#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
RASGEF1A	221002	broad.mit.edu	37	10	43701485	43701485	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr10:43701485C>T	ENST00000395809.1	-	2	2586	c.80G>A	c.(79-81)cGt>cAt	p.R27H	RASGEF1A_ENST00000374459.1_Missense_Mutation_p.R35H|RASGEF1A_ENST00000472864.1_5'Flank|RASGEF1A_ENST00000395810.1_Missense_Mutation_p.R27H			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	27					cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.R27H(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						CCCGCCTCCACGCTCCCCCAT	0.637																																						ENST00000395809.1	1.000000	0.700000	1.000000	0.990000	0.990000	0.977917	0.990000	1.000000																										1	Substitution - Missense(1)	p.R27H(1)	prostate(1)	11						c.(79-81)cGt>cAt		RasGEF domain family, member 1A							31.0	34.0	33.0					10																	43701485		2202	4296	6498	SO:0001583	missense	221002	9	121094	38				g.chr10:43701485C>T	AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.80G>A	chr10.hg19:g.43701485C>T	ENSP00000379154:p.Arg27His	0					RASGEF1A_ENST00000374459.1_Missense_Mutation_p.R35H|RASGEF1A_ENST00000395810.1_Missense_Mutation_p.R27H|RASGEF1A_ENST00000472864.1_5'Flank	p.R27H			0	1	1	2.001307	Q8N9B8	RGF1A_HUMAN		2	2586	-			Q8TBF1	Missense_Mutation	SNP	ENST00000395809.1	0	1	hg19	c.80G>A	CCDS7202.2	1	.	.	.	.	.	.	.	.	.	.	c	15.65	2.896724	0.52121	.	.	ENSG00000198915	ENST00000374459;ENST00000395810;ENST00000395809	T;T;T	0.71579	-0.56;-0.58;-0.58	5.49	3.63	0.41609	5.49	3.63	0.41609	.	0.397928	0.18488	N	0.139733	T	0.54775	0.1879	N	0.22421	0.69	0.26555	N	0.973839	B;B	0.10296	0.002;0.003	B;B	0.08055	0.001;0.003	T	0.49606	-0.8922	10	0.45353	T	0.12	.	9.9083	0.41390	0.0:0.7883:0.0:0.2117	.	27;35	Q8N9B8;Q8N9B8-2	RGF1A_HUMAN;.	H	35;27;27	ENSP00000363583:R35H;ENSP00000379155:R27H;ENSP00000379154:R27H	ENSP00000363583:R35H	R	-	2	0	0	RASGEF1A	43021491	43021491	0.769000	0.28531	0.691000	0.30163	0.786000	0.44442	1.601000	0.36773	1.344000	0.45657	-0.119000	0.15052	CGT	0.101600		TCGA-3E-AAAY-01A-11D-A38G-08	0.637	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	0	0	1	2	2	2	2	0	0	0	0	20	20	20	18	1	1.860000	-12.258250	1	0.110000	NM_145313		0	6	5	0	50	49	1		1	0		0	0	20	0	0	0.963922	4.418469e-02	0	0	0	3	0	6	50
RTKN2	219790	broad.mit.edu	37	10	64005797	64005797	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr10:64005797T>C	ENST00000373789.3	-	3	373	c.277A>G	c.(277-279)Aaa>Gaa	p.K93E	RTKN2_ENST00000395260.3_Missense_Mutation_p.K93E|RTKN2_ENST00000395265.1_Missense_Mutation_p.K93E	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	93					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					GTTCGTTCTTTACTTTCAAAT	0.279																																						ENST00000373789.3	1.000000	0.270000	0.850000	0.420000	0.610000	0.636064	0.610000	1.000000																										0				21						c.(277-279)Aaa>Gaa		rhotekin 2							96.0	97.0	96.0					10																	64005797		2202	4296	6498	SO:0001583	missense	219790	0	0					g.chr10:64005797T>C	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.277A>G	chr10.hg19:g.64005797T>C	ENSP00000362894:p.Lys93Glu	0					RTKN2_ENST00000395260.3_Missense_Mutation_p.K93E|RTKN2_ENST00000395265.1_Missense_Mutation_p.K93E	p.K93E	NM_145307.2	NP_660350.2	0	1	1	2.001307	Q8IZC4	RTKN2_HUMAN		3	373	-	Prostate(12;0.0297)|all_hematologic(501;0.215)		Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	1	1	hg19	c.277A>G	CCDS7263.1	0	.	.	.	.	.	.	.	.	.	.	T	4.450	0.083293	0.08533	.	.	ENSG00000182010	ENST00000395265;ENST00000373789;ENST00000395260	T;T;T	0.41758	1.6;1.6;0.99	5.38	1.67	0.24075	5.38	1.67	0.24075	.	0.457220	0.27932	N	0.017279	T	0.28333	0.0700	L	0.48362	1.52	0.19300	N	0.999979	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.002	T	0.20042	-1.0287	10	0.13853	T	0.58	-0.4111	5.9418	0.19198	0.0:0.1462:0.1373:0.7165	.	93;93	Q8IZC4-3;Q8IZC4	.;RTKN2_HUMAN	E	93	ENSP00000378682:K93E;ENSP00000362894:K93E;ENSP00000378678:K93E	ENSP00000362894:K93E	K	-	1	0	0	RTKN2	63675803	63675803	0.949000	0.32298	0.294000	0.24946	0.859000	0.49053	1.602000	0.36783	0.337000	0.23665	0.528000	0.53228	AAA	0.101600		TCGA-3E-AAAY-01A-11D-A38G-08	0.279	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	119	1	1.860000	-9.121509	1	0.110000	NM_145307		0	7	7	0	205	202	0		1	1		0	0	119	0	0	0.980136	9.923676e-02	0	6	0	8	0	7	205
IGF2	3481	broad.mit.edu	37	11	2154783	2154783	+	Silent	SNP	G	G	A	rs373036890		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr11:2154783G>A	ENST00000416167.2	-	3	1436	c.270C>T	c.(268-270)tcC>tcT	p.S90S	IGF2_ENST00000381392.1_Silent_p.S93S|IGF2_ENST00000381395.1_Silent_p.S90S|IGF2_ENST00000418738.2_Silent_p.S90S|IGF2_ENST00000434045.2_Silent_p.S146S|IGF2_ENST00000300632.5_Silent_p.S90S|IGF2_ENST00000381389.1_Silent_p.S90S|IGF2_ENST00000381406.4_Silent_p.S93S|MIR483_ENST00000385070.1_RNA			P01344	IGF2_HUMAN	insulin-like growth factor 2	90	D.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)			central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		CGTCCCTCTCGGACTTGGCGG	0.652																																						ENST00000416167.2	1.000000	0.880000	1.000000	0.990000	0.990000	0.993015	0.990000	1.000000																										0				6						c.(268-270)tcC>tcT		insulin-like growth factor 2			,,	0,4404		0,0,2202	46.0	40.0	42.0		270,270,438	2.2	1.0	11		42	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	IGF2	NM_000612.4,NM_001007139.4,NM_001127598.1	,,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,,	90/181,90/181,146/237	2154783	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	3481	10	121334	37				g.chr11:2154783G>A	M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000416167.2:c.270C>T	chr11.hg19:g.2154783G>A		0					IGF2_ENST00000381389.1_Silent_p.S90S|IGF2_ENST00000381395.1_Silent_p.S90S|IGF2_ENST00000381406.4_Silent_p.S93S|IGF2_ENST00000300632.5_Silent_p.S90S|IGF2_ENST00000418738.2_Silent_p.S90S|IGF2_ENST00000434045.2_Silent_p.S146S|MIR483_ENST00000385070.1_RNA|IGF2_ENST00000381392.1_Silent_p.S93S	p.S90S			1	2	3	2.018697	P01344	IGF2_HUMAN	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	3	1436	-		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	Silent	SNP	ENST00000416167.2	1	1	hg19	c.270C>T	CCDS7728.1	1																																																																																								0.115835		TCGA-3E-AAAY-01A-11D-A38G-08	0.652	IGF2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026053.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	52	1	1.860000	-15.704970	1	0.110000	NM_000612		0	10	9	0	96	91	0		1	0		0	0	55	0	0	0.996416	2.722885e-01	0	0	0	10	0	10	96
INS-IGF2	723961	broad.mit.edu	37	11	2182109	2182109	+	Silent	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr11:2182109G>A	ENST00000397270.1	-	2	151	c.93C>T	c.(91-93)tgC>tgT	p.C31C	INS_ENST00000397262.1_Silent_p.C31C|INS_ENST00000512523.1_Silent_p.C31C|INS_ENST00000250971.3_Silent_p.C31C|INS_ENST00000381330.4_Silent_p.C31C|INS-IGF2_ENST00000481781.1_5'Flank	NM_001042376.2	NP_001035835.1	F8WCM5	INSR2_HUMAN	INS-IGF2 readthrough	31						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	5		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.0832)|Lung(200;0.156)		GGTGTGAGCCGCACAGGTGTT	0.652																																						ENST00000397270.1	1.000000	0.300000	1.000000	0.460000	0.690000	0.708609	0.690000	1.000000																										0				5						c.(91-93)tgC>tgT		INS-IGF2 readthrough							52.0	52.0	52.0					11																	2182109		2200	4299	6499	SO:0001819	synonymous_variant	723961	3	121154	34				g.chr11:2182109G>A	DQ104205	CCDS41598.1	11p15.5	2011-03-23			ENSG00000129965	ENSG00000129965			33527	other	readthrough						16531418	Standard	NM_001042376		Approved		uc001lvm.3	F8WCM5	OTTHUMG00000166213	ENST00000397270.1:c.93C>T	chr11.hg19:g.2182109G>A		0					INS_ENST00000512523.1_Silent_p.C31C|INS_ENST00000250971.3_Silent_p.C31C|INS_ENST00000397262.1_Silent_p.C31C|INS_ENST00000381330.4_Silent_p.C31C|INS-IGF2_ENST00000481781.1_5'Flank	p.C31C	NM_001042376.2	NP_001035835.1	1	2	3	2.018697	F8WCM5	INSR2_HUMAN	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	2	151	-		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Q1WM24	Silent	SNP	ENST00000397270.1	0	1	hg19	c.93C>T	CCDS41598.1	0																																																																																								0.115835		TCGA-3E-AAAY-01A-11D-A38G-08	0.652	INS-IGF2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000388404.1	0	0	1	2	9	2	2	0	0	0	1	95	95	95	93	1	1.860000	-3.066688	1	0.110000	NM_001042376.2		0	7	8	0	194	191	0		0	1		0	0	95	0	0	0.387947	1	0	4	0	7436	0	7	194
PIK3C2A	5286	broad.mit.edu	37	11	17156533	17156533	+	Silent	SNP	T	T	C	rs377262754	byFrequency	TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr11:17156533T>C	ENST00000265970.7	-	10	1940	c.1941A>G	c.(1939-1941)caA>caG	p.Q647Q	PIK3C2A_ENST00000540361.1_Silent_p.Q267Q|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	647					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						CTGCAGTTAATTGGTTTATGC	0.373													T|||	10	0.00199681	0.0	0.0	5008	,	,		18418	0.0		0.0	False		,,,				2504	0.0102					ENST00000265970.7	1.000000	0.870000	1.000000	0.990000	0.990000	0.991727	0.990000	1.000000																										0				58						c.(1939-1941)caA>caG		phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha							124.0	123.0	123.0					11																	17156533		2200	4293	6493	SO:0001819	synonymous_variant	5286	151	121412	54				g.chr11:17156533T>C	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1941A>G	chr11.hg19:g.17156533T>C		0					PIK3C2A_ENST00000540361.1_Silent_p.Q267Q|PIK3C2A_ENST00000531428.1_Intron	p.Q647Q	NM_002645.2	NP_002636.2	1	2	3	2.018697	O00443	P3C2A_HUMAN		10	1940	-			B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	ENST00000265970.7	1	1	hg19	c.1941A>G	CCDS7824.1	1																																																																																								0.115835		TCGA-3E-AAAY-01A-11D-A38G-08	0.373	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	1	0	1	2	2	2	2	0	0	0	0	191	191	191	191	1	1.860000	-8.146276	1	0.110000	NM_002645		0	31	31	0	425	418	0		1	0		0	0	191	0	0	1.000000	4.979723e-03	0	0	0	2	0	31	425
ABTB2	25841	broad.mit.edu	37	11	34218927	34218927	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr11:34218927C>A	ENST00000435224.2	-	3	1613	c.1189G>T	c.(1189-1191)Gag>Tag	p.E397*	ABTB2_ENST00000530814.1_5'UTR|ABTB2_ENST00000298992.2_Nonsense_Mutation_p.E211*	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	397					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TCCATGGACTCCATCTGTGGA	0.632																																						ENST00000435224.2	1.000000	0.410000	1.000000	0.590000	0.820000	0.804304	0.820000	1.000000																										0				25						c.(1189-1191)Gag>Tag		ankyrin repeat and BTB (POZ) domain containing 2							62.0	62.0	62.0					11																	34218927		2202	4298	6500	SO:0001587	stop_gained	25841	0	0					g.chr11:34218927C>A	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1189G>T	chr11.hg19:g.34218927C>A	ENSP00000410157:p.Glu397*	0					ABTB2_ENST00000298992.2_Nonsense_Mutation_p.E211*|ABTB2_ENST00000530814.1_5'UTR	p.E397*	NM_145804.2	NP_665803.2	1	2	3	2.018697	Q8N961	ABTB2_HUMAN		3	1613	-		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Nonsense_Mutation	SNP	ENST00000435224.2	0	1	hg19	c.1189G>T	CCDS7890.2	0	.	.	.	.	.	.	.	.	.	.	C	43	10.292513	0.99377	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	.	.	.	5.6	5.6	0.85130	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.6082	19.6195	0.95650	0.0:1.0:0.0:0.0	.	.	.	.	X	397;211	.	ENSP00000298992:E211X	E	-	1	0	0	ABTB2	34175503	34175503	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.633000	0.89246	0.561000	0.74099	GAG	0.115835		TCGA-3E-AAAY-01A-11D-A38G-08	0.632	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	1	0	1	2	2	2	2	0	0	0	0	113	113	113	112	1	1.860000	-11.684580	1	0.110000	NM_145804		0	10	9	0	226	220	0		1	0		0	0	113	0	0	0.996575	5.233446e-02	0	0	0	8	0	10	226
FAT3	120114	broad.mit.edu	37	11	92577822	92577822	+	Silent	SNP	G	G	A	rs373765265		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr11:92577822G>A	ENST00000298047.6	+	18	11306	c.11289G>A	c.(11287-11289)gcG>gcA	p.A3763A	FAT3_ENST00000533797.1_Silent_p.A98A|FAT3_ENST00000409404.2_Silent_p.A3763A|FAT3_ENST00000525166.1_Silent_p.A3613A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3763					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATTCCCACGCGCTCATGACCT	0.532										TCGA Ovarian(4;0.039)																												ENST00000298047.6	1.000000	0.380000	1.000000	0.660000	0.990000	0.877956	0.990000	1.000000																										0				85						c.(11287-11289)gcG>gcA		FAT atypical cadherin 3							98.0	98.0	98.0					11																	92577822		2145	4242	6387	SO:0001819	synonymous_variant	120114	1	121156	34				g.chr11:92577822G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11289G>A	chr11.hg19:g.92577822G>A		0	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Silent_p.A3613A|FAT3_ENST00000533797.1_Silent_p.A98A|FAT3_ENST00000409404.2_Silent_p.A3763A	p.A3763A			0	1	1	2.007625	Q8TDW7	FAT3_HUMAN		18	11306	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	0	1	hg19	c.11289G>A		1																																																																																								0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.532	FAT3-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.860000	-4.311882	1	0.110000	NM_001008781		0	4	4	0	62	60	0		1			0	0	22	0	0	0.885132	0	0	0	0	0	0	4	62
ROBO3	64221	broad.mit.edu	37	11	124743218	124743218	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr11:124743218G>A	ENST00000397801.1	+	10	1741	c.1549G>A	c.(1549-1551)Ggc>Agc	p.G517S	ROBO3_ENST00000538940.1_Missense_Mutation_p.G495S	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	517	Ig-like C2-type 5.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GATGGACATGGGCTTCTACAG	0.542																																						ENST00000397801.1	1.000000	0.270000	1.000000	0.510000	0.880000	0.800659	0.880000	1.000000																										0				35						c.(1549-1551)Ggc>Agc		roundabout, axon guidance receptor, homolog 3 (Drosophila)							56.0	62.0	60.0					11																	124743218		1969	4154	6123	SO:0001583	missense	64221	0	0					g.chr11:124743218G>A	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1549G>A	chr11.hg19:g.124743218G>A	ENSP00000380903:p.Gly517Ser	0					ROBO3_ENST00000538940.1_Missense_Mutation_p.G495S	p.G517S	NM_022370.3	NP_071765.2	0	1	1	2.007625	Q96MS0	ROBO3_HUMAN		10	1741	+	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		Missense_Mutation	SNP	ENST00000397801.1	0	1	hg19	c.1549G>A	CCDS44755.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186181	0.78789	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.60171	0.21;0.21	4.89	4.89	0.63831	4.89	4.89	0.63831	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.197564	0.25478	N	0.030400	D	0.84696	0.5529	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90158	0.4226	10	0.87932	D	0	.	16.9991	0.86377	0.0:0.0:1.0:0.0	.	517	Q96MS0	ROBO3_HUMAN	S	517;495	ENSP00000380903:G517S;ENSP00000441797:G495S	ENSP00000380903:G517S	G	+	1	0	0	ROBO3	124248428	124248428	1.000000	0.71417	0.107000	0.21349	0.762000	0.43233	8.485000	0.90448	2.548000	0.85928	0.455000	0.32223	GGC	0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.542	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	0	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.860000	-4.236343	1	0.110000	XM_370663		0	3	3	0	59	57	0		1			0	0	25	0	0	0.802062	0	0	0	0	0	0	3	59
SRRM4	84530	broad.mit.edu	37	12	119568524	119568524	+	Missense_Mutation	SNP	G	G	A	rs559217766	byFrequency	TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr12:119568524G>A	ENST00000267260.4	+	8	1044	c.656G>A	c.(655-657)cGa>cAa	p.R219Q	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	219	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						AAGTCCCGCCGAAGGCACTCC	0.657													G|||	3	0.000599042	0.0	0.0014	5008	,	,		12417	0.0		0.002	False		,,,				2504	0.0					ENST00000267260.4	1.000000	0.330000	1.000000	0.580000	0.920000	0.831459	0.920000	1.000000																										0				24						c.(655-657)cGa>cAa		serine/arginine repetitive matrix 4							19.0	24.0	22.0					12																	119568524		1916	4105	6021	SO:0001583	missense	84530	3	120776	30				g.chr12:119568524G>A	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.656G>A	chr12.hg19:g.119568524G>A	ENSP00000267260:p.Arg219Gln	0					SRRM4_ENST00000537597.1_3'UTR	p.R219Q	NM_194286.3	NP_919262.2	0	1	1	2.008853	A7MD48	SRRM4_HUMAN		8	1044	+			A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	0	1	hg19	c.656G>A	CCDS44994.1	1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360937	0.61403	.	.	ENSG00000139767	ENST00000267260	T	0.24723	1.84	5.07	4.18	0.49190	5.07	4.18	0.49190	.	0.282843	0.28403	N	0.015470	T	0.25344	0.0616	L	0.50333	1.59	0.31952	N	0.609555	P	0.48998	0.918	B	0.44278	0.445	T	0.23119	-1.0197	10	0.25751	T	0.34	-2.736	10.6863	0.45846	0.0886:0.0:0.9114:0.0	.	219	A7MD48	SRRM4_HUMAN	Q	219	ENSP00000267260:R219Q	ENSP00000267260:R219Q	R	+	2	0	0	SRRM4	118052907	118052907	0.951000	0.32395	0.966000	0.40874	0.950000	0.60333	1.852000	0.39348	1.135000	0.42183	0.448000	0.29417	CGA	0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.657	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	0	0	0	2	2	2	2	0	0	0	0	42	42	42	41	1	1.860000	-8.032464	1	0.110000	NM_194286		0	4	3	0	74	71	0		1			0	0	42	0	0	0.879395	0	0	0	0	0	0	4	74
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.290000	0.800000	0.420000	0.590000	0.616008	0.590000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	1	1	2.008853	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1	2	2	2	2	0	0	0	0	123	123	123	122	1	1.860000	-3.791404	1	0.110000	NM_033360		581	9	9	7441	271	264	0	1	1	1	1	0	0	123	212	1	0.993740	1.846200e-02	9.930780e-01	2	11	4	256	9	271
KCNH3	23416	broad.mit.edu	37	12	49950199	49950199	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr12:49950199T>C	ENST00000257981.6	+	13	2775	c.2515T>C	c.(2515-2517)Ttc>Ctc	p.F839L	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	839					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CCAGCCCAAGTTCTCTTTCCG	0.622																																						ENST00000257981.6	1.000000	0.380000	0.910000	0.520000	0.700000	0.717593	0.700000	1.000000																										0				36						c.(2515-2517)Ttc>Ctc		potassium voltage-gated channel, subfamily H (eag-related), member 3							110.0	107.0	108.0					12																	49950199		2203	4300	6503	SO:0001583	missense	23416	0	0					g.chr12:49950199T>C	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2515T>C	chr12.hg19:g.49950199T>C	ENSP00000257981:p.Phe839Leu	0					MCRS1_ENST00000547182.1_5'Flank	p.F839L	NM_012284.1	NP_036416.1	0	1	1	2.008853	Q9ULD8	KCNH3_HUMAN		13	2775	+			Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	1	1	hg19	c.2515T>C	CCDS8786.1	0	.	.	.	.	.	.	.	.	.	.	T	32	5.153821	0.94645	.	.	ENSG00000135519	ENST00000257981	D	0.99239	-5.61	6.04	6.04	0.98038	6.04	6.04	0.98038	.	0.000000	0.49305	D	0.000159	D	0.97885	0.9305	N	0.08118	0	0.39148	D	0.962164	P	0.49447	0.924	P	0.57776	0.827	D	0.98971	1.0801	10	0.44086	T	0.13	.	12.9803	0.58559	0.0:0.0:0.0:1.0	.	839	Q9ULD8	KCNH3_HUMAN	L	839	ENSP00000257981:F839L	ENSP00000257981:F839L	F	+	1	0	0	KCNH3	48236466	48236466	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.896000	0.63222	2.317000	0.78254	0.460000	0.39030	TTC	0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.622	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	0	0	1	2	2	2	2	0	0	0	0	141	141	141	137	1	1.860000	-13.217620	1	0.110000	NM_012284		0	12	12	0	299	290	0		1	0		0	0	141	0	0	0.998999	1.682052e-02	0	0	0	5	0	12	299
HPD	3242	broad.mit.edu	37	12	122292622	122292622	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr12:122292622G>A	ENST00000289004.4	-	7	436	c.401C>T	c.(400-402)gCt>gTt	p.A134V	RP11-7M8.2_ENST00000543848.1_RNA|HPD_ENST00000543163.1_Missense_Mutation_p.A95V	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	134					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	CTGCAGCACAGCAAACTTCAC	0.597																																						ENST00000289004.4	0.450000	0.100000	0.350000	0.160000	0.240000	0.263934	0.240000	0.230000																										0				18						c.(400-402)gCt>gTt		4-hydroxyphenylpyruvate dioxygenase	Nitisinone(DB00348)						214.0	182.0	193.0					12																	122292622		2203	4300	6503	SO:0001583	missense	3242	0	0					g.chr12:122292622G>A	BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.401C>T	chr12.hg19:g.122292622G>A	ENSP00000289004:p.Ala134Val	0					HPD_ENST00000543163.1_Missense_Mutation_p.A95V|RP11-7M8.2_ENST00000543848.1_RNA	p.A134V	NM_002150.2	NP_002141	0	1	1	2.008853	P32754	HPPD_HUMAN		7	436	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	ENST00000289004.4	0	1	hg19	c.401C>T	CCDS9224.1	0	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665066	0.67700	.	.	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.65732	-0.17;-0.17	5.29	4.38	0.52667	5.29	4.38	0.52667	.	0.301114	0.35151	N	0.003416	T	0.71702	0.3371	M	0.90425	3.115	0.80722	D	1	B	0.33280	0.405	B	0.37144	0.242	T	0.76599	-0.2900	10	0.87932	D	0	-7.5669	14.9723	0.71243	0.0:0.1435:0.8565:0.0	.	134	P32754	HPPD_HUMAN	V	134;131;95	ENSP00000289004:A134V;ENSP00000441677:A95V	ENSP00000289004:A134V	A	-	2	0	0	HPD	120777005	120777005	1.000000	0.71417	0.987000	0.45799	0.993000	0.82548	9.210000	0.95106	1.203000	0.43233	0.467000	0.42956	GCT	0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.597	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402184.1	0	0	1	2	10	2	2	1	1	1	1	225	225	225	224	1	1.860000	-2.016036	0	0.110000	NM_002150		0	7	7	0	529	525	0		0	0		1	0	225	0	0	0.306196	3.531803e-03	0	0	0	6	0	7	529
IPO5	3843	broad.mit.edu	37	13	98671972	98671972	+	Missense_Mutation	SNP	G	G	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr13:98671972G>T	ENST00000490680.1	+	24	3039	c.2974G>T	c.(2974-2976)Gtc>Ttc	p.V992F	IPO5_ENST00000261574.5_Missense_Mutation_p.V1010F|IPO5_ENST00000539640.1_Missense_Mutation_p.V867F			O00410	IPO5_HUMAN	importin 5	992					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						CGTTGAAGAGGTCCTTCCACA	0.413																																						ENST00000490680.1	1.000000	0.920000	1.000000	0.990000	0.990000	0.995629	0.990000	1.000000																										0				27						c.(2974-2976)Gtc>Ttc		importin 5							149.0	135.0	140.0					13																	98671972		2203	4300	6503	SO:0001583	missense	3843	0	0					g.chr13:98671972G>T	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2974G>T	chr13.hg19:g.98671972G>T	ENSP00000418393:p.Val992Phe	0					IPO5_ENST00000539640.1_Missense_Mutation_p.V867F|IPO5_ENST00000261574.5_Missense_Mutation_p.V1010F	p.V992F			1	2	3	2.054353	O00410	IPO5_HUMAN		24	3039	+			B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	1	1	hg19	c.2974G>T		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.24|13.24	2.176764|2.176764	0.38413|0.38413	.|.	.|.	ENSG00000065150|ENSG00000065150	ENST00000469360|ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	.|T;T;T;T	.|0.16073	.|2.39;2.39;2.39;2.37	5.95|5.95	1.82|1.82	0.25136|0.25136	5.95|5.95	1.82|1.82	0.25136|0.25136	.|.	.|0.289846	.|0.38959	.|N	.|0.001514	T|T	0.29321|0.29321	0.0730|0.0730	M|M	0.80616|0.80616	2.505|2.505	0.58432|0.58432	D|D	0.999997|0.999997	.|P	.|0.36048	.|0.534	.|B	.|0.43916	.|0.436	T|T	0.17349|0.17349	-1.0372|-1.0372	5|10	.|0.87932	.|D	.|0	-19.4383|-19.4383	11.6613|11.6613	0.51347|0.51347	0.2788:0.0:0.7212:0.0|0.2788:0.0:0.7212:0.0	.|.	.|1010	.|O00410-3	.|.	S|F	993|1010;992;992;867	.|ENSP00000261574:V1010F;ENSP00000350219:V992F;ENSP00000418393:V992F;ENSP00000445126:V867F	.|ENSP00000261574:V1010F	R|V	+|+	3|1	2|0	2|0	IPO5|IPO5	97469973|97469973	97469973|97469973	1.000000|1.000000	0.71417|0.71417	0.015000|0.015000	0.15790|0.15790	0.547000|0.547000	0.35210|0.35210	2.700000|2.700000	0.47085|0.47085	0.426000|0.426000	0.26116|0.26116	-0.145000|-0.145000	0.13849|0.13849	AGG|GTC	0.123498		TCGA-3E-AAAY-01A-11D-A38G-08	0.413	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	1	0	1	2	2	2	2	0	0	0	0	197	197	197	197	1	1.860000	-20.000000	1	0.110000	NM_002271		0	32	32	0	424	417	1		1	1		0	0	197	0	0	1.000000	9.994488e-01	0	24	0	128	0	32	424
VPS13C	54832	broad.mit.edu	37	15	62283987	62283987	+	Silent	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr15:62283987C>T	ENST00000261517.5	-	17	1441	c.1368G>A	c.(1366-1368)ggG>ggA	p.G456G	VPS13C_ENST00000395898.3_Silent_p.G413G|VPS13C_ENST00000395896.4_Silent_p.G456G|VPS13C_ENST00000249837.3_Silent_p.G413G	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.G456G(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTAATTTTTGCCCAGACCGAA	0.383																																						ENST00000261517.5	1.000000	0.090000	0.380000	0.150000	0.230000	0.305435	0.230000	0.210000																										1	Substitution - coding silent(1)	p.G456G(1)	prostate(1)	117						c.(1366-1368)ggG>ggA		vacuolar protein sorting 13 homolog C (S. cerevisiae)							125.0	131.0	129.0					15																	62283987		2203	4300	6503	SO:0001819	synonymous_variant	54832	10	121412	43				g.chr15:62283987C>T	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1368G>A	chr15.hg19:g.62283987C>T		0					VPS13C_ENST00000395896.4_Silent_p.G456G|VPS13C_ENST00000395898.3_Silent_p.G413G|VPS13C_ENST00000249837.3_Silent_p.G413G	p.G456G	NM_020821.2	NP_065872.1	1	2	3	2.015703				17	1441	-				Silent	SNP	ENST00000261517.5	0	1	hg19	c.1368G>A	CCDS32257.1	0																																																																																								0.114868		TCGA-3E-AAAY-01A-11D-A38G-08	0.383	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	0	0	1	2	2	2	2	0	0	0	0	272	272	272	267	1	1.860000	-1.761338	0	0.110000	NM_017684		0	6	6	0	508	493	0		1			0	0	272	0	0	0.961595	0	0	0	0	0	0	6	508
MAZ	4150	broad.mit.edu	37	16	29819148	29819148	+	Splice_Site	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr16:29819148C>T	ENST00000322945.6	+	2	1207	c.1042C>T	c.(1042-1044)Cgg>Tgg	p.R348W	AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000566906.2_Intron|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000545521.1_Splice_Site_p.R325W|MAZ_ENST00000568282.1_5'Flank|MAZ_ENST00000569978.1_5'Flank|MAZ_ENST00000562337.1_Intron|MAZ_ENST00000219782.6_Splice_Site_p.R348W|MAZ_ENST00000568544.1_5'Flank|AC009133.20_ENST00000569039.1_RNA|AC009133.15_ENST00000566537.1_RNA	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	348					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						GAGCTTCTCCCGGTGTGCACG	0.701																																					Colon(72;875 1167 15364 30899 37091)	ENST00000322945.6	1.000000	0.780000	1.000000	0.990000	0.990000	0.982998	0.990000	1.000000																										0				10						c.(1042-1044)Cgg>Tgg		MYC-associated zinc finger protein (purine-binding transcription factor)							20.0	22.0	21.0					16																	29819148		2035	4144	6179	SO:0001630	splice_region_variant	4150	0	0					g.chr16:29819148C>T	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1043+1C>T	chr16.hg19:g.29819148C>T		0					MAZ_ENST00000562337.1_Intron|MAZ_ENST00000566906.2_Intron|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000568282.1_5'Flank|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000568544.1_5'Flank|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000545521.1_Splice_Site_p.R325W|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000569978.1_5'Flank|MAZ_ENST00000219782.6_Splice_Site_p.R348W	p.R348W	NM_002383.2	NP_002374.2	0	1	1	2.006578	P56270	MAZ_HUMAN		2	1207	+			A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Splice_Site	SNP	ENST00000322945.6	1	0	hg19	c.1042C>T	CCDS42143.1	1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.603964	0.66445	.	.	ENSG00000103495	ENST00000545521;ENST00000322945;ENST00000219782;ENST00000544343	T;T;T	0.58210	3.17;3.17;0.35	2.69	2.69	0.31865	2.69	2.69	0.31865	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000001	T	0.64907	0.2641	L	0.60067	1.865	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.951;1.0	D;D;P;D	0.91635	0.996;0.999;0.818;0.998	T	0.64050	-0.6498	10	0.38643	T	0.18	-5.0701	11.6094	0.51052	0.0:1.0:0.0:0.0	.	325;113;348;348	C6G496;Q59GP8;P56270;G5E927	.;.;MAZ_HUMAN;.	W	325;348;348;123	ENSP00000443956:R325W;ENSP00000313362:R348W;ENSP00000219782:R348W	ENSP00000219782:R348W	R	+	1	2	2	MAZ	29726649	29726649	0.772000	0.28567	1.000000	0.80357	0.693000	0.40251	0.202000	0.17295	1.459000	0.47892	0.435000	0.28638	CGG	0.103094		TCGA-3E-AAAY-01A-11D-A38G-08	0.701	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.860000	-2.879664	1	0.110000	NM_002383	Missense_Mutation	0	15	15	0	187	184	0		1	1		0	0	79	0	0	0.999878	9.999997e-01	0	73	0	313	0	15	187
COL1A1	1277	broad.mit.edu	37	17	48273541	48273541	+	Missense_Mutation	SNP	C	C	T	rs72645356		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr17:48273541C>T	ENST00000225964.5	-	15	1095	c.977G>A	c.(976-978)gGt>gAt	p.G326D		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	326	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	ACCAGTAGCACCATCATTTCC	0.632			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															ENST00000225964.5	1.000000	0.690000	1.000000	0.990000	0.990000	0.974299	0.990000	1.000000				Dom	yes			Dom	yes		17	17q21.31-q22	17q21.31-q22	1277	T	"""collagen, type I, alpha 1"""	yes	yes	Osteogenesis imperfecta	M	M	PDGFB, USP6		dermatofibrosarcoma protuberans, aneurysmal bone cyst 	COL1A1/PDGFB(429)	0				71	GRCh37	CM070721	COL1A1	M	rs72645356	c.(976-978)gGt>gAt		collagen, type I, alpha 1	Collagenase(DB00048)						39.0	41.0	40.0					17																	48273541		2203	4300	6503	SO:0001583	missense	1277	0	0					g.chr17:48273541C>T	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.977G>A	chr17.hg19:g.48273541C>T	ENSP00000225964:p.Gly326Asp	0						p.G326D	NM_000088.3	NP_000079	1	2	3	2.080272	P02452	CO1A1_HUMAN		15	1095	-			O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	1	1	hg19	c.977G>A	CCDS11561.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334954	0.81801	.	.	ENSG00000108821	ENST00000225964	D	0.99619	-6.28	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	H	0.99130	4.44	0.80722	D	1	D	0.76494	0.999	D	0.97110	1.0	D	0.96436	0.9323	10	0.87932	D	0	.	17.3045	0.87191	0.0:1.0:0.0:0.0	.	326	P02452	CO1A1_HUMAN	D	326	ENSP00000225964:G326D	ENSP00000225964:G326D	G	-	2	0	0	COL1A1	45628540	45628540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.737000	0.84957	2.382000	0.81193	0.650000	0.86243	GGT	0.128690		TCGA-3E-AAAY-01A-11D-A38G-08	0.632	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.860000	-13.394600	1	0.110000			0	9	9	0	119	118	0		1	1		0	0	60	0	0	0.994565	1	0	5	0	2133	0	9	119
TP53	7157	broad.mit.edu	37	17	7577058	7577058	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr17:7577058C>A	ENST00000269305.4	-	8	1069	c.880G>T	c.(880-882)Gag>Tag	p.E294*	TP53_ENST00000359597.4_Nonsense_Mutation_p.E294*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E294*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.E294*|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.E294*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	294	Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E294*(46)|p.E294fs*51(9)|p.K291fs*48(8)|p.0?(8)|p.E294K(3)|p.E294fs*12(3)|p.?(2)|p.E294Q(2)|p.L265_K305del41(1)|p.E294>*(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.R290_P295>X(1)|p.E294fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGCTCCCCTTTCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.710000	0.990000	0.830000	0.930000	0.915232	0.930000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		87	Substitution - Nonsense(46)|Deletion - Frameshift(20)|Whole gene deletion(8)|Substitution - Missense(5)|Insertion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Complex - deletion inframe(1)|Complex - compound substitution(1)	p.E294*(46)|p.E294fs*51(9)|p.K291fs*48(8)|p.0?(8)|p.E294K(3)|p.E294fs*12(3)|p.?(2)|p.E294Q(2)|p.L265_K305del41(1)|p.E294>*(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.R290_P295>X(1)|p.E294fs*11(1)	upper_aerodigestive_tract(17)|lung(14)|large_intestine(10)|breast(7)|urinary_tract(6)|oesophagus(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|stomach(3)|central_nervous_system(2)|skin(2)|salivary_gland(1)|vulva(1)|soft_tissue(1)|endometrium(1)	24185						c.(880-882)Gag>Tag	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						109.0	95.0	100.0					17																	7577058		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577058C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.880G>T	chr17.hg19:g.7577058C>A	ENSP00000269305:p.Glu294*	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.E294*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.E294*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E294*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E294*|TP53_ENST00000413465.2_Intron	p.E294*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.947990	P04637	P53_HUMAN		8	1069	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	0	hg19	c.880G>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.130179	0.94473	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	4.29	0.51040	5.26	4.29	0.51040	.	0.702099	0.13430	N	0.388474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-17.6918	13.5106	0.61511	0.0:0.8337:0.1663:0.0	.	.	.	.	X	294;294;294;294;294;283;162	.	ENSP00000269305:E294X	E	-	1	0	0	TP53	7517783	7517783	0.019000	0.18553	0.006000	0.13384	0.253000	0.25986	1.700000	0.37815	1.441000	0.47550	0.561000	0.74099	GAG	0.058201		TCGA-3E-AAAY-01A-11D-A38G-08	0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	1.860000	-20.000000	1	0.110000	NM_000546		0	18	18	0	159	155	1		1	0	1	0	0	81	749	0	0.999984	8.854256e-01	1	1	77	35	759	18	159
ACE	1636	broad.mit.edu	37	17	61558987	61558987	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr17:61558987T>C	ENST00000290866.4	+	7	1030	c.1006T>C	c.(1006-1008)Tcc>Ccc	p.S336P	ACE_ENST00000584529.1_3'UTR|ACE_ENST00000428043.1_Missense_Mutation_p.S336P|ACE_ENST00000538928.1_Missense_Mutation_p.S336P	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	336	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CCTGGAGCTCTCCCCCATGCC	0.657																																						ENST00000290866.4	0.940000	0.190000	0.770000	0.330000	0.530000	0.556357	0.530000	0.500000																										0				51						c.(1006-1008)Tcc>Ccc		angiotensin I converting enzyme	Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)						48.0	47.0	47.0					17																	61558987		2203	4300	6503	SO:0001583	missense	1636	0	0					g.chr17:61558987T>C	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1006T>C	chr17.hg19:g.61558987T>C	ENSP00000290866:p.Ser336Pro	0					ACE_ENST00000584529.1_3'UTR|ACE_ENST00000428043.1_Missense_Mutation_p.S336P|ACE_ENST00000538928.1_Missense_Mutation_p.S336P	p.S336P	NM_000789.3	NP_000780.1	0	1	1	1.937262	P12821	ACE_HUMAN		7	1030	+			B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	0	1	hg19	c.1006T>C	CCDS11637.1	0	.	.	.	.	.	.	.	.	.	.	t	3.965	-0.009611	0.07727	.	.	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	T;T;T	0.32023	1.47;1.47;1.47	4.48	-4.34	0.03666	4.48	-4.34	0.03666	.	1.422290	0.04337	N	0.353487	T	0.12646	0.0307	N	0.04787	-0.16	0.09310	N	1	P;B;B	0.44006	0.824;0.283;0.008	B;B;B	0.33799	0.17;0.111;0.022	T	0.22800	-1.0206	10	0.30854	T	0.27	-0.4851	10.3367	0.43854	0.0:0.6211:0.1276:0.2513	.	336;336;336	F5H1K1;P12821-2;P12821	.;.;ACE_HUMAN	P	336	ENSP00000439591:S336P;ENSP00000290866:S336P;ENSP00000397593:S336P	ENSP00000290866:S336P	S	+	1	0	0	ACE	58912719	58912719	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.457000	0.06745	-0.775000	0.04584	-0.360000	0.07572	TCC	0.058201		TCGA-3E-AAAY-01A-11D-A38G-08	0.657	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2	0	0	1	2	2	2	2	0	0	0	0	56	56	56	55	1	1.860000	-6.789107	1	0.110000			0	4	4	0	120	118	0		1	0		0	0	56	0	0	0.887743	2.888618e-01	0	0	0	27	0	4	120
ST8SIA5	29906	broad.mit.edu	37	18	44268880	44268880	+	Missense_Mutation	SNP	G	G	C	rs151163620		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr18:44268880G>C	ENST00000315087.7	-	4	974	c.314C>G	c.(313-315)tCt>tGt	p.S105C	ST8SIA5_ENST00000536490.1_Missense_Mutation_p.S74C|ST8SIA5_ENST00000590497.1_Intron|ST8SIA5_ENST00000538168.1_Missense_Mutation_p.S141C	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	105					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						GGACAGAGTAGACCTGCCAGG	0.587																																						ENST00000315087.7	0.970000	0.240000	0.800000	0.390000	0.570000	0.597418	0.570000	1.000000																										0				22						c.(313-315)tCt>tGt		ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5							94.0	81.0	85.0					18																	44268880		2203	4300	6503	SO:0001583	missense	29906	0	0					g.chr18:44268880G>C	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.314C>G	chr18.hg19:g.44268880G>C	ENSP00000321343:p.Ser105Cys	0					ST8SIA5_ENST00000538168.1_Missense_Mutation_p.S141C|ST8SIA5_ENST00000590497.1_Intron|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.S74C	p.S105C	NM_013305.4	NP_037437.2	0	0	0	1.922669	O15466	SIA8E_HUMAN		4	974	-			B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	1	1	hg19	c.314C>G	CCDS11930.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120457	0.77323	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.48201	0.83;0.82;1.44	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.108387	0.64402	D	0.000004	T	0.53867	0.1823	L	0.43152	1.355	0.50313	D	0.999867	P;P;P	0.52577	0.797;0.954;0.832	P;P;P	0.50440	0.641;0.57;0.625	T	0.56306	-0.8001	10	0.66056	D	0.02	.	19.345	0.94359	0.0:0.0:1.0:0.0	.	74;141;105	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	C	105;141;74	ENSP00000321343:S105C;ENSP00000445492:S141C;ENSP00000443683:S74C	ENSP00000321343:S105C	S	-	2	0	0	ST8SIA5	42522878	42522878	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.746000	0.74866	2.578000	0.87016	0.555000	0.69702	TCT	0.061478		TCGA-3E-AAAY-01A-11D-A38G-08	0.587	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	70	1	1.860000	-8.448689	1	0.110000	NM_013305		0	6	6	0	170	163	0		1	0		0	0	73	0	0	0.961220	0	0	0	0	1	0	6	170
ABHD8	79575	broad.mit.edu	37	19	17412369	17412369	+	Silent	SNP	G	G	A	rs546146109		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:17412369G>A	ENST00000247706.3	-	2	296	c.57C>T	c.(55-57)aaC>aaT	p.N19N	MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	19							hydrolase activity (GO:0016787)	p.N19N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						GCCCCACGGCGTTGGGGGGCG	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15365	0.0		0.0	False		,,,				2504	0.0				Ovarian(156;1368 2543 15275 41187)	ENST00000247706.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.997195	0.990000	1.000000																										1	Substitution - coding silent(1)	p.N19N(1)	endometrium(1)	9						c.(55-57)aaC>aaT		abhydrolase domain containing 8							24.0	26.0	25.0					19																	17412369		2175	4219	6394	SO:0001819	synonymous_variant	79575	1	121056	30				g.chr19:17412369G>A	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.57C>T	chr19.hg19:g.17412369G>A		0					MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	p.N19N	NM_024527.4	NP_078803.4	1	2	3	2.035854	Q96I13	ABHD8_HUMAN		2	296	-			Q9HAE9	Silent	SNP	ENST00000247706.3	1	1	hg19	c.57C>T	CCDS12355.1	1																																																																																								0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.652	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.860000	-18.323130	1	0.110000	NM_024527		0	12	12	0	109	105	0		1	1		0	0	68	0	0	0.999112	7.953371e-01	0	3	0	26	0	12	109
PDE4C	5143	broad.mit.edu	37	19	18331091	18331091	+	Silent	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:18331091G>A	ENST00000355502.3	-	11	1618	c.747C>T	c.(745-747)tcC>tcT	p.S249S	PDE4C_ENST00000539010.1_Silent_p.S18S|PDE4C_ENST00000597297.1_Silent_p.S19S|PDE4C_ENST00000594465.3_Silent_p.S249S|PDE4C_ENST00000262805.12_Silent_p.S217S|PDE4C_ENST00000598111.2_Silent_p.S19S|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000447275.3_Silent_p.S143S|PDE4C_ENST00000594617.3_Silent_p.S249S			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	249					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGCTGGTTTCGGACAGGTGGG	0.597																																						ENST00000355502.3	1.000000	0.090000	0.430000	0.150000	0.230000	0.341232	0.230000	0.200000																										0				33						c.(745-747)tcC>tcT		phosphodiesterase 4C, cAMP-specific	Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)						96.0	101.0	99.0					19																	18331091		2203	4300	6503	SO:0001819	synonymous_variant	5143	9	121412	44				g.chr19:18331091G>A		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.747C>T	chr19.hg19:g.18331091G>A		0					PDE4C_ENST00000262805.12_Silent_p.S217S|PDE4C_ENST00000597297.1_Silent_p.S19S|PDE4C_ENST00000447275.3_Silent_p.S143S|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000594617.3_Silent_p.S249S|PDE4C_ENST00000598111.2_Silent_p.S19S|PDE4C_ENST00000594465.3_Silent_p.S249S|PDE4C_ENST00000539010.1_Silent_p.S18S	p.S249S			1	2	3	2.035854	Q08493	PDE4C_HUMAN		11	1618	-			B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	ENST00000355502.3	0	1	hg19	c.747C>T	CCDS12373.1	0																																																																																								0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.597	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1	0	0	1	2	2	2	2	0	0	0	0	268	268	268	262	1	1.860000	-2.172914	0	0.110000			0	7	8	0	625	610	0		1	0		0	0	268	0	0	0.978839	0	0	0	0	1	0	7	625
SIGLEC7	27036	broad.mit.edu	37	19	51647799	51647799	+	Silent	SNP	C	C	G			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:51647799C>G	ENST00000317643.6	+	2	639	c.570C>G	c.(568-570)tcC>tcG	p.S190S	SIGLEC7_ENST00000600577.1_Intron|SIGLEC7_ENST00000305628.7_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	190	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CCTCTGTGTCCCCCCTGCACC	0.662																																						ENST00000317643.6	1.000000	0.590000	1.000000	0.760000	0.970000	0.906669	0.970000	1.000000																										0				29						c.(568-570)tcC>tcG		sialic acid binding Ig-like lectin 7							87.0	86.0	87.0					19																	51647799		2203	4300	6503	SO:0001819	synonymous_variant	27036	0	0					g.chr19:51647799C>G	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.570C>G	chr19.hg19:g.51647799C>G		0					SIGLEC7_ENST00000600577.1_Intron|SIGLEC7_ENST00000305628.7_Intron	p.S190S	NM_014385.2	NP_055200.1	1	2	3	2.035854	Q9Y286	SIGL7_HUMAN		2	639	+		all_neural(266;0.0199)	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	1	1	hg19	c.570C>G	CCDS12826.1	1																																																																																								0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.662	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	1	0	1	2	2	2	2	0	0	0	0	167	167	167	164	1	1.860000	-3.302928	1	0.110000	NM_016543		0	20	20	0	377	373	0		1	0		0	0	167	0	0	0.999995	8.352146e-03	0	0	0	3	0	20	377
ZNF613	79898	broad.mit.edu	37	19	52448449	52448449	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:52448449G>A	ENST00000293471.6	+	6	1992	c.1313G>A	c.(1312-1314)aGc>aAc	p.S438N	ZNF613_ENST00000391794.4_Missense_Mutation_p.S402N|ZNF613_ENST00000601794.1_3'UTR	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		AAAGGCTTCAGCCAGAAGACA	0.443																																						ENST00000293471.6	1.000000	0.940000	1.000000	0.990000	0.990000	0.996304	0.990000	1.000000																										0				19						c.(1312-1314)aGc>aAc		zinc finger protein 613							83.0	77.0	79.0					19																	52448449		2203	4300	6503	SO:0001583	missense	79898	0	0					g.chr19:52448449G>A	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1313G>A	chr19.hg19:g.52448449G>A	ENSP00000293471:p.Ser438Asn	0					ZNF613_ENST00000391794.4_Missense_Mutation_p.S402N|ZNF613_ENST00000601794.1_3'UTR	p.S438N	NM_001031721.3	NP_001026891.2	1	2	3	2.035854	Q6PF04	ZN613_HUMAN		6	1992	+		all_neural(266;0.117)	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	1	1	hg19	c.1313G>A	CCDS33089.1	1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238490	0.58886	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.19394	2.15;2.15	3.36	2.31	0.28768	3.36	2.31	0.28768	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.331298	0.22091	N	0.064756	T	0.25901	0.0631	L	0.35854	1.095	0.20764	N	0.99985	D	0.63046	0.992	P	0.59288	0.855	T	0.03043	-1.1079	10	0.59425	D	0.04	.	6.1129	0.20110	0.1094:0.1914:0.6992:0.0	.	438	Q6PF04	ZN613_HUMAN	N	438;402;112	ENSP00000293471:S438N;ENSP00000375671:S402N	ENSP00000293471:S438N	S	+	2	0	0	ZNF613	57140261	57140261	0.000000	0.05858	0.970000	0.41538	0.981000	0.71138	-0.130000	0.10498	0.756000	0.33013	0.655000	0.94253	AGC	0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.443	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	1	0	1	2	2	2	2	0	0	0	0	170	170	170	168	1	1.860000	-7.921733	1	0.110000	NM_024840		0	26	26	0	321	315	0		1	0		0	0	170	0	0	1.000000	4.332782e-01	0	1	0	18	0	26	321
RETN	56729	broad.mit.edu	37	19	7735211	7735211	+	Silent	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:7735211G>A	ENST00000221515.2	+	4	391	c.303G>A	c.(301-303)gcG>gcA	p.A101A	RETN_ENST00000381324.2_Silent_p.A75A	NM_001193374.1|NM_020415.3	NP_001180303.1|NP_065148.1	Q9HD89	RETN_HUMAN	resistin	101					aging (GO:0007568)|fat cell differentiation (GO:0045444)|negative regulation of feeding behavior (GO:2000252)|positive regulation of collagen metabolic process (GO:0010714)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				ovary(1)	1						GGACCGGAGCGCGCTGCTGTC	0.706																																						ENST00000221515.2	1.000000	0.550000	1.000000	0.950000	0.990000	0.957854	0.990000	1.000000																										0				1						c.(301-303)gcG>gcA		resistin							7.0	7.0	7.0					19																	7735211		2151	4211	6362	SO:0001819	synonymous_variant	56729	0	0					g.chr19:7735211G>A	AF205952	CCDS12182.1	19p13.2	2008-02-05				ENSG00000104918			20389	protein-coding gene	gene with protein product		605565				12050208	Standard	NM_020415		Approved	FIZZ3, ADSF, RETN1	uc002mhf.1	Q9HD89		ENST00000221515.2:c.303G>A	chr19.hg19:g.7735211G>A		0					RETN_ENST00000381324.2_Silent_p.A75A	p.A101A	NM_001193374.1|NM_020415.3	NP_001180303.1|NP_065148.1	1	2	3	2.035854	Q9HD89	RETN_HUMAN		4	391	+			D6W649|Q540D9|Q76B53	Silent	SNP	ENST00000221515.2	0	1	hg19	c.303G>A	CCDS12182.1	1																																																																																								0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.706	RETN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461731.1	0	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.860000	-9.713918	1	0.110000	NM_020415		0	4	4	0	43	41	0		1	0		0	0	16	0	0	0.882813	9.253838e-02	0	0	0	5	0	4	43
OR7G2	390882	broad.mit.edu	37	19	9213690	9213690	+	Missense_Mutation	SNP	G	G	A	rs371388820	byFrequency	TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:9213690G>A	ENST00000305456.2	-	1	292	c.293C>T	c.(292-294)aCg>aTg	p.T98M		NM_001005193.1	NP_001005193.1	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G, member 2	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|skin(3)	16						CTTTGGGATCGTGGTTGTGCT	0.488													-|||	3	0.000599042	0.0	0.0	5008	,	,		21260	0.001		0.0	False		,,,				2504	0.002				Esophageal Squamous(67;143 1448 28637 40648)	ENST00000305456.2	1.000000	0.720000	1.000000	0.890000	0.990000	0.962532	0.990000	1.000000																										0				16						c.(292-294)aCg>aTg		olfactory receptor, family 7, subfamily G, member 2		G	MET/THR	0,4406		0,0,2203	148.0	139.0	142.0		293	3.2	0.5	19		142	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR7G2	NM_001005193.1	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	98/346	9213690	1,13005	2203	4300	6503	SO:0001583	missense	390882	8	121412	43				g.chr19:9213690G>A		CCDS32897.1	19p13.2	2013-09-24			ENSG00000170923	ENSG00000170923		"""GPCR / Class A : Olfactory receptors"""	8466	protein-coding gene	gene with protein product							Standard	NM_001005193		Approved	OST260	uc010xkk.2	Q8NG99	OTTHUMG00000179931	ENST00000305456.2:c.293C>T	chr19.hg19:g.9213690G>A	ENSP00000303822:p.Thr98Met	0						p.T98M	NM_001005193.1	NP_001005193.1	1	2	3	2.035854	Q8NG99	OR7G2_HUMAN		1	292	-			Q6IFJ4|Q96RA0	Missense_Mutation	SNP	ENST00000305456.2	1	1	hg19	c.293C>T	CCDS32897.1	1	.	.	.	.	.	.	.	.	.	.	g	4.837	0.155672	0.09236	0.0	1.16E-4	ENSG00000170923	ENST00000305456	T	0.00882	5.58	3.2	3.2	0.36748	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.201904	0.23891	N	0.043541	T	0.01870	0.0059	M	0.87900	2.915	0.09310	N	1	P	0.49961	0.93	B	0.39379	0.298	T	0.41288	-0.9517	10	0.62326	D	0.03	.	8.3321	0.32193	0.1159:0.0:0.8841:0.0	.	77	Q8NG99	OR7G2_HUMAN	M	98	ENSP00000303822:T98M	ENSP00000303822:T98M	T	-	2	0	0	OR7G2	9074690	9074690	0.000000	0.05858	0.524000	0.27887	0.008000	0.06430	-0.287000	0.08388	2.145000	0.66743	0.494000	0.49563	ACG	0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.488	OR7G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448994.1	1	0	1	2	2	2	2	0	0	0	0	169	169	169	168	1	1.860000	-5.977114	1	0.110000			0	25	23	0	405	394	0		1			0	0	169	0	0	1.000000	0	0	0	0	0	0	25	405
NLRP2	55655	broad.mit.edu	37	19	55501405	55501405	+	Silent	SNP	C	C	T	rs148932752		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr19:55501405C>T	ENST00000543010.1	+	9	2525	c.2382C>T	c.(2380-2382)tcC>tcT	p.S794S	NLRP2_ENST00000448584.2_Silent_p.S794S|NLRP2_ENST00000538819.1_Silent_p.S770S|NLRP2_ENST00000537859.1_Silent_p.S772S|NLRP2_ENST00000263437.6_Silent_p.S791S|NLRP2_ENST00000427260.2_Silent_p.S771S|NLRP2_ENST00000339757.7_Silent_p.S772S|NLRP2_ENST00000391721.4_Silent_p.S770S	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	794					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGTCTTGTTCCGCTACCACTC	0.512																																						ENST00000543010.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.997975	0.990000	1.000000																										0				11						c.(2380-2382)tcC>tcT		NLR family, pyrin domain containing 2		C	,,,	1,4405	2.1+/-5.4	0,1,2202	112.0	99.0	103.0		2382,2316,2313,2382	-5.0	0.0	19	dbSNP_134	103	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NLRP2	NM_001174081.1,NM_001174082.1,NM_001174083.1,NM_017852.3	,,,	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	,,,	794/1063,772/1041,771/1040,794/1063	55501405	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	55655	8	121412	42				g.chr19:55501405C>T	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2382C>T	chr19.hg19:g.55501405C>T		0					NLRP2_ENST00000448584.2_Silent_p.S794S|NLRP2_ENST00000263437.6_Silent_p.S791S|NLRP2_ENST00000339757.7_Silent_p.S772S|NLRP2_ENST00000537859.1_Silent_p.S772S|NLRP2_ENST00000538819.1_Silent_p.S770S|NLRP2_ENST00000427260.2_Silent_p.S771S|NLRP2_ENST00000391721.4_Silent_p.S770S	p.S794S	NM_001174081.1	NP_001167552.1	1	2	3	2.035854	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	9	2525	+			B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	ENST00000543010.1	1	1	hg19	c.2382C>T	CCDS12913.1	1																																																																																								0.119204		TCGA-3E-AAAY-01A-11D-A38G-08	0.512	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	1	0	1	2	2	2	2	0	0	0	0	139	139	139	139	1	1.860000	-2.690404	1	0.110000	NM_017852		0	23	22	0	259	252	0		1	0		0	0	139	0	0	0.999999	7.361060e-03	0	0	0	2	0	23	259
PRDM16	63976	broad.mit.edu	37	1	3331138	3331138	+	Missense_Mutation	SNP	G	G	A	rs184929979		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr1:3331138G>A	ENST00000270722.5	+	10	2667	c.2618G>A	c.(2617-2619)cGg>cAg	p.R873Q	PRDM16_ENST00000378398.3_Missense_Mutation_p.R873Q|PRDM16_ENST00000378391.2_Missense_Mutation_p.R873Q|PRDM16_ENST00000442529.2_Missense_Mutation_p.R872Q|PRDM16_ENST00000441472.2_Missense_Mutation_p.R872Q|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000514189.1_Missense_Mutation_p.R873Q|PRDM16_ENST00000511072.1_Missense_Mutation_p.R874Q			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	873	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GTAGAAAAGCGGAAGGTCACA	0.687			T	EVI1	"""MDS, AML"""								G|||	1	0.000199681	0.0	0.0014	5008	,	,		13232	0.0		0.0	False		,,,				2504	0.0					ENST00000270722.5	1.000000	0.280000	1.000000	0.490000	0.790000	0.766090	0.790000	1.000000				Dom	yes			Dom	yes		1	1p36.23-p33	1p36.23-p33	63976	T	PR domain containing 16				L	L	EVI1		MDS, AML		0				59						c.(2617-2619)cGg>cAg		PR domain containing 16							45.0	57.0	53.0					1																	3331138		1953	4136	6089	SO:0001583	missense	63976	5	120878	34				g.chr1:3331138G>A	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2618G>A	chr1.hg19:g.3331138G>A	ENSP00000270722:p.Arg873Gln	0					PRDM16_ENST00000511072.1_Missense_Mutation_p.R874Q|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000514189.1_Missense_Mutation_p.R873Q|PRDM16_ENST00000378391.2_Missense_Mutation_p.R873Q|PRDM16_ENST00000378398.3_Missense_Mutation_p.R873Q|PRDM16_ENST00000441472.2_Missense_Mutation_p.R872Q|PRDM16_ENST00000442529.2_Missense_Mutation_p.R872Q	p.R873Q			0	1	1	2.015160	Q9HAZ2	PRD16_HUMAN		10	2667	+	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	0	1	hg19	c.2618G>A	CCDS41236.2	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	35	5.594815	0.96602	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.06608	3.35;3.32;3.33;3.33;3.37;3.32;3.39;3.34;3.28	4.94	4.94	0.65067	4.94	4.94	0.65067	.	0.000000	0.46758	D	0.000277	T	0.23330	0.0564	M	0.64404	1.975	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;P	0.79108	0.992;0.955;0.965;0.903	T	0.00498	-1.1704	10	0.46703	T	0.11	.	18.1398	0.89636	0.0:0.0:1.0:0.0	.	873;873;872;872	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	Q	874;873;872;872;873;873;873;689;689;681	ENSP00000426975:R874Q;ENSP00000367651:R873Q;ENSP00000407968:R872Q;ENSP00000405253:R872Q;ENSP00000367643:R873Q;ENSP00000421400:R873Q;ENSP00000270722:R873Q;ENSP00000422504:R689Q;ENSP00000425796:R681Q	ENSP00000270722:R873Q	R	+	2	0	0	PRDM16	3320998	3320998	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.341000	0.97041	2.281000	0.76405	0.511000	0.50034	CGG	0.105078		TCGA-3E-AAAY-01A-11D-A38G-08	0.687	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	1	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.860000	-7.179940	1	0.110000	NM_022114		0	4	4	0	90	87	0		1	0		0	0	43	0	0	0.884144	6.798549e-02	0	1	0	7	0	4	90
HP1BP3	50809	broad.mit.edu	37	1	21071440	21071440	+	Silent	SNP	C	C	T	rs144814158		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr1:21071440C>T	ENST00000312239.5	-	13	1651	c.1512G>A	c.(1510-1512)acG>acA	p.T504T	HP1BP3_ENST00000375003.2_Silent_p.T352T|RP5-930J4.4_ENST00000413451.1_RNA	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	504	Lys-rich.				nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TCTTGGCAGGCGTTTTGGCCT	0.527																																						ENST00000312239.5	1.000000	0.350000	0.920000	0.490000	0.660000	0.687256	0.660000	1.000000																										0				16						c.(1510-1512)acG>acA		heterochromatin protein 1, binding protein 3		C		0,4406		0,0,2203	123.0	115.0	118.0		1512	-0.9	1.0	1	dbSNP_134	118	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	HP1BP3	NM_016287.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		504/554	21071440	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	50809	15	121412	43				g.chr1:21071440C>T	BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1512G>A	chr1.hg19:g.21071440C>T		0					HP1BP3_ENST00000375003.2_Silent_p.T352T|RP5-930J4.4_ENST00000413451.1_RNA	p.T504T	NM_016287.3	NP_057371.2	1	2	3	2.015617	Q5SSJ5	HP1B3_HUMAN		13	1651	-		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Silent	SNP	ENST00000312239.5	1	1	hg19	c.1512G>A	CCDS30621.1	0																																																																																								0.114868		TCGA-3E-AAAY-01A-11D-A38G-08	0.527	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007457.2	0	0	1	2	2	2	2	0	0	0	0	165	165	165	162	1	1.860000	-3.342456	1	0.110000	NM_016287		0	12	11	0	336	330	0		1	1		0	0	165	0	0	0.999043	9.732042e-01	0	30	0	143	0	12	336
TAL1	6886	broad.mit.edu	37	1	47685731	47685731	+	Silent	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr1:47685731C>T	ENST00000294339.3	-	4	1233	c.657G>A	c.(655-657)ccG>ccA	p.P219P	TAL1_ENST00000371883.3_Silent_p.P221P|TAL1_ENST00000371884.2_Silent_p.P219P|TAL1_ENST00000459729.1_5'UTR	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	219	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						GCTTCTTGTCCGGGGGATGTG	0.587			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																	ENST00000294339.3	1.000000	0.750000	1.000000	0.940000	0.990000	0.974001	0.990000	1.000000				Dom	yes			Dom	yes		1	1p32	1p32	6886	T	T-cell acute lymphocytic leukemia 1 (SCL)				L	L	TRD@, SIL		lymphoblastic leukemia/biphasic		0				15						c.(655-657)ccG>ccA		T-cell acute lymphocytic leukemia 1							65.0	63.0	64.0					1																	47685731		2203	4300	6503	SO:0001819	synonymous_variant	6886	0	0					g.chr1:47685731C>T	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.657G>A	chr1.hg19:g.47685731C>T		0					TAL1_ENST00000371883.3_Silent_p.P221P|TAL1_ENST00000371884.2_Silent_p.P219P|TAL1_ENST00000459729.1_5'UTR	p.P219P	NM_003189.2	NP_003180.1	1	2	3	2.015617	P17542	TAL1_HUMAN		4	1233	-			D3DQ24	Silent	SNP	ENST00000294339.3	1	1	hg19	c.657G>A	CCDS547.1	1																																																																																								0.114868		TCGA-3E-AAAY-01A-11D-A38G-08	0.587	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	1	0	1	2	2	2	2	0	0	0	0	138	138	138	136	1	1.860000	-2.578515	1	0.110000	NM_003189		0	21	21	0	310	303	0		1	0		0	0	138	0	0	0.999997	1.299652e-02	0	0	0	3	0	21	310
DEFB119	245932	broad.mit.edu	37	20	29965177	29965177	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr20:29965177C>T	ENST00000376321.3	-	2	246	c.127G>A	c.(127-129)Gaa>Aaa	p.E43K	SNORA40_ENST00000390832.1_RNA|DEFB119_ENST00000492344.1_5'UTR|DEFB119_ENST00000339144.3_3'UTR	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119	43					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TAGGGCTGTTCGTTCTTTTTG	0.433																																						ENST00000376321.3	1.000000	0.690000	1.000000	0.830000	0.990000	0.939428	0.990000	1.000000																										0				4						c.(127-129)Gaa>Aaa		defensin, beta 119							201.0	183.0	189.0					20																	29965177		2203	4300	6503	SO:0001583	missense	245932	2	121412	41				g.chr20:29965177C>T	AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.127G>A	chr20.hg19:g.29965177C>T	ENSP00000365499:p.Glu43Lys	0					SNORA40_ENST00000390832.1_RNA|DEFB119_ENST00000492344.1_5'UTR|DEFB119_ENST00000339144.3_3'UTR	p.E43K	NM_153289.3	NP_695021.2	1	2	3	2.031726	Q8N690	DB119_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)	2	246	-	all_hematologic(12;0.158)		Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Missense_Mutation	SNP	ENST00000376321.3	1	1	hg19	c.127G>A	CCDS13178.1	1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596310	0.46318	.	.	ENSG00000180483	ENST00000376321	T	0.73575	-0.76	4.31	4.31	0.51392	4.31	4.31	0.51392	.	.	.	.	.	D	0.84946	0.5585	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86218	0.1629	8	0.87932	D	0	.	12.5997	0.56491	0.0:1.0:0.0:0.0	.	43	Q8N690	DB119_HUMAN	K	43	ENSP00000365499:E43K	ENSP00000365499:E43K	E	-	1	0	0	DEFB119	29428838	29428838	0.471000	0.25862	0.184000	0.23157	0.007000	0.05969	1.525000	0.35953	2.678000	0.91216	0.655000	0.94253	GAA	0.118244		TCGA-3E-AAAY-01A-11D-A38G-08	0.433	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078514.1	1	0	1	2	2	2	2	0	0	0	0	279	279	279	280	1	1.860000	-5.349535	1	0.110000	NM_153289		0	34	33	0	605	590	0		1			0	0	279	0	0	1.000000	0	0	0	0	0	0	34	605
TRAPPC10	7109	broad.mit.edu	37	21	45478983	45478983	+	Splice_Site	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr21:45478983G>A	ENST00000291574.4	+	6	853		c.e6-1		TRAPPC10_ENST00000380221.3_Splice_Site	NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10						sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						TGGGCGAATAGGAGGAGCTTG	0.448																																						ENST00000291574.4	1.000000	0.640000	1.000000	0.850000	0.990000	0.949281	0.990000	1.000000																										0				41						c.e6-1		trafficking protein particle complex 10							69.0	62.0	64.0					21																	45478983		2203	4300	6503	SO:0001630	splice_region_variant	7109	0	0					g.chr21:45478983G>A	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.679-1G>A	chr21.hg19:g.45478983G>A		0					TRAPPC10_ENST00000380221.3_Splice_Site		NM_003274.4	NP_003265.3	1	2	3	2.085679	P48553	TPC10_HUMAN		6	853	+			Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Splice_Site	SNP	ENST00000291574.4	1	1	hg19		CCDS13704.1	1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763268	0.69763	.	.	ENSG00000160218	ENST00000380221;ENST00000291574	.	.	.	5.25	5.25	0.73442	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8261	0.92119	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	TRAPPC10	44303411	44303411	1.000000	0.71417	0.995000	0.50966	0.579000	0.36224	9.523000	0.98034	2.443000	0.82685	0.561000	0.74099	.	0.130095		TCGA-3E-AAAY-01A-11D-A38G-08	0.448	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	1	0	1	2	2	2	2	0	0	0	0	104	104	104	103	1	1.860000	-2.810242	1	0.110000	NM_003274	Intron	0	15	15	0	252	249	0		1			0	0	104	0	0	0.999874	0	0	0	0	0	0	15	252
FAM49A	81553	broad.mit.edu	37	2	16745312	16745312	+	Silent	SNP	C	C	T	rs570137045	byFrequency	TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr2:16745312C>T	ENST00000381323.3	-	5	463	c.243G>A	c.(241-243)gcG>gcA	p.A81A	FAM49A_ENST00000355549.2_Silent_p.A81A|FAM49A_ENST00000406434.1_Silent_p.A81A	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	81						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			GAGGGCACACCGCATTCCAAG	0.408													C|||	2	0.000399361	0.0	0.0	5008	,	,		20092	0.0		0.0	False		,,,				2504	0.002					ENST00000381323.3	0.980000	0.410000	0.890000	0.550000	0.720000	0.723612	0.720000	0.730000																										0				23						c.(241-243)gcG>gcA		family with sequence similarity 49, member A							127.0	118.0	121.0					2																	16745312		2203	4300	6503	SO:0001819	synonymous_variant	81553	21	121406	41				g.chr2:16745312C>T	AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.243G>A	chr2.hg19:g.16745312C>T		0					FAM49A_ENST00000355549.2_Silent_p.A81A|FAM49A_ENST00000406434.1_Silent_p.A81A	p.A81A	NM_030797.3	NP_110424.1	0	1	1	1.918548	Q9H0Q0	FA49A_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)	5	463	-	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		B3KNZ1|Q53QW2	Silent	SNP	ENST00000381323.3	1	1	hg19	c.243G>A	CCDS1688.1	0																																																																																								0.058201		TCGA-3E-AAAY-01A-11D-A38G-08	0.408	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2	0	0	1	2	9	2	2	1	1	1	1	132	132	132	132	1	1.860000	-2.463726	0	0.110000	NM_030797		0	12	12	0	254	249	0		1	0		1	0	132	0	0	0.798505	2.184062e-01	0	1	0	17	0	12	254
SAG	6295	broad.mit.edu	37	2	234229331	234229331	+	Silent	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr2:234229331C>T	ENST00000409110.1	+	5	467	c.237C>T	c.(235-237)atC>atT	p.I79I	SAG_ENST00000449594.2_5'UTR|SAG_ENST00000461532.1_3'UTR	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	79					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		TTGACGTGATCGGCTTGACCT	0.607																																						ENST00000409110.1	1.000000	0.800000	1.000000	0.990000	0.990000	0.988569	0.990000	1.000000																										0				9						c.(235-237)atC>atT		S-antigen; retina and pineal gland (arrestin)							35.0	38.0	37.0					2																	234229331		2111	4258	6369	SO:0001819	synonymous_variant	6295	8	121162	36				g.chr2:234229331C>T		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.237C>T	chr2.hg19:g.234229331C>T		0					SAG_ENST00000461532.1_3'UTR|SAG_ENST00000449594.2_5'UTR	p.I79I	NM_000541.4	NP_000532.2	1	2	3	2.042421	P10523	ARRS_HUMAN		5	467	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)	A0FDN6|Q53SV3|Q99858	Silent	SNP	ENST00000409110.1	0	1	hg19	c.237C>T	CCDS46545.1	1																																																																																								0.120640		TCGA-3E-AAAY-01A-11D-A38G-08	0.607	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.860000	-6.127719	1	0.110000	NM_000541		0	6	6	0	50	47	1		1			0	0	21	0	0	0.961766	0	0	0	0	0	0	6	50
FBXL5	26234	broad.mit.edu	37	4	15627448	15627448	+	Missense_Mutation	SNP	A	A	G			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr4:15627448A>G	ENST00000341285.3	-	9	1401	c.1277T>C	c.(1276-1278)aTt>aCt	p.I426T	FBXL5_ENST00000382358.4_Missense_Mutation_p.I300T|FBXL5_ENST00000412094.2_Missense_Mutation_p.I409T	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	426					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						AGTTGAAGTAATTTTGCTTGT	0.393																																						ENST00000341285.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999979	0.990000	1.000000																										0				13						c.(1276-1278)aTt>aCt		F-box and leucine-rich repeat protein 5							88.0	85.0	86.0					4																	15627448		2203	4300	6503	SO:0001583	missense	26234	0	0					g.chr4:15627448A>G	AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.1277T>C	chr4.hg19:g.15627448A>G	ENSP00000344866:p.Ile426Thr	0					FBXL5_ENST00000412094.2_Missense_Mutation_p.I409T|FBXL5_ENST00000382358.4_Missense_Mutation_p.I300T	p.I426T	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	1	2	3	2.043877	Q9UKA1	FBXL5_HUMAN		9	1401	-			A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	ENST00000341285.3	1	1	hg19	c.1277T>C	CCDS3415.1	1	.	.	.	.	.	.	.	.	.	.	A	0.449	-0.894587	0.02491	.	.	ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358	T;T;T	0.30182	1.57;1.57;1.54	5.92	-0.683	0.11335	5.92	-0.683	0.11335	.	0.891429	0.10025	N	0.725521	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32052	-0.9921	10	0.09338	T	0.73	-0.7497	0.2314	0.00180	0.2771:0.162:0.2613:0.2996	.	409;426	Q9UKA1-2;Q9UKA1	.;FBXL5_HUMAN	T	426;409;300	ENSP00000344866:I426T;ENSP00000408679:I409T;ENSP00000371795:I300T	ENSP00000344866:I426T	I	-	2	0	0	FBXL5	15236546	15236546	0.000000	0.05858	0.000000	0.03702	0.492000	0.33523	-0.249000	0.08842	-0.087000	0.12528	0.528000	0.53228	ATT	0.121118		TCGA-3E-AAAY-01A-11D-A38G-08	0.393	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214235.2	1	0	1	2	2	2	2	0	0	0	0	183	183	183	183	1	1.860000	-20.000000	1	0.110000			0	35	33	0	323	322	1		1	1		0	0	183	0	0	1.000000	9.933099e-01	0	11	0	63	0	35	323
REEP2	51308	broad.mit.edu	37	5	137777145	137777145	+	Silent	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr5:137777145C>T	ENST00000254901.5	+	3	299	c.177C>T	c.(175-177)ctC>ctT	p.L59L	REEP2_ENST00000464751.2_3'UTR|REEP2_ENST00000378339.2_Silent_p.L59L|REEP2_ENST00000506158.1_Silent_p.L21L	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	59					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ATATAGTGCTCTCCTGGTGAG	0.592																																						ENST00000254901.5	1.000000	0.420000	1.000000	0.620000	0.900000	0.840956	0.900000	1.000000																										0				12						c.(175-177)ctC>ctT		receptor accessory protein 2							120.0	96.0	104.0					5																	137777145		2203	4300	6503	SO:0001819	synonymous_variant	51308	0	0					g.chr5:137777145C>T	AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.177C>T	chr5.hg19:g.137777145C>T		0					REEP2_ENST00000506158.1_Silent_p.L21L|REEP2_ENST00000464751.2_3'UTR|REEP2_ENST00000378339.2_Silent_p.L59L	p.L59L	NM_016606.2	NP_057690.2	1	2	3	2.015560	Q9BRK0	REEP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)	3	299	+			Q53EM8|Q9NYF2	Silent	SNP	ENST00000254901.5	0	1	hg19	c.177C>T	CCDS4205.1	1	.	.	.	.	.	.	.	.	.	.	C	9.842	1.191368	0.21954	.	.	ENSG00000132563	ENST00000512126	.	.	.	4.01	-4.81	0.03180	4.01	-4.81	0.03180	.	.	.	.	.	T	0.50769	0.1635	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52426	-0.8577	4	.	.	.	-4.1558	8.4986	0.33144	0.0:0.2491:0.5241:0.2268	.	.	.	.	F	97	.	.	S	+	2	0	0	REEP2	137805044	137805044	0.915000	0.31059	0.934000	0.37439	0.986000	0.74619	-0.207000	0.09384	-0.560000	0.06102	0.455000	0.32223	TCT	0.114868		TCGA-3E-AAAY-01A-11D-A38G-08	0.592	REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	0	0	1	2	2	2	2	0	0	0	0	77	77	77	76	1	1.860000	-3.354106	1	0.110000	NM_016606		0	8	8	0	164	161	0		1	0		0	0	77	0	0	0.989134	9.570907e-02	0	0	0	10	0	8	164
PCDHB3	56132	broad.mit.edu	37	5	140481822	140481822	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr5:140481822G>A	ENST00000231130.2	+	1	1589	c.1589G>A	c.(1588-1590)cGc>cAc	p.R530H	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	530	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R530H(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGAGTTCCGCGTGGGCGCC	0.667																																						ENST00000231130.2	1.000000	0.950000	1.000000	0.990000	0.990000	0.996819	0.990000	1.000000																										1	Substitution - Missense(1)	p.R530H(1)	large_intestine(1)	72						c.(1588-1590)cGc>cAc		protocadherin beta 3							59.0	63.0	62.0					5																	140481822		2203	4300	6503	SO:0001583	missense	56132	0	0					g.chr5:140481822G>A	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1589G>A	chr5.hg19:g.140481822G>A	ENSP00000231130:p.Arg530His	0					AC005754.7_ENST00000607216.1_RNA	p.R530H	NM_018937.2	NP_061760.1	1	2	3	2.015560	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1589	+			B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	1	1	hg19	c.1589G>A	CCDS4245.1	1	.	.	.	.	.	.	.	.	.	.	G	0.185	-1.058176	0.01950	.	.	ENSG00000113205	ENST00000231130	T	0.01767	4.65	4.14	1.03	0.20045	4.14	1.03	0.20045	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01092	0.0036	N	0.11064	0.09	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.48854	-0.8998	9	0.15499	T	0.54	.	6.6896	0.23163	0.1992:0.224:0.5769:0.0	.	530	Q9Y5E6	PCDB3_HUMAN	H	530	ENSP00000231130:R530H	ENSP00000231130:R530H	R	+	2	0	0	PCDHB3	140462006	140462006	0.000000	0.05858	0.989000	0.46669	0.065000	0.16274	-0.362000	0.07602	0.834000	0.34852	0.650000	0.86243	CGC	0.114868		TCGA-3E-AAAY-01A-11D-A38G-08	0.667	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	1	0	1	2	9	2	2	0	0	0	1	172	172	172	183	1	1.860000	-3.318788	1	0.110000	NM_018937		0	28	28	0	342	326	0		1	0		0	0	172	0	0	0.999536	7.516577e-02	0	0	0	6	0	28	342
RASGEF1C	255426	broad.mit.edu	37	5	179548100	179548100	+	Missense_Mutation	SNP	A	A	C			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr5:179548100A>C	ENST00000393371.2	-	6	1060	c.764T>G	c.(763-765)tTc>tGc	p.F255C	RASGEF1C_ENST00000361132.4_Missense_Mutation_p.F255C|RASGEF1C_ENST00000522500.1_Missense_Mutation_p.F104C|RASGEF1C_ENST00000519883.1_5'UTR			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	255	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGCCTGTTGAACCATTTCAC	0.557																																						ENST00000393371.2	1.000000	0.580000	1.000000	0.760000	0.990000	0.910360	0.990000	1.000000																										0				12						c.(763-765)tTc>tGc		RasGEF domain family, member 1C							157.0	143.0	147.0					5																	179548100		2203	4300	6503	SO:0001583	missense	255426	0	0					g.chr5:179548100A>C	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.764T>G	chr5.hg19:g.179548100A>C	ENSP00000377037:p.Phe255Cys	0					RASGEF1C_ENST00000522500.1_Missense_Mutation_p.F104C|RASGEF1C_ENST00000519883.1_5'UTR|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.F255C	p.F255C			1	2	3	2.015560	Q8N431	RGF1C_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	6	1060	-	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	ENST00000393371.2	1	1	hg19	c.764T>G	CCDS4452.1	1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.934399	0.52866	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.39787	1.06;1.06;1.06	3.64	3.64	0.41730	3.64	3.64	0.41730	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.059111	0.64402	D	0.000002	T	0.62575	0.2439	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.67745	-0.5591	10	0.87932	D	0	.	11.5493	0.50711	1.0:0.0:0.0:0.0	.	255	Q8N431	RGF1C_HUMAN	C	255;255;104	ENSP00000354963:F255C;ENSP00000377037:F255C;ENSP00000429114:F104C	ENSP00000354963:F255C	F	-	2	0	0	RASGEF1C	179480706	179480706	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	5.407000	0.66363	1.677000	0.50941	0.254000	0.18369	TTC	0.114868		TCGA-3E-AAAY-01A-11D-A38G-08	0.557	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	1	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.860000	-18.389890	1	0.110000	NM_175062		0	16	16	0	288	278	0		1			0	0	99	0	0	0.999920	0	0	0	0	0	0	16	288
AIM1	202	broad.mit.edu	37	6	106987390	106987390	+	Missense_Mutation	SNP	C	C	T	rs373859652		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr6:106987390C>T	ENST00000369066.3	+	7	4094	c.3607C>T	c.(3607-3609)Cgg>Tgg	p.R1203W	AIM1_ENST00000535438.1_5'Flank	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TGGATCCATGCGGCCTCTGAA	0.438																																						ENST00000369066.3	0.490000	0.100000	0.370000	0.170000	0.250000	0.276203	0.250000	0.240000																										0				69						c.(3607-3609)Cgg>Tgg		absent in melanoma 1		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	123.0	120.0	121.0		3607	3.7	1.0	6		121	0,8600		0,0,4300	no	missense	AIM1	NM_001624.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1203/1724	106987390	1,13005	2203	4300	6503	SO:0001583	missense	202	2	121412	36				g.chr6:106987390C>T	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.3607C>T	chr6.hg19:g.106987390C>T	ENSP00000358062:p.Arg1203Trp	0					AIM1_ENST00000535438.1_5'Flank	p.R1203W	NM_001624.2	NP_001615	0	0	0	1.958727	Q9UMX9	S45A2_HUMAN	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	7	4094	+	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	0	1	hg19	c.3607C>T	CCDS34506.1	0	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674524	0.67928	2.27E-4	0.0	ENSG00000112297	ENST00000369066	D	0.82344	-1.6	5.66	3.67	0.42095	5.66	3.67	0.42095	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.094954	0.64402	D	0.000002	D	0.90728	0.7090	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92760	0.6223	10	0.87932	D	0	.	13.4764	0.61312	0.4327:0.5673:0.0:0.0	.	1203	Q9Y4K1	AIM1_HUMAN	W	1203	ENSP00000358062:R1203W	ENSP00000358062:R1203W	R	+	1	2	2	AIM1	107094083	107094083	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.275000	0.33144	1.360000	0.45960	0.655000	0.94253	CGG	0.078580		TCGA-3E-AAAY-01A-11D-A38G-08	0.438	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1	0	0	1	2	2	2	2	0	0	0	0	201	201	201	199	1	1.860000	-2.223643	0	0.110000			0	6	6	0	425	416	0		1	0		0	0	201	0	0	0.962874	1.448882e-02	0	0	0	11	0	6	425
DNAH11	8701	broad.mit.edu	37	7	21628848	21628848	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr7:21628848G>A	ENST00000409508.3	+	12	2027	c.1996G>A	c.(1996-1998)Gct>Act	p.A666T	DNAH11_ENST00000328843.6_Missense_Mutation_p.A666T	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	666	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TCCTGATCACGCTTTAGTTTA	0.303									Kartagener syndrome																													ENST00000409508.3	1.000000	0.770000	1.000000	0.990000	0.990000	0.982963	0.990000	1.000000																										0				230						c.(1996-1998)Gct>Act		dynein, axonemal, heavy chain 11							84.0	81.0	82.0					7																	21628848		1814	4077	5891	SO:0001583	missense	8701	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21628848G>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.1996G>A	chr7.hg19:g.21628848G>A	ENSP00000475939:p.Ala666Thr	0					DNAH11_ENST00000328843.6_Missense_Mutation_p.A666T	p.A666T	NM_001277115.1	NP_001264044.1	1	2	3	2.047513	Q96DT5	DYH11_HUMAN		12	2027	+			Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	1	1	hg19	c.1996G>A		1	.	.	.	.	.	.	.	.	.	.	G	4.091	0.014837	0.07959	.	.	ENSG00000105877	ENST00000328843	T	0.55413	0.52	5.58	3.79	0.43588	5.58	3.79	0.43588	Dynein heavy chain, domain-1 (1);	0.823945	0.11127	N	0.596763	T	0.38612	0.1047	.	.	.	0.09310	N	0.999998	B	0.11235	0.004	B	0.04013	0.001	T	0.26815	-1.0092	9	0.41790	T	0.15	.	6.2505	0.20843	0.1557:0.0:0.6953:0.149	.	666	Q96DT5	DYH11_HUMAN	T	666	ENSP00000330671:A666T	ENSP00000330671:A666T	A	+	1	0	0	DNAH11	21595373	21595373	0.022000	0.18835	0.476000	0.27291	0.043000	0.13939	1.048000	0.30379	0.731000	0.32448	0.650000	0.86243	GCT	0.122072		TCGA-3E-AAAY-01A-11D-A38G-08	0.303	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1	2	10	2	2	1	1	1	1	85	85	85	85	1	1.860000	-6.240001	1	0.110000	NM_003777		0	15	15	0	201	198	0		1			1	0	85	0	0	0.883000	0	0	0	0	0	0	15	201
BAZ1B	9031	broad.mit.edu	37	7	72892025	72892025	+	Missense_Mutation	SNP	T	T	G			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr7:72892025T>G	ENST00000339594.4	-	7	2104	c.1766A>C	c.(1765-1767)aAc>aCc	p.N589T	BAZ1B_ENST00000404251.1_Missense_Mutation_p.N589T	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	589					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TGCTGGAAGGTTTTTGCCAGT	0.458																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)	ENST00000339594.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999513	0.990000	1.000000																										0				61						c.(1765-1767)aAc>aCc		bromodomain adjacent to zinc finger domain, 1B							151.0	165.0	160.0					7																	72892025		2202	4299	6501	SO:0001583	missense	9031	0	0					g.chr7:72892025T>G	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.1766A>C	chr7.hg19:g.72892025T>G	ENSP00000342434:p.Asn589Thr	0					BAZ1B_ENST00000404251.1_Missense_Mutation_p.N589T	p.N589T	NM_032408.3	NP_115784.1	1	2	3	2.055439	Q9UIG0	BAZ1B_HUMAN		7	2104	-		Lung NSC(55;0.0659)|all_lung(88;0.152)	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	1	1	hg19	c.1766A>C	CCDS5549.1	1	.	.	.	.	.	.	.	.	.	.	T	5.695	0.312690	0.10789	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.57273	0.41;0.41	5.82	-6.38	0.01957	5.82	-6.38	0.01957	.	0.558505	0.22152	N	0.063904	T	0.32436	0.0829	L	0.40543	1.245	0.24006	N	0.996196	B	0.02656	0.0	B	0.01281	0.0	T	0.30736	-0.9968	10	0.14656	T	0.56	-6.4103	10.4288	0.44395	0.0:0.4925:0.284:0.2234	.	589	Q9UIG0	BAZ1B_HUMAN	T	589	ENSP00000342434:N589T;ENSP00000385442:N589T	ENSP00000342434:N589T	N	-	2	0	0	BAZ1B	72529961	72529961	0.003000	0.15002	0.412000	0.26496	0.974000	0.67602	-0.564000	0.05936	-1.088000	0.03077	0.533000	0.62120	AAC	0.123498		TCGA-3E-AAAY-01A-11D-A38G-08	0.458	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	0	0	1	2	2	2	2	0	0	0	0	393	393	393	391	1	1.860000	-12.935160	1	0.110000	NM_032408		0	69	69	0	907	890	0		1	1		0	0	393	0	0	1.000000	6.193964e-01	0	4	0	25	0	69	907
HOOK3	84376	broad.mit.edu	37	8	42805542	42805542	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr8:42805542G>A	ENST00000307602.4	+	6	612	c.412G>A	c.(412-414)Gcc>Acc	p.A138T	Y_RNA_ENST00000365644.1_RNA	NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	138	Sufficient for interaction with microtubules.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GTACATCCAAGCCATTATGAT	0.353			T	RET	papillary thyroid																																	ENST00000307602.4	0.570000	0.190000	0.470000	0.260000	0.350000	0.369641	0.350000	0.340000				Dom	yes			Dom	yes		8	8p11.21	8p11.21	84376	T	hook homolog 3				E	E	RET		papillary thyroid		0				31						c.(412-414)Gcc>Acc		hook microtubule-tethering protein 3							194.0	173.0	181.0					8																	42805542		2203	4300	6503	SO:0001583	missense	84376	0	0					g.chr8:42805542G>A	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.412G>A	chr8.hg19:g.42805542G>A	ENSP00000305699:p.Ala138Thr	0					Y_RNA_ENST00000365644.1_RNA	p.A138T	NM_032410.3	NP_115786.1	0	0	0	1.968648	Q86VS8	HOOK3_HUMAN	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)	6	612	+	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	0	1	hg19	c.412G>A	CCDS6139.1	0	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487393	0.44249	.	.	ENSG00000168172	ENST00000307602	T	0.17370	2.28	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.104415	0.64402	N	0.000006	T	0.06462	0.0166	N	0.02539	-0.55	0.40492	D	0.980557	B;B	0.18310	0.027;0.0	B;B	0.22880	0.042;0.003	T	0.40627	-0.9553	10	0.20046	T	0.44	-4.5861	7.4677	0.27330	0.1979:0.0:0.8021:0.0	.	138;138	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	T	138	ENSP00000305699:A138T	ENSP00000305699:A138T	A	+	1	0	0	HOOK3	42924699	42924699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.773000	0.68898	2.677000	0.91161	0.650000	0.86243	GCC	0.083797		TCGA-3E-AAAY-01A-11D-A38G-08	0.353	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	0	0	1	2	2	2	2	0	0	0	0	270	270	270	268	1	1.860000	-2.677842	1	0.110000	NM_032410		0	12	12	0	596	586	0		1	0		0	0	270	0	0	0.999032	1.239606e-02	0	0	0	8	0	12	596
ZFHX4	79776	broad.mit.edu	37	8	77767067	77767067	+	Missense_Mutation	SNP	A	A	G			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr8:77767067A>G	ENST00000521891.2	+	10	8358	c.7910A>G	c.(7909-7911)cAt>cGt	p.H2637R	ZFHX4_ENST00000455469.2_Missense_Mutation_p.H2592R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.H2611R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.H2592R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATGCTTGATCATATTGCCCGC	0.507										HNSCC(33;0.089)																												ENST00000521891.2	1.000000	0.560000	1.000000	0.790000	0.990000	0.925270	0.990000	1.000000																										0				432						c.(7909-7911)cAt>cGt		zinc finger homeobox 4							39.0	40.0	39.0					8																	77767067		1856	4100	5956	SO:0001583	missense	79776	1	120810	31				g.chr8:77767067A>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7910A>G	chr8.hg19:g.77767067A>G	ENSP00000430497:p.His2637Arg	0	HNSCC(33;0.089)				ZFHX4_ENST00000518282.1_Missense_Mutation_p.H2611R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.H2592R|ZFHX4_ENST00000455469.2_Missense_Mutation_p.H2592R	p.H2637R	NM_024721.4	NP_078997.4	1	2	3	2.037747	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)	10	8358	+			G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	1	1	hg19	c.7910A>G	CCDS47878.2	1	.	.	.	.	.	.	.	.	.	.	A	8.874	0.950034	0.18431	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	5.32	5.32	0.75619	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.47093	U	0.000258	D	0.89291	0.6673	N	0.01473	-0.845	0.80722	D	1	P;B;B	0.34412	0.453;0.399;0.259	B;B;B	0.42827	0.128;0.078;0.399	D	0.89968	0.4091	10	0.40728	T	0.16	.	15.4359	0.75146	1.0:0.0:0.0:0.0	.	2592;2592;2637	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	2637;2621;2592;2592;2611	ENSP00000430497:H2637R;ENSP00000399605:H2592R;ENSP00000050961:H2592R;ENSP00000430848:H2611R	ENSP00000050961:H2592R	H	+	2	0	0	ZFHX4	77929622	77929622	1.000000	0.71417	0.327000	0.25402	0.090000	0.18270	9.139000	0.94554	2.230000	0.72887	0.528000	0.53228	CAT	0.119683		TCGA-3E-AAAY-01A-11D-A38G-08	0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	1	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	1.860000	-14.594170	1	0.110000	NM_024721		0	11	11	0	188	183	0		1			0	0	78	0	0	0.998244	0	0	0	0	0	0	11	188
ZC3H3	23144	broad.mit.edu	37	8	144620233	144620233	+	Missense_Mutation	SNP	G	G	A	rs368969638		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr8:144620233G>A	ENST00000262577.5	-	2	1335	c.1304C>T	c.(1303-1305)cCg>cTg	p.P435L		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	435					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			AGCCGAGAGCGGGGTCTCCCC	0.642																																						ENST00000262577.5	1.000000	0.240000	1.000000	0.400000	0.660000	0.683308	0.660000	1.000000																										0				23						c.(1303-1305)cCg>cTg		zinc finger CCCH-type containing 3		G	LEU/PRO	0,4406		0,0,2203	40.0	45.0	43.0		1304	4.4	0.0	8		43	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZC3H3	NM_015117.2	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	435/949	144620233	1,13005	2203	4300	6503	SO:0001583	missense	23144	2	121350	32				g.chr8:144620233G>A	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1304C>T	chr8.hg19:g.144620233G>A	ENSP00000262577:p.Pro435Leu	0						p.P435L	NM_015117.2	NP_055932.2	1	2	3	2.037747	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)	2	1335	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	0	1	hg19	c.1304C>T	CCDS6402.1	0	.	.	.	.	.	.	.	.	.	.	G	3.338	-0.135192	0.06711	0.0	1.16E-4	ENSG00000014164	ENST00000262577	T	0.02863	4.13	5.31	4.4	0.53042	5.31	4.4	0.53042	.	0.573853	0.17539	N	0.170615	T	0.02455	0.0075	L	0.47716	1.5	0.09310	N	1	P	0.37997	0.614	B	0.22152	0.038	T	0.47837	-0.9086	10	0.31617	T	0.26	-2.5276	6.5088	0.22210	0.0734:0.1267:0.6613:0.1386	.	435	Q8IXZ2	ZC3H3_HUMAN	L	435	ENSP00000262577:P435L	ENSP00000262577:P435L	P	-	2	0	0	ZC3H3	144691376	144691376	0.002000	0.14202	0.005000	0.12908	0.022000	0.10575	1.201000	0.32259	1.177000	0.42855	0.561000	0.74099	CCG	0.119683		TCGA-3E-AAAY-01A-11D-A38G-08	0.642	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	86	1	1.860000	-6.966358	1	0.110000	NM_015117		0	5	5	0	157	151	0		1	1		0	0	87	0	0	0.932155	4.052244e-01	0	4	0	35	0	5	157
C9orf24	84688	broad.mit.edu	37	9	34381395	34381395	+	Silent	SNP	A	A	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr9:34381395A>T	ENST00000297623.2	-	4	642	c.444T>A	c.(442-444)ccT>ccA	p.P148P	C9orf24_ENST00000379124.1_Silent_p.P13P|C9orf24_ENST00000481295.1_5'Flank|C9orf24_ENST00000379127.1_Silent_p.P13P|C9orf24_ENST00000379133.3_Silent_p.P13P|C9orf24_ENST00000379126.3_Silent_p.P13P	NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	148					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		CCGGCCTAGGAGGGCATTCCA	0.617																																						ENST00000297623.2	1.000000	0.770000	1.000000	0.890000	0.980000	0.958010	0.980000	1.000000																										0				5						c.(442-444)ccT>ccA		chromosome 9 open reading frame 24							152.0	129.0	137.0					9																	34381395		2203	4300	6503	SO:0001819	synonymous_variant	84688	0	0					g.chr9:34381395A>T	BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.444T>A	chr9.hg19:g.34381395A>T		0					C9orf24_ENST00000379124.1_Silent_p.P13P|C9orf24_ENST00000379133.3_Silent_p.P13P|C9orf24_ENST00000379126.3_Silent_p.P13P|C9orf24_ENST00000379127.1_Silent_p.P13P|C9orf24_ENST00000481295.1_5'Flank	p.P148P	NM_032596.3	NP_115985.2	0	1	1	1.916859	Q8NCR6	SMRP1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)	4	642	-			Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Silent	SNP	ENST00000297623.2	1	1	hg19	c.444T>A	CCDS6554.1	1																																																																																								0.061478		TCGA-3E-AAAY-01A-11D-A38G-08	0.617	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001098.3	1	0	1	2	2	2	2	0	0	0	0	185	185	185	181	1	1.860000	-9.198959	1	0.110000	NM_147169		0	29	28	0	334	328	0		1	0		0	0	185	0	0	1.000000	1.967078e-02	0	1	0	2	0	29	334
TRPM3	80036	broad.mit.edu	37	9	73151305	73151305	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr9:73151305G>A	ENST00000377110.3	-	25	4931	c.4688C>T	c.(4687-4689)gCg>gTg	p.A1563V	TRPM3_ENST00000423814.3_Missense_Mutation_p.A1590V|TRPM3_ENST00000357533.2_Missense_Mutation_p.A1567V|TRPM3_ENST00000396285.1_Missense_Mutation_p.A1422V|TRPM3_ENST00000377106.1_Missense_Mutation_p.A1435V|TRPM3_ENST00000360823.2_Missense_Mutation_p.A1425V|TRPM3_ENST00000358082.3_Missense_Mutation_p.A1425V|TRPM3_ENST00000396292.4_Missense_Mutation_p.A1435V|TRPM3_ENST00000377105.1_Missense_Mutation_p.A1422V|TRPM3_ENST00000396280.5_Missense_Mutation_p.A1412V|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000408909.2_Missense_Mutation_p.A1422V			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1588					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGCTCTGTCCGCAATTGCTTG	0.493																																						ENST00000377110.3	0.460000	0.080000	0.350000	0.140000	0.230000	0.252366	0.230000	0.210000																										0				95						c.(4687-4689)gCg>gTg		transient receptor potential cation channel, subfamily M, member 3							97.0	90.0	92.0					9																	73151305		2203	4300	6503	SO:0001583	missense	80036	2	121412	35				g.chr9:73151305G>A	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4688C>T	chr9.hg19:g.73151305G>A	ENSP00000366314:p.Ala1563Val	0					TRPM3_ENST00000360823.2_Missense_Mutation_p.A1425V|TRPM3_ENST00000396285.1_Missense_Mutation_p.A1422V|TRPM3_ENST00000423814.3_Missense_Mutation_p.A1590V|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396292.4_Missense_Mutation_p.A1435V|TRPM3_ENST00000377105.1_Missense_Mutation_p.A1422V|TRPM3_ENST00000358082.3_Missense_Mutation_p.A1425V|TRPM3_ENST00000408909.2_Missense_Mutation_p.A1422V|TRPM3_ENST00000396280.5_Missense_Mutation_p.A1412V|TRPM3_ENST00000377106.1_Missense_Mutation_p.A1435V|TRPM3_ENST00000357533.2_Missense_Mutation_p.A1567V	p.A1563V			0	1	1	1.916859	Q9HCF6	TRPM3_HUMAN		25	4931	-			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	0	1	hg19	c.4688C>T	CCDS43835.1	0	.	.	.	.	.	.	.	.	.	.	G	6.617	0.482296	0.12581	.	.	ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T	0.56275	0.56;0.5;0.5;0.47;0.57;0.47;0.51;0.5;0.5;0.56	5.87	4.97	0.65823	5.87	4.97	0.65823	.	0.180840	0.47093	D	0.000241	T	0.29158	0.0725	N	0.11560	0.145	0.19775	N	0.99995	B;B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001;0.001;0.0	T	0.10590	-1.0623	10	0.12766	T	0.61	-8.7036	10.1358	0.42706	0.0704:0.0:0.7916:0.138	.	1563;1553;1567;1425;1422;1535;1422	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.	V	1563;1435;1425;1422;1567;1422;1422;1435;1425;1590	ENSP00000366314:A1563V;ENSP00000366310:A1435V;ENSP00000354066:A1425V;ENSP00000366309:A1422V;ENSP00000350140:A1567V;ENSP00000386127:A1422V;ENSP00000379581:A1422V;ENSP00000379587:A1435V;ENSP00000350791:A1425V;ENSP00000389542:A1590V	ENSP00000350140:A1567V	A	-	2	0	0	TRPM3	72341125	72341125	0.994000	0.37717	0.071000	0.20095	0.751000	0.42716	4.224000	0.58593	2.785000	0.95823	0.655000	0.94253	GCG	0.061478		TCGA-3E-AAAY-01A-11D-A38G-08	0.493	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	0	0	1	2	10	2	2	1	1	1	1	179	179	179	178	1	1.860000	-1.964215	0	0.110000	NM_206945		0	5	5	0	387	378	0		0			1	0	179	0	0	0.137011	0	0	0	0	0	0	5	387
ZCCHC6	79670	broad.mit.edu	37	9	88938112	88938112	+	Silent	SNP	G	G	A	rs146207882	byFrequency	TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr9:88938112G>A	ENST00000375963.3	-	13	2725	c.2553C>T	c.(2551-2553)gaC>gaT	p.D851D	ZCCHC6_ENST00000375961.2_Silent_p.D851D|ZCCHC6_ENST00000277141.6_Silent_p.D140D|ZCCHC6_ENST00000375960.2_Silent_p.D728D|ZCCHC6_ENST00000469004.1_5'Flank	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	851	Glu-rich.				RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						cctcttcttcgtcgtcctcct	0.463													G|||	17	0.00339457	0.0091	0.0	5008	,	,		21595	0.005		0.0	False		,,,				2504	0.0					ENST00000375963.3	1.000000	0.500000	0.990000	0.660000	0.840000	0.825546	0.840000	1.000000																										0				46						c.(2551-2553)gaC>gaT		zinc finger, CCHC domain containing 6		G	,,	24,4382	30.8+/-60.4	0,24,2179	115.0	99.0	105.0		2553,2184,2553	-2.7	0.1	9	dbSNP_134	105	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	ZCCHC6	NM_001185059.1,NM_001185074.1,NM_024617.3	,,	0,26,6477	AA,AG,GG		0.0233,0.5447,0.1999	,,	851/1496,728/1260,851/1496	88938112	26,12980	2203	4300	6503	SO:0001819	synonymous_variant	79670	163	121404	54				g.chr9:88938112G>A	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2553C>T	chr9.hg19:g.88938112G>A		0					ZCCHC6_ENST00000375961.2_Silent_p.D851D|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000375960.2_Silent_p.D728D|ZCCHC6_ENST00000277141.6_Silent_p.D140D	p.D851D	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	0	1	1	1.916859	Q5VYS8	TUT7_HUMAN		13	2725	-			Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Silent	SNP	ENST00000375963.3	1	0	hg19	c.2553C>T	CCDS35057.1	0																																																																																								0.061478		TCGA-3E-AAAY-01A-11D-A38G-08	0.463	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	1	0	1	2	9	2	2	0	0	0	1	117	117	117	115	1	1.860000	-3.298050	1	0.110000	NM_024617		0	13	13	0	221	217	0		1	1		0	0	117	0	0	0.850983	2.242333e-01	0	4	0	11	0	13	221
TGFBR1	7046	broad.mit.edu	37	9	101891209	101891209	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chr9:101891209C>T	ENST00000374994.4	+	2	287	c.170C>T	c.(169-171)tCt>tTt	p.S57F	TGFBR1_ENST00000552516.1_Missense_Mutation_p.S57F|TGFBR1_ENST00000550253.1_5'UTR|TGFBR1_ENST00000374990.2_Missense_Mutation_p.S57F	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	57					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TGCTTTGTCTCTGTCACAGAG	0.408																																						ENST00000374994.4	1.000000	0.850000	1.000000	0.940000	0.990000	0.979279	0.990000	1.000000																										0				27						c.(169-171)tCt>tTt		transforming growth factor, beta receptor 1							92.0	83.0	86.0					9																	101891209		2203	4300	6503	SO:0001583	missense	7046	0	0					g.chr9:101891209C>T		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.170C>T	chr9.hg19:g.101891209C>T	ENSP00000364133:p.Ser57Phe	0					TGFBR1_ENST00000552516.1_Missense_Mutation_p.S57F|TGFBR1_ENST00000374990.2_Missense_Mutation_p.S57F|TGFBR1_ENST00000550253.1_5'UTR	p.S57F	NM_004612.2	NP_004603.1	0	1	1	1.916859	P36897	TGFR1_HUMAN		2	287	+		Acute lymphoblastic leukemia(62;0.0559)	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	1	1	hg19	c.170C>T	CCDS6738.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508992	0.85282	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000546096;ENST00000546584	D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68	6.08	6.08	0.98989	6.08	6.08	0.98989	TGF-beta receptor/activin receptor, type I/II (1);	0.334572	0.36002	N	0.002853	D	0.97012	0.9024	M	0.73430	2.235	0.80722	D	1	P;B	0.40794	0.729;0.057	B;B	0.41236	0.351;0.082	D	0.96884	0.9648	10	0.87932	D	0	.	14.3009	0.66352	0.1487:0.8513:0.0:0.0	.	57;57	P36897-3;P36897	.;TGFR1_HUMAN	F	57;57;57;57;42;54	ENSP00000364133:S57F;ENSP00000364129:S57F;ENSP00000447297:S57F;ENSP00000447707:S54F	ENSP00000364129:S57F	S	+	2	0	0	TGFBR1	100931030	100931030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.297000	0.65704	2.894000	0.99253	0.591000	0.81541	TCT	0.061478		TCGA-3E-AAAY-01A-11D-A38G-08	0.408	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3	1	0	1	2	2	2	2	0	0	0	0	243	243	243	242	1	1.860000	-3.017764	1	0.110000			0	44	43	0	486	476	0		1	0	1	0	0	243	251	0	1.000000	2.054057e-02	1	0	23	3	338	44	486
KIF4A	24137	broad.mit.edu	37	X	69615826	69615826	+	Missense_Mutation	SNP	C	C	T	rs200516198		TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chrX:69615826C>T	ENST00000374403.3	+	22	2498	c.2416C>T	c.(2416-2418)Cgt>Tgt	p.R806C	KIF4A_ENST00000374388.3_Missense_Mutation_p.R806C|RNY4P23_ENST00000364507.1_RNA	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	806	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TACTGAAGTGCGTGGTCAAGT	0.398													C|||	1	0.000264901	0.0	0.0	3775	,	,		13713	0.0		0.001	False		,,,				2504	0.0					ENST00000374403.3	0.720000	0.140000	0.550000	0.240000	0.370000	0.400970	0.370000	0.340000																										0				51						c.(2416-2418)Cgt>Tgt		kinesin family member 4A							73.0	63.0	67.0					X																	69615826		2203	4300	6503	SO:0001583	missense	24137	2	121410	30				g.chrX:69615826C>T	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2416C>T	chrX.hg19:g.69615826C>T	ENSP00000363524:p.Arg806Cys						KIF4A_ENST00000374388.3_Missense_Mutation_p.R806C|RNY4P23_ENST00000364507.1_RNA	p.R806C	NM_012310.4	NP_036442.3	0	1	1		O95239	KIF4A_HUMAN		22	2498	+			B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	0	1	hg19	c.2416C>T	CCDS14401.1	0	1	6.027727546714888E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	6.236	0.411750	0.11812	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.69806	-0.43;-0.37	4.78	3.92	0.45320	4.78	3.92	0.45320	.	0.641178	0.13965	N	0.350586	T	0.35682	0.0940	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20706	-1.0267	9	.	.	.	.	7.9061	0.29763	0.0:0.886:0.0:0.114	.	806	O95239	KIF4A_HUMAN	C	806;806;108	ENSP00000363509:R806C;ENSP00000363524:R806C	.	R	+	1	0	0	KIF4A	69532551	69532551	0.999000	0.42202	0.001000	0.08648	0.223000	0.24884	3.801000	0.55545	1.133000	0.42147	0.594000	0.82650	CGT	0.110000		TCGA-3E-AAAY-01A-11D-A38G-08	0.398	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	1.860000	-2.998761	1	0.110000	NM_012310		0	5	5	0	120	118	0		1	0		0	0	45	0	0	0.936177	8.401479e-02	0	0	0	10	0	5	120
SRPX2	27286	broad.mit.edu	37	X	99925874	99925874	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAY-01A-11D-A38G-08	TCGA-3E-AAAY-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e732348f-c0aa-41bb-b465-09607386d190	6eadfab7-891c-443f-bf86-e072cb8338d3	g.chrX:99925874C>T	ENST00000373004.3	+	11	1716	c.1288C>T	c.(1288-1290)Cgc>Tgc	p.R430C	RP11-524D16__A.3_ENST00000568809.1_RNA	NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	430					angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						TGACCGAGACCGCTACATGGA	0.512											OREG0019890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000373004.3	1.000000	0.710000	0.980000	0.820000	0.920000	0.910525	0.920000	0.990000																										0				19						c.(1288-1290)Cgc>Tgc		sushi-repeat containing protein, X-linked 2							164.0	126.0	138.0					X																	99925874		2203	4300	6503	SO:0001583	missense	27286	0	0					g.chrX:99925874C>T	AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.1288C>T	chrX.hg19:g.99925874C>T	ENSP00000362095:p.Arg430Cys			OREG0019890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1347	RP11-524D16__A.3_ENST00000568809.1_RNA	p.R430C	NM_014467.2	NP_055282.1	0	1	1		O60687	SRPX2_HUMAN		11	1716	+			B3KQT3|Q8WW85	Missense_Mutation	SNP	ENST00000373004.3	1	1	hg19	c.1288C>T	CCDS14471.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590739	0.86851	.	.	ENSG00000102359	ENST00000373004	T	0.54071	0.59	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.74419	0.3714	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76756	-0.2842	9	.	.	.	-14.007	17.6638	0.88198	0.0:1.0:0.0:0.0	.	430	O60687	SRPX2_HUMAN	C	430	ENSP00000362095:R430C	.	R	+	1	0	0	SRPX2	99812530	99812530	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	5.063000	0.64332	2.357000	0.79964	0.523000	0.50628	CGC	0.110000		TCGA-3E-AAAY-01A-11D-A38G-08	0.512	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057486.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	1.860000	-2.895261	1	0.110000	NM_014467		0	24	24	0	143	141	1		1	1		0	0	75	0	0	1.000000	9.999907e-01	0	12	0	106	0	24	143
