000379593:S107Y;ENSP00000350359:S140Y;ENSP00000379594:S133Y;ENSP00000387197:S107Y	ENSP00000350359:S140Y	S	+	2	0	0	CREB5	28576635	28576635	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.205000	0.77881	2.583000	0.87209	0.650000	0.86243	TCC	0.561229		TCGA-3A-A9IZ-01A-12D-A40W-08	0.622	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	0	0	1		2	2	2	1		1	0	45		45	41	1	1.960000	-20.000000	1	0.560000	NM_004904			79	76		222	214	0		1	0		1	0	45	0		1.000000	2.861770e-01	0	0	0	4	0	79	222
PPP1R3A	5506	broad.mit.edu	37	7	113518053	113518053	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr7:113518053C>G	ENST00000284601.3	-	4	3162	c.3094G>C	c.(3094-3096)Gta>Cta	p.V1032L		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1032					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CCAGAGCTTACTAATCCTTCA	0.403																																						ENST00000284601.3	1.000000	7.700000e-01	0.960000	0.830000	0.890000	0.899845	0.890000	1.000000																										0				121						c.(3094-3096)Gta>Cta		protein phosphatase 1, regulatory subunit 3A							197.0	192.0	193.0					7																	113518053		2203	4299	6502	SO:0001583	missense	5506	0	0					g.chr7:113518053C>G	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3094G>C	chr7.hg19:g.113518053C>G	ENSP00000284601:p.Val1032Leu	0						p.V1032L	NM_002711.3	NP_002702.2	0	0	0	2.017843	Q16821	PPR3A_HUMAN		4	3162	-			A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	1	1	hg19	c.3094G>C	CCDS5759.1	1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.552420	0.00918	.	.	ENSG00000154415	ENST00000284601	T	0.14391	2.51	5.71	-1.44	0.08856	5.71	-1.44	0.08856	.	0.595751	0.16550	N	0.209508	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28299	-1.0048	10	0.56958	D	0.05	0.0241	0.9691	0.01412	0.2108:0.1318:0.2531:0.4042	.	1032	Q16821	PPR3A_HUMAN	L	1032	ENSP00000284601:V1032L	ENSP00000284601:V1032L	V	-	1	0	0	PPP1R3A	113305289	113305289	0.002000	0.14202	0.000000	0.03702	0.120000	0.20174	-0.006000	0.12833	-0.436000	0.07254	-0.300000	0.09419	GTA	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	1	0	1		2	2	2	0		0	0	150		150	148	1	1.960000	-20.000000	1	0.560000	NM_002711			163	160		484	478	1		1			0	0	150	0		1.000000	0	0	0	0	0	0	163	484
OXR1	55074	broad.mit.edu	37	8	107705020	107705020	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr8:107705020G>A	ENST00000442977.2	+	6	692	c.593G>A	c.(592-594)cGa>cAa	p.R198Q	OXR1_ENST00000445937.1_Missense_Mutation_p.R197Q|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000531443.1_Missense_Mutation_p.R197Q|OXR1_ENST00000517566.2_Missense_Mutation_p.R197Q|OXR1_ENST00000312046.6_Missense_Mutation_p.R190Q|OXR1_ENST00000497705.1_Missense_Mutation_p.R130Q	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	198					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CGACCTGCACGAGTTGTATCT	0.348																																						ENST00000442977.2	1.000000	7.700000e-01	1.000000	0.850000	0.940000	0.936374	0.940000	1.000000																										0				31						c.(592-594)cGa>cAa		oxidation resistance 1							79.0	81.0	80.0					8																	107705020		2203	4300	6503	SO:0001583	missense	55074	5	121412	36				g.chr8:107705020G>A	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.593G>A	chr8.hg19:g.107705020G>A	ENSP00000405424:p.Arg198Gln	1					OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000312046.6_Missense_Mutation_p.R190Q|OXR1_ENST00000445937.1_Missense_Mutation_p.R197Q|OXR1_ENST00000531443.1_Missense_Mutation_p.R197Q|OXR1_ENST00000497705.1_Missense_Mutation_p.R130Q|OXR1_ENST00000517566.2_Missense_Mutation_p.R197Q	p.R198Q	NM_001198532.1	NP_001185461.1	1	2	3	2.535813	Q8N573	OXR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)	6	692	+			A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	1	1	hg19	c.593G>A	CCDS56548.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.008905|4.008905	0.75046|0.75046	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000517455|ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046	.|T;T;T;T;T;T	.|0.25414	.|2.62;2.62;2.61;2.61;1.8;2.64	5.06|5.06	5.06|5.06	0.68205|0.68205	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.33323|0.33323	0.0859|0.0859	L|L	0.52573|0.52573	1.65|1.65	0.80722|0.80722	D|D	1|1	.|P;P;P;P	.|0.52692	.|0.903;0.843;0.955;0.955	.|B;B;P;B	.|0.47299	.|0.283;0.147;0.543;0.392	T|T	0.06338|0.06338	-1.0832|-1.0832	5|10	.|0.46703	.|T	.|0.11	-14.7806|-14.7806	17.9993|17.9993	0.89194|0.89194	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|190;198;130;197	.|Q8N573-2;Q8N573;Q8N573-3;Q8N573-5	.|.;OXR1_HUMAN;.;.	K|Q	114|197;197;197;198;130;190	.|ENSP00000402918:R197Q;ENSP00000431966:R197Q;ENSP00000429205:R197Q;ENSP00000405424:R198Q;ENSP00000431014:R130Q;ENSP00000311026:R190Q	.|ENSP00000311026:R190Q	E|R	+|+	1|2	0|0	0|0	OXR1|OXR1	107774196|107774196	107774196|107774196	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.329000|0.329000	0.28539|0.28539	7.352000|7.352000	0.79404|0.79404	2.336000|2.336000	0.79503|0.79503	0.467000|0.467000	0.42956|0.42956	GAG|CGA	0.651678		TCGA-3A-A9IZ-01A-12D-A40W-08	0.348	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1		2	5	2	1		1	0	57		57	57	1	1.960000	-3.145317	1	0.560000	NM_181354			89	89		336	328	1		1	1		1	0	57	0		1.000000	9.720256e-01	0	17	0	29	0	89	336
ABRA	137735	broad.mit.edu	37	8	107782407	107782407	+	Silent	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr8:107782407G>A	ENST00000311955.3	-	1	66	c.12C>T	c.(10-12)ggC>ggT	p.G4G		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TTTCCTTTTCGCCCGGAGCCA	0.592																																						ENST00000311955.3	1.000000	5.000000e-02	0.190000	0.080000	0.120000	0.174723	0.120000	0.120000																										0				27						c.(10-12)ggC>ggT		actin-binding Rho activating protein																																				SO:0001819	synonymous_variant	137735	1	121364	29				g.chr8:107782407G>A	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.12C>T	chr8.hg19:g.107782407G>A		1						p.G4G	NM_139166.4	NP_631905.1	1	2	3	2.535813			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)	1	66	-				Silent	SNP	ENST00000311955.3	1	1	hg19	c.12C>T	CCDS6305.1	0																																																																																								0.651678		TCGA-3A-A9IZ-01A-12D-A40W-08	0.592	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	0	0	1		2	2	2	0		0	0	46		46	46	1	1.960000	-3.422836	1	0.560000	NM_139166			9	9		325	320	0		1			0	0	46	0		0.993893	0	0	0	0	0	0	9	325
ERI1	90459	broad.mit.edu	37	8	8875864	8875864	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr8:8875864A>T	ENST00000523898.1	+	6	1319	c.640A>T	c.(640-642)Atg>Ttg	p.M214L	ERI1_ENST00000519292.1_Missense_Mutation_p.M214L|ERI1_ENST00000520332.1_3'UTR|ERI1_ENST00000250263.7_Missense_Mutation_p.M214L			Q8IV48	ERI1_HUMAN	exoribonuclease 1	214	Exonuclease.				gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						AATTGACTGGATGAAATTGAA	0.308																																						ENST00000523898.1	1.000000	6.500000e-01	0.950000	0.740000	0.840000	0.847618	0.840000	1.000000																										0				11						c.(640-642)Atg>Ttg		exoribonuclease 1							53.0	56.0	55.0					8																	8875864		2203	4299	6502	SO:0001583	missense	90459	0	0					g.chr8:8875864A>T	BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	ENST00000523898.1:c.640A>T	chr8.hg19:g.8875864A>T	ENSP00000429615:p.Met214Leu	0					ERI1_ENST00000520332.1_3'UTR|ERI1_ENST00000250263.7_Missense_Mutation_p.M214L|ERI1_ENST00000519292.1_Missense_Mutation_p.M214L	p.M214L			1	2	3	2.044957	Q8IV48	ERI1_HUMAN		6	1319	+			A8K4U7|Q9NSX3	Missense_Mutation	SNP	ENST00000523898.1	1	1	hg19	c.640A>T	CCDS5972.1	0	.	.	.	.	.	.	.	.	.	.	A	9.693	1.152316	0.21371	.	.	ENSG00000104626	ENST00000523898;ENST00000250263;ENST00000519292	T;T;T	0.32753	1.44;1.44;1.44	5.83	5.83	0.93111	5.83	5.83	0.93111	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.040723	0.85682	D	0.000000	T	0.11495	0.0280	N	0.01446	-0.86	0.80722	D	1	B	0.11235	0.004	B	0.16289	0.015	T	0.18681	-1.0329	10	0.02654	T	1	-25.2268	15.3806	0.74651	1.0:0.0:0.0:0.0	.	214	Q8IV48	ERI1_HUMAN	L	214	ENSP00000429615:M214L;ENSP00000250263:M214L;ENSP00000430190:M214L	ENSP00000250263:M214L	M	+	1	0	0	ERI1	8913274	8913274	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.856000	0.69518	2.220000	0.72140	0.459000	0.35465	ATG	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.308	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251471.2	1	0	1		2	2	2	0		0	0	47		47	47	1	1.960000	-20.000000	1	0.560000	NM_153332			55	55		179	178	1		1	1		0	0	47	0		1.000000	9.894830e-01	0	2	0	24	0	55	179
PTDSS1	9791	broad.mit.edu	37	8	97342493	97342493	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr8:97342493A>G	ENST00000517309.1	+	11	1552	c.1226A>G	c.(1225-1227)tAt>tGt	p.Y409C	PTDSS1_ENST00000455950.2_Missense_Mutation_p.Y263C|PTDSS1_ENST00000522072.1_Missense_Mutation_p.Y206C	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	409					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	GCAGAACACTATGGTCACCGA	0.463																																						ENST00000517309.1	1.000000	6.000000e-01	0.920000	0.690000	0.790000	0.807436	0.790000	0.790000																										0				29						c.(1225-1227)tAt>tGt		phosphatidylserine synthase 1	Phosphatidylserine(DB00144)						129.0	113.0	119.0					8																	97342493		2203	4300	6503	SO:0001583	missense	9791	1	121412	30				g.chr8:97342493A>G	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1226A>G	chr8.hg19:g.97342493A>G	ENSP00000430548:p.Tyr409Cys	1					PTDSS1_ENST00000522072.1_Missense_Mutation_p.Y206C|PTDSS1_ENST00000455950.2_Missense_Mutation_p.Y263C	p.Y409C	NM_014754.1	NP_055569.1	1	2	3	2.535813	P48651	PTSS1_HUMAN		11	1552	+	Breast(36;6.18e-05)		E5RFC5|Q9BUQ5	Missense_Mutation	SNP	ENST00000517309.1	1	1	hg19	c.1226A>G	CCDS6271.1	0	.	.	.	.	.	.	.	.	.	.	A	8.633	0.894173	0.17613	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.46451	0.93;0.93;0.87	5.6	0.454	0.16644	5.6	0.454	0.16644	.	0.185282	0.49916	N	0.000121	T	0.19005	0.0456	N	0.04959	-0.14	0.48185	D	0.999601	B	0.06786	0.001	B	0.06405	0.002	T	0.03922	-1.0992	10	0.38643	T	0.18	-3.7125	8.5488	0.33438	0.5948:0.0:0.4052:0.0	.	409	P48651	PTSS1_HUMAN	C	409;263;206	ENSP00000430548:Y409C;ENSP00000401248:Y263C;ENSP00000430928:Y206C	ENSP00000401248:Y263C	Y	+	2	0	0	PTDSS1	97411669	97411669	0.554000	0.26522	0.933000	0.37362	0.785000	0.44390	0.481000	0.22260	0.080000	0.16959	-0.411000	0.06167	TAT	0.651678		TCGA-3A-A9IZ-01A-12D-A40W-08	0.463	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2	1	0	1		2	2	2	0		0	0	29		29	28	1	1.960000	-20.000000	1	0.560000				51	50		240	233	1		1	1		0	0	29	0		1.000000	9.999999e-01	0	25	0	96	0	51	240
FBXL6	26233	broad.mit.edu	37	8	145580308	145580308	+	Silent	SNP	G	G	A	rs148685592		TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr8:145580308G>A	ENST00000331890.5	-	6	1009	c.945C>T	c.(943-945)ccC>ccT	p.P315P	FBXL6_ENST00000455319.2_Silent_p.P309P|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|FBXL6_ENST00000526524.1_5'UTR|TMEM249_ENST00000531225.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	315					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCAGCTGAAGGGGAATGCTAT	0.647																																						ENST00000331890.5	1.000000	0	0.090000	0.020000	0.050000	0.158073	0.050000	0.060000																										0				5						c.(943-945)ccC>ccT		F-box and leucine-rich repeat protein 6		G	,	1,4405	2.1+/-5.4	0,1,2202	80.0	80.0	80.0		945,927	-1.7	0.7	8	dbSNP_134	80	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	FBXL6	NM_012162.1,NM_024555.3	,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,	315/540,309/534	145580308	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	26233	2	121392	34				g.chr8:145580308G>A	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.945C>T	chr8.hg19:g.145580308G>A		1					SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|FBXL6_ENST00000455319.2_Silent_p.P309P|TMEM249_ENST00000531225.1_5'Flank|FBXL6_ENST00000526524.1_5'UTR|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank	p.P315P	NM_012162.2	NP_036294.2	1	2	3	2.520403	Q8N531	FBXL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)	6	1009	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q53G43|Q9H5W9|Q9UKC7	Silent	SNP	ENST00000331890.5	0	1	hg19	c.945C>T	CCDS6422.1	0																																																																																								0.645390		TCGA-3A-A9IZ-01A-12D-A40W-08	0.647	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	0	0	1		2	2	2	0		0	0	102		102	97	1	1.960000	-2.538992	1	0.560000	NM_024555			6	6		576	563	0		1	0		0	0	102	0		0.962599	1.707104e-02	0	0	0	16	0	6	576
PRUNE2	158471	broad.mit.edu	37	9	79318726	79318726	+	Silent	SNP	G	G	A			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr9:79318726G>A	ENST00000376718.3	-	9	7926	c.7803C>T	c.(7801-7803)gcC>gcT	p.A2601A	PRUNE2_ENST00000428286.1_Silent_p.A2242A	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2601					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CATTTAAGGAGGCTGGCTGAC	0.428																																						ENST00000376718.3	1.000000	7.400000e-01	1.000000	0.820000	0.910000	0.912633	0.910000	1.000000																										0				16						c.(7801-7803)gcC>gcT		prune homolog 2 (Drosophila)							96.0	89.0	91.0					9																	79318726		1568	3582	5150	SO:0001819	synonymous_variant	158471	0	0					g.chr9:79318726G>A	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7803C>T	chr9.hg19:g.79318726G>A		0					PRUNE2_ENST00000428286.1_Silent_p.A2242A	p.A2601A	NM_015225.2	NP_056040.2	0	0	0	2.024122	Q8WUY3	PRUN2_HUMAN		9	7926	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	1	1	hg19	c.7803C>T	CCDS47982.1	1	.	.	.	.	.	.	.	.	.	.	G	2.478	-0.320244	0.05386	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.61	-1.16	0.09678	5.61	-1.16	0.09678	.	.	.	.	.	T	0.18635	0.0447	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23190	-1.0195	4	.	.	.	-2.112	0.8443	0.01157	0.2855:0.1178:0.3678:0.229	.	.	.	.	F	1923	.	.	L	-	1	0	0	PRUNE2	78508546	78508546	0.010000	0.17322	0.001000	0.08648	0.460000	0.32559	0.028000	0.13644	-0.216000	0.10048	-0.218000	0.12543	CTC	0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.428	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	1	0	1		2	2	2	0		0	0	66		66	62	1	1.960000	-20.000000	1	0.560000	NM_138818			78	78		225	225	1		1			0	0	66	0		1.000000	0	0	0	0	0	0	78	225
NOTCH1	4851	broad.mit.edu	37	9	139412288	139412288	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chr9:139412288C>T	ENST00000277541.6	-	8	1432	c.1357G>A	c.(1357-1359)Gtc>Atc	p.V453I	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	453	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CACTCGTTGACGTCGATCTCG	0.657			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												ENST00000277541.6	1.000000	6.900000e-01	0.960000	0.770000	0.860000	0.866137	0.860000	1.000000				Dom	yes			Dom	yes		9	9q34.3	9q34.3	4851	T, Mis, O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""				L	L	TRB@		T-ALL		0				1359						c.(1357-1359)Gtc>Atc		notch 1							57.0	63.0	61.0					9																	139412288		2176	4267	6443	SO:0001583	missense	4851	2	120904	35				g.chr9:139412288C>T	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1357G>A	chr9.hg19:g.139412288C>T	ENSP00000277541:p.Val453Ile	0	HNSCC(8;0.001)				MIR4673_ENST00000584777.1_RNA	p.V453I	NM_017617.3	NP_060087.3	1	2	3	2.043119	P46531	NOTC1_HUMAN		8	1432	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	1	1	hg19	c.1357G>A	CCDS43905.1	1	.	.	.	.	.	.	.	.	.	.	C	5.036	0.192406	0.09599	.	.	ENSG00000148400	ENST00000277541	D	0.87103	-2.21	4.57	4.57	0.56435	4.57	4.57	0.56435	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.202030	0.42682	D	0.000678	T	0.67249	0.2873	N	0.02120	-0.675	0.43588	D	0.995933	P	0.35363	0.497	B	0.34418	0.182	T	0.72953	-0.4135	10	0.02654	T	1	.	16.3317	0.83023	0.0:1.0:0.0:0.0	.	453	P46531	NOTC1_HUMAN	I	453	ENSP00000277541:V453I	ENSP00000277541:V453I	V	-	1	0	0	NOTCH1	138532109	138532109	0.997000	0.39634	0.990000	0.47175	0.788000	0.44548	0.789000	0.26886	2.088000	0.63022	0.462000	0.41574	GTC	0.562450		TCGA-3A-A9IZ-01A-12D-A40W-08	0.657	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	1	0	1		2	2	2	0		0	0	63		63	58	1	1.960000	-20.000000	1	0.560000	NM_017617			76	73		240	234	1		1	1		0	0	63	0		1.000000	7.316790e-01	0	4	0	6	0	76	240
PNMA5	114824	broad.mit.edu	37	X	152159333	152159333	+	Silent	SNP	C	C	G			TCGA-3A-A9IZ-01A-12D-A40W-08	TCGA-3A-A9IZ-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6baafe4a-8cdb-4775-8f5b-575d68e9d1ba	33790505-3f29-412f-ad68-7dbe0943b342	g.chrX:152159333C>G	ENST00000439251.1	-	2	1248	c.810G>C	c.(808-810)ctG>ctC	p.L270L	PNMA5_ENST00000361887.5_Silent_p.L270L|PNMA5_ENST00000452693.1_Silent_p.L270L|PNMA5_ENST00000535214.1_Silent_p.L270L	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	270					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CGGCTTTCTGCAGCAGGGGCT	0.542																																						ENST00000439251.1	0.400000	2.300000e-01	0.360000	0.270000	0.310000	0.318885	0.310000	0.310000																										0				25						c.(808-810)ctG>ctC		paraneoplastic Ma antigen family member 5							57.0	58.0	58.0					X																	152159333		2203	4300	6503	SO:0001819	synonymous_variant	114824	0	0					g.chrX:152159333C>G	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.810G>C	chrX.hg19:g.152159333C>G							PNMA5_ENST00000535214.1_Silent_p.L270L|PNMA5_ENST00000361887.5_Silent_p.L270L|PNMA5_ENST00000452693.1_Silent_p.L270L	p.L270L	NM_001103150.1	NP_001096620.1	0	1	1		Q96PV4	PNMA5_HUMAN		2	1248	-	Acute lymphoblastic leukemia(192;6.56e-05)		B4DI72|B7Z9Y9|Q495L5|Q8NET3	Silent	SNP	ENST00000439251.1	1	1	hg19	c.810G>C	CCDS14718.1	0																																																																																								0.560000		TCGA-3A-A9IZ-01A-12D-A40W-08	0.542	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	1	0	1		2	2	2	0		0	0	36		36	36	1	1.960000	-20.000000	1	0.560000	NM_052926			47	47		219	216	1		1			0	0	36	0		1.000000	0	0	0	0	0	0	47	219
