#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CDC73	79577	broad.mit.edu	37	1	193172923	193172949	+	Splice_Site	DEL	AGGAGGGTGCATCTGCCCGGAAGACTC	AGGAGGGTGCATCTGCCCGGAAGACTC	-	rs149875598		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr1:193172923_193172949delAGGAGGGTGCATCTGCCCGGAAGACTC	ENST00000367435.3	+	11	1156_1181	c.972_997delAGGAGGGTGCATCTGCCCGGAAGACTC	c.(970-999)acaggagggtgcatctgcccggaagactca>acca	p.GGCICPEDS325del		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	325	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.R330L(1)|p.R330R(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						ATTCTTTTAAAGGAGGGTGCATCTGCCCGGAAGACTCAGACTCCTGC	0.352																																						ENST00000367435.3	0.360000	0.090000	0.290000	0.140000	0.200000	0.222017	0.200000	0.210000																										2	Substitution - Missense(1)|Substitution - coding silent(1)	p.R330L(1)|p.R330R(1)	lung(2)	87						c.(970-999)acaggagggtgcatctgcccggaagactca>acca		cell division cycle 73																																				SO:0001630	splice_region_variant	79577	0	0					g.chr1:193172923_193172949delAGGAGGGTGCATCTGCCCGGAAGACTC	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.973-1AGGAGGGTGCATCTGCCCGGAAGACTC>-	chr1.hg19:g.193172923_193172949delAGGAGGGTGCATCTGCCCGGAAGACTC		1						p.GGCICPEDS325del	NM_024529.4	NP_078805.3	1	2	3	2.507409	Q6P1J9	CDC73_HUMAN		11	1156_1181	+			A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Splice_Site	DEL	ENST00000367435.3	1	1	hg19	c.972_997delAGGAGGGTGCATCTGCCCGGAAGACTC	CCDS1382.1	0																																																																																								0.478992		TCGA-3E-AAAZ-01A-11D-A38G-08	0.352	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	0	0	1		18	2		0	0	0	3	117	0	117	119	1	1.810000	-3.142408	1	0.380000	NM_024529	In_Frame_Del	0	9	31	0	270	281	0	0	1	0	0	0	0	117	0	0	9.768436e-02	7.433416e-01	0	0	0	80	0	9	270
CDC20B	166979	broad.mit.edu	37	5	54423083	54423083	+	Splice_Site	DEL	A	A	-			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr5:54423083delA	ENST00000381375.2	-	8	1135		c.e8+1		CDC20B_ENST00000334206.5_Splice_Site|CDC20B_ENST00000322374.6_Splice_Site|CDC20B_ENST00000296733.1_Splice_Site			Q86Y33	CD20B_HUMAN	cell division cycle 20B											kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			GACGCTTCTTACCTGCTGAGG	0.383																																						ENST00000381375.2	1.000000	0.650000	0.860000	0.710000	0.780000	0.793991	0.780000	0.780000																										0				19						c.e8+1		cell division cycle 20B							102.0	104.0	103.0					5																	54423083		2203	4300	6503	SO:0001630	splice_region_variant	166979	0	0					g.chr5:54423083delA	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.989+1T>-	chr5.hg19:g.54423083delA		0					CDC20B_ENST00000296733.1_Splice_Site|CDC20B_ENST00000334206.5_Splice_Site|CDC20B_ENST00000322374.6_Splice_Site				1	2	3	2.098585	Q86Y33	CD20B_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.225)	8	1135	-		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Splice_Site	DEL	ENST00000381375.2	1	1	hg19		CCDS54852.1	0																																																																																								0.384676		TCGA-3E-AAAZ-01A-11D-A38G-08	0.383	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	0	0	1		2			0	0	0	0	255	0	255	253	1	1.810000	-20.000000	1	0.380000	NM_152623	Intron	0	123	123	0	708	687	0	0	1		0	0	0	255	0	0	1		0	0	0	0	0	123	708
FRMD4A	55691	broad.mit.edu	37	10	13696478	13696478	+	Silent	SNP	C	C	T	rs377693430		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr10:13696478C>T	ENST00000357447.2	-	23	3356	c.2988G>A	c.(2986-2988)ccG>ccA	p.P996P	FRMD4A_ENST00000358621.4_Silent_p.P981P|FRMD4A_ENST00000378503.1_Silent_p.P996P	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	996	Ser-rich.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TTTCACTTGACGGTGTCGAGC	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19859	0.0		0.0	False		,,,				2504	0.0					ENST00000357447.2	1.000000	0.070000	0.260000	0.110000	0.170000	0.226029	0.170000	0.160000																										0				41						c.(2986-2988)ccG>ccA		FERM domain containing 4A		C		1,4405	2.1+/-5.4	0,1,2202	90.0	86.0	87.0		2988	-8.3	0.1	10		87	0,8600		0,0,4300	no	coding-synonymous	FRMD4A	NM_018027.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		996/1040	13696478	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55691	15	121412	43				g.chr10:13696478C>T	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2988G>A	chr10.hg19:g.13696478C>T		0					FRMD4A_ENST00000378503.1_Silent_p.P996P|FRMD4A_ENST00000358621.4_Silent_p.P981P	p.P996P	NM_018027.3	NP_060497.3	1	2	3	2.123923	Q9P2Q2	FRM4A_HUMAN		23	3356	-			A7E2Y3|Q5T377	Silent	SNP	ENST00000357447.2	1	1	hg19	c.2988G>A	CCDS7101.1	0																																																																																								0.388138		TCGA-3E-AAAZ-01A-11D-A38G-08	0.547	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	0	0	1	2	11	2	2	1	1	1	1	80	80	80	80	1	1.810000	-3.017760	1	0.380000	NM_018027		0	7	7	0	226	221	0		0	0		1	0	80	0	0	2.187635e-01	1.286869e-01	0	0	0	18	0	7	226
IGSF22	283284	broad.mit.edu	37	11	18738405	18738405	+	Missense_Mutation	SNP	C	C	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr11:18738405C>A	ENST00000513874.1	-	10	1255	c.1116G>T	c.(1114-1116)aaG>aaT	p.K372N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	372										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TGATTTCATACTTGTCATCCC	0.527																																						ENST00000513874.1	1.000000	0.910000	1.000000	0.980000	0.990000	0.992214	0.990000	1.000000																										0				56						c.(1114-1116)aaG>aaT		immunoglobulin superfamily, member 22							255.0	252.0	253.0					11																	18738405		2078	4192	6270	SO:0001583	missense	283284	0	0					g.chr11:18738405C>A	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1116G>T	chr11.hg19:g.18738405C>A	ENSP00000421191:p.Lys372Asn	0					RP11-1081L13.4_ENST00000527285.1_RNA	p.K372N	NM_173588.3	NP_775859	0	0	0	2.063146	Q8N9C0	IGS22_HUMAN		10	1255	-			A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	1	1	hg19	c.1116G>T	CCDS41625.2	1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783844	0.70222	.	.	ENSG00000179057	ENST00000513874	T	0.44083	0.93	4.94	-0.225	0.13111	4.94	-0.225	0.13111	.	0.000000	0.37857	U	0.001902	T	0.39091	0.1065	M	0.73319	2.225	0.27060	N	0.96358	P	0.40578	0.722	B	0.39738	0.308	T	0.34650	-0.9820	10	0.45353	T	0.12	.	9.8716	0.41177	0.0:0.6398:0.0:0.3602	.	372	D6RGV7	.	N	372	ENSP00000421191:K372N	ENSP00000322422:K372N	K	-	3	2	2	IGSF22	18694981	18694981	0.334000	0.24739	0.728000	0.30774	0.997000	0.91878	-0.495000	0.06443	0.050000	0.15949	0.655000	0.94253	AAG	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.527	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	1	0	1	2	2	2	2	0	0	0	0	242	242	242	238	1	1.810000	-20.000000	1	0.380000	NM_173588		0	148	147	0	579	571	1		1			0	0	242	0	0	1	0	0	0	0	0	0	148	579
OR5M3	219482	broad.mit.edu	37	11	56237502	56237502	+	Missense_Mutation	SNP	T	T	C	rs148100298	byFrequency	TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr11:56237502T>C	ENST00000312240.2	-	1	512	c.472A>G	c.(472-474)Aca>Gca	p.T158A		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T158A(1)|p.T158P(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GTCCATAATGTTGCTGCCAGA	0.428																																						ENST00000312240.2	1.000000	0.880000	1.000000	0.950000	0.990000	0.985164	0.990000	1.000000																										2	Substitution - Missense(2)	p.T158A(1)|p.T158P(1)	ovary(1)|lung(1)	37						c.(472-474)Aca>Gca		olfactory receptor, family 5, subfamily M, member 3							122.0	112.0	115.0					11																	56237502		2201	4295	6496	SO:0001583	missense	219482	0	0					g.chr11:56237502T>C	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.472A>G	chr11.hg19:g.56237502T>C	ENSP00000312208:p.Thr158Ala	0						p.T158A	NM_001004742.2	NP_001004742.2	0	0	0	2.063146	Q8NGP4	OR5M3_HUMAN		1	512	-	Esophageal squamous(21;0.00448)		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	1	1	hg19	c.472A>G	CCDS31532.1	1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.870782	0.33069	.	.	ENSG00000174937	ENST00000312240	T	0.00256	8.42	5.22	4.07	0.47477	5.22	4.07	0.47477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000173	T	0.00412	0.0013	L	0.60904	1.88	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51411	-0.8709	10	0.48119	T	0.1	-6.2895	10.3656	0.44021	0.1471:0.0:0.0:0.8529	.	158	Q8NGP4	OR5M3_HUMAN	A	158	ENSP00000312208:T158A	ENSP00000312208:T158A	T	-	1	0	0	OR5M3	55994078	55994078	0.000000	0.05858	0.015000	0.15790	0.560000	0.35617	0.095000	0.15127	0.796000	0.33947	0.448000	0.29417	ACA	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.428	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	1	0	1	2	2	2	2	0	0	0	0	226	226	226	222	1	1.810000	-2.941315	1	0.380000	NM_001004742		0	134	133	0	541	522	1		1			0	0	226	0	0	1	0	0	0	0	0	0	134	541
PRKRIR	5612	broad.mit.edu	37	11	76063580	76063580	+	Missense_Mutation	SNP	A	A	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr11:76063580A>G	ENST00000260045.3	-	5	719	c.614T>C	c.(613-615)cTg>cCg	p.L205P	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	205					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						CCGACACTCCAGCAGTGCCTG	0.438																																						ENST00000260045.3	1.000000	0.850000	1.000000	0.950000	0.990000	0.982455	0.990000	1.000000																										0				25						c.(613-615)cTg>cCg		protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)							40.0	39.0	39.0					11																	76063580		2199	4287	6486	SO:0001583	missense	5612	0	0					g.chr11:76063580A>G	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.614T>C	chr11.hg19:g.76063580A>G	ENSP00000260045:p.Leu205Pro	0					PRKRIR_ENST00000531878.1_5'Flank	p.L205P	NM_004705.2	NP_004696.2	0	0	0	2.055980	O43422	P52K_HUMAN		5	719	-			A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	1	1	hg19	c.614T>C	CCDS8243.1	1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615922	0.66672	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	4.75	4.75	0.60458	4.75	4.75	0.60458	.	0.061993	0.64402	D	0.000003	T	0.77452	0.4132	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.80759	-0.1239	9	0.87932	D	0	.	14.5953	0.68400	1.0:0.0:0.0:0.0	.	205	O43422	P52K_HUMAN	P	30;205	.	ENSP00000260045:L205P	L	-	2	0	0	PRKRIR	75741228	75741228	1.000000	0.71417	0.993000	0.49108	0.908000	0.53690	8.562000	0.90719	1.925000	0.55765	0.397000	0.26171	CTG	0.375252		TCGA-3E-AAAZ-01A-11D-A38G-08	0.438	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	1	0	1	2	2	2	2	0	0	0	0	123	123	123	127	1	1.810000	-20.000000	1	0.380000	NM_004705		0	68	67	0	264	253	1		1	1		0	0	123	0	0	1	9.993306e-01	0	14	0	31	0	68	264
ATM	472	broad.mit.edu	37	11	108117798	108117798	+	Missense_Mutation	SNP	C	C	T	rs138398778		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr11:108117798C>T	ENST00000452508.2	+	9	1198	c.1009C>T	c.(1009-1011)Cgt>Tgt	p.R337C	ATM_ENST00000278616.4_Missense_Mutation_p.R337C			Q13315	ATM_HUMAN	ATM serine/threonine kinase	337			R -> C (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.|R -> H (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.R337C(3)|p.R337S(2)|p.F336_A340del(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTCAGGATTTCGTAATATTGC	0.323			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												ENST00000452508.2	1.000000	0.690000	1.000000	0.790000	0.890000	0.892887	0.890000	1.000000			yes	Rec	yes	Ataxia-telangiectasia	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	11q22.3	472	D, Mis, N, F, S	ataxia telangiectasia mutated				"""L, O"""	L, O		leukemia, lymphoma, medulloblastoma, glioma	T-PLL		6	Substitution - Missense(5)|Deletion - In frame(1)	p.R337C(3)|p.R337S(2)|p.F336_A340del(1)	haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	448						c.(1009-1011)Cgt>Tgt	Genes defective in diseases associated with sensitivity to DNA damaging agents	ATM serine/threonine kinase	Caffeine(DB00201)	C	CYS/ARG	0,4402		0,0,2201	60.0	61.0	61.0		1009	5.7	1.0	11	dbSNP_134	61	1,8595	1.2+/-3.3	0,1,4297	yes	missense	ATM	NM_000051.3	180	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	337/3057	108117798	1,12997	2201	4298	6499	SO:0001583	missense	472	11	121406	42	Ataxia Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	g.chr11:108117798C>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1009C>T	chr11.hg19:g.108117798C>T	ENSP00000388058:p.Arg337Cys	0	TSP Lung(14;0.12)				ATM_ENST00000278616.4_Missense_Mutation_p.R337C	p.R337C			0	0	0	2.055980	Q13315	ATM_HUMAN		9	1198	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	1	1	hg19	c.1009C>T	CCDS31669.1	1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568847	0.86439	0.0	1.16E-4	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.02369	4.32;4.62;4.62	5.72	5.72	0.89469	5.72	5.72	0.89469	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.15565	0.0375	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.00022	-1.2342	10	0.87932	D	0	.	19.8868	0.96915	0.0:1.0:0.0:0.0	.	337	Q13315	ATM_HUMAN	C	337	ENSP00000435747:R337C;ENSP00000278616:R337C;ENSP00000388058:R337C	ENSP00000278616:R337C	R	+	1	0	0	ATM	107623008	107623008	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.213000	0.58520	2.709000	0.92574	0.655000	0.94253	CGT	0.375252		TCGA-3E-AAAZ-01A-11D-A38G-08	0.323	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	1.810000	-3.270775	1	0.380000	NM_000051		0	58	57	0	279	272	1		1	0	1	0	0	97	203	0	1	3.507537e-01	1	0	30	7	175	58	279
ANAPC7	51434	broad.mit.edu	37	12	110815272	110815272	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:110815272T>C	ENST00000455511.3	-	9	1385	c.1385A>G	c.(1384-1386)aAa>aGa	p.K462R	ANAPC7_ENST00000481473.1_5'UTR|ANAPC7_ENST00000450008.2_Missense_Mutation_p.K462R	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	462					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						TAATAATGTTTTGGCTTTCTC	0.423																																						ENST00000455511.3	1.000000	0.930000	1.000000	0.990000	0.990000	0.995523	0.990000	1.000000																										0				19						c.(1384-1386)aAa>aGa		anaphase promoting complex subunit 7							251.0	213.0	226.0					12																	110815272		2203	4300	6503	SO:0001583	missense	51434	0	0					g.chr12:110815272T>C	AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1385A>G	chr12.hg19:g.110815272T>C	ENSP00000394394:p.Lys462Arg	0					ANAPC7_ENST00000481473.1_5'UTR|ANAPC7_ENST00000450008.2_Missense_Mutation_p.K462R	p.K462R	NM_016238.2	NP_057322.2	0	0	0	2.011306	Q9UJX3	APC7_HUMAN		9	1385	-			Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	ENST00000455511.3	1	1	hg19	c.1385A>G	CCDS9145.2	1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634913	0.87760	.	.	ENSG00000196510	ENST00000455511;ENST00000481473;ENST00000486321;ENST00000450008;ENST00000471602	T;T	0.78126	-1.15;0.67	5.79	5.79	0.91817	5.79	5.79	0.91817	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.80752	0.4683	L	0.37800	1.135	0.58432	D	0.999998	D;P	0.56035	0.974;0.671	D;B	0.70487	0.969;0.202	T	0.75121	-0.3429	10	0.07482	T	0.82	-10.9948	16.1303	0.81428	0.0:0.0:0.0:1.0	.	462;462	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	R	462;36;60;462;155	ENSP00000394394:K462R;ENSP00000402314:K462R	ENSP00000402314:K462R	K	-	2	0	0	ANAPC7	109299655	109299655	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.698000	0.84413	2.218000	0.71995	0.533000	0.62120	AAA	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.423	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	1	0	1	2	2	2	2	0	0	0	0	240	240	240	239	1	1.810000	-20.000000	1	0.380000	NM_016238		0	156	154	0	576	568	1		1	1		0	0	240	0	0	1	1	0	49	0	106	0	156	576
LHX5	64211	broad.mit.edu	37	12	113906184	113906184	+	Missense_Mutation	SNP	C	C	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:113906184C>G	ENST00000261731.3	-	3	996	c.423G>C	c.(421-423)ttG>ttC	p.L141F		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	141					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						GGTCCGGGGACAAACTGCGGT	0.642																																						ENST00000261731.3	1.000000	0.740000	1.000000	0.910000	0.990000	0.966564	0.990000	1.000000																										0				10						c.(421-423)ttG>ttC		LIM homeobox 5							85.0	68.0	74.0					12																	113906184		2203	4300	6503	SO:0001583	missense	64211	0	0					g.chr12:113906184C>G	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.423G>C	chr12.hg19:g.113906184C>G	ENSP00000261731:p.Leu141Phe	0						p.L141F	NM_022363.2	NP_071758.1	0	0	0	2.011306	Q9H2C1	LHX5_HUMAN		3	996	-			Q32MA4	Missense_Mutation	SNP	ENST00000261731.3	1	1	hg19	c.423G>C	CCDS9171.1	1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838936	0.51057	.	.	ENSG00000089116	ENST00000261731	D	0.91945	-2.94	4.85	2.98	0.34508	4.85	2.98	0.34508	.	0.000000	0.43747	D	0.000537	D	0.89451	0.6719	L	0.59436	1.845	0.51767	D	0.999931	P	0.40332	0.713	B	0.44044	0.439	D	0.85201	0.1015	10	0.16896	T	0.51	.	9.9534	0.41653	0.0:0.7986:0.0:0.2014	.	141	Q9H2C1	LHX5_HUMAN	F	141	ENSP00000261731:L141F	ENSP00000261731:L141F	L	-	3	2	2	LHX5	112390567	112390567	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.206000	0.32321	2.213000	0.71641	0.491000	0.48974	TTG	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.642	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.810000	-20.000000	1	0.380000	NM_022363		0	22	22	0	79	76	1		1			0	0	44	0	0	9.999993e-01	0	0	0	0	0	0	22	79
MLEC	9761	broad.mit.edu	37	12	121134267	121134267	+	Silent	SNP	G	G	A	rs144716658		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:121134267G>A	ENST00000228506.3	+	5	1226	c.798G>A	c.(796-798)tcG>tcA	p.S266S	RP11-173P15.3_ENST00000541383.1_RNA|MLEC_ENST00000412616.2_Missense_Mutation_p.R188Q|MLEC_ENST00000535413.1_3'UTR|RP11-173P15.3_ENST00000535720.1_RNA	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	266					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						CCTATGCCTCGGACAACAGCA	0.502																																						ENST00000228506.3	0.120000	0.020000	0.090000	0.040000	0.060000	0.071332	0.060000	0.070000																										0				16						c.(796-798)tcG>tcA		malectin		G		1,4405	2.1+/-5.4	0,1,2202	183.0	171.0	175.0		798	-2.4	1.0	12	dbSNP_134	175	0,8600		0,0,4300	no	coding-synonymous	MLEC	NM_014730.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		266/293	121134267	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9761	2	121412	40				g.chr12:121134267G>A	BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.798G>A	chr12.hg19:g.121134267G>A		0					MLEC_ENST00000535413.1_3'UTR|RP11-173P15.3_ENST00000541383.1_RNA|MLEC_ENST00000412616.2_Missense_Mutation_p.R188Q|RP11-173P15.3_ENST00000535720.1_RNA	p.S266S	NM_014730.2	NP_055545.1	0	0	0	2.011306	Q14165	MLEC_HUMAN		5	1226	+				Silent	SNP	ENST00000228506.3	0	1	hg19	c.798G>A	CCDS9206.1	0	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572146	0.28092	2.27E-4	0.0	ENSG00000110917	ENST00000412616	.	.	.	5.43	-2.37	0.06643	5.43	-2.37	0.06643	.	.	.	.	.	T	0.23926	0.0579	.	.	.	0.22156	N	0.999323	.	.	.	.	.	.	T	0.31668	-0.9935	5	0.45353	T	0.12	.	1.5104	0.02494	0.3009:0.0872:0.3554:0.2565	.	.	.	.	Q	188	.	ENSP00000440746:R188Q	R	+	2	0	0	MLEC	119618650	119618650	0.974000	0.33945	0.996000	0.52242	0.982000	0.71751	0.103000	0.15292	-0.107000	0.12088	-1.008000	0.02478	CGG	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.502	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	0	0	1	2	2	2	2	0	0	0	0	266	266	266	265	1	1.810000	-1.807407	0	0.380000	NM_014730		0	10	10	0	773	755	0		1	1		0	0	266	0	0	9.964880e-01	8.067091e-01	0	5	0	232	0	10	773
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.930000	0.560000	0.840000	0.640000	0.730000	0.747354	0.730000	0.740000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	0	0	2.011306	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	97	1	1.810000	-19.999950	1	0.380000	NM_033360		2010	52	51	6000	306	297	1	1	1	1	1	0	0	97	369	1	1	8.929242e-01	1	7	38	18	274	52	306
SLC16A7	9194	broad.mit.edu	37	12	60173406	60173406	+	Silent	SNP	C	C	T	rs3763979	byFrequency	TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:60173406C>T	ENST00000261187.4	+	5	1547	c.1383C>T	c.(1381-1383)aaC>aaT	p.N461N	SLC16A7_ENST00000552024.1_Silent_p.N461N|SLC16A7_ENST00000552432.1_Silent_p.N461N|SLC16A7_ENST00000547379.1_Silent_p.N461N|SLC16A7_ENST00000543448.1_Silent_p.N362N	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	461					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	AAGATGTTAACGTCAAAGTTT	0.373													c|||	401	0.0800719	0.0484	0.0576	5008	,	,		16539	0.0238		0.0845	False		,,,				2504	0.1922					ENST00000261187.4	1.000000	0.570000	0.960000	0.690000	0.820000	0.824857	0.820000	1.000000																										0				30						c.(1381-1383)aaC>aaT		solute carrier family 16 (monocarboxylate transporter), member 7	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	T		271,4135	151.0+/-185.0	7,257,1939	83.0	77.0	79.0		1383	-9.7	0.0	12	dbSNP_107	79	736,7864	177.0+/-226.7	35,666,3599	no	coding-synonymous	SLC16A7	NM_004731.3		42,923,5538	TT,TC,CC		8.5581,6.1507,7.7426		461/479	60173406	1007,11999	2203	4300	6503	SO:0001819	synonymous_variant	9194	10588	121356	70				g.chr12:60173406C>T	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.1383C>T	chr12.hg19:g.60173406C>T		0					SLC16A7_ENST00000547379.1_Silent_p.N461N|SLC16A7_ENST00000552432.1_Silent_p.N461N|SLC16A7_ENST00000543448.1_Silent_p.N362N|SLC16A7_ENST00000552024.1_Silent_p.N461N	p.N461N	NM_004731.4	NP_004722.2	0	0	0	2.011306	O60669	MOT2_HUMAN		5	1547	+			Q8NEM3|Q9UPB3	Silent	SNP	ENST00000261187.4	1	0	hg19	c.1383C>T	CCDS8961.1	0																																																																																								0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.373	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.810000	-1.741521	0	0.380000	NM_004731		0	30	29	0	156	155	1		1	0		0	0	68	0	0	1	5.018894e-01	0	0	0	10	0	30	156
AVPR1A	552	broad.mit.edu	37	12	63543857	63543857	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:63543857G>A	ENST00000299178.2	-	1	865	c.760C>T	c.(760-762)Cgc>Tgc	p.R254C		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	254					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.R254C(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	TTGCTCTGGCGCGACGCCGTC	0.617																																						ENST00000299178.2	1.000000	0.870000	1.000000	0.940000	0.990000	0.980840	0.990000	1.000000																										1	Substitution - Missense(1)	p.R254C(1)	prostate(1)	26						c.(760-762)Cgc>Tgc		arginine vasopressin receptor 1A	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)						96.0	96.0	96.0					12																	63543857		2203	4300	6503	SO:0001583	missense	552	0	0					g.chr12:63543857G>A	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.760C>T	chr12.hg19:g.63543857G>A	ENSP00000299178:p.Arg254Cys	0						p.R254C	NM_000706.4	NP_000697.1	0	0	0	2.011306	P37288	V1AR_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.193)	1	865	-				Missense_Mutation	SNP	ENST00000299178.2	1	1	hg19	c.760C>T	CCDS8965.1	1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921813	0.33908	.	.	ENSG00000166148	ENST00000550940;ENST00000299178	T;T	0.73469	-0.75;-0.75	5.29	1.6	0.23607	5.29	1.6	0.23607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38959	N	0.001512	T	0.59115	0.2170	L	0.39514	1.22	0.21220	N	0.999759	B	0.19817	0.039	B	0.21546	0.035	T	0.40270	-0.9572	9	.	.	.	-13.3074	5.8336	0.18594	0.1974:0.3561:0.4465:0.0	.	254	P37288	V1AR_HUMAN	C	35;254	ENSP00000449822:R35C;ENSP00000299178:R254C	.	R	-	1	0	0	AVPR1A	61830124	61830124	0.001000	0.12720	0.135000	0.22099	0.903000	0.53119	0.341000	0.19909	1.224000	0.43551	0.455000	0.32223	CGC	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.617	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1	1	0	1	2	2	2	2	0	0	0	0	221	221	221	220	1	1.810000	-20.000000	1	0.380000			0	140	140	0	557	550	1		1	0		0	0	221	0	0	1	1.060643e-01	0	0	0	3	0	140	557
DNAH10	196385	broad.mit.edu	37	12	124326011	124326011	+	Missense_Mutation	SNP	C	C	T	rs373004317		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr12:124326011C>T	ENST00000409039.3	+	29	4950	c.4925C>T	c.(4924-4926)aCg>aTg	p.T1642M		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1642	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GACTGGATGACGGCAGTTTTG	0.463																																						ENST00000409039.3	1.000000	0.720000	1.000000	0.810000	0.900000	0.903182	0.900000	1.000000																										0				52						c.(4924-4926)aCg>aTg		dynein, axonemal, heavy chain 10		C	MET/THR	0,3956		0,0,1978	141.0	145.0	144.0		4925	5.2	0.9	12		144	3,8305		0,3,4151	no	missense	DNAH10	NM_207437.3	81	0,3,6129	TT,TC,CC		0.0361,0.0,0.0245	probably-damaging	1642/4472	124326011	3,12261	1978	4154	6132	SO:0001583	missense	196385	17	120916	46				g.chr12:124326011C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.4925C>T	chr12.hg19:g.124326011C>T	ENSP00000386770:p.Thr1642Met	0						p.T1642M	NM_207437.3	NP_997320.2	0	0	0	2.011306	Q8IVF4	DYH10_HUMAN		29	4950	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	1	1	hg19	c.4925C>T	CCDS9255.2	1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671082	0.47781	0.0	3.61E-4	ENSG00000197653	ENST00000409039	T	0.61510	0.1	5.23	5.23	0.72850	5.23	5.23	0.72850	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	U	0.000001	T	0.77644	0.4161	M	0.81942	2.565	0.58432	D	0.999995	D	0.89917	1.0	D	0.75484	0.986	T	0.77550	-0.2546	10	0.39692	T	0.17	.	18.7853	0.91952	0.0:1.0:0.0:0.0	.	1642	Q8IVF4	DYH10_HUMAN	M	1642	ENSP00000386770:T1642M	ENSP00000386770:T1642M	T	+	2	0	0	DNAH10	122891964	122891964	1.000000	0.71417	0.945000	0.38365	0.206000	0.24218	4.564000	0.60830	2.457000	0.83068	0.561000	0.74099	ACG	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.463	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3	1	0	1	2	2	2	2	0	0	0	0	138	138	138	138	1	1.810000	-20.000000	1	0.380000			0	75	72	0	346	337	1		1			0	0	138	0	0	1	0	0	0	0	0	0	75	346
MYO16	23026	broad.mit.edu	37	13	109777647	109777647	+	Silent	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr13:109777647C>T	ENST00000357550.2	+	29	3698	c.3657C>T	c.(3655-3657)aaC>aaT	p.N1219N	MYO16_ENST00000356711.2_Silent_p.N1219N|MYO16_ENST00000457511.2_Silent_p.N731N	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GTGAAATGAACGCTCCCTACC	0.458																																						ENST00000357550.2	1.000000	0.550000	0.910000	0.650000	0.770000	0.786874	0.770000	1.000000																										0				121						c.(3655-3657)aaC>aaT		myosin XVI							62.0	58.0	59.0					13																	109777647		2203	4300	6503	SO:0001819	synonymous_variant	23026	3	121412	35				g.chr13:109777647C>T		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3657C>T	chr13.hg19:g.109777647C>T		0					MYO16_ENST00000356711.2_Silent_p.N1219N|MYO16_ENST00000457511.2_Silent_p.N731N	p.N1219N	NM_001198950.1	NP_001185879.1	0	0	0	2.029422			BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)	29	3698	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)			Silent	SNP	ENST00000357550.2	1	1	hg19	c.3657C>T	CCDS32008.1	0																																																																																								0.365534		TCGA-3E-AAAZ-01A-11D-A38G-08	0.458	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.810000	-20.000000	1	0.380000	NM_015011		0	32	32	0	179	178	0		1	0		0	0	66	0	0	1	0	0	0	0	1	0	32	179
BAHD1	22893	broad.mit.edu	37	15	40756141	40756141	+	Missense_Mutation	SNP	C	C	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr15:40756141C>G	ENST00000416165.1	+	4	1968	c.1897C>G	c.(1897-1899)Ctt>Gtt	p.L633V	RP11-64K12.8_ENST00000559730.1_RNA|BAHD1_ENST00000560846.1_Missense_Mutation_p.L633V|BAHD1_ENST00000561234.1_Missense_Mutation_p.L632V	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	633	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		GGACACCGTCCTTCTCAAATC	0.592																																						ENST00000416165.1	1.000000	0.830000	1.000000	0.950000	0.990000	0.981676	0.990000	1.000000																										0				28						c.(1897-1899)Ctt>Gtt		bromo adjacent homology domain containing 1							106.0	94.0	98.0					15																	40756141		2203	4300	6503	SO:0001583	missense	22893	0	0					g.chr15:40756141C>G	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.1897C>G	chr15.hg19:g.40756141C>G	ENSP00000396976:p.Leu633Val	1					BAHD1_ENST00000561234.1_Missense_Mutation_p.L632V|BAHD1_ENST00000560846.1_Missense_Mutation_p.L633V|RP11-64K12.8_ENST00000559730.1_RNA	p.L633V	NM_014952.3	NP_055767.3	0	1	1	1.771745	Q8TBE0	BAHD1_HUMAN		4	1968	+		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	ENST00000416165.1	1	1	hg19	c.1897C>G	CCDS10058.1	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871132	0.91587	.	.	ENSG00000140320	ENST00000416165	D	0.86865	-2.18	5.28	5.28	0.74379	5.28	5.28	0.74379	Bromo adjacent homology (BAH) domain (3);	0.068049	0.64402	D	0.000012	D	0.92018	0.7471	L	0.55103	1.725	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.959;0.998;0.997	D	0.90870	0.4745	10	0.41790	T	0.15	-24.8954	19.0957	0.93249	0.0:1.0:0.0:0.0	.	633;633;632	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	V	633	ENSP00000396976:L633V	ENSP00000396976:L633V	L	+	1	0	0	BAHD1	38543433	38543433	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.606000	0.67641	2.755000	0.94549	0.655000	0.94253	CTT	0.276968		TCGA-3E-AAAZ-01A-11D-A38G-08	0.592	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	60	1	1.810000	-20.000000	1	0.380000	NM_014952		0	43	42	0	129	125	1		1	1		0	0	63	0	0	1	9.999708e-01	0	16	0	36	0	43	129
LINGO1	84894	broad.mit.edu	37	15	77906745	77906745	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr15:77906745C>T	ENST00000355300.6	-	2	1678	c.1504G>A	c.(1504-1506)Gcg>Acg	p.A502T	LINGO1_ENST00000561030.1_Missense_Mutation_p.A496T	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	502	Ig-like C2-type.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						TTGCCGCCCGCGTTGGCCGCG	0.637																																						ENST00000355300.6	0.640000	0.220000	0.530000	0.300000	0.400000	0.423058	0.400000	0.400000																										0				31						c.(1504-1506)Gcg>Acg		leucine rich repeat and Ig domain containing 1							40.0	44.0	43.0					15																	77906745		2132	4216	6348	SO:0001583	missense	84894	1	121040	20				g.chr15:77906745C>T	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1504G>A	chr15.hg19:g.77906745C>T	ENSP00000347451:p.Ala502Thr	1					LINGO1_ENST00000561030.1_Missense_Mutation_p.A496T	p.A502T	NM_032808.5	NP_116197.4	0	1	1	1.771745	Q96FE5	LIGO1_HUMAN		2	1678	-			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	1	1	hg19	c.1504G>A	CCDS45313.1	0	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222208	0.79464	.	.	ENSG00000169783	ENST00000355300	T	0.67171	-0.25	5.08	5.08	0.68730	5.08	5.08	0.68730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74230	0.3689	L	0.55743	1.74	0.80722	D	1	D	0.63046	0.992	P	0.57679	0.825	T	0.70303	-0.4909	10	0.22706	T	0.39	.	18.482	0.90815	0.0:1.0:0.0:0.0	.	502	Q96FE5	LIGO1_HUMAN	T	502	ENSP00000347451:A502T	ENSP00000347451:A502T	A	-	1	0	0	LINGO1	75693800	75693800	1.000000	0.71417	0.996000	0.52242	0.770000	0.43624	7.818000	0.86416	2.359000	0.80004	0.462000	0.41574	GCG	0.276968		TCGA-3E-AAAZ-01A-11D-A38G-08	0.637	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419546.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	1.810000	-18.262660	1	0.380000	NM_032808		0	12	12	0	122	120	0		1	0		0	0	59	0	0	9.991887e-01	2.843508e-01	0	1	0	10	0	12	122
HS3ST6	64711	broad.mit.edu	37	16	1962193	1962193	+	Nonsense_Mutation	SNP	G	G	A	rs371972747		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr16:1962193G>A	ENST00000293937.3	-	2	426	c.427C>T	c.(427-429)Cga>Tga	p.R143*	HS3ST6_ENST00000443547.1_Nonsense_Mutation_p.R112*|HS3ST6_ENST00000454677.2_Nonsense_Mutation_p.R160*			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	143					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						TCCAGGGTTCGGGGCATCAGA	0.692																																						ENST00000293937.3	1.000000	0.710000	1.000000	0.910000	0.990000	0.965184	0.990000	1.000000																										0				4						c.(427-429)Cga>Tga		heparan sulfate (glucosamine) 3-O-sulfotransferase 6		G	stop/ARG	1,4379		0,1,2189	12.0	14.0	13.0		334	4.9	0.7	16		13	0,8588		0,0,4294	no	stop-gained	HS3ST6	NM_001009606.2		0,1,6483	AA,AG,GG		0.0,0.0228,0.0077		112/312	1962193	1,12967	2190	4294	6484	SO:0001587	stop_gained	64711	3	112292	24				g.chr16:1962193G>A			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.427C>T	chr16.hg19:g.1962193G>A	ENSP00000293937:p.Arg143*	0					HS3ST6_ENST00000454677.2_Nonsense_Mutation_p.R160*|HS3ST6_ENST00000443547.1_Nonsense_Mutation_p.R112*	p.R143*			0	0	0	2.064610	Q96QI5	HS3S6_HUMAN		2	426	-			Q96RX7	Nonsense_Mutation	SNP	ENST00000293937.3	0	1	hg19	c.427C>T		1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316851	0.40996	2.28E-4	0.0	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	.	.	.	4.91	4.91	0.64330	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2723	0.54712	0.0:0.0:0.8304:0.1696	.	.	.	.	X	143;112;182	.	ENSP00000293937:R143X	R	-	1	2	2	HS3ST6	1902194	1902194	0.990000	0.36364	0.651000	0.29564	0.066000	0.16364	2.443000	0.44881	2.287000	0.76781	0.555000	0.69702	CGA	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.692	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.810000	-20.000000	1	0.380000	NM_001009606		0	16	16	0	57	55	1		1	0		0	0	27	0	0	9.999592e-01	0	0	1	0	0	0	16	57
DNAH3	55567	broad.mit.edu	37	16	21049118	21049118	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr16:21049118C>T	ENST00000261383.3	-	34	4914	c.4915G>A	c.(4915-4917)Gcc>Acc	p.A1639T	DNAH3_ENST00000415178.1_Missense_Mutation_p.A1639T	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1639					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AAGAACTTGGCCAGATTGACA	0.498																																						ENST00000261383.3	0.290000	0.040000	0.210000	0.070000	0.130000	0.148383	0.130000	0.120000																										0				202						c.(4915-4917)Gcc>Acc		dynein, axonemal, heavy chain 3							143.0	112.0	122.0					16																	21049118		2201	4300	6501	SO:0001583	missense	55567	0	0					g.chr16:21049118C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4915G>A	chr16.hg19:g.21049118C>T	ENSP00000261383:p.Ala1639Thr	0					DNAH3_ENST00000415178.1_Missense_Mutation_p.A1639T	p.A1639T	NM_017539.1	NP_060009.1	0	0	0	2.064610	Q8TD57	DYH3_HUMAN		34	4914	-			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	0	1	hg19	c.4915G>A	CCDS10594.1	0	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773845	0.69992	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.39592	1.07;1.07	5.6	5.6	0.85130	5.6	5.6	0.85130	.	0.127782	0.51477	D	0.000088	T	0.69566	0.3125	M	0.89214	3.015	0.80722	D	1	D	0.76494	0.999	P	0.61275	0.886	T	0.75795	-0.3192	10	0.87932	D	0	.	19.6229	0.95667	0.0:1.0:0.0:0.0	.	1639	Q8TD57	DYH3_HUMAN	T	1639	ENSP00000261383:A1639T;ENSP00000394245:A1639T	ENSP00000261383:A1639T	A	-	1	0	0	DNAH3	20956619	20956619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.920000	0.56446	2.648000	0.89879	0.561000	0.74099	GCC	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	0	0	1	2	2	2	2	1	1	1	0	62	62	62	61	1	1.810000	-3.362364	1	0.380000	NM_017539		0	4	4	0	169	168	0		1			1	0	62	0	0	8.899516e-01	0	0	0	0	0	0	4	169
ZNF688	146542	broad.mit.edu	37	16	30581656	30581656	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr16:30581656G>A	ENST00000223459.6	-	3	1516	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C	AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000395219.1_Missense_Mutation_p.R124C	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						TCAGGGTTGCGTTCCACCAGC	0.607																																						ENST00000223459.6	1.000000	0.840000	1.000000	0.940000	0.990000	0.979272	0.990000	1.000000																										0				8						c.(412-414)Cgc>Tgc		zinc finger protein 688							49.0	46.0	47.0					16																	30581656		2197	4300	6497	SO:0001583	missense	146542	7	121412	39				g.chr16:30581656G>A	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.412C>T	chr16.hg19:g.30581656G>A	ENSP00000223459:p.Arg138Cys	0					ZNF688_ENST00000395219.1_Missense_Mutation_p.R124C|AC002310.7_ENST00000492040.1_RNA|AC002310.7_ENST00000486926.1_RNA	p.R138C	NM_145271.3	NP_660314.1	0	0	0	2.064610	P0C7X2	ZN688_HUMAN		3	1516	-			A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000223459.6	1	1	hg19	c.412C>T	CCDS10684.1	1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342937	0.24339	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.04360	3.64;3.85	4.38	2.33	0.28932	4.38	2.33	0.28932	.	.	.	.	.	T	0.03477	0.0100	N	0.22421	0.69	0.09310	N	1	P;D	0.53151	0.696;0.958	B;B	0.38296	0.186;0.27	T	0.44498	-0.9324	9	0.51188	T	0.08	.	8.6385	0.33964	0.0939:0.1533:0.7528:0.0	.	138;124	P0C7X2;A8MV39	ZN688_HUMAN;.	C	124;138	ENSP00000378645:R124C;ENSP00000223459:R138C	ENSP00000223459:R138C	R	-	1	0	0	ZNF688	30489157	30489157	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.659000	0.24994	0.191000	0.20236	-1.151000	0.01829	CGC	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.607	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	1	0	0	2	2	2	2	0	0	0	0	101	101	101	101	1	1.810000	-20.000000	1	0.380000	NM_145271		0	67	67	0	265	261	1		1	1		0	0	101	0	0	1	1	0	21	0	88	0	67	265
CPNE2	221184	broad.mit.edu	37	16	57153169	57153169	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr16:57153169G>A	ENST00000535318.2	+	7	931	c.570G>A	c.(568-570)tgG>tgA	p.W190*	CPNE2_ENST00000565874.1_Nonsense_Mutation_p.W190*|CPNE2_ENST00000290776.8_Nonsense_Mutation_p.W190*|CPNE2_ENST00000537605.1_Nonsense_Mutation_p.W88*			Q96FN4	CPNE2_HUMAN	copine II	190	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				ATGGCAAGTGGATGCTGGTCC	0.582																																						ENST00000535318.2	1.000000	0.690000	0.950000	0.770000	0.850000	0.863851	0.850000	1.000000																										0				21						c.(568-570)tgG>tgA		copine II							103.0	93.0	97.0					16																	57153169		2198	4300	6498	SO:0001587	stop_gained	221184	0	0					g.chr16:57153169G>A		CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.570G>A	chr16.hg19:g.57153169G>A	ENSP00000439018:p.Trp190*	0					CPNE2_ENST00000290776.8_Nonsense_Mutation_p.W190*|CPNE2_ENST00000537605.1_Nonsense_Mutation_p.W88*|CPNE2_ENST00000565874.1_Nonsense_Mutation_p.W190*	p.W190*			0	0	0	2.064610	Q96FN4	CPNE2_HUMAN		7	931	+		all_neural(199;0.224)	Q68D19|Q719H8|Q86XP9	Nonsense_Mutation	SNP	ENST00000535318.2	0	1	hg19	c.570G>A	CCDS10774.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.004895	0.99315	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	.	.	.	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2675	19.397	0.94611	0.0:0.0:1.0:0.0	.	.	.	.	X	190;88;190	.	ENSP00000290776:W190X	W	+	3	0	0	CPNE2	55710670	55710670	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.845000	0.99498	2.594000	0.87642	0.555000	0.69702	TGG	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.582	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	1	0	1	2	2	2	2	0	0	0	0	152	152	152	151	1	1.810000	-20.000000	1	0.380000	NM_152727		0	77	75	0	391	380	1		1	0		0	0	152	0	0	1	9.996848e-01	0	1	0	61	0	77	391
ZNF821	55565	broad.mit.edu	37	16	71894200	71894200	+	Silent	SNP	C	C	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr16:71894200C>A	ENST00000565601.1	-	7	1367	c.960G>T	c.(958-960)ctG>ctT	p.L320L	ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000313565.6_Silent_p.L278L|ZNF821_ENST00000446827.2_Silent_p.L278L|ZNF821_ENST00000425432.1_Silent_p.L320L|ZNF821_ENST00000564134.1_3'UTR	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						GATCCCGCTGCAGCCGGCGTG	0.672																																						ENST00000565601.1	1.000000	0.050000	0.240000	0.090000	0.150000	0.188390	0.150000	0.140000																										0				13						c.(958-960)ctG>ctT		zinc finger protein 821							26.0	27.0	27.0					16																	71894200		2196	4298	6494	SO:0001819	synonymous_variant	55565	0	0					g.chr16:71894200C>A	AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.960G>T	chr16.hg19:g.71894200C>A		0					ZNF821_ENST00000446827.2_Silent_p.L278L|ZNF821_ENST00000564134.1_3'UTR|ZNF821_ENST00000425432.1_Silent_p.L320L|ZNF821_ENST00000313565.6_Silent_p.L278L|ATXN1L_ENST00000569119.1_Intron	p.L320L	NM_001201553.1	NP_001188482.1	1	2	3	2.079998	O75541	ZN821_HUMAN		7	1367	-			A6NK48|B4DKK4|D3DWS3	Silent	SNP	ENST00000565601.1	0	1	hg19	c.960G>T	CCDS56006.1	0																																																																																								0.384676		TCGA-3E-AAAZ-01A-11D-A38G-08	0.672	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1	0	0	0	2	2	2	2	0	0	0	0	75	75	75	74	1	1.810000	-7.228993	1	0.380000	NM_017530		0	5	5	0	185	182	0		1	0		0	0	75	0	0	9.357407e-01	3.071684e-01	0	0	0	36	0	5	185
CHMP1A	5119	broad.mit.edu	37	16	89718035	89718035	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			T	C	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr16:89718035T>C	ENST00000397901.3	-	3	303	c.47A>G	c.(46-48)gAg>gGg	p.E16G	CHMP1A_ENST00000547614.1_5'UTR|CHMP1A_ENST00000535997.2_5'UTR|CHMP1A_ENST00000253475.5_Silent_p.G9G|CHMP1A_ENST00000550102.1_Missense_Mutation_p.E16G	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A	16					cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		GGCCAGCTTCTCCAGCTGCTT	0.632																																						ENST00000397901.3	0.350000	0.060000	0.260000	0.110000	0.170000	0.190255	0.170000	0.160000																										0				3						c.(46-48)gAg>gGg		charged multivesicular body protein 1A							62.0	69.0	67.0					16																	89718035		2024	4179	6203	SO:0001583	missense	5119	0	0					g.chr16:89718035T>C	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.47A>G	chr16.hg19:g.89718035T>C	ENSP00000380998:p.Glu16Gly	0					CHMP1A_ENST00000535997.2_5'UTR|CHMP1A_ENST00000550102.1_Missense_Mutation_p.E16G|CHMP1A_ENST00000253475.5_Silent_p.G9G|CHMP1A_ENST00000547614.1_5'UTR	p.E16G	NM_002768.3	NP_002759.2	0	1	1	2.068558	Q9HD42	CHM1A_HUMAN		3	303	-		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)	A2RU09|Q14468|Q15779|Q96G31	Missense_Mutation	SNP	ENST00000397901.3	0	1	hg19	c.47A>G	CCDS45552.1	0	.	.	.	.	.	.	.	.	.	.	T	18.38	3.611348	0.66558	.	.	ENSG00000131165	ENST00000397901;ENST00000550102	T;T	0.74106	-0.81;-0.81	4.81	4.81	0.61882	4.81	4.81	0.61882	.	.	.	.	.	T	0.70202	0.3197	.	.	.	0.80722	D	1	P	0.38300	0.626	B	0.40782	0.34	T	0.69101	-0.5234	7	.	.	.	-1.7391	14.6528	0.68811	0.0:0.0:0.0:1.0	.	16	Q9HD42	CHM1A_HUMAN	G	16	ENSP00000380998:E16G;ENSP00000449243:E16G	.	E	-	2	0	0	CHMP1A	88245536	88245536	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.600000	0.82769	1.905000	0.55150	0.533000	0.62120	GAG	0.378820		TCGA-3E-AAAZ-01A-11D-A38G-08	0.632	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	0	0	0	2	2	2	2	0	0	0	0	55	55	55	54	1	1.810000	-7.528092	1	0.380000	NM_002768		0	5	4	0	157	154	0		1	0		0	0	55	0	0	9.343588e-01	9.970741e-01	0	0	0	399	0	5	157
COASY	80347	broad.mit.edu	37	17	40714982	40714982	+	Silent	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr17:40714982G>A	ENST00000393818.2	+	1	798	c.342G>A	c.(340-342)gtG>gtA	p.V114V	COASY_ENST00000449624.1_De_novo_Start_InFrame|COASY_ENST00000421097.2_Silent_p.V114V|COASY_ENST00000590958.1_Silent_p.V143V|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000420359.1_Silent_p.V114V	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	114					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CAGAAGTCGTGTTGACAGATT	0.562																																						ENST00000393818.2	0.560000	0.370000	0.520000	0.420000	0.460000	0.473052	0.460000	0.470000																										0				21						c.(340-342)gtG>gtA		CoA synthase							160.0	156.0	157.0					17																	40714982		2203	4300	6503	SO:0001819	synonymous_variant	80347	0	0					g.chr17:40714982G>A	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.342G>A	chr17.hg19:g.40714982G>A		0					COASY_ENST00000420359.1_Silent_p.V114V|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000590958.1_Silent_p.V143V|COASY_ENST00000449624.1_De_novo_Start_InFrame|COASY_ENST00000421097.2_Silent_p.V114V	p.V114V	NM_025233.6	NP_079509.5	0	1	1	2.074202	Q13057	COASY_HUMAN		1	798	+		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Silent	SNP	ENST00000393818.2	1	0	hg19	c.342G>A	CCDS11429.1	0	.	.	.	.	.	.	.	.	.	.	G	10.94	1.491978	0.26774	.	.	ENSG00000068120	ENST00000426807	.	.	.	5.57	-0.966	0.10320	5.57	-0.966	0.10320	.	0.000000	0.85682	D	0.000000	T	0.53126	0.1777	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51220	-0.8733	6	0.87932	D	0	-22.1199	1.666	0.02802	0.1574:0.2286:0.3692:0.2448	.	.	.	.	I	90	.	ENSP00000390306:V90I	V	+	1	0	0	COASY	37968508	37968508	0.995000	0.38212	0.998000	0.56505	0.922000	0.55478	0.457000	0.21875	0.008000	0.14787	-0.305000	0.09177	GTT	0.378820		TCGA-3E-AAAZ-01A-11D-A38G-08	0.562	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	1	0	1	2	2	2	2	0	0	0	0	293	293	293	292	1	1.810000	-19.997890	1	0.380000	NM_025233		0	91	91	0	927	900	1		1	1		0	0	293	0	0	1	9.998678e-01	0	12	0	117	0	91	927
C17orf53	78995	broad.mit.edu	37	17	42225373	42225373	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr17:42225373C>T	ENST00000319977.4	+	3	439	c.202C>T	c.(202-204)Ccc>Tcc	p.P68S	C17orf53_ENST00000245382.6_Missense_Mutation_p.P68S|C17orf53_ENST00000585683.1_Missense_Mutation_p.P68S	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	68										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCCACTGCTCCCTCAGAGGC	0.622																																						ENST00000319977.4	1.000000	0.860000	1.000000	0.950000	0.990000	0.983862	0.990000	1.000000																										0				22						c.(202-204)Ccc>Tcc		chromosome 17 open reading frame 53							84.0	71.0	76.0					17																	42225373		2203	4300	6503	SO:0001583	missense	78995	0	0					g.chr17:42225373C>T	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.202C>T	chr17.hg19:g.42225373C>T	ENSP00000313500:p.Pro68Ser	0					C17orf53_ENST00000585683.1_Missense_Mutation_p.P68S|C17orf53_ENST00000245382.6_Missense_Mutation_p.P68S	p.P68S	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	0	1	1	2.074202	Q8N3J3	CQ053_HUMAN		3	439	+		Breast(137;0.0364)|Prostate(33;0.0376)	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	1	1	hg19	c.202C>T	CCDS11477.1	1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604612	0.28623	.	.	ENSG00000125319	ENST00000319977;ENST00000245382;ENST00000253405	T;T	0.49139	0.79;0.79	5.28	2.2	0.27929	5.28	2.2	0.27929	.	0.378727	0.22038	N	0.065500	T	0.38558	0.1045	L	0.55481	1.735	0.09310	N	1	B;B;B	0.29646	0.084;0.253;0.084	B;B;B	0.29663	0.022;0.105;0.022	T	0.30297	-0.9983	10	0.51188	T	0.08	-0.8579	6.2724	0.20961	0.0:0.6818:0.1524:0.1659	.	68;68;68	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	S	68	ENSP00000313500:P68S;ENSP00000245382:P68S	ENSP00000245382:P68S	P	+	1	0	0	C17orf53	39580899	39580899	0.001000	0.12720	0.001000	0.08648	0.044000	0.14063	0.181000	0.16880	0.362000	0.24319	0.561000	0.74099	CCC	0.378820		TCGA-3E-AAAZ-01A-11D-A38G-08	0.622	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	1	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	1.810000	-3.497239	1	0.380000	NM_024032		0	85	81	0	336	326	1		1	1		0	0	135	0	0	1	1.866122e-01	0	3	0	1	0	85	336
SLC16A13	201232	broad.mit.edu	37	17	6941599	6941599	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr17:6941599T>C	ENST00000308027.6	+	3	780	c.472T>C	c.(472-474)Ttt>Ctt	p.F158L		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	158						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.F158L(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						ATTTGCCCCCTTTTTCCAGTG	0.652																																						ENST00000308027.6	0.180000	0.020000	0.130000	0.040000	0.080000	0.091290	0.080000	0.080000																										1	Substitution - Missense(1)	p.F158L(1)	lung(1)	10						c.(472-474)Ttt>Ctt		solute carrier family 16, member 13							62.0	66.0	64.0					17																	6941599		2203	4300	6503	SO:0001583	missense	201232	0	0					g.chr17:6941599T>C	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.472T>C	chr17.hg19:g.6941599T>C	ENSP00000309751:p.Phe158Leu	0						p.F158L	NM_201566.2	NP_963860.1	0	1	1	2.074202	Q7RTY0	MOT13_HUMAN		3	780	+			A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	ENST00000308027.6	0	1	hg19	c.472T>C	CCDS11085.1	0	.	.	.	.	.	.	.	.	.	.	T	4.647	0.120233	0.08881	.	.	ENSG00000174327	ENST00000308027	T	0.48522	0.81	5.54	-1.46	0.08800	5.54	-1.46	0.08800	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.192516	0.46442	N	0.000288	T	0.13713	0.0332	N	0.01202	-0.96	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.38001	-0.9681	10	0.02654	T	1	.	10.4076	0.44274	0.0:0.5248:0.0:0.4752	.	158	Q7RTY0	MOT13_HUMAN	L	158	ENSP00000309751:F158L	ENSP00000309751:F158L	F	+	1	0	0	SLC16A13	6882323	6882323	0.479000	0.25925	0.535000	0.28026	0.981000	0.71138	1.161000	0.31773	-0.053000	0.13289	-0.313000	0.08912	TTT	0.378820		TCGA-3E-AAAZ-01A-11D-A38G-08	0.652	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2	0	0	1	2	2	2	2	0	0	0	0	90	90	90	83	1	1.810000	-2.766372	1	0.380000			0	4	4	0	280	276	0		1	0		0	0	90	0	0	8.876849e-01	5.137871e-03	0	0	0	6	0	4	280
RNF43	54894	broad.mit.edu	37	17	56440904	56440904	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr17:56440904G>A	ENST00000584437.1	-	3	2388	c.433C>T	c.(433-435)Cga>Tga	p.R145*	RNF43_ENST00000581868.1_Nonsense_Mutation_p.R18*|RNF43_ENST00000583753.1_Nonsense_Mutation_p.R104*|RNF43_ENST00000577625.1_Nonsense_Mutation_p.R18*|RNF43_ENST00000577716.1_Nonsense_Mutation_p.R145*|RNF43_ENST00000500597.2_Nonsense_Mutation_p.R104*|RNF43_ENST00000407977.2_Nonsense_Mutation_p.R145*|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	145					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R145*(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCAGCAGCTCGATCCTCAGTG	0.597																																						ENST00000584437.1	1.000000	0.900000	1.000000	0.980000	0.990000	0.990858	0.990000	1.000000																										1	Substitution - Nonsense(1)	p.R145*(1)	pancreas(1)	60						c.(433-435)Cga>Tga		ring finger protein 43							127.0	122.0	123.0					17																	56440904		2203	4300	6503	SO:0001587	stop_gained	54894	0	0					g.chr17:56440904G>A		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.433C>T	chr17.hg19:g.56440904G>A	ENSP00000463069:p.Arg145*	0					RNF43_ENST00000407977.2_Nonsense_Mutation_p.R145*|RNF43_ENST00000583753.1_Nonsense_Mutation_p.R104*|RNF43_ENST00000500597.2_Nonsense_Mutation_p.R104*|RNF43_ENST00000581868.1_Nonsense_Mutation_p.R18*|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Nonsense_Mutation_p.R145*|RNF43_ENST00000577625.1_Nonsense_Mutation_p.R18*	p.R145*			1	2	3	2.079788	Q68DV7	RNF43_HUMAN		3	2388	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Nonsense_Mutation	SNP	ENST00000584437.1	0	1	hg19	c.433C>T	CCDS11607.1	1	.	.	.	.	.	.	.	.	.	.	G	44	10.601706	0.99435	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	.	.	.	5.4	4.41	0.53225	5.4	4.41	0.53225	.	0.592346	0.16161	N	0.226756	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-19.4207	8.5535	0.33467	0.0:0.1579:0.5559:0.2861	.	.	.	.	X	145;104	.	ENSP00000385328:R145X	R	-	1	2	2	RNF43	53795903	53795903	0.980000	0.34600	0.994000	0.49952	0.991000	0.79684	2.127000	0.42035	1.234000	0.43709	0.591000	0.81541	CGA	0.381176		TCGA-3E-AAAZ-01A-11D-A38G-08	0.597	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	1	2	2	2	2	0	0	0	0	235	235	235	232	1	1.810000	-3.432944	1	0.380000	NM_017763		0	138	137	0	546	526	1		1	1	1	0	0	235	765	0	1	9.976352e-01	1	16	167	22	630	138	546
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	G	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr18:45368211G>C	ENST00000402690.2	-	11	1785	c.1391C>G	c.(1390-1392)tCa>tGa	p.S464*	SMAD2_ENST00000356825.4_Nonsense_Mutation_p.S434*|SMAD2_ENST00000262160.6_Nonsense_Mutation_p.S464*|SMAD2_ENST00000586040.1_Nonsense_Mutation_p.S434*	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	464	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.S464*(4)|p.R462fs*>4(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TGACATGCTTGAGCAACGCAC	0.423																																						ENST00000402690.2	0.980000	0.620000	0.920000	0.720000	0.820000	0.824882	0.820000	0.830000																										5	Substitution - Nonsense(4)|Deletion - Frameshift(1)	p.S464*(4)|p.R462fs*>4(1)	large_intestine(4)|kidney(1)	43						c.(1390-1392)tCa>tGa		SMAD family member 2							162.0	130.0	141.0					18																	45368211		2203	4300	6503	SO:0001587	stop_gained	4087	0	0					g.chr18:45368211G>C	U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1391C>G	chr18.hg19:g.45368211G>C	ENSP00000384449:p.Ser464*	1					SMAD2_ENST00000586040.1_Nonsense_Mutation_p.S434*|SMAD2_ENST00000356825.4_Nonsense_Mutation_p.S434*|SMAD2_ENST00000262160.6_Nonsense_Mutation_p.S464*	p.S464*	NM_001003652.3	NP_001003652.1	0	1	1	1.716701	Q15796	SMAD2_HUMAN		11	1785	-				Nonsense_Mutation	SNP	ENST00000402690.2	0	1	hg19	c.1391C>G	CCDS11934.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.723736	0.98929	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	.	.	.	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	.	.	.	X	464;434;464	.	ENSP00000262160:S464X	S	-	2	0	0	SMAD2	43622209	43622209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.781000	0.99029	2.824000	0.97209	0.655000	0.94253	TCA	0.234568		TCGA-3E-AAAZ-01A-11D-A38G-08	0.423	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	1	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	1.810000	-20.000000	1	0.380000	NM_005901		0	45	45	0	182	176	0		1	1		0	0	105	0	0	1	1	0	43	0	111	0	45	182
SMAD4	4089	broad.mit.edu	37	18	48591889	48591889	+	Missense_Mutation	SNP	A	A	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr18:48591889A>C	ENST00000342988.3	+	9	1590	c.1052A>C	c.(1051-1053)gAt>gCt	p.D351A	SMAD4_ENST00000588745.1_Missense_Mutation_p.D255A|SMAD4_ENST00000398417.2_Missense_Mutation_p.D351A	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	351	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		D -> N (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GTTACTGTTGATGGATACGTG	0.438																																						ENST00000342988.3	1.000000	0.760000	0.980000	0.840000	0.910000	0.911478	0.910000	0.950000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1051-1053)gAt>gCt		SMAD family member 4							237.0	199.0	212.0					18																	48591889		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48591889A>C	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1052A>C	chr18.hg19:g.48591889A>C	ENSP00000341551:p.Asp351Ala	1					SMAD4_ENST00000588745.1_Missense_Mutation_p.D255A|SMAD4_ENST00000398417.2_Missense_Mutation_p.D351A	p.D351A	NM_005359.5	NP_005350.1	0	1	1	1.716701	Q13485	SMAD4_HUMAN		9	1590	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1052A>C	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.942647	0.92526	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98437	-4.93;-4.93	5.86	5.86	0.93980	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.044633	0.85682	D	0.000000	D	0.99239	0.9735	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99069	1.0833	10	0.87932	D	0	.	15.2431	0.73485	1.0:0.0:0.0:0.0	.	351	Q13485	SMAD4_HUMAN	A	351	ENSP00000341551:D351A;ENSP00000381452:D351A	ENSP00000341551:D351A	D	+	2	0	0	SMAD4	46845887	46845887	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.159000	0.94728	2.237000	0.73441	0.460000	0.39030	GAT	0.234568		TCGA-3E-AAAZ-01A-11D-A38G-08	0.438	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	166	166	166	165	1	1.810000	-20.000000	1	0.380000	NM_005359		0	80	79	0	274	271	1		1	1	1	0	0	166	858	0	1	1	1	44	130	67	480	80	274
NUDT19	390916	broad.mit.edu	37	19	33183406	33183406	+	Silent	SNP	G	G	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr19:33183406G>C	ENST00000397061.3	+	1	540	c.540G>C	c.(538-540)cgG>cgC	p.R180R	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	180	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					ACTTCCTGCGGCTGTGCGCCC	0.731																																						ENST00000397061.3	1.000000	0.750000	1.000000	0.970000	0.990000	0.977213	0.990000	1.000000																										0				8						c.(538-540)cgG>cgC		nudix (nucleoside diphosphate linked moiety X)-type motif 19							4.0	5.0	5.0					19																	33183406		1793	3922	5715	SO:0001819	synonymous_variant	390916	0	0					g.chr19:33183406G>C		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.540G>C	chr19.hg19:g.33183406G>C		0					CTD-2538C1.2_ENST00000592431.1_lincRNA	p.R180R	NM_001105570.1	NP_001099040.1	0	0	0	1.992977	A8MXV4	NUD19_HUMAN		1	540	+	Esophageal squamous(110;0.137)			Silent	SNP	ENST00000397061.3	1	1	hg19	c.540G>C	CCDS42543.1	1																																																																																								0.352953		TCGA-3E-AAAZ-01A-11D-A38G-08	0.731	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	1	0	1	2	2	2	2	0	0	0	0	14	14	14	12	1	1.810000	-20.000000	1	0.380000	XM_372723		0	14	11	0	42	37	0		1	1		0	0	14	0	0	9.996433e-01	8.313841e-01	0	4	0	8	0	14	42
ZNF382	84911	broad.mit.edu	37	19	37118421	37118421	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr19:37118421C>T	ENST00000292928.2	+	5	1735	c.1622C>T	c.(1621-1623)aCt>aTt	p.T541I	ZNF382_ENST00000423582.1_Missense_Mutation_p.T492I|CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000435416.1_Missense_Mutation_p.T540I|ZNF382_ENST00000439428.1_Missense_Mutation_p.T540I	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	541	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CATCAGAAAACTCACAAGGTA	0.383																																						ENST00000292928.2	0.860000	0.500000	0.770000	0.580000	0.660000	0.679741	0.660000	0.670000																										0				34						c.(1621-1623)aCt>aTt		zinc finger protein 382							66.0	65.0	65.0					19																	37118421		2203	4300	6503	SO:0001583	missense	84911	0	0					g.chr19:37118421C>T	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.1622C>T	chr19.hg19:g.37118421C>T	ENSP00000292928:p.Thr541Ile	0					ZNF382_ENST00000439428.1_Missense_Mutation_p.T540I|ZNF382_ENST00000435416.1_Missense_Mutation_p.T540I|CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000423582.1_Missense_Mutation_p.T492I	p.T541I	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	0	0	0	1.992977	Q96SR6	ZN382_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)	5	1735	+	Esophageal squamous(110;0.198)		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	1	1	hg19	c.1622C>T	CCDS33004.1	0	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.392618	0.01185	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.06687	3.27;3.38;3.39;3.4	4.35	2.24	0.28232	4.35	2.24	0.28232	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.155759	0.30277	N	0.009982	T	0.02380	0.0073	N	0.02802	-0.49	0.29661	N	0.843215	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.40997	-0.9533	10	0.07813	T	0.8	.	4.1521	0.10242	0.0:0.5955:0.1948:0.2097	.	540;540;541	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	I	492;541;540;540	ENSP00000389722:T492I;ENSP00000292928:T541I;ENSP00000407593:T540I;ENSP00000410113:T540I	ENSP00000292928:T541I	T	+	2	0	0	ZNF382	41810261	41810261	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	-0.905000	0.04075	1.192000	0.43071	0.591000	0.81541	ACT	0.352953		TCGA-3E-AAAZ-01A-11D-A38G-08	0.383	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	1	0	1	2	2	2	2	0	0	0	0	113	113	113	113	1	1.810000	-20.000000	1	0.380000	NM_032825		0	44	42	0	286	281	1		1	0		0	0	113	0	0	1	1.850031e-02	0	0	0	2	0	44	286
ZNF585B	92285	broad.mit.edu	37	19	37676154	37676154	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr19:37676154C>T	ENST00000532828.2	-	5	2536	c.2285G>A	c.(2284-2286)aGt>aAt	p.S762N	ZNF585B_ENST00000531805.1_Missense_Mutation_p.S707N|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_3'UTR|ZNF585B_ENST00000312908.5_Missense_Mutation_p.S350N	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	762					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGATGAACACTGAACACTGA	0.463																																					Melanoma(93;882 1454 18863 28917 48427)	ENST00000532828.2	1.000000	0.810000	1.000000	0.880000	0.960000	0.953679	0.960000	1.000000																										0				29						c.(2284-2286)aGt>aAt		zinc finger protein 585B							169.0	147.0	154.0					19																	37676154		2203	4300	6503	SO:0001583	missense	92285	0	0					g.chr19:37676154C>T	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.2285G>A	chr19.hg19:g.37676154C>T	ENSP00000433773:p.Ser762Asn	0					ZNF585B_ENST00000531805.1_Missense_Mutation_p.S707N|ZNF585B_ENST00000312908.5_Missense_Mutation_p.S350N|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_3'UTR	p.S762N	NM_152279.3	NP_689492.3	0	0	0	1.992977	Q52M93	Z585B_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	2536	-			Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	1	1	hg19	c.2285G>A	CCDS12500.1	1	.	.	.	.	.	.	.	.	.	.	C	5.066	0.197903	0.09652	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.15718	2.4;2.4;2.4	2.72	-0.663	0.11410	2.72	-0.663	0.11410	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.836945	0.10095	N	0.716705	T	0.08492	0.0211	N	0.16233	0.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37709	-0.9694	10	0.27082	T	0.32	.	4.5817	0.12262	0.0:0.4379:0.331:0.231	.	707;762	E9PQH3;Q52M93	.;Z585B_HUMAN	N	707;762;350	ENSP00000436774:S707N;ENSP00000433773:S762N;ENSP00000442139:S350N	ENSP00000442139:S350N	S	-	2	0	0	ZNF585B	42367994	42367994	0.000000	0.05858	0.093000	0.20910	0.199000	0.23934	-2.835000	0.00741	0.221000	0.20879	0.305000	0.20034	AGT	0.352953		TCGA-3E-AAAZ-01A-11D-A38G-08	0.463	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	1	0	1	2	2	2	2	0	0	0	0	195	195	195	192	1	1.810000	-20.000000	1	0.380000	NM_152279		0	119	115	0	498	489	1		1	0		0	0	195	0	0	1	7.813651e-01	0	1	0	13	0	119	498
RSPH6A	81492	broad.mit.edu	37	19	46307696	46307696	+	Silent	SNP	C	C	T	rs146411467		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr19:46307696C>T	ENST00000221538.3	-	3	1609	c.1467G>A	c.(1465-1467)tcG>tcA	p.S489S	RSPH6A_ENST00000600188.1_Silent_p.S225S|RSPH6A_ENST00000597055.1_Silent_p.S489S	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	489						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GCGTGGCGGCCGAGATGCGGG	0.642																																						ENST00000221538.3	0.410000	0.130000	0.330000	0.180000	0.250000	0.266610	0.250000	0.250000																										0				32						c.(1465-1467)tcG>tcA		radial spoke head 6 homolog A (Chlamydomonas)		C		0,4406		0,0,2203	45.0	45.0	45.0		1467	-1.7	1.0	19	dbSNP_134	45	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	RSPH6A	NM_030785.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		489/718	46307696	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	81492	11	121410	40				g.chr19:46307696C>T	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1467G>A	chr19.hg19:g.46307696C>T		0					RSPH6A_ENST00000600188.1_Silent_p.S225S|RSPH6A_ENST00000597055.1_Silent_p.S489S	p.S489S	NM_030785.3	NP_110412.1	0	0	0	2.053708	Q9H0K4	RSH6A_HUMAN		3	1609	-			Q53FE2|Q6PEZ9	Silent	SNP	ENST00000221538.3	1	1	hg19	c.1467G>A	CCDS12675.1	0																																																																																								0.375252		TCGA-3E-AAAZ-01A-11D-A38G-08	0.642	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1	1	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	1.810000	-3.161500	1	0.380000			0	12	12	0	239	232	0		1			0	0	78	0	0	9.990030e-01	0	0	0	0	0	0	12	239
SAE1	10055	broad.mit.edu	37	19	47646755	47646755	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr19:47646755C>T	ENST00000270225.7	+	2	171	c.103C>T	c.(103-105)Cgg>Tgg	p.R35W	SAE1_ENST00000392776.3_Missense_Mutation_p.R35W|SAE1_ENST00000413379.3_Missense_Mutation_p.R35W|SAE1_ENST00000540850.1_5'UTR|SAE1_ENST00000598840.1_Missense_Mutation_p.R35W	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	35					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)	p.R35W(2)		endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		TTACAGGCTGCGGGCCTCTCG	0.458																																						ENST00000270225.7	0.220000	0.040000	0.170000	0.070000	0.110000	0.125783	0.110000	0.110000																										2	Substitution - Missense(2)	p.R35W(2)	endometrium(2)	13						c.(103-105)Cgg>Tgg		SUMO1 activating enzyme subunit 1							81.0	80.0	80.0					19																	47646755		2203	4300	6503	SO:0001583	missense	10055	0	0					g.chr19:47646755C>T	BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.103C>T	chr19.hg19:g.47646755C>T	ENSP00000270225:p.Arg35Trp	0					SAE1_ENST00000413379.3_Missense_Mutation_p.R35W|SAE1_ENST00000540850.1_5'UTR|SAE1_ENST00000392776.3_Missense_Mutation_p.R35W|SAE1_ENST00000598840.1_Missense_Mutation_p.R35W	p.R35W	NM_005500.2	NP_005491.1	0	0	0	2.053708	Q9UBE0	SAE1_HUMAN		2	171	+		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)	B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Missense_Mutation	SNP	ENST00000270225.7	0	1	hg19	c.103C>T	CCDS12696.1	0	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049237	0.75846	.	.	ENSG00000142230	ENST00000413379;ENST00000270225;ENST00000392776;ENST00000414294	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.85	4.81	0.61882	5.85	4.81	0.61882	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	M	0.85777	2.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.86378	0.1727	10	0.72032	D	0.01	.	15.35	0.74376	0.1409:0.8591:0.0:0.0	.	35;35;35	G3XAK6;F5GXX7;Q9UBE0	.;.;SAE1_HUMAN	W	35	ENSP00000416557:R35W;ENSP00000270225:R35W;ENSP00000440818:R35W;ENSP00000398818:R35W	ENSP00000270225:R35W	R	+	1	2	2	SAE1	52338595	52338595	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.111000	0.57838	1.471000	0.48121	-0.175000	0.13238	CGG	0.375252		TCGA-3E-AAAZ-01A-11D-A38G-08	0.458	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466775.1	0	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	1.810000	-2.386746	0	0.380000	NM_005500		0	6	6	0	281	275	0		1	0		0	0	92	0	0	9.630720e-01	9.614088e-01	0	0	0	277	0	6	281
NLRP2	55655	broad.mit.edu	37	19	55494938	55494938	+	Silent	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr19:55494938G>A	ENST00000543010.1	+	6	2015	c.1872G>A	c.(1870-1872)caG>caA	p.Q624Q	NLRP2_ENST00000537859.1_Silent_p.Q602Q|NLRP2_ENST00000448584.2_Silent_p.Q624Q|NLRP2_ENST00000339757.7_Silent_p.Q602Q|NLRP2_ENST00000391721.4_Silent_p.Q600Q|NLRP2_ENST00000538819.1_Silent_p.Q600Q|NLRP2_ENST00000263437.6_Silent_p.Q621Q|NLRP2_ENST00000427260.2_Silent_p.Q601Q	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	624					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGATGGCTCAGTTCAAAGAAA	0.502																																						ENST00000543010.1	1.000000	0.850000	1.000000	0.990000	0.990000	0.987862	0.990000	1.000000																										0				11						c.(1870-1872)caG>caA		NLR family, pyrin domain containing 2							110.0	88.0	96.0					19																	55494938		2203	4300	6503	SO:0001819	synonymous_variant	55655	0	0					g.chr19:55494938G>A	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1872G>A	chr19.hg19:g.55494938G>A		0					NLRP2_ENST00000448584.2_Silent_p.Q624Q|NLRP2_ENST00000263437.6_Silent_p.Q621Q|NLRP2_ENST00000339757.7_Silent_p.Q602Q|NLRP2_ENST00000537859.1_Silent_p.Q602Q|NLRP2_ENST00000538819.1_Silent_p.Q600Q|NLRP2_ENST00000427260.2_Silent_p.Q601Q|NLRP2_ENST00000391721.4_Silent_p.Q600Q	p.Q624Q	NM_001174081.1	NP_001167552.1	1	2	3	2.083946	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	6	2015	+			B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	ENST00000543010.1	1	1	hg19	c.1872G>A	CCDS12913.1	1																																																																																								0.381176		TCGA-3E-AAAZ-01A-11D-A38G-08	0.502	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.810000	-20.000000	1	0.380000	NM_017852		0	39	39	0	139	134	1		1	1		0	0	57	0	0	1	9.999873e-01	0	59	0	7	0	39	139
CDC73	79577	broad.mit.edu	37	1	193111023	193111023	+	Missense_Mutation	SNP	A	A	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr1:193111023A>G	ENST00000367435.3	+	7	740	c.556A>G	c.(556-558)Aaa>Gaa	p.K186E		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	186				AIKA -> CNQT (in Ref. 2; BAB15608). {ECO:0000305}.	cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						TGCTGCAATCAAAGCCAAAAT	0.363																																						ENST00000367435.3	1.000000	0.650000	1.000000	0.770000	0.910000	0.898593	0.910000	1.000000																										0				87						c.(556-558)Aaa>Gaa		cell division cycle 73							54.0	49.0	51.0					1																	193111023		2203	4300	6503	SO:0001583	missense	79577	0	0					g.chr1:193111023A>G	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.556A>G	chr1.hg19:g.193111023A>G	ENSP00000356405:p.Lys186Glu	1						p.K186E	NM_024529.4	NP_078805.3	1	2	3	2.507409	Q6P1J9	CDC73_HUMAN		7	740	+			A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	1	1	hg19	c.556A>G	CCDS1382.1	1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.913112	0.92178	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.89617	-2.54	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.94009	0.8081	M	0.78916	2.43	0.80722	D	1	D	0.76494	0.999	D	0.66497	0.944	D	0.94174	0.7426	10	0.56958	D	0.05	-23.6629	16.5582	0.84512	1.0:0.0:0.0:0.0	.	186	Q6P1J9	CDC73_HUMAN	E	186	ENSP00000356405:K186E	ENSP00000356405:K186E	K	+	1	0	0	CDC73	191377646	191377646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.109000	0.94291	2.308000	0.77769	0.533000	0.62120	AAA	0.478992		TCGA-3E-AAAZ-01A-11D-A38G-08	0.363	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.810000	-20.000000	1	0.380000	NM_024529		0	35	35	0	205	204	1		1	1		0	0	76	0	0	1	9.404518e-01	0	8	0	22	0	35	205
NUAK2	81788	broad.mit.edu	37	1	205273036	205273036	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr1:205273036C>T	ENST00000367157.3	-	7	1555	c.1429G>A	c.(1429-1431)Gtg>Atg	p.V477M		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTCACAAACACGTCGCCTGCG	0.587																																						ENST00000367157.3	1.000000	0.440000	1.000000	0.560000	0.720000	0.757985	0.720000	0.660000																										0				23						c.(1429-1431)Gtg>Atg		NUAK family, SNF1-like kinase, 2							38.0	37.0	38.0					1																	205273036		2203	4300	6503	SO:0001583	missense	81788	6	121412	39				g.chr1:205273036C>T	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1429G>A	chr1.hg19:g.205273036C>T	ENSP00000356125:p.Val477Met	1						p.V477M	NM_030952.1	NP_112214.1	1	3	4	2.522300			BRCA - Breast invasive adenocarcinoma(75;0.117)	7	1555	-	Breast(84;0.186)			Missense_Mutation	SNP	ENST00000367157.3	1	1	hg19	c.1429G>A	CCDS1453.1	0	.	.	.	.	.	.	.	.	.	.	C	11.20	1.567476	0.28003	.	.	ENSG00000163545	ENST00000367157	T	0.72282	-0.64	4.86	4.86	0.63082	4.86	4.86	0.63082	.	0.000000	0.40640	N	0.001045	T	0.69187	0.3083	L	0.60455	1.87	0.28049	N	0.933438	D	0.64830	0.994	P	0.52159	0.691	T	0.65911	-0.6053	10	0.37606	T	0.19	.	4.1079	0.10045	0.1634:0.5906:0.158:0.088	.	477	Q9H093	NUAK2_HUMAN	M	477	ENSP00000356125:V477M	ENSP00000356125:V477M	V	-	1	0	0	NUAK2	203539659	203539659	0.846000	0.29590	0.989000	0.46669	0.173000	0.22820	1.357000	0.34090	2.234000	0.73211	0.407000	0.27541	GTG	0.487179		TCGA-3E-AAAZ-01A-11D-A38G-08	0.587	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.810000	-9.895783	1	0.380000	NM_030952		0	21	21	0	181	178	1		1	0		0	0	61	0	0	9.999980e-01	3.351851e-01	0	1	0	10	0	21	181
URB2	9816	broad.mit.edu	37	1	229763503	229763503	+	Silent	SNP	A	A	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr1:229763503A>G	ENST00000258243.2	+	2	259	c.123A>G	c.(121-123)gaA>gaG	p.E41E	TAF5L_ENST00000477957.1_5'Flank|TAF5L_ENST00000366675.3_5'Flank|TAF5L_ENST00000366674.1_5'Flank|TAF5L_ENST00000258281.2_5'Flank	NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	41						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CAAATAAAGAACAAGTAAGTT	0.294																																						ENST00000258243.2	1.000000	0.040000	1.000000	0.070000	0.110000	0.323202	0.110000	0.090000																										0				73						c.(121-123)gaA>gaG		URB2 ribosome biogenesis 2 homolog (S. cerevisiae)							77.0	87.0	84.0					1																	229763503		2203	4300	6503	SO:0001819	synonymous_variant	9816	0	0					g.chr1:229763503A>G	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.123A>G	chr1.hg19:g.229763503A>G		1					TAF5L_ENST00000477957.1_5'Flank|TAF5L_ENST00000258281.2_5'Flank|TAF5L_ENST00000366675.3_5'Flank|TAF5L_ENST00000366674.1_5'Flank	p.E41E	NM_014777.2	NP_055592.2	1	3	4	2.522300	Q14146	URB2_HUMAN		2	259	+			Q5VYC9	Silent	SNP	ENST00000258243.2	0	1	hg19	c.123A>G	CCDS31052.1	0																																																																																								0.487179		TCGA-3E-AAAZ-01A-11D-A38G-08	0.294	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	0	0	1	2	2	2	2	0	0	0	0	148	148	148	148	1	1.810000	-2.931921	1	0.380000	NM_014777		0	8	9	0	512	499	0		1	0		0	0	148	0	0	9.884167e-01	1.076311e-02	0	1	0	8	0	8	512
MEGF6	1953	broad.mit.edu	37	1	3411193	3411193	+	Silent	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr1:3411193C>T	ENST00000356575.4	-	31	4210	c.3984G>A	c.(3982-3984)ggG>ggA	p.G1328G	MEGF6_ENST00000294599.4_Silent_p.G1093G	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	1328	EGF-like 24. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CGCAGTGCCGCCCCGTCCAGC	0.711																																					Ovarian(73;978 3658)	ENST00000356575.4	0.980000	0.230000	0.890000	0.420000	0.670000	0.660133	0.670000	0.740000																										0				19						c.(3982-3984)ggG>ggA		multiple EGF-like-domains 6							7.0	11.0	10.0					1																	3411193		1995	4096	6091	SO:0001819	synonymous_variant	1953	0	0					g.chr1:3411193C>T	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.3984G>A	chr1.hg19:g.3411193C>T		1					MEGF6_ENST00000294599.4_Silent_p.G1093G	p.G1328G	NM_001409.3	NP_001400.3	0	1	1	1.706239	O75095	MEGF6_HUMAN		31	4210	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	0	1	hg19	c.3984G>A	CCDS41237.1	0	.	.	.	.	.	.	.	.	.	.	C	0.026	-1.369662	0.01225	.	.	ENSG00000162591	ENST00000491842	D	0.82619	-1.63	3.72	0.574	0.17368	3.72	0.574	0.17368	.	0.000000	0.85682	D	0.000000	D	0.85340	0.5674	.	.	.	0.53005	D	0.999965	.	.	.	.	.	.	D	0.84086	0.0387	7	0.66056	D	0.02	-26.2078	9.8377	0.40980	0.0:0.499:0.4156:0.0854	.	.	.	.	D	102	ENSP00000420386:G102D	ENSP00000420386:G102D	G	-	2	0	0	MEGF6	3401053	3401053	0.000000	0.05858	0.089000	0.20774	0.012000	0.07955	-0.398000	0.07259	0.312000	0.23038	0.462000	0.41574	GGC	0.234568		TCGA-3E-AAAZ-01A-11D-A38G-08	0.711	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	0	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.810000	-10.909080	1	0.380000	NM_001409		0	3	3	0	12	12	0		1	0		0	0	9	0	0	8.136201e-01	9.750119e-01	0	0	0	37	0	3	12
NLRP3	114548	broad.mit.edu	37	1	247587616	247587616	+	Missense_Mutation	SNP	G	G	A	rs145092553		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr1:247587616G>A	ENST00000336119.3	+	3	1617	c.871G>A	c.(871-873)Gtg>Atg	p.V291M	NLRP3_ENST00000391828.3_Missense_Mutation_p.V291M|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366497.2_Missense_Mutation_p.V291M|NLRP3_ENST00000366496.2_Missense_Mutation_p.V291M|NLRP3_ENST00000391827.2_Missense_Mutation_p.V291M|NLRP3_ENST00000348069.2_Missense_Mutation_p.V291M	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	291	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CCACAAGATCGTGAGAAAACC	0.562																																						ENST00000336119.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				142						c.(871-873)Gtg>Atg		NLR family, pyrin domain containing 3		G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	71.0	72.0	72.0		871,871,871,871,871	-3.9	0.1	1	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	NLRP3	NM_001079821.2,NM_001127461.2,NM_001127462.2,NM_004895.4,NM_183395.2	21,21,21,21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	291/1037,291/980,291/980,291/1037,291/923	247587616	1,13005	2203	4300	6503	SO:0001583	missense	114548	4	121412	38				g.chr1:247587616G>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.871G>A	chr1.hg19:g.247587616G>A	ENSP00000337383:p.Val291Met	1					NLRP3_ENST00000391827.2_Missense_Mutation_p.V291M|NLRP3_ENST00000348069.2_Missense_Mutation_p.V291M|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391828.3_Missense_Mutation_p.V291M|NLRP3_ENST00000366496.2_Missense_Mutation_p.V291M|NLRP3_ENST00000366497.2_Missense_Mutation_p.V291M	p.V291M	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	1	3	4	2.522300	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)	3	1617	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	1	1	hg19	c.871G>A	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	G	0.829	-0.746010	0.03065	0.0	1.16E-4	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	4.04	-3.93	0.04143	4.04	-3.93	0.04143	NACHT nucleoside triphosphatase (1);	0.890365	0.09442	N	0.801583	T	0.51381	0.1671	N	0.13003	0.285	0.09310	N	1	B;B;P;B;B	0.40602	0.07;0.057;0.723;0.194;0.038	B;B;B;B;B	0.31495	0.025;0.015;0.131;0.04;0.028	T	0.51764	-0.8664	10	0.16420	T	0.52	.	2.6671	0.05056	0.1107:0.4328:0.1811:0.2754	.	291;291;291;291;291	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	M	291	ENSP00000375704:V291M;ENSP00000355453:V291M;ENSP00000337383:V291M;ENSP00000294752:V291M;ENSP00000355452:V291M;ENSP00000375703:V291M	ENSP00000337383:V291M	V	+	1	0	0	NLRP3	245654239	245654239	0.004000	0.15560	0.095000	0.20976	0.012000	0.07955	0.080000	0.14802	-0.743000	0.04784	0.563000	0.77884	GTG	0.487179		TCGA-3E-AAAZ-01A-11D-A38G-08	0.562	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	1	0	1	2	2	2	2	0	0	0	0	156	156	156	150	1	1.810000	-20.000000	1	0.380000	NM_004895		0	168	163	0	296	282	1		1	0		0	0	156	0	0	1	2.995791e-01	0	0	0	3	0	168	296
PDYN	5173	broad.mit.edu	37	20	1961195	1961195	+	Missense_Mutation	SNP	C	C	T	rs377075531		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr20:1961195C>T	ENST00000217305.2	-	4	764	c.539G>A	c.(538-540)cGc>cAc	p.R180H	RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000539905.1_Missense_Mutation_p.R180H|PDYN_ENST00000540134.1_Missense_Mutation_p.R180H	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	180					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGGTATTTGCGCAAAAAGCC	0.602																																						ENST00000217305.2	1.000000	0.770000	1.000000	0.850000	0.940000	0.936140	0.940000	1.000000																										0				38						c.(538-540)cGc>cAc		prodynorphin							99.0	103.0	102.0					20																	1961195		2203	4300	6503	SO:0001583	missense	5173	5	121412	40				g.chr20:1961195C>T		CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.539G>A	chr20.hg19:g.1961195C>T	ENSP00000217305:p.Arg180His	0					RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000540134.1_Missense_Mutation_p.R180H|PDYN_ENST00000539905.1_Missense_Mutation_p.R180H	p.R180H	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	0	0	0	2.055692	P01213	PDYN_HUMAN		4	764	-			A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	1	1	hg19	c.539G>A	CCDS13023.1	1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772531	0.90108	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.86769	-2.17;-2.17;-2.17	4.7	4.7	0.59300	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.94162	0.8127	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95090	0.8221	10	0.87932	D	0	-18.2484	15.1657	0.72821	0.0:1.0:0.0:0.0	.	180	P01213	PDYN_HUMAN	H	180	ENSP00000440185:R180H;ENSP00000442259:R180H;ENSP00000217305:R180H	ENSP00000217305:R180H	R	-	2	0	0	PDYN	1909195	1909195	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.652000	0.61454	2.445000	0.82738	0.313000	0.20887	CGC	0.375252		TCGA-3E-AAAZ-01A-11D-A38G-08	0.602	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2	1	0	1	2	2	2	2	0	0	0	0	189	189	189	186	1	1.810000	-3.221387	1	0.380000			0	91	86	0	409	401	1		1			0	0	189	0	0	1	0	0	0	0	0	0	91	409
SEL1L2	80343	broad.mit.edu	37	20	13846127	13846127	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr20:13846127C>T	ENST00000284951.5	-	16	1512	c.1438G>A	c.(1438-1440)Gct>Act	p.A480T	SEL1L2_ENST00000378072.5_Intron|SEL1L2_ENST00000486903.1_Intron			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	480						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AATTTCTCAGCCCAGTGGCCT	0.433																																						ENST00000284951.5	0.370000	0.140000	0.310000	0.190000	0.240000	0.255986	0.240000	0.240000																										0				51						c.(1438-1440)Gct>Act		sel-1 suppressor of lin-12-like 2 (C. elegans)							83.0	79.0	80.0					20																	13846127		1900	4111	6011	SO:0001583	missense	80343	0	0					g.chr20:13846127C>T	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1438G>A	chr20.hg19:g.13846127C>T	ENSP00000284951:p.Ala480Thr	0					SEL1L2_ENST00000486903.1_Intron|SEL1L2_ENST00000378072.5_Intron	p.A480T			0	0	0	2.055692	Q5TEA6	SE1L2_HUMAN		16	1512	-			B4DXX5	Missense_Mutation	SNP	ENST00000284951.5	1	1	hg19	c.1438G>A		0	.	.	.	.	.	.	.	.	.	.	C	18.20	3.570723	0.65765	.	.	ENSG00000101251	ENST00000284951	T	0.50813	0.73	5.88	5.88	0.94601	5.88	5.88	0.94601	.	0.000000	0.56097	D	0.000036	T	0.52403	0.1732	L	0.39245	1.2	0.46260	D	0.998956	D	0.67145	0.996	P	0.61070	0.883	T	0.36286	-0.9754	10	0.14656	T	0.56	-7.8336	12.6549	0.56782	0.165:0.835:0.0:0.0	.	480	Q5TEA6	SE1L2_HUMAN	T	480	ENSP00000284951:A480T	ENSP00000284951:A480T	A	-	1	0	0	SEL1L2	13794127	13794127	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.684000	0.61686	2.774000	0.95407	0.655000	0.94253	GCT	0.375252		TCGA-3E-AAAZ-01A-11D-A38G-08	0.433	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	0	0	1	2	2	2	2	0	0	0	0	143	143	143	143	1	1.810000	-4.820165	1	0.380000	NM_025229		0	18	18	0	366	361	0		1			0	0	143	0	0	9.999812e-01	0	0	0	0	0	0	18	366
BACH1	571	broad.mit.edu	37	21	30693720	30693720	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr21:30693720T>C	ENST00000399921.1	+	2	362	c.119T>C	c.(118-120)gTg>gCg	p.V40A	BACH1_ENST00000286800.3_Missense_Mutation_p.V40A	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						ACCATCTTTGTGGAGGGACAG	0.517																																						ENST00000399921.1	1.000000	0.970000	1.000000	0.990000	0.990000	0.998567	0.990000	1.000000																										0				27						c.(118-120)gTg>gCg		BTB and CNC homology 1, basic leucine zipper transcription factor 1							150.0	122.0	132.0					21																	30693720		2203	4300	6503	SO:0001583	missense	571	0	0					g.chr21:30693720T>C	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.119T>C	chr21.hg19:g.30693720T>C	ENSP00000382805:p.Val40Ala	0					BACH1_ENST00000286800.3_Missense_Mutation_p.V40A	p.V40A	NM_206866.1	NP_996749.1	1	2	3	2.082276	Q9BX63	FANCJ_HUMAN		2	362	+			Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000399921.1	1	1	hg19	c.119T>C	CCDS13585.1	1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.270251	0.80469	.	.	ENSG00000156273	ENST00000286800;ENST00000399921;ENST00000451655;ENST00000447177;ENST00000435072	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.4	5.4	0.78164	5.4	5.4	0.78164	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000003	T	0.49830	0.1580	L	0.50993	1.605	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.41413	-0.9510	9	.	.	.	-19.2783	15.7695	0.78157	0.0:0.0:0.0:1.0	.	40	O14867	BACH1_HUMAN	A	40	ENSP00000286800:V40A;ENSP00000382805:V40A;ENSP00000400576:V40A;ENSP00000408605:V40A;ENSP00000392202:V40A	.	V	+	2	0	0	BACH1	29615591	29615591	1.000000	0.71417	0.996000	0.52242	0.569000	0.35902	5.701000	0.68325	2.183000	0.69458	0.451000	0.29950	GTG	0.381176		TCGA-3E-AAAZ-01A-11D-A38G-08	0.517	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	1	0	1	2	2	2	2	0	0	0	0	184	184	184	184	1	1.810000	-20.000000	1	0.380000	NM_206866		0	104	103	0	364	354	1		1	1		0	0	184	0	0	1	9.997354e-01	0	11	0	34	0	104	364
PES1	23481	broad.mit.edu	37	22	30976083	30976083	+	Missense_Mutation	SNP	G	G	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr22:30976083G>T	ENST00000405677.1	-	13	1652	c.709C>A	c.(709-711)Cag>Aag	p.Q237K	PES1_ENST00000335214.6_Missense_Mutation_p.Q371K|PES1_ENST00000402281.1_Missense_Mutation_p.Q237K|PES1_ENST00000354694.7_Missense_Mutation_p.Q376K|PES1_ENST00000402284.3_Missense_Mutation_p.Q359K	NM_001282328.1	NP_001269257.1			pescadillo ribosomal biogenesis factor 1											breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						TCGACAATCTGATGGGTGATG	0.577																																						ENST00000405677.1	1.000000	0.870000	1.000000	0.950000	0.990000	0.984203	0.990000	1.000000																										0				29						c.(709-711)Cag>Aag		pescadillo ribosomal biogenesis factor 1							153.0	145.0	148.0					22																	30976083		2203	4300	6503	SO:0001583	missense	23481	0	0					g.chr22:30976083G>T	U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000405677.1:c.709C>A	chr22.hg19:g.30976083G>T	ENSP00000385654:p.Gln237Lys	0					PES1_ENST00000354694.7_Missense_Mutation_p.Q376K|PES1_ENST00000335214.6_Missense_Mutation_p.Q371K|PES1_ENST00000402284.3_Missense_Mutation_p.Q359K|PES1_ENST00000402281.1_Missense_Mutation_p.Q237K	p.Q237K	NM_001282328.1	NP_001269257.1	1	2	3	2.102370				13	1652	-				Missense_Mutation	SNP	ENST00000405677.1	1	1	hg19	c.709C>A		1	.	.	.	.	.	.	.	.	.	.	G	36	5.682142	0.96774	.	.	ENSG00000100029	ENST00000354694;ENST00000402281;ENST00000405677;ENST00000402284;ENST00000335214	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	5.28	5.28	0.74379	5.28	5.28	0.74379	BRCT (4);	0.127391	0.56097	D	0.000035	D	0.89781	0.6814	M	0.89287	3.02	0.80722	D	1	D;D;P;D	0.63046	0.969;0.992;0.925;0.969	P;D;P;P	0.67382	0.72;0.951;0.616;0.72	D	0.91528	0.5240	10	0.72032	D	0.01	-34.7935	18.5306	0.90990	0.0:0.0:1.0:0.0	.	376;359;371;376	B2RDF2;B5MCF9;O00541-2;O00541	.;.;.;PESC_HUMAN	K	376;237;237;359;371	ENSP00000346725:Q376K;ENSP00000384366:Q237K;ENSP00000385654:Q237K;ENSP00000384252:Q359K;ENSP00000334612:Q371K	ENSP00000334612:Q371K	Q	-	1	0	0	PES1	29306083	29306083	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.655000	0.98512	2.467000	0.83353	0.655000	0.94253	CAG	0.384676		TCGA-3E-AAAZ-01A-11D-A38G-08	0.577	PES1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000321189.2	1	0	1	2	2	2	2	0	0	0	0	204	204	204	200	1	1.810000	-20.000000	1	0.380000	NM_014303		0	113	110	0	461	442	1		1	1		0	0	204	0	0	1	1	0	125	0	241	0	113	461
GREB1	9687	broad.mit.edu	37	2	11780474	11780474	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr2:11780474G>A	ENST00000381486.2	+	33	6044	c.5744G>A	c.(5743-5745)cGc>cAc	p.R1915H	GREB1_ENST00000234142.5_Missense_Mutation_p.R1915H|GREB1_ENST00000396123.1_Missense_Mutation_p.R913H	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1915						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ACGGTCGTCCGCCTGGAGCTC	0.622																																					Ovarian(39;850 945 2785 23371 33093)	ENST00000381486.2	1.000000	0.720000	1.000000	0.820000	0.940000	0.924647	0.940000	1.000000																										0				30						c.(5743-5745)cGc>cAc		growth regulation by estrogen in breast cancer 1							47.0	54.0	52.0					2																	11780474		2036	4175	6211	SO:0001583	missense	9687	2	120982	33				g.chr2:11780474G>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5744G>A	chr2.hg19:g.11780474G>A	ENSP00000370896:p.Arg1915His	0					GREB1_ENST00000234142.5_Missense_Mutation_p.R1915H|GREB1_ENST00000396123.1_Missense_Mutation_p.R913H	p.R1915H	NM_014668.3	NP_055483.2	1	2	3	2.086862	Q4ZG55	GREB1_HUMAN		33	6044	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	1	1	hg19	c.5744G>A	CCDS42655.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.412272	0.96072	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.33438	2.72;2.72;1.41	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.57154	0.2034	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62039	-0.6938	10	0.87932	D	0	-33.8736	18.3628	0.90380	0.0:0.0:1.0:0.0	.	1915	Q4ZG55	GREB1_HUMAN	H	1915;1915;913	ENSP00000370896:R1915H;ENSP00000234142:R1915H;ENSP00000379429:R913H	ENSP00000234142:R1915H	R	+	2	0	0	GREB1	11697925	11697925	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.227000	0.95236	2.316000	0.78162	0.563000	0.77884	CGC	0.382347		TCGA-3E-AAAZ-01A-11D-A38G-08	0.622	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	1	0	1	2	2	2	2	0	0	0	0	95	95	95	94	1	1.810000	-20.000000	1	0.380000	NM_014668		0	51	48	0	234	223	1		1	0		0	0	95	0	0	1	8.328248e-01	0	0	0	17	0	51	234
DTYMK	1841	broad.mit.edu	37	2	242625239	242625239	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr2:242625239C>T	ENST00000305784.2	-	2	391	c.184G>A	c.(184-186)Gac>Aac	p.D62N	DTYMK_ENST00000493095.1_5'UTR	NM_001165031.1|NM_012145.3	NP_001158503.1|NP_036277.2	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)	62					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|cellular response to growth factor stimulus (GO:0071363)|dTDP biosynthetic process (GO:0006233)|dTTP biosynthetic process (GO:0006235)|myoblast differentiation (GO:0045445)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside monophosphate phosphorylation (GO:0046940)|nucleotide phosphorylation (GO:0046939)|response to cadmium ion (GO:0046686)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|nucleoside phosphate kinase activity (GO:0050145)|thymidylate kinase activity (GO:0004798)			NS(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TCCTCCACGTCACTTTTCTTT	0.438																																						ENST00000305784.2	1.000000	0.930000	1.000000	0.990000	0.990000	0.995069	0.990000	1.000000																										0				7						c.(184-186)Gac>Aac		deoxythymidylate kinase (thymidylate kinase)							175.0	167.0	170.0					2																	242625239		2203	4296	6499	SO:0001583	missense	1841	0	0					g.chr2:242625239C>T	X54729	CCDS2552.1	2q37	2008-02-05			ENSG00000168393	ENSG00000168393	2.7.4.9		3061	protein-coding gene	gene with protein product	"""dTMP kinase"", ""thymidylate (dTMP) kinase"""	188345				2017365, 8024690	Standard	NM_001165031		Approved	CDC8, TYMK, TMPK	uc002wbz.2	P23919	OTTHUMG00000133409	ENST00000305784.2:c.184G>A	chr2.hg19:g.242625239C>T	ENSP00000304802:p.Asp62Asn	0					DTYMK_ENST00000493095.1_5'UTR	p.D62N	NM_001165031.1|NM_012145.3	NP_001158503.1|NP_036277.2	1	2	3	2.101801	P23919	KTHY_HUMAN		2	391	-		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	B7ZW70|Q6FGX1|Q9BUX4	Missense_Mutation	SNP	ENST00000305784.2	1	1	hg19	c.184G>A	CCDS2552.1	1	.	.	.	.	.	.	.	.	.	.	C	5.106	0.205171	0.09704	.	.	ENSG00000168393	ENST00000305784	T	0.41400	1.0	5.34	3.25	0.37280	5.34	3.25	0.37280	.	0.614711	0.18111	N	0.151344	T	0.16085	0.0387	N	0.03881	-0.34	0.21220	N	0.999754	B;B	0.10296	0.003;0.0	B;B	0.12156	0.007;0.003	T	0.17107	-1.0380	10	0.17369	T	0.5	-13.2689	4.2064	0.10490	0.0:0.531:0.2149:0.2541	.	62;62	B7ZW70;P23919	.;KTHY_HUMAN	N	62	ENSP00000304802:D62N	ENSP00000304802:D62N	D	-	1	0	0	DTYMK	242273912	242273912	0.986000	0.35501	0.013000	0.15412	0.357000	0.29423	2.433000	0.44793	1.216000	0.43427	0.655000	0.94253	GAC	0.384676		TCGA-3E-AAAZ-01A-11D-A38G-08	0.438	DTYMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257266.2	1	0	1	2	2	2	2	0	0	0	0	420	420	420	416	1	1.810000	-20.000000	1	0.380000	NM_012145		0	251	246	0	1008	985	1		1	1		0	0	420	0	0	1	1	0	47	0	95	0	251	1008
IMPG2	50939	broad.mit.edu	37	3	100951770	100951770	+	Missense_Mutation	SNP	A	A	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr3:100951770A>T	ENST00000193391.7	-	15	3275	c.3088T>A	c.(3088-3090)Tgg>Agg	p.W1030R		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1030	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TCTCCACTCCAGGGGTTGACC	0.463																																						ENST00000193391.7	1.000000	0.870000	1.000000	0.980000	0.990000	0.988714	0.990000	1.000000																										0				64						c.(3088-3090)Tgg>Agg		interphotoreceptor matrix proteoglycan 2	Hyaluronan(DB08818)						100.0	98.0	99.0					3																	100951770		2203	4300	6503	SO:0001583	missense	50939	0	0					g.chr3:100951770A>T	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.3088T>A	chr3.hg19:g.100951770A>T	ENSP00000193391:p.Trp1030Arg	0						p.W1030R	NM_016247.3	NP_057331.2	0	0	0	2.014901	Q9BZV3	IMPG2_HUMAN		15	3275	-			A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	1	1	hg19	c.3088T>A	CCDS2940.1	1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.993749	0.74703	.	.	ENSG00000081148	ENST00000193391	T	0.25085	1.82	5.88	4.66	0.58398	5.88	4.66	0.58398	Epidermal growth factor-like, type 3 (1);	0.082660	0.53938	D	0.000052	T	0.44435	0.1293	L	0.55834	1.745	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.38436	-0.9661	10	0.72032	D	0.01	-4.5245	12.8058	0.57612	0.8637:0.1363:0.0:0.0	.	1030;1030	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	R	1030	ENSP00000193391:W1030R	ENSP00000193391:W1030R	W	-	1	0	0	IMPG2	102434460	102434460	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	5.846000	0.69444	2.257000	0.74773	0.459000	0.35465	TGG	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.463	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3	1	0	1	2	2	2	2	0	0	0	0	101	101	101	99	1	1.810000	-20.000000	1	0.380000			0	65	65	0	235	229	1		1			0	0	101	0	0	1	0	0	0	0	0	0	65	235
CHL1	10752	broad.mit.edu	37	3	439920	439920	+	Silent	SNP	C	C	T	rs373156471		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr3:439920C>T	ENST00000256509.2	+	25	3747	c.3105C>T	c.(3103-3105)atC>atT	p.I1035I	CHL1_ENST00000397491.2_Silent_p.I1019I	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.I1035I(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GTAAAGGTATCGGGAAGATAT	0.353																																						ENST00000256509.2	1.000000	0.610000	1.000000	0.730000	0.860000	0.858773	0.860000	1.000000																										1	Substitution - coding silent(1)	p.I1035I(1)	large_intestine(1)	93						c.(3103-3105)atC>atT		cell adhesion molecule L1-like		C		1,4405	2.1+/-5.4	0,1,2202	59.0	58.0	58.0		3105	4.8	1.0	3		58	0,8600		0,0,4300	no	coding-synonymous	CHL1	NM_006614.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1035/1225	439920	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10752	4	121408	37				g.chr3:439920C>T	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3105C>T	chr3.hg19:g.439920C>T		0					CHL1_ENST00000397491.2_Silent_p.I1019I	p.I1035I	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	0	0	0	2.014901	Q96FC9	DDX11_HUMAN		25	3747	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000256509.2	1	1	hg19	c.3105C>T	CCDS2556.1	1																																																																																								0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.353	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.810000	-3.391473	1	0.380000	NM_006614		0	33	32	0	162	160	0		1			0	0	69	0	0	1	0	0	0	0	0	0	33	162
DLEC1	9940	broad.mit.edu	37	3	38103746	38103746	+	Missense_Mutation	SNP	G	G	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr3:38103746G>T	ENST00000308059.6	+	4	781	c.760G>T	c.(760-762)Gat>Tat	p.D254Y	DLEC1_ENST00000452631.2_Missense_Mutation_p.D254Y|DLEC1_ENST00000346219.3_Missense_Mutation_p.D254Y					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GAAGCTTGAAGATTCATGCAG	0.463																																						ENST00000308059.6	0.550000	0.220000	0.460000	0.280000	0.360000	0.378334	0.360000	0.360000																										0				51						c.(760-762)Gat>Tat		deleted in lung and esophageal cancer 1							97.0	89.0	92.0					3																	38103746		1973	4173	6146	SO:0001583	missense	9940	0	0					g.chr3:38103746G>T	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.760G>T	chr3.hg19:g.38103746G>T	ENSP00000308597:p.Asp254Tyr	0					DLEC1_ENST00000452631.2_Missense_Mutation_p.D254Y|DLEC1_ENST00000346219.3_Missense_Mutation_p.D254Y	p.D254Y			0	0	0	2.014901				4	781	+				Missense_Mutation	SNP	ENST00000308059.6	1	1	hg19	c.760G>T	CCDS2672.2	0	.	.	.	.	.	.	.	.	.	.	G	9.251	1.040773	0.19669	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.05319	3.47;3.46;3.7	3.67	1.69	0.24217	3.67	1.69	0.24217	.	1.190300	0.06148	N	0.673614	T	0.08537	0.0212	L	0.46157	1.445	0.09310	N	1	B;P;B	0.35714	0.333;0.517;0.333	B;B;B	0.35413	0.187;0.202;0.187	T	0.40739	-0.9547	10	0.62326	D	0.03	-0.079	9.4496	0.38719	0.0:0.4281:0.5719:0.0	.	254;254;254	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	Y	254	ENSP00000308597:D254Y;ENSP00000315914:D254Y;ENSP00000410427:D254Y	ENSP00000308597:D254Y	D	+	1	0	0	DLEC1	38078750	38078750	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.182000	0.16900	0.455000	0.26910	0.655000	0.94253	GAT	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.463	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	1	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.810000	-19.978610	1	0.380000	NM_007337		0	17	17	0	222	217	0		1			0	0	99	0	0	9.999647e-01	0	0	0	0	0	0	17	222
FILIP1L	11259	broad.mit.edu	37	3	99569205	99569205	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr3:99569205G>A	ENST00000354552.3	-	5	1785	c.1315C>T	c.(1315-1317)Caa>Taa	p.Q439*	FILIP1L_ENST00000471562.1_Nonsense_Mutation_p.Q199*|CMSS1_ENST00000496116.1_Intron|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000383694.2_Nonsense_Mutation_p.Q199*|FILIP1L_ENST00000487087.1_Nonsense_Mutation_p.Q15*|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000331335.5_Nonsense_Mutation_p.Q439*	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	439						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						TAGCATTCTTGTTTGCTTTTG	0.358																																						ENST00000354552.3	1.000000	0.730000	0.970000	0.810000	0.880000	0.890069	0.880000	1.000000																										0				35						c.(1315-1317)Caa>Taa		filamin A interacting protein 1-like							113.0	107.0	109.0					3																	99569205		1834	4073	5907	SO:0001587	stop_gained	11259	0	0					g.chr3:99569205G>A		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.1315C>T	chr3.hg19:g.99569205G>A	ENSP00000346560:p.Gln439*	0					CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000383694.2_Nonsense_Mutation_p.Q199*|FILIP1L_ENST00000487087.1_Nonsense_Mutation_p.Q15*|FILIP1L_ENST00000331335.5_Nonsense_Mutation_p.Q439*|FILIP1L_ENST00000471562.1_Nonsense_Mutation_p.Q199*|FILIP1L_ENST00000476723.1_Intron|CMSS1_ENST00000496116.1_Intron	p.Q439*	NM_182909.2	NP_878913.2	0	0	0	2.014901	Q4L180	FIL1L_HUMAN		5	1785	-			B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Nonsense_Mutation	SNP	ENST00000354552.3	0	1	hg19	c.1315C>T	CCDS43117.1	1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736310	0.89482	.	.	ENSG00000168386	ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	.	.	.	5.55	4.66	0.58398	5.55	4.66	0.58398	.	0.000000	0.50627	D	0.000119	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-2.2035	16.0018	0.80297	0.0:0.1518:0.8482:0.0	.	.	.	.	X	439;15;199;439;199;185;199	.	ENSP00000327880:Q439X	Q	-	1	0	0	FILIP1L	101051895	101051895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.462000	0.66707	1.286000	0.44565	0.655000	0.94253	CAA	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.358	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	1	0	1	2	2	2	2	0	0	0	0	263	263	263	262	1	1.810000	-20.000000	1	0.380000	NM_014890		0	107	106	0	506	496	1		1	0		0	0	263	0	0	1	1	0	0	0	201	0	107	506
COL6A6	131873	broad.mit.edu	37	3	130361862	130361862	+	Missense_Mutation	SNP	G	G	A	rs370927133		TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr3:130361862G>A	ENST00000358511.6	+	30	5253	c.5222G>A	c.(5221-5223)cGc>cAc	p.R1741H	COL6A6_ENST00000453409.2_Missense_Mutation_p.R1741H	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1741	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GTGCGAGACCGCAGTCGTAAG	0.393																																						ENST00000358511.6	0.980000	0.430000	0.840000	0.550000	0.680000	0.698130	0.680000	1.000000																										0				134						c.(5221-5223)cGc>cAc		collagen, type VI, alpha 6		G	HIS/ARG	1,3761		0,1,1880	111.0	97.0	101.0		5222	3.3	0.5	3		101	0,8210		0,0,4105	no	missense	COL6A6	NM_001102608.1	29	0,1,5985	AA,AG,GG		0.0,0.0266,0.0084	benign	1741/2264	130361862	1,11971	1881	4105	5986	SO:0001583	missense	131873	3	120810	32				g.chr3:130361862G>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.5222G>A	chr3.hg19:g.130361862G>A	ENSP00000351310:p.Arg1741His	0					COL6A6_ENST00000453409.2_Missense_Mutation_p.R1741H	p.R1741H	NM_001102608.1	NP_001096078.1	0	0	0	2.014901	A6NMZ7	CO6A6_HUMAN		30	5253	+			A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	1	1	hg19	c.5222G>A	CCDS46911.1	0	.	.	.	.	.	.	.	.	.	.	G	3.402	-0.122029	0.06795	2.66E-4	0.0	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.88818	-2.42;-2.43	5.67	3.33	0.38152	5.67	3.33	0.38152	.	.	.	.	.	T	0.61085	0.2319	N	0.00182	-1.905	0.22253	N	0.999252	B	0.02656	0.0	B	0.01281	0.0	T	0.55755	-0.8091	9	0.12430	T	0.62	.	7.9706	0.30126	0.8354:0.0:0.1646:0.0	.	1741	A6NMZ7	CO6A6_HUMAN	H	1741	ENSP00000351310:R1741H;ENSP00000399236:R1741H	ENSP00000351310:R1741H	R	+	2	0	0	COL6A6	131844552	131844552	1.000000	0.71417	0.542000	0.28115	0.935000	0.57460	3.430000	0.52807	0.445000	0.26639	-0.367000	0.07326	CGC	0.360561		TCGA-3E-AAAZ-01A-11D-A38G-08	0.393	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.810000	-10.725220	1	0.380000	NM_001102608		0	19	19	0	123	121	1		1			0	0	39	0	0	9.999932e-01	0	0	0	0	0	0	19	123
PCDHA2	56146	broad.mit.edu	37	5	140175222	140175222	+	Missense_Mutation	SNP	A	A	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr5:140175222A>G	ENST00000526136.1	+	1	673	c.673A>G	c.(673-675)Acc>Gcc	p.T225A	PCDHA2_ENST00000378132.1_Missense_Mutation_p.T225A|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.T225A	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	225	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCACGGGCACCGTTCAAAT	0.423																																						ENST00000526136.1	1.000000	0.720000	0.980000	0.800000	0.880000	0.887473	0.880000	1.000000																										0				71						c.(673-675)Acc>Gcc		protocadherin alpha 2							81.0	91.0	87.0					5																	140175222		2202	4300	6502	SO:0001583	missense	56146	0	0					g.chr5:140175222A>G	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.673A>G	chr5.hg19:g.140175222A>G	ENSP00000431748:p.Thr225Ala	0					PCDHA2_ENST00000520672.2_Missense_Mutation_p.T225A|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.T225A|PCDHA1_ENST00000394633.3_Intron	p.T225A	NM_018905.2	NP_061728.1	1	2	3	2.093560	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	673	+			O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	1	1	hg19	c.673A>G	CCDS54914.1	1	.	.	.	.	.	.	.	.	.	.	a	14.46	2.541178	0.45280	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.56275	0.47;0.47;0.47	4.02	2.83	0.33086	4.02	2.83	0.33086	Cadherin (4);Cadherin-like (1);	0.000000	0.40908	U	0.000988	T	0.69735	0.3144	M	0.92077	3.27	0.31199	N	0.699996	P;B;P	0.40266	0.71;0.374;0.71	B;P;B	0.50378	0.362;0.639;0.362	T	0.75105	-0.3435	10	0.87932	D	0	.	9.9392	0.41570	0.8476:0.0:0.0:0.1524	.	225;225;225	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	A	225	ENSP00000430584:T225A;ENSP00000367372:T225A;ENSP00000431748:T225A	ENSP00000367372:T225A	T	+	1	0	0	PCDHA2	140155406	140155406	0.998000	0.40836	0.981000	0.43875	0.995000	0.86356	4.169000	0.58223	0.681000	0.31386	0.528000	0.53228	ACC	0.382347		TCGA-3E-AAAZ-01A-11D-A38G-08	0.423	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	1	0	1	2	2	2	2	0	0	0	0	167	167	167	166	1	1.810000	-20.000000	1	0.380000	NM_018905		0	92	89	0	456	450	1		1			0	0	167	0	0	1	0	0	0	0	0	0	92	456
SPATA9	83890	broad.mit.edu	37	5	95011166	95011166	+	Missense_Mutation	SNP	G	G	A	rs140676515	byFrequency	TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr5:95011166G>A	ENST00000274432.8	-	3	469	c.328C>T	c.(328-330)Cgt>Tgt	p.R110C	SPATA9_ENST00000395899.3_Missense_Mutation_p.R110C|SPATA9_ENST00000477047.2_5'UTR|RFESD_ENST00000508206.1_Intron	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	110					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		CTCAGCAGACGACCAGATATG	0.433													G|||	5	0.000998403	0.0038	0.0	5008	,	,		18649	0.0		0.0	False		,,,				2504	0.0					ENST00000274432.8	1.000000	0.690000	1.000000	0.800000	0.910000	0.906018	0.910000	1.000000																										0				7						c.(328-330)Cgt>Tgt		spermatogenesis associated 9		G	CYS/ARG	29,4377	35.2+/-66.4	0,29,2174	133.0	113.0	120.0		328	3.9	0.0	5	dbSNP_134	120	0,8600		0,0,4300	yes	missense	SPATA9	NM_031952.3	180	0,29,6474	AA,AG,GG		0.0,0.6582,0.223	probably-damaging	110/255	95011166	29,12977	2203	4300	6503	SO:0001583	missense	83890	72	121412	51				g.chr5:95011166G>A	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.328C>T	chr5.hg19:g.95011166G>A	ENSP00000274432:p.Arg110Cys	0					RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_5'UTR|SPATA9_ENST00000395899.3_Missense_Mutation_p.R110C	p.R110C	NM_031952.3	NP_114158.2	1	2	3	2.093560	Q9BWV2	SPAT9_HUMAN		3	469	-		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)	A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	ENST00000274432.8	1	0	hg19	c.328C>T	CCDS4076.1	1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	12.73	2.024694	0.35701	0.006582	0.0	ENSG00000145757	ENST00000274432;ENST00000395899	T	0.31510	1.49	4.76	3.88	0.44766	4.76	3.88	0.44766	.	0.000000	0.51477	D	0.000082	T	0.26448	0.0646	L	0.27053	0.805	0.19300	N	0.999974	D	0.67145	0.996	P	0.57371	0.819	T	0.05818	-1.0862	10	0.87932	D	0	-8.0846	10.6281	0.45519	0.0:0.0:0.8093:0.1907	.	110	Q9BWV2	SPAT9_HUMAN	C	110	ENSP00000274432:R110C	ENSP00000274432:R110C	R	-	1	0	0	SPATA9	95036922	95036922	0.074000	0.21230	0.029000	0.17559	0.011000	0.07611	1.948000	0.40303	1.329000	0.45376	0.655000	0.94253	CGT	0.382347		TCGA-3E-AAAZ-01A-11D-A38G-08	0.433	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	1	0	1	2	2	2	2	0	0	0	0	114	114	114	112	1	1.810000	-3.273902	1	0.380000	NM_031952		0	49	49	0	233	231	1		1	0		0	0	114	0	0	1	0	0	0	0	1	0	49	233
FAM71B	153745	broad.mit.edu	37	5	156590130	156590130	+	Silent	SNP	G	G	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr5:156590130G>T	ENST00000302938.4	-	2	1241	c.1146C>A	c.(1144-1146)acC>acA	p.T382T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	382						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CACACTTGCTGGTCGTAATAC	0.567																																						ENST00000302938.4	0.420000	0.110000	0.310000	0.160000	0.230000	0.248937	0.230000	0.220000																										0				68						c.(1144-1146)acC>acA		family with sequence similarity 71, member B							47.0	49.0	48.0					5																	156590130		2203	4300	6503	SO:0001819	synonymous_variant	153745	2	121412	34				g.chr5:156590130G>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1146C>A	chr5.hg19:g.156590130G>T		0						p.T382T	NM_130899.2	NP_570969.2	1	2	3	2.093560	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	2	1241	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	1	1	hg19	c.1146C>A	CCDS4335.1	0																																																																																								0.382347		TCGA-3E-AAAZ-01A-11D-A38G-08	0.567	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	0	0	1	2	2	2	2	0	0	0	0	78	78	78	77	1	1.810000	-2.885356	1	0.380000	NM_130899		0	10	10	0	227	221	0		1			0	0	78	0	0	9.966511e-01	0	0	0	0	0	0	10	227
GPRC6A	222545	broad.mit.edu	37	6	117113727	117113727	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr6:117113727C>T	ENST00000310357.3	-	6	2380	c.2359G>A	c.(2359-2361)Ggc>Agc	p.G787S	GPRC6A_ENST00000530250.1_Missense_Mutation_p.G612S|GPRC6A_ENST00000368549.3_Missense_Mutation_p.G716S	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	787					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		ATGAGCATGCCAAATGTAATG	0.378																																						ENST00000310357.3	0.940000	0.540000	0.860000	0.640000	0.740000	0.752837	0.740000	0.750000																										0				65						c.(2359-2361)Ggc>Agc		G protein-coupled receptor, class C, group 6, member A							74.0	79.0	77.0					6																	117113727		2203	4300	6503	SO:0001583	missense	222545	0	0					g.chr6:117113727C>T	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2359G>A	chr6.hg19:g.117113727C>T	ENSP00000309493:p.Gly787Ser	1					GPRC6A_ENST00000530250.1_Missense_Mutation_p.G612S|GPRC6A_ENST00000368549.3_Missense_Mutation_p.G716S	p.G787S	NM_148963.2	NP_683766.2	0	1	1	1.695354	Q5T6X5	GPC6A_HUMAN		6	2380	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	1	1	hg19	c.2359G>A	CCDS5112.1	0	.	.	.	.	.	.	.	.	.	.	C	8.574	0.880765	0.17467	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.85411	-1.98;-1.98;-1.98	4.26	4.26	0.50523	4.26	4.26	0.50523	GPCR, family 3, C-terminal (2);	0.000000	0.53938	D	0.000041	T	0.62146	0.2404	N	0.04669	-0.19	0.49130	D	0.999757	P;P;P	0.39903	0.65;0.504;0.694	P;B;B	0.47603	0.551;0.292;0.418	T	0.70171	-0.4945	10	0.02654	T	1	.	16.8566	0.86007	0.0:1.0:0.0:0.0	.	716;612;787	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	S	787;716;612	ENSP00000309493:G787S;ENSP00000357537:G716S;ENSP00000433465:G612S	ENSP00000309493:G787S	G	-	1	0	0	GPRC6A	117220420	117220420	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.930000	0.48924	2.210000	0.71456	0.591000	0.81541	GGC	0.234568		TCGA-3E-AAAZ-01A-11D-A38G-08	0.378	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2	1	0	1	2	2	2	2	0	0	0	0	86	86	86	87	1	1.810000	-3.185659	1	0.380000			0	38	37	0	176	176	1		1			0	0	86	0	0	1	0	0	0	0	0	0	38	176
XPO5	57510	broad.mit.edu	37	6	43491668	43491668	+	Missense_Mutation	SNP	T	T	C			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr6:43491668T>C	ENST00000265351.7	-	32	3763	c.3553A>G	c.(3553-3555)Atg>Gtg	p.M1185V	POLR1C_ENST00000304004.3_Intron	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	1185					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GTCTCCAGCATTGGCTTTGTT	0.463																																						ENST00000265351.7	0.160000	0.020000	0.110000	0.040000	0.070000	0.080765	0.070000	0.070000																										0				34						c.(3553-3555)Atg>Gtg		exportin 5							94.0	94.0	94.0					6																	43491668		1896	4111	6007	SO:0001583	missense	57510	1	120838	31				g.chr6:43491668T>C	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.3553A>G	chr6.hg19:g.43491668T>C	ENSP00000265351:p.Met1185Val	1					POLR1C_ENST00000304004.3_Intron	p.M1185V	NM_020750.2	NP_065801.1	0	1	1	1.756394	Q9HAV4	XPO5_HUMAN	all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)	32	3763	-	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	ENST00000265351.7	0	1	hg19	c.3553A>G	CCDS47430.1	0	.	.	.	.	.	.	.	.	.	.	T	2.456	-0.325143	0.05350	.	.	ENSG00000124571	ENST00000265351;ENST00000439465	T	0.27256	1.68	6.05	-7.28	0.01456	6.05	-7.28	0.01456	.	0.722313	0.14370	N	0.323863	T	0.02156	0.0067	N	0.04203	-0.255	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.41520	-0.9504	10	0.25106	T	0.35	-0.074	5.3159	0.15854	0.1366:0.4805:0.0853:0.2977	.	1185	Q9HAV4	XPO5_HUMAN	V	1185;813	ENSP00000265351:M1185V	ENSP00000265351:M1185V	M	-	1	0	0	XPO5	43599646	43599646	0.347000	0.24853	0.870000	0.34147	0.979000	0.70002	-0.064000	0.11636	-0.740000	0.04803	-0.280000	0.10049	ATG	0.262256		TCGA-3E-AAAZ-01A-11D-A38G-08	0.463	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	0	0	0	2	2	2	2	0	0	0	0	123	123	123	0	1	1.810000	-4.214947	1	0.380000	NM_020750		0	4	0	0	265	0	0			0		0	0	123	0	0	0	3.649573e-01	0	0	0	71	0	4	265
TULP4	56995	broad.mit.edu	37	6	158922970	158922970	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr6:158922970G>A	ENST00000367097.3	+	13	3632	c.2275G>A	c.(2275-2277)Gga>Aga	p.G759R	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	759					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGTGATTTTCGGAAGCGTGGA	0.612																																						ENST00000367097.3	0.310000	0.160000	0.280000	0.190000	0.230000	0.241214	0.230000	0.240000																										0				49						c.(2275-2277)Gga>Aga		tubby like protein 4							196.0	188.0	191.0					6																	158922970		2203	4300	6503	SO:0001583	missense	56995	2	121412	40				g.chr6:158922970G>A		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2275G>A	chr6.hg19:g.158922970G>A	ENSP00000356064:p.Gly759Arg	1					TULP4_ENST00000367094.2_Intron	p.G759R	NM_020245.4	NP_064630.2	0	1	1	1.695354	Q9NRJ4	TULP4_HUMAN		13	3632	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	1	1	hg19	c.2275G>A	CCDS34561.1	0	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270972	0.80469	.	.	ENSG00000130338	ENST00000367097	T	0.61980	0.06	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.395439	0.28327	N	0.015758	T	0.44932	0.1317	L	0.56769	1.78	0.80722	D	1	P	0.45011	0.848	B	0.34722	0.188	T	0.56565	-0.7958	10	0.54805	T	0.06	-15.9636	14.9195	0.70826	0.0707:0.0:0.9293:0.0	.	759	Q9NRJ4	TULP4_HUMAN	R	759	ENSP00000356064:G759R	ENSP00000356064:G759R	G	+	1	0	0	TULP4	158842958	158842958	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	5.865000	0.69583	2.659000	0.90383	0.650000	0.86243	GGA	0.234568		TCGA-3E-AAAZ-01A-11D-A38G-08	0.612	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	1	0	1	2	2	2	2	0	0	0	0	308	308	308	306	1	1.810000	-2.774566	1	0.380000	NM_020245		0	41	40	0	696	672	0		1	0		0	0	308	0	0	1	9.008827e-02	0	0	0	9	0	41	696
PTPN12	5782	broad.mit.edu	37	7	77230064	77230064	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr7:77230064G>A	ENST00000248594.6	+	8	908	c.636G>A	c.(634-636)atG>atA	p.M212I	PTPN12_ENST00000415482.2_Missense_Mutation_p.M93I|PTPN12_ENST00000435495.2_Missense_Mutation_p.M82I	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	212	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						TTCTGGACATGATAAGCTTAA	0.328																																						ENST00000248594.6	1.000000	0.950000	1.000000	0.990000	0.990000	0.997714	0.990000	1.000000																										0				39						c.(634-636)atG>atA		protein tyrosine phosphatase, non-receptor type 12							105.0	91.0	96.0					7																	77230064		2203	4300	6503	SO:0001583	missense	5782	0	0					g.chr7:77230064G>A		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.636G>A	chr7.hg19:g.77230064G>A	ENSP00000248594:p.Met212Ile	0					PTPN12_ENST00000435495.2_Missense_Mutation_p.M82I|PTPN12_ENST00000415482.2_Missense_Mutation_p.M93I	p.M212I	NM_002835.3	NP_002826.3	0	0	0	2.065404	Q05209	PTN12_HUMAN		8	908	+			A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	1	1	hg19	c.636G>A	CCDS5592.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.202288	0.94997	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;D;D	0.82893	2.85;-1.66;-1.66	5.51	5.51	0.81932	5.51	5.51	0.81932	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.87478	0.6187	L	0.41573	1.285	0.80722	D	1	D	0.58620	0.983	D	0.63033	0.91	D	0.88185	0.2873	10	0.66056	D	0.02	.	19.4115	0.94675	0.0:0.0:1.0:0.0	.	212	Q05209	PTN12_HUMAN	I	212;93;93;82	ENSP00000248594:M212I;ENSP00000392429:M93I;ENSP00000397991:M82I	ENSP00000248594:M212I	M	+	3	0	0	PTPN12	77068000	77068000	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.824000	0.86668	2.585000	0.87301	0.557000	0.71058	ATG	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.328	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3	1	0	1	2	2	2	2	0	0	0	0	129	129	129	127	1	1.810000	-20.000000	1	0.380000			0	100	99	0	354	347	1		1	1		0	0	129	0	0	1	1	0	52	0	75	0	100	354
GRM8	2918	broad.mit.edu	37	7	126173814	126173814	+	Missense_Mutation	SNP	C	C	G			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr7:126173814C>G	ENST00000339582.2	-	9	2430	c.1622G>C	c.(1621-1623)tGt>tCt	p.C541S	GRM8_ENST00000444921.2_Missense_Mutation_p.C541S|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000358373.3_Missense_Mutation_p.C541S			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	541					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTAACCTTCACAGCGTTCACA	0.562										HNSCC(24;0.065)																												ENST00000339582.2	1.000000	0.770000	1.000000	0.860000	0.960000	0.946398	0.960000	1.000000																										0				125						c.(1621-1623)tGt>tCt		glutamate receptor, metabotropic 8							127.0	118.0	121.0					7																	126173814		2203	4300	6503	SO:0001583	missense	2918	0	0					g.chr7:126173814C>G		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1622G>C	chr7.hg19:g.126173814C>G	ENSP00000344173:p.Cys541Ser	0	HNSCC(24;0.065)				GRM8_ENST00000358373.3_Missense_Mutation_p.C541S|GRM8_ENST00000444921.2_Missense_Mutation_p.C541S|GRM8_ENST00000480995.1_5'UTR	p.C541S			0	0	0	2.065404	O00222	GRM8_HUMAN		9	2430	-		Prostate(267;0.186)	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	1	1	hg19	c.1622G>C	CCDS5794.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281561	0.80692	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.99494	-6.01;-6.01;-6.01	5.8	5.8	0.92144	5.8	5.8	0.92144	GPCR, family 3, conserved site (1);GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.99785	0.9910	H	0.98682	4.3	0.80722	D	1	P;D	0.89917	0.867;1.0	B;D	0.87578	0.359;0.998	D	0.97086	0.9787	10	0.87932	D	0	.	19.0428	0.93008	0.0:1.0:0.0:0.0	.	541;541	O00222-2;O00222	.;GRM8_HUMAN	S	541	ENSP00000344173:C541S;ENSP00000409790:C541S;ENSP00000351142:C541S	ENSP00000344173:C541S	C	-	2	0	0	GRM8	125961050	125961050	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.811000	0.86092	2.758000	0.94735	0.643000	0.83706	TGT	0.377635		TCGA-3E-AAAZ-01A-11D-A38G-08	0.562	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4	1	0	1	2	2	2	2	0	0	0	0	141	141	141	140	1	1.810000	-20.000000	1	0.380000			0	74	73	0	325	321	1		1			0	0	141	0	0	1	0	0	0	0	0	0	74	325
BAALC	79870	broad.mit.edu	37	8	104225200	104225200	+	Missense_Mutation	SNP	G	G	A			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr8:104225200G>A	ENST00000297574.6	+	3	458	c.319G>A	c.(319-321)Ggt>Agt	p.G107S	RP11-318M2.2_ENST00000523614.2_RNA|BAALC_ENST00000309982.5_Missense_Mutation_p.G72S|BAALC_ENST00000438105.2_Intron|RP11-318M2.2_ENST00000499522.2_RNA			Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic	107						cytoplasm (GO:0005737)|membrane (GO:0016020)				kidney(1)|large_intestine(3)|lung(3)	7			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TACAGCCCCAGGTGGAATACC	0.577																																						ENST00000297574.6	1.000000	0.790000	1.000000	0.870000	0.960000	0.948510	0.960000	1.000000																										0				7						c.(319-321)Ggt>Agt		brain and acute leukemia, cytoplasmic							138.0	122.0	127.0					8																	104225200		2203	4300	6503	SO:0001583	missense	79870	0	0					g.chr8:104225200G>A	AF363578	CCDS6297.1, CCDS47906.1	8q22.3	2008-07-29			ENSG00000164929	ENSG00000164929			14333	protein-coding gene	gene with protein product		606602				11707601	Standard	NM_024812		Approved		uc003yld.3	Q8WXS3	OTTHUMG00000164782	ENST00000297574.6:c.319G>A	chr8.hg19:g.104225200G>A	ENSP00000297574:p.Gly107Ser	0					RP11-318M2.2_ENST00000499522.2_RNA|BAALC_ENST00000438105.2_Intron|BAALC_ENST00000309982.5_Missense_Mutation_p.G72S|RP11-318M2.2_ENST00000523614.2_RNA	p.G107S			1	2	3	2.087904	Q8WXS3	BAALC_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)	3	458	+			Q8WTP6|Q8WXS0|Q8WXS1|Q8WXS2|Q9HA93	Missense_Mutation	SNP	ENST00000297574.6	1	1	hg19	c.319G>A		1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927804	0.34002	.	.	ENSG00000164929	ENST00000309982;ENST00000297574	T;T	0.53206	1.02;0.63	5.47	1.85	0.25348	5.47	1.85	0.25348	.	0.578794	0.17232	N	0.181915	T	0.30070	0.0753	.	.	.	0.80722	D	1	B;B	0.18741	0.03;0.005	B;B	0.17722	0.014;0.019	T	0.05971	-1.0853	9	0.26408	T	0.33	-6.8436	5.7463	0.18122	0.4639:0.0:0.5361:0.0	.	107;72	Q8WXS3;Q8WXS3-2	BAALC_HUMAN;.	S	72;107	ENSP00000312457:G72S;ENSP00000297574:G107S	ENSP00000297574:G107S	G	+	1	0	0	BAALC	104294376	104294376	0.137000	0.22531	0.196000	0.23383	0.544000	0.35116	0.274000	0.18680	0.631000	0.30412	0.650000	0.86243	GGT	0.382347		TCGA-3E-AAAZ-01A-11D-A38G-08	0.577	BAALC-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000380257.1	1	0	1	2	2	2	2	0	0	0	0	190	190	190	186	1	1.810000	-2.938922	1	0.380000			0	86	86	0	382	372	1		1	0		0	0	190	0	0	1	3.082701e-01	0	0	0	6	0	86	382
OR1N2	138882	broad.mit.edu	37	9	125315452	125315452	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr9:125315452G>T	ENST00000373688.2	+	1	62	c.4G>T	c.(4-6)Gaa>Taa	p.E2*		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						CTGACACATGGAAGGTTTTTA	0.408																																						ENST00000373688.2	1.000000	0.780000	1.000000	0.860000	0.950000	0.942531	0.950000	1.000000																										0				26						c.(4-6)Gaa>Taa		olfactory receptor, family 1, subfamily N, member 2							80.0	83.0	82.0					9																	125315452		2203	4300	6503	SO:0001587	stop_gained	138882	0	0					g.chr9:125315452G>T		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.4G>T	chr9.hg19:g.125315452G>T	ENSP00000362792:p.Glu2*	1						p.E2*	NM_001004457.1	NP_001004457.1	0	1	1	1.897685	Q8NGR9	OR1N2_HUMAN		1	62	+			A3KFM2|B2RNY4|Q6IF17|Q96RA3	Nonsense_Mutation	SNP	ENST00000373688.2	0	1	hg19	c.4G>T	CCDS35123.1	1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426314	0.62733	.	.	ENSG00000171501	ENST00000373688	.	.	.	3.55	0.384	0.16244	3.55	0.384	0.16244	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	0.7679	0.01018	0.2222:0.1643:0.399:0.2145	.	.	.	.	X	2	.	ENSP00000362792:E2X	E	+	1	0	0	OR1N2	124355273	124355273	0.000000	0.05858	0.000000	0.03702	0.186000	0.23388	-0.184000	0.09698	-0.024000	0.13941	0.638000	0.83543	GAA	0.324839		TCGA-3E-AAAZ-01A-11D-A38G-08	0.408	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2	1	0	1	2	11	2	2	1	1	1	1	161	161	161	160	1	1.810000	-20.000000	1	0.380000			0	81	75	0	325	322	1		1		1	1	0	161	727	0	1	0	1	0	146	0	525	81	325
C9orf3	84909	broad.mit.edu	37	9	97843044	97843044	+	Missense_Mutation	SNP	G	G	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr9:97843044G>T	ENST00000375315.2	+	14	2301	c.2301G>T	c.(2299-2301)agG>agT	p.R767S	C9orf3_ENST00000425634.2_Missense_Mutation_p.R129S|C9orf3_ENST00000297979.5_Missense_Mutation_p.R668S|C9orf3_ENST00000433691.2_Missense_Mutation_p.R108S	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	767					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		GTGTGGAGAGGTTCCTTCAGG	0.502																																						ENST00000375315.2	0.930000	0.540000	0.830000	0.620000	0.720000	0.734447	0.720000	0.720000																										0				23						c.(2299-2301)agG>agT		chromosome 9 open reading frame 3							158.0	138.0	145.0					9																	97843044		2203	4300	6503	SO:0001583	missense	84909	0	0					g.chr9:97843044G>T	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.2301G>T	chr9.hg19:g.97843044G>T	ENSP00000364464:p.Arg767Ser	0					C9orf3_ENST00000433691.2_Missense_Mutation_p.R108S|C9orf3_ENST00000297979.5_Missense_Mutation_p.R668S|C9orf3_ENST00000425634.2_Missense_Mutation_p.R129S	p.R767S	NM_001193329.1	NP_001180258.1	0	1	1	1.924680	Q8N6M6	AMPO_HUMAN		14	2301	+			Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	ENST00000375315.2	1	1	hg19	c.2301G>T	CCDS55328.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.86|12.86	2.063994|2.063994	0.36373|0.36373	.|.	.|.	ENSG00000148120|ENSG00000148120	ENST00000297979;ENST00000375315;ENST00000424143;ENST00000428313;ENST00000425634;ENST00000433691;ENST00000375314|ENST00000445181	T;T;T;T;T;T|.	0.41400|.	1.0;1.0;1.0;1.0;1.0;1.0|.	5.57|5.57	-11.1|-11.1	0.00147|0.00147	5.57|5.57	-11.1|-11.1	0.00147|0.00147	Peptidase M1, leukotriene A4 hydrolase, aminopeptidase C-terminal (1);Armadillo-type fold (1);|.	0.730929|.	0.12958|.	N|.	0.425271|.	T|T	0.34308|0.34308	0.0893|0.0893	L|L	0.57536|0.57536	1.79|1.79	0.22156|0.22156	N|N	0.999328|0.999328	P;P;B;B;B|.	0.48834|.	0.845;0.916;0.095;0.418;0.306|.	P;P;B;B;B|.	0.51657|.	0.676;0.515;0.053;0.085;0.169|.	T|T	0.36939|0.36939	-0.9727|-0.9727	10|5	0.11485|.	T|.	0.65|.	0.0602|0.0602	6.0437|6.0437	0.19748|0.19748	0.1409:0.4072:0.3673:0.0845|0.1409:0.4072:0.3673:0.0845	.|.	108;129;767;668;668|.	B4DU39;B4DQU3;Q8N6M6;Q8N6M6-4;Q8N6M6-2|.	.;.;AMPO_HUMAN;.;.|.	S|F	668;767;491;549;129;108;131|132	ENSP00000297979:R668S;ENSP00000364464:R767S;ENSP00000402171:R491S;ENSP00000401854:R549S;ENSP00000411815:R129S;ENSP00000399365:R108S|.	ENSP00000297979:R668S|.	R|V	+|+	3|1	2|0	2|0	C9orf3|C9orf3	96882865|96882865	96882865|96882865	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.090000|0.090000	0.18270|0.18270	-1.167000|-1.167000	0.03126|0.03126	-1.392000|-1.392000	0.02082|0.02082	-0.378000|-0.378000	0.06908|0.06908	AGG|GTT	0.333118		TCGA-3E-AAAZ-01A-11D-A38G-08	0.502	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	1.810000	-20.000000	1	0.380000	NM_032823		0	43	42	0	246	239	1		1	1		0	0	112	0	0	1	1	0	33	0	244	0	43	246
CACNA1B	774	broad.mit.edu	37	9	141014657	141014657	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chr9:141014657C>T	ENST00000371372.1	+	45	6216	c.6071C>T	c.(6070-6072)aCg>aTg	p.T2024M	CACNA1B_ENST00000371357.1_Missense_Mutation_p.T2023M|CACNA1B_ENST00000277549.5_Missense_Mutation_p.T1218M|CACNA1B_ENST00000371363.1_Missense_Mutation_p.T2022M|CACNA1B_ENST00000277551.2_Missense_Mutation_p.T2024M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.T2025M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2024					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCATCTCCACGCTGGCCCAG	0.687																																						ENST00000371372.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.998906	0.990000	1.000000																										0				80						c.(6070-6072)aCg>aTg		calcium channel, voltage-dependent, N type, alpha 1B subunit	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)						38.0	61.0	53.0					9																	141014657		2170	4264	6434	SO:0001583	missense	774	0	0					g.chr9:141014657C>T	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6071C>T	chr9.hg19:g.141014657C>T	ENSP00000360423:p.Thr2024Met	1					CACNA1B_ENST00000277551.2_Missense_Mutation_p.T2024M|CACNA1B_ENST00000277549.5_Missense_Mutation_p.T1218M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.T2025M|CACNA1B_ENST00000371363.1_Missense_Mutation_p.T2022M|CACNA1B_ENST00000371357.1_Missense_Mutation_p.T2023M	p.T2024M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	0	0	0	1.897261	Q00975	CAC1B_HUMAN		45	6216	+	all_cancers(76;0.166)		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	1	1	hg19	c.6071C>T	CCDS59522.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339170	0.81911	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99;-0.99	4.78	4.78	0.61160	4.78	4.78	0.61160	.	0.330500	0.29767	N	0.011255	T	0.73961	0.3654	L	0.49126	1.545	0.80722	D	1	P;P	0.48162	0.906;0.906	P;P	0.45276	0.475;0.475	T	0.77411	-0.2598	10	0.52906	T	0.07	.	17.8144	0.88627	0.0:1.0:0.0:0.0	.	2023;2022	B1AQK7;B1AQK6	.;.	M	2024;2024;1218;2022;2023;2025	ENSP00000360423:T2024M;ENSP00000277551:T2024M;ENSP00000277549:T1218M;ENSP00000360414:T2022M;ENSP00000360408:T2023M;ENSP00000360406:T2025M	ENSP00000277549:T1218M	T	+	2	0	0	CACNA1B	140134478	140134478	0.997000	0.39634	0.976000	0.42696	0.747000	0.42532	3.527000	0.53517	2.210000	0.71456	0.491000	0.48974	ACG	0.320622		TCGA-3E-AAAZ-01A-11D-A38G-08	0.687	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.810000	-20.000000	1	0.380000	NM_000718		0	24	24	0	48	48	1		1			0	0	24	0	0	1	0	0	0	0	0	0	24	48
HTR2C	3358	broad.mit.edu	37	X	114082716	114082716	+	Missense_Mutation	SNP	C	C	T			TCGA-3E-AAAZ-01A-11D-A38G-08	TCGA-3E-AAAZ-10A-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2be6181-6c54-4ab7-bea5-d5f94e8b65e5	a03f6870-eb79-4f62-9b59-5e12dffc9a97	g.chrX:114082716C>T	ENST00000276198.1	+	5	1228	c.500C>T	c.(499-501)tCg>tTg	p.S167L	HTR2C_ENST00000371950.3_Intron|HTR2C_ENST00000371951.1_Missense_Mutation_p.S167L	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	167					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.S167L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CGTTTCAATTCGCGGACTAAG	0.408																																						ENST00000276198.1	0.890000	0.610000	0.830000	0.680000	0.740000	0.756800	0.740000	0.750000																										1	Substitution - Missense(1)	p.S167L(1)	large_intestine(1)	50						c.(499-501)tCg>tTg		5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)						126.0	106.0	113.0					X																	114082716		2203	4300	6503	SO:0001583	missense	3358	0	0					g.chrX:114082716C>T		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.500C>T	chrX.hg19:g.114082716C>T	ENSP00000276198:p.Ser167Leu						HTR2C_ENST00000371950.3_Intron|HTR2C_ENST00000371951.1_Missense_Mutation_p.S167L	p.S167L	NM_000868.2	NP_000859.1	0	1	1		P28335	5HT2C_HUMAN		5	1228	+			B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	1	1	hg19	c.500C>T	CCDS14564.1	0	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713163	0.89112	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.41400	1.0;1.0	4.27	4.27	0.50696	4.27	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.69369	0.3103	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77112	-0.2708	10	0.87932	D	0	.	13.3413	0.60547	0.0:1.0:0.0:0.0	.	167	P28335	5HT2C_HUMAN	L	167	ENSP00000276198:S167L;ENSP00000361019:S167L	ENSP00000276198:S167L	S	+	2	0	0	HTR2C	113988972	113988972	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.686000	0.84128	1.704000	0.51252	0.544000	0.68410	TCG	0.380000		TCGA-3E-AAAZ-01A-11D-A38G-08	0.408	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	1	0	1	2	2	2	2	0	0	0	0	102	102	102	101	1	1.810000	-20.000000	1	0.380000	NM_000868		0	78	78	0	193	190	1		1			0	0	102	0	0	1	0	0	0	0	0	0	78	193
