#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
MYH7B	57644	broad.mit.edu	37	20	33586211	33586212	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr20:33586211_33586212delAC	ENST00000262873.7	+	31	4079_4080	c.3987_3988delAC	c.(3985-3990)ctacagfs	p.Q1330fs		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1288						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GTGGGCGACTACAGACGGAAAG	0.649																																						ENST00000262873.7	0.970000	6.100000e-01			0.780000	0.795274	0.780000	0.800000																										0				54						c.(3985-3990)ctacagfs		myosin, heavy chain 7B, cardiac muscle, beta																																				SO:0001589	frameshift_variant	57644	0	0					g.chr20:33586211_33586212delAC	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3987_3988delAC	chr20.hg19:g.33586211_33586212delAC	ENSP00000262873:p.Gln1330fs	1						p.Q1330fs	NM_020884.3	NP_065935.2	1	3	4	2.263571	A7E2Y1	MYH7B_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00691)	31	4079_4080	+			Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Frame_Shift_Del	DEL	ENST00000262873.7	1	1	hg19	c.3987_3988delAC	CCDS42869.1	0																																																																																								0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.649	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	1	0	1		26	2		0		0	2	97		97	93	1	3.280000	-20.000000	1	0.470000	NM_020884			66	71		458	454	0		1	0	0	0	0	97	0		0.999997	1.255107e-01	0	0	0	5	0	66	458
SLC12A5	57468	broad.mit.edu	37	20	44685140	44685142	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr20:44685140_44685142delAGA	ENST00000454036.2	+	23	3165_3167	c.3116_3118delAGA	c.(3115-3120)gagaag>gag	p.K1040del	SLC12A5_ENST00000243964.3_In_Frame_Del_p.K1017del	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1040					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCGGTGGCAGAGAAGAATAAGGG	0.635																																						ENST00000454036.2	0.630000	2.600000e-01			0.420000	0.440905	0.420000	0.430000																										0				80						c.(3115-3120)gagaag>gag		solute carrier family 12 (potassium/chloride transporter), member 5	Bumetanide(DB00887)|Potassium Chloride(DB00761)																																			SO:0001651	inframe_deletion	57468	0	0					g.chr20:44685140_44685142delAGA	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3116_3118delAGA	chr20.hg19:g.44685143_44685145delAGA	ENSP00000387694:p.Lys1040del	1					SLC12A5_ENST00000243964.3_In_Frame_Del_p.K1017del	p.K1040del	NM_001134771.1	NP_001128243.1	1	3	4	2.263571	Q9H2X9	S12A5_HUMAN		23	3165_3167	+		Myeloproliferative disorder(115;0.0122)	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	In_Frame_Del	DEL	ENST00000454036.2	0	1	hg19	c.3116_3118delAGA	CCDS46610.1	0																																																																																								0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.635	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1	1	0	0		24			0		0	2	49		49	50	1	3.280000	-19.995170	1	0.470000				18	25		249	251	0		1		0	0	0	49	0		0.241023		0	0	0	0	0	18	249
ANKRD50	57182	broad.mit.edu	37	4	125599951	125599952	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr4:125599951_125599952insA	ENST00000504087.1	-	3	1658_1659	c.621_622insT	c.(619-624)tctaccfs	p.T208fs	ANKRD50_ENST00000515641.1_Frame_Shift_Ins_p.T29fs	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	208										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GATAAGCTGGTAGACGTTTGTT	0.475																																						ENST00000504087.1	1.000000	9.900000e-01			0.990000	0.999958	0.990000	1.000000																										0				55						c.(619-624)tctaccfs		ankyrin repeat domain 50																																				SO:0001589	frameshift_variant	57182	0	0					g.chr4:125599951_125599952insA	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.622dupT	chr4.hg19:g.125599952_125599952dupA	ENSP00000425658:p.Thr208fs	1					ANKRD50_ENST00000515641.1_Frame_Shift_Ins_p.T29fs	p.T208fs	NM_020337.2	NP_065070.1	1	2	3	1.838072	Q9ULJ7	ANR50_HUMAN		3	1658_1659	-			A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Frame_Shift_Ins	INS	ENST00000504087.1	0	1	hg19	c.621_622insT	CCDS34060.1	1																																																																																								0.566728		TCGA-3A-A9J0-01A-11D-A40W-08	0.475	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	1	0	1		2			0		0	0	130		130	127	1	3.280000	-20.000000	1	0.470000	NM_020337			219	220		735	731	0		1		0	0	0	130	0		1.000000		0	0	0	0	0	219	735
IL2RA	3559	broad.mit.edu	37	10	6063598	6063598	+	Silent	SNP	G	G	A	rs373429536		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr10:6063598G>A	ENST00000379959.3	-	4	599	c.426C>T	c.(424-426)ttC>ttT	p.F142F	IL2RA_ENST00000379954.1_Intron|IL2RA_ENST00000256876.6_Silent_p.F142F	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	142	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)	p.F142F(2)		endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GCCCCACCACGAAATGATAAA	0.512																																						ENST00000379959.3	1.000000	9.400000e-01			0.990000	0.996612	0.990000	1.000000																										2	Substitution - coding silent(2)	p.F142F(2)	large_intestine(1)|lung(1)	17						c.(424-426)ttC>ttT		interleukin 2 receptor, alpha	Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)						153.0	134.0	140.0					10																	6063598		2203	4300	6503	SO:0001819	synonymous_variant	3559	1	121412	33				g.chr10:6063598G>A	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.426C>T	chr10.hg19:g.6063598G>A		1					IL2RA_ENST00000379954.1_Intron|IL2RA_ENST00000256876.6_Silent_p.F142F	p.F142F	NM_000417.2	NP_000408.1	0	3	3	1.931745	P01589	IL2RA_HUMAN		4	599	-			Q5W007	Silent	SNP	ENST00000379959.3	1	1	hg19	c.426C>T	CCDS7076.1	1																																																																																								0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.512	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	1	0	1		2	2	2	0		0	0	76		76	74	1	3.280000	-20.000000	1	0.470000	NM_000417			85	84		303	294	1		1	0		0	0	76	0		1.000000	3.054982e-01	0	0	0	5	0	85	303
ARHGAP21	57584	broad.mit.edu	37	10	24959236	24959236	+	Missense_Mutation	SNP	T	T	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr10:24959236T>G	ENST00000396432.2	-	3	640	c.154A>C	c.(154-156)Acg>Ccg	p.T52P		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	51	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CTTTTCAACGTAACTGTTTTG	0.343																																						ENST00000396432.2	0.470000	2.000000e-01			0.320000	0.333422	0.320000	0.330000																										0				78						c.(154-156)Acg>Ccg		Rho GTPase activating protein 21							135.0	120.0	125.0					10																	24959236		2203	4300	6503	SO:0001583	missense	57584	0	0					g.chr10:24959236T>G	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.154A>C	chr10.hg19:g.24959236T>G	ENSP00000379709:p.Thr52Pro	1						p.T52P	NM_020824.3	NP_065875.3	0	3	3	1.931745	Q5T5U3	RHG21_HUMAN		3	640	-			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	1	1	hg19	c.154A>C	CCDS7144.2	0	.	.	.	.	.	.	.	.	.	.	T	10.53	1.375711	0.24857	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000376410;ENST00000446003;ENST00000416305	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.19	-0.861	0.10676	5.19	-0.861	0.10676	PDZ/DHR/GLGF (2);	0.700803	0.15367	N	0.266050	T	0.19046	0.0457	M	0.63843	1.955	0.09310	N	1	B;B;B	0.15719	0.014;0.011;0.002	B;B;B	0.28638	0.077;0.092;0.039	T	0.29792	-1.0000	10	0.52906	T	0.07	.	3.228	0.06739	0.1417:0.131:0.5257:0.2015	.	52;51;51	F8W9U9;Q5T5U2;Q5T5U3	.;.;RHG21_HUMAN	P	52;51;52;52;41	ENSP00000379709:T52P;ENSP00000365592:T52P;ENSP00000405018:T52P;ENSP00000400566:T41P	ENSP00000365592:T52P	T	-	1	0	0	ARHGAP21	24999242	24999242	0.001000	0.12720	0.006000	0.13384	0.925000	0.55904	0.156000	0.16382	-0.015000	0.14150	-0.321000	0.08615	ACG	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.343	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	0	0	1		15	3	2	1		1	1	78		78	78	1	3.280000	-6.276031	1	0.470000	NM_020824			21	20		323	319	0		1	1		1	0	78	0		0.873978	1.212428e-01	0	3	0	16	0	21	323
CPXM2	119587	broad.mit.edu	37	10	125557591	125557591	+	Missense_Mutation	SNP	C	C	T	rs199927775		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr10:125557591C>T	ENST00000241305.3	-	6	944	c.790G>A	c.(790-792)Gtc>Atc	p.V264I	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	264	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		ACCATGGGGACGGGTAGCTCA	0.483																																						ENST00000241305.3	0.570000	2.400000e-01			0.380000	0.401540	0.380000	0.390000																										0				47						c.(790-792)Gtc>Atc		carboxypeptidase X (M14 family), member 2							130.0	110.0	117.0					10																	125557591		2203	4300	6503	SO:0001583	missense	119587	20	121412	43				g.chr10:125557591C>T	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.790G>A	chr10.hg19:g.125557591C>T	ENSP00000241305:p.Val264Ile	1					CPXM2_ENST00000368854.3_5'UTR	p.V264I	NM_198148.2	NP_937791.2	0	3	3	1.934708	Q8N436	CPXM2_HUMAN		6	944	-		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	1	1	hg19	c.790G>A	CCDS7637.1	0	.	.	.	.	.	.	.	.	.	.	C	6.854	0.526842	0.13066	.	.	ENSG00000121898	ENST00000241305;ENST00000540123;ENST00000418782	D	0.98164	-4.76	4.46	4.46	0.54185	4.46	4.46	0.54185	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.450854	0.23631	N	0.046134	D	0.95850	0.8649	L	0.45051	1.395	0.25694	N	0.985655	P	0.41420	0.749	B	0.36534	0.227	D	0.90460	0.4445	10	0.23891	T	0.37	-14.947	17.3109	0.87210	0.0:1.0:0.0:0.0	.	264	Q8N436	CPXM2_HUMAN	I	264;97;264	ENSP00000241305:V264I	ENSP00000241305:V264I	V	-	1	0	0	CPXM2	125547581	125547581	0.000000	0.05858	0.972000	0.41901	0.126000	0.20510	0.687000	0.25407	2.292000	0.77174	0.557000	0.71058	GTC	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.483	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	1	0	1		2	2	2	0		0	0	46		46	43	1	3.280000	-6.781784	1	0.470000	NM_198148			19	19		240	235	0		1	0		0	0	46	0		0.999990	4.267932e-01	0	0	0	19	0	19	240
MCAM	4162	broad.mit.edu	37	11	119182565	119182565	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr11:119182565C>T	ENST00000264036.4	-	10	1252	c.1238G>A	c.(1237-1239)aGc>aAc	p.S413N	MCAM_ENST00000392814.1_Missense_Mutation_p.S362N	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	413	Ig-like C2-type 2.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GCCGGGTATGCTGGGCACAGA	0.617																																						ENST00000264036.4	1.000000	1.000000e-02			0.070000	0.135251	0.070000	0.060000																										0				22						c.(1237-1239)aGc>aAc		melanoma cell adhesion molecule							89.0	92.0	91.0					11																	119182565		2199	4295	6494	SO:0001583	missense	4162	0	0					g.chr11:119182565C>T	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1238G>A	chr11.hg19:g.119182565C>T	ENSP00000264036:p.Ser413Asn	1					MCAM_ENST00000392814.1_Missense_Mutation_p.S362N	p.S413N	NM_006500.2	NP_006491.2	1	2	3	1.848552	P43121	MUC18_HUMAN		10	1252	-		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	0	1	hg19	c.1238G>A	CCDS31690.1	0	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664926	0.47572	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.15256	2.44;2.44	4.86	1.75	0.24633	4.86	1.75	0.24633	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	.	.	.	.	T	0.20577	0.0495	M	0.80183	2.485	0.22354	N	0.999179	B	0.20671	0.047	B	0.20577	0.03	T	0.17684	-1.0361	9	0.38643	T	0.18	-5.4	6.2247	0.20701	0.0:0.5299:0.3693:0.1008	.	413	P43121	MUC18_HUMAN	N	413;362	ENSP00000264036:S413N;ENSP00000376561:S362N	ENSP00000264036:S413N	S	-	2	0	0	MCAM	118687775	118687775	0.002000	0.14202	0.803000	0.32268	0.710000	0.40934	-0.056000	0.11787	1.216000	0.43427	0.561000	0.74099	AGC	0.564216		TCGA-3A-A9J0-01A-11D-A40W-08	0.617	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2	0	0	1		2	2	2	0		0	0	113		113	110	1	3.280000	-2.580035	1	0.470000				5	5		401	395	0		1	0		0	0	113	0		0.935436	3.755845e-01	0	0	0	91	0	5	401
PKNOX2	63876	broad.mit.edu	37	11	125281736	125281736	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr11:125281736G>A	ENST00000298282.9	+	10	1182	c.911G>A	c.(910-912)cGt>cAt	p.R304H	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Missense_Mutation_p.R240H	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	304					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		AATATAATGCGTTCTTGGCTC	0.517																																						ENST00000298282.9	1.000000	7.900000e-01			0.970000	0.950271	0.970000	1.000000																										0				29						c.(910-912)cGt>cAt		PBX/knotted 1 homeobox 2							139.0	138.0	138.0					11																	125281736		2064	4217	6281	SO:0001583	missense	63876	1	121012	33				g.chr11:125281736G>A	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.911G>A	chr11.hg19:g.125281736G>A	ENSP00000298282:p.Arg304His	1					PKNOX2_ENST00000542175.1_Missense_Mutation_p.R240H|PKNOX2_ENST00000530517.1_3'UTR	p.R304H	NM_022062.2	NP_071345.2	1	2	3	1.859412	Q96KN3	PKNX2_HUMAN		10	1182	+		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	1	1	hg19	c.911G>A	CCDS41730.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.173199	0.94807	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175;ENST00000535518	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	5.45	5.45	0.79879	5.45	5.45	0.79879	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.91095	0.7197	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.987;0.98	D	0.91504	0.5221	10	0.87932	D	0	-4.6596	19.2404	0.93879	0.0:0.0:1.0:0.0	.	240;275;304	F5GZ15;B7Z3G7;Q96KN3	.;.;PKNX2_HUMAN	H	275;275;304;240;292	ENSP00000434732:R275H;ENSP00000433971:R275H;ENSP00000298282:R304H;ENSP00000441470:R240H	ENSP00000298282:R304H	R	+	2	0	0	PKNOX2	124786946	124786946	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.048000	0.93830	2.714000	0.92807	0.561000	0.74099	CGT	0.570032		TCGA-3A-A9J0-01A-11D-A40W-08	0.517	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3	1	0	1		2	2	2	0		0	0	129		129	127	1	3.280000	-20.000000	1	0.470000				87	87		382	376	1		1	0		0	0	129	0		1.000000	3.522977e-02	0	0	0	2	0	87	382
FAR1	84188	broad.mit.edu	37	11	13749183	13749183	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr11:13749183G>T	ENST00000354817.3	+	11	1482	c.1338G>T	c.(1336-1338)ttG>ttT	p.L446F	FAR1_ENST00000532502.1_Missense_Mutation_p.L70F	NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	446					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						AGTACGTATTGAATGAAGAAA	0.373																																						ENST00000354817.3	1.000000	6.700000e-01			0.860000	0.869408	0.860000	1.000000																										0				13						c.(1336-1338)ttG>ttT		fatty acyl CoA reductase 1							122.0	122.0	122.0					11																	13749183		2200	4294	6494	SO:0001583	missense	84188	0	0					g.chr11:13749183G>T	AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.1338G>T	chr11.hg19:g.13749183G>T	ENSP00000346874:p.Leu446Phe	1					FAR1_ENST00000532502.1_Missense_Mutation_p.L70F	p.L446F	NM_032228.5	NP_115604.1	1	2	3	1.851246	Q8WVX9	FACR1_HUMAN		11	1482	+			D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	1	1	hg19	c.1338G>T	CCDS7813.1	1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979207	0.53827	.	.	ENSG00000197601	ENST00000354817;ENST00000532502	T	0.28454	1.61	5.59	5.59	0.84812	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	L	0.55834	1.745	0.51482	D	0.999929	D	0.89917	1.0	D	0.83275	0.996	T	0.23797	-1.0178	10	0.30078	T	0.28	-8.0128	16.1581	0.81680	0.0:0.1335:0.8665:0.0	.	446	Q8WVX9	FACR1_HUMAN	F	446;70	ENSP00000346874:L446F	ENSP00000346874:L446F	L	+	3	2	2	FAR1	13705759	13705759	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.970000	0.40520	2.783000	0.95769	0.655000	0.94253	TTG	0.565894		TCGA-3A-A9J0-01A-11D-A40W-08	0.373	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2	1	0	1		2	2	2	0		0	0	50		50	49	1	3.280000	-3.247996	1	0.470000	NM_032228			57	57		287	286	1		1	1		0	0	50	0		1.000000	9.660403e-01	0	9	0	21	0	57	287
UVRAG	7405	broad.mit.edu	37	11	75851957	75851957	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr11:75851957G>A	ENST00000356136.3	+	15	1841	c.1600G>A	c.(1600-1602)Gtc>Atc	p.V534I	UVRAG_ENST00000539288.1_Missense_Mutation_p.V162I|UVRAG_ENST00000531818.1_Missense_Mutation_p.V162I|UVRAG_ENST00000532130.1_Missense_Mutation_p.V162I|UVRAG_ENST00000533454.1_Missense_Mutation_p.V162I|UVRAG_ENST00000528420.1_Missense_Mutation_p.V433I|UVRAG_ENST00000538870.1_Missense_Mutation_p.V90I	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	534					DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						TGTGACCACCGTCCCCTCCAT	0.493																																						ENST00000356136.3	1.000000	7.800000e-01			0.990000	0.962392	0.990000	1.000000																										0				32						c.(1600-1602)Gtc>Atc		UV radiation resistance associated							83.0	78.0	80.0					11																	75851957		2200	4292	6492	SO:0001583	missense	7405	0	0					g.chr11:75851957G>A	X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.1600G>A	chr11.hg19:g.75851957G>A	ENSP00000348455:p.Val534Ile	1					UVRAG_ENST00000531818.1_Missense_Mutation_p.V162I|UVRAG_ENST00000533454.1_Missense_Mutation_p.V162I|UVRAG_ENST00000532130.1_Missense_Mutation_p.V162I|UVRAG_ENST00000539288.1_Missense_Mutation_p.V162I|UVRAG_ENST00000528420.1_Missense_Mutation_p.V433I|UVRAG_ENST00000538870.1_Missense_Mutation_p.V90I	p.V534I	NM_003369.3	NP_003360.2	1	2	3	1.848552	Q9P2Y5	UVRAG_HUMAN		15	1841	+			B3KTC1|O00392	Missense_Mutation	SNP	ENST00000356136.3	1	1	hg19	c.1600G>A	CCDS8241.1	1	.	.	.	.	.	.	.	.	.	.	G	0.634	-0.816014	0.02776	.	.	ENSG00000198382	ENST00000356136;ENST00000528420;ENST00000533454;ENST00000531818;ENST00000532130;ENST00000539288;ENST00000538870	T	0.44881	0.91	5.3	-10.6	0.00265	5.3	-10.6	0.00265	.	1.580430	0.03003	N	0.148498	T	0.18299	0.0439	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.22382	-1.0218	10	0.12766	T	0.61	1.0426	15.3224	0.74132	0.2482:0.0:0.6594:0.0925	.	90;534	B7Z6A0;Q9P2Y5	.;UVRAG_HUMAN	I	534;433;162;162;162;162;90	ENSP00000348455:V534I	ENSP00000348455:V534I	V	+	1	0	0	UVRAG	75529605	75529605	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.434000	0.06939	-2.212000	0.00736	-0.768000	0.03414	GTC	0.564216		TCGA-3A-A9J0-01A-11D-A40W-08	0.493	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383430.1	1	0	1		2	2	2	0		0	0	64		64	63	1	3.280000	-3.270213	1	0.470000	NM_003369			55	56		227	222	1		1	1		0	0	64	0		1.000000	9.968574e-01	0	6	0	33	0	55	227
APLP2	334	broad.mit.edu	37	11	129993656	129993656	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr11:129993656G>A	ENST00000263574.5	+	7	1144	c.1072G>A	c.(1072-1074)Gct>Act	p.A358T	APLP2_ENST00000539648.1_Intron|APLP2_ENST00000528499.1_Intron|APLP2_ENST00000338167.5_Missense_Mutation_p.A358T|APLP2_ENST00000278756.7_Missense_Mutation_p.A368T|APLP2_ENST00000345598.5_Intron|APLP2_ENST00000543137.1_Missense_Mutation_p.A265T	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	358	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TTATTGTATGGCTGTGTGTAA	0.562																																						ENST00000263574.5	1.000000	8.100000e-01			0.990000	0.962247	0.990000	1.000000																										0				31						c.(1072-1074)Gct>Act		amyloid beta (A4) precursor-like protein 2							152.0	142.0	146.0					11																	129993656		2201	4297	6498	SO:0001583	missense	334	0	0					g.chr11:129993656G>A	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.1072G>A	chr11.hg19:g.129993656G>A	ENSP00000263574:p.Ala358Thr	1					APLP2_ENST00000528499.1_Intron|APLP2_ENST00000543137.1_Missense_Mutation_p.A265T|APLP2_ENST00000345598.5_Intron|APLP2_ENST00000338167.5_Missense_Mutation_p.A358T|APLP2_ENST00000539648.1_Intron|APLP2_ENST00000278756.7_Missense_Mutation_p.A368T	p.A358T	NM_001642.2	NP_001633.1	1	2	3	1.859412	Q06481	APLP2_HUMAN		7	1144	+	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	1	1	hg19	c.1072G>A	CCDS8486.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.360245	0.95877	.	.	ENSG00000084234	ENST00000263574;ENST00000338167;ENST00000278756;ENST00000543137	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.61	5.61	0.85477	5.61	5.61	0.85477	Proteinase inhibitor I2, Kunitz metazoa (6);	0.050804	0.85682	D	0.000000	T	0.66470	0.2792	L	0.42686	1.345	0.80722	D	1	P;D	0.89917	0.91;1.0	P;D	0.87578	0.508;0.998	T	0.61569	-0.7036	10	0.33141	T	0.24	-17.6546	18.621	0.91321	0.0:0.0:1.0:0.0	.	358;358	Q06481;Q06481-3	APLP2_HUMAN;.	T	358;358;368;265	ENSP00000263574:A358T;ENSP00000345444:A358T;ENSP00000278756:A368T;ENSP00000444122:A265T	ENSP00000263574:A358T	A	+	1	0	0	APLP2	129498866	129498866	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.630000	0.83225	2.631000	0.89168	0.650000	0.86243	GCT	0.570032		TCGA-3A-A9J0-01A-11D-A40W-08	0.562	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	1	0	1		2	2	2	0		0	0	143		143	139	1	3.280000	-20.000000	1	0.470000	NM_001642			89	87		380	374	1		1	1		0	0	143	0		1.000000	1	0	19	0	119	0	89	380
ULK1	8408	broad.mit.edu	37	12	132396530	132396530	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr12:132396530C>T	ENST00000321867.4	+	13	1343	c.992C>T	c.(991-993)cCg>cTg	p.P331L		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	331	Interaction with GABARAP and GABARAPL2.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CTGGCCTCCCCGGCTGACACC	0.632																																						ENST00000321867.4	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				29						c.(991-993)cCg>cTg		unc-51 like autophagy activating kinase 1							51.0	47.0	48.0					12																	132396530		2203	4298	6501	SO:0001583	missense	8408	1	121154	35				g.chr12:132396530C>T	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.992C>T	chr12.hg19:g.132396530C>T	ENSP00000324560:p.Pro331Leu	1						p.P331L	NM_003565.2	NP_003556	0	3	3	1.895325	O75385	ULK1_HUMAN		13	1343	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	1	1	hg19	c.992C>T	CCDS9274.1	1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977274	0.53720	.	.	ENSG00000177169	ENST00000321867	T	0.72394	-0.65	4.87	4.87	0.63330	4.87	4.87	0.63330	Protein kinase-like domain (1);	0.141351	0.47852	D	0.000218	D	0.82513	0.5053	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	P	0.59546	0.859	D	0.85704	0.1315	10	0.87932	D	0	-38.8868	17.5963	0.88013	0.0:1.0:0.0:0.0	.	331	O75385	ULK1_HUMAN	L	331	ENSP00000324560:P331L	ENSP00000324560:P331L	P	+	2	0	0	ULK1	130962483	130962483	1.000000	0.71417	0.303000	0.25071	0.032000	0.12392	4.382000	0.59594	2.245000	0.73994	0.561000	0.74099	CCG	0.558241		TCGA-3A-A9J0-01A-11D-A40W-08	0.632	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3	1	0	1		2	2	2	0		0	0	43		43	41	1	3.280000	-20.000000	1	0.470000				92	89		67	65	0		1	1		0	0	43	0		1.000000	1	0	15	0	15	0	92	67
EP400	57634	broad.mit.edu	37	12	132445272	132445272	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr12:132445272G>A	ENST00000333577.4	+	2	217	c.108G>A	c.(106-108)ccG>ccA	p.P36P	EP400_ENST00000389562.2_Silent_p.P36P|EP400_ENST00000389561.2_Silent_p.P36P|EP400_ENST00000332482.4_Silent_p.P36P|EP400_ENST00000330386.6_Silent_p.P36P			Q96L91	EP400_HUMAN	E1A binding protein p400	36					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		ACCCACCCCCGTCCCCCGCAG	0.667																																						ENST00000333577.4	1.000000	9.900000e-01			0.990000	0.999952	0.990000	1.000000																										0				161						c.(106-108)ccG>ccA		E1A binding protein p400							11.0	14.0	13.0					12																	132445272		2154	4230	6384	SO:0001819	synonymous_variant	57634	14	119986	35				g.chr12:132445272G>A	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.108G>A	chr12.hg19:g.132445272G>A		1					EP400_ENST00000330386.6_Silent_p.P36P|EP400_ENST00000389562.2_Silent_p.P36P|EP400_ENST00000389561.2_Silent_p.P36P|EP400_ENST00000332482.4_Silent_p.P36P	p.P36P			0	3	3	1.895325	Q96L91	EP400_HUMAN		2	217	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	1	0	hg19	c.108G>A		1																																																																																								0.558241		TCGA-3A-A9J0-01A-11D-A40W-08	0.667	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	24		24	18	1	3.280000	-1.203433	0	0.470000	NM_015409			21	20		35	32	0		1	0		0	0	24	0		0.999999	1.382514e-01	0	1	0	1	0	21	35
FGD4	121512	broad.mit.edu	37	12	32754273	32754273	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr12:32754273A>G	ENST00000427716.2	+	6	1176	c.752A>G	c.(751-753)aAt>aGt	p.N251S	FGD4_ENST00000546442.1_Missense_Mutation_p.N158S|FGD4_ENST00000525053.1_Missense_Mutation_p.N363S|FGD4_ENST00000531134.1_Missense_Mutation_p.N336S|FGD4_ENST00000381025.3_Missense_Mutation_p.N3S|FGD4_ENST00000266482.3_Missense_Mutation_p.N3S|FGD4_ENST00000534526.2_Missense_Mutation_p.N388S	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	251	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GAGATGGTGAATAAAATCTTT	0.348																																						ENST00000427716.2	1.000000	8.100000e-01			0.990000	0.980028	0.990000	1.000000																										0				27						c.(751-753)aAt>aGt		FYVE, RhoGEF and PH domain containing 4							74.0	85.0	81.0					12																	32754273		2203	4300	6503	SO:0001583	missense	121512	0	0					g.chr12:32754273A>G	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.752A>G	chr12.hg19:g.32754273A>G	ENSP00000394487:p.Asn251Ser	1					FGD4_ENST00000531134.1_Missense_Mutation_p.N336S|FGD4_ENST00000534526.2_Missense_Mutation_p.N388S|FGD4_ENST00000381025.3_Missense_Mutation_p.N3S|FGD4_ENST00000266482.3_Missense_Mutation_p.N3S|FGD4_ENST00000546442.1_Missense_Mutation_p.N158S|FGD4_ENST00000525053.1_Missense_Mutation_p.N363S	p.N251S	NM_139241.2	NP_640334.2	0	3	3	1.895325	Q96M96	FGD4_HUMAN		6	1176	+	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	1	1	hg19	c.752A>G	CCDS8727.1	1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.794476	0.31777	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000266482;ENST00000546442;ENST00000525053;ENST00000381025	T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	4.86	4.86	0.63082	4.86	4.86	0.63082	Dbl homology (DH) domain (5);	0.000000	0.53938	D	0.000056	T	0.64800	0.2631	L	0.31578	0.945	0.42950	D	0.99437	B;B;D;B	0.58970	0.236;0.071;0.984;0.288	B;B;P;B	0.57846	0.18;0.18;0.828;0.095	T	0.67534	-0.5646	10	0.49607	T	0.09	-25.0515	14.6203	0.68579	1.0:0.0:0.0:0.0	.	363;336;251;3	E9PJX4;B7Z493;Q96M96;G3XA97	.;.;FGD4_HUMAN;.	S	388;336;251;3;158;363;3	ENSP00000449273:N388S;ENSP00000431323:N336S;ENSP00000394487:N251S;ENSP00000266482:N3S;ENSP00000446695:N158S;ENSP00000433666:N363S;ENSP00000370413:N3S	ENSP00000266482:N3S	N	+	2	0	0	FGD4	32645540	32645540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.697000	0.68295	2.037000	0.60232	0.459000	0.35465	AAT	0.558241		TCGA-3A-A9J0-01A-11D-A40W-08	0.348	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	1	0	1		2	2	2	0		0	0	66		66	65	1	3.280000	-20.000000	1	0.470000	NM_139241			42	42		156	155	1		1	0		0	0	66	0		1.000000	0	0	0	0	1	0	42	156
ZNF605	100289635	broad.mit.edu	37	12	133502024	133502024	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr12:133502024C>G	ENST00000360187.4	-	5	2209	c.1861G>C	c.(1861-1863)Gag>Cag	p.E621Q	ZNF605_ENST00000331711.7_5'Flank|ZNF605_ENST00000392321.3_Missense_Mutation_p.E652Q	NM_183238.3	NP_899061.1	Q86T29	ZN605_HUMAN	zinc finger protein 605	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(16)|large_intestine(5)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		GTCCCACACTCATTGCATCCA	0.383																																						ENST00000360187.4	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				28						c.(1861-1863)Gag>Cag		zinc finger protein 605							120.0	115.0	116.0					12																	133502024		2203	4300	6503	SO:0001583	missense	100289635	0	0					g.chr12:133502024C>G	AL832623	CCDS31938.1, CCDS53850.1	12q24.33	2013-01-08	2009-09-11	2009-09-11		ENSG00000196458		"""Zinc fingers, C2H2-type"", ""-"""	28068	protein-coding gene	gene with protein product							Standard	NM_183238		Approved		uc001uli.3	Q86T29		ENST00000360187.4:c.1861G>C	chr12.hg19:g.133502024C>G	ENSP00000353314:p.Glu621Gln	1					ZNF605_ENST00000331711.7_5'Flank|ZNF605_ENST00000392321.3_Missense_Mutation_p.E652Q	p.E621Q	NM_183238.3	NP_899061.1	0	3	3	1.895325	Q86T29	ZN605_HUMAN		5	2209	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)	B3KVG4|D3DXJ0|Q86T91	Missense_Mutation	SNP	ENST00000360187.4	1	1	hg19	c.1861G>C	CCDS31938.1	1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835555	0.50951	.	.	ENSG00000196458	ENST00000360187;ENST00000392321	T;T	0.52057	0.68;0.68	3.72	1.76	0.24704	3.72	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35451	0.0932	L	0.32530	0.975	0.21984	N	0.999438	B;B	0.16166	0.003;0.016	B;B	0.12156	0.006;0.007	T	0.20571	-1.0271	9	0.22706	T	0.39	.	12.2303	0.54484	0.0:0.656:0.344:0.0	.	652;621	B3KVG4;Q86T29	.;ZN605_HUMAN	Q	621;652	ENSP00000353314:E621Q;ENSP00000376135:E652Q	ENSP00000353314:E621Q	E	-	1	0	0	ZNF605	132012097	132012097	0.000000	0.05858	0.005000	0.12908	0.937000	0.57800	0.278000	0.18753	0.325000	0.23359	0.462000	0.41574	GAG	0.558241		TCGA-3A-A9J0-01A-11D-A40W-08	0.383	ZNF605-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397135.2	1	0	1		2	2	2	0		0	0	104		104	103	1	3.280000	-20.000000	1	0.470000	NM_183238			129	129		196	192	1		1	0		0	0	104	0		1.000000	1.587790e-01	0	0	0	2	0	129	196
RNF17	56163	broad.mit.edu	37	13	25444786	25444786	+	Silent	SNP	C	C	T	rs200797570		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr13:25444786C>T	ENST00000255324.5	+	32	4408	c.4356C>T	c.(4354-4356)agC>agT	p.S1452S	RNF17_ENST00000339524.3_Silent_p.S462S|RNF17_ENST00000381921.1_Silent_p.S1410S	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1452					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GTGGAGTCAGCGGGGAATCAG	0.438																																						ENST00000255324.5	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				36						c.(4354-4356)agC>agT		ring finger protein 17							117.0	109.0	111.0					13																	25444786		2203	4300	6503	SO:0001819	synonymous_variant	56163	2	121412	36				g.chr13:25444786C>T	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.4356C>T	chr13.hg19:g.25444786C>T		1					RNF17_ENST00000339524.3_Silent_p.S462S|RNF17_ENST00000381921.1_Silent_p.S1410S	p.S1452S	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	3	3	6	2.641929	Q9BXT8	RNF17_HUMAN		32	4408	+		Lung SC(185;0.0225)|Breast(139;0.077)	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	1	1	hg19	c.4356C>T	CCDS9308.2	1																																																																																								0.692540		TCGA-3A-A9J0-01A-11D-A40W-08	0.438	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	0	0	1		20	2	2	1		1	1	87		87	83	1	3.280000	-9.594065	1	0.470000	NM_031994			148	145		357	351	1		1			1	0	87	0		1.000000	0	0	0	0	0	0	148	357
KL	9365	broad.mit.edu	37	13	33635841	33635841	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr13:33635841C>T	ENST00000380099.3	+	4	2633	c.2625C>T	c.(2623-2625)atC>atT	p.I875I	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	875	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CCAATGGAATCGATGACGGGC	0.517																																						ENST00000380099.3	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				41						c.(2623-2625)atC>atT		klotho							114.0	113.0	113.0					13																	33635841		2203	4300	6503	SO:0001819	synonymous_variant	9365	1	121412	31				g.chr13:33635841C>T	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2625C>T	chr13.hg19:g.33635841C>T		1					KL_ENST00000487852.1_3'UTR	p.I875I	NM_004795.3	NP_004786.2	2	3	5	2.606114	Q9UEF7	KLOT_HUMAN		4	2633	+	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Silent	SNP	ENST00000380099.3	1	1	hg19	c.2625C>T	CCDS9347.1	1																																																																																								0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.517	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1	1	0	1		2	2	2	0		0	0	115		115	109	1	3.280000	-19.999950	1	0.470000				207	205		348	344	1		1	0		0	0	115	0		1.000000	0	0	0	0	1	0	207	348
CPB2	1361	broad.mit.edu	37	13	46638808	46638808	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr13:46638808C>T	ENST00000181383.4	-	8	787	c.771G>A	c.(769-771)agG>agA	p.R257R	CPB2_ENST00000439329.3_Silent_p.R220R|CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000606351.1_RNA|CPB2-AS1_ENST00000415033.2_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	257					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		AAGCAAAGTTCCTATTCAGGT	0.413																																						ENST00000181383.4	0.210000	1.000000e-02			0.100000	0.111343	0.100000	0.100000																										0				21						c.(769-771)agG>agA		carboxypeptidase B2 (plasma)							182.0	152.0	162.0					13																	46638808		2203	4300	6503	SO:0001819	synonymous_variant	1361	0	0					g.chr13:46638808C>T	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.771G>A	chr13.hg19:g.46638808C>T		1					CPB2_ENST00000439329.3_Silent_p.R220R|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606351.1_RNA	p.R257R	NM_001872.3	NP_001863.3	2	3	5	2.631542	Q96IY4	CBPB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	8	787	-		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Silent	SNP	ENST00000181383.4	0	1	hg19	c.771G>A	CCDS9401.1	0																																																																																								0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.413	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	0	0	1		18	2	2	1		1	1	73		73	73	1	3.280000	-4.637711	1	0.470000	NM_001872			5	5		381	376	0		0			1	0	73	0		0.004268	0	0	0	0	0	0	5	381
PCDH8	5100	broad.mit.edu	37	13	53420319	53420319	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr13:53420319G>A	ENST00000377942.3	-	1	2456	c.2253C>T	c.(2251-2253)atC>atT	p.I751I	PCDH8_ENST00000338862.4_Silent_p.I751I	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	751					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGATGATGACGATCAGCGGCG	0.701																																					GBM(36;25 841 9273 49207)	ENST00000377942.3	1.000000	5.700000e-01			0.820000	0.826789	0.820000	1.000000																										0				36						c.(2251-2253)atC>atT		protocadherin 8							27.0	36.0	33.0					13																	53420319		2167	4239	6406	SO:0001819	synonymous_variant	5100	0	0					g.chr13:53420319G>A	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2253C>T	chr13.hg19:g.53420319G>A		1					PCDH8_ENST00000338862.4_Silent_p.I751I	p.I751I	NM_002590.3	NP_002581.2	2	3	5	2.631542	O95206	PCDH8_HUMAN		1	2456	-		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Silent	SNP	ENST00000377942.3	1	1	hg19	c.2253C>T	CCDS9438.1	0																																																																																								0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.701	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	1	0	1		2	2	2	0		0	0	74		74	72	1	3.280000	-20.000000	1	0.470000	NM_002590			31	29		244	242	0		1			0	0	74	0		1.000000	0	0	0	0	0	0	31	244
SLAIN1	122060	broad.mit.edu	37	13	78293775	78293775	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr13:78293775G>A	ENST00000466548.1	+	3	695	c.669G>A	c.(667-669)gcG>gcA	p.A223A	SLAIN1_ENST00000488699.1_Silent_p.A81A|SLAIN1_ENST00000267219.8_Silent_p.A4A|SLAIN1_ENST00000418532.1_Silent_p.A4A	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	223										breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		TGGAAGCAGCGAGACGTTCCC	0.468																																						ENST00000466548.1	1.000000	7.100000e-01			0.860000	0.869848	0.860000	1.000000																										0				14						c.(667-669)gcG>gcA		SLAIN motif family, member 1							378.0	301.0	327.0					13																	78293775		2203	4300	6503	SO:0001819	synonymous_variant	122060	2	121408	30				g.chr13:78293775G>A	AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.669G>A	chr13.hg19:g.78293775G>A		1					SLAIN1_ENST00000418532.1_Silent_p.A4A|SLAIN1_ENST00000267219.8_Silent_p.A4A|SLAIN1_ENST00000488699.1_Silent_p.A81A	p.A223A	NM_001242868.1	NP_001229797.1	2	3	5	2.631542	Q8ND83	SLAI1_HUMAN		3	695	+		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Silent	SNP	ENST00000466548.1	1	1	hg19	c.669G>A		1																																																																																								0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.468	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000355018.1	1	0	1		2	2	2	0		0	0	116		116	111	1	3.280000	-3.017764	1	0.470000	NM_144595			110	105		811	799	1		1	1		0	0	116	0		1.000000	3.415559e-01	0	4	0	6	0	110	811
ZIC2	7546	broad.mit.edu	37	13	100637726	100637726	+	Silent	SNP	G	G	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr13:100637726G>T	ENST00000376335.3	+	3	1682	c.1389G>T	c.(1387-1389)gcG>gcT	p.A463A	ZIC2_ENST00000477213.1_3'UTR	NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	463	Poly-Ala.				brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					cggcggcggcggctgcggcgg	0.816																																					Pancreas(97;119 1522 31925 44771 48764)	ENST00000376335.3	1.000000	2.700000e-01			0.880000	0.799445	0.880000	1.000000																										0				13						c.(1387-1389)gcG>gcT		Zic family member 2							2.0	3.0	3.0					13																	100637726		765	1850	2615	SO:0001819	synonymous_variant	7546	0	0					g.chr13:100637726G>T	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.1389G>T	chr13.hg19:g.100637726G>T		1					ZIC2_ENST00000477213.1_3'UTR	p.A463A	NM_007129.3	NP_009060.2	2	3	5	2.631542	O95409	ZIC2_HUMAN		3	1682	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		Q5VYA9|Q9H309	Silent	SNP	ENST00000376335.3	0	1	hg19	c.1389G>T	CCDS9495.1	1																																																																																								0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.816	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	0	0	0		2	2	2	0		0	0	9		9	9	1	3.280000	-4.074491	1	0.470000	NM_007129			3	0		25	36	0		0			0	0	9	0		0.882106	0	0	0	0	0	0	3	25
FERMT2	10979	broad.mit.edu	37	14	53386031	53386031	+	Silent	SNP	C	C	T	rs567979465		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr14:53386031C>T	ENST00000395631.2	-	3	417	c.201G>A	c.(199-201)aaG>aaA	p.K67K	FERMT2_ENST00000341590.3_Silent_p.K67K|FERMT2_ENST00000399304.3_Silent_p.K67K|FERMT2_ENST00000343279.4_Silent_p.K67K|FERMT2_ENST00000553373.1_Silent_p.K67K			Q96AC1	FERM2_HUMAN	fermitin family member 2	67	Interaction with membranes containing phosphatidylinositol phosphate.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					AAGTTCTCTTCTTTTCCCACC	0.393																																						ENST00000395631.2	1.000000	7.500000e-01			0.920000	0.918918	0.920000	1.000000																									ERO1L/FERMT2(2)	0				20						c.(199-201)aaG>aaA		fermitin family member 2							129.0	119.0	123.0					14																	53386031		2203	4300	6503	SO:0001819	synonymous_variant	10979	0	0					g.chr14:53386031C>T	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.201G>A	chr14.hg19:g.53386031C>T		1					FERMT2_ENST00000553373.1_Silent_p.K67K|FERMT2_ENST00000343279.4_Silent_p.K67K|FERMT2_ENST00000399304.3_Silent_p.K67K|FERMT2_ENST00000341590.3_Silent_p.K67K	p.K67K			2	3	5	2.541460	Q96AC1	FERM2_HUMAN		3	417	-	Breast(41;0.0342)		B5TJY2|Q14840|Q86TY7	Silent	SNP	ENST00000395631.2	1	1	hg19	c.201G>A	CCDS9713.1	1																																																																																								0.677134		TCGA-3A-A9J0-01A-11D-A40W-08	0.393	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	1	0	1		2	2	2	0		0	0	127		127	125	1	3.280000	-20.000000	1	0.470000	NM_006832			109	105		723	719	1		1	0		0	0	127	0		1.000000	9.252279e-01	0	0	0	31	0	109	723
WDR89	112840	broad.mit.edu	37	14	64066609	64066609	+	Missense_Mutation	SNP	A	A	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr14:64066609A>T	ENST00000394942.2	-	2	140	c.52T>A	c.(52-54)Tta>Ata	p.L18I	CTD-2302E22.2_ENST00000553983.1_lincRNA|WDR89_ENST00000267522.3_Missense_Mutation_p.L18I	NM_001008726.2|NM_001258272.1|NM_080666.3	NP_001008726.1|NP_001245201.1|NP_542397.1	Q96FK6	WDR89_HUMAN	WD repeat domain 89	18										endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)		TTGGTTCCTAAGGAACATTTA	0.368																																						ENST00000394942.2	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				14						c.(52-54)Tta>Ata		WD repeat domain 89							68.0	69.0	69.0					14																	64066609		2203	4298	6501	SO:0001583	missense	112840	0	0					g.chr14:64066609A>T	AF115513	CCDS9759.1	14q23.2	2013-01-09		2006-07-07	ENSG00000140006	ENSG00000140006		"""WD repeat domain containing"""	20489	protein-coding gene	gene with protein product				C14orf150			Standard	NM_080666		Approved	MGC9907	uc001xgi.4	Q96FK6	OTTHUMG00000140340	ENST00000394942.2:c.52T>A	chr14.hg19:g.64066609A>T	ENSP00000378399:p.Leu18Ile	1					CTD-2302E22.2_ENST00000553983.1_lincRNA|WDR89_ENST00000267522.3_Missense_Mutation_p.L18I	p.L18I	NM_001008726.2|NM_001258272.1|NM_080666.3	NP_001008726.1|NP_001245201.1|NP_542397.1	2	3	5	2.541460	Q96FK6	WDR89_HUMAN		2	140	-				Missense_Mutation	SNP	ENST00000394942.2	1	1	hg19	c.52T>A	CCDS9759.1	1	.	.	.	.	.	.	.	.	.	.	A	3.553	-0.091356	0.07053	.	.	ENSG00000140006	ENST00000394942;ENST00000267522;ENST00000554717	T;T;T	0.67171	-0.25;-0.25;0.96	5.93	3.42	0.39159	5.93	3.42	0.39159	.	0.938409	0.09031	N	0.858708	T	0.47040	0.1424	N	0.14661	0.345	0.09310	N	0.999998	B	0.15473	0.013	B	0.09377	0.004	T	0.29579	-1.0007	10	0.20046	T	0.44	.	8.1435	0.31097	0.6475:0.2533:0.0:0.0992	.	18	Q96FK6	WDR89_HUMAN	I	18	ENSP00000378399:L18I;ENSP00000267522:L18I;ENSP00000451702:L18I	ENSP00000267522:L18I	L	-	1	2	2	WDR89	63136362	63136362	0.692000	0.27719	0.971000	0.41717	0.360000	0.29518	0.704000	0.25661	1.055000	0.40461	0.533000	0.62120	TTA	0.677134		TCGA-3A-A9J0-01A-11D-A40W-08	0.368	WDR89-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411879.2	1	0	1		2	2	2	0		0	0	93		93	89	1	3.280000	-20.000000	1	0.470000	NM_080666			135	131		385	381	1		1	1		0	0	93	0		1.000000	8.572710e-01	0	3	0	9	0	135	385
RYR3	6263	broad.mit.edu	37	15	34130031	34130031	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr15:34130031G>A	ENST00000389232.4	+	89	11920	c.11850G>A	c.(11848-11850)ggG>ggA	p.G3950G	RYR3_ENST00000415757.3_Silent_p.G3945G	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3950					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.G3949G(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCATGGAAGGGCAAAAACAGT	0.408																																						ENST00000389232.4	1.000000	1.000000e-02			0.070000	0.190765	0.070000	0.070000																										1	Substitution - coding silent(1)	p.G3949G(1)	lung(1)	311						c.(11848-11850)ggG>ggA		ryanodine receptor 3							109.0	105.0	107.0					15																	34130031		1905	4114	6019	SO:0001819	synonymous_variant	6263	0	0					g.chr15:34130031G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11850G>A	chr15.hg19:g.34130031G>A		1					RYR3_ENST00000415757.3_Silent_p.G3945G	p.G3950G	NM_001036.3	NP_001027.3	0	4	4	2.083936	Q15413	RYR3_HUMAN		89	11920	+		all_lung(180;7.18e-09)	O15175|Q15412	Silent	SNP	ENST00000389232.4	0	1	hg19	c.11850G>A	CCDS45210.1	0																																																																																								0.621293		TCGA-3A-A9J0-01A-11D-A40W-08	0.408	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	0	0	1		2	2	2	0		0	0	61		61	60	1	3.280000	-2.537812	1	0.470000				5	5		427	418	0		1			0	0	61	0		0.934374	0	0	0	0	0	0	5	427
MYO5C	55930	broad.mit.edu	37	15	52534277	52534277	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr15:52534277G>A	ENST00000261839.7	-	20	2685	c.2524C>T	c.(2524-2526)Cga>Tga	p.R842*	MYO5C_ENST00000443683.2_Intron	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	842	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		AGGAATCCTCGGCTGTAGGCC	0.542																																						ENST00000261839.7	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				66						c.(2524-2526)Cga>Tga		myosin VC							209.0	209.0	209.0					15																	52534277		2026	4188	6214	SO:0001587	stop_gained	55930	0	0					g.chr15:52534277G>A	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.2524C>T	chr15.hg19:g.52534277G>A	ENSP00000261839:p.Arg842*	1					MYO5C_ENST00000443683.2_Intron	p.R842*	NM_018728.3	NP_061198.2	2	4	6	2.826299	Q9NQX4	MYO5C_HUMAN		20	2685	-			Q6P1W8	Nonsense_Mutation	SNP	ENST00000261839.7	0	1	hg19	c.2524C>T	CCDS42036.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.406745	0.98265	.	.	ENSG00000128833	ENST00000261839	.	.	.	5.09	3.11	0.35812	5.09	3.11	0.35812	.	0.068470	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3048	0.60347	0.0:0.0:0.5797:0.4203	.	.	.	.	X	842	.	ENSP00000261839:R842X	R	-	1	2	2	MYO5C	50321569	50321569	0.973000	0.33851	0.975000	0.42487	0.225000	0.24961	1.711000	0.37930	0.653000	0.30826	0.650000	0.86243	CGA	0.711423		TCGA-3A-A9J0-01A-11D-A40W-08	0.542	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	1	0	1		2	2	2	0		0	0	232		232	231	1	3.280000	-8.225900	1	0.470000	NM_018728			341	337		1028	1016	1		1	1		0	0	232	0		1.000000	9.999711e-01	0	4	0	43	0	341	1028
UNC13C	440279	broad.mit.edu	37	15	54825264	54825264	+	Splice_Site	SNP	C	C	T	rs377163291		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr15:54825264C>T	ENST00000260323.11	+	25	5696	c.5696C>T	c.(5695-5697)aCa>aTa	p.T1899I	UNC13C_ENST00000545554.1_Splice_Site_p.T1899I|UNC13C_ENST00000537900.1_Splice_Site_p.T1897I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1899	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTGGACAAAACGTAAGTTTTT	0.338																																						ENST00000260323.11	1.000000	2.600000e-01			0.700000	0.707984	0.700000	1.000000																										0				121						c.(5695-5697)aCa>aTa		unc-13 homolog C (C. elegans)		C	ILE/THR	0,3610		0,0,1805	65.0	66.0	66.0		5696	4.9	1.0	15		66	1,8129		0,1,4064	no	missense-near-splice	UNC13C	NM_001080534.1	89	0,1,5869	TT,TC,CC		0.0123,0.0,0.0085	benign	1899/2215	54825264	1,11739	1805	4065	5870	SO:0001630	splice_region_variant	440279	1	120228	21				g.chr15:54825264C>T	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5696+1C>T	chr15.hg19:g.54825264C>T		1					UNC13C_ENST00000537900.1_Splice_Site_p.T1897I|UNC13C_ENST00000545554.1_Splice_Site_p.T1899I	p.T1899I	NM_001080534.1	NP_001074003.1	2	4	6	2.826299	Q8NB66	UN13C_HUMAN		25	5696	+			Q0P613|Q8ND48|Q96NP3	Splice_Site	SNP	ENST00000260323.11	0	1	hg19	c.5696C>T	CCDS45264.1	0	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047374	0.36085	0.0	1.23E-4	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.15256	2.44;2.44;2.44	5.83	4.91	0.64330	5.83	4.91	0.64330	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.104815	0.64402	D	0.000004	T	0.14570	0.0352	L	0.29908	0.895	0.40999	D	0.98491	B	0.16603	0.018	B	0.16722	0.016	T	0.03863	-1.0997	10	0.39692	T	0.17	.	14.2915	0.66281	0.0:0.9288:0.0:0.0712	.	1899	Q8NB66	UN13C_HUMAN	I	1899;1899;1897	ENSP00000260323:T1899I;ENSP00000438156:T1899I;ENSP00000442569:T1897I	ENSP00000260323:T1899I	T	+	2	0	0	UNC13C	52612556	52612556	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.303000	0.33470	1.472000	0.48140	0.655000	0.94253	ACA	0.711423		TCGA-3A-A9J0-01A-11D-A40W-08	0.338	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	0	0	1		2	2	2	0		0	0	10		10	10	1	3.280000	-10.057750	1	0.470000	NM_173166	Missense_Mutation		5	5		59	58	0		1			0	0	10	0		0.937584	0	0	0	0	0	0	5	59
CIB2	10518	broad.mit.edu	37	15	78401612	78401612	+	Missense_Mutation	SNP	C	C	T	rs200697103		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr15:78401612C>T	ENST00000258930.3	-	4	639	c.311G>A	c.(310-312)cGa>cAa	p.R104Q	CIB2_ENST00000557846.1_Missense_Mutation_p.R55Q|CIB2_ENST00000539011.1_Missense_Mutation_p.R61Q|CIB2_ENST00000560618.1_Missense_Mutation_p.R61Q	NM_006383.2	NP_006374.1	O75838	CIB2_HUMAN	calcium and integrin binding family member 2	104	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion homeostasis (GO:0055074)|photoreceptor cell maintenance (GO:0045494)	blood microparticle (GO:0072562)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|photoreceptor inner segment (GO:0001917)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)	p.R104Q(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	11						CTTGAGCTCTCGGGGAGCCGA	0.552																																						ENST00000258930.3	0.220000	2.000000e-02			0.100000	0.114076	0.100000	0.100000																										1	Substitution - Missense(1)	p.R104Q(1)	central_nervous_system(1)	11						c.(310-312)cGa>cAa		calcium and integrin binding family member 2		C	GLN/ARG	0,4392		0,0,2196	95.0	83.0	87.0		311	4.5	1.0	15		87	3,8583	3.0+/-9.4	0,3,4290	yes	missense	CIB2	NM_006383.2	43	0,3,6486	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	104/188	78401612	3,12975	2196	4293	6489	SO:0001583	missense	10518	0	0					g.chr15:78401612C>T	BC047381	CCDS10296.1, CCDS61722.1, CCDS61723.1	15q24	2013-01-10			ENSG00000136425	ENSG00000136425		"""EF-hand domain containing"""	24579	protein-coding gene	gene with protein product		605564	"""deafness, autosomal recessive 48"", ""Usher syndrome 1J (autosomal recessive)"""	DFNB48, USH1J		9931475, 23023331	Standard	NM_006383		Approved	KIP2	uc002bdb.2	O75838	OTTHUMG00000143731	ENST00000258930.3:c.311G>A	chr15.hg19:g.78401612C>T	ENSP00000258930:p.Arg104Gln	1					CIB2_ENST00000560618.1_Missense_Mutation_p.R61Q|CIB2_ENST00000539011.1_Missense_Mutation_p.R61Q|CIB2_ENST00000557846.1_Missense_Mutation_p.R55Q	p.R104Q	NM_006383.2	NP_006374.1	2	3	5	2.668272	O75838	CIB2_HUMAN		4	639	-			B4DDF0|H0YM71|Q05BT6	Missense_Mutation	SNP	ENST00000258930.3	0	1	hg19	c.311G>A	CCDS10296.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.114424	0.94339	0.0	3.49E-4	ENSG00000136425	ENST00000258930;ENST00000539011	T;T	0.67171	-0.25;2.96	4.46	4.46	0.54185	4.46	4.46	0.54185	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77363	0.4119	L	0.58669	1.825	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.64506	0.926;0.925	T	0.78607	-0.2138	10	0.48119	T	0.1	-16.4882	16.4633	0.84071	0.0:1.0:0.0:0.0	.	104;104	B4DDF0;O75838	.;CIB2_HUMAN	Q	104;61	ENSP00000258930:R104Q;ENSP00000442459:R61Q	ENSP00000258930:R104Q	R	-	2	0	0	CIB2	76188667	76188667	1.000000	0.71417	0.981000	0.43875	0.958000	0.62258	7.617000	0.83032	2.199000	0.70637	0.591000	0.81541	CGA	0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.552	CIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289798.1	0	0	1		2	2	2	0		0	0	53		53	52	1	3.280000	-4.339525	1	0.470000	NM_006383			5	5		372	362	0		1	0		0	0	53	0		0.933436	5.945755e-02	0	0	0	24	0	5	372
RGMA	56963	broad.mit.edu	37	15	93588701	93588701	+	Missense_Mutation	SNP	C	C	T	rs201119116	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr15:93588701C>T	ENST00000329082.7	-	4	1151	c.880G>A	c.(880-882)Gtc>Atc	p.V294I	RGMA_ENST00000542321.2_Missense_Mutation_p.V278I|RGMA_ENST00000557420.1_3'UTR|RGMA_ENST00000425933.2_Missense_Mutation_p.V278I|RGMA_ENST00000556658.1_Missense_Mutation_p.V185I|RGMA_ENST00000557301.1_Missense_Mutation_p.V302I|RGMA_ENST00000538818.1_Missense_Mutation_p.V185I|RGMA_ENST00000543599.1_Missense_Mutation_p.V278I	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	294					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GGCATGCGGACGGCAAAGGTC	0.622													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19417	0.0		0.001	False		,,,				2504	0.0					ENST00000329082.7	1.000000	5.400000e-01			0.860000	0.852002	0.860000	1.000000																										0				9						c.(880-882)Gtc>Atc		repulsive guidance molecule family member a							31.0	37.0	35.0					15																	93588701		2131	4229	6360	SO:0001583	missense	56963	13	121100	39				g.chr15:93588701C>T	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.880G>A	chr15.hg19:g.93588701C>T	ENSP00000330005:p.Val294Ile	1					RGMA_ENST00000425933.2_Missense_Mutation_p.V278I|RGMA_ENST00000542321.2_Missense_Mutation_p.V278I|RGMA_ENST00000557301.1_Missense_Mutation_p.V302I|RGMA_ENST00000556658.1_Missense_Mutation_p.V185I|RGMA_ENST00000538818.1_Missense_Mutation_p.V185I|RGMA_ENST00000543599.1_Missense_Mutation_p.V278I|RGMA_ENST00000557420.1_3'UTR	p.V294I	NM_020211.2	NP_064596	2	3	5	2.668272	Q96B86	RGMA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)	4	1151	-	Lung NSC(78;0.0542)|all_lung(78;0.0786)		B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	0	1	hg19	c.880G>A	CCDS45357.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	5.222	0.226549	0.09916	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000538818;ENST00000557301	D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	4.76	3.81	0.43845	4.76	3.81	0.43845	Repulsive guidance molecule, C-terminal (1);	0.058854	0.64402	N	0.000002	T	0.71417	0.3337	N	0.25825	0.765	0.80722	D	1	B;B	0.18741	0.024;0.03	B;B	0.15052	0.012;0.012	T	0.61491	-0.7052	10	0.02654	T	1	-9.2223	10.6561	0.45675	0.0:0.8974:0.0:0.1026	.	302;294	G3V518;Q96B86	.;RGMA_HUMAN	I	278;278;294;278;185;302	ENSP00000442498:V278I;ENSP00000404442:V278I;ENSP00000330005:V294I;ENSP00000440025:V278I;ENSP00000442546:V185I;ENSP00000452126:V302I	ENSP00000330005:V294I	V	-	1	0	0	RGMA	91389705	91389705	0.999000	0.42202	0.400000	0.26346	0.678000	0.39670	4.046000	0.57376	0.880000	0.35969	0.491000	0.48974	GTC	0.689150		TCGA-3A-A9J0-01A-11D-A40W-08	0.622	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	1	0	1		2	2	2	0		0	0	26		26	26	1	3.280000	-20.000000	1	0.470000	NM_020211			18	17		135	129	1		1	0		0	0	26	0		0.999981	4.379888e-01	0	0	0	12	0	18	135
CACNA1H	8912	broad.mit.edu	37	16	1246017	1246017	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:1246017G>A	ENST00000348261.5	+	5	885	c.637G>A	c.(637-639)Gtg>Atg	p.V213M	CACNA1H_ENST00000565831.1_Missense_Mutation_p.V213M|CACNA1H_ENST00000358590.4_Missense_Mutation_p.V213M	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	213					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CATCAACCGCGTGCCTAGTAA	0.652																																						ENST00000348261.5	1.000000	7.100000e-01			0.940000	0.924757	0.940000	1.000000																										0				34						c.(637-639)Gtg>Atg		calcium channel, voltage-dependent, T type, alpha 1H subunit	Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)						41.0	49.0	47.0					16																	1246017		2016	4165	6181	SO:0001583	missense	8912	2	120908	30				g.chr16:1246017G>A	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.637G>A	chr16.hg19:g.1246017G>A	ENSP00000334198:p.Val213Met	1					CACNA1H_ENST00000565831.1_Missense_Mutation_p.V213M|CACNA1H_ENST00000358590.4_Missense_Mutation_p.V213M	p.V213M	NM_021098.2	NP_066921.2	2	2	4	2.300494	O95180	CAC1H_HUMAN		5	885	+		Hepatocellular(780;0.00369)	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	1	1	hg19	c.637G>A	CCDS45375.1	1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447525	0.63178	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.98649	-5.05;-5.05	4.23	4.23	0.50019	4.23	4.23	0.50019	Ion transport (1);	0.149470	0.44688	N	0.000436	D	0.99080	0.9684	M	0.83774	2.66	0.40988	D	0.984831	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	D	0.99875	1.1103	10	0.87932	D	0	.	15.9489	0.79817	0.0:0.0:1.0:0.0	.	213;213	O95180-2;O95180	.;CAC1H_HUMAN	M	213	ENSP00000334198:V213M;ENSP00000351401:V213M	ENSP00000334198:V213M	V	+	1	0	0	CACNA1H	1186018	1186018	1.000000	0.71417	0.923000	0.36655	0.020000	0.10135	9.594000	0.98254	2.061000	0.61500	0.478000	0.44815	GTG	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.652	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	1	0	1		2	2	2	0		0	0	69		69	67	1	3.280000	-20.000000	1	0.470000	NM_001005407			46	45		258	253	1		1	0		0	0	69	0		1.000000	1.726037e-01	0	0	0	5	0	46	258
USP31	57478	broad.mit.edu	37	16	23119457	23119457	+	Silent	SNP	A	A	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:23119457A>G	ENST00000219689.7	-	2	680	c.681T>C	c.(679-681)caT>caC	p.H227H		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	180	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CCTGGGCATCATGTTGGGAAT	0.478																																						ENST00000219689.7	1.000000	9.200000e-01			0.990000	0.994906	0.990000	1.000000																										0				57						c.(679-681)caT>caC		ubiquitin specific peptidase 31							100.0	96.0	97.0					16																	23119457		2197	4300	6497	SO:0001819	synonymous_variant	57478	0	0					g.chr16:23119457A>G	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.681T>C	chr16.hg19:g.23119457A>G		1						p.H227H	NM_020718.3	NP_065769.3	2	2	4	2.241091	Q86UV5	UBP48_HUMAN		2	680	-			B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000219689.7	1	1	hg19	c.681T>C	CCDS10607.1	1																																																																																								0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.478	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	1	0	1		2	2	2	0		0	0	50		50	48	1	3.280000	-20.000000	1	0.470000	NM_020718			67	66		294	286	1		1	1		0	0	50	0		1.000000	2.376766e-01	0	2	0	3	0	67	294
ZKSCAN2	342357	broad.mit.edu	37	16	25251421	25251421	+	Missense_Mutation	SNP	A	A	C			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:25251421A>C	ENST00000328086.7	-	7	3423	c.2620T>G	c.(2620-2622)Ttc>Gtc	p.F874V	CTD-2547G23.2_ENST00000569456.1_RNA	NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	874					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TGGGCGCTGAAATGAGAACTG	0.458																																						ENST00000328086.7	1.000000	7.000000e-01			0.880000	0.882631	0.880000	1.000000																										0				36						c.(2620-2622)Ttc>Gtc		zinc finger with KRAB and SCAN domains 2							86.0	81.0	83.0					16																	25251421		2197	4300	6497	SO:0001583	missense	342357	0	0					g.chr16:25251421A>C	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.2620T>G	chr16.hg19:g.25251421A>C	ENSP00000331626:p.Phe874Val	1					CTD-2547G23.2_ENST00000569456.1_RNA	p.F874V	NM_001012981.4	NP_001012999.3	2	2	4	2.241091	Q63HK3	ZKSC2_HUMAN		7	3423	-			A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	1	1	hg19	c.2620T>G	CCDS32410.1	1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.026466	0.54683	.	.	ENSG00000155592	ENST00000328086	T	0.18338	2.22	5.53	5.53	0.82687	5.53	5.53	0.82687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.173579	0.41823	D	0.000812	T	0.19886	0.0478	L	0.31120	0.905	0.36356	D	0.860369	P;D	0.53619	0.951;0.961	P;P	0.53224	0.696;0.721	T	0.10451	-1.0629	10	0.66056	D	0.02	-9.4959	8.0971	0.30835	0.913:0.0:0.087:0.0	.	670;874	B4DYF0;Q63HK3	.;ZKSC2_HUMAN	V	874	ENSP00000331626:F874V	ENSP00000331626:F874V	F	-	1	0	0	ZKSCAN2	25158922	25158922	0.820000	0.29190	0.998000	0.56505	0.489000	0.33432	1.465000	0.35299	2.315000	0.78130	0.533000	0.62120	TTC	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.458	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	1	0	1		2	2	2	0		0	0	91		91	91	1	3.280000	-20.000000	1	0.470000	NM_001012981			71	68		431	423	1		1	0		0	0	91	0		1.000000	5.591180e-02	0	1	0	2	0	71	431
ATXN2L	11273	broad.mit.edu	37	16	28841228	28841228	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:28841228C>T	ENST00000336783.4	+	8	1050	c.883C>T	c.(883-885)Cgt>Tgt	p.R295C	ATXN2L_ENST00000570200.1_Missense_Mutation_p.R295C|ATXN2L_ENST00000382686.4_Missense_Mutation_p.R295C|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000325215.6_Missense_Mutation_p.R295C|ATXN2L_ENST00000395547.2_Missense_Mutation_p.R295C|ATXN2L_ENST00000564304.1_Missense_Mutation_p.R295C|ATXN2L_ENST00000340394.8_Missense_Mutation_p.R295C	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	295					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GCGAGAGCTGCGTGCGGCCCA	0.577																																						ENST00000336783.4	1.000000	8.900000e-01			0.990000	0.993174	0.990000	1.000000																										0				36						c.(883-885)Cgt>Tgt		ataxin 2-like							68.0	66.0	67.0					16																	28841228		2197	4300	6497	SO:0001583	missense	11273	0	0					g.chr16:28841228C>T		CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.883C>T	chr16.hg19:g.28841228C>T	ENSP00000338718:p.Arg295Cys	1					ATXN2L_ENST00000325215.6_Missense_Mutation_p.R295C|ATXN2L_ENST00000395547.2_Missense_Mutation_p.R295C|ATXN2L_ENST00000382686.4_Missense_Mutation_p.R295C|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000564304.1_Missense_Mutation_p.R295C|ATXN2L_ENST00000570200.1_Missense_Mutation_p.R295C|ATXN2L_ENST00000340394.8_Missense_Mutation_p.R295C	p.R295C	NM_007245.3	NP_009176.2	2	2	4	2.241091	Q8WWM7	ATX2L_HUMAN		8	1050	+			A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	1	1	hg19	c.883C>T	CCDS10641.1	1	.	.	.	.	.	.	.	.	.	.	.	28.0	4.882278	0.91740	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000359153;ENST00000382686;ENST00000325215	T;T;T;T;T	0.51817	0.7;0.7;0.69;0.7;0.7	5.85	5.85	0.93711	5.85	5.85	0.93711	LsmAD domain (1);	0.000000	0.64402	D	0.000001	T	0.67711	0.2922	M	0.72118	2.19	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.87578	0.997;0.998;0.998;0.998;0.997;0.997;0.998;0.997	T	0.69672	-0.5082	10	0.87932	D	0	-9.2431	14.4368	0.67287	0.148:0.8519:0.0:0.0	.	295;295;295;295;295;295;295;295	Q8WWM7-6;Q8WWM7-5;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;.;ATX2L_HUMAN;.;.;.;.	C	295	ENSP00000341459:R295C;ENSP00000378917:R295C;ENSP00000338718:R295C;ENSP00000372133:R295C;ENSP00000315650:R295C	ENSP00000315650:R295C	R	+	1	0	0	ATXN2L	28748729	28748729	0.953000	0.32496	1.000000	0.80357	0.950000	0.60333	2.191000	0.42640	2.779000	0.95612	0.491000	0.48974	CGT	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.577	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	1	0	1		2	2	2	0		0	0	66		66	62	1	3.280000	-20.000000	1	0.470000	NM_007245			51	51		221	219	1		1	1		0	0	66	0		1.000000	9.999999e-01	0	22	0	87	0	51	221
KIF22	3835	broad.mit.edu	37	16	29814108	29814108	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:29814108C>A	ENST00000160827.4	+	9	1339	c.1299C>A	c.(1297-1299)agC>agA	p.S433R	KIF22_ENST00000400751.5_Missense_Mutation_p.S365R|KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000569382.2_Missense_Mutation_p.S365R|KIF22_ENST00000561482.1_Missense_Mutation_p.S365R	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	433				APASASQKLSPLQKLSSMDPAMLERLLSLDRLLASQGSQ -> SSSLCLPETQPPTEAKAAWTRPCGAPPQLGPSACLPGE P (in Ref. 2; BAA33063). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						AGAAGCTAAGCAGCATGGACC	0.617																																						ENST00000160827.4	0.180000	1.000000e-02			0.080000	0.091559	0.080000	0.080000																										0				14						c.(1297-1299)agC>agA		kinesin family member 22							57.0	62.0	60.0					16																	29814108		2197	4298	6495	SO:0001583	missense	3835	0	0					g.chr16:29814108C>A	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1299C>A	chr16.hg19:g.29814108C>A	ENSP00000160827:p.Ser433Arg	1					KIF22_ENST00000400751.5_Missense_Mutation_p.S365R|KIF22_ENST00000569382.2_Missense_Mutation_p.S365R|KIF22_ENST00000561482.1_Missense_Mutation_p.S365R|KIF22_ENST00000400750.2_5'UTR	p.S433R	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	2	2	4	2.241091	Q14807	KIF22_HUMAN		9	1339	+			B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	ENST00000160827.4	0	1	hg19	c.1299C>A	CCDS10653.1	0	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646600	0.47258	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.74002	-0.72;-0.8	5.67	-4.09	0.03951	5.67	-4.09	0.03951	.	.	.	.	.	T	0.50034	0.1592	N	0.14661	0.345	0.25229	N	0.989848	P;P	0.40731	0.483;0.728	B;B	0.37601	0.084;0.254	T	0.46020	-0.9221	9	0.23891	T	0.37	.	8.278	0.31883	0.0:0.5586:0.2028:0.2385	.	365;433	B7Z265;Q14807	.;KIF22_HUMAN	R	433;365	ENSP00000160827:S433R;ENSP00000383562:S365R	ENSP00000160827:S433R	S	+	3	2	2	KIF22	29721609	29721609	0.167000	0.22975	0.935000	0.37517	0.919000	0.55068	-0.212000	0.09319	-0.299000	0.08909	-0.156000	0.13503	AGC	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.617	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2	0	0	1		2	2	2	0		0	0	99		99	98	1	3.280000	-2.924628	1	0.470000				5	5		399	390	0		1	0		0	0	99	0		0.934150	4.681834e-01	0	0	0	112	0	5	399
SEPT1	1731	broad.mit.edu	37	16	30393182	30393182	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:30393182G>A	ENST00000571393.1	-	5	390	c.204C>T	c.(202-204)gcC>gcT	p.A68A	SEPT1_ENST00000321367.3_Silent_p.A115A|SEPT1_ENST00000605106.1_Silent_p.A73A|SEPT1_ENST00000570039.1_5'Flank			Q8WYJ6	SEPT1_HUMAN	septin 1	68	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			GGCGCTCAATGGCCAGGGTCT	0.562																																						ENST00000571393.1	0.290000	1.200000e-01			0.200000	0.207946	0.200000	0.200000																										0				24						c.(202-204)gcC>gcT		septin 1							109.0	107.0	108.0					16																	30393182		2197	4300	6497	SO:0001819	synonymous_variant	1731	0	0					g.chr16:30393182G>A	AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.204C>T	chr16.hg19:g.30393182G>A		1					SEPT1_ENST00000570039.1_5'Flank|SEPT1_ENST00000605106.1_Silent_p.A73A|SEPT1_ENST00000321367.3_Silent_p.A115A	p.A68A			2	2	4	2.241091	Q8WYJ6	SEPT1_HUMAN	Colorectal(24;0.193)	5	390	-			B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Silent	SNP	ENST00000571393.1	1	1	hg19	c.204C>T		0																																																																																								0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.562	SEPT1-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2	2	2	1		1	0	164		164	157	1	3.280000	-2.900864	1	0.470000	NM_052838			28	28		839	813	0		1	0		1	0	164	0		1.000000	3.501273e-02	0	0	0	9	0	28	839
ABCC12	94160	broad.mit.edu	37	16	48174686	48174686	+	Missense_Mutation	SNP	G	G	A	rs535991858		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:48174686G>A	ENST00000311303.3	-	4	914	c.569C>T	c.(568-570)aCg>aTg	p.T190M	ABCC12_ENST00000416054.1_Missense_Mutation_p.T190M|ABCC12_ENST00000448542.1_Missense_Mutation_p.T190M	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	190	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CCGGATGGCCGTGCGGTAGTT	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		19848	0.001		0.0	False		,,,				2504	0.0					ENST00000311303.3	0.130000	0			0.050000	0.062019	0.050000	0.040000																										0				90						c.(568-570)aCg>aTg		ATP-binding cassette, sub-family C (CFTR/MRP), member 12							101.0	104.0	103.0					16																	48174686		2201	4300	6501	SO:0001583	missense	94160	7	121412	43				g.chr16:48174686G>A	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.569C>T	chr16.hg19:g.48174686G>A	ENSP00000311030:p.Thr190Met	1					ABCC12_ENST00000448542.1_Missense_Mutation_p.T190M|ABCC12_ENST00000416054.1_Missense_Mutation_p.T190M	p.T190M	NM_033226.2	NP_150229.2	2	2	4	2.241091	Q96J65	MRP9_HUMAN		4	914	-		all_cancers(37;0.0474)|all_lung(18;0.047)	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	0	1	hg19	c.569C>T	CCDS10730.1	0	.	.	.	.	.	.	.	.	.	.	G	14.79	2.641298	0.47153	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.90197	-2.63;-2.63;-2.63	6.07	4.13	0.48395	6.07	4.13	0.48395	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94896	0.8350	M	0.84219	2.685	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.94242	0.7486	10	0.51188	T	0.08	.	12.0291	0.53388	0.1413:0.0:0.8587:0.0	.	190;190	Q96J65-2;Q96J65	.;MRP9_HUMAN	M	190	ENSP00000311030:T190M;ENSP00000401855:T190M;ENSP00000413046:T190M	ENSP00000311030:T190M	T	-	2	0	0	ABCC12	46732187	46732187	1.000000	0.71417	0.755000	0.31263	0.011000	0.07611	5.520000	0.67080	0.900000	0.36469	0.655000	0.94253	ACG	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.532	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	0	0	1		2	2	2	0		0	0	110		110	110	1	3.280000	-2.512945	1	0.470000	NM_033226			6	6		674	668	0		1			0	0	110	0		0.964110	0	0	0	0	0	0	6	674
WDR90	197335	broad.mit.edu	37	16	708985	708985	+	Silent	SNP	C	C	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:708985C>G	ENST00000293879.4	+	24	2985	c.2985C>G	c.(2983-2985)ctC>ctG	p.L995L	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Silent_p.L995L			Q96KV7	WDR90_HUMAN	WD repeat domain 90	995										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCGTCTTCCTCTGGGATGTCC	0.642																																						ENST00000293879.4	0.420000	1.700000e-01			0.280000	0.294826	0.280000	0.280000																										0				37						c.(2983-2985)ctC>ctG		WD repeat domain 90							77.0	95.0	89.0					16																	708985		2110	4220	6330	SO:0001819	synonymous_variant	197335	3	121024	38				g.chr16:708985C>G	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2985C>G	chr16.hg19:g.708985C>G		1					WDR90_ENST00000549091.1_Silent_p.L995L|LA16c-349E10.1_ENST00000573609.1_RNA	p.L995L			2	2	4	2.300494	Q96KV7	WDR90_HUMAN		24	2985	+		Hepatocellular(780;0.0218)	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	ENST00000293879.4	1	1	hg19	c.2985C>G	CCDS42092.1	0																																																																																								0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.642	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	1	0	1		2	2	2	0		0	0	91		91	88	1	3.280000	-4.855244	1	0.470000	NM_145294			20	20		423	415	0		1	1		0	0	91	0		0.999995	4.594150e-01	0	3	0	30	0	20	423
SLC12A3	6559	broad.mit.edu	37	16	56904081	56904081	+	Silent	SNP	C	C	T	rs369387970		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:56904081C>T	ENST00000563236.1	+	5	700	c.675C>T	c.(673-675)ttC>ttT	p.F225F	SLC12A3_ENST00000566786.1_Silent_p.F224F|SLC12A3_ENST00000438926.2_Silent_p.F225F|SLC12A3_ENST00000262502.5_Silent_p.F224F			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	225					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTTTCGCTTTCGCCAATGCCG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		19036	0.0		0.0	False		,,,				2504	0.001					ENST00000563236.1	1.000000	7.800000e-01			0.990000	0.958304	0.990000	1.000000																										0				50						c.(673-675)ttC>ttT		solute carrier family 12 (sodium/chloride transporter), member 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	C	,,	0,4396		0,0,2198	66.0	65.0	65.0		675,672,675	-10.8	0.0	16		65	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC12A3	NM_000339.2,NM_001126107.1,NM_001126108.1	,,	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	,,	225/1031,224/1030,225/1022	56904081	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	6559	8	121412	41				g.chr16:56904081C>T		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.675C>T	chr16.hg19:g.56904081C>T		1					SLC12A3_ENST00000262502.5_Silent_p.F224F|SLC12A3_ENST00000438926.2_Silent_p.F225F|SLC12A3_ENST00000566786.1_Silent_p.F224F	p.F225F			2	2	4	2.220512	P55017	S12A3_HUMAN		5	700	+			A8MSJ2|C9JNN9	Silent	SNP	ENST00000563236.1	1	1	hg19	c.675C>T	CCDS58464.1	1																																																																																								0.633598		TCGA-3A-A9J0-01A-11D-A40W-08	0.647	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1	1	0	1		2	2	2	0		0	0	77		77	75	1	3.280000	-3.336150	1	0.470000				58	57		299	297	1		1			0	0	77	0		1.000000	0	0	0	0	0	0	58	299
DHX38	9785	broad.mit.edu	37	16	72132878	72132878	+	Nonsense_Mutation	SNP	A	A	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:72132878A>T	ENST00000268482.3	+	6	1326	c.817A>T	c.(817-819)Aaa>Taa	p.K273*	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	273					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TCCCTCCTACAAATATAACGA	0.592																																					Melanoma(97;711 1442 7855 13832 28836)	ENST00000268482.3	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				48						c.(817-819)Aaa>Taa		DEAH (Asp-Glu-Ala-His) box polypeptide 38							57.0	56.0	56.0					16																	72132878		2198	4300	6498	SO:0001587	stop_gained	9785	0	0					g.chr16:72132878A>T	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.817A>T	chr16.hg19:g.72132878A>T	ENSP00000268482:p.Lys273*	1					DHX38_ENST00000536867.1_Intron	p.K273*	NM_014003.3	NP_054722.2	2	2	4	2.220512	Q92620	PRP16_HUMAN		6	1326	+		Ovarian(137;0.125)	B4DVG8|D3DWS7|O75212|Q96HN7	Nonsense_Mutation	SNP	ENST00000268482.3	0	1	hg19	c.817A>T	CCDS10907.1	1	.	.	.	.	.	.	.	.	.	.	A	41	8.828726	0.98970	.	.	ENSG00000140829	ENST00000268482	.	.	.	4.87	4.87	0.63330	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7562	0.69567	1.0:0.0:0.0:0.0	.	.	.	.	X	273	.	ENSP00000268482:K273X	K	+	1	0	0	DHX38	70690379	70690379	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	8.784000	0.91818	1.958000	0.56883	0.460000	0.39030	AAA	0.633598		TCGA-3A-A9J0-01A-11D-A40W-08	0.592	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	1	0	1		2	2	2	0		0	0	31		31	29	1	3.280000	-20.000000	1	0.470000	NM_014003			55	55		105	102	1		1	1		0	0	31	0		1.000000	9.999941e-01	0	6	0	34	0	55	105
SPATA2L	124044	broad.mit.edu	37	16	89764252	89764252	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr16:89764252C>T	ENST00000289805.5	-	3	833	c.765G>A	c.(763-765)gcG>gcA	p.A255A	SPATA2L_ENST00000335360.7_Intron	NM_152339.3	NP_689552.2	Q8IUW3	SPA2L_HUMAN	spermatogenesis associated 2-like	255										breast(1)|cervix(1)|endometrium(1)|lung(2)|skin(1)	6		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		AGGCCAGCTCCGCCGGGGGCG	0.701																																						ENST00000289805.5	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				6						c.(763-765)gcG>gcA		spermatogenesis associated 2-like							10.0	11.0	11.0					16																	89764252		2191	4281	6472	SO:0001819	synonymous_variant	124044	3	121026	32				g.chr16:89764252C>T	AF070574	CCDS10985.1	16q24.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000158792	ENSG00000158792			28393	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 76"""	C16orf76		8619474	Standard	NM_152339		Approved	MGC26885, tamo	uc002foj.3	Q8IUW3	OTTHUMG00000138047	ENST00000289805.5:c.765G>A	chr16.hg19:g.89764252C>T		1					SPATA2L_ENST00000335360.7_Intron	p.A255A	NM_152339.3	NP_689552.2	2	2	4	2.258548	Q8IUW3	SPA2L_HUMAN		3	833	-		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)	D3DX85|Q8NHV3	Silent	SNP	ENST00000289805.5	1	1	hg19	c.765G>A	CCDS10985.1	1																																																																																								0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.701	SPATA2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269923.1	1	0	1		2	2	2	0		0	0	15		15	13	1	3.280000	-20.000000	1	0.470000	NM_152339			24	16		38	34	1		1	1		0	0	15	0		1.000000	9.941312e-01	0	4	0	13	0	24	38
SCARF1	8578	broad.mit.edu	37	17	1538332	1538332	+	Missense_Mutation	SNP	C	C	T	rs147642060	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr17:1538332C>T	ENST00000263071.4	-	11	2262	c.2213G>A	c.(2212-2214)cGg>cAg	p.R738Q	SCARF1_ENST00000571272.1_3'UTR|SCARF1_ENST00000348987.3_Missense_Mutation_p.R652Q	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	738	Gly-rich.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCCCTTTTTCCGATTCAGGGC	0.632													C|||	6	0.00119808	0.0045	0.0	5008	,	,		16845	0.0		0.0	False		,,,				2504	0.0					ENST00000263071.4	1.000000	4.600000e-01			0.730000	0.749210	0.730000	1.000000																										0				20						c.(2212-2214)cGg>cAg		scavenger receptor class F, member 1			GLN/ARG,,GLN/ARG	10,4396		0,10,2193	23.0	24.0	24.0		2213,,1955	2.5	0.9	17	dbSNP_134	24	1,8599		0,1,4299	yes	missense,utr-3,missense	SCARF1	NM_003693.2,NM_145350.1,NM_145352.2	43,,43	0,11,6492	TT,TC,CC		0.0116,0.227,0.0846	possibly-damaging,,possibly-damaging	738/831,,652/745	1538332	11,12995	2203	4300	6503	SO:0001583	missense	8578	30	121406	44				g.chr17:1538332C>T	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.2213G>A	chr17.hg19:g.1538332C>T	ENSP00000263071:p.Arg738Gln	1					SCARF1_ENST00000348987.3_Missense_Mutation_p.R652Q|SCARF1_ENST00000571272.1_3'UTR	p.R738Q	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	0	2	2	1.636792	Q14162	SREC_HUMAN		11	2262	-			A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	1	1	hg19	c.2213G>A	CCDS11007.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	c	10.85	1.466182	0.26335	0.00227	1.16E-4	ENSG00000074660	ENST00000263071;ENST00000348987	T;T	0.22539	1.95;2.62	4.89	2.46	0.29980	4.89	2.46	0.29980	.	0.197318	0.25025	N	0.033728	T	0.17916	0.0430	M	0.63428	1.95	0.22918	N	0.998569	B;B	0.32781	0.384;0.145	B;B	0.26693	0.072;0.024	T	0.14227	-1.0480	10	0.26408	T	0.33	-6.2381	8.5352	0.33360	0.0:0.8531:0.0:0.1469	.	652;738	Q14162-2;Q14162	.;SREC_HUMAN	Q	738;652	ENSP00000263071:R738Q;ENSP00000323964:R652Q	ENSP00000263071:R738Q	R	-	2	0	0	SCARF1	1485082	1485082	0.995000	0.38212	0.865000	0.33974	0.372000	0.29890	0.814000	0.27239	0.257000	0.21650	0.550000	0.68814	CGG	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.632	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	1	0	1		2	2	2	0		0	0	51		51	48	1	3.280000	-3.634488	1	0.470000	NM_003693			18	16		86	87	1		1	1		0	0	51	0		0.999989	9.437098e-01	0	2	0	24	0	18	86
ERBB2	2064	broad.mit.edu	37	17	37863277	37863277	+	Silent	SNP	T	T	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr17:37863277T>A	ENST00000269571.5	+	2	267	c.108T>A	c.(106-108)ccT>ccA	p.P36P	ERBB2_ENST00000584601.1_Silent_p.P6P|ERBB2_ENST00000445658.2_Intron|ERBB2_ENST00000541774.1_Silent_p.P21P|ERBB2_ENST00000406381.2_Silent_p.P6P|ERBB2_ENST00000540042.1_Silent_p.P6P|ERBB2_ENST00000540147.1_Silent_p.P6P|ERBB2_ENST00000584450.1_Silent_p.P36P|ERBB2_ENST00000578199.1_Silent_p.P6P			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	36					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TGCGGCTCCCTGCCAGTCCCG	0.642		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												ENST00000269571.5	0.280000	3.000000e-02			0.150000	0.160263	0.150000	0.160000		1		Dom	yes			Dom	yes		17	17q21.1	17q21.1	2064	A, Mis, O	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""				E	E			breast, ovarian, other tumour types, NSCLC, gastric		0				247						c.(106-108)ccT>ccA		v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)						43.0	38.0	39.0					17																	37863277		2202	4295	6497	SO:0001819	synonymous_variant	2064	0	0					g.chr17:37863277T>A	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.108T>A	chr17.hg19:g.37863277T>A		1	TCGA GBM(5;<1E-08)				ERBB2_ENST00000541774.1_Silent_p.P21P|ERBB2_ENST00000584450.1_Silent_p.P36P|ERBB2_ENST00000540042.1_Silent_p.P6P|ERBB2_ENST00000445658.2_Intron|ERBB2_ENST00000578199.1_Silent_p.P6P|ERBB2_ENST00000584601.1_Silent_p.P6P|ERBB2_ENST00000406381.2_Silent_p.P6P|ERBB2_ENST00000540147.1_Silent_p.P6P	p.P36P			1	15	16	38.437938	P04626	ERBB2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	2	267	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	0	1	hg19	c.108T>A	CCDS32642.1	0																																																																																								0.876457		TCGA-3A-A9J0-01A-11D-A40W-08	0.642	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2	0	0	1		2	2	2	0		0	0	55		55	50	1	3.280000	-16.205390	1	0.470000				51	52		4703	4489	0		1	1		0	0	55	0		1.000000	1	0	16	0	2906	0	51	4703
TP53	7157	broad.mit.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr17:7578370C>T	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)	24185						c.e5+1	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						48.0	46.0	47.0					17																	7578370		2203	4300	6503	SO:0001630	splice_region_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578370C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>A	chr17.hg19:g.7578370C>T		1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site		NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.636792	P04637	P53_HUMAN		5	749	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	1	1	hg19		CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774230	0.31411	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	TP53	7519095	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	60		60	58	1	3.280000	-20.000000	1	0.470000	NM_000546	Intron		74	74		96	94	1		1		1	0	0	60	681		1.000000	0	1	0	400	0	408	74	96
TTYH2	94015	broad.mit.edu	37	17	72227040	72227040	+	Missense_Mutation	SNP	G	G	A	rs150215307	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr17:72227040G>A	ENST00000269346.4	+	3	390	c.316G>A	c.(316-318)Gtt>Att	p.V106I	TTYH2_ENST00000529107.1_Missense_Mutation_p.V85I	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	106						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						TGCGGTGGGCGTTGGTTTCTA	0.483													g|||	23	0.00459265	0.0159	0.0014	5008	,	,		20070	0.0		0.0	False		,,,				2504	0.001					ENST00000269346.4	1.000000	6.500000e-01			0.860000	0.868288	0.860000	1.000000																										0				36						c.(316-318)Gtt>Att		tweety family member 2		A	ILE/VAL	58,4348	56.2+/-92.4	0,58,2145	174.0	137.0	150.0		316	3.4	0.9	17	dbSNP_134	150	2,8598	1.2+/-3.3	0,2,4298	yes	missense	TTYH2	NM_032646.5	29	0,60,6443	AA,AG,GG		0.0233,1.3164,0.4613	benign	106/535	72227040	60,12946	2203	4300	6503	SO:0001583	missense	94015	205	121412	55				g.chr17:72227040G>A		CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.316G>A	chr17.hg19:g.72227040G>A	ENSP00000269346:p.Val106Ile	1					TTYH2_ENST00000529107.1_Missense_Mutation_p.V85I	p.V106I	NM_032646.5	NP_116035.5	1	3	4	2.244625	Q9BSA4	TTYH2_HUMAN		3	390	+			B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	ENST00000269346.4	1	0	hg19	c.316G>A	CCDS32717.1	1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	g	8.083	0.772809	0.16051	0.013164	2.33E-4	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.12984	2.63;2.63	5.35	3.38	0.38709	5.35	3.38	0.38709	.	0.185685	0.46758	N	0.000263	T	0.06234	0.0161	L	0.41961	1.31	0.80722	D	1	B;B	0.33857	0.429;0.092	B;B	0.28305	0.088;0.037	T	0.24870	-1.0148	10	0.13470	T	0.59	-8.4172	7.2697	0.26250	0.3324:0.0:0.6676:0.0	.	85;106	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	I	106;85	ENSP00000269346:V106I;ENSP00000433089:V85I	ENSP00000269346:V106I	V	+	1	0	0	TTYH2	69738635	69738635	0.567000	0.26626	0.943000	0.38184	0.688000	0.40055	1.396000	0.34531	0.658000	0.30925	-0.119000	0.15052	GTT	0.634785		TCGA-3A-A9J0-01A-11D-A40W-08	0.483	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1	0	0	1		2	2	2	0		0	0	66		66	66	1	3.280000	-3.218233	1	0.470000				49	48		302	299	1		1	0		0	0	66	0		1.000000	3.163420e-01	0	0	0	8	0	49	302
LIPG	9388	broad.mit.edu	37	18	47110141	47110141	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr18:47110141G>A	ENST00000261292.4	+	8	1651	c.1373G>A	c.(1372-1374)cGg>cAg	p.R458Q	LIPG_ENST00000427224.2_Missense_Mutation_p.R384Q	NM_006033.2	NP_006024.1	Q9Y5X9	LIPE_HUMAN	lipase, endothelial	458	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				cell proliferation (GO:0008283)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle remodeling (GO:0034375)|lipid metabolic process (GO:0006629)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|regulation of lipoprotein metabolic process (GO:0050746)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)	extracellular space (GO:0005615)	heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phospholipase activity (GO:0004620)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(2)	18						GAAACCCAGCGGAAGTAAGTG	0.562																																					Pancreas(126;280 1778 12814 26243 34948)	ENST00000261292.4	0.530000	7.000000e-02			0.240000	0.264678	0.240000	0.210000																										0				18						c.(1372-1374)cGg>cAg		lipase, endothelial							26.0	24.0	25.0					18																	47110141		2203	4300	6503	SO:0001583	missense	9388	3	121394	27				g.chr18:47110141G>A	AF118767	CCDS11938.1	18q21.1	2006-04-22				ENSG00000101670			6623	protein-coding gene	gene with protein product		603684				10318835, 10192396	Standard	XM_005258390		Approved	EDL	uc002ldv.3	Q9Y5X9		ENST00000261292.4:c.1373G>A	chr18.hg19:g.47110141G>A	ENSP00000261292:p.Arg458Gln	1					LIPG_ENST00000427224.2_Missense_Mutation_p.R384Q	p.R458Q	NM_006033.2	NP_006024.1	0	1	1	1.264376	Q9Y5X9	LIPE_HUMAN		8	1651	+			B0LPG6|Q6P9C8|Q6UW82	Missense_Mutation	SNP	ENST00000261292.4	0	1	hg19	c.1373G>A	CCDS11938.1	0	.	.	.	.	.	.	.	.	.	.	G	13.21	2.168290	0.38315	.	.	ENSG00000101670	ENST00000261292;ENST00000427224	T;T	0.64438	-0.1;-0.1	5.6	-1.19	0.09585	5.6	-1.19	0.09585	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);	0.314978	0.38381	N	0.001720	T	0.21509	0.0518	N	0.00885	-1.115	0.80722	D	1	B;B	0.20550	0.001;0.046	B;B	0.12837	0.001;0.008	T	0.11131	-1.0600	10	0.09084	T	0.74	-10.3611	7.2214	0.25990	0.6792:0.0:0.1813:0.1396	.	384;458	B4DTR8;Q9Y5X9	.;LIPE_HUMAN	Q	458;384	ENSP00000261292:R458Q;ENSP00000387978:R384Q	ENSP00000261292:R458Q	R	+	2	0	0	LIPG	45364139	45364139	0.664000	0.27457	0.301000	0.25044	0.917000	0.54804	0.558000	0.23469	-0.126000	0.11682	0.561000	0.74099	CGG	0.321774		TCGA-3A-A9J0-01A-11D-A40W-08	0.562	LIPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447546.1	0	0	1		2	2	2	0		0	0	16		16	16	1	3.280000	-7.404661	1	0.470000	NM_006033			3	3		43	41	0		1	0		0	0	16	0		0.798256	3.757470e-01	0	0	0	16	0	3	43
TCF4	6925	broad.mit.edu	37	18	52899837	52899837	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr18:52899837C>T	ENST00000356073.4	-	17	2163	c.1552G>A	c.(1552-1554)Gag>Aag	p.E518K	TCF4_ENST00000398339.1_Missense_Mutation_p.E620K|TCF4_ENST00000565018.2_Missense_Mutation_p.E518K|TCF4_ENST00000568740.1_Missense_Mutation_p.E493K|TCF4_ENST00000544241.2_Missense_Mutation_p.E447K|TCF4_ENST00000570177.2_Missense_Mutation_p.E388K|TCF4_ENST00000567880.1_Missense_Mutation_p.E458K|TCF4_ENST00000566279.1_Missense_Mutation_p.E458K|TCF4_ENST00000537578.1_Missense_Mutation_p.E494K|TCF4_ENST00000570287.2_Missense_Mutation_p.E358K|TCF4_ENST00000543082.1_Missense_Mutation_p.E476K|TCF4_ENST00000566286.1_Missense_Mutation_p.E515K|TCF4_ENST00000537856.3_Missense_Mutation_p.E388K|TCF4_ENST00000561992.1_Missense_Mutation_p.E388K|TCF4_ENST00000457482.3_Missense_Mutation_p.E358K|TCF4_ENST00000561831.3_Missense_Mutation_p.E358K|TCF4_ENST00000354452.3_Missense_Mutation_p.E518K|TCF4_ENST00000564999.1_Missense_Mutation_p.E518K|TCF4_ENST00000564403.2_Missense_Mutation_p.E524K|TCF4_ENST00000540999.1_Missense_Mutation_p.E494K|TCF4_ENST00000568673.1_Missense_Mutation_p.E494K|TCF4_ENST00000564228.1_Missense_Mutation_p.E447K	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	518					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TCATCACCCTCGTCATCGGAT	0.468																																						ENST00000356073.4	1.000000	7.100000e-01			0.910000	0.909871	0.910000	1.000000																										0				41						c.(1552-1554)Gag>Aag		transcription factor 4							129.0	110.0	117.0					18																	52899837		2203	4300	6503	SO:0001583	missense	6925	0	0					g.chr18:52899837C>T	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1552G>A	chr18.hg19:g.52899837C>T	ENSP00000348374:p.Glu518Lys	1					TCF4_ENST00000398339.1_Missense_Mutation_p.E620K|TCF4_ENST00000564999.1_Missense_Mutation_p.E518K|TCF4_ENST00000564403.2_Missense_Mutation_p.E524K|TCF4_ENST00000567880.1_Missense_Mutation_p.E458K|TCF4_ENST00000568740.1_Missense_Mutation_p.E493K|TCF4_ENST00000561831.3_Missense_Mutation_p.E358K|TCF4_ENST00000566286.1_Missense_Mutation_p.E515K|TCF4_ENST00000561992.1_Missense_Mutation_p.E388K|TCF4_ENST00000537578.1_Missense_Mutation_p.E494K|TCF4_ENST00000570287.2_Missense_Mutation_p.E358K|TCF4_ENST00000565018.2_Missense_Mutation_p.E518K|TCF4_ENST00000540999.1_Missense_Mutation_p.E494K|TCF4_ENST00000570177.2_Missense_Mutation_p.E388K|TCF4_ENST00000457482.3_Missense_Mutation_p.E358K|TCF4_ENST00000543082.1_Missense_Mutation_p.E476K|TCF4_ENST00000537856.3_Missense_Mutation_p.E388K|TCF4_ENST00000568673.1_Missense_Mutation_p.E494K|TCF4_ENST00000544241.2_Missense_Mutation_p.E447K|TCF4_ENST00000564228.1_Missense_Mutation_p.E447K|TCF4_ENST00000566279.1_Missense_Mutation_p.E458K|TCF4_ENST00000354452.3_Missense_Mutation_p.E518K	p.E518K	NM_003199.2	NP_003190.1	0	1	1	1.249961	P15884	ITF2_HUMAN		17	2163	-			B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	1	1	hg19	c.1552G>A	CCDS11960.1	1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745039	0.49151	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.18810	2.51;2.22;2.47;2.46;2.48;2.51;2.48;2.19;2.49	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.35856	0.0946	L	0.49640	1.575	0.80722	D	1	B;B;B;P;D;B;B;D;B	0.65815	0.038;0.172;0.065;0.919;0.992;0.038;0.038;0.995;0.371	B;B;B;B;P;B;B;D;B	0.68192	0.007;0.017;0.025;0.394;0.905;0.007;0.007;0.956;0.095	T	0.06826	-1.0805	10	0.02654	T	1	-15.4116	17.8399	0.88712	0.0:1.0:0.0:0.0	.	494;518;358;620;518;476;447;358;515	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	K	518;358;518;476;494;494;447;388;620	ENSP00000346440:E518K;ENSP00000409447:E358K;ENSP00000348374:E518K;ENSP00000439656:E476K;ENSP00000445202:E494K;ENSP00000440731:E494K;ENSP00000441562:E447K;ENSP00000439827:E388K;ENSP00000381382:E620K	ENSP00000346440:E518K	E	-	1	0	0	TCF4	51050835	51050835	0.998000	0.40836	0.998000	0.56505	0.952000	0.60782	3.845000	0.55880	2.510000	0.84645	0.467000	0.42956	GAG	0.325828		TCGA-3A-A9J0-01A-11D-A40W-08	0.468	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	1	0	1		2	2	2	0		0	0	64		64	62	1	3.280000	-5.456219	1	0.470000	NM_003199			49	49		125	125	1		1	0		0	0	64	0		1.000000	9.968765e-01	0	1	0	25	0	49	125
KIAA1468	57614	broad.mit.edu	37	18	59912054	59912054	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr18:59912054G>A	ENST00000398130.2	+	11	1910	c.1678G>A	c.(1678-1680)Gat>Aat	p.D560N	RP11-173A16.2_ENST00000588561.1_RNA|KIAA1468_ENST00000256858.6_Missense_Mutation_p.D560N	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	560										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				TAAAGAGCGAGATCAGCTTCT	0.378																																						ENST00000398130.2	1.000000	8.100000e-01			0.940000	0.941718	0.940000	0.990000																										0				47						c.(1678-1680)Gat>Aat		KIAA1468							112.0	106.0	108.0					18																	59912054		2203	4300	6503	SO:0001583	missense	57614	0	0					g.chr18:59912054G>A	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1678G>A	chr18.hg19:g.59912054G>A	ENSP00000381198:p.Asp560Asn	1					RP11-173A16.2_ENST00000588561.1_RNA|KIAA1468_ENST00000256858.6_Missense_Mutation_p.D560N	p.D560N	NM_020854.3	NP_065905.2	0	1	1	1.255422	Q9P260	K1468_HUMAN		11	1910	+		Colorectal(73;0.186)		Missense_Mutation	SNP	ENST00000398130.2	1	1	hg19	c.1678G>A	CCDS11979.2	1	.	.	.	.	.	.	.	.	.	.	G	34	5.334181	0.95758	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.39787	1.06;1.06	5.61	5.61	0.85477	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63236	0.2494	L	0.60845	1.875	0.80722	D	1	D;D;D	0.89917	0.994;0.98;1.0	P;P;D	0.83275	0.895;0.753;0.996	T	0.57969	-0.7719	9	.	.	.	-19.5571	20.0051	0.97433	0.0:0.0:1.0:0.0	.	560;560;204	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	N	560	ENSP00000381198:D560N;ENSP00000256858:D560N	.	D	+	1	0	0	KIAA1468	58063034	58063034	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.715000	0.98748	2.799000	0.96334	0.650000	0.86243	GAT	0.307190		TCGA-3A-A9J0-01A-11D-A40W-08	0.378	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	1	0	1		2	2	2	0		0	0	28		28	27	1	3.280000	-20.000000	1	0.470000	NM_020854			60	58		118	116	1		1	1		0	0	28	0		1.000000	9.709536e-01	0	9	0	5	0	60	118
PHLPP1	23239	broad.mit.edu	37	18	60563163	60563163	+	Missense_Mutation	SNP	T	T	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr18:60563163T>G	ENST00000262719.5	+	6	2597	c.2363T>G	c.(2362-2364)cTt>cGt	p.L788R	PHLPP1_ENST00000400316.4_Missense_Mutation_p.L276R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	788					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						GTGGATAAACTTTGTATGTCT	0.383																																						ENST00000262719.5	1.000000	7.000000e-01			0.890000	0.886424	0.890000	0.940000																										0				17						c.(2362-2364)cTt>cGt		PH domain and leucine rich repeat protein phosphatase 1							118.0	112.0	114.0					18																	60563163		1852	4099	5951	SO:0001583	missense	23239	0	0					g.chr18:60563163T>G	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2363T>G	chr18.hg19:g.60563163T>G	ENSP00000262719:p.Leu788Arg	1					PHLPP1_ENST00000400316.4_Missense_Mutation_p.L276R	p.L788R			0	1	1	1.255422	O60346	PHLP1_HUMAN		6	2597	+			A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	1	1	hg19	c.2363T>G	CCDS45881.2	1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.709037	0.89018	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.59638	0.25;0.25	5.07	5.07	0.68467	5.07	5.07	0.68467	.	.	.	.	.	T	0.81250	0.4783	M	0.92317	3.295	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.86211	0.1625	9	0.87932	D	0	-10.6448	15.016	0.71584	0.0:0.0:0.0:1.0	.	788	O60346	PHLP1_HUMAN	R	276;788	ENSP00000383170:L276R;ENSP00000262719:L788R	ENSP00000262719:L788R	L	+	2	0	0	PHLPP1	58714143	58714143	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.489000	0.81451	2.146000	0.66826	0.533000	0.62120	CTT	0.307190		TCGA-3A-A9J0-01A-11D-A40W-08	0.383	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	1	0	1		2	2	2	0		0	0	49		49	49	1	3.280000	-20.000000	1	0.470000	NM_194449			45	45		109	108	1		1	1		0	0	49	0		1.000000	6.544192e-01	0	4	0	3	0	45	109
ZNF181	339318	broad.mit.edu	37	19	35232318	35232318	+	Silent	SNP	T	T	G	rs2607243		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:35232318T>G	ENST00000492450.1	+	4	1121	c.1032T>G	c.(1030-1032)acT>acG	p.T344T	ZNF181_ENST00000459757.2_Silent_p.T343T|ZNF181_ENST00000392232.3_Silent_p.T388T			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GAATTCATACTCAAGAAAAAC	0.388																																						ENST00000492450.1	0.210000	3.000000e-02			0.100000	0.116518	0.100000	0.100000																										0				22						c.(1030-1032)acT>acG		zinc finger protein 181							69.0	69.0	69.0					19																	35232318		2203	4300	6503	SO:0001819	synonymous_variant	339318	0	0					g.chr19:35232318T>G	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1032T>G	chr19.hg19:g.35232318T>G		1					ZNF181_ENST00000392232.3_Silent_p.T388T|ZNF181_ENST00000459757.2_Silent_p.T343T	p.T344T			0	3	3	1.942808	Q2M3W8	ZN181_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.138)	4	1121	+	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		B7ZKX3|Q49A75	Silent	SNP	ENST00000492450.1	0	1	hg19	c.1032T>G	CCDS32990.2	0																																																																																								0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.388	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	0	0	1		2	2	2	0		0	0	46		46	46	1	3.280000	-2.537562	1	0.470000	NM_001029997			6	6		307	306	0		1	0		0	0	46	0		0.965022	1.074758e-02	0	0	0	7	0	6	307
KLK15	55554	broad.mit.edu	37	19	51330356	51330356	+	Missense_Mutation	SNP	G	G	A	rs61751959	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:51330356G>A	ENST00000598239.1	-	3	289	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	KLK15_ENST00000326856.4_Missense_Mutation_p.R86W|KLK15_ENST00000301421.2_Missense_Mutation_p.R87W|KLK15_ENST00000596931.1_Missense_Mutation_p.R86W|KLK15_ENST00000416184.1_Missense_Mutation_p.R87W	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	87	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		GACGTGGTCCGTAGTTGCTCT	0.652																																					Pancreas(140;10 2513 7143 9246)	ENST00000598239.1	1.000000	8.100000e-01			0.990000	0.970630	0.990000	1.000000																										0				24						c.(259-261)Cgg>Tgg		kallikrein-related peptidase 15		G	TRP/ARG,TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	82.0	70.0	74.0		259,259,259	-0.5	0.0	19	dbSNP_129	74	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense,missense	KLK15	NM_017509.2,NM_138563.1,NM_138564.1	101,101,101	0,8,6495	AA,AG,GG		0.0698,0.0454,0.0615	probably-damaging,probably-damaging,probably-damaging	87/257,87/162,87/172	51330356	8,12998	2203	4300	6503	SO:0001583	missense	55554	122	121346	54				g.chr19:51330356G>A	AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.259C>T	chr19.hg19:g.51330356G>A	ENSP00000469315:p.Arg87Trp	1					KLK15_ENST00000596931.1_Missense_Mutation_p.R86W|KLK15_ENST00000416184.1_Missense_Mutation_p.R87W|KLK15_ENST00000326856.4_Missense_Mutation_p.R86W|KLK15_ENST00000301421.2_Missense_Mutation_p.R87W	p.R87W	NM_017509.2	NP_059979.2	0	4	4	2.013086	Q9H2R5	KLK15_HUMAN		3	289	-		all_neural(266;0.057)	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	ENST00000598239.1	1	1	hg19	c.259C>T	CCDS12805.1	1	.	.	.	.	.	.	.	.	.	.	g	18.66	3.671049	0.67814	4.54E-4	6.98E-4	ENSG00000174562	ENST00000326856;ENST00000416184;ENST00000301421;ENST00000544946	D;D	0.93712	-3.27;-3.27	4.51	-0.491	0.12045	4.51	-0.491	0.12045	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.354502	0.20216	N	0.096801	D	0.96519	0.8864	M	0.90814	3.15	0.09310	N	0.999999	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	P;D;D;D	0.70016	0.892;0.93;0.94;0.967	D	0.92113	0.5697	10	0.87932	D	0	.	13.1286	0.59369	0.0:0.0:0.296:0.704	rs61751959	87;86;87;87	Q6UBM2;Q6ISI0;Q9H2R5-4;Q9H2R5	.;.;.;KLK15_HUMAN	W	87	ENSP00000415136:R87W;ENSP00000301421:R87W	ENSP00000301421:R87W	R	-	1	2	2	KLK15	56022168	56022168	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	0.668000	0.25127	-0.033000	0.13736	-0.268000	0.10319	CGG	0.609490		TCGA-3A-A9J0-01A-11D-A40W-08	0.652	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465160.1	1	0	1		2	2	2	0		0	0	155		155	151	1	3.280000	-3.901235	1	0.470000	NM_017509			79	79		375	369	1		1			0	0	155	0		1.000000	0	0	0	0	0	0	79	375
LILRA1	11024	broad.mit.edu	37	19	55106342	55106342	+	Missense_Mutation	SNP	C	C	T	rs372024491	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:55106342C>T	ENST00000251372.3	+	4	465	c.283C>T	c.(283-285)Cgg>Tgg	p.R95W	LILRA1_ENST00000453777.1_Missense_Mutation_p.R95W|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	95	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		ACACACAGGGCGGTATCGCTG	0.572													c|||	2	0.000399361	0.0	0.0	5008	,	,		19200	0.0		0.0	False		,,,				2504	0.002					ENST00000251372.3	1.000000	9.900000e-01			0.990000	0.999800	0.990000	1.000000																										0				47						c.(283-285)Cgg>Tgg		leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1		C	TRP/ARG	0,4406		0,0,2203	121.0	115.0	117.0		283	-1.3	0.0	19		117	1,8599	1.2+/-3.3	0,1,4299	no	missense	LILRA1	NM_006863.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	95/490	55106342	1,13005	2203	4300	6503	SO:0001583	missense	11024	14	121412	45				g.chr19:55106342C>T	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.283C>T	chr19.hg19:g.55106342C>T	ENSP00000251372:p.Arg95Trp	1					LILRA1_ENST00000453777.1_Missense_Mutation_p.R95W|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR	p.R95W	NM_006863.2	NP_006854.1	0	4	4	2.048062	O75019	LIRA1_HUMAN		4	465	+			O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	1	1	hg19	c.283C>T	CCDS12901.1	1	.	.	.	.	.	.	.	.	.	.	C	8.318	0.823541	0.16678	0.0	1.16E-4	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.13778	2.56;2.56	1.58	-1.3	0.09259	1.58	-1.3	0.09259	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.639860	0.04121	N	0.316290	T	0.19604	0.0471	M	0.86740	2.835	0.09310	N	1	B;P	0.38440	0.097;0.631	B;B	0.32805	0.03;0.153	T	0.37842	-0.9688	10	0.72032	D	0.01	.	5.5529	0.17101	0.6042:0.3958:0.0:0.0	.	95;95	O75019-2;O75019	.;LIRA1_HUMAN	W	95	ENSP00000251372:R95W;ENSP00000413715:R95W	ENSP00000251372:R95W	R	+	1	2	2	LILRA1	59798154	59798154	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.728000	0.04925	-0.245000	0.09625	0.194000	0.17425	CGG	0.613505		TCGA-3A-A9J0-01A-11D-A40W-08	0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	1	0	1		2	2	2	0		0	0	105		105	104	1	3.280000	-20.000000	1	0.470000	NM_006863			88	87		314	307	0		1	0		0	0	105	0		1.000000	0	0	0	0	1	0	88	314
NLRP7	199713	broad.mit.edu	37	19	55450945	55450945	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:55450945C>T	ENST00000590030.1	-	3	1282	c.1242G>A	c.(1240-1242)acG>acA	p.T414T	NLRP7_ENST00000588756.1_Silent_p.T414T|NLRP7_ENST00000328092.5_Silent_p.T414T|NLRP7_ENST00000448121.2_Silent_p.T414T|NLRP7_ENST00000340844.2_Silent_p.T414T|NLRP7_ENST00000446217.1_Silent_p.T442T|NLRP7_ENST00000592784.1_Silent_p.T414T			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	414	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GGAGGCTCAGCGTCCGCAGCG	0.711																																						ENST00000590030.1	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				73						c.(1240-1242)acG>acA		NLR family, pyrin domain containing 7							16.0	14.0	15.0					19																	55450945		2167	4243	6410	SO:0001819	synonymous_variant	199713	7	119984	34				g.chr19:55450945C>T	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1242G>A	chr19.hg19:g.55450945C>T		1					NLRP7_ENST00000446217.1_Silent_p.T442T|NLRP7_ENST00000588756.1_Silent_p.T414T|NLRP7_ENST00000592784.1_Silent_p.T414T|NLRP7_ENST00000340844.2_Silent_p.T414T|NLRP7_ENST00000328092.5_Silent_p.T414T|NLRP7_ENST00000448121.2_Silent_p.T414T	p.T414T			0	4	4	2.046693	Q8WX94	NALP7_HUMAN		3	1282	-			E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	1	1	hg19	c.1242G>A	CCDS33109.1	1																																																																																								0.612176		TCGA-3A-A9J0-01A-11D-A40W-08	0.711	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	1	0	1		2	2	2	0		0	0	38		38	52	1	3.280000	-20.000000	1	0.470000	NM_139176			39	36		77	67	0		1			0	0	38	0		1.000000	0	0	0	0	0	0	39	77
FBN3	84467	broad.mit.edu	37	19	8180474	8180474	+	Missense_Mutation	SNP	C	C	T	rs146523311		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:8180474C>T	ENST00000600128.1	-	30	4177	c.3763G>A	c.(3763-3765)Gag>Aag	p.E1255K	FBN3_ENST00000270509.2_Missense_Mutation_p.E1255K|FBN3_ENST00000601739.1_Missense_Mutation_p.E1255K			Q75N90	FBN3_HUMAN	fibrillin 3	1255	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TTCGTGTTCTCGCAGTCCCCA	0.607																																						ENST00000600128.1	1.000000	8.200000e-01			0.990000	0.983334	0.990000	1.000000																										0				132						c.(3763-3765)Gag>Aag		fibrillin 3		C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	88.0	69.0	76.0		3763	1.8	0.7	19	dbSNP_134	76	0,8600		0,0,4300	no	missense	FBN3	NM_032447.3	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	1255/2810	8180474	1,13005	2203	4300	6503	SO:0001583	missense	84467	48	121412	45				g.chr19:8180474C>T		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3763G>A	chr19.hg19:g.8180474C>T	ENSP00000470498:p.Glu1255Lys	1					FBN3_ENST00000601739.1_Missense_Mutation_p.E1255K|FBN3_ENST00000270509.2_Missense_Mutation_p.E1255K	p.E1255K			0	3	3	1.668820	Q75N90	FBN3_HUMAN		30	4177	-			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	1	1	hg19	c.3763G>A	CCDS12196.1	1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300009	0.23650	2.27E-4	0.0	ENSG00000142449	ENST00000270509	D	0.87334	-2.24	3.94	1.81	0.25067	3.94	1.81	0.25067	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.056825	0.64402	U	0.000002	T	0.76807	0.4039	L	0.37750	1.13	0.53688	D	0.999971	P	0.35050	0.482	B	0.29440	0.102	T	0.68131	-0.5490	10	0.28530	T	0.3	.	9.5212	0.39135	0.0:0.8225:0.0:0.1775	.	1255	Q75N90	FBN3_HUMAN	K	1255	ENSP00000270509:E1255K	ENSP00000270509:E1255K	E	-	1	0	0	FBN3	8086474	8086474	0.991000	0.36638	0.727000	0.30756	0.091000	0.18340	2.896000	0.48656	0.349000	0.23975	-0.254000	0.11334	GAG	0.545786		TCGA-3A-A9J0-01A-11D-A40W-08	0.607	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	1	0	1		2	2	2	0		0	0	45		45	44	1	3.280000	-3.705161	1	0.470000	NM_032447			32	32		110	107	1		1			0	0	45	0		1.000000	0	0	0	0	0	0	32	110
OR7G1	125962	broad.mit.edu	37	19	9225729	9225729	+	Silent	SNP	C	C	T	rs138779373	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:9225729C>T	ENST00000541538.1	-	1	710	c.711G>A	c.(709-711)gcG>gcA	p.A237A	OR7G1_ENST00000293614.1_Silent_p.A237A	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						AGGTGGAAAACGCTTTATACT	0.418																																						ENST00000541538.1	1.000000	9.900000e-01			0.990000	0.999135	0.990000	1.000000																										0				20						c.(709-711)gcG>gcA		olfactory receptor, family 7, subfamily G, member 1							94.0	95.0	95.0					19																	9225729		2203	4300	6503	SO:0001819	synonymous_variant	125962	24	121412	46				g.chr19:9225729C>T		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.711G>A	chr19.hg19:g.9225729C>T		1					OR7G1_ENST00000293614.1_Silent_p.A237A	p.A237A	NM_001005192.2	NP_001005192.2	0	3	3	1.668820	Q8NGA0	OR7G1_HUMAN		1	710	-			Q6IFJ5|Q96RA1	Silent	SNP	ENST00000541538.1	1	1	hg19	c.711G>A	CCDS32898.2	1																																																																																								0.545786		TCGA-3A-A9J0-01A-11D-A40W-08	0.418	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1	1	0	1		2	2	2	0		0	0	60		60	58	1	3.280000	-20.000000	1	0.470000				60	59		176	174	1		1			0	0	60	0		1.000000	0	0	0	0	0	0	60	176
ZNF562	54811	broad.mit.edu	37	19	9764114	9764114	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:9764114G>T	ENST00000448622.1	-	6	954	c.792C>A	c.(790-792)aaC>aaA	p.N264K	ZNF562_ENST00000293648.4_Missense_Mutation_p.N192K|ZNF562_ENST00000541032.1_Missense_Mutation_p.N227K|ZNF562_ENST00000453372.2_Missense_Mutation_p.N264K|ZNF562_ENST00000590155.1_Missense_Mutation_p.N263K|ZNF562_ENST00000453792.2_Missense_Mutation_p.N195K|ZNF562_ENST00000537617.1_Missense_Mutation_p.N148K	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						ATTTCCCACAGTTCTTAGTCT	0.378																																						ENST00000448622.1	1.000000	1.800000e-01			0.310000	0.437706	0.310000	0.280000																										0				17						c.(790-792)aaC>aaA		zinc finger protein 562							84.0	82.0	83.0					19																	9764114		2203	4300	6503	SO:0001583	missense	54811	9	121410	41				g.chr19:9764114G>T	AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.792C>A	chr19.hg19:g.9764114G>T	ENSP00000411784:p.Asn264Lys	1					ZNF562_ENST00000453792.2_Missense_Mutation_p.N195K|ZNF562_ENST00000537617.1_Missense_Mutation_p.N148K|ZNF562_ENST00000590155.1_Missense_Mutation_p.N263K|ZNF562_ENST00000453372.2_Missense_Mutation_p.N264K|ZNF562_ENST00000293648.4_Missense_Mutation_p.N192K|ZNF562_ENST00000541032.1_Missense_Mutation_p.N227K	p.N264K	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	0	3	3	1.668820	Q6V9R5	ZN562_HUMAN		6	954	-			Q32MN2|Q9NXS5	Missense_Mutation	SNP	ENST00000448622.1	0	1	hg19	c.792C>A	CCDS45956.1	0	.	.	.	.	.	.	.	.	.	.	G	0.658	-0.806919	0.02819	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000293648;ENST00000541032;ENST00000453792;ENST00000537617	T;T;T;T;T;T	0.06768	3.28;3.28;3.35;3.26;3.36;3.38	1.67	-3.33	0.04958	1.67	-3.33	0.04958	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02571	0.0078	N	0.02412	-0.56	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0	T	0.39643	-0.9604	9	0.54805	T	0.06	.	1.739	0.02948	0.1587:0.1235:0.163:0.5548	.	148;263;227;264;192	F5H1B4;B4DMG0;B4DZP9;Q6V9R5;Q6V9R5-2	.;.;.;ZN562_HUMAN;.	K	264;264;192;227;195;148	ENSP00000410734:N264K;ENSP00000411784:N264K;ENSP00000293648:N192K;ENSP00000442614:N227K;ENSP00000440451:N195K;ENSP00000445816:N148K	ENSP00000293648:N192K	N	-	3	2	2	ZNF562	9625114	9625114	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.367000	0.00069	-1.457000	0.01919	-3.756000	0.00021	AAC	0.545786		TCGA-3A-A9J0-01A-11D-A40W-08	0.378	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450239.1	1	0	0		2	2	2	0		0	0	82		82	80	1	3.280000	-5.810944	1	0.470000	NM_017656			20	20		326	323	0		1	0		0	0	82	0		0.999995	4.780103e-02	0	0	0	6	0	20	326
SYT5	6861	broad.mit.edu	37	19	55690401	55690401	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr19:55690401C>T	ENST00000354308.3	-	2	378	c.9G>A	c.(7-9)ccG>ccA	p.P3P	SYT5_ENST00000590851.1_Missense_Mutation_p.R58Q|SYT5_ENST00000537500.1_Silent_p.P3P|CTD-2587H24.5_ENST00000591665.1_RNA	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	3					calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		TTGGGGGCTCCGGGAACATGG	0.677																																						ENST00000354308.3	1.000000	2.300000e-01			0.620000	0.654928	0.620000	1.000000																										0				18						c.(7-9)ccG>ccA		synaptotagmin V							19.0	27.0	24.0					19																	55690401		2201	4297	6498	SO:0001819	synonymous_variant	6861	0	0					g.chr19:55690401C>T	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.9G>A	chr19.hg19:g.55690401C>T		1					SYT5_ENST00000537500.1_Silent_p.P3P|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000590851.1_Missense_Mutation_p.R58Q	p.P3P	NM_003180.2	NP_003171.2	0	4	4	2.046693	O00445	SYT5_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	2	378	-			B3KWJ8|B7Z300|Q86X72	Silent	SNP	ENST00000354308.3	0	1	hg19	c.9G>A	CCDS12919.1	0	.	.	.	.	.	.	.	.	.	.	C	8.945	0.966705	0.18659	.	.	ENSG00000129990	ENST00000543844	.	.	.	3.54	1.3	0.21679	3.54	1.3	0.21679	.	.	.	.	.	T	0.23649	0.0572	.	.	.	0.80722	D	1	B	0.34372	0.451	B	0.18871	0.023	T	0.05178	-1.0901	7	0.27785	T	0.31	.	3.9386	0.09316	0.2358:0.6379:0.0:0.1263	.	58	B7Z300	.	Q	58	.	ENSP00000441336:R58Q	R	-	2	0	0	SYT5	60382213	60382213	0.974000	0.33945	1.000000	0.80357	0.304000	0.27724	-0.295000	0.08298	0.450000	0.26774	0.558000	0.71614	CGG	0.612176		TCGA-3A-A9J0-01A-11D-A40W-08	0.677	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	0	0	1		2	2	2	0		0	0	12		12	11	1	3.280000	-3.233199	1	0.470000	NM_003180			5	5		51	49	0		1			0	0	12	0		0.934520	0	0	0	0	0	0	5	51
PLOD1	5351	broad.mit.edu	37	1	12030859	12030859	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:12030859G>A	ENST00000196061.4	+	17	1915	c.1888G>A	c.(1888-1890)Ggc>Agc	p.G630S	PLOD1_ENST00000376369.3_Missense_Mutation_p.G677S	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	630					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GCTCTACCCCGGCTACTACAC	0.607																																						ENST00000196061.4	1.000000	5.000000e-02			0.180000	0.343673	0.180000	0.140000																										0				29						c.(1888-1890)Ggc>Agc		procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	Succinic acid(DB00139)|Vitamin C(DB00126)						55.0	49.0	51.0					1																	12030859		2202	4300	6502	SO:0001583	missense	5351	3	121386	33				g.chr1:12030859G>A	BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1888G>A	chr1.hg19:g.12030859G>A	ENSP00000196061:p.Gly630Ser	1					PLOD1_ENST00000376369.3_Missense_Mutation_p.G677S	p.G630S	NM_000302.3	NP_000293.2	1	3	4	2.035345	Q02809	PLOD1_HUMAN		17	1915	+	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	0	1	hg19	c.1888G>A	CCDS142.1	0	.	.	.	.	.	.	.	.	.	.	G	27.8	4.864455	0.91511	.	.	ENSG00000083444	ENST00000414311;ENST00000376369;ENST00000196061	T;T	0.65916	-0.18;-0.17	5.94	5.94	0.96194	5.94	5.94	0.96194	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.70325	0.3211	M	0.89715	3.055	0.80722	D	1	B;B	0.31435	0.323;0.323	B;B	0.23275	0.03;0.045	T	0.73864	-0.3848	10	0.87932	D	0	.	19.3514	0.94389	0.0:0.0:1.0:0.0	.	677;630	B4DR87;Q02809	.;PLOD1_HUMAN	S	294;677;630	ENSP00000365548:G677S;ENSP00000196061:G630S	ENSP00000196061:G630S	G	+	1	0	0	PLOD1	11953446	11953446	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	9.869000	0.99810	2.826000	0.97356	0.561000	0.74099	GGC	0.598363		TCGA-3A-A9J0-01A-11D-A40W-08	0.607	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	0	0	1		2	2	2	0		0	0	35		35	35	1	3.280000	-6.080160	1	0.470000	NM_000302			4	4		159	156	0		1	0		0	0	35	0		0.886949	9.881234e-01	0	0	0	369	0	4	159
HNRNPCL1	343069	broad.mit.edu	37	1	12908073	12908073	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:12908073T>C	ENST00000317869.6	-	2	295	c.70A>G	c.(70-72)Aac>Gac	p.N24D		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	24	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						ACAAGAGTGTTGAGATTCCCA	0.453																																						ENST00000317869.6	1.000000	2.500000e-01			0.340000	0.475043	0.340000	0.330000																										0				29						c.(70-72)Aac>Gac		heterogeneous nuclear ribonucleoprotein C-like 1							191.0	177.0	182.0					1																	12908073		2203	4300	6503	SO:0001583	missense	343069	0	0					g.chr1:12908073T>C	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.70A>G	chr1.hg19:g.12908073T>C	ENSP00000365370:p.Asn24Asp	1						p.N24D	NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	1	3	4	2.035345	O60812	HNRC1_HUMAN		2	295	-			B2RP44	Missense_Mutation	SNP	ENST00000317869.6	1	1	hg19	c.70A>G	CCDS30591.1	0	.	.	.	.	.	.	.	.	.	.	T	18.56	3.650509	0.67472	.	.	ENSG00000179172	ENST00000317869	T	0.40225	1.04	1.09	-0.423	0.12325	1.09	-0.423	0.12325	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.179946	0.45361	U	0.000369	T	0.24005	0.0581	N	0.17474	0.49	0.42596	D	0.993268	B	0.31931	0.347	B	0.37989	0.262	T	0.03068	-1.1076	10	0.39692	T	0.17	.	4.9313	0.13919	0.0:0.0:0.3116:0.6884	.	24	O60812	HNRCL_HUMAN	D	24	ENSP00000365370:N24D	ENSP00000365370:N24D	N	-	1	0	0	HNRNPCL1	12830660	12830660	1.000000	0.71417	0.489000	0.27452	0.699000	0.40488	5.399000	0.66314	-0.107000	0.12088	0.341000	0.21757	AAC	0.598363		TCGA-3A-A9J0-01A-11D-A40W-08	0.453	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	0	0	1		2	2	2	0		0	0	202		202	199	1	3.280000	-9.527195	1	0.470000	NM_001013631			59	59		942	930	0		1			0	0	202	0		1.000000	0	0	0	0	0	0	59	942
S100A3	6274	broad.mit.edu	37	1	153520200	153520200	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:153520200C>A	ENST00000368713.3	-	3	460	c.264G>T	c.(262-264)gaG>gaT	p.E88D	S100A4_ENST00000354332.4_5'Flank|S100A3_ENST00000368712.1_Missense_Mutation_p.E88D|S100A4_ENST00000368716.4_5'Flank|S100A4_ENST00000368715.1_5'Flank|S100A4_ENST00000368714.1_Intron|S100A4_ENST00000481009.1_5'Flank	NM_002960.1	NP_002951.1	P33764	S10A3_HUMAN	S100 calcium binding protein A3	88						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|liver(1)|lung(1)	3	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCTTGAAGTACTCGTGGCAGT	0.597																																						ENST00000368713.3	1.000000	7.800000e-01			0.990000	0.957669	0.990000	1.000000																										0				3						c.(262-264)gaG>gaT		S100 calcium binding protein A3							149.0	133.0	138.0					1																	153520200		2203	4300	6503	SO:0001583	missense	6274	0	0					g.chr1:153520200C>A	BC012893	CCDS1043.1	1q21	2008-02-05	2001-11-28		ENSG00000188015	ENSG00000188015		"""S100 calcium binding proteins"""	10493	protein-coding gene	gene with protein product		176992	"""S100 calcium-binding protein A3"""	S100E		8341667	Standard	NM_002960		Approved		uc001fca.1	P33764	OTTHUMG00000013550	ENST00000368713.3:c.264G>T	chr1.hg19:g.153520200C>A	ENSP00000357702:p.Glu88Asp	1					S100A3_ENST00000368712.1_Missense_Mutation_p.E88D|S100A4_ENST00000481009.1_5'Flank|S100A4_ENST00000368715.1_5'Flank|S100A4_ENST00000368714.1_Intron|S100A4_ENST00000368716.4_5'Flank|S100A4_ENST00000354332.4_5'Flank	p.E88D	NM_002960.1	NP_002951.1	3	3	6	2.322612	P33764	S10A3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	3	460	-	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		D3DV51|Q6FGE4	Missense_Mutation	SNP	ENST00000368713.3	1	1	hg19	c.264G>T	CCDS1043.1	1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.485114	0.26598	.	.	ENSG00000188015	ENST00000368713;ENST00000368712	T;T	0.15139	2.45;2.45	5.02	-0.489	0.12052	5.02	-0.489	0.12052	EF-hand-like domain (1);	0.179337	0.47093	N	0.000253	T	0.03220	0.0094	L	0.41632	1.29	0.37075	D	0.898697	B	0.06786	0.001	B	0.06405	0.002	T	0.38779	-0.9645	10	0.08837	T	0.75	.	6.8995	0.24275	0.0:0.4367:0.3951:0.1682	.	88	P33764	S10A3_HUMAN	D	88	ENSP00000357702:E88D;ENSP00000357701:E88D	ENSP00000357701:E88D	E	-	3	2	2	S100A3	151786824	151786824	0.992000	0.36948	0.997000	0.53966	0.958000	0.62258	0.042000	0.13949	-0.037000	0.13646	0.655000	0.94253	GAG	0.648448		TCGA-3A-A9J0-01A-11D-A40W-08	0.597	S100A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037726.1	1	0	1		2	2	2	0		0	0	108		108	102	1	3.280000	-20.000000	1	0.470000	NM_002960			79	79		446	440	0		1	0		0	0	108	0		1.000000	2.886893e-01	0	0	0	7	0	79	446
UBQLN4	56893	broad.mit.edu	37	1	156012004	156012004	+	Silent	SNP	G	G	A	rs192302628	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:156012004G>A	ENST00000368309.3	-	8	1382	c.1290C>T	c.(1288-1290)ttC>ttT	p.F430F		NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	430					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					GGTTCCCCGCGAAGAGCGGCA	0.617													G|||	2	0.000399361	0.0	0.0029	5008	,	,		18705	0.0		0.0	False		,,,				2504	0.0					ENST00000368309.3	1.000000	6.100000e-01			0.850000	0.859474	0.850000	1.000000																										0				16						c.(1288-1290)ttC>ttT		ubiquilin 4							44.0	46.0	45.0					1																	156012004		2203	4300	6503	SO:0001819	synonymous_variant	56893	5	121410	39				g.chr1:156012004G>A	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.1290C>T	chr1.hg19:g.156012004G>A		1						p.F430F	NM_020131.3	NP_064516.2	3	3	6	2.322612	Q9NRR5	UBQL4_HUMAN		8	1382	-	Hepatocellular(266;0.133)|all_neural(408;0.195)		A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Silent	SNP	ENST00000368309.3	1	1	hg19	c.1290C>T	CCDS1127.1	1																																																																																								0.648448		TCGA-3A-A9J0-01A-11D-A40W-08	0.617	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	1	0	1		25	2	2	0		0	2	66		66	65	1	3.280000	-20.000000	1	0.470000	NM_020131			46	44		320	317	1		1	1		0	0	66	0		0.996464	9.993203e-01	0	15	0	63	0	46	320
NUF2	83540	broad.mit.edu	37	1	163317716	163317716	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:163317716G>A	ENST00000271452.3	+	12	1391	c.1112G>A	c.(1111-1113)cGc>cAc	p.R371H	NUF2_ENST00000524800.1_Missense_Mutation_p.R324H|NUF2_ENST00000367900.3_Missense_Mutation_p.R371H	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	371	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.R371H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					CAATACAAACGCACAGTAATT	0.318																																						ENST00000271452.3	1.000000	6.700000e-01			0.990000	0.930027	0.990000	1.000000																										1	Substitution - Missense(1)	p.R371H(1)	large_intestine(1)	35						c.(1111-1113)cGc>cAc		NUF2, NDC80 kinetochore complex component							69.0	66.0	67.0					1																	163317716		2203	4300	6503	SO:0001583	missense	83540	2	121412	31				g.chr1:163317716G>A	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1112G>A	chr1.hg19:g.163317716G>A	ENSP00000271452:p.Arg371His	1					NUF2_ENST00000524800.1_Missense_Mutation_p.R324H|NUF2_ENST00000367900.3_Missense_Mutation_p.R371H	p.R371H	NM_145697.2	NP_663735.2	3	3	6	2.322612	Q9BZD4	NUF2_HUMAN		12	1391	+	all_hematologic(923;0.101)		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	1	1	hg19	c.1112G>A	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089136	0.36855	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.34859	1.45;1.34;1.34	6.03	4.13	0.48395	6.03	4.13	0.48395	.	0.220012	0.49916	D	0.000130	T	0.07863	0.0197	N	0.16478	0.41	0.28144	N	0.929683	P;P	0.39352	0.669;0.669	B;B	0.27076	0.076;0.046	T	0.11372	-1.0590	9	0.44086	T	0.13	-6.6183	9.1986	0.37244	0.2248:0.0:0.7752:0.0	.	324;371	E9PQC4;Q9BZD4	.;NUF2_HUMAN	H	324;371;371	ENSP00000436888:R324H;ENSP00000356875:R371H;ENSP00000271452:R371H	ENSP00000271452:R371H	R	+	2	0	0	NUF2	161584340	161584340	0.995000	0.38212	0.857000	0.33713	0.990000	0.78478	1.124000	0.31320	1.521000	0.48983	0.655000	0.94253	CGC	0.648448		TCGA-3A-A9J0-01A-11D-A40W-08	0.318	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	1	0	1		2	2	2	0		0	0	48		48	47	1	3.280000	-16.227440	1	0.470000	NM_145697			31	31		183	181	1		1	1		0	0	48	0		1.000000	8.766069e-01	0	3	0	21	0	31	183
HMCN1	83872	broad.mit.edu	37	1	186030997	186030997	+	Missense_Mutation	SNP	C	C	T	rs376132541	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:186030997C>T	ENST00000271588.4	+	47	7556	c.7327C>T	c.(7327-7329)Cgg>Tgg	p.R2443W	HMCN1_ENST00000367492.2_Missense_Mutation_p.R2443W	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2443	Ig-like C2-type 22.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGGATGCTACGGCTGATGCA	0.398													C|||	2	0.000399361	0.0	0.0	5008	,	,		16462	0.0		0.0	False		,,,				2504	0.002					ENST00000271588.4	1.000000	9.300000e-01			0.990000	0.996367	0.990000	1.000000																										0				308						c.(7327-7329)Cgg>Tgg		hemicentin 1		C	TRP/ARG	0,4406		0,0,2203	87.0	94.0	92.0		7327	4.4	0.3	1		92	1,8599	1.2+/-3.3	0,1,4299	no	missense	HMCN1	NM_031935.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2443/5636	186030997	1,13005	2203	4300	6503	SO:0001583	missense	83872	7	121402	40				g.chr1:186030997C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7327C>T	chr1.hg19:g.186030997C>T	ENSP00000271588:p.Arg2443Trp	1					HMCN1_ENST00000367492.2_Missense_Mutation_p.R2443W	p.R2443W	NM_031935.2	NP_114141.2	3	3	6	2.360015	Q96RW7	HMCN1_HUMAN		47	7556	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	1	1	hg19	c.7327C>T	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274075	0.80580	0.0	1.16E-4	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.36520	1.25;1.25	5.39	4.42	0.53409	5.39	4.42	0.53409	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53906	-0.8372	10	0.37606	T	0.19	.	14.5328	0.67939	0.1471:0.8529:0.0:0.0	.	2443	Q96RW7	HMCN1_HUMAN	W	2443	ENSP00000271588:R2443W;ENSP00000356462:R2443W	ENSP00000271588:R2443W	R	+	1	2	2	HMCN1	184297620	184297620	1.000000	0.71417	0.330000	0.25442	0.846000	0.48090	4.567000	0.60850	2.528000	0.85240	0.591000	0.81541	CGG	0.654903		TCGA-3A-A9J0-01A-11D-A40W-08	0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	1	0	1		2	2	2	0		0	0	13		13	12	1	3.280000	-3.289656	1	0.470000	NM_031935			48	48		212	210	1		1	0		0	0	13	0		1.000000	0	0	0	0	1	0	48	212
ASPM	259266	broad.mit.edu	37	1	197072286	197072286	+	Missense_Mutation	SNP	C	C	T	rs149033840		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:197072286C>T	ENST00000367409.4	-	18	6351	c.6095G>A	c.(6094-6096)cGt>cAt	p.R2032H	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2032	IQ 14. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTTCATACCACGATAAGCTGA	0.333																																						ENST00000367409.4	1.000000	6.900000e-01			0.850000	0.857003	0.850000	1.000000																										0				165						c.(6094-6096)cGt>cAt		asp (abnormal spindle) homolog, microcephaly associated (Drosophila)			,HIS/ARG	0,4406		0,0,2203	95.0	99.0	98.0		,6095	5.6	0.7	1	dbSNP_134	98	1,8593	1.2+/-3.3	0,1,4296	no	intron,missense	ASPM	NM_001206846.1,NM_018136.4	,29	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	,probably-damaging	,2032/3478	197072286	1,12999	2203	4297	6500	SO:0001583	missense	259266	1	121386	31				g.chr1:197072286C>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6095G>A	chr1.hg19:g.197072286C>T	ENSP00000356379:p.Arg2032His	1					ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	p.R2032H	NM_018136.4	NP_060606.3	0	2	2	1.605430	Q8IZT6	ASPM_HUMAN		18	6351	-			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	1	1	hg19	c.6095G>A	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	c	29.9	5.043488	0.93685	0.0	1.16E-4	ENSG00000066279	ENST00000367409	T	0.77098	-1.07	5.57	5.57	0.84162	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000004	D	0.93012	0.7776	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95297	0.8400	10	0.87932	D	0	.	18.5928	0.91220	0.0:1.0:0.0:0.0	.	2032	Q8IZT6	ASPM_HUMAN	H	2032	ENSP00000356379:R2032H	ENSP00000356379:R2032H	R	-	2	0	0	ASPM	195338909	195338909	1.000000	0.71417	0.711000	0.30485	0.987000	0.75469	4.754000	0.62191	2.635000	0.89317	0.632000	0.83419	CGT	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.333	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	1	0	1		2	2	2	0		0	0	64		64	64	1	3.280000	-20.000000	1	0.470000	NM_018136			84	84		334	332	1		1	1		0	0	64	0		1.000000	1.851841e-01	0	3	0	1	0	84	334
DISP1	84976	broad.mit.edu	37	1	223175862	223175862	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:223175862G>A	ENST00000284476.6	+	8	1287	c.1123G>A	c.(1123-1125)Gtt>Att	p.V375I		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	375					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TGAGCGAGACGTTTCTCATAC	0.527											OREG0014268|OREG0026708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000284476.6	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				69						c.(1123-1125)Gtt>Att		dispatched homolog 1 (Drosophila)							104.0	95.0	98.0					1																	223175862		2203	4300	6503	SO:0001583	missense	84976	1	121412	31				g.chr1:223175862G>A	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.1123G>A	chr1.hg19:g.223175862G>A	ENSP00000284476:p.Val375Ile	1		OREG0014268|OREG0026708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2287		p.V375I	NM_032890.3	NP_116279.2	3	3	6	2.332360	Q96F81	DISP1_HUMAN		8	1287	+			Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	1	1	hg19	c.1123G>A	CCDS1536.1	1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.730061	0.30684	.	.	ENSG00000154309	ENST00000284476	D	0.86164	-2.08	5.25	4.33	0.51752	5.25	4.33	0.51752	.	0.114979	0.64402	D	0.000013	D	0.82765	0.5108	L	0.43598	1.365	0.58432	D	0.999992	P	0.43314	0.803	B	0.39935	0.314	T	0.81145	-0.1066	10	0.27785	T	0.31	-17.2678	16.1121	0.81271	0.0:0.1337:0.8663:0.0	.	375	Q96F81	DISP1_HUMAN	I	375	ENSP00000284476:V375I	ENSP00000284476:V375I	V	+	1	0	0	DISP1	221242485	221242485	1.000000	0.71417	0.522000	0.27862	0.672000	0.39443	5.135000	0.64777	1.433000	0.47394	0.655000	0.94253	GTT	0.650626		TCGA-3A-A9J0-01A-11D-A40W-08	0.527	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	1	0	1		2	2	2	0		0	0	44		44	44	1	3.280000	-20.000000	1	0.470000	NM_032890			116	113		240	237	1		1	1		0	0	44	0		1.000000	7.909829e-01	0	3	0	5	0	116	240
CDC42BPA	8476	broad.mit.edu	37	1	227223274	227223274	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:227223274G>A	ENST00000366769.3	-	24	4420	c.3129C>T	c.(3127-3129)aaC>aaT	p.N1043N	CDC42BPA_ENST00000366766.2_Silent_p.N1078N|CDC42BPA_ENST00000334218.5_Silent_p.N1043N|CDC42BPA_ENST00000535525.1_Silent_p.N1023N|CDC42BPA_ENST00000366764.2_Silent_p.N1015N|CDC42BPA_ENST00000366767.3_Silent_p.N962N|CDC42BPA_ENST00000366765.3_Silent_p.N1056N	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				TTGGAGCTTTGTTTACACAAG	0.373																																						ENST00000366769.3	1.000000	8.400000e-01			0.990000	0.983121	0.990000	1.000000																										0				77						c.(3127-3129)aaC>aaT		CDC42 binding protein kinase alpha (DMPK-like)							95.0	95.0	95.0					1																	227223274		2203	4300	6503	SO:0001819	synonymous_variant	8476	0	0					g.chr1:227223274G>A	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.3129C>T	chr1.hg19:g.227223274G>A		1					CDC42BPA_ENST00000366764.2_Silent_p.N1015N|CDC42BPA_ENST00000366767.3_Silent_p.N962N|CDC42BPA_ENST00000366766.2_Silent_p.N1078N|CDC42BPA_ENST00000334218.5_Silent_p.N1043N|CDC42BPA_ENST00000366765.3_Silent_p.N1056N|CDC42BPA_ENST00000535525.1_Silent_p.N1023N	p.N1043N	NM_003607.3	NP_003598.2	3	3	6	2.332360				24	4420	-		all_cancers(173;0.156)|Prostate(94;0.0792)		Silent	SNP	ENST00000366769.3	1	1	hg19	c.3129C>T	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	G	9.760	1.169942	0.21621	.	.	ENSG00000143776	ENST00000448940;ENST00000442054;ENST00000441725	.	.	.	5.8	5.8	0.92144	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.051	0.97627	0.0:0.0:1.0:0.0	.	.	.	.	X	246;372;268	.	.	Q	-	1	0	0	CDC42BPA	225289897	225289897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.833000	0.48159	2.740000	0.93945	0.650000	0.86243	CAA	0.650626		TCGA-3A-A9J0-01A-11D-A40W-08	0.373	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	1	0	1		2	2	2	0		0	0	87		87	86	1	3.280000	-20.000000	1	0.470000	NM_014826			69	70		355	350	0		1	0		0	0	87	0		1.000000	9.367419e-01	0	0	0	26	0	69	355
WNT3A	89780	broad.mit.edu	37	1	228246856	228246856	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:228246856G>A	ENST00000284523.1	+	4	827	c.749G>A	c.(748-750)cGc>cAc	p.R250H	WNT3A_ENST00000366753.2_Missense_Mutation_p.R250H	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	250					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				CGGGAGTCCCGCGGCTGGGTG	0.657																																						ENST00000284523.1	1.000000	7.300000e-01			0.990000	0.955290	0.990000	1.000000																										0				12						c.(748-750)cGc>cAc		wingless-type MMTV integration site family, member 3A							47.0	51.0	50.0					1																	228246856		2203	4300	6503	SO:0001583	missense	89780	0	0					g.chr1:228246856G>A	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.749G>A	chr1.hg19:g.228246856G>A	ENSP00000284523:p.Arg250His	1					WNT3A_ENST00000366753.2_Missense_Mutation_p.R250H	p.R250H	NM_033131.3	NP_149122.1	3	3	6	2.332360	P56704	WNT3A_HUMAN		4	827	+		Prostate(94;0.0405)	Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	1	1	hg19	c.749G>A	CCDS1564.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.345122	0.95807	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.76448	-1.02;-1.02	4.68	4.68	0.58851	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.85283	0.5661	L	0.51914	1.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.987;0.993	D	0.86836	0.2014	10	0.66056	D	0.02	.	17.9461	0.89039	0.0:0.0:1.0:0.0	.	250;250	P56704;Q3SY79	WNT3A_HUMAN;.	H	250	ENSP00000284523:R250H;ENSP00000355715:R250H	ENSP00000284523:R250H	R	+	2	0	0	WNT3A	226313479	226313479	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	9.733000	0.98818	2.300000	0.77407	0.491000	0.48974	CGC	0.650626		TCGA-3A-A9J0-01A-11D-A40W-08	0.657	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	1	0	1		2	2	2	0		0	0	58		58	58	1	3.280000	-20.000000	1	0.470000	NM_033131			39	38		217	211	1		1			0	0	58	0		1.000000	0	0	0	0	0	0	39	217
CSMD2	114784	broad.mit.edu	37	1	34092119	34092119	+	Missense_Mutation	SNP	C	C	T	rs529128430		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:34092119C>T	ENST00000373380.1	-	12	2102	c.1882G>A	c.(1882-1884)Gca>Aca	p.A628T	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373377.1_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.A1755T			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1715	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGGCTGGTGCGAGGCCTTTG	0.542																																						ENST00000373380.1	1.000000	5.000000e-01			0.990000	0.893702	0.990000	1.000000																										0				246						c.(1882-1884)Gca>Aca		CUB and Sushi multiple domains 2							58.0	52.0	54.0					1																	34092119		2203	4300	6503	SO:0001583	missense	114784	6	121402	32				g.chr1:34092119C>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1882G>A	chr1.hg19:g.34092119C>T	ENSP00000362478:p.Ala628Thr	1					CSMD2_ENST00000373377.1_5'UTR|CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.A1755T	p.A628T			1	3	4	1.984023	Q7Z408	CSMD2_HUMAN		12	2102	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	1	1	hg19	c.1882G>A		1	.	.	.	.	.	.	.	.	.	.	c	9.717	1.158608	0.21454	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.59083	0.29;0.29	5.87	0.757	0.18427	5.87	0.757	0.18427	CUB (5);	0.497844	0.22002	N	0.065989	T	0.26340	0.0643	N	0.03903	-0.33	0.20403	N	0.999907	B;B;B	0.15473	0.002;0.013;0.002	B;B;B	0.15870	0.002;0.008;0.014	T	0.13737	-1.0498	10	0.22706	T	0.39	.	5.2569	0.15552	0.3639:0.4384:0.0:0.1976	.	628;1715;1755	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	T	1755;628	ENSP00000362479:A1755T;ENSP00000362478:A628T	ENSP00000241312:A1715T	A	-	1	0	0	CSMD2	33864706	33864706	0.019000	0.18553	0.012000	0.15200	0.327000	0.28475	0.209000	0.17435	0.103000	0.17682	-0.713000	0.03633	GCA	0.583530		TCGA-3A-A9J0-01A-11D-A40W-08	0.542	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	1	0	1		2	2	2	0		0	0	19		19	18	1	3.280000	-18.535100	1	0.470000	NM_052896			10	10		51	51	1		1	0		0	0	19	0		0.997694	0	0	0	0	1	0	10	51
HIVEP3	59269	broad.mit.edu	37	1	41976495	41976495	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:41976495C>T	ENST00000372583.1	-	9	7733	c.6848G>A	c.(6847-6849)gGa>gAa	p.G2283E	HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000372584.1_Missense_Mutation_p.G2282E|HIVEP3_ENST00000247584.5_Missense_Mutation_p.G2283E|HIVEP3_ENST00000429157.2_Missense_Mutation_p.G2282E	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2283					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GCCCGGGCCTCCGCCGGTCCT	0.682																																						ENST00000372583.1	1.000000	7.400000e-01			0.990000	0.970960	0.990000	1.000000																										0				85						c.(6847-6849)gGa>gAa		human immunodeficiency virus type I enhancer binding protein 3							19.0	23.0	22.0					1																	41976495		2201	4298	6499	SO:0001583	missense	59269	0	0					g.chr1:41976495C>T	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.6848G>A	chr1.hg19:g.41976495C>T	ENSP00000361664:p.Gly2283Glu	1					HIVEP3_ENST00000372584.1_Missense_Mutation_p.G2282E|HIVEP3_ENST00000429157.2_Missense_Mutation_p.G2282E|HIVEP3_ENST00000247584.5_Missense_Mutation_p.G2283E|HIVEP3_ENST00000460604.1_5'UTR	p.G2283E	NM_024503.4	NP_078779.2	1	3	4	1.984023	Q5T1R4	ZEP3_HUMAN		9	7733	-	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	1	1	hg19	c.6848G>A	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	C	1.034	-0.680791	0.03353	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.04917	3.54;3.53;3.53;3.54	5.27	3.27	0.37495	5.27	3.27	0.37495	.	0.615288	0.14475	N	0.317317	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.46679	-0.9174	10	0.09843	T	0.71	-1.0496	4.9301	0.13912	0.0:0.6819:0.0:0.3181	.	2282;2283	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	E	2282;2283;2283;2282	ENSP00000361665:G2282E;ENSP00000361664:G2283E;ENSP00000247584:G2283E;ENSP00000410828:G2282E	ENSP00000247584:G2283E	G	-	2	0	0	HIVEP3	41749082	41749082	0.008000	0.16893	0.462000	0.27118	0.101000	0.19017	0.771000	0.26633	1.462000	0.47948	0.561000	0.74099	GGA	0.583530		TCGA-3A-A9J0-01A-11D-A40W-08	0.682	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	1	0	1		2	2	2	0		0	0	28		28	27	1	3.280000	-20.000000	1	0.470000	NM_024503			22	20		88	88	0		1	1		0	0	28	0		0.999999	5.068464e-01	0	2	0	6	0	22	88
SSX2IP	117178	broad.mit.edu	37	1	85124124	85124124	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:85124124C>T	ENST00000342203.3	-	9	1218	c.955G>A	c.(955-957)Ggg>Agg	p.G319R	SSX2IP_ENST00000437941.2_Missense_Mutation_p.G292R|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000370612.4_Missense_Mutation_p.G319R|SSX2IP_ENST00000605755.1_Missense_Mutation_p.G292R	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	319					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CTTAGTTCCCCGGCATCTTCT	0.438																																						ENST00000342203.3	1.000000	2.300000e-01			0.440000	0.551462	0.440000	0.380000																										0				19						c.(955-957)Ggg>Agg		synovial sarcoma, X breakpoint 2 interacting protein							105.0	90.0	95.0					1																	85124124		2203	4300	6503	SO:0001583	missense	117178	0	0					g.chr1:85124124C>T		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.955G>A	chr1.hg19:g.85124124C>T	ENSP00000340279:p.Gly319Arg	1					SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000437941.2_Missense_Mutation_p.G292R|SSX2IP_ENST00000605755.1_Missense_Mutation_p.G292R|SSX2IP_ENST00000370612.4_Missense_Mutation_p.G319R	p.G319R	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	1	3	4	1.986928	Q9Y2D8	ADIP_HUMAN		9	1218	-			A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	1	1	hg19	c.955G>A	CCDS699.1	0	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325317	0.81580	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T	0.49720	0.77;0.77	5.76	4.77	0.60923	5.76	4.77	0.60923	.	0.455024	0.25037	N	0.033632	T	0.45796	0.1360	L	0.47716	1.5	0.35549	D	0.803693	D;D;D	0.63046	0.99;0.992;0.985	P;P;P	0.53760	0.615;0.734;0.648	T	0.42766	-0.9432	10	0.46703	T	0.11	.	17.5251	0.87798	0.1322:0.8678:0.0:0.0	.	315;319;292	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	R	319;292;315;319	ENSP00000340279:G319R;ENSP00000412781:G292R	ENSP00000340279:G319R	G	-	1	0	0	SSX2IP	84896712	84896712	0.967000	0.33354	0.993000	0.49108	0.938000	0.57974	4.489000	0.60309	2.732000	0.93576	0.655000	0.94253	GGG	0.585062		TCGA-3A-A9J0-01A-11D-A40W-08	0.438	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	1	0	1		2	2	2	0		0	0	25		25	25	1	3.280000	-2.841579	1	0.470000	NM_014021			13	13		168	162	0		1	1		0	0	25	0		0.999494	6.577031e-01	0	2	0	28	0	13	168
OR2M4	26245	broad.mit.edu	37	1	248402386	248402386	+	Missense_Mutation	SNP	G	G	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr1:248402386G>T	ENST00000306687.1	+	1	156	c.156G>T	c.(154-156)gaG>gaT	p.E52D		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	52					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCTACATAGAGAAACAGCTCC	0.478																																						ENST00000306687.1	1.000000	7.000000e-01			0.880000	0.889382	0.880000	0.840000																										0				50						c.(154-156)gaG>gaT		olfactory receptor, family 2, subfamily M, member 4							203.0	190.0	195.0					1																	248402386		2203	4300	6503	SO:0001583	missense	26245	0	0					g.chr1:248402386G>T	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.156G>T	chr1.hg19:g.248402386G>T	ENSP00000306688:p.Glu52Asp	1						p.E52D	NM_017504.1	NP_059974.1	3	3	6	2.332360	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)	1	156	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	1	1	hg19	c.156G>T	CCDS31108.1	1	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.029643	0.00041	.	.	ENSG00000171180	ENST00000306687	T	0.02140	4.43	3.08	1.13	0.20643	3.08	1.13	0.20643	GPCR, rhodopsin-like superfamily (1);	0.344625	0.20655	N	0.088135	T	0.00468	0.0015	N	0.00140	-2.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46735	-0.9170	10	0.02654	T	1	.	2.8665	0.05603	0.1816:0.523:0.1817:0.1137	.	52	Q96R27	OR2M4_HUMAN	D	52	ENSP00000306688:E52D	ENSP00000306688:E52D	E	+	3	2	2	OR2M4	246469009	246469009	0.000000	0.05858	0.096000	0.21009	0.114000	0.19823	-2.414000	0.01037	0.614000	0.30107	-0.268000	0.10319	GAG	0.650626		TCGA-3A-A9J0-01A-11D-A40W-08	0.478	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	1	0	1		2	2	2	0		0	0	89		89	85	1	3.280000	-3.221884	1	0.470000	NM_017504			98	98		646	633	1		1			0	0	89	0		1.000000	0	0	0	0	0	0	98	646
PPP1R16B	26051	broad.mit.edu	37	20	37536753	37536753	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr20:37536753C>T	ENST00000299824.1	+	10	1300	c.1111C>T	c.(1111-1113)Cgg>Tgg	p.R371W	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.R329W	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	371					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				CCTGTGGCAGCGGAGTGCAGC	0.602																																						ENST00000299824.1	1.000000	6.600000e-01			0.900000	0.894557	0.900000	1.000000																										0				49						c.(1111-1113)Cgg>Tgg		protein phosphatase 1, regulatory subunit 16B							110.0	95.0	100.0					20																	37536753		2203	4300	6503	SO:0001583	missense	26051	0	0					g.chr20:37536753C>T	AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1111C>T	chr20.hg19:g.37536753C>T	ENSP00000299824:p.Arg371Trp	1					PPP1R16B_ENST00000373331.2_Missense_Mutation_p.R329W	p.R371W	NM_015568.2	NP_056383.1	1	3	4	2.263571	Q96T49	PP16B_HUMAN		10	1300	+		Myeloproliferative disorder(115;0.00878)	A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	ENST00000299824.1	1	1	hg19	c.1111C>T	CCDS13309.1	1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814832	0.70912	.	.	ENSG00000101445	ENST00000299824;ENST00000373331	T;T	0.71103	-0.41;-0.54	5.26	3.2	0.36748	5.26	3.2	0.36748	.	0.204892	0.41938	D	0.000796	T	0.66317	0.2777	L	0.36672	1.1	0.27630	N	0.948065	D;D	0.71674	0.998;0.995	P;P	0.51657	0.613;0.676	T	0.61247	-0.7101	10	0.72032	D	0.01	.	8.6451	0.34000	0.3461:0.5789:0.0:0.075	.	329;371	E9PFS8;Q96T49	.;PP16B_HUMAN	W	371;329	ENSP00000299824:R371W;ENSP00000362428:R329W	ENSP00000299824:R371W	R	+	1	2	2	PPP1R16B	36970167	36970167	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.866000	0.27954	1.476000	0.48215	0.644000	0.83932	CGG	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.602	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	1	0	1		2	2	2	1		1	0	37		37	35	1	3.280000	-2.846317	1	0.470000	NM_015568			39	39		231	224	1		1	0		1	0	37	0		1.000000	2.208576e-02	0	0	0	2	0	39	231
ARFGEF2	10564	broad.mit.edu	37	20	47569336	47569336	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr20:47569336G>A	ENST00000371917.4	+	5	518	c.518G>A	c.(517-519)aGc>aAc	p.S173N		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	173	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TATTTGGCCAGCAAAAATCTC	0.443																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	ENST00000371917.4	0.130000	0			0.050000	0.064971	0.050000	0.050000																										0				63						c.(517-519)aGc>aAc		ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)							144.0	128.0	134.0					20																	47569336		2203	4300	6503	SO:0001583	missense	10564	0	0					g.chr20:47569336G>A	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.518G>A	chr20.hg19:g.47569336G>A	ENSP00000360985:p.Ser173Asn	1						p.S173N	NM_006420.2	NP_006411.2	1	3	4	2.263571	Q9Y6D5	BIG2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)	5	518	+			Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	0	1	hg19	c.518G>A	CCDS13411.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.522113	0.96416	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.33654	1.4	6.06	6.06	0.98353	6.06	6.06	0.98353	Armadillo-type fold (1);	0.079509	0.85682	D	0.000000	T	0.74366	0.3707	H	0.96208	3.785	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.81656	-0.0834	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	173	Q9Y6D5	BIG2_HUMAN	N	173	ENSP00000360985:S173N	ENSP00000360985:S173N	S	+	2	0	0	ARFGEF2	47002743	47002743	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.857000	0.99534	2.882000	0.98803	0.655000	0.94253	AGC	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.443	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	0	0	1		19	2	2	0		0	1	98		98	96	1	3.280000	-2.617075	1	0.470000	NM_006420			5	5		557	553	0		0	0		0	0	98	0		0.002837	4.442817e-03	0	0	0	9	0	5	557
DSCAM	1826	broad.mit.edu	37	21	41710288	41710288	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr21:41710288C>T	ENST00000400454.1	-	8	2000	c.1523G>A	c.(1522-1524)cGa>cAa	p.R508Q		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	508	Ig-like C2-type 6.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTTCATTGGTCGAATGCTTGC	0.403																																					Melanoma(134;970 1778 1785 21664 32388)	ENST00000400454.1	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				142						c.(1522-1524)cGa>cAa		Down syndrome cell adhesion molecule							142.0	132.0	135.0					21																	41710288		1906	4132	6038	SO:0001583	missense	1826	1	120828	35				g.chr21:41710288C>T	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1523G>A	chr21.hg19:g.41710288C>T	ENSP00000383303:p.Arg508Gln	1						p.R508Q	NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	0	2	2	1.590636	O60469	DSCAM_HUMAN		8	2000	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	O60468	Missense_Mutation	SNP	ENST00000400454.1	1	1	hg19	c.1523G>A	CCDS42929.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.256495	0.95336	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.64260	-0.09;-0.09	5.77	5.77	0.91146	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.75042	0.3796	L	0.50847	1.595	0.53688	D	0.999972	D	0.76494	0.999	D	0.68192	0.956	T	0.70963	-0.4729	10	0.35671	T	0.21	.	19.9857	0.97347	0.0:1.0:0.0:0.0	.	508	O60469	DSCAM_HUMAN	Q	508;260	ENSP00000383303:R508Q;ENSP00000385342:R260Q	ENSP00000383303:R508Q	R	-	2	0	0	DSCAM	40632158	40632158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.656000	0.83736	2.724000	0.93272	0.655000	0.94253	CGA	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.403	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	1	0	1		2	2	2	0		0	0	60		60	59	1	3.280000	-20.000000	1	0.470000	NM_001389			57	54		89	88	1		1			0	0	60	0		1.000000	0	0	0	0	0	0	57	89
COL6A2	1292	broad.mit.edu	37	21	47545822	47545822	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr21:47545822C>T	ENST00000300527.4	+	26	2197	c.2093C>T	c.(2092-2094)gCg>gTg	p.A698V	COL6A2_ENST00000409416.1_Missense_Mutation_p.A698V|COL6A2_ENST00000310645.5_Missense_Mutation_p.A698V|COL6A2_ENST00000397763.1_Missense_Mutation_p.A698V|COL6A2_ENST00000357838.4_Missense_Mutation_p.A698V	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	698	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GAGTGGATTGCGGGCGGCACC	0.602																																						ENST00000300527.4	1.000000	8.000000e-01			0.990000	0.975379	0.990000	1.000000																										0				43						c.(2092-2094)gCg>gTg		collagen, type VI, alpha 2							76.0	69.0	71.0					21																	47545822		2203	4300	6503	SO:0001583	missense	1292	0	0					g.chr21:47545822C>T	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2093C>T	chr21.hg19:g.47545822C>T	ENSP00000300527:p.Ala698Val	1					COL6A2_ENST00000357838.4_Missense_Mutation_p.A698V|COL6A2_ENST00000397763.1_Missense_Mutation_p.A698V|COL6A2_ENST00000310645.5_Missense_Mutation_p.A698V|COL6A2_ENST00000409416.1_Missense_Mutation_p.A698V	p.A698V	NM_001849.3	NP_001840.3	0	2	2	1.590636	P12110	CO6A2_HUMAN		26	2197	+	Breast(49;0.245)		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	1	1	hg19	c.2093C>T	CCDS13728.1	1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559002	0.65538	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18	4.21	4.21	0.49690	4.21	4.21	0.49690	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.89107	0.3493	10	0.72032	D	0.01	-18.7532	16.5536	0.84479	0.0:1.0:0.0:0.0	.	698;698;698	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	V	698	ENSP00000300527:A698V;ENSP00000350497:A698V;ENSP00000312529:A698V;ENSP00000387115:A698V;ENSP00000380870:A698V	ENSP00000300527:A698V	A	+	2	0	0	COL6A2	46370250	46370250	1.000000	0.71417	0.030000	0.17652	0.733000	0.41908	7.562000	0.82300	1.889000	0.54706	0.491000	0.48974	GCG	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.602	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1	1	0	1		2	2	2	0		0	0	49		49	46	1	3.280000	-20.000000	1	0.470000				37	37		108	105	1		1	1		0	0	49	0		1.000000	1	0	2	0	2304	0	37	108
PPM1F	9647	broad.mit.edu	37	22	22277807	22277807	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr22:22277807G>A	ENST00000263212.5	-	8	1128	c.1023C>T	c.(1021-1023)gcC>gcT	p.A341A	PPM1F_ENST00000407142.1_Silent_p.A173A|PPM1F_ENST00000538191.1_Silent_p.A237A	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	341					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		AAGCTGCATCGGCCTCCCCAG	0.632																																						ENST00000263212.5	1.000000	9.300000e-01			0.990000	0.996304	0.990000	1.000000																										0				12						c.(1021-1023)gcC>gcT		protein phosphatase, Mg2+/Mn2+ dependent, 1F							40.0	45.0	43.0					22																	22277807		2203	4300	6503	SO:0001819	synonymous_variant	9647	1	121408	28				g.chr22:22277807G>A	D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.1023C>T	chr22.hg19:g.22277807G>A		1					PPM1F_ENST00000407142.1_Silent_p.A173A|PPM1F_ENST00000538191.1_Silent_p.A237A	p.A341A	NM_014634.3	NP_055449.1	0	3	3	1.990590	P49593	PPM1F_HUMAN		8	1128	-	Colorectal(54;0.105)		A8K6G3|B7Z2C3|Q96PM2	Silent	SNP	ENST00000263212.5	1	1	hg19	c.1023C>T	CCDS13796.1	1																																																																																								0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.632	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	1	0	1		2	2	2	0		0	0	52		52	50	1	3.280000	-4.271238	1	0.470000	NM_014634			46	46		151	148	1		1	0		0	0	52	0		1.000000	7.650780e-01	0	1	0	10	0	46	151
TBC1D10A	83874	broad.mit.edu	37	22	30722767	30722767	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr22:30722767G>A	ENST00000215790.7	-	1	268	c.104C>T	c.(103-105)aCc>aTc	p.T35I	TBC1D10A_ENST00000403477.3_Missense_Mutation_p.T35I|TBC1D10A_ENST00000490449.1_5'UTR	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	35					activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						GAGTTCGTCGGTGGTTGCGGC	0.711																																						ENST00000215790.7	1.000000	8.300000e-01			0.990000	0.984948	0.990000	1.000000																										0				23						c.(103-105)aCc>aTc		TBC1 domain family, member 10A							24.0	30.0	28.0					22																	30722767		2200	4292	6492	SO:0001583	missense	83874	0	0					g.chr22:30722767G>A	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.104C>T	chr22.hg19:g.30722767G>A	ENSP00000215790:p.Thr35Ile	1					TBC1D10A_ENST00000490449.1_5'UTR|TBC1D10A_ENST00000403477.3_Missense_Mutation_p.T35I	p.T35I	NM_031937.2	NP_114143.1	0	6	6	2.712028	Q9BXI6	TB10A_HUMAN		1	268	-			B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	1	1	hg19	c.104C>T	CCDS13874.1	1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535300	0.45176	.	.	ENSG00000099992	ENST00000215790;ENST00000403477	T;T	0.18174	2.23;3.53	4.13	3.1	0.35709	4.13	3.1	0.35709	.	0.783594	0.11519	N	0.555865	T	0.09730	0.0239	N	0.14661	0.345	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.12682	-1.0538	10	0.38643	T	0.18	.	6.2359	0.20762	0.1066:0.1878:0.7056:0.0	.	35;35;35	Q20WK7;B3KXT8;Q9BXI6	.;.;TB10A_HUMAN	I	35	ENSP00000215790:T35I;ENSP00000384996:T35I	ENSP00000215790:T35I	T	-	2	0	0	TBC1D10A	29052767	29052767	0.815000	0.29118	0.337000	0.25536	0.754000	0.42855	1.587000	0.36622	0.843000	0.35070	0.430000	0.28490	ACC	0.703844		TCGA-3A-A9J0-01A-11D-A40W-08	0.711	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	1	0	1		2	2	2	0		0	0	61		61	58	1	3.280000	-20.000000	1	0.470000	NM_031937			44	42		258	245	0		1	1		0	0	61	0		1.000000	9.968197e-01	0	8	0	46	0	44	258
GCC2	9648	broad.mit.edu	37	2	109092224	109092224	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:109092224A>G	ENST00000309863.6	+	9	3692	c.2978A>G	c.(2977-2979)gAa>gGa	p.E993G		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	993					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						ACTGTGAAGGAAGAACTTGAA	0.313																																						ENST00000309863.6	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				54						c.(2977-2979)gAa>gGa		GRIP and coiled-coil domain containing 2							48.0	53.0	51.0					2																	109092224		2203	4296	6499	SO:0001583	missense	9648	0	0					g.chr2:109092224A>G	BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.2978A>G	chr2.hg19:g.109092224A>G	ENSP00000307939:p.Glu993Gly	1						p.E993G	NM_181453.3	NP_852118	2	2	4	2.183810	Q8IWJ2	GCC2_HUMAN		9	3692	+			A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	1	1	hg19	c.2978A>G	CCDS33268.1	1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.561512	0.65538	.	.	ENSG00000135968	ENST00000309863	T	0.37752	1.18	5.69	4.47	0.54385	5.69	4.47	0.54385	.	0.060927	0.64402	D	0.000005	T	0.36193	0.0958	M	0.65975	2.015	0.43719	D	0.996197	D	0.53619	0.961	P	0.44597	0.454	T	0.14643	-1.0465	10	0.35671	T	0.21	.	8.0869	0.30777	0.7272:0.1393:0.0:0.1335	.	993	Q8IWJ2	GCC2_HUMAN	G	993	ENSP00000307939:E993G	ENSP00000307939:E993G	E	+	2	0	0	GCC2	108458656	108458656	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	4.657000	0.61490	2.296000	0.77279	0.533000	0.62120	GAA	0.627547		TCGA-3A-A9J0-01A-11D-A40W-08	0.313	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	1	0	1		2	2	2	0		0	0	73		73	71	1	3.280000	-20.000000	1	0.470000	NM_014635			107	105		286	282	1		1	1		0	0	73	0		1.000000	9.985026e-01	0	9	0	20	0	107	286
CKAP2L	150468	broad.mit.edu	37	2	113514074	113514074	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:113514074A>G	ENST00000302450.6	-	4	952	c.874T>C	c.(874-876)Tca>Cca	p.S292P	CKAP2L_ENST00000541405.1_Missense_Mutation_p.S127P|CKAP2L_ENST00000481732.1_5'Flank	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	292						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						GGTTTCTTTGATGACTGAACT	0.403																																						ENST00000302450.6	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				28						c.(874-876)Tca>Cca		cytoskeleton associated protein 2-like							94.0	98.0	96.0					2																	113514074		2203	4300	6503	SO:0001583	missense	150468	0	0					g.chr2:113514074A>G	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.874T>C	chr2.hg19:g.113514074A>G	ENSP00000305204:p.Ser292Pro	1					CKAP2L_ENST00000541405.1_Missense_Mutation_p.S127P|CKAP2L_ENST00000481732.1_5'Flank	p.S292P	NM_152515.3	NP_689728.3	2	2	4	2.183810	Q8IYA6	CKP2L_HUMAN		4	952	-			A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	1	1	hg19	c.874T>C	CCDS2100.1	1	.	.	.	.	.	.	.	.	.	.	A	5.274	0.235997	0.10023	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.18657	2.2;2.87	4.69	-2.55	0.06288	4.69	-2.55	0.06288	.	0.644272	0.13672	N	0.370817	T	0.10723	0.0262	L	0.33485	1.01	0.09310	N	1	B	0.14012	0.009	B	0.16722	0.016	T	0.27123	-1.0083	10	0.33141	T	0.24	-0.2642	0.2847	0.00249	0.3956:0.1484:0.1686:0.2874	.	292	Q8IYA6	CKP2L_HUMAN	P	127;292	ENSP00000438763:S127P;ENSP00000305204:S292P	ENSP00000305204:S292P	S	-	1	0	0	CKAP2L	113230545	113230545	0.527000	0.26306	0.001000	0.08648	0.091000	0.18340	0.044000	0.13992	-0.386000	0.07821	0.477000	0.44152	TCA	0.627547		TCGA-3A-A9J0-01A-11D-A40W-08	0.403	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	0	0	1		2	2	2	0		0	0	113		113	110	1	3.280000	-20.000000	1	0.470000	NM_152515			154	153		374	371	1		1	1		0	0	113	0		1.000000	7.263466e-01	0	4	0	4	0	154	374
GPR39	2863	broad.mit.edu	37	2	133402714	133402714	+	Missense_Mutation	SNP	C	C	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:133402714C>G	ENST00000329321.3	+	2	1366	c.897C>G	c.(895-897)aaC>aaG	p.N299K	LYPD1_ENST00000397463.2_3'UTR|GPR39_ENST00000470071.1_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	299					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGATGCCCAACCAGATTCGGA	0.547																																						ENST00000329321.3	1.000000	9.900000e-01			0.990000	0.999997	0.990000	1.000000																										0				22						c.(895-897)aaC>aaG		G protein-coupled receptor 39							88.0	76.0	80.0					2																	133402714		2203	4300	6503	SO:0001583	missense	2863	0	0					g.chr2:133402714C>G	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.897C>G	chr2.hg19:g.133402714C>G	ENSP00000327417:p.Asn299Lys	1					GPR39_ENST00000470071.1_3'UTR|LYPD1_ENST00000397463.2_3'UTR	p.N299K	NM_001508.2	NP_001499.1	2	2	4	2.183810	O43194	GPR39_HUMAN		2	1366	+			B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	1	1	hg19	c.897C>G	CCDS2170.1	1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795528	0.50208	.	.	ENSG00000183840	ENST00000329321	T	0.71817	-0.6	5.3	3.48	0.39840	5.3	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.108898	0.64402	D	0.000010	T	0.78104	0.4231	L	0.57536	1.79	0.80722	D	1	D	0.63046	0.992	D	0.66847	0.947	T	0.77531	-0.2553	10	0.62326	D	0.03	.	9.5552	0.39334	0.0:0.7715:0.0:0.2285	.	299	O43194	GPR39_HUMAN	K	299	ENSP00000327417:N299K	ENSP00000327417:N299K	N	+	3	2	2	GPR39	133119184	133119184	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.664000	0.25068	0.799000	0.34018	0.650000	0.86243	AAC	0.627547		TCGA-3A-A9J0-01A-11D-A40W-08	0.547	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1	1	0	1		2	2	2	0		0	0	87		87	87	1	3.280000	-20.000000	1	0.470000				81	80		251	250	1		1	1		0	0	87	0		1.000000	9.999954e-01	0	27	0	32	0	81	251
ABCB6	10058	broad.mit.edu	37	2	220080843	220080843	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:220080843G>A	ENST00000265316.3	-	5	1346	c.1030C>T	c.(1030-1032)Cgg>Tgg	p.R344W	ABCB6_ENST00000439002.2_Missense_Mutation_p.R298W	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	344	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCTCCACCCGCCGAGACGTG	0.687																																						ENST00000265316.3	1.000000	5.600000e-01			0.990000	0.910020	0.990000	1.000000																										0				34						c.(1030-1032)Cgg>Tgg		ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)							24.0	27.0	26.0					2																	220080843		2193	4294	6487	SO:0001583	missense	10058	0	0					g.chr2:220080843G>A	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1030C>T	chr2.hg19:g.220080843G>A	ENSP00000265316:p.Arg344Trp	1					ABCB6_ENST00000439002.2_Missense_Mutation_p.R298W	p.R344W	NM_005689.2	NP_005680.1	2	2	4	2.143198	Q9NP58	ABCB6_HUMAN		5	1346	-		Renal(207;0.0474)	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	ENST00000265316.3	0	1	hg19	c.1030C>T	CCDS2436.1	1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282959	0.40394	.	.	ENSG00000115657	ENST00000265316;ENST00000439002	D;D	0.94376	-2.67;-3.41	5.07	2.06	0.26882	5.07	2.06	0.26882	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.770646	0.12487	N	0.464574	D	0.94686	0.8286	M	0.71206	2.165	0.18873	N	0.999982	D;D	0.56746	0.975;0.977	P;P	0.55303	0.663;0.773	D	0.87676	0.2544	10	0.72032	D	0.01	-1.3565	12.0339	0.53415	0.0:0.4794:0.3877:0.1328	.	298;344	Q9NP58-4;Q9NP58	.;ABCB6_HUMAN	W	344;298	ENSP00000265316:R344W;ENSP00000394333:R298W	ENSP00000265316:R344W	R	-	1	2	2	ABCB6	219789087	219789087	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	1.031000	0.30165	0.306000	0.22856	0.650000	0.86243	CGG	0.620017		TCGA-3A-A9J0-01A-11D-A40W-08	0.687	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	1	0	1		2	2	2	0		0	0	10		10	9	1	3.280000	-19.980230	1	0.470000	NM_005689			12	11		63	47	0		1	1		0	0	10	0		0.997207	9.742557e-01	0	6	0	30	0	12	63
COL4A4	1286	broad.mit.edu	37	2	227920747	227920747	+	Missense_Mutation	SNP	C	C	T	rs150979437	byFrequency	TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:227920747C>T	ENST00000396625.3	-	30	2837	c.2630G>A	c.(2629-2631)cGg>cAg	p.R877Q	COL4A4_ENST00000329662.7_Missense_Mutation_p.R877Q	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	877	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGCCCCAGGCCGTCCTGGGAG	0.627													C|||	26	0.00519169	0.0	0.0	5008	,	,		15399	0.0258		0.0	False		,,,				2504	0.0					ENST00000396625.3	1.000000	5.600000e-01			0.830000	0.834406	0.830000	1.000000																										0				98						c.(2629-2631)cGg>cAg		collagen, type IV, alpha 4		C	GLN/ARG	4,3654		0,4,1825	36.0	39.0	39.0		2630	-1.9	0.0	2	dbSNP_134	39	27,8121		0,27,4047	no	missense	COL4A4	NM_000092.4	43	0,31,5872	TT,TC,CC		0.3314,0.1093,0.2626	benign	877/1691	227920747	31,11775	1829	4074	5903	SO:0001583	missense	1286	502	120794	58				g.chr2:227920747C>T		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2630G>A	chr2.hg19:g.227920747C>T	ENSP00000379866:p.Arg877Gln	1					COL4A4_ENST00000329662.7_Missense_Mutation_p.R877Q	p.R877Q	NM_000092.4	NP_000083.3	2	2	4	2.143198	P53420	CO4A4_HUMAN		30	2837	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	1	0	hg19	c.2630G>A	CCDS42828.1	0	224	0.10256410256410256	71	0.1443089430894309	23	0.06353591160220995	44	0.07692307692307693	86	0.11345646437994723	C	3.151	-0.174203	0.06421	0.001093	0.003314	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.93307	-3.2;-3.2	5.63	-1.9	0.07665	5.63	-1.9	0.07665	.	.	.	.	.	T	0.02533	0.0077	N	0.16743	0.435	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.40701	-0.9549	9	0.13470	T	0.59	.	2.2257	0.03983	0.2432:0.4338:0.1032:0.2199	.	877	P53420	CO4A4_HUMAN	Q	877	ENSP00000379866:R877Q;ENSP00000328553:R877Q	ENSP00000328553:R877Q	R	-	2	0	0	COL4A4	227628991	227628991	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.006000	0.13152	-0.756000	0.04703	-0.271000	0.10264	CGG	0.620017		TCGA-3A-A9J0-01A-11D-A40W-08	0.627	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	0	0	1		2	2	2	0		0	0	37		37	35	1	3.280000	-2.989699	1	0.470000	NM_000092			29	29		186	183	1		1	1		0	0	37	0		1.000000	1.453389e-01	0	3	0	2	0	29	186
LRRFIP1	9208	broad.mit.edu	37	2	238671269	238671269	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:238671269A>G	ENST00000392000.4	+	11	1030	c.913A>G	c.(913-915)Aaa>Gaa	p.K305E	LRRFIP1_ENST00000244815.5_Missense_Mutation_p.K281E|LRRFIP1_ENST00000308482.9_Intron|LRRFIP1_ENST00000289175.6_Missense_Mutation_p.K249E	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	305					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		AGTGGAGGTGAAAAATGAAAT	0.433																																						ENST00000392000.4	1.000000	3.000000e-02			0.130000	0.242719	0.130000	0.110000																										0				29						c.(913-915)Aaa>Gaa		leucine rich repeat (in FLII) interacting protein 1							56.0	53.0	54.0					2																	238671269		2203	4300	6503	SO:0001583	missense	9208	1	121412	27				g.chr2:238671269A>G	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.913A>G	chr2.hg19:g.238671269A>G	ENSP00000375857:p.Lys305Glu	1					LRRFIP1_ENST00000244815.5_Missense_Mutation_p.K281E|LRRFIP1_ENST00000289175.6_Missense_Mutation_p.K249E|LRRFIP1_ENST00000308482.9_Intron	p.K305E	NM_001137552.1	NP_001131024.1	2	2	4	2.137730	Q32MZ4	LRRF1_HUMAN		11	1030	+		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000392000.4	0	1	hg19	c.913A>G	CCDS46552.1	0	.	.	.	.	.	.	.	.	.	.	A	18.59	3.655875	0.67586	.	.	ENSG00000124831	ENST00000289175;ENST00000244815;ENST00000392000	T;T;T	0.47528	0.84;0.84;0.84	5.69	0.0731	0.14389	5.69	0.0731	0.14389	.	0.837827	0.10426	N	0.676077	T	0.37785	0.1016	L	0.51422	1.61	0.21445	N	0.999689	B;B;B	0.27882	0.192;0.046;0.1	B;B;B	0.25759	0.063;0.046;0.027	T	0.29640	-1.0005	10	0.45353	T	0.12	-15.096	6.5329	0.22336	0.6466:0.1247:0.2287:0.0	.	249;305;281	Q32MZ4-3;Q32MZ4;Q32MZ4-2	.;LRRF1_HUMAN;.	E	249;281;305	ENSP00000289175:K249E;ENSP00000244815:K281E;ENSP00000375857:K305E	ENSP00000244815:K281E	K	+	1	0	0	LRRFIP1	238336008	238336008	0.972000	0.33761	0.276000	0.24689	0.948000	0.59901	0.407000	0.21049	0.095000	0.17434	0.528000	0.53228	AAA	0.620017		TCGA-3A-A9J0-01A-11D-A40W-08	0.433	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	0	0	1		2	2	2	0		0	0	37		37	37	1	3.280000	-3.118740	1	0.470000	NM_004735			4	4		215	208	0		1	0		0	0	37	0		0.883376	8.366742e-01	0	0	0	179	0	4	215
KIF1A	547	broad.mit.edu	37	2	241697827	241697827	+	Silent	SNP	G	G	A	rs370648599		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:241697827G>A	ENST00000320389.7	-	25	2663	c.2505C>T	c.(2503-2505)acC>acT	p.T835T	KIF1A_ENST00000498729.2_Silent_p.T844T	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	835					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.T835T(1)		NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGTCTCCGCCGGTCACCACGT	0.637																																						ENST00000320389.7	1.000000	3.800000e-01			0.710000	0.735511	0.710000	1.000000																										1	Substitution - coding silent(1)	p.T835T(1)	endometrium(1)	66						c.(2503-2505)acC>acT		kinesin family member 1A		G		1,4319		0,1,2159	59.0	69.0	66.0		2505	-5.2	0.9	2		66	0,8514		0,0,4257	no	coding-synonymous	KIF1A	NM_004321.5		0,1,6416	AA,AG,GG		0.0,0.0231,0.0078		835/1691	241697827	1,12833	2160	4257	6417	SO:0001819	synonymous_variant	547	4	121188	35				g.chr2:241697827G>A	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2505C>T	chr2.hg19:g.241697827G>A		1					KIF1A_ENST00000498729.2_Silent_p.T844T	p.T835T	NM_004321.6	NP_004312.2	2	2	4	2.137730	Q12756	KIF1A_HUMAN		25	2663	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	1	1	hg19	c.2505C>T	CCDS46561.1	0																																																																																								0.620017		TCGA-3A-A9J0-01A-11D-A40W-08	0.637	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	1	0	1		2	2	2	0		0	0	29		29	28	1	3.280000	-18.801000	1	0.470000	NM_138483			12	12		95	89	1		1			0	0	29	0		0.999005	0	0	0	0	0	0	12	95
PASK	23178	broad.mit.edu	37	2	242065640	242065640	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr2:242065640C>T	ENST00000405260.1	-	10	3388	c.2690G>A	c.(2689-2691)aGc>aAc	p.S897N	PASK_ENST00000544142.1_Missense_Mutation_p.S711N|PASK_ENST00000234040.4_Missense_Mutation_p.S897N|PASK_ENST00000358649.4_Missense_Mutation_p.S897N|PASK_ENST00000539818.1_Missense_Mutation_p.S681N|PASK_ENST00000403638.3_Missense_Mutation_p.S897N	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	897					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		ATGGTAGCAGCTCCCGGAGTA	0.647																																						ENST00000405260.1	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				53						c.(2689-2691)aGc>aAc		PAS domain containing serine/threonine kinase							73.0	58.0	63.0					2																	242065640		2203	4300	6503	SO:0001583	missense	23178	0	0					g.chr2:242065640C>T	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.2690G>A	chr2.hg19:g.242065640C>T	ENSP00000384016:p.Ser897Asn	1					PASK_ENST00000403638.3_Missense_Mutation_p.S897N|PASK_ENST00000544142.1_Missense_Mutation_p.S711N|PASK_ENST00000539818.1_Missense_Mutation_p.S681N|PASK_ENST00000358649.4_Missense_Mutation_p.S897N|PASK_ENST00000234040.4_Missense_Mutation_p.S897N	p.S897N	NM_001252120.1	NP_001239049.1	2	2	4	2.137730	Q96RG2	PASK_HUMAN		10	3388	-		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	1	1	hg19	c.2690G>A	CCDS2545.1	1	.	.	.	.	.	.	.	.	.	.	C	8.379	0.837154	0.16891	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.34;-0.37;0.58	4.94	3.07	0.35406	4.94	3.07	0.35406	.	0.267711	0.32357	N	0.006217	T	0.68943	0.3056	L	0.53249	1.67	0.26862	N	0.967935	B;B;B;D;B	0.65815	0.245;0.36;0.2;0.995;0.245	B;B;B;P;B	0.61477	0.052;0.112;0.069;0.889;0.052	T	0.57602	-0.7783	10	0.28530	T	0.3	.	5.2403	0.15467	0.0:0.644:0.1701:0.1859	.	862;711;897;897;897	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	N	897;711;897;897;681;897	ENSP00000234040:S897N;ENSP00000441374:S711N;ENSP00000384016:S897N;ENSP00000351475:S897N;ENSP00000443083:S681N;ENSP00000384438:S897N	ENSP00000234040:S897N	S	-	2	0	0	PASK	241714313	241714313	0.998000	0.40836	0.992000	0.48379	0.111000	0.19643	0.836000	0.27545	1.084000	0.41184	0.561000	0.74099	AGC	0.620017		TCGA-3A-A9J0-01A-11D-A40W-08	0.647	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	1	0	1		2	2	2	0		0	0	39		39	37	1	3.280000	-20.000000	1	0.470000	NM_015148			55	54		129	123	1		1	1		0	0	39	0		1.000000	8.428958e-01	0	3	0	7	0	55	129
MYH15	22989	broad.mit.edu	37	3	108172884	108172884	+	Nonsense_Mutation	SNP	G	G	A	rs201762535		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:108172884G>A	ENST00000273353.3	-	22	2484	c.2428C>T	c.(2428-2430)Cga>Tga	p.R810*	MYH15_ENST00000495753.2_5'Flank	NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	810	IQ.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AATTTGATTCGCATCAGTTTG	0.448																																						ENST00000273353.3	1.000000	5.800000e-01			0.820000	0.826477	0.820000	1.000000																										0				105						c.(2428-2430)Cga>Tga		myosin, heavy chain 15		G	stop/ARG	1,3835		0,1,1917	103.0	95.0	98.0		2428	-4.7	0.0	3		98	1,8283		0,1,4141	yes	stop-gained	MYH15	NM_014981.1		0,2,6058	AA,AG,GG		0.0121,0.0261,0.0165		810/1947	108172884	2,12118	1918	4142	6060	SO:0001587	stop_gained	22989	3	120838	34				g.chr3:108172884G>A	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2428C>T	chr3.hg19:g.108172884G>A	ENSP00000273353:p.Arg810*	1					MYH15_ENST00000495753.2_5'Flank	p.R810*	NM_014981.1	NP_055796.1	2	2	4	2.249909	Q9Y2K3	MYH15_HUMAN		22	2484	-				Nonsense_Mutation	SNP	ENST00000273353.3	0	1	hg19	c.2428C>T	CCDS43127.1	0	.	.	.	.	.	.	.	.	.	.	G	38	6.993775	0.97987	2.61E-4	1.21E-4	ENSG00000144821	ENST00000273353	.	.	.	5.51	-4.68	0.03309	5.51	-4.68	0.03309	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4871	0.16755	0.2937:0.0:0.3652:0.3411	.	.	.	.	X	810	.	ENSP00000273353:R810X	R	-	1	2	2	MYH15	109655574	109655574	0.146000	0.22672	0.000000	0.03702	0.931000	0.56810	-0.349000	0.07731	-0.540000	0.06265	-0.897000	0.02905	CGA	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.448	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	1	0	1		2	2	2	0		0	0	46		46	45	1	3.280000	-15.432470	1	0.470000	XM_036988			34	33		225	225	1		1			0	0	46	0		1.000000	0	0	0	0	0	0	34	225
TBCCD1	55171	broad.mit.edu	37	3	186276243	186276243	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:186276243G>A	ENST00000424280.1	-	3	934	c.455C>T	c.(454-456)tCt>tTt	p.S152F	TBCCD1_ENST00000338733.5_Missense_Mutation_p.S152F|TBCCD1_ENST00000446782.1_Missense_Mutation_p.S56F	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	152					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		CAGGTCAGGAGACTGAGATTT	0.403																																						ENST00000424280.1	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				17						c.(454-456)tCt>tTt		TBCC domain containing 1							143.0	144.0	144.0					3																	186276243		2203	4300	6503	SO:0001583	missense	55171	0	0					g.chr3:186276243G>A	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.455C>T	chr3.hg19:g.186276243G>A	ENSP00000411253:p.Ser152Phe	1					TBCCD1_ENST00000446782.1_Missense_Mutation_p.S56F|TBCCD1_ENST00000338733.5_Missense_Mutation_p.S152F	p.S152F	NM_001134415.1	NP_001127887.1	2	2	4	2.249909	Q9NVR7	TBCC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	3	934	-	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	1	1	hg19	c.455C>T	CCDS3276.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933597	0.73442	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000446782;ENST00000413695;ENST00000430560	T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;0.7	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.207799	0.43747	D	0.000530	T	0.77579	0.4151	M	0.61703	1.905	0.43930	D	0.996586	P;P	0.50819	0.939;0.807	P;B	0.53490	0.727;0.401	T	0.75482	-0.3302	10	0.33940	T	0.23	-19.0802	10.1928	0.43037	0.0911:0.0:0.9089:0.0	.	56;152	G5E9J4;Q9NVR7	.;TBCC1_HUMAN	F	152;152;56;152;136	ENSP00000411253:S152F;ENSP00000341652:S152F;ENSP00000397091:S56F;ENSP00000391109:S152F;ENSP00000407506:S136F	ENSP00000341652:S152F	S	-	2	0	0	TBCCD1	187758937	187758937	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.081000	0.76844	2.607000	0.88179	0.655000	0.94253	TCT	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.403	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	1	0	1		2	2	2	0		0	0	113		113	108	1	3.280000	-20.000000	1	0.470000	NM_018138			197	195		479	469	1		1	1		0	0	113	0		1.000000	9.683370e-01	0	8	0	8	0	197	479
ITPR1	3708	broad.mit.edu	37	3	4718357	4718357	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:4718357C>T	ENST00000443694.2	+	21	2794	c.2794C>T	c.(2794-2796)Cgg>Tgg	p.R932W	ITPR1_ENST00000357086.4_Missense_Mutation_p.R938W|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000423119.2_Missense_Mutation_p.R938W|ITPR1_ENST00000302640.8_Missense_Mutation_p.R932W|ITPR1_ENST00000354582.6_Missense_Mutation_p.R947W|ITPR1_ENST00000456211.2_Missense_Mutation_p.R923W			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	947					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GGTGGTGCTCCGGGGAGGAGG	0.562																																						ENST00000443694.2	1.000000	9.900000e-01			0.990000	0.999850	0.990000	1.000000																										0				106						c.(2794-2796)Cgg>Tgg		inositol 1,4,5-trisphosphate receptor, type 1	Caffeine(DB00201)						74.0	79.0	77.0					3																	4718357		2050	4197	6247	SO:0001583	missense	3708	1	121000	27				g.chr3:4718357C>T	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2794C>T	chr3.hg19:g.4718357C>T	ENSP00000401671:p.Arg932Trp	1					ITPR1_ENST00000354582.6_Missense_Mutation_p.R947W|ITPR1_ENST00000357086.4_Missense_Mutation_p.R938W|ITPR1_ENST00000423119.2_Missense_Mutation_p.R938W|ITPR1_ENST00000456211.2_Missense_Mutation_p.R923W|ITPR1_ENST00000302640.8_Missense_Mutation_p.R932W|ITPR1_ENST00000544951.1_Intron	p.R932W			2	2	4	2.249909	Q14643	ITPR1_HUMAN		21	2794	+			E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	1	1	hg19	c.2794C>T	CCDS54551.1	1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400893	0.62177	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83;-2.83	4.1	3.14	0.36123	4.1	3.14	0.36123	.	0.000000	0.85682	D	0.000000	D	0.91723	0.7383	L	0.47716	1.5	0.80722	D	1	D;D;D	0.76494	0.998;0.997;0.999	P;P;D	0.63283	0.821;0.895;0.913	D	0.91805	0.5455	10	0.72032	D	0.01	.	11.6166	0.51094	0.252:0.748:0.0:0.0	.	932;947;938	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	W	947;932;947;938;938;923;932	ENSP00000306253:R932W;ENSP00000346595:R947W;ENSP00000405934:R938W;ENSP00000349597:R938W;ENSP00000397885:R923W;ENSP00000401671:R932W	ENSP00000306253:R932W	R	+	1	2	2	ITPR1	4693357	4693357	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.115000	0.41921	2.280000	0.76307	0.313000	0.20887	CGG	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.562	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	1	0	1		2	2	2	0		0	0	26		26	24	1	3.280000	-3.960281	1	0.470000	NM_002222			35	34		105	104	1		1	0		0	0	26	0		1.000000	0	0	0	0	1	0	35	105
STAC	6769	broad.mit.edu	37	3	36547239	36547239	+	Splice_Site	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:36547239G>A	ENST00000273183.3	+	8	1133	c.833G>A	c.(832-834)gGa>gAa	p.G278E	STAC_ENST00000457375.2_Splice_Site_p.G217E|STAC_ENST00000476388.1_3'UTR	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	278					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						ctctttcAGGGATCTCTTTCC	0.338																																						ENST00000273183.3	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				32						c.(832-834)gGa>gAa		SH3 and cysteine rich domain							41.0	43.0	42.0					3																	36547239		2203	4296	6499	SO:0001630	splice_region_variant	6769	0	0					g.chr3:36547239G>A	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.832-1G>A	chr3.hg19:g.36547239G>A		1					STAC_ENST00000457375.2_Splice_Site_p.G217E|STAC_ENST00000476388.1_3'UTR	p.G278E	NM_003149.1	NP_003140.1	2	2	4	2.249909	Q99469	STAC_HUMAN		8	1133	+			B2R8S8	Splice_Site	SNP	ENST00000273183.3	1	0	hg19	c.833G>A	CCDS2662.1	1	.	.	.	.	.	.	.	.	.	.	G	8.374	0.835918	0.16820	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687;ENST00000434649	T;T;T	0.75367	-0.93;1.09;1.57	5.21	-0.896	0.10557	5.21	-0.896	0.10557	Src homology-3 domain (1);	0.496999	0.22073	N	0.065008	T	0.48572	0.1507	N	0.24115	0.695	0.39959	D	0.974646	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.44081	-0.9351	10	0.02654	T	1	.	6.0123	0.19582	0.3402:0.1237:0.5361:0.0	.	217;278	E9PEA7;Q99469	.;STAC_HUMAN	E	278;217;210;206	ENSP00000273183:G278E;ENSP00000393713:G217E;ENSP00000398403:G206E	ENSP00000273183:G278E	G	+	2	0	0	STAC	36522243	36522243	0.996000	0.38824	0.975000	0.42487	0.667000	0.39255	0.231000	0.17872	-0.428000	0.07339	-0.145000	0.13849	GGA	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.338	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	1	0	1		2	2	2	0		0	0	23		23	22	1	3.280000	-20.000000	1	0.470000	NM_003149	Missense_Mutation		47	47		104	100	1		1	1		0	0	23	0		1.000000	6.009984e-01	0	3	0	3	0	47	104
DCLK3	85443	broad.mit.edu	37	3	36779648	36779648	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:36779648T>C	ENST00000416516.2	-	2	993	c.503A>G	c.(502-504)aAg>aGg	p.K168R		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	168						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						CATTGGGCCCTTCCCCATATC	0.567																																						ENST00000416516.2	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				48						c.(502-504)aAg>aGg		doublecortin-like kinase 3							112.0	118.0	116.0					3																	36779648		1984	4153	6137	SO:0001583	missense	85443	0	0					g.chr3:36779648T>C	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.503A>G	chr3.hg19:g.36779648T>C	ENSP00000394484:p.Lys168Arg	1						p.K168R	NM_033403.1	NP_208382.1	2	2	4	2.249909	Q9C098	DCLK3_HUMAN		2	993	-				Missense_Mutation	SNP	ENST00000416516.2	1	1	hg19	c.503A>G	CCDS43064.1	1	.	.	.	.	.	.	.	.	.	.	T	5.009	0.187282	0.09547	.	.	ENSG00000163673	ENST00000416516	T	0.67171	-0.25	4.7	-2.05	0.07321	4.7	-2.05	0.07321	.	0.350599	0.17768	N	0.162674	T	0.34832	0.0911	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.23797	-1.0178	10	0.10377	T	0.69	.	6.1062	0.20075	0.2212:0.4608:0.0:0.318	.	168	Q9C098	DCLK3_HUMAN	R	168	ENSP00000394484:K168R	ENSP00000394484:K168R	K	-	2	0	0	DCLK3	36754652	36754652	0.000000	0.05858	0.001000	0.08648	0.834000	0.47266	-0.855000	0.04295	-0.571000	0.06014	0.533000	0.62120	AAG	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.567	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	1	0	1		2	2	2	0		0	0	94		94	88	1	3.280000	-20.000000	1	0.470000	XM_047355			173	168		362	358	1		1			0	0	94	0		1.000000	0	0	0	0	0	0	173	362
CTNNB1	1499	broad.mit.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)	ENST00000349496.5	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000		15		Dom	yes			Dom	yes		3	3p22-p21.3	3p22-p21.3	1499	H, Mis, T	"""catenin (cadherin-associated protein), beta 1"""				"""E, M, O"""	E, M, O	PLAG1		colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma	CTNNB1/PLAG1(60)	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	3893						c.(133-135)Tct>Cct		catenin (cadherin-associated protein), beta 1, 88kDa							84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	0	0		Pilomatrixoma, Familial Clustering of	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	g.chr3:41266136T>C	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	1					CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P	p.S45P	NM_001904.3	NP_001895.1	2	2	4	2.249909	P35222	CTNB1_HUMAN		3	413	+			A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	1	1	hg19	c.133T>C	CCDS2694.1	1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	0	CTNNB1	41241140	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	1	0	1		2	2	2	0		0	0	35		35	35	1	3.280000	-20.000000	1	0.470000	NM_001098210			82	81		174	173	1		1	1		0	0	35	0		1.000000	1	0	201	0	318	0	82	174
ALS2CL	259173	broad.mit.edu	37	3	46728567	46728567	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:46728567C>T	ENST00000318962.4	-	5	523	c.440G>A	c.(439-441)gGc>gAc	p.G147D	ALS2CL_ENST00000415953.1_Missense_Mutation_p.G147D	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	147					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CAGCGATGCGCCCACCGAGCC	0.677																																						ENST00000318962.4	1.000000	9.900000e-01			0.990000	0.997352	0.990000	1.000000																										0				29						c.(439-441)gGc>gAc		ALS2 C-terminal like							37.0	37.0	37.0					3																	46728567		2200	4298	6498	SO:0001583	missense	259173	0	0					g.chr3:46728567C>T	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.440G>A	chr3.hg19:g.46728567C>T	ENSP00000313670:p.Gly147Asp	1					ALS2CL_ENST00000415953.1_Missense_Mutation_p.G147D	p.G147D	NM_147129.3	NP_667340.2	2	2	4	2.249909	Q60I27	AL2CL_HUMAN		5	523	-			Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	1	1	hg19	c.440G>A	CCDS2743.1	1	.	.	.	.	.	.	.	.	.	.	C	9.379	1.072447	0.20147	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.17528	2.27;2.27	4.18	2.22	0.28083	4.18	2.22	0.28083	Dbl homology (DH) domain (1);	0.498524	0.18254	N	0.146852	T	0.10208	0.0250	L	0.29908	0.895	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.18871	-1.0323	10	0.35671	T	0.21	.	3.9061	0.09183	0.0:0.5781:0.2013:0.2207	.	147	Q60I27	AL2CL_HUMAN	D	147	ENSP00000313670:G147D;ENSP00000413223:G147D	ENSP00000313670:G147D	G	-	2	0	0	ALS2CL	46703571	46703571	0.005000	0.15991	0.015000	0.15790	0.001000	0.01503	0.589000	0.23939	1.103000	0.41568	0.591000	0.81541	GGC	0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.677	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	1	0	1		2	2	2	0		0	0	14		14	14	1	3.280000	-20.000000	1	0.470000	NM_147129			14	14		40	38	1		1	1		0	0	14	0		0.999850	9.998274e-01	0	18	0	33	0	14	40
RFC4	5984	broad.mit.edu	37	3	186518951	186518951	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr3:186518951C>T	ENST00000392481.2	-	3	446	c.165G>A	c.(163-165)caG>caA	p.Q55Q	RFC4_ENST00000433496.1_Silent_p.Q55Q|RFC4_ENST00000296273.2_Silent_p.Q55Q	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	55					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CCACTTCTTCCTGGAAAGCAA	0.383																																						ENST00000392481.2	1.000000	8.500000e-01			0.990000	0.979696	0.990000	1.000000																										0				26						c.(163-165)caG>caA		replication factor C (activator 1) 4, 37kDa							119.0	128.0	125.0					3																	186518951		2203	4300	6503	SO:0001819	synonymous_variant	5984	0	0					g.chr3:186518951C>T		CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.165G>A	chr3.hg19:g.186518951C>T		1					RFC4_ENST00000296273.2_Silent_p.Q55Q|RFC4_ENST00000433496.1_Silent_p.Q55Q	p.Q55Q	NM_181573.2	NP_853551.1	2	2	4	2.249909	P35249	RFC4_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	3	446	-	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		B4DM41|D3DNV2|Q6FHX7	Silent	SNP	ENST00000392481.2	1	1	hg19	c.165G>A	CCDS3283.1	1																																																																																								0.638299		TCGA-3A-A9J0-01A-11D-A40W-08	0.383	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344471.1	1	0	1		2	2	2	0		0	0	106		106	103	1	3.280000	-2.851936	1	0.470000	NM_002916			95	94		475	470	1		1	1		0	0	106	0		1.000000	9.998127e-01	0	12	0	52	0	95	475
HSD17B13	345275	broad.mit.edu	37	4	88243945	88243945	+	Missense_Mutation	SNP	A	A	G			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr4:88243945A>G	ENST00000328546.4	-	1	113	c.49T>C	c.(49-51)Tcc>Ccc	p.S17P	HSD17B13_ENST00000302219.6_Missense_Mutation_p.S17P|RP11-529H2.2_ENST00000508163.1_RNA	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	17						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		TCCAAGTAGGAGTAGATGATG	0.468																																						ENST00000328546.4	1.000000	7.400000e-01			0.990000	0.947465	0.990000	1.000000																										0				8						c.(49-51)Tcc>Ccc		hydroxysteroid (17-beta) dehydrogenase 13							79.0	73.0	75.0					4																	88243945		2203	4300	6503	SO:0001583	missense	345275	0	0					g.chr4:88243945A>G		CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.49T>C	chr4.hg19:g.88243945A>G	ENSP00000333300:p.Ser17Pro	1					RP11-529H2.2_ENST00000508163.1_RNA|HSD17B13_ENST00000302219.6_Missense_Mutation_p.S17P	p.S17P	NM_178135.3	NP_835236.2	1	2	3	1.838065	Q7Z5P4	DHB13_HUMAN		1	113	-		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)	A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	ENST00000328546.4	1	1	hg19	c.49T>C	CCDS3618.1	1	.	.	.	.	.	.	.	.	.	.	A	14.50	2.553115	0.45487	.	.	ENSG00000170509	ENST00000302219;ENST00000328546	D;D	0.90133	-2.62;-1.97	4.81	3.6	0.41247	4.81	3.6	0.41247	.	0.194975	0.35436	N	0.003214	D	0.92473	0.7610	M	0.79258	2.445	0.33675	D	0.611372	P;P	0.48503	0.911;0.856	P;P	0.53102	0.718;0.526	D	0.93413	0.6770	10	0.37606	T	0.19	.	11.291	0.49250	0.8469:0.1531:0.0:0.0	.	17;17	Q7Z5P4-2;Q7Z5P4	.;DHB13_HUMAN	P	17	ENSP00000305438:S17P;ENSP00000333300:S17P	ENSP00000305438:S17P	S	-	1	0	0	HSD17B13	88462969	88462969	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.554000	0.53720	0.824000	0.34613	0.477000	0.44152	TCC	0.566728		TCGA-3A-A9J0-01A-11D-A40W-08	0.468	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253052.1	1	0	1		2	2	2	0		0	0	44		44	42	1	3.280000	-20.000000	1	0.470000	NM_178135			42	40		179	177	1		1			0	0	44	0		1.000000	0	0	0	0	0	0	42	179
DCLK2	166614	broad.mit.edu	37	4	151160950	151160950	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr4:151160950G>A	ENST00000296550.7	+	11	2377	c.1623G>A	c.(1621-1623)gcG>gcA	p.A541A	DCLK2_ENST00000506325.1_Silent_p.A540A|DCLK2_ENST00000302176.8_Silent_p.A558A	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	541	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TTGGGCTTGCGACTGTGGTAG	0.458																																					GBM(195;186 2215 13375 16801 37459)	ENST00000296550.7	1.000000	2.100000e-01			0.310000	0.348333	0.310000	0.320000																										0				26						c.(1621-1623)gcG>gcA		doublecortin-like kinase 2							138.0	137.0	138.0					4																	151160950		2203	4300	6503	SO:0001819	synonymous_variant	166614	11	121412	42				g.chr4:151160950G>A	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1623G>A	chr4.hg19:g.151160950G>A		1					DCLK2_ENST00000506325.1_Silent_p.A540A|DCLK2_ENST00000302176.8_Silent_p.A558A	p.A541A	NM_001040260.3	NP_001035350.2	1	2	3	1.838072	Q8N568	DCLK2_HUMAN		11	2377	+	all_hematologic(180;0.151)		C9J5Q9|Q59GC8|Q8N399	Silent	SNP	ENST00000296550.7	1	1	hg19	c.1623G>A	CCDS34076.1	0																																																																																								0.566728		TCGA-3A-A9J0-01A-11D-A40W-08	0.458	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1	1	0	1		2	2	2	0		0	0	95		95	91	1	3.280000	-6.418375	1	0.470000	NM_001040260			27	27		422	419	0		1	0		0	0	95	0		1.000000	4.997810e-02	0	0	0	6	0	27	422
ADAMTS19	171019	broad.mit.edu	37	5	128863477	128863477	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr5:128863477C>T	ENST00000274487.4	+	5	1250	c.1105C>T	c.(1105-1107)Cag>Tag	p.Q369*	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	369	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TCTGAGTGTGCAGGTCAATCT	0.299																																						ENST00000274487.4	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				91						c.(1105-1107)Cag>Tag		ADAM metallopeptidase with thrombospondin type 1 motif, 19							92.0	97.0	96.0					5																	128863477		2203	4300	6503	SO:0001587	stop_gained	171019	0	0					g.chr5:128863477C>T	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1105C>T	chr5.hg19:g.128863477C>T	ENSP00000274487:p.Gln369*	1					CTC-575N7.1_ENST00000503616.1_RNA	p.Q369*	NM_133638.3	NP_598377.3	0	3	3	1.941373	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	5	1250	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)		Nonsense_Mutation	SNP	ENST00000274487.4	0	1	hg19	c.1105C>T	CCDS4146.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.444548	0.96187	.	.	ENSG00000145808	ENST00000274487	.	.	.	4.41	4.41	0.53225	4.41	4.41	0.53225	.	0.085473	0.47455	D	0.000231	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.326	0.90254	0.0:1.0:0.0:0.0	.	.	.	.	X	369	.	.	Q	+	1	0	0	ADAMTS19	128891376	128891376	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.856000	0.48341	2.737000	0.93849	0.563000	0.77884	CAG	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.299	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	1	0	1		2	2	2	0		0	0	63		63	60	1	3.280000	-20.000000	1	0.470000	NM_133638			276	273		220	219	1		1			0	0	63	0		1.000000	0	0	0	0	0	0	276	220
MAP1B	4131	broad.mit.edu	37	5	71494871	71494871	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr5:71494871C>T	ENST00000296755.7	+	5	5987	c.5689C>T	c.(5689-5691)Cgg>Tgg	p.R1897W		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1897					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GAAGACCACCCGGACCTCAGA	0.453																																					Melanoma(17;367 822 11631 31730 47712)	ENST00000296755.7	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				104						c.(5689-5691)Cgg>Tgg		microtubule-associated protein 1B							66.0	71.0	69.0					5																	71494871		2203	4300	6503	SO:0001583	missense	4131	3	121412	36				g.chr5:71494871C>T	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5689C>T	chr5.hg19:g.71494871C>T	ENSP00000296755:p.Arg1897Trp	1						p.R1897W	NM_005909.3	NP_005900.2	0	3	3	1.932771	P46821	MAP1B_HUMAN		5	5987	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	1	1	hg19	c.5689C>T	CCDS4012.1	1	.	.	.	.	.	.	.	.	.	.	C	3.470	-0.108223	0.06924	.	.	ENSG00000131711	ENST00000296755	T	0.03524	3.9	5.52	3.67	0.42095	5.52	3.67	0.42095	.	0.220565	0.30658	N	0.009152	T	0.05044	0.0135	N	0.08118	0	0.09310	N	1	D;D	0.65815	0.995;0.995	P;P	0.56823	0.807;0.714	T	0.31696	-0.9934	10	0.87932	D	0	-2.6404	11.924	0.52808	0.4852:0.5148:0.0:0.0	.	1771;1897	A2BDK6;P46821	.;MAP1B_HUMAN	W	1897	ENSP00000296755:R1897W	ENSP00000296755:R1897W	R	+	1	2	2	MAP1B	71530627	71530627	0.001000	0.12720	0.011000	0.14972	0.113000	0.19764	0.695000	0.25527	0.645000	0.30675	0.551000	0.68910	CGG	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.453	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	1	0	1		2	2	2	0		0	0	60		60	59	1	3.280000	-20.000000	1	0.470000	NM_005909			180	181		120	119	1		1	0		0	0	60	0		1.000000	8.185223e-01	0	0	0	4	0	180	120
MAP1B	4131	broad.mit.edu	37	5	71495084	71495084	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr5:71495084G>A	ENST00000296755.7	+	5	6200	c.5902G>A	c.(5902-5904)Gaa>Aaa	p.E1968K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1968					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CAGCCCCCCCGAAGTGAGTGG	0.478																																					Melanoma(17;367 822 11631 31730 47712)	ENST00000296755.7	1.000000	7.600000e-01			0.930000	0.928299	0.930000	1.000000																										0				104						c.(5902-5904)Gaa>Aaa		microtubule-associated protein 1B							70.0	75.0	73.0					5																	71495084		2203	4300	6503	SO:0001583	missense	4131	0	0					g.chr5:71495084G>A	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5902G>A	chr5.hg19:g.71495084G>A	ENSP00000296755:p.Glu1968Lys	1						p.E1968K	NM_005909.3	NP_005900.2	0	3	3	1.932771	P46821	MAP1B_HUMAN		5	6200	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	1	1	hg19	c.5902G>A	CCDS4012.1	1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840480	0.32513	.	.	ENSG00000131711	ENST00000296755	T	0.03524	3.9	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.436414	0.21672	N	0.070842	T	0.04679	0.0127	N	0.08118	0	0.36942	D	0.892433	D;P	0.58268	0.982;0.512	P;B	0.50825	0.651;0.14	T	0.57791	-0.7750	10	0.49607	T	0.09	-6.4359	16.7322	0.85438	0.0:0.0:1.0:0.0	.	1842;1968	A2BDK6;P46821	.;MAP1B_HUMAN	K	1968	ENSP00000296755:E1968K	ENSP00000296755:E1968K	E	+	1	0	0	MAP1B	71530840	71530840	0.787000	0.28750	0.992000	0.48379	0.246000	0.25737	4.449000	0.60034	2.381000	0.81170	0.551000	0.68910	GAA	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.478	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	1	0	1		2	2	2	0		0	0	69		69	65	1	3.280000	-20.000000	1	0.470000	NM_005909			81	81		372	364	1		1	0		0	0	69	0		1.000000	4.364138e-01	0	0	0	8	0	81	372
PCDHB7	56129	broad.mit.edu	37	5	140552501	140552501	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr5:140552501G>A	ENST00000231137.3	+	1	259	c.85G>A	c.(85-87)Gaa>Aaa	p.E29K		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	29					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCTGGCGCCGAACCGCTTCG	0.517																																						ENST00000231137.3	1.000000	8.400000e-01			0.990000	0.976823	0.990000	1.000000																										0				119						c.(85-87)Gaa>Aaa		protocadherin beta 7							166.0	147.0	153.0					5																	140552501		2203	4300	6503	SO:0001583	missense	56129	1	121412	31				g.chr5:140552501G>A	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.85G>A	chr5.hg19:g.140552501G>A	ENSP00000231137:p.Glu29Lys	1						p.E29K	NM_018940.2	NP_061763.1	0	3	3	1.941373	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	259	+			A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	1	1	hg19	c.85G>A	CCDS4249.1	1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918636	0.33908	.	.	ENSG00000113212	ENST00000231137	T	0.48836	0.8	4.78	4.78	0.61160	4.78	4.78	0.61160	.	.	.	.	.	T	0.57533	0.2060	M	0.88377	2.95	0.22017	N	0.999413	B	0.25312	0.123	B	0.21708	0.036	T	0.54029	-0.8354	9	0.40728	T	0.16	.	16.7421	0.85462	0.0:0.0:1.0:0.0	.	29	Q9Y5E2	PCDB7_HUMAN	K	29	ENSP00000231137:E29K	ENSP00000231137:E29K	E	+	1	0	0	PCDHB7	140532685	140532685	0.877000	0.30153	0.510000	0.27712	0.294000	0.27393	5.150000	0.64869	2.353000	0.79882	0.650000	0.86243	GAA	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.517	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	1	0	1		2	2	2	0		0	0	113		113	112	1	3.280000	-20.000000	1	0.470000	NM_018940			82	80		334	326	1		1	0		0	0	113	0		1.000000	4.897161e-01	0	0	0	8	0	82	334
LAMA4	3910	broad.mit.edu	37	6	112496518	112496518	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:112496518C>T	ENST00000230538.7	-	11	1751	c.1354G>A	c.(1354-1356)Gaa>Aaa	p.E452K	LAMA4_ENST00000522006.1_Missense_Mutation_p.E445K|LAMA4_ENST00000389463.4_Missense_Mutation_p.E445K|LAMA4_ENST00000424408.2_Missense_Mutation_p.E445K	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	452	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CACCTACGTTCGTAAGCCTCA	0.483																																						ENST00000230538.7	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				100						c.(1354-1356)Gaa>Aaa		laminin, alpha 4							139.0	124.0	129.0					6																	112496518		2203	4300	6503	SO:0001583	missense	3910	0	0					g.chr6:112496518C>T		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1354G>A	chr6.hg19:g.112496518C>T	ENSP00000230538:p.Glu452Lys	1					LAMA4_ENST00000522006.1_Missense_Mutation_p.E445K|LAMA4_ENST00000424408.2_Missense_Mutation_p.E445K|LAMA4_ENST00000389463.4_Missense_Mutation_p.E445K	p.E452K	NM_001105206.2	NP_001098676.2	1	2	3	1.945845	Q16363	LAMA4_HUMAN		11	1751	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	1	1	hg19	c.1354G>A	CCDS43491.1	1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694350	0.48202	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	5.91	5.91	0.95273	5.91	5.91	0.95273	Laminin I (1);	0.213635	0.48767	D	0.000165	T	0.12433	0.0302	L	0.47716	1.5	0.80722	D	1	D;D	0.67145	0.996;0.995	P;P	0.58391	0.838;0.749	T	0.10683	-1.0619	10	0.11182	T	0.66	.	18.0694	0.89400	0.0:1.0:0.0:0.0	.	452;445	Q16363;Q16363-2	LAMA4_HUMAN;.	K	452;445;445;445	ENSP00000230538:E452K;ENSP00000429488:E445K;ENSP00000374114:E445K;ENSP00000416470:E445K	ENSP00000230538:E452K	E	-	1	0	0	LAMA4	112603211	112603211	0.981000	0.34729	0.343000	0.25615	0.031000	0.12232	2.957000	0.49137	2.813000	0.96785	0.655000	0.94253	GAA	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.483	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	1	0	1		2	2	2	0		0	0	86		86	84	1	3.280000	-19.999980	1	0.470000	NM_001105206			163	158		233	230	1		1	0		0	0	86	0		1.000000	1	0	0	0	41	0	163	233
IFNGR1	3459	broad.mit.edu	37	6	137524778	137524778	+	Missense_Mutation	SNP	C	C	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:137524778C>A	ENST00000367739.4	-	5	712	c.591G>T	c.(589-591)gaG>gaT	p.E197D	IFNGR1_ENST00000367735.2_3'UTR|IFNGR1_ENST00000543628.1_Missense_Mutation_p.E169D|IFNGR1_ENST00000478333.1_5'Flank	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	197					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	GGCACTGAATCTCGTCACAAT	0.378																																						ENST00000367739.4	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				18						c.(589-591)gaG>gaT		interferon gamma receptor 1	Interferon gamma-1b(DB00033)						109.0	93.0	98.0					6																	137524778		2203	4300	6503	SO:0001583	missense	3459	0	0					g.chr6:137524778C>A		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.591G>T	chr6.hg19:g.137524778C>A	ENSP00000356713:p.Glu197Asp	1					IFNGR1_ENST00000367735.2_3'UTR|IFNGR1_ENST00000478333.1_5'Flank|IFNGR1_ENST00000543628.1_Missense_Mutation_p.E169D	p.E197D	NM_000416.2	NP_000407.1	1	2	3	1.945845	P15260	INGR1_HUMAN		5	712	-	Colorectal(23;0.24)		B4DFT7|E1P587|Q53Y96	Missense_Mutation	SNP	ENST00000367739.4	1	1	hg19	c.591G>T	CCDS5185.1	1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866633	0.32977	.	.	ENSG00000027697	ENST00000367739;ENST00000418947;ENST00000543628;ENST00000458076	T;T;T	0.45276	0.9;0.9;0.9	5.34	-3.11	0.05299	5.34	-3.11	0.05299	Interferon gamma receptor, poxvirus/mammal (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.212273	0.23342	N	0.049224	T	0.13628	0.0330	M	0.71581	2.175	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.14578	0.007;0.011	T	0.18713	-1.0328	10	0.30078	T	0.28	-11.59	2.1319	0.03752	0.1234:0.2775:0.3634:0.2358	.	169;197	F5H5M7;P15260	.;INGR1_HUMAN	D	197;197;169;163	ENSP00000356713:E197D;ENSP00000443282:E169D;ENSP00000389249:E163D	ENSP00000356713:E197D	E	-	3	2	2	IFNGR1	137566471	137566471	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.316000	0.02710	-0.289000	0.09038	-0.305000	0.09177	GAG	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.378	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1	1	0	1		2	2	2	0		0	0	64		64	62	1	3.280000	-20.000000	1	0.470000				86	86		172	171	1		1	1		0	0	64	0		1.000000	1	0	119	0	132	0	86	172
MUC21	394263	broad.mit.edu	37	6	30955236	30955236	+	Silent	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:30955236C>T	ENST00000376296.3	+	2	1525	c.1284C>T	c.(1282-1284)acC>acT	p.T428T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	428	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAGCACAACCTCCAGTGGGG	0.597																																						ENST00000376296.3	0.890000	6.000000e-01			0.740000	0.751034	0.740000	0.750000																										0				42						c.(1282-1284)acC>acT		mucin 21, cell surface associated							133.0	128.0	130.0					6																	30955236		2203	4300	6503	SO:0001819	synonymous_variant	394263	0	0					g.chr6:30955236C>T	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1284C>T	chr6.hg19:g.30955236C>T		1					MUC21_ENST00000486149.2_5'UTR	p.T428T	NM_001010909.2	NP_001010909.2	1	2	3	1.954404	Q5SSG8	MUC21_HUMAN		2	1525	+			B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	1	0	hg19	c.1284C>T	CCDS34388.1	0																																																																																								0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.597	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	1	0	1		2	2	2	0		0	0	128		128	125	1	3.280000	-20.000000	1	0.470000	NM_001010909			91	86		550	530	1		1			0	0	128	0		1.000000	0	0	0	0	0	0	91	550
TNXB	7148	broad.mit.edu	37	6	32063700	32063700	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:32063700C>T	ENST00000479795.1	-	3	2070	c.1930G>A	c.(1930-1932)Ggc>Agc	p.G644S	TNXB_ENST00000375244.3_Missense_Mutation_p.G644S|TNXB_ENST00000375247.2_Missense_Mutation_p.G644S			P22105	TENX_HUMAN	tenascin XB	644	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CAGGTAGGGCCGGTGTAGCCT	0.687																																						ENST00000479795.1	1.000000	8.100000e-01			0.990000	0.984096	0.990000	1.000000																										0				8						c.(1930-1932)Ggc>Agc		tenascin XB							16.0	18.0	17.0					6																	32063700		2119	4216	6335	SO:0001583	missense	7148	2	120958	38				g.chr6:32063700C>T	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.1930G>A	chr6.hg19:g.32063700C>T	ENSP00000418248:p.Gly644Ser	1					TNXB_ENST00000375247.2_Missense_Mutation_p.G644S|TNXB_ENST00000375244.3_Missense_Mutation_p.G644S	p.G644S			1	2	3	1.954404	P22105	TENX_HUMAN		3	2070	-			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000479795.1	1	1	hg19	c.1930G>A		1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673033	0.47781	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;D	0.85013	1.81;1.81;-1.93	4.25	4.25	0.50352	4.25	4.25	0.50352	.	0.000000	0.43416	D	0.000580	D	0.92773	0.7702	M	0.91561	3.22	0.40214	D	0.977668	D	0.89917	1.0	D	0.97110	1.0	D	0.93982	0.7259	10	0.59425	D	0.04	.	15.6045	0.76652	0.0:1.0:0.0:0.0	.	644	P22105-3	.	S	644	ENSP00000364393:G644S;ENSP00000364396:G644S;ENSP00000418248:G644S	ENSP00000364393:G644S	G	-	1	0	0	TNXB	32171678	32171678	.	.	0.189000	0.23252	0.058000	0.15608	.	.	2.198000	0.70561	0.563000	0.77884	GGC	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.687	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	1	0	1		2	2	2	0		0	0	32		32	32	1	3.280000	-20.000000	1	0.470000	NM_019105			24	21		82	79	1		1	0		0	0	32	0		1.000000	5.521577e-02	0	0	0	2	0	24	82
PRSS35	167681	broad.mit.edu	37	6	84233890	84233890	+	Missense_Mutation	SNP	G	G	A	rs541411659		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:84233890G>A	ENST00000369700.3	+	2	907	c.730G>A	c.(730-732)Gaa>Aaa	p.E244K	PRSS35_ENST00000536636.1_Missense_Mutation_p.E244K	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	244	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GAGGATTGCCGAAGGGAGGCC	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16881	0.0		0.0	False		,,,				2504	0.0					ENST00000369700.3	1.000000	7.100000e-01			0.980000	0.938784	0.980000	1.000000																										0				32						c.(730-732)Gaa>Aaa		protease, serine, 35							52.0	61.0	58.0					6																	84233890		2203	4300	6503	SO:0001583	missense	167681	2	121412	32				g.chr6:84233890G>A	BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.730G>A	chr6.hg19:g.84233890G>A	ENSP00000358714:p.Glu244Lys	1					PRSS35_ENST00000536636.1_Missense_Mutation_p.E244K	p.E244K	NM_153362.2	NP_699193.2	1	2	3	1.945845	Q8N3Z0	PRS35_HUMAN		2	907	+		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)	A8K7B3|Q9BQP6	Missense_Mutation	SNP	ENST00000369700.3	1	1	hg19	c.730G>A	CCDS4999.1	1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281627	0.23392	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	T;T	0.43294	0.95;0.95	5.65	4.76	0.60689	5.65	4.76	0.60689	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.988869	0.08242	N	0.975900	T	0.09512	0.0234	N	0.04508	-0.205	0.28907	N	0.892957	B	0.28801	0.223	B	0.16722	0.016	T	0.22312	-1.0220	10	0.17832	T	0.49	-10.6501	16.2336	0.82360	0.0:0.1375:0.8625:0.0	.	244	Q8N3Z0	PRS35_HUMAN	K	244	ENSP00000440870:E244K;ENSP00000358714:E244K	ENSP00000358714:E244K	E	+	1	0	0	PRSS35	84290609	84290609	0.017000	0.18338	0.008000	0.14137	0.110000	0.19582	1.679000	0.37597	1.349000	0.45751	0.462000	0.41574	GAA	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.567	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	1	0	1		2	2	2	0		0	0	33		33	33	1	3.280000	-3.267408	1	0.470000	NM_153362			35	35		152	146	1		1	0		0	0	33	0		1.000000	0	0	0	0	1	0	35	152
EPHA7	2045	broad.mit.edu	37	6	93956606	93956606	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:93956606C>T	ENST00000369303.4	-	15	2814	c.2630G>A	c.(2629-2631)cGt>cAt	p.R877H		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	877	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.R877L(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CCTTTCAGCACGCTCCTTTTG	0.423																																						ENST00000369303.4	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.R877L(1)	lung(1)	112						c.(2629-2631)cGt>cAt		EPH receptor A7							114.0	110.0	111.0					6																	93956606		2203	4300	6503	SO:0001583	missense	2045	4	121412	38				g.chr6:93956606C>T	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2630G>A	chr6.hg19:g.93956606C>T	ENSP00000358309:p.Arg877His	1						p.R877H	NM_004440.3	NP_004431.1	1	2	3	1.945845	Q15375	EPHA7_HUMAN		15	2814	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	1	1	hg19	c.2630G>A	CCDS5031.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.526893	0.96431	.	.	ENSG00000135333	ENST00000369303	T	0.62364	0.03	5.74	5.74	0.90152	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63177	0.2489	N	0.20445	0.575	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.70716	0.97;0.942;0.966	T	0.69213	-0.5204	10	0.87932	D	0	.	19.9265	0.97104	0.0:1.0:0.0:0.0	.	873;872;877	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	H	877	ENSP00000358309:R877H	ENSP00000358309:R877H	R	-	2	0	0	EPHA7	94013327	94013327	1.000000	0.71417	0.870000	0.34147	0.995000	0.86356	7.726000	0.84824	2.723000	0.93209	0.591000	0.81541	CGT	0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.423	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1	1	0	1		2	2	2	0		0	0	64		64	63	1	3.280000	-20.000000	1	0.470000				115	116		241	238	1		1			0	0	64	0		1.000000	0	0	0	0	0	0	115	241
LPA	4018	broad.mit.edu	37	6	161006101	161006101	+	Silent	SNP	C	C	T	rs372776354		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr6:161006101C>T	ENST00000316300.5	-	26	4310	c.4266G>A	c.(4264-4266)agG>agA	p.R1422R	LPA_ENST00000447678.1_Silent_p.R1422R			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3930	Kringle 13. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.R1422S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	ATAATGGGATCCTCCGATGCC	0.443																																						ENST00000316300.5	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.R1422S(1)	lung(1)	107						c.(4264-4266)agG>agA		lipoprotein, Lp(a)	Aminocaproic Acid(DB00513)						210.0	207.0	208.0					6																	161006101		2166	4293	6459	SO:0001819	synonymous_variant	4018	0	0					g.chr6:161006101C>T	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4266G>A	chr6.hg19:g.161006101C>T		1					LPA_ENST00000447678.1_Silent_p.R1422R	p.R1422R			1	2	3	1.945845	P08519	APOA_HUMAN		26	4310	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	1	1	hg19	c.4266G>A	CCDS43523.1	1																																																																																								0.570850		TCGA-3A-A9J0-01A-11D-A40W-08	0.443	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	1	0	1		25	2	2	0		0	1	105		105	103	1	3.280000	-20.000000	1	0.470000	NM_005577			288	285		550	545	1		1			0	0	105	0		1.000000	0	0	0	0	0	0	288	550
OR2A14	135941	broad.mit.edu	37	7	143826573	143826573	+	Missense_Mutation	SNP	C	C	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr7:143826573C>T	ENST00000408899.2	+	1	423	c.368C>T	c.(367-369)gCg>gTg	p.A123V		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					GATCGCTATGCGGACATCTGC	0.493																																						ENST00000408899.2	0.120000	0			0.060000	0.066212	0.060000	0.080000																										0				22						c.(367-369)gCg>gTg		olfactory receptor, family 2, subfamily A, member 14							224.0	221.0	222.0					7																	143826573		2151	4253	6404	SO:0001583	missense	135941	4	121204	35				g.chr7:143826573C>T		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.368C>T	chr7.hg19:g.143826573C>T	ENSP00000386137:p.Ala123Val	1						p.A123V	NM_001001659.1	NP_001001659.1	2	2	4	2.315457	Q96R47	O2A14_HUMAN		1	423	+	Melanoma(164;0.0783)		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	0	1	hg19	c.368C>T	CCDS43672.1	0	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.806132	0.00606	.	.	ENSG00000221938	ENST00000408899	T	0.00402	7.56	4.18	3.02	0.34903	4.18	3.02	0.34903	GPCR, rhodopsin-like superfamily (1);	0.677608	0.11236	N	0.585087	T	0.00073	0.0002	N	0.00121	-2.07	0.22684	N	0.998858	B	0.02656	0.0	B	0.01281	0.0	T	0.23261	-1.0193	10	0.02654	T	1	-8.6728	8.1672	0.31233	0.0:0.099:0.0:0.901	.	123	Q96R47	O2A14_HUMAN	V	123	ENSP00000386137:A123V	ENSP00000386137:A123V	A	+	2	0	0	OR2A14	143457506	143457506	0.128000	0.22383	0.910000	0.35882	0.018000	0.09664	2.090000	0.41682	0.732000	0.32470	-0.415000	0.06103	GCG	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.493	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1	0	0	1		2	2	2	0		0	0	135		135	135	1	3.280000	-1.816548	0	0.470000				7	8		729	721	0		1			0	0	135	0		0.979983	0	0	0	0	0	0	7	729
NUB1	51667	broad.mit.edu	37	7	151072988	151072988	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr7:151072988G>A	ENST00000355851.4	+	13	1527	c.1450G>A	c.(1450-1452)Gac>Aac	p.D484N	NUB1_ENST00000413040.2_Missense_Mutation_p.D494N|NUB1_ENST00000566856.1_Missense_Mutation_p.D470N|WDR86_ENST00000463000.1_5'Flank|NUB1_ENST00000568733.1_Missense_Mutation_p.D508N	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	484					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		TCCTGAAACCGACAACCGTCA	0.493																																						ENST00000355851.4	0.110000	0			0.040000	0.054933	0.040000	0.040000																										0				11						c.(1450-1452)Gac>Aac		negative regulator of ubiquitin-like proteins 1							221.0	219.0	220.0					7																	151072988		1963	4143	6106	SO:0001583	missense	51667	1	120878	36				g.chr7:151072988G>A	AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.1450G>A	chr7.hg19:g.151072988G>A	ENSP00000348110:p.Asp484Asn	1					NUB1_ENST00000568733.1_Missense_Mutation_p.D508N|NUB1_ENST00000413040.2_Missense_Mutation_p.D494N|NUB1_ENST00000566856.1_Missense_Mutation_p.D470N|WDR86_ENST00000463000.1_5'Flank	p.D484N	NM_001243351.1	NP_001230280.1	2	2	4	2.315457	Q9Y5A7	NUB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00569)	13	1527	+			O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	ENST00000355851.4	0	1	hg19	c.1450G>A		0	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.671641	0.00758	.	.	ENSG00000013374	ENST00000413040;ENST00000355851	T	0.42513	0.97	5.29	1.42	0.22433	5.29	1.42	0.22433	UBA-like (1);	0.997169	0.08136	N	0.992432	T	0.13329	0.0323	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30475	-0.9977	10	0.02654	T	1	-13.5194	3.5859	0.07970	0.6533:0.1362:0.0787:0.1318	.	484;470	Q9Y5A7;Q9Y5A7-2	NUB1_HUMAN;.	N	470;484	ENSP00000348110:D484N	ENSP00000348110:D484N	D	+	1	0	0	NUB1	150703921	150703921	0.001000	0.12720	0.000000	0.03702	0.077000	0.17291	1.025000	0.30090	0.109000	0.17891	-1.421000	0.01109	GAC	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.493	NUB1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	148		148	142	1	3.280000	-2.138169	0	0.470000	NM_016118			6	6		756	739	0		1	0		0	0	148	0		0.962387	2.272615e-01	0	0	0	98	0	6	756
GLI3	2737	broad.mit.edu	37	7	42018305	42018305	+	Missense_Mutation	SNP	C	C	T	rs148502119		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr7:42018305C>T	ENST00000395925.3	-	11	1624	c.1540G>A	c.(1540-1542)Gtg>Atg	p.V514M	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	514					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CACCTGCACACGAACTCCTTC	0.443									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				112						c.(1540-1542)Gtg>Atg		GLI family zinc finger 3		C	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	98.0	93.0	95.0		1540	5.8	1.0	7	dbSNP_134	95	0,8600		0,0,4300	yes	missense	GLI3	NM_000168.5	21	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	514/1581	42018305	2,13004	2203	4300	6503	SO:0001583	missense	2737	2	121412	33	Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42018305C>T		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1540G>A	chr7.hg19:g.42018305C>T	ENSP00000379258:p.Val514Met	1					GLI3_ENST00000479210.1_5'UTR	p.V514M	NM_000168.5	NP_000159.3	2	2	4	2.285665	P10071	GLI3_HUMAN		11	1624	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	1	1	hg19	c.1540G>A	CCDS5465.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.177605	0.94846	4.54E-4	0.0	ENSG00000106571	ENST00000395925	D	0.93811	-3.29	5.84	5.84	0.93424	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97564	0.9202	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.66979	0.948	D	0.97919	1.0313	10	0.87932	D	0	.	20.1381	0.98040	0.0:1.0:0.0:0.0	.	514	P10071	GLI3_HUMAN	M	514	ENSP00000379258:V514M	ENSP00000379258:V514M	V	-	1	0	0	GLI3	41984830	41984830	1.000000	0.71417	0.989000	0.46669	0.984000	0.73092	7.770000	0.85390	2.763000	0.94921	0.650000	0.86243	GTG	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.443	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	1	0	1		2	2	2	0		0	0	106		106	104	1	3.280000	-20.000000	1	0.470000	NM_000168			125	124		279	276	1		1	0		0	0	106	0		1.000000	0	0	0	0	1	0	125	279
ADCY1	107	broad.mit.edu	37	7	45699701	45699701	+	Silent	SNP	G	G	A	rs149589767		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr7:45699701G>A	ENST00000297323.7	+	7	1390	c.1368G>A	c.(1366-1368)ccG>ccA	p.P456P	ADCY1_ENST00000432715.1_Silent_p.P231P	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	456			P -> L (in dbSNP:rs12721473).		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AGGTAGAACCGGGTTACGGAC	0.507																																						ENST00000297323.7	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				71						c.(1366-1368)ccG>ccA		adenylate cyclase 1 (brain)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	A		1,4405	2.1+/-5.4	0,1,2202	169.0	151.0	157.0		1368	-11.0	0.0	7	dbSNP_134	157	0,8600		0,0,4300	no	coding-synonymous	ADCY1	NM_021116.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		456/1120	45699701	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	107	2	121412	37				g.chr7:45699701G>A	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1368G>A	chr7.hg19:g.45699701G>A		1					ADCY1_ENST00000432715.1_Silent_p.P231P	p.P456P	NM_021116.2	NP_066939.1	2	2	4	2.285665	Q08828	ADCY1_HUMAN		7	1390	+			A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	1	1	hg19	c.1368G>A	CCDS34631.1	1																																																																																								0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.507	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	0	0	1		13	2	2	1		1	1	124		124	121	1	3.280000	-11.776190	1	0.470000	NM_021116			138	137		286	281	1		1			1	0	124	0		1.000000	0	0	0	0	0	0	138	286
WBSCR17	64409	broad.mit.edu	37	7	71142270	71142270	+	Silent	SNP	G	G	A	rs145007893		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr7:71142270G>A	ENST00000333538.5	+	9	2113	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	493	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TATTGTATCCGTGCCATGGCT	0.537																																						ENST00000333538.5	0.220000	8.000000e-02			0.140000	0.153534	0.140000	0.160000																										0				100						c.(1477-1479)ccG>ccA		Williams-Beuren syndrome chromosome region 17		G		1,4405	2.1+/-5.4	0,1,2202	181.0	180.0	180.0		1479	-7.2	0.8	7	dbSNP_134	180	0,8600		0,0,4300	no	coding-synonymous	WBSCR17	NM_022479.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		493/599	71142270	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64409	3	121412	44				g.chr7:71142270G>A	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1479G>A	chr7.hg19:g.71142270G>A		1					WBSCR17_ENST00000498380.2_3'UTR	p.P493P	NM_022479.1	NP_071924.1	2	2	4	2.285665	Q6IS24	GLTL3_HUMAN		9	2113	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	0	1	hg19	c.1479G>A	CCDS5540.1	0																																																																																								0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.537	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	0	0	1		2	2	2	0		0	0	139		139	136	1	3.280000	-2.623359	1	0.470000	NM_022479			23	23		952	941	0		1	0		0	0	139	0		0.999999	3.635603e-03	0	0	0	4	0	23	952
LMBR1	64327	broad.mit.edu	37	7	156520649	156520649	+	Missense_Mutation	SNP	T	T	C			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr7:156520649T>C	ENST00000353442.5	-	12	1204	c.968A>G	c.(967-969)gAa>gGa	p.E323G	LMBR1_ENST00000354505.4_Missense_Mutation_p.E364G|LMBR1_ENST00000540390.1_Missense_Mutation_p.E302G|LMBR1_ENST00000359422.4_Missense_Mutation_p.E171G	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1	323					embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		CATTGCTGTTTCATCAACCAA	0.363																																						ENST00000353442.5	0.290000	5.000000e-02			0.150000	0.164866	0.150000	0.160000																										0				18						c.(967-969)gAa>gGa		limb development membrane protein 1							76.0	68.0	71.0					7																	156520649		2203	4300	6503	SO:0001583	missense	64327	0	0					g.chr7:156520649T>C	AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.968A>G	chr7.hg19:g.156520649T>C	ENSP00000326604:p.Glu323Gly	1					LMBR1_ENST00000354505.4_Missense_Mutation_p.E364G|LMBR1_ENST00000359422.4_Missense_Mutation_p.E171G|LMBR1_ENST00000540390.1_Missense_Mutation_p.E302G	p.E323G	NM_022458.3	NP_071903.2	2	2	4	2.315457	Q8WVP7	LMBR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	12	1204	-	Ovarian(565;0.218)	all_hematologic(28;0.0592)	A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Missense_Mutation	SNP	ENST00000353442.5	0	1	hg19	c.968A>G	CCDS5945.1	0	.	.	.	.	.	.	.	.	.	.	T	19.26	3.793587	0.70452	.	.	ENSG00000105983	ENST00000353442;ENST00000359422;ENST00000415428;ENST00000354505;ENST00000540390	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	4.66	4.66	0.58398	4.66	4.66	0.58398	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.40423	0.1116	L	0.31752	0.955	0.80722	D	1	D;B;D	0.89917	0.999;0.084;1.0	D;B;D	0.83275	0.995;0.042;0.996	T	0.11275	-1.0594	10	0.18276	T	0.48	-11.8648	13.7733	0.63038	0.0:0.0:0.0:1.0	.	302;364;323	B7Z633;Q8WVP7-3;Q8WVP7	.;.;LMBR1_HUMAN	G	323;171;362;364;302	ENSP00000326604:E323G;ENSP00000352392:E171G;ENSP00000408256:E362G;ENSP00000346500:E364G;ENSP00000445509:E302G	ENSP00000326604:E323G	E	-	2	0	0	LMBR1	156213410	156213410	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.084000	0.76866	1.750000	0.51863	0.383000	0.25322	GAA	0.639456		TCGA-3A-A9J0-01A-11D-A40W-08	0.363	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347939.3	0	0	1		2	2	2	0		0	0	57		57	56	1	3.280000	-3.482006	1	0.470000	NM_022458			7	7		294	292	0		1	0		0	0	57	0		0.980472	4.811309e-02	0	0	0	13	0	7	294
LZTS1	11178	broad.mit.edu	37	8	20107374	20107374	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr8:20107374G>A	ENST00000381569.1	-	4	2007	c.1650C>T	c.(1648-1650)taC>taT	p.Y550Y	LZTS1_ENST00000522290.1_Silent_p.Y491Y|LZTS1_ENST00000265801.6_Silent_p.Y550Y			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	550					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		ACATGGCCACGTAGCTCTGCT	0.627																																						ENST00000381569.1	1.000000	8.300000e-01			0.990000	0.968710	0.990000	1.000000																										0				29						c.(1648-1650)taC>taT		leucine zipper, putative tumor suppressor 1							117.0	117.0	117.0					8																	20107374		2203	4300	6503	SO:0001819	synonymous_variant	11178	2	121410	35				g.chr8:20107374G>A	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1650C>T	chr8.hg19:g.20107374G>A		0					LZTS1_ENST00000265801.6_Silent_p.Y550Y|LZTS1_ENST00000522290.1_Silent_p.Y491Y	p.Y550Y			1	2	3	1.601012	Q9Y250	LZTS1_HUMAN		4	2007	-			D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	1	1	hg19	c.1650C>T	CCDS6015.1	1																																																																																								0.482169		TCGA-3A-A9J0-01A-11D-A40W-08	0.627	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	1	0	1		2	2	2	0		0	0	161		161	155	1	3.280000	-20.000000	1	0.470000	NM_021020			102	100		343	340	0		1	0	1	0	0	161	4		1.000000	5.790849e-01	7.545493e-01	0	7	8	4	102	343
TEK	7010	broad.mit.edu	37	9	27158047	27158047	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr9:27158047G>T	ENST00000380036.4	+	2	713	c.271G>T	c.(271-273)Gaa>Taa	p.E91*	TEK_ENST00000519097.1_Intron|TEK_ENST00000406359.4_Nonsense_Mutation_p.E91*	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	91	Ig-like C2-type 1.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TTGGAAGAGAGAAAAGGCTAG	0.448																																						ENST00000380036.4	1.000000	8.300000e-01			0.990000	0.976859	0.990000	1.000000																										0				15						c.(271-273)Gaa>Taa		TEK tyrosine kinase, endothelial	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)						119.0	115.0	116.0					9																	27158047		2203	4300	6503	SO:0001587	stop_gained	7010	0	0					g.chr9:27158047G>T	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.271G>T	chr9.hg19:g.27158047G>T	ENSP00000369375:p.Glu91*	1					TEK_ENST00000406359.4_Nonsense_Mutation_p.E91*|TEK_ENST00000519097.1_Intron	p.E91*	NM_000459.3	NP_000450	0	2	2	1.594592	Q02763	TIE2_HUMAN		2	713	+		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Nonsense_Mutation	SNP	ENST00000380036.4	0	1	hg19	c.271G>T	CCDS6519.1	1	.	.	.	.	.	.	.	.	.	.	G	38	7.144543	0.98092	.	.	ENSG00000120156	ENST00000380036;ENST00000346448;ENST00000406359	.	.	.	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.000000	0.52532	D	0.000066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	.	.	.	X	91	.	ENSP00000343716:E91X	E	+	1	0	0	TEK	27148047	27148047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.664000	0.74437	2.809000	0.96659	0.655000	0.94253	GAA	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.448	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3	1	0	1		2	2	2	0		0	0	47		47	45	1	3.280000	-20.000000	1	0.470000				62	59		189	186	1		1	0		0	0	47	0		1.000000	6.274315e-02	0	0	0	2	0	62	189
TRPM6	140803	broad.mit.edu	37	9	77376995	77376995	+	Missense_Mutation	SNP	C	C	T	rs199963114		TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr9:77376995C>T	ENST00000360774.1	-	26	4829	c.4592G>A	c.(4591-4593)cGc>cAc	p.R1531H	TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.R1526H|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1526H|TRPM6_ENST00000451710.3_Missense_Mutation_p.R1531H|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1531H	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1531					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CCTGTATCTGCGGAGAGGATT	0.418																																						ENST00000360774.1	1.000000	6.900000e-01			0.880000	0.885130	0.880000	1.000000																										0				126						c.(4591-4593)cGc>cAc		transient receptor potential cation channel, subfamily M, member 6							93.0	92.0	92.0					9																	77376995		2203	4300	6503	SO:0001583	missense	140803	5	121412	39				g.chr9:77376995C>T	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4592G>A	chr9.hg19:g.77376995C>T	ENSP00000354006:p.Arg1531His	1					TRPM6_ENST00000451710.3_Missense_Mutation_p.R1531H|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1531H|TRPM6_ENST00000361255.3_Missense_Mutation_p.R1526H|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1526H	p.R1531H	NM_017662.4	NP_060132.3	0	2	2	1.594592	Q9BX84	TRPM6_HUMAN		26	4829	-			Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	1	1	hg19	c.4592G>A	CCDS6647.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.535|1.535	-0.543353|-0.543353	0.04053|0.04053	.|.	.|.	ENSG00000119121|ENSG00000119121	ENST00000448641|ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449	.|T;T;T;T;T	.|0.54279	.|0.68;0.68;0.68;0.68;0.58	5.33|5.33	-5.55|-5.55	0.02536|0.02536	5.33|5.33	-5.55|-5.55	0.02536|0.02536	.|.	.|1.118960	.|0.06509	.|N	.|0.737619	.|T	.|0.28599	.|0.0708	N|N	0.05383|0.05383	-0.06|-0.06	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.10296	.|0.002;0.003;0.003	.|B;B;B	.|0.06405	.|0.001;0.002;0.002	.|T	.|0.27226	.|-1.0080	.|10	.|0.54805	.|T	.|0.06	.|.	7.9227|7.9227	0.29857|0.29857	0.1046:0.3691:0.0:0.5263|0.1046:0.3691:0.0:0.5263	.|.	.|1531;1526;1526	.|Q9BX84;Q9BX84-3;Q9BX84-2	.|TRPM6_HUMAN;.;.	.|H	-1|1531;1531;1526;1526;1531;1104	.|ENSP00000354006:R1531H;ENSP00000407341:R1531H;ENSP00000396672:R1526H;ENSP00000354962:R1526H;ENSP00000366060:R1531H	.|ENSP00000309693:R1104H	.|R	-|-	.|2	.|0	.|0	TRPM6|TRPM6	76566815|76566815	76566815|76566815	0.085000|0.085000	0.21516|0.21516	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-0.050000|-0.050000	0.11904|0.11904	-1.668000|-1.668000	0.01471|0.01471	-0.290000|-0.290000	0.09829|0.09829	.|CGC	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.418	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	1	0	1		2	2	2	0		0	0	57		57	56	1	3.280000	-3.695870	1	0.470000	NM_017662			56	55		212	212	1		1			0	0	57	0		1.000000	0	0	0	0	0	0	56	212
C9orf89	84270	broad.mit.edu	37	9	95869990	95869990	+	Silent	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chr9:95869990G>A	ENST00000375464.2	+	2	170	c.42G>A	c.(40-42)acG>acA	p.T14T		NM_032310.3	NP_115686.3	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	14	CARD.				negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						TGCAGGACACGCCTTTCCTGA	0.562																																						ENST00000375464.2	1.000000	9.900000e-01			0.990000	1.000000	0.990000	1.000000																										0				7						c.(40-42)acG>acA		chromosome 9 open reading frame 89							96.0	71.0	80.0					9																	95869990		2203	4300	6503	SO:0001819	synonymous_variant	84270	5	121412	37				g.chr9:95869990G>A	AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000375464.2:c.42G>A	chr9.hg19:g.95869990G>A		1						p.T14T	NM_032310.3	NP_115686.3	0	2	2	1.567572	Q96LW7	BINCA_HUMAN		2	170	+			Q5BJH8|Q9BSY2	Silent	SNP	ENST00000375464.2	1	1	hg19	c.42G>A	CCDS6702.2	1																																																																																								0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.562	C9orf89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053128.1	1	0	1		2	2	2	0		0	0	30		30	30	1	3.280000	-20.000000	1	0.470000	NM_032310			50	49		67	65	1		1	1		0	0	30	0		1.000000	1	0	44	0	37	0	50	67
TMEM47	83604	broad.mit.edu	37	X	34657384	34657384	+	Missense_Mutation	SNP	G	G	A			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chrX:34657384G>A	ENST00000275954.3	-	2	605	c.347C>T	c.(346-348)gCg>gTg	p.A116V		NM_031442.3	NP_113630.1	Q9BQJ4	TMM47_HUMAN	transmembrane protein 47	116						cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						AAGCATGACCGCAACAGGTCT	0.443																																						ENST00000275954.3	0.500000	6.000000e-02			0.230000	0.256276	0.230000	0.210000																										0				9						c.(346-348)gCg>gTg		transmembrane protein 47							65.0	53.0	57.0					X																	34657384		2201	4297	6498	SO:0001583	missense	83604	5	120388	33				g.chrX:34657384G>A	AK090917	CCDS14235.1	Xp11.4	2008-02-05	2005-03-21	2005-03-21	ENSG00000147027	ENSG00000147027			18515	protein-coding gene	gene with protein product		300698	"""transmembrane 4 superfamily member 10"""	TM4SF10		11472633	Standard	NM_031442		Approved	BCMP1, DKFZP761J17121, DKFZp564E153	uc004ddh.3	Q9BQJ4	OTTHUMG00000021343	ENST00000275954.3:c.347C>T	chrX.hg19:g.34657384G>A	ENSP00000275954:p.Ala116Val							p.A116V	NM_031442.3	NP_113630.1	0	1	1		Q9BQJ4	TMM47_HUMAN		2	605	-			Q5JR44	Missense_Mutation	SNP	ENST00000275954.3	0	1	hg19	c.347C>T	CCDS14235.1	0	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638349	0.87760	.	.	ENSG00000147027	ENST00000275954	T	0.69926	-0.44	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.81049	0.4742	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82625	-0.0365	10	0.66056	D	0.02	-7.661	17.3961	0.87445	0.0:0.0:1.0:0.0	.	116	Q9BQJ4	TMM47_HUMAN	V	116	ENSP00000275954:A116V	ENSP00000275954:A116V	A	-	2	0	0	TMEM47	34567305	34567305	1.000000	0.71417	0.997000	0.53966	0.862000	0.49288	9.476000	0.97823	2.321000	0.78463	0.538000	0.68166	GCG	0.470000		TCGA-3A-A9J0-01A-11D-A40W-08	0.443	TMEM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056209.1	0	0	0		2	2	2	0		0	0	8		8	8	1	3.280000	-4.892002	1	0.470000	NM_031442			3	2		27	27	0		1	0		0	0	8	0		0.801814	5.883815e-01	0	0	0	17	0	3	27
PCDH11Y	83259	broad.mit.edu	37	Y	4968431	4968431	+	Missense_Mutation	SNP	G	G	C			TCGA-3A-A9J0-01A-11D-A40W-08	TCGA-3A-A9J0-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9a6c492b-d3dc-4d8e-bb91-fef812140b6e	36b866cd-0189-43dc-8ebb-5839e55f48e1	g.chrY:4968431G>C	ENST00000333703.4	+	5	3292	c.2779G>C	c.(2779-2781)Gac>Cac	p.D927H	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.D938H|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.D938H	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	938					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AGTCACACTAGACCTTCCTAT	0.428																																						ENST00000333703.4																																		0				27						c.(2779-2781)Gac>Cac		protocadherin 11 Y-linked																																				SO:0001583	missense	83259	0	0					g.chrY:4968431G>C	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2779G>C	chrY.hg19:g.4968431G>C	ENSP00000330552:p.Asp927His						PCDH11Y_ENST00000215473.6_Missense_Mutation_p.D938H|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.D938H	p.D927H	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1					Q9BZA8	PC11Y_HUMAN		5	3292	+			Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	0	1	hg19	c.2779G>C	CCDS14776.1																																																																																											TCGA-3A-A9J0-01A-11D-A40W-08	0.428	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	1	0	1		2	2	2	0		0	0	45		45	55	1	3.280000	-20.000000	1	0.470000	NM_032973			71	47		86	61	0		1			0	0	45	0		1.000000	0	0	0	0	0	0	71	86
