#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
RRP8	23378	broad.mit.edu	37	11	6622389	6622389	+	Missense_Mutation	SNP	G	G	T			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr11:6622389G>T	ENST00000254605.6	-	3	1024	c.907C>A	c.(907-909)Ctt>Att	p.L303I	RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000537806.1_5'Flank|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000396751.2_5'Flank|RRP8_ENST00000534343.1_Intron	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	303					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						CGCTGGCGAAGATCCCTGGCG	0.572																																						ENST00000254605.6	0.980000	0.530000	0.910000	0.650000	0.780000	0.781097	0.780000	0.790000																										0				13						c.(907-909)Ctt>Att		ribosomal RNA processing 8, methyltransferase, homolog (yeast)							32.0	32.0	32.0					11																	6622389		2201	4296	6497	SO:0001583	missense	23378	0	0					g.chr11:6622389G>T	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.907C>A	chr11.hg19:g.6622389G>T	ENSP00000254605:p.Leu303Ile	1					RRP8_ENST00000534343.1_Intron|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000537806.1_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000396751.2_5'Flank|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000528995.1_5'Flank	p.L303I	NM_015324.3	NP_056139.1	0	1	1	1.800142	O43159	RRP8_HUMAN		3	1024	-			Q7KZ78|Q9BVM6	Missense_Mutation	SNP	ENST00000254605.6	0	1	hg19	c.907C>A	CCDS31411.1	0	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737955	0.49045	.	.	ENSG00000132275	ENST00000254605;ENST00000533907	T;T	0.53206	0.63;0.63	6.08	4.99	0.66335	6.080000	4.990000	0.663350	.	0.059275	0.64402	D	0.000004	T	0.46151	0.1378	N	0.17922	0.545	0.80722	D	1	B	0.26809	0.16	P	0.51918	0.684	T	0.37407	-0.9707	10	0.07644	T	0.81	-20.4274	9.7753	0.40614	0.0818:0.0:0.7743:0.144	.	303	O43159	RRP8_HUMAN	I	303	ENSP00000254605:L303I;ENSP00000436246:L303I	ENSP00000254605:L303I	L	-	1	0	0	RRP8	6578965	6578965	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.110000	0.57831	2.894000	0.99253	0.655000	0.94253	CTT	0.149425		TCGA-F2-A44H-01A-11D-A26I-08	0.572	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	1	0	1		2	2	2	0		0	0	18		18	18	1	1.820000	-20.000000	1	0.260000	NM_015324			26	26		189	186	1		1	1		0	0	18	0		1.000000	7.415646e-01	0	7	0	14	0	26	189
SLC6A5	9152	broad.mit.edu	37	11	20676316	20676316	+	Missense_Mutation	SNP	C	C	T	rs141654146	byFrequency	TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr11:20676316C>T	ENST00000525748.1	+	16	2569	c.2296C>T	c.(2296-2298)Cgc>Tgc	p.R766C	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	766					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	AGCTCAACACCGCGGGGAGCG	0.542																																						ENST00000525748.1	0.340000	0.150000	0.290000	0.190000	0.230000	0.247950	0.230000	0.240000																										0				63						c.(2296-2298)Cgc>Tgc		solute carrier family 6 (neurotransmitter transporter), member 5	Glycine(DB00145)	C	CYS/ARG	1,4405		0,1,2202	145.0	138.0	140.0		2296	6.0	1.0	11	dbSNP_134	140	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SLC6A5	NM_004211.3	180	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	766/798	20676316	3,13003	2203	4300	6503	SO:0001583	missense	9152	8	121412	44				g.chr11:20676316C>T	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.2296C>T	chr11.hg19:g.20676316C>T	ENSP00000434364:p.Arg766Cys	1					SLC6A5_ENST00000528440.1_3'UTR	p.R766C	NM_004211.3	NP_004202.2	0	1	1	1.800142	Q9Y345	SC6A5_HUMAN		16	2569	+			O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	1	1	hg19	c.2296C>T	CCDS7854.1	0	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640687	0.87859	2.27E-4	2.33E-4	ENSG00000165970	ENST00000525748	T	0.75938	-0.98	6.04	6.04	0.98038	6.040000	6.040000	0.980380	.	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82748	-0.0304	10	0.87932	D	0	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	766	Q9Y345	SC6A5_HUMAN	C	766	ENSP00000434364:R766C	ENSP00000434364:R766C	R	+	1	0	0	SLC6A5	20632892	20632892	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.645000	0.67909	2.873000	0.98535	0.563000	0.77884	CGC	0.149425		TCGA-F2-A44H-01A-11D-A26I-08	0.542	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	0	0	1		2	2	2	0		0	0	93		93	92	1	1.820000	-2.652367	1	0.260000	NM_004211			24	24		643	636	0		1			0	0	93	0		1.000000	0	0	0	0	0	0	24	643
FAT3	120114	broad.mit.edu	37	11	92569867	92569867	+	Missense_Mutation	SNP	C	C	T	rs200404766		TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr11:92569867C>T	ENST00000298047.6	+	15	10239	c.10222C>T	c.(10222-10224)Cgg>Tgg	p.R3408W	FAT3_ENST00000409404.2_Missense_Mutation_p.R3408W|FAT3_ENST00000525166.1_Missense_Mutation_p.R3258W			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3408	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGACCGGGAACGGGTAAGCTA	0.438										TCGA Ovarian(4;0.039)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		17240	0.0		0.0	False		,,,				2504	0.0					ENST00000298047.6	1.000000	0.650000	0.980000	0.760000	0.880000	0.872276	0.880000	1.000000																										0				85						c.(10222-10224)Cgg>Tgg		FAT atypical cadherin 3		C	TRP/ARG	0,3766		0,0,1883	106.0	101.0	102.0		10222	5.1	1.0	11		102	21,8199		0,21,4089	yes	missense	FAT3	NM_001008781.2	101	0,21,5972	TT,TC,CC		0.2555,0.0,0.1752	probably-damaging	3408/4558	92569867	21,11965	1883	4110	5993	SO:0001583	missense	120114	269	120836	54				g.chr11:92569867C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10222C>T	chr11.hg19:g.92569867C>T	ENSP00000298047:p.Arg3408Trp	1	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Missense_Mutation_p.R3258W|FAT3_ENST00000409404.2_Missense_Mutation_p.R3408W	p.R3408W			0	1	1	1.797776	Q8TDW7	FAT3_HUMAN		15	10239	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	1	0	hg19	c.10222C>T		1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496552	0.64186	0.0	0.002555	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01804	4.63;4.63;4.63	5.09	5.09	0.68999	5.090000	5.090000	0.689990	.	.	.	.	.	T	0.06371	0.0164	M	0.64404	1.975	0.80722	D	1	D	0.71674	0.998	P	0.57009	0.811	T	0.05022	-1.0911	9	0.66056	D	0.02	.	13.097	0.59197	0.1702:0.8298:0.0:0.0	.	3408	Q8TDW7-3	.	W	3408;3408;3258	ENSP00000298047:R3408W;ENSP00000387040:R3408W;ENSP00000432586:R3258W	ENSP00000298047:R3408W	R	+	1	2	2	FAT3	92209515	92209515	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	0.977000	0.29475	2.526000	0.85167	0.563000	0.77884	CGG	0.151960		TCGA-F2-A44H-01A-11D-A26I-08	0.438	FAT3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	27		27	27	1	1.820000	-4.337061	1	0.260000	NM_001008781			33	33		200	199	1		1			0	0	27	0		1.000000	0	0	0	0	0	0	33	200
MLF2	8079	broad.mit.edu	37	12	6858098	6858098	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr12:6858098G>A	ENST00000203630.5	-	8	1254	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	MLF2_ENST00000564181.1_5'Flank|MLF2_ENST00000542154.1_Missense_Mutation_p.R204W|MLF2_ENST00000435120.1_Missense_Mutation_p.R204W|MLF2_ENST00000539187.1_Missense_Mutation_p.R204W			Q15773	MLF2_HUMAN	myeloid leukemia factor 2	204					defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(2)|large_intestine(3)|lung(4)	9						CGCTGCTGCCGGAATCGGGAG	0.687																																						ENST00000203630.5	1.000000	0.430000	0.890000	0.560000	0.710000	0.727124	0.710000	1.000000																										0				9						c.(610-612)Cgg>Tgg		myeloid leukemia factor 2							15.0	15.0	15.0					12																	6858098		2184	4269	6453	SO:0001583	missense	8079	0	0					g.chr12:6858098G>A	U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.610C>T	chr12.hg19:g.6858098G>A	ENSP00000203630:p.Arg204Trp	0					MLF2_ENST00000542154.1_Missense_Mutation_p.R204W|MLF2_ENST00000539187.1_Missense_Mutation_p.R204W|MLF2_ENST00000435120.1_Missense_Mutation_p.R204W|MLF2_ENST00000564181.1_5'Flank	p.R204W			0	0	0	2.003992	Q15773	MLF2_HUMAN		8	1254	-				Missense_Mutation	SNP	ENST00000203630.5	0	1	hg19	c.610C>T	CCDS8559.1	0	.	.	.	.	.	.	.	.	.	.	G	13.71	2.316957	0.40996	.	.	ENSG00000089693	ENST00000435120;ENST00000203630;ENST00000542154;ENST00000539187	.	.	.	5.21	2.18	0.27775	5.210000	2.180000	0.277750	.	0.153364	0.44688	D	0.000421	T	0.54127	0.1839	L	0.27053	0.805	0.49798	D	0.999828	D	0.89917	1.0	D	0.75020	0.985	T	0.53173	-0.8476	9	0.62326	D	0.03	.	7.9052	0.29757	0.0728:0.0:0.5051:0.4222	.	204	Q15773	MLF2_HUMAN	W	204	.	ENSP00000203630:R204W	R	-	1	2	2	MLF2	6728359	6728359	1.000000	0.71417	0.989000	0.46669	0.001000	0.01503	1.782000	0.38654	0.548000	0.28955	-0.218000	0.12543	CGG	0.242269		TCGA-F2-A44H-01A-11D-A26I-08	0.687	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400733.2	1	0	1		2	2	2	0		0	0	22		22	22	1	1.820000	-19.999250	1	0.260000				16	16		153	149	1		1	1		0	0	22	0		0.999936	9.999997e-01	0	50	0	247	0	16	153
TBX3	6926	broad.mit.edu	37	12	115112388	115112388	+	Missense_Mutation	SNP	G	G	A	rs565848855		TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr12:115112388G>A	ENST00000257566.3	-	7	1741	c.1352C>T	c.(1351-1353)gCg>gTg	p.A451V	TBX3_ENST00000349155.2_Missense_Mutation_p.A431V	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	451					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GCGCTCCTCCGCGCCCAGGCC	0.751																																						ENST00000257566.3	1.000000	0.280000	0.920000	0.440000	0.650000	0.673846	0.650000	1.000000																										0				47						c.(1351-1353)gCg>gTg		T-box 3							9.0	12.0	11.0					12																	115112388		2170	4223	6393	SO:0001583	missense	6926	1	118710	23				g.chr12:115112388G>A	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1352C>T	chr12.hg19:g.115112388G>A	ENSP00000257566:p.Ala451Val	0					TBX3_ENST00000349155.2_Missense_Mutation_p.A431V	p.A451V	NM_016569.3	NP_057653.3	0	0	0	2.011317	O15119	TBX3_HUMAN		7	1741	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	0	1	hg19	c.1352C>T	CCDS9176.1	0	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490947	0.44249	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.87103	-2.21;-2.2	5.14	1.42	0.22433	5.140000	1.420000	0.224330	.	6.239900	0.01621	U	0.023007	T	0.75184	0.3815	N	0.22421	0.69	0.26006	N	0.982051	B;B	0.34349	0.45;0.043	B;B	0.23852	0.049;0.007	T	0.67094	-0.5757	10	0.17369	T	0.5	.	5.0234	0.14372	0.2845:0.2671:0.4484:0.0	.	431;451	O15119-2;O15119	.;TBX3_HUMAN	V	431;451;451	ENSP00000257567:A431V;ENSP00000257566:A451V	ENSP00000257566:A451V	A	-	2	0	0	TBX3	113596771	113596771	0.352000	0.24895	0.749000	0.31150	0.723000	0.41478	1.286000	0.33273	1.175000	0.42826	-0.191000	0.12829	GCG	0.244281		TCGA-F2-A44H-01A-11D-A26I-08	0.751	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	0	0	1		2	2	2	0		0	0	10		10	10	1	1.820000	-13.977980	1	0.260000	NM_016569, NM_005996			6	6		65	64	0		1	0		0	0	10	0		0.965690	2.861163e-02	0	0	0	3	0	6	65
MYH7	4625	broad.mit.edu	37	14	23885302	23885302	+	Missense_Mutation	SNP	G	G	C	rs397516231		TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr14:23885302G>C	ENST00000355349.3	-	34	5026	c.4864C>G	c.(4864-4866)Ctc>Gtc	p.L1622V	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1622					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ATCTCATTGAGGTCTCCTTCC	0.607																																						ENST00000355349.3	1.000000	0.730000	0.990000	0.800000	0.890000	0.895792	0.890000	1.000000																										0				137						c.(4864-4866)Ctc>Gtc		myosin, heavy chain 7, cardiac muscle, beta							198.0	146.0	163.0					14																	23885302		2203	4300	6503	SO:0001583	missense	4625	0	0					g.chr14:23885302G>C	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4864C>G	chr14.hg19:g.23885302G>C	ENSP00000347507:p.Leu1622Val	0					MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	p.L1622V	NM_000257.2	NP_000248.2	0	0	0	2.039838	P12883	MYH7_HUMAN		34	5026	-	all_cancers(95;2.54e-05)		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	1	1	hg19	c.4864C>G	CCDS9601.1	1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409563	0.62399	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.79454	-1.27	4.55	4.55	0.56014	4.550000	4.550000	0.560140	Myosin tail (1);	.	.	.	.	D	0.83843	0.5342	M	0.71206	2.165	0.50313	D	0.999869	P	0.40534	0.72	P	0.50162	0.633	D	0.85606	0.1255	9	0.59425	D	0.04	.	17.8682	0.88803	0.0:0.0:1.0:0.0	.	1622	P12883	MYH7_HUMAN	V	1622;1627	ENSP00000347507:L1622V	ENSP00000347507:L1622V	L	-	1	0	0	MYH7	22955142	22955142	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.165000	0.77544	2.537000	0.85549	0.655000	0.94253	CTC	0.256132		TCGA-F2-A44H-01A-11D-A26I-08	0.607	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	1	0	1		2	2	2	0		0	0	68		68	68	1	1.820000	-3.221883	1	0.260000	NM_000257			94	93		707	692	1		1	0		0	0	68	0		1.000000	0	0	0	0	1	0	94	707
TRIM37	4591	broad.mit.edu	37	17	57158534	57158534	+	Missense_Mutation	SNP	T	T	A			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr17:57158534T>A	ENST00000262294.7	-	6	675	c.416A>T	c.(415-417)cAc>cTc	p.H139L	TRIM37_ENST00000376149.3_Missense_Mutation_p.H17L|TRIM37_ENST00000393066.3_Missense_Mutation_p.H139L|TRIM37_ENST00000393065.2_Missense_Mutation_p.H105L	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	139					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTAGTGACGTGTTGCTCATA	0.373									Mulibrey Nanism																													ENST00000262294.7	0.530000	0.270000	0.460000	0.330000	0.380000	0.396593	0.380000	0.390000																										0				37						c.(415-417)cAc>cTc		tripartite motif containing 37							117.0	115.0	116.0					17																	57158534		2203	4300	6503	SO:0001583	missense	4591	0	0		Mulibrey Nanism	Familial Cancer Database	Perheentupa syndrome	g.chr17:57158534T>A	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.416A>T	chr17.hg19:g.57158534T>A	ENSP00000262294:p.His139Leu	0					TRIM37_ENST00000376149.3_Missense_Mutation_p.H17L|TRIM37_ENST00000393065.2_Missense_Mutation_p.H105L|TRIM37_ENST00000393066.3_Missense_Mutation_p.H139L	p.H139L	NM_015294.3	NP_056109.1	1	2	3	2.049772	O94972	TRI37_HUMAN		6	675	-	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	1	1	hg19	c.416A>T	CCDS32694.1	0	.	.	.	.	.	.	.	.	.	.	T	31	5.079159	0.94050	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.68479	0.57;0.57;-0.33;0.57	5.62	5.62	0.85841	5.620000	5.620000	0.858410	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.82185	0.4982	M	0.81682	2.555	0.80722	D	1	D;D;B	0.89917	0.994;1.0;0.128	D;D;B	0.83275	0.949;0.996;0.138	D	0.84263	0.0484	10	0.59425	D	0.04	-21.7933	14.6613	0.68873	0.0:0.0:0.0:1.0	.	105;17;139	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	L	139;139;17;105	ENSP00000376785:H139L;ENSP00000262294:H139L;ENSP00000365319:H17L;ENSP00000376784:H105L	ENSP00000262294:H139L	H	-	2	0	0	TRIM37	54513316	54513316	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.864000	0.87037	2.150000	0.67090	0.528000	0.53228	CAC	0.260961		TCGA-F2-A44H-01A-11D-A26I-08	0.373	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	1	0	1		2	2	2	0		0	0	66		66	66	1	1.820000	-20.000000	1	0.260000	NM_015294			39	39		733	727	0		1	0		0	0	66	0		1.000000	4.787797e-02	0	0	0	7	0	39	733
C18orf25	147339	broad.mit.edu	37	18	43833700	43833700	+	Silent	SNP	A	A	T			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr18:43833700A>T	ENST00000282059.6	+	4	1310	c.936A>T	c.(934-936)acA>acT	p.T312T	C18orf25_ENST00000321319.6_Silent_p.T251T	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	312										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						GTGACAAAACATCTGGCAATG	0.398																																						ENST00000282059.6	1.000000	0.900000	1.000000	0.940000	0.970000	0.976506	0.970000	0.990000																										0				11						c.(934-936)acA>acT		chromosome 18 open reading frame 25							131.0	121.0	124.0					18																	43833700		1866	4088	5954	SO:0001819	synonymous_variant	147339	0	0					g.chr18:43833700A>T	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.936A>T	chr18.hg19:g.43833700A>T		1					C18orf25_ENST00000321319.6_Silent_p.T251T	p.T312T	NM_145055.3	NP_659492	0	1	1	1.772900	Q96B23	CR025_HUMAN		4	1310	+			A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Silent	SNP	ENST00000282059.6	1	0	hg19	c.936A>T	CCDS42430.1	1																																																																																								0.149425		TCGA-F2-A44H-01A-11D-A26I-08	0.398	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	1	0	1		2	2	2	0		0	0	61		61	61	1	1.820000	-3.213718	1	0.260000	NM_145055			133	135		589	590	1		1	0		0	0	61	0		1.000000	3.446371e-02	0	0	0	2	0	133	589
ALPK2	115701	broad.mit.edu	37	18	56274646	56274646	+	Nonsense_Mutation	SNP	C	C	T			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr18:56274646C>T	ENST00000361673.3	-	3	348	c.135G>A	c.(133-135)tgG>tgA	p.W45*		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	45	Ig-like 1.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CATTCTTATACCAAGTTACCT	0.348																																						ENST00000361673.3	1.000000	0.670000	0.970000	0.780000	0.880000	0.876745	0.880000	0.950000																										0				84						c.(133-135)tgG>tgA		alpha-kinase 2							72.0	68.0	69.0					18																	56274646		1880	4105	5985	SO:0001587	stop_gained	115701	0	0					g.chr18:56274646C>T	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.135G>A	chr18.hg19:g.56274646C>T	ENSP00000354991:p.Trp45*	1						p.W45*	NM_052947.3	NP_443179.3	0	1	1	1.772900	Q86TB3	ALPK2_HUMAN		3	348	-			Q6ZUX0|Q8NAT5|Q96L95	Nonsense_Mutation	SNP	ENST00000361673.3	0	1	hg19	c.135G>A	CCDS11966.2	1	.	.	.	.	.	.	.	.	.	.	C	39	7.294979	0.98192	.	.	ENSG00000198796	ENST00000361673	.	.	.	5.9	5.9	0.94986	5.900000	5.900000	0.949860	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.1281	17.1872	0.86869	0.0:1.0:0.0:0.0	.	.	.	.	X	45	.	ENSP00000354991:W45X	W	-	3	0	0	ALPK2	54425626	54425626	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.818000	0.55678	2.793000	0.96121	0.591000	0.81541	TGG	0.149425		TCGA-F2-A44H-01A-11D-A26I-08	0.348	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	1	0	1		2	2	2	0		0	0	18		18	18	1	1.820000	-20.000000	1	0.260000	NM_052947			38	38		225	222	0		1			0	0	18	0		1.000000	0	0	0	0	0	0	38	225
BST2	684	broad.mit.edu	37	19	17515193	17515193	+	Silent	SNP	C	C	A			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr19:17515193C>A	ENST00000252593.6	-	2	411	c.339G>T	c.(337-339)gtG>gtT	p.V113V	CTD-2521M24.9_ENST00000500836.2_lincRNA|BST2_ENST00000527220.1_Intron	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	113					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						CAAGCTCCTCCACTTTCTTTT	0.582																																						ENST00000252593.6	1.000000	0.680000	0.930000	0.760000	0.840000	0.850890	0.840000	1.000000																										0				9						c.(337-339)gtG>gtT		bone marrow stromal cell antigen 2							107.0	109.0	109.0					19																	17515193		2203	4300	6503	SO:0001819	synonymous_variant	684	0	0					g.chr19:17515193C>A		CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.339G>T	chr19.hg19:g.17515193C>A		0					BST2_ENST00000527220.1_Intron|CTD-2521M24.9_ENST00000500836.2_lincRNA	p.V113V	NM_004335.2	NP_004326.1	0	1	1	2.039936	Q10589	BST2_HUMAN		2	411	-			A8K4Y4|Q53G07	Silent	SNP	ENST00000252593.6	1	1	hg19	c.339G>T	CCDS12358.1	0																																																																																								0.258071		TCGA-F2-A44H-01A-11D-A26I-08	0.582	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387346.1	1	0	1		2	2	2	0		0	0	92		92	92	1	1.820000	-3.318794	1	0.260000	NM_004335			91	89		732	726	1		1	1		0	0	92	0		1.000000	1	0	6	0	224	0	91	732
SLC8A2	6543	broad.mit.edu	37	19	47968987	47968987	+	Splice_Site	SNP	T	T	C			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr19:47968987T>C	ENST00000236877.6	-	2	1069	c.674A>G	c.(673-675)cAg>cGg	p.Q225R	SLC8A2_ENST00000539381.1_Intron|SLC8A2_ENST00000542837.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	225					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		TTTGCTCACCTGGACCACACC	0.478																																						ENST00000236877.6	0.850000	0.190000	0.650000	0.300000	0.460000	0.487537	0.460000	0.430000																										0				31						c.(673-675)cAg>cGg		solute carrier family 8 (sodium/calcium exchanger), member 2							51.0	35.0	41.0					19																	47968987		2203	4300	6503	SO:0001630	splice_region_variant	6543	0	0					g.chr19:47968987T>C	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.675+1A>G	chr19.hg19:g.47968987T>C		0					SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	p.Q225R	NM_015063.2	NP_055878.1	0	1	1	2.040873	Q9UPR5	NAC2_HUMAN		2	1069	-		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)	B4DYQ9	Splice_Site	SNP	ENST00000236877.6	0	1	hg19	c.674A>G	CCDS33065.1	0	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103832	0.37145	.	.	ENSG00000118160	ENST00000391903;ENST00000236877	T	0.62639	0.01	4.16	4.16	0.48862	4.160000	4.160000	0.488620	Sodium/calcium exchanger membrane region (1);	0.066208	0.64402	D	0.000012	T	0.55353	0.1915	L	0.39898	1.24	0.80722	D	1	P;P	0.43826	0.818;0.801	P;B	0.44561	0.453;0.438	T	0.60429	-0.7265	10	0.87932	D	0	.	9.5368	0.39226	0.0:0.0:0.0:1.0	.	53;225	E9PGS7;Q9UPR5	.;NAC2_HUMAN	R	53;225	ENSP00000236877:Q225R	ENSP00000236877:Q225R	Q	-	2	0	0	SLC8A2	52660799	52660799	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	6.954000	0.76001	1.758000	0.51981	0.454000	0.30748	CAG	0.258071		TCGA-F2-A44H-01A-11D-A26I-08	0.478	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1	0	0	1		2	2	2	0		0	0	14		14	14	1	1.820000	-10.190810	1	0.260000		Missense_Mutation		6	6		99	97	0		1	0		0	0	14	0		0.964338	0	0	0	0	1	0	6	99
LILRA6	79168	broad.mit.edu	37	19	54744909	54744909	+	Silent	SNP	G	G	A	rs370378163	byFrequency	TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr19:54744909G>A	ENST00000396365.2	-	5	792	c.753C>T	c.(751-753)taC>taT	p.Y251Y	LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000419410.2_Silent_p.Y251Y|LILRA6_ENST00000440558.2_Silent_p.Y251Y|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000245621.5_Silent_p.Y251Y|LILRB3_ENST00000407860.2_Intron	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	251	Ig-like C2-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAAATCTGTCGTAGCCGACAT	0.652													.|||	2	0.000399361	0.0	0.0	5008	,	,		32161	0.0		0.002	False		,,,				2504	0.0					ENST00000396365.2	1.000000	0.300000	0.470000	0.350000	0.400000	0.429978	0.400000	0.410000																										0				38						c.(751-753)taC>taT		leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6		G		1,4405	2.1+/-5.4	0,1,2202	121.0	130.0	127.0		753	-1.1	0.0	19		127	1,8599		0,1,4299	no	coding-synonymous	LILRA6	NM_024318.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		251/482	54744909	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	79168	1	121412	43				g.chr19:54744909G>A	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.753C>T	chr19.hg19:g.54744909G>A		0					LILRA6_ENST00000440558.2_Silent_p.Y251Y|LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000245621.5_Silent_p.Y251Y|LILRA6_ENST00000419410.2_Silent_p.Y251Y|LILRB3_ENST00000407860.2_Intron	p.Y251Y	NM_024318.2	NP_077294	1	2	3	2.059402	Q6PI73	LIRA6_HUMAN		5	792	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			Silent	SNP	ENST00000396365.2	1	1	hg19	c.753C>T	CCDS42610.1	0																																																																																								0.263828		TCGA-F2-A44H-01A-11D-A26I-08	0.652	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	0	0	1		25	2	2	1		1	1	122		122	123	1	1.820000	-6.375130	1	0.260000	NM_024318			53	54		953	925	0		1	0		1	0	122	0		0.999433	8.098397e-02	0	0	0	9	0	53	953
SORT1	6272	broad.mit.edu	37	1	109883487	109883487	+	Missense_Mutation	SNP	T	T	C			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr1:109883487T>C	ENST00000256637.6	-	10	1181	c.1123A>G	c.(1123-1125)Aca>Gca	p.T375A	SORT1_ENST00000538502.1_Missense_Mutation_p.T238A	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	375					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		GTAAAGATTGTGCCAAACCCA	0.443																																						ENST00000256637.6	1.000000	0.770000	1.000000	0.870000	0.960000	0.946102	0.960000	1.000000																										0				26						c.(1123-1125)Aca>Gca		sortilin 1							116.0	98.0	104.0					1																	109883487		2203	4300	6503	SO:0001583	missense	6272	0	0					g.chr1:109883487T>C	BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1123A>G	chr1.hg19:g.109883487T>C	ENSP00000256637:p.Thr375Ala	1					SORT1_ENST00000538502.1_Missense_Mutation_p.T238A	p.T375A	NM_002959.5	NP_002950.3	0	1	1	1.805362	Q99523	SORT_HUMAN		10	1181	-		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	ENST00000256637.6	1	1	hg19	c.1123A>G	CCDS798.1	1	.	.	.	.	.	.	.	.	.	.	t	17.76	3.469461	0.63625	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.28454	1.61;1.61	5.69	5.69	0.88448	5.690000	5.690000	0.884480	VPS10 (1);	0.101437	0.64402	D	0.000003	T	0.23532	0.0569	L	0.43757	1.38	0.58432	D	0.999999	B;P	0.43352	0.434;0.804	B;P	0.47102	0.148;0.537	T	0.01557	-1.1325	10	0.36615	T	0.2	-10.6008	14.923	0.70854	0.0:0.0:0.0:1.0	.	238;375	B4DWI3;Q99523	.;SORT_HUMAN	A	375;238	ENSP00000256637:T375A;ENSP00000438597:T238A	ENSP00000256637:T375A	T	-	1	0	0	SORT1	109685010	109685010	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.820000	0.86633	2.170000	0.68504	0.529000	0.55759	ACA	0.155733		TCGA-F2-A44H-01A-11D-A26I-08	0.443	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	1	0	1		2	2	2	0		0	0	31		31	31	1	1.820000	-19.999700	1	0.260000	NM_002959			45	45		231	231	1		1	1		0	0	31	0		1.000000	9.576930e-01	0	3	0	26	0	45	231
FLRT3	23767	broad.mit.edu	37	20	14307019	14307019	+	Silent	SNP	T	T	C	rs36034779	byFrequency	TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr20:14307019T>C	ENST00000378053.3	-	2	1390	c.1134A>G	c.(1132-1134)caA>caG	p.Q378Q	MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000462077.1_5'Flank|MACROD2_ENST00000310348.4_Intron|FLRT3_ENST00000341420.4_Silent_p.Q378Q	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	378					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		GCCACTGTCCTTGGGCAGGAT	0.453																																						ENST00000378053.3	0.550000	0.340000	0.500000	0.380000	0.430000	0.446106	0.430000	0.440000																										0				17						c.(1132-1134)caA>caG		fibronectin leucine rich transmembrane protein 3							177.0	170.0	172.0					20																	14307019		2203	4300	6503	SO:0001819	synonymous_variant	23767	0	0					g.chr20:14307019T>C	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.1134A>G	chr20.hg19:g.14307019T>C		0					MACROD2_ENST00000310348.4_Intron|FLRT3_ENST00000462077.1_5'Flank|MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000341420.4_Silent_p.Q378Q	p.Q378Q	NM_013281.3	NP_037413.1	0	1	1	2.044880	Q9NZU0	FLRT3_HUMAN	COAD - Colon adenocarcinoma(2;0.129)	2	1390	-		Colorectal(1;0.0464)	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Silent	SNP	ENST00000378053.3	1	0	hg19	c.1134A>G	CCDS13121.1	0																																																																																								0.258071		TCGA-F2-A44H-01A-11D-A26I-08	0.453	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	1	0	1		2	2	2	0		0	0	89		89	88	1	1.820000	-9.193671	1	0.260000	NM_013281			69	69		1130	1124	0		1	0		0	0	89	0		1.000000	3.437054e-03	0	0	0	2	0	69	1130
MCM3AP	8888	broad.mit.edu	37	21	47704430	47704430	+	Silent	SNP	C	C	T			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr21:47704430C>T	ENST00000397708.1	-	2	1025	c.771G>A	c.(769-771)gcG>gcA	p.A257A	YBEY_ENST00000329319.3_5'Flank|YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000397694.1_5'Flank|YBEY_ENST00000397701.4_5'Flank|YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000339195.6_5'Flank|MCM3AP_ENST00000291688.1_Silent_p.A257A			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	257	FG-repeats.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CGCCCAAAACCGCAGATGATA	0.468																																						ENST00000397708.1	1.000000	0.760000	1.000000	0.840000	0.930000	0.926172	0.930000	1.000000																										0				72						c.(769-771)gcG>gcA		minichromosome maintenance complex component 3 associated protein							82.0	82.0	82.0					21																	47704430		2203	4300	6503	SO:0001819	synonymous_variant	8888	0	0					g.chr21:47704430C>T	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.771G>A	chr21.hg19:g.47704430C>T		0					YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000397701.4_5'Flank|YBEY_ENST00000329319.3_5'Flank|MCM3AP_ENST00000291688.1_Silent_p.A257A|YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000339195.6_5'Flank|YBEY_ENST00000397694.1_5'Flank	p.A257A			0	1	1	2.042870	O60318	GANP_HUMAN		2	1025	-	Breast(49;0.112)		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	1	1	hg19	c.771G>A	CCDS13734.1	1																																																																																								0.258071		TCGA-F2-A44H-01A-11D-A26I-08	0.468	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	1	0	1		2	2	2	0		0	0	74		74	74	1	1.820000	-2.716734	1	0.260000	NM_003906			94	92		676	669	1		1	1		0	0	74	0		1.000000	5.997189e-01	0	3	0	13	0	94	676
C2orf71	388939	broad.mit.edu	37	2	29295765	29295765	+	Missense_Mutation	SNP	G	G	T			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr2:29295765G>T	ENST00000331664.5	-	1	1362	c.1363C>A	c.(1363-1365)Cca>Aca	p.P455T		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	455					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GAATCACATGGGGTGCTTGTC	0.552																																						ENST00000331664.5	0.580000	0.280000	0.500000	0.340000	0.410000	0.430132	0.410000	0.420000																										0				60						c.(1363-1365)Cca>Aca		chromosome 2 open reading frame 71							86.0	90.0	89.0					2																	29295765		1975	4158	6133	SO:0001583	missense	388939	0	0					g.chr2:29295765G>T		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1363C>A	chr2.hg19:g.29295765G>T	ENSP00000332809:p.Pro455Thr	0						p.P455T	NM_001029883.2	NP_001025054.1	0	0	0	2.037145	A6NGG8	CB071_HUMAN		1	1362	-				Missense_Mutation	SNP	ENST00000331664.5	1	1	hg19	c.1363C>A	CCDS42669.1	0	.	.	.	.	.	.	.	.	.	.	G	9.104	1.004923	0.19199	.	.	ENSG00000179270	ENST00000331664	T	0.19394	2.15	5.3	-3.7	0.04437	5.300000	-3.700000	0.044370	.	1.678270	0.03044	N	0.153697	T	0.18800	0.0451	L	0.56769	1.78	0.09310	N	1	P	0.38370	0.628	B	0.34489	0.184	T	0.29912	-0.9996	10	0.33940	T	0.23	3.0531	6.309	0.21154	0.4479:0.3978:0.1543:0.0	.	455	A6NGG8	CB071_HUMAN	T	455	ENSP00000332809:P455T	ENSP00000332809:P455T	P	-	1	0	0	C2orf71	29149269	29149269	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.083000	0.11286	-0.583000	0.05921	0.561000	0.74099	CCA	0.256132		TCGA-F2-A44H-01A-11D-A26I-08	0.552	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	1	0	1		2	2	2	0		0	0	57		57	56	1	1.820000	-2.665703	1	0.260000	NM_001029883			28	28		483	479	0		1			0	0	57	0		1.000000	0	0	0	0	0	0	28	483
APLF	200558	broad.mit.edu	37	2	68729986	68729986	+	Missense_Mutation	SNP	T	T	A			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr2:68729986T>A	ENST00000303795.4	+	3	463	c.292T>A	c.(292-294)Ttc>Atc	p.F98I		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	98	FHA-like.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						CAAATACATTTTCCGCATTCT	0.373																																						ENST00000303795.4	1.000000	0.880000	1.000000	0.960000	0.990000	0.986810	0.990000	1.000000																										0				25						c.(292-294)Ttc>Atc		aprataxin and PNKP like factor							137.0	137.0	137.0					2																	68729986		2203	4300	6503	SO:0001583	missense	200558	0	0					g.chr2:68729986T>A	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.292T>A	chr2.hg19:g.68729986T>A	ENSP00000307004:p.Phe98Ile	0						p.F98I	NM_173545.2	NP_775816.1	0	0	0	2.037145	Q8IW19	APLF_HUMAN		3	463	+			A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	1	1	hg19	c.292T>A	CCDS1888.1	1	.	.	.	.	.	.	.	.	.	.	t	15.35	2.807837	0.50421	.	.	ENSG00000169621	ENST00000303795	T	0.27104	1.69	5.22	5.22	0.72569	5.220000	5.220000	0.725690	SMAD/FHA domain (1);	0.053905	0.64402	D	0.000001	T	0.53449	0.1797	M	0.83603	2.65	0.44432	D	0.997351	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.60136	-0.7322	10	0.87932	D	0	.	12.924	0.58249	0.0:0.0:0.0:1.0	.	98;98	F8WET0;Q8IW19	.;APLF_HUMAN	I	98	ENSP00000307004:F98I	ENSP00000307004:F98I	F	+	1	0	0	APLF	68583490	68583490	0.982000	0.34865	0.424000	0.26647	0.007000	0.05969	4.205000	0.58466	2.091000	0.63221	0.533000	0.62120	TTC	0.256132		TCGA-F2-A44H-01A-11D-A26I-08	0.373	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	1	0	1		2	2	2	0		0	0	60		60	60	1	1.820000	-20.000000	1	0.260000	NM_173545			126	125		789	786	1		1	0		0	0	60	0		1.000000	1.972041e-01	0	1	0	5	0	126	789
AGGF1	55109	broad.mit.edu	37	5	76349893	76349893	+	Missense_Mutation	SNP	A	A	T	rs543793359		TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr5:76349893A>T	ENST00000312916.7	+	10	1953	c.1571A>T	c.(1570-1572)gAt>gTt	p.D524V		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	524					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GATACCTGTGATGGCTGTGAA	0.408																																						ENST00000312916.7	0.830000	0.490000	0.730000	0.560000	0.630000	0.648112	0.630000	0.630000																										0				20						c.(1570-1572)gAt>gTt		angiogenic factor with G patch and FHA domains 1							140.0	135.0	137.0					5																	76349893		2203	4300	6503	SO:0001583	missense	55109	0	0					g.chr5:76349893A>T	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.1571A>T	chr5.hg19:g.76349893A>T	ENSP00000316109:p.Asp524Val	0						p.D524V	NM_018046.4	NP_060516.2	1	2	3	2.054723	Q8N302	AGGF1_HUMAN		10	1953	+		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)	O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	1	1	hg19	c.1571A>T	CCDS4035.1	0	.	.	.	.	.	.	.	.	.	.	A	17.03	3.284157	0.59867	.	.	ENSG00000164252	ENST00000312916	T	0.40476	1.03	5.02	5.02	0.67125	5.020000	5.020000	0.671250	Forkhead-associated (FHA) domain (1);	0.000000	0.85682	D	0.000000	T	0.40619	0.1124	L	0.56769	1.78	0.80722	D	1	P	0.38617	0.64	B	0.34779	0.189	T	0.46345	-0.9198	10	0.72032	D	0.01	-0.0151	14.7498	0.69516	1.0:0.0:0.0:0.0	.	524	Q8N302	AGGF1_HUMAN	V	524	ENSP00000316109:D524V	ENSP00000316109:D524V	D	+	2	0	0	AGGF1	76385649	76385649	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.271000	0.95698	1.883000	0.54544	0.379000	0.24179	GAT	0.261919		TCGA-F2-A44H-01A-11D-A26I-08	0.408	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	1	0	1		2	2	2	0		0	0	73		73	72	1	1.820000	-20.000000	1	0.260000	NM_018046			59	59		654	646	0		1	0		0	0	73	0		1.000000	5.822350e-01	0	0	0	23	0	59	654
SYNE1	23345	broad.mit.edu	37	6	152651474	152651474	+	Silent	SNP	T	T	C			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr6:152651474T>C	ENST00000367255.5	-	78	14947	c.14346A>G	c.(14344-14346)gaA>gaG	p.E4782E	SYNE1_ENST00000448038.1_Silent_p.E4711E|SYNE1_ENST00000341594.5_Silent_p.E4529E|SYNE1_ENST00000265368.4_Silent_p.E4782E|SYNE1_ENST00000423061.1_Silent_p.E4711E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4782					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTCTCGTGTTCTTGGTAAG	0.478										HNSCC(10;0.0054)																												ENST00000367255.5	0.460000	0.160000	0.380000	0.220000	0.290000	0.308619	0.290000	0.290000																										0				524						c.(14344-14346)gaA>gaG		spectrin repeat containing, nuclear envelope 1							107.0	97.0	101.0					6																	152651474		2203	4300	6503	SO:0001819	synonymous_variant	23345	0	0					g.chr6:152651474T>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14346A>G	chr6.hg19:g.152651474T>C		1	HNSCC(10;0.0054)				SYNE1_ENST00000341594.5_Silent_p.E4529E|SYNE1_ENST00000265368.4_Silent_p.E4782E|SYNE1_ENST00000448038.1_Silent_p.E4711E|SYNE1_ENST00000423061.1_Silent_p.E4711E	p.E4782E	NM_182961.3	NP_892006.3	0	1	1	1.793106	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	78	14947	-		Ovarian(120;0.0955)	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	0	1	hg19	c.14346A>G	CCDS5236.2	0																																																																																								0.150694		TCGA-F2-A44H-01A-11D-A26I-08	0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	1	0	1		2	2	2	0		0	0	18		18	18	1	1.820000	-15.561270	1	0.260000	NM_182961			14	14		304	301	0		1	0		0	0	18	0		0.999755	0	0	0	0	1	0	14	304
ELMO1	9844	broad.mit.edu	37	7	37354484	37354484	+	Silent	SNP	G	G	A	rs368913504	byFrequency	TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr7:37354484G>A	ENST00000310758.4	-	4	809	c.162C>T	c.(160-162)gcC>gcT	p.A54A	ELMO1_ENST00000442504.1_Silent_p.A54A|ELMO1_ENST00000448602.1_Silent_p.A54A	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	54					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						TTGAACTATCGGCATGCTGGA	0.328													G|||	2	0.000399361	0.0008	0.0	5008	,	,		21569	0.001		0.0	False		,,,				2504	0.0					ENST00000310758.4	1.000000	0.360000	0.800000	0.480000	0.620000	0.642075	0.620000	0.610000																										0				58						c.(160-162)gcC>gcT		engulfment and cell motility 1		G	,,	0,4406		0,0,2203	110.0	104.0	106.0		162,162,162	-8.8	0.7	7		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ELMO1	NM_001206480.1,NM_001206482.1,NM_014800.10	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	54/728,54/728,54/728	37354484	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9844	18	121412	43				g.chr7:37354484G>A	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.162C>T	chr7.hg19:g.37354484G>A		0					ELMO1_ENST00000442504.1_Silent_p.A54A|ELMO1_ENST00000448602.1_Silent_p.A54A	p.A54A	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	1	2	3	2.054742	Q92556	ELMO1_HUMAN		4	809	-			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	0	1	hg19	c.162C>T	CCDS5449.1	0																																																																																								0.261919		TCGA-F2-A44H-01A-11D-A26I-08	0.328	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	1	0	1		2	2	2	0		0	0	10		10	10	1	1.820000	-2.841682	1	0.260000	NM_130442			15	15		173	170	0		1	0		0	0	10	0		0.999879	2.108019e-02	0	0	0	3	0	15	173
ASH2L	9070	broad.mit.edu	37	8	37974234	37974234	+	Missense_Mutation	SNP	A	A	T			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr8:37974234A>T	ENST00000343823.6	+	8	1153	c.844A>T	c.(844-846)Aat>Tat	p.N282Y	ASH2L_ENST00000250635.7_Missense_Mutation_p.N188Y|ASH2L_ENST00000545394.1_Missense_Mutation_p.N143Y|ASH2L_ENST00000521652.1_Missense_Mutation_p.N188Y|ASH2L_ENST00000524263.1_3'UTR|ASH2L_ENST00000428278.2_Missense_Mutation_p.N188Y	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	282					cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				TACTAGTGGGAATTTAAATGG	0.378																																						ENST00000343823.6	0.970000	0.470000	0.820000	0.570000	0.680000	0.695840	0.680000	0.670000																										0				19						c.(844-846)Aat>Tat		ash2 (absent, small, or homeotic)-like (Drosophila)							93.0	88.0	89.0					8																	37974234		2203	4300	6503	SO:0001583	missense	9070	0	0					g.chr8:37974234A>T	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.844A>T	chr8.hg19:g.37974234A>T	ENSP00000340896:p.Asn282Tyr	0					ASH2L_ENST00000524263.1_3'UTR|ASH2L_ENST00000428278.2_Missense_Mutation_p.N188Y|ASH2L_ENST00000545394.1_Missense_Mutation_p.N143Y|ASH2L_ENST00000250635.7_Missense_Mutation_p.N188Y|ASH2L_ENST00000521652.1_Missense_Mutation_p.N188Y	p.N282Y	NM_004674.4	NP_004665.2	1	2	3	2.056714	Q9UBL3	ASH2L_HUMAN		8	1153	+	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	ENST00000343823.6	1	1	hg19	c.844A>T	CCDS6101.1	0	.	.	.	.	.	.	.	.	.	.	A	16.04	3.009607	0.54361	.	.	ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000545394;ENST00000428278;ENST00000521652	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.79	5.79	0.91817	5.790000	5.790000	0.918170	.	0.088769	0.85682	D	0.000000	T	0.12347	0.0300	N	0.03608	-0.345	0.46774	D	0.99919	B;P	0.47350	0.001;0.894	B;B	0.41723	0.001;0.365	T	0.17107	-1.0380	10	0.59425	D	0.04	.	16.1193	0.81336	1.0:0.0:0.0:0.0	.	188;282	Q9UBL3-2;Q9UBL3	.;ASH2L_HUMAN	Y	282;188;143;188;188	ENSP00000340896:N282Y;ENSP00000250635:N188Y;ENSP00000443606:N143Y;ENSP00000395310:N188Y;ENSP00000430259:N188Y	ENSP00000250635:N188Y	N	+	1	0	0	ASH2L	38093391	38093391	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.057000	0.64294	2.201000	0.70794	0.533000	0.62120	AAT	0.261919		TCGA-F2-A44H-01A-11D-A26I-08	0.378	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	1	0	1		2	2	2	0		0	0	25		25	24	1	1.820000	-20.000000	1	0.260000	NM_004674			30	30		310	308	0		1	1		0	0	25	0		1.000000	7.705493e-01	0	5	0	26	0	30	310
PXDNL	137902	broad.mit.edu	37	8	52321508	52321508	+	Silent	SNP	G	G	C			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr8:52321508G>C	ENST00000356297.4	-	17	2776	c.2676C>G	c.(2674-2676)gcC>gcG	p.A892A	PXDNL_ENST00000543296.1_Silent_p.A892A	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	892					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CATCGATGTAGGCTGTTTGCT	0.617																																						ENST00000356297.4	1.000000	0.530000	0.880000	0.630000	0.740000	0.759196	0.740000	1.000000																										0				48						c.(2674-2676)gcC>gcG		peroxidasin homolog (Drosophila)-like							45.0	51.0	49.0					8																	52321508		2051	4185	6236	SO:0001819	synonymous_variant	137902	0	0					g.chr8:52321508G>C		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2676C>G	chr8.hg19:g.52321508G>C		0					PXDNL_ENST00000543296.1_Silent_p.A892A	p.A892A	NM_144651.4	NP_653252	1	2	3	2.056714	A1KZ92	PXDNL_HUMAN		17	2776	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	1	1	hg19	c.2676C>G	CCDS47855.1	0	.	.	.	.	.	.	.	.	.	.	G	0.661	-0.805621	0.02819	.	.	ENSG00000147485	ENST00000522933	.	.	.	4.17	-1.27	0.09347	4.170000	-1.270000	0.093470	.	.	.	.	.	T	0.42539	0.1207	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21449	-1.0245	4	.	.	.	.	3.3987	0.07315	0.3694:0.0:0.3804:0.2502	.	.	.	.	R	11	.	.	P	-	2	0	0	PXDNL	52484061	52484061	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-3.594000	0.00420	-0.767000	0.04633	0.655000	0.94253	CCT	0.261919		TCGA-F2-A44H-01A-11D-A26I-08	0.617	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	1	0	0		2	2	2	0		0	0	53		53	53	1	1.820000	-20.000000	1	0.260000	NM_144651			34	34		317	315	0		1			0	0	53	0		1.000000	0	0	0	0	0	0	34	317
ZNF484	83744	broad.mit.edu	37	9	95610736	95610736	+	Silent	SNP	T	T	C			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chr9:95610736T>C	ENST00000375495.3	-	5	481	c.333A>G	c.(331-333)ccA>ccG	p.P111P	ZNF484_ENST00000332591.6_Silent_p.P75P|ZNF484_ENST00000395506.3_Silent_p.P113P|ZNF484_ENST00000395505.2_Silent_p.P75P|ANKRD19P_ENST00000473204.1_RNA	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						AAATGGAATATGGGTCATCTC	0.363																																						ENST00000375495.3	1.000000	0.840000	1.000000	0.910000	0.970000	0.964709	0.970000	1.000000																										0				33						c.(331-333)ccA>ccG		zinc finger protein 484							117.0	119.0	118.0					9																	95610736		2203	4300	6503	SO:0001819	synonymous_variant	83744	0	0					g.chr9:95610736T>C	AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.333A>G	chr9.hg19:g.95610736T>C		1					ANKRD19P_ENST00000473204.1_RNA|ZNF484_ENST00000395505.2_Silent_p.P75P|ZNF484_ENST00000332591.6_Silent_p.P75P|ZNF484_ENST00000395506.3_Silent_p.P113P	p.P111P	NM_031486.2	NP_113674.1	0	1	1	1.798577	Q5JVG2	ZN484_HUMAN		5	481	-			B1AL89|B4DRI2	Silent	SNP	ENST00000375495.3	1	1	hg19	c.333A>G	CCDS35066.1	1																																																																																								0.154479		TCGA-F2-A44H-01A-11D-A26I-08	0.363	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053111.2	1	0	1		2	2	2	0		0	0	32		32	30	1	1.820000	-20.000000	1	0.260000	XM_046861			95	95		506	502	1		1			0	0	32	0		1.000000	0	0	0	0	0	0	95	506
RBM10	8241	broad.mit.edu	37	X	47045114	47045114	+	Splice_Site	SNP	G	G	C			TCGA-F2-A44H-01A-11D-A26I-08	TCGA-F2-A44H-10A-01D-A26I-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b059c399-13e4-4524-9505-49b477983cfa	bc622231-2dda-44dc-b430-9f4738960c07	g.chrX:47045114G>C	ENST00000377604.3	+	21	3097		c.e21-1		RBM10_ENST00000329236.7_Splice_Site|RBM10_ENST00000345781.6_Splice_Site	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10						3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CCCTCTTGCAGCAAAACCTTG	0.562																																					Melanoma(171;120 2705 19495 39241)	ENST00000377604.3	0.980000	0.490000	0.920000	0.620000	0.770000	0.774076	0.770000	0.810000																										0				48						c.e21-1		RNA binding motif protein 10							86.0	71.0	76.0					X																	47045114		2203	4300	6503	SO:0001630	splice_region_variant	8241	0	0					g.chrX:47045114G>C	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2356-1G>C	chrX.hg19:g.47045114G>C							RBM10_ENST00000329236.7_Splice_Site|RBM10_ENST00000345781.6_Splice_Site		NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	0	1	1		P98175	RBM10_HUMAN		21	3097	+			C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Splice_Site	SNP	ENST00000377604.3	1	1	hg19		CCDS14274.1	0	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012815	0.54468	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	5.13	5.13	0.70059	5.130000	5.130000	0.700590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2759	0.73742	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	RBM10	46930058	46930058	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	9.496000	0.97967	2.285000	0.76669	0.529000	0.55759	.	0.260000		TCGA-F2-A44H-01A-11D-A26I-08	0.562	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	1	0	1		2	2	2	0		0	0	13		13	13	1	1.820000	-12.784080	1	0.260000	NM_005676	Intron		15	15		54	53	1		1	1	1	0	0	13	300		0.999927	7.677208e-01	1	10	87	2	279	15	54
