#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
OC90	729330	broad.mit.edu	37	8	133048648	133048648	+	Frame_Shift_Del	DEL	C	C	-			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr8:133048648delC	ENST00000443356.2	-	10	783	c.697delG	c.(697-699)gctfs	p.A233fs	OC90_ENST00000254627.3_Intron|OC90_ENST00000262283.5_Frame_Shift_Del_p.A429fs|OC90_ENST00000603859.1_Intron			Q02509	OC90_HUMAN	otoconin 90	233					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			AGTCTGTCAGCCTCAGTCTCT	0.443																																						ENST00000443356.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				37						c.(697-699)gctfs		otoconin 90							111.0	106.0	108.0					8																	133048648		1900	4133	6033	SO:0001589	frameshift_variant	729330	0	0					g.chr8:133048648delC	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.697delG	chr8.hg19:g.133048648delC	ENSP00000390050:p.Ala233fs	1					OC90_ENST00000254627.3_Intron|OC90_ENST00000262283.5_Frame_Shift_Del_p.A429fs|OC90_ENST00000603859.1_Intron	p.A233fs			3	3	6	2.460283	Q02509	OC90_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)	10	783	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		B4DNG8	Frame_Shift_Del	DEL	ENST00000443356.2	1	1	hg19	c.697delG		1																																																																																								0.413043		TCGA-F2-A7TX-01A-33D-A38G-08	0.443	OC90-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2			0	0	0	0	188	0	188	186	1	3.450000	-3.076112	1	0.190000	NM_001080399		0	91	100	0	516	509	0	0	1	0	0	0	0	0	0	0	1.000000	0	0	0	0	0	0	91	516
CAMK1D	57118	broad.mit.edu	37	10	12870810	12870810	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr10:12870810C>T	ENST00000378847.3	+	11	1419	c.1082C>T	c.(1081-1083)tCg>tTg	p.S361L		NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	361	Ser-rich.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		TCTTCTTCGTCGGGGGTCTCA	0.592																																						ENST00000378847.3	1.000000	0.710000	1.000000	0.840000	0.990000	0.942124	0.990000	1.000000																										0				16						c.(1081-1083)tCg>tTg		calcium/calmodulin-dependent protein kinase ID							70.0	68.0	69.0					10																	12870810		2203	4300	6503	SO:0001583	missense	57118	0	0					g.chr10:12870810C>T	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.1082C>T	chr10.hg19:g.12870810C>T	ENSP00000368124:p.Ser361Leu	1						p.S361L	NM_153498.2	NP_705718.1	0	4	4	2.104230	Q8IU85	KCC1D_HUMAN		11	1419	+			B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	1	1	hg19	c.1082C>T	CCDS7091.1	1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260463	0.59431	.	.	ENSG00000183049	ENST00000378847	T	0.68479	-0.33	5.39	5.39	0.77823	5.39	5.39	0.77823	.	0.318671	0.30695	N	0.009065	T	0.52240	0.1722	N	0.22421	0.69	0.80722	D	1	B	0.30634	0.288	B	0.19148	0.024	T	0.54476	-0.8288	10	0.51188	T	0.08	-3.006	16.3016	0.82820	0.0:1.0:0.0:0.0	.	361	Q8IU85	KCC1D_HUMAN	L	361	ENSP00000368124:S361L	ENSP00000368124:S361L	S	+	2	0	0	CAMK1D	12910816	12910816	0.995000	0.38212	0.026000	0.17262	0.974000	0.67602	5.608000	0.67654	2.518000	0.84900	0.655000	0.94253	TCG	0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.592	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	1	0	1	2	2	2	2	0	0	0	0	168	168	168	168	1	3.450000	-9.684724	1	0.190000	NM_020397		0	36	34	0	418	413	0		1	1		0	0	168	0	0	1.000000	7.346466e-01	0	3	0	29	0	36	418
ABLIM1	3983	broad.mit.edu	37	10	116307515	116307515	+	Missense_Mutation	SNP	C	C	G			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr10:116307515C>G	ENST00000277895.5	-	5	791	c.694G>C	c.(694-696)Gat>Cat	p.D232H	ABLIM1_ENST00000369252.4_Missense_Mutation_p.D172H|ABLIM1_ENST00000533213.2_Missense_Mutation_p.D172H	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	232	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TTCTTGATATCTCTTCCGCAG	0.537																																						ENST00000277895.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				30						c.(694-696)Gat>Cat		actin binding LIM protein 1							36.0	36.0	36.0					10																	116307515		2203	4300	6503	SO:0001583	missense	3983	0	0					g.chr10:116307515C>G	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.694G>C	chr10.hg19:g.116307515C>G	ENSP00000277895:p.Asp232His	1					ABLIM1_ENST00000533213.2_Missense_Mutation_p.D172H|ABLIM1_ENST00000369252.4_Missense_Mutation_p.D172H	p.D232H	NM_002313.5	NP_002304.3	0	4	4	2.119681	O14639	ABLM1_HUMAN		5	791	-		Colorectal(252;0.0373)|Breast(234;0.231)	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	1	1	hg19	c.694G>C	CCDS7590.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.080432|5.080432	0.94050|0.94050	.|.	.|.	ENSG00000099204|ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369256;ENST00000369260;ENST00000277895|ENST00000392955	D;D;D|.	0.87412|.	-2.25;-2.25;-2.25|.	5.66|5.66	5.66|5.66	0.87406|0.87406	5.66|5.66	5.66|5.66	0.87406|0.87406	Zinc finger, LIM-type (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50480|0.50480	0.1618|0.1618	N|N	0.11756|0.11756	0.17|0.17	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.998;0.98;0.997|.	D;D;D;D;D;D|.	0.91635|.	0.989;0.999;0.993;0.99;0.931;0.95|.	T|T	0.44205|0.44205	-0.9343|-0.9343	10|5	0.87932|.	D|.	0|.	.|.	19.7538|19.7538	0.96281|0.96281	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	156;172;172;232;172;156|.	B7Z4H1;F8W8M4;A6NKJ2;O14639;B3KVH2;C9K0X4|.	.;.;.;ABLM1_HUMAN;.;.|.	H|D	232;172;172;172;232;156;156;156;232|140	ENSP00000358256:D172H;ENSP00000433629:D172H;ENSP00000277895:D232H|.	ENSP00000277895:D232H|.	D|E	-|-	1|3	0|2	0|2	ABLIM1|ABLIM1	116297505|116297505	116297505|116297505	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.930000|0.930000	0.56654|0.56654	7.640000|7.640000	0.83355|0.83355	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GAT|GAG	0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.537	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3	1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	3.450000	-20.000000	1	0.190000			0	58	57	0	133	131	1		1	1		0	0	80	0	0	1.000000	9.997122e-01	0	14	0	18	0	58	133
ADM	133	broad.mit.edu	37	11	10327978	10327978	+	Silent	SNP	G	G	A	rs367972567		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr11:10327978G>A	ENST00000528655.1	+	3	965	c.348G>A	c.(346-348)acG>acA	p.T116T	RP11-351I24.1_ENST00000526906.1_RNA|ADM_ENST00000530439.1_Silent_p.T48T|ADM_ENST00000534464.1_Silent_p.T69T|ADM_ENST00000526492.1_Missense_Mutation_p.G127S|ADM_ENST00000278175.5_Silent_p.T116T|ADM_ENST00000525063.1_Silent_p.T116T			P35318	ADML_HUMAN	adrenomedullin	116					aging (GO:0007568)|androgen metabolic process (GO:0008209)|blood circulation (GO:0008015)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cAMP biosynthetic process (GO:0006171)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|developmental growth (GO:0048589)|female pregnancy (GO:0007565)|G-protein coupled receptor internalization (GO:0002031)|heart development (GO:0007507)|hormone secretion (GO:0046879)|negative regulation of cell proliferation (GO:0008285)|negative regulation of vascular permeability (GO:0043116)|negative regulation of vasoconstriction (GO:0045906)|neural tube closure (GO:0001843)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of vasculogenesis (GO:2001214)|positive regulation of vasodilation (GO:0045909)|progesterone biosynthetic process (GO:0006701)|receptor internalization (GO:0031623)|regulation of the force of heart contraction (GO:0002026)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|spongiotrophoblast layer development (GO:0060712)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(1)	6				all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)		GGACGTGCACGGTGCAGAAGC	0.642																																						ENST00000528655.1	0.640000	0.100000	0.470000	0.180000	0.300000	0.332803	0.300000	0.280000																										0				6						c.(346-348)acG>acA		adrenomedullin							35.0	36.0	36.0					11																	10327978		2201	4294	6495	SO:0001819	synonymous_variant	133	0	0					g.chr11:10327978G>A	D14874	CCDS7801.1	11p15.4	2013-02-25			ENSG00000148926	ENSG00000148926		"""Endogenous ligands"""	259	protein-coding gene	gene with protein product		103275				7688224	Standard	NM_001124		Approved	AM	uc001mil.1	P35318	OTTHUMG00000165907	ENST00000528655.1:c.348G>A	chr11.hg19:g.10327978G>A		0					ADM_ENST00000526492.1_Missense_Mutation_p.G127S|ADM_ENST00000534464.1_Silent_p.T69T|ADM_ENST00000278175.5_Silent_p.T116T|ADM_ENST00000530439.1_Silent_p.T48T|RP11-351I24.1_ENST00000526906.1_RNA|ADM_ENST00000525063.1_Silent_p.T116T	p.T116T			2	2	4	2.090885	P35318	ADML_HUMAN		3	965	+			B2R793|D3DQV3|Q6FGW2	Silent	SNP	ENST00000528655.1	0	1	hg19	c.348G>A	CCDS7801.1	0	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354363	0.41700	.	.	ENSG00000148926	ENST00000526492	T	0.38887	1.11	5.58	-8.42	0.00957	5.58	-8.42	0.00957	.	.	.	.	.	T	0.33059	0.0850	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.51044	-0.8755	6	0.87932	D	0	-19.2336	5.6872	0.17809	0.2155:0.3914:0.3179:0.0752	.	.	.	.	S	127	ENSP00000434354:G127S	ENSP00000434354:G127S	G	+	1	0	0	ADM	10284554	10284554	0.101000	0.21875	0.568000	0.28447	0.908000	0.53690	-1.312000	0.02720	-1.324000	0.02272	-1.567000	0.00876	GGT	0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.642	ADM-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387008.1	0	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	3.450000	-3.677356	1	0.190000	NM_001124		0	4	4	0	180	178	0		1	0		0	0	64	0	0	0.888693	3.595542e-01	0	0	0	48	0	4	180
NPAT	4863	broad.mit.edu	37	11	108040579	108040579	+	Splice_Site	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr11:108040579C>T	ENST00000278612.8	-	15	3007	c.2902G>A	c.(2902-2904)Gtt>Att	p.V968I	NPAT_ENST00000610253.1_5'Flank	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	968					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ATATGAAGAACCTGGAAGAGA	0.423																																						ENST00000278612.8	1.000000	0.800000	1.000000	0.940000	0.990000	0.976908	0.990000	1.000000																										0				46						c.(2902-2904)Gtt>Att		nuclear protein, ataxia-telangiectasia locus							125.0	115.0	118.0					11																	108040579		1851	4092	5943	SO:0001630	splice_region_variant	4863	0	0					g.chr11:108040579C>T	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.2902-1G>A	chr11.hg19:g.108040579C>T		0					NPAT_ENST00000610253.1_5'Flank	p.V968I	NM_002519.2	NP_002510.2	2	2	4	2.093922	Q14207	NPAT_HUMAN		15	3007	-		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Splice_Site	SNP	ENST00000278612.8	1	0	hg19	c.2902G>A	CCDS41710.1	1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568083	0.45798	.	.	ENSG00000149308	ENST00000278612	T	0.04758	3.56	5.39	4.48	0.54585	5.39	4.48	0.54585	.	0.154045	0.43747	D	0.000523	T	0.07007	0.0178	M	0.66939	2.045	0.44890	D	0.997906	B	0.19583	0.037	B	0.19148	0.024	T	0.13791	-1.0496	10	0.33141	T	0.24	-6.2259	8.9418	0.35733	0.0:0.7759:0.0:0.2241	.	968	Q14207	NPAT_HUMAN	I	968	ENSP00000278612:V968I	ENSP00000278612:V968I	V	-	1	0	0	NPAT	107545789	107545789	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	1.857000	0.39399	1.408000	0.46895	-0.237000	0.12165	GTT	0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.423	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	1	0	1	2	2	2	2	0	0	0	0	175	175	175	174	1	3.450000	-20.000000	1	0.190000	NM_002519	Missense_Mutation	0	41	42	0	429	422	0		1	1		0	0	175	0	0	1.000000	6.118798e-01	0	3	0	20	0	41	429
TRIM68	55128	broad.mit.edu	37	11	4623634	4623634	+	Silent	SNP	C	C	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr11:4623634C>A	ENST00000300747.5	-	4	820	c.531G>T	c.(529-531)gtG>gtT	p.V177V		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	177					protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		TTCGGGTTTCCACCTGTATCT	0.463																																						ENST00000300747.5	0.750000	0.190000	0.590000	0.290000	0.420000	0.448765	0.420000	0.400000																										0				15						c.(529-531)gtG>gtT		tripartite motif containing 68							58.0	58.0	58.0					11																	4623634		2201	4298	6499	SO:0001819	synonymous_variant	55128	0	0					g.chr11:4623634C>A	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.531G>T	chr11.hg19:g.4623634C>A		0						p.V177V	NM_018073.6	NP_060543.5	2	2	4	2.090885	Q6AZZ1	TRI68_HUMAN		4	820	-		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Silent	SNP	ENST00000300747.5	1	1	hg19	c.531G>T	CCDS31356.1	0																																																																																								0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.463	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	3.450000	-3.193088	1	0.190000	NM_018073		0	8	7	0	239	237	0		1	0		0	0	93	0	0	0.989171	2.623025e-02	0	0	0	7	0	8	239
MTNR1B	4544	broad.mit.edu	37	11	92715454	92715455	+	Nonsense_Mutation	DNP	GC	GC	AT			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr11:92715454_92715455GC>AT	ENST00000257068.2	+	2	1071_1072	c.1065_1066GC>AT	c.(1063-1068)gtGCag>gtATag	p.Q356*		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	356					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TCATTGGTGTGCAGCACCAGGC	0.584																																						ENST00000257068.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				33						c.(1063-1065)gtG>gtA|c.(1066-1068)Cag>Tag		melatonin receptor 1B	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)																																			SO:0001587	stop_gained	4544	0|1	0|121412	|31				g.chr11:92715454G>A|g.chr11:92715455C>T	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	Exception_encountered	chr11.hg19:g.92715454_92715455delinsAT	ENSP00000257068:p.Gln356*	0						p.V355V|p.Q356*	NM_005959.3	NP_005950.1	2	2	4	2.093922	P49286	MTR1B_HUMAN		2	1071|1072	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		Silent|Nonsense_Mutation	SNP	ENST00000257068.2	1|0	1	hg19	c.1065G>A|c.1066C>T	CCDS8290.1	1																									|4.33	|1.14	|0.20703																																												|0			|92355103														0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.584	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1	1	0	1	2	2	2	2	0	0	0	0	127	129|127	129|127	128|126	1	3.450000	-20.000000|-3.249722	1	0.190000			0	50|51	49|50	0	264|259	260|255	1		1			0	0	129|127	0	0	1.000000	0	0	0	0	0	0	50	259
TECTA	7007	broad.mit.edu	37	11	121023690	121023690	+	Silent	SNP	C	C	T	rs371771729		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr11:121023690C>T	ENST00000392793.1	+	13	4477	c.4206C>T	c.(4204-4206)tgC>tgT	p.C1402C	TECTA_ENST00000264037.2_Silent_p.C1402C			O75443	TECTA_HUMAN	tectorin alpha	1402	TIL 3.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCCACTACTGCGTGGAGGGCT	0.622																																						ENST00000392793.1	1.000000	0.340000	0.930000	0.490000	0.690000	0.707624	0.690000	1.000000																									TECTA/TBCEL(2)	0				135						c.(4204-4206)tgC>tgT		tectorin alpha		C		0,4406		0,0,2203	44.0	42.0	43.0		4206	-1.5	1.0	11		43	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	TECTA	NM_005422.2		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		1402/2156	121023690	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	7007	2	121410	31				g.chr11:121023690C>T	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4206C>T	chr11.hg19:g.121023690C>T		0					TECTA_ENST00000264037.2_Silent_p.C1402C	p.C1402C			2	2	4	2.093922	O75443	TECTA_HUMAN		13	4477	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		Silent	SNP	ENST00000392793.1	1	1	hg19	c.4206C>T	CCDS8434.1	0																																																																																								0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.622	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	3.450000	-12.313410	1	0.190000	NM_005422		0	9	9	0	160	155	0		1			0	0	68	0	0	0.993812	0	0	0	0	0	0	9	160
IQCD	115811	broad.mit.edu	37	12	113645289	113645289	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr12:113645289G>A	ENST00000416617.2	-	2	873	c.683C>T	c.(682-684)aCt>aTt	p.T228I	IQCD_ENST00000299732.2_Missense_Mutation_p.T228I|IQCD_ENST00000546692.1_Missense_Mutation_p.T228I			Q96DY2	IQCD_HUMAN	IQ motif containing D	228										endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CTTTTCAAGAGTATCAATGAT	0.378																																						ENST00000416617.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				12						c.(682-684)aCt>aTt		IQ motif containing D							101.0	99.0	100.0					12																	113645289		2203	4300	6503	SO:0001583	missense	115811	0	0					g.chr12:113645289G>A	BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.683C>T	chr12.hg19:g.113645289G>A	ENSP00000400669:p.Thr228Ile	0					IQCD_ENST00000546692.1_Missense_Mutation_p.T228I|IQCD_ENST00000299732.2_Missense_Mutation_p.T228I	p.T228I			2	3	5	2.051061	Q96DY2	IQCD_HUMAN		2	873	-			Q6ZSU0	Missense_Mutation	SNP	ENST00000416617.2	1	1	hg19	c.683C>T		1	.	.	.	.	.	.	.	.	.	.	G	9.256	1.041929	0.19748	.	.	ENSG00000166578	ENST00000299732;ENST00000416617;ENST00000546692;ENST00000392574	T;T;T	0.23147	2.85;2.85;1.92	5.25	-1.09	0.09904	5.25	-1.09	0.09904	.	1.285360	0.05512	N	0.560377	T	0.22704	0.0548	L	0.56769	1.78	0.09310	N	1	B;B	0.21147	0.052;0.002	B;B	0.15052	0.012;0.007	T	0.33059	-0.9883	10	0.46703	T	0.11	2.6825	2.9086	0.05730	0.1569:0.0995:0.418:0.3256	.	228;228	F8VZV9;Q96DY2-2	.;.	I	228	ENSP00000299732:T228I;ENSP00000400669:T228I;ENSP00000446623:T228I	ENSP00000299732:T228I	T	-	2	0	0	IQCD	112129672	112129672	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.233000	0.17911	-0.073000	0.12842	0.563000	0.77884	ACT	0.308284		TCGA-F2-A7TX-01A-33D-A38G-08	0.378	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405327.1	1	0	1	2	2	2	2	0	0	0	0	250	250	250	250	1	3.450000	-20.000000	1	0.190000	NM_138451		0	100	98	0	594	583	1		1	1		0	0	250	0	0	1.000000	1.560253e-01	0	2	0	3	0	100	594
TMEM132D	121256	broad.mit.edu	37	12	130184899	130184899	+	Missense_Mutation	SNP	G	G	A	rs368850505		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr12:130184899G>A	ENST00000422113.2	-	2	750	c.424C>T	c.(424-426)Cgg>Tgg	p.R142W	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	142					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ACTTTGGGCCGGCTCAGGTAG	0.527																																						ENST00000422113.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999976	0.990000	1.000000																										0				152						c.(424-426)Cgg>Tgg		transmembrane protein 132D		G	TRP/ARG	0,4406		0,0,2203	38.0	38.0	38.0		424	3.3	1.0	12		38	1,8599	1.2+/-3.3	0,1,4299	no	missense	TMEM132D	NM_133448.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	142/1100	130184899	1,13005	2203	4300	6503	SO:0001583	missense	121256	1	121410	28				g.chr12:130184899G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.424C>T	chr12.hg19:g.130184899G>A	ENSP00000408581:p.Arg142Trp	0					RP11-174M13.2_ENST00000544036.1_lincRNA	p.R142W	NM_133448.2	NP_597705.2	2	3	5	2.051061	Q14C87	T132D_HUMAN		2	750	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	1	1	hg19	c.424C>T	CCDS9266.1	1	.	.	.	.	.	.	.	.	.	.	G	9.165	1.019720	0.19355	0.0	1.16E-4	ENSG00000151952	ENST00000422113	T	0.12984	2.63	5.33	3.3	0.37823	5.33	3.3	0.37823	.	0.515638	0.16729	N	0.201915	T	0.16599	0.0399	M	0.71036	2.16	0.23449	N	0.997652	B	0.22211	0.066	B	0.12156	0.007	T	0.10894	-1.0610	9	.	.	.	-20.3601	11.7484	0.51835	0.0:0.0:0.3963:0.6037	.	142	Q14C87	T132D_HUMAN	W	142	ENSP00000408581:R142W	.	R	-	1	2	2	TMEM132D	128750852	128750852	0.995000	0.38212	0.978000	0.43139	0.278000	0.26855	1.468000	0.35332	1.208000	0.43306	-0.324000	0.08512	CGG	0.308284		TCGA-F2-A7TX-01A-33D-A38G-08	0.527	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	3.450000	-20.000000	1	0.190000	NM_133448		0	30	30	0	171	166	1		1	0		0	0	65	0	0	1.000000	2.395441e-02	0	0	0	2	0	30	171
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	2	2	4	2.048859	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.308284		TCGA-F2-A7TX-01A-33D-A38G-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	122	122	122	120	1	3.450000	-20.000000	1	0.190000	NM_033360		1877	51	51	6137	273	269	1	1	1	1	1	0	0	122	248	1	1.000000	9.833576e-01	1	10	72	27	332	51	273
ANO6	196527	broad.mit.edu	37	12	45815050	45815050	+	Missense_Mutation	SNP	C	C	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr12:45815050C>A	ENST00000320560.8	+	18	2616	c.2414C>A	c.(2413-2415)aCa>aAa	p.T805K	ANO6_ENST00000441606.2_Missense_Mutation_p.T787K|ANO6_ENST00000435642.1_Missense_Mutation_p.T805K|ANO6_ENST00000423947.3_Missense_Mutation_p.T826K|ANO6_ENST00000425752.2_Missense_Mutation_p.T805K	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	805					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AACCATACCACATGCAGGCAA	0.373																																						ENST00000320560.8	1.000000	0.120000	0.630000	0.220000	0.370000	0.431856	0.370000	0.300000																										0				46						c.(2413-2415)aCa>aAa		anoctamin 6							78.0	71.0	73.0					12																	45815050		2203	4300	6503	SO:0001583	missense	196527	0	0					g.chr12:45815050C>A	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.2414C>A	chr12.hg19:g.45815050C>A	ENSP00000320087:p.Thr805Lys	0					ANO6_ENST00000425752.2_Missense_Mutation_p.T805K|ANO6_ENST00000435642.1_Missense_Mutation_p.T805K|ANO6_ENST00000441606.2_Missense_Mutation_p.T787K|ANO6_ENST00000423947.3_Missense_Mutation_p.T826K	p.T805K	NM_001025356.2	NP_001020527.2	2	2	4	2.048859	Q4KMQ2	ANO6_HUMAN		18	2616	+			A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	0	1	hg19	c.2414C>A	CCDS31782.1	0	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001985	0.54254	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.71461	-0.57;-0.44;-0.57;-0.44;-0.44	5.05	3.2	0.36748	5.05	3.2	0.36748	.	0.224065	0.44902	D	0.000417	T	0.71567	0.3355	M	0.74881	2.28	0.40730	D	0.982733	P;P;P;B	0.42248	0.573;0.774;0.551;0.317	P;P;B;B	0.45794	0.493;0.493;0.325;0.118	T	0.70274	-0.4917	9	.	.	.	.	8.7333	0.34512	0.0:0.7605:0.0:0.2395	.	787;826;805;805	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	K	805;826;805;805;787	ENSP00000391417:T805K;ENSP00000409126:T826K;ENSP00000413840:T805K;ENSP00000320087:T805K;ENSP00000413137:T787K	.	T	+	2	0	0	ANO6	44101317	44101317	0.950000	0.32346	0.006000	0.13384	0.422000	0.31414	2.368000	0.44222	0.767000	0.33267	0.650000	0.86243	ACA	0.308284		TCGA-F2-A7TX-01A-33D-A38G-08	0.373	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	3.450000	-6.458672	1	0.190000	XM_113743		0	4	4	0	153	149	0		1	0		0	0	68	0	0	0.885229	6.402992e-01	0	0	0	77	0	4	153
RIMBP2	23504	broad.mit.edu	37	12	130921729	130921729	+	Silent	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr12:130921729G>A	ENST00000261655.4	-	10	1876	c.1713C>T	c.(1711-1713)ggC>ggT	p.G571G	RIMBP2_ENST00000536002.1_Silent_p.G479G|RIMBP2_ENST00000535703.1_Silent_p.G479G	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	571	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCACGGACTCGCCCTGGGCGG	0.662																																						ENST00000261655.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				96						c.(1711-1713)ggC>ggT		RIMS binding protein 2							23.0	20.0	21.0					12																	130921729		2190	4290	6480	SO:0001819	synonymous_variant	23504	0	0					g.chr12:130921729G>A	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1713C>T	chr12.hg19:g.130921729G>A		0					RIMBP2_ENST00000536002.1_Silent_p.G479G|RIMBP2_ENST00000535703.1_Silent_p.G479G	p.G571G	NM_015347.4	NP_056162.4	2	3	5	2.051061	O15034	RIMB2_HUMAN		10	1876	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	Q96ID2	Silent	SNP	ENST00000261655.4	1	1	hg19	c.1713C>T	CCDS31925.1	1																																																																																								0.308284		TCGA-F2-A7TX-01A-33D-A38G-08	0.662	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	3.450000	-20.000000	1	0.190000	NM_015347		0	15	15	0	33	33	1		1	0		0	0	17	0	0	0.999956	1.066667e-01	0	0	0	2	0	15	33
PSMA6	5687	broad.mit.edu	37	14	35761738	35761738	+	Missense_Mutation	SNP	A	A	G			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr14:35761738A>G	ENST00000261479.4	+	1	176	c.56A>G	c.(55-57)gAg>gGg	p.E19G	PSMA6_ENST00000555764.1_5'UTR|PSMA6_ENST00000540871.1_Intron|AL121594.1_ENST00000578587.1_RNA|PSMA6_ENST00000553809.1_Missense_Mutation_p.E19G|PSMA6_ENST00000556506.1_Missense_Mutation_p.E19G|KIAA0391_ENST00000557565.1_Intron	NM_002791.1	NP_002782.1	P60900	PSA6_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 6	19					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of inflammatory response (GO:0050727)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myofibril (GO:0030016)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)|sarcomere (GO:0030017)	endopeptidase activity (GO:0004175)|NF-kappaB binding (GO:0051059)|purine ribonucleoside triphosphate binding (GO:0035639)|RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(1)|lung(5)|prostate(1)|urinary_tract(1)	10	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		TTTTCACCCGAGGGTCGGCTC	0.582																																						ENST00000261479.4	1.000000	0.060000	0.260000	0.110000	0.170000	0.207997	0.170000	0.160000																										0				10						c.(55-57)gAg>gGg		proteasome (prosome, macropain) subunit, alpha type, 6							100.0	96.0	98.0					14																	35761738		2203	4300	6503	SO:0001583	missense	5687	0	0					g.chr14:35761738A>G	X59417	CCDS9655.1, CCDS61437.1, CCDS61438.1	14q13	2003-03-12			ENSG00000100902	ENSG00000100902		"""Proteasome (prosome, macropain) subunits"""	9535	protein-coding gene	gene with protein product		602855				1888762, 8811196	Standard	NM_002791		Approved	IOTA, PROS27, p27K, MGC22756, MGC2333, MGC23846	uc001wtd.3	P60900	OTTHUMG00000140221	ENST00000261479.4:c.56A>G	chr14.hg19:g.35761738A>G	ENSP00000261479:p.Glu19Gly	0					PSMA6_ENST00000556506.1_Missense_Mutation_p.E19G|AL121594.1_ENST00000578587.1_RNA|PSMA6_ENST00000555764.1_5'UTR|KIAA0391_ENST00000557565.1_Intron|PSMA6_ENST00000540871.1_Intron|PSMA6_ENST00000553809.1_Missense_Mutation_p.E19G	p.E19G	NM_002791.1	NP_002782.1	2	2	4	2.072114	P60900	PSA6_HUMAN	Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	1	176	+	Breast(36;0.0519)|Hepatocellular(127;0.158)		B2R7J9|B4DQR4|B4DXJ9|P34062|Q6IB60	Missense_Mutation	SNP	ENST00000261479.4	0	1	hg19	c.56A>G	CCDS9655.1	0	.	.	.	.	.	.	.	.	.	.	A	34	5.412570	0.96072	.	.	ENSG00000100902	ENST00000261479;ENST00000553809;ENST00000556506	T;T;T	0.51325	0.71;0.71;0.71	5.87	5.87	0.94306	5.87	5.87	0.94306	Proteasome, alpha-subunit, conserved site (3);	0.000000	0.85682	D	0.000000	T	0.75421	0.3847	H	0.95574	3.69	0.80722	D	1	D	0.57257	0.979	P	0.60541	0.876	T	0.83320	-0.0018	10	0.87932	D	0	-31.8945	14.4865	0.67622	1.0:0.0:0.0:0.0	.	19	P60900	PSA6_HUMAN	G	19	ENSP00000261479:E19G;ENSP00000452603:E19G;ENSP00000450528:E19G	ENSP00000261479:E19G	E	+	2	0	0	PSMA6	34831489	34831489	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.288000	0.78691	2.242000	0.73789	0.482000	0.46254	GAG	0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.582	PSMA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276684.1	0	0	1	2	2	2	2	0	0	0	0	168	168	168	167	1	3.450000	-5.678617	1	0.190000			0	6	6	0	462	451	0		1	0		0	0	168	0	0	0.962534	9.986657e-01	0	1	0	1079	0	6	462
SSTR1	6751	broad.mit.edu	37	14	38678945	38678945	+	Silent	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr14:38678945C>T	ENST00000267377.2	+	3	968	c.351C>T	c.(349-351)tcC>tcT	p.S117S		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	117					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	TAGTCACCTCCACGTTGTTGC	0.577																																						ENST00000267377.2	1.000000	0.650000	1.000000	0.760000	0.870000	0.875729	0.870000	1.000000																										0				29						c.(349-351)tcC>tcT		somatostatin receptor 1	Octreotide(DB00104)|Pasireotide(DB06663)						202.0	182.0	189.0					14																	38678945		2203	4300	6503	SO:0001819	synonymous_variant	6751	0	0					g.chr14:38678945C>T		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.351C>T	chr14.hg19:g.38678945C>T		0						p.S117S	NM_001049.2	NP_001040.1	2	2	4	2.072114	P30872	SSR1_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	3	968	+	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)			Silent	SNP	ENST00000267377.2	1	1	hg19	c.351C>T	CCDS9666.1	1																																																																																								0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.577	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2	1	0	1	2	2	2	2	0	0	0	0	253	253	253	252	1	3.450000	-9.822766	1	0.190000			0	50	49	0	664	649	0		1	0		0	0	253	0	0	1.000000	2.788252e-02	0	0	0	4	0	50	664
LTBP2	4053	broad.mit.edu	37	14	74968210	74968210	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr14:74968210G>A	ENST00000261978.4	-	35	5640	c.5254C>T	c.(5254-5256)Cgg>Tgg	p.R1752W	LTBP2_ENST00000556690.1_Missense_Mutation_p.R1708W	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1752	EGF-like 19; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TAGCCCTCCCGCACGCGCACA	0.622											OREG0022805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000261978.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				58						c.(5254-5256)Cgg>Tgg		latent transforming growth factor beta binding protein 2							86.0	84.0	85.0					14																	74968210		2203	4300	6503	SO:0001583	missense	4053	3	121412	40				g.chr14:74968210G>A		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.5254C>T	chr14.hg19:g.74968210G>A	ENSP00000261978:p.Arg1752Trp	0		OREG0022805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1156	LTBP2_ENST00000556690.1_Missense_Mutation_p.R1708W	p.R1752W	NM_000428.2	NP_000419.1	2	2	4	2.072114	Q14767	LTBP2_HUMAN		35	5640	-			Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	1	1	hg19	c.5254C>T	CCDS9831.1	1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.786592	0.70337	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.92699	-3.09;-3.09	5.25	2.23	0.28157	5.25	2.23	0.28157	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.470600	0.16123	N	0.228535	D	0.92143	0.7509	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.68192	0.956	D	0.84993	0.0895	10	0.66056	D	0.02	.	11.6308	0.51173	0.0:0.1212:0.6393:0.2395	.	1752	Q14767	LTBP2_HUMAN	W	1752;1708	ENSP00000261978:R1752W;ENSP00000451477:R1708W	ENSP00000261978:R1752W	R	-	1	2	2	LTBP2	74037963	74037963	0.860000	0.29831	0.786000	0.31890	0.986000	0.74619	1.961000	0.40432	0.740000	0.32651	-0.188000	0.12872	CGG	0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.622	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	1	0	1	2	2	2	2	0	0	0	0	187	187	187	183	1	3.450000	-3.320658	1	0.190000	NM_000428		0	68	69	0	382	371	1		1	1		0	0	187	0	0	1.000000	1	0	33	0	212	0	68	382
DLL4	54567	broad.mit.edu	37	15	41226899	41226899	+	Missense_Mutation	SNP	A	A	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr15:41226899A>T	ENST00000249749.5	+	7	1280	c.1004A>T	c.(1003-1005)aAt>aTt	p.N335I		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	335	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CCCTGTCGCAATGGAGGCAGC	0.592																																						ENST00000249749.5	1.000000	0.400000	1.000000	0.570000	0.780000	0.783398	0.780000	1.000000																										0				4						c.(1003-1005)aAt>aTt		delta-like 4 (Drosophila)							60.0	64.0	63.0					15																	41226899		2200	4296	6496	SO:0001583	missense	54567	0	0					g.chr15:41226899A>T	AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.1004A>T	chr15.hg19:g.41226899A>T	ENSP00000249749:p.Asn335Ile	1						p.N335I	NM_019074.3	NP_061947.1	2	3	5	2.260305	Q9NR61	DLL4_HUMAN		7	1280	+		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	Q3KP23|Q9NQT9	Missense_Mutation	SNP	ENST00000249749.5	1	1	hg19	c.1004A>T	CCDS45232.1	0	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830554	0.91036	.	.	ENSG00000128917	ENST00000249749	D	0.95069	-3.6	5.97	5.97	0.96955	5.97	5.97	0.96955	EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98444	0.9482	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99751	1.1018	10	0.87932	D	0	.	16.4504	0.83984	1.0:0.0:0.0:0.0	.	335	Q9NR61	DLL4_HUMAN	I	335	ENSP00000249749:N335I	ENSP00000249749:N335I	N	+	2	0	0	DLL4	39014191	39014191	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	8.962000	0.93254	2.288000	0.76882	0.533000	0.62120	AAT	0.369650		TCGA-F2-A7TX-01A-33D-A38G-08	0.592	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	3.450000	-13.715050	1	0.190000			0	10	10	0	168	166	0		1	0		0	0	55	0	0	0.996966	2.344568e-01	0	0	0	15	0	10	168
UNC13C	440279	broad.mit.edu	37	15	54306714	54306714	+	Missense_Mutation	SNP	G	G	C			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr15:54306714G>C	ENST00000260323.11	+	1	1614	c.1614G>C	c.(1612-1614)caG>caC	p.Q538H	UNC13C_ENST00000545554.1_Missense_Mutation_p.Q538H|UNC13C_ENST00000537900.1_Missense_Mutation_p.Q538H	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	538					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGCACTCACAGAGTGATTTTT	0.368																																						ENST00000260323.11	1.000000	0.990000	1.000000	0.990000	0.990000	0.998418	0.990000	1.000000																										0				121						c.(1612-1614)caG>caC		unc-13 homolog C (C. elegans)							58.0	57.0	58.0					15																	54306714		1850	4105	5955	SO:0001583	missense	440279	0	0					g.chr15:54306714G>C	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1614G>C	chr15.hg19:g.54306714G>C	ENSP00000260323:p.Gln538His	1					UNC13C_ENST00000537900.1_Missense_Mutation_p.Q538H|UNC13C_ENST00000545554.1_Missense_Mutation_p.Q538H	p.Q538H	NM_001080534.1	NP_001074003.1	2	3	5	2.260305	Q8NB66	UN13C_HUMAN		1	1614	+			Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	1	1	hg19	c.1614G>C	CCDS45264.1	1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267447	0.40095	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83506	-1.73;-1.73;-1.73	5.01	4.02	0.46733	5.01	4.02	0.46733	.	.	.	.	.	D	0.83510	0.5270	L	0.27053	0.805	0.39140	D	0.962024	D	0.67145	0.996	D	0.75484	0.986	D	0.84308	0.0509	9	0.87932	D	0	.	9.0517	0.36380	0.1739:0.0:0.8261:0.0	.	538	Q8NB66	UN13C_HUMAN	H	538	ENSP00000260323:Q538H;ENSP00000438156:Q538H;ENSP00000442569:Q538H	ENSP00000260323:Q538H	Q	+	3	2	2	UNC13C	52094006	52094006	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.057000	0.41365	2.608000	0.88229	0.655000	0.94253	CAG	0.369650		TCGA-F2-A7TX-01A-33D-A38G-08	0.368	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	1	0	1	2	2	2	2	0	0	0	0	100	100	100	99	1	3.450000	-2.774778	1	0.190000	NM_173166		0	26	25	0	212	208	0		1			0	0	100	0	0	1.000000	0	0	0	0	0	0	26	212
RFX7	64864	broad.mit.edu	37	15	56535410	56535410	+	Missense_Mutation	SNP	T	T	C			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr15:56535410T>C	ENST00000423270.1	-	1	73	c.74A>G	c.(73-75)aAc>aGc	p.N25S	RFX7_ENST00000559447.2_5'UTR|RFX7_ENST00000317318.6_Missense_Mutation_p.N25S|RFX7_ENST00000422057.1_5'UTR	NM_022841.5	NP_073752.5	Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	0					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CACCCCCGAGTTGGGGGCGCT	0.652																																						ENST00000423270.1	1.000000	0.790000	1.000000	0.990000	0.990000	0.987205	0.990000	1.000000																										0				19						c.(73-75)aAc>aGc		regulatory factor X, 7							10.0	12.0	11.0					15																	56535410		1909	4106	6015	SO:0001583	missense	64864	0	0					g.chr15:56535410T>C			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000423270.1:c.74A>G	chr15.hg19:g.56535410T>C	ENSP00000397644:p.Asn25Ser	1					RFX7_ENST00000559447.2_5'UTR|RFX7_ENST00000422057.1_5'UTR|RFX7_ENST00000317318.6_Missense_Mutation_p.N25S	p.N25S	NM_022841.5	NP_073752.5	2	3	5	2.260305	Q2KHR2	RFX7_HUMAN		1	73	-			Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000423270.1	0	1	hg19	c.74A>G		1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.456433	0.26161	.	.	ENSG00000181827	ENST00000317318;ENST00000423270	T;T	0.50001	0.76;0.76	3.0	0.546	0.17196	3.0	0.546	0.17196	.	.	.	.	.	T	0.30727	0.0774	.	.	.	0.25825	N	0.984237	.	.	.	.	.	.	T	0.23511	-1.0186	6	0.31617	T	0.26	.	1.6971	0.02864	0.2693:0.2644:0.0:0.4663	.	.	.	.	S	25	ENSP00000313299:N25S;ENSP00000397644:N25S	ENSP00000313299:N25S	N	-	2	0	0	RFX7	54322702	54322702	0.761000	0.28439	0.997000	0.53966	0.994000	0.84299	0.111000	0.15458	0.339000	0.23719	0.377000	0.23210	AAC	0.369650		TCGA-F2-A7TX-01A-33D-A38G-08	0.652	RFX7-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	3.450000	-14.981830	1	0.190000	NM_022841		0	8	7	0	61	58	0		1	1		0	0	21	0	0	0.988259	3.183734e-01	0	2	0	7	0	8	61
XYLT1	64131	broad.mit.edu	37	16	17228362	17228362	+	Silent	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr16:17228362C>T	ENST00000261381.6	-	9	2079	c.1995G>A	c.(1993-1995)acG>acA	p.T665T	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	665			T -> M. {ECO:0000269|PubMed:16571645}.		cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.T665T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGTGCAGGGACGTCTCGGCCC	0.607																																						ENST00000261381.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - coding silent(1)	p.T665T(1)	lung(1)	67						c.(1993-1995)acG>acA		xylosyltransferase I							73.0	63.0	67.0					16																	17228362		2197	4300	6497	SO:0001819	synonymous_variant	64131	3	121412	34				g.chr16:17228362C>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1995G>A	chr16.hg19:g.17228362C>T		1					CTD-2576D5.4_ENST00000567344.1_RNA	p.T665T	NM_022166.3	NP_071449.1	1	3	4	2.103136	Q86Y38	XYLT1_HUMAN		9	2079	-			Q9H1B6	Silent	SNP	ENST00000261381.6	1	1	hg19	c.1995G>A	CCDS10569.1	1																																																																																								0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.607	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	1	0	1	2	2	2	2	0	0	0	0	121	121	121	118	1	3.450000	-20.000000	1	0.190000	NM_022166		0	66	67	0	229	222	1		1	1		0	0	121	0	0	1.000000	9.170887e-01	0	3	0	14	0	66	229
CMIP	80790	broad.mit.edu	37	16	81479102	81479102	+	Missense_Mutation	SNP	C	C	G			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr16:81479102C>G	ENST00000537098.3	+	1	328	c.256C>G	c.(256-258)Ccg>Gcg	p.P86A		NM_198390.2	NP_938204.2	Q8IY22	CMIP_HUMAN	c-Maf inducing protein	86	PH.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(5)|kidney(1)|lung(7)	13						GCGCTGGGAGCCGCACCACCT	0.667																																						ENST00000537098.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999789	0.990000	1.000000																										0				13						c.(256-258)Ccg>Gcg		c-Maf inducing protein							17.0	21.0	20.0					16																	81479102		1935	4104	6039	SO:0001583	missense	80790	0	0					g.chr16:81479102C>G	AB051481	CCDS54044.1, CCDS54045.1	16q23	2011-08-04			ENSG00000153815	ENSG00000153815			24319	protein-coding gene	gene with protein product		610112				11214970, 12939343	Standard	NM_030629		Approved		uc002fgp.3	Q8IY22		ENST00000537098.3:c.256C>G	chr16.hg19:g.81479102C>G	ENSP00000446100:p.Pro86Ala	1						p.P86A	NM_198390.2	NP_938204.2	0	3	3	1.937805	Q8IY22	CMIP_HUMAN		1	328	+			Q9C0G9	Missense_Mutation	SNP	ENST00000537098.3	0	1	hg19	c.256C>G	CCDS54044.1	1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744161	0.49151	.	.	ENSG00000153815	ENST00000537098	T	0.29142	1.58	2.97	2.97	0.34412	2.97	2.97	0.34412	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.36303	U	0.002668	T	0.16938	0.0407	N	0.08118	0	0.80722	D	1	B	0.14438	0.01	B	0.06405	0.002	T	0.05225	-1.0898	10	0.42905	T	0.14	.	14.1926	0.65649	0.0:1.0:0.0:0.0	.	86	Q8IY22	CMIP_HUMAN	A	86	ENSP00000446100:P86A	ENSP00000446100:P86A	P	+	1	0	0	CMIP	80036603	80036603	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.464000	0.73534	1.329000	0.45376	0.313000	0.20887	CCG	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.667	CMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432399.2	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	3.450000	-18.926090	1	0.190000	NM_030629		0	8	8	0	19	18	0		1	1		0	0	10	0	0	0.991947	9.999886e-01	0	62	0	21	0	8	19
GRN	2896	broad.mit.edu	37	17	42428464	42428464	+	Silent	SNP	C	C	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr17:42428464C>A	ENST00000053867.3	+	8	830	c.768C>A	c.(766-768)atC>atA	p.I256I	GRN_ENST00000589923.1_3'UTR|GRN_ENST00000589265.1_Intron	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	256					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GTGACCTGATCCAGAGTAAGT	0.607											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000053867.3	0.430000	0.090000	0.330000	0.140000	0.220000	0.244585	0.220000	0.210000																										0				23						c.(766-768)atC>atA		granulin							112.0	102.0	105.0					17																	42428464		2203	4300	6503	SO:0001819	synonymous_variant	2896	0	0					g.chr17:42428464C>A	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.768C>A	chr17.hg19:g.42428464C>A		0		OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	908	GRN_ENST00000589265.1_Intron|GRN_ENST00000589923.1_3'UTR	p.I256I	NM_002087.2	NP_002078.1	1	2	3	1.957126	P28799	GRN_HUMAN		8	830	+		Prostate(33;0.0181)	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Silent	SNP	ENST00000053867.3	0	1	hg19	c.768C>A	CCDS11483.1	0																																																																																								0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.607	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	0	0	1	2	2	2	2	0	0	0	0	100	100	100	99	1	3.450000	-6.380860	1	0.190000	NM_002087		0	6	6	0	319	308	0		1	0		0	0	100	0	0	0.961458	9.994823e-01	0	0	0	911	0	6	319
MAPT	4137	broad.mit.edu	37	17	44060673	44060673	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr17:44060673G>A	ENST00000571987.1	+	5	503	c.503G>A	c.(502-504)cGc>cAc	p.R168H	MAPT_ENST00000340799.5_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.R168H|MAPT_ENST00000262410.5_Missense_Mutation_p.R168H|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.R168H|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000446361.3_Intron			P10636	TAU_HUMAN	microtubule-associated protein tau	168					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GAGGCCACACGCCAACCTTCG	0.697																																						ENST00000571987.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999868	0.990000	1.000000																										0				38						c.(502-504)cGc>cAc		microtubule-associated protein tau	Docetaxel(DB01248)|Paclitaxel(DB01229)						13.0	15.0	14.0					17																	44060673		2196	4288	6484	SO:0001583	missense	4137	0	0					g.chr17:44060673G>A	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.503G>A	chr17.hg19:g.44060673G>A	ENSP00000458742:p.Arg168His	0					MAPT_ENST00000431008.3_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.R168H|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.R168H|MAPT_ENST00000415613.2_Missense_Mutation_p.R168H	p.R168H			1	2	3	1.957126	P10636	TAU_HUMAN		5	503	+		Melanoma(429;0.216)	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	1	1	hg19	c.503G>A	CCDS11501.1	1	.	.	.	.	.	.	.	.	.	.	G	9.502	1.103437	0.20632	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000415613	T;T;T	0.10099	2.91;2.91;2.91	4.03	-7.22	0.01485	4.03	-7.22	0.01485	.	2.448770	0.01389	N	0.013192	T	0.02380	0.0073	N	0.00538	-1.39	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.0	T	0.39354	-0.9618	10	0.31617	T	0.26	4.9526	2.1491	0.03795	0.3493:0.1391:0.3754:0.1362	.	168;168	P10636-9;P10636	.;TAU_HUMAN	H	168	ENSP00000340820:R168H;ENSP00000262410:R168H;ENSP00000410838:R168H	ENSP00000262410:R168H	R	+	2	0	0	MAPT	41416510	41416510	0.000000	0.05858	0.000000	0.03702	0.316000	0.28119	-1.116000	0.03286	-1.431000	0.01982	-0.459000	0.05422	CGC	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.697	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	3.450000	-19.999990	1	0.190000	NM_016835		0	13	13	0	49	49	1		1			0	0	15	0	0	0.999731	0	0	0	0	0	0	13	49
TP53	7157	broad.mit.edu	37	17	7578260	7578260	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr17:7578260C>T	ENST00000269305.4	-	6	778	c.589G>A	c.(589-591)Gtg>Atg	p.V197M	TP53_ENST00000359597.4_Missense_Mutation_p.V197M|TP53_ENST00000420246.2_Missense_Mutation_p.V197M|TP53_ENST00000445888.2_Missense_Mutation_p.V197M|TP53_ENST00000413465.2_Missense_Mutation_p.V197M|TP53_ENST00000455263.2_Missense_Mutation_p.V197M|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	197	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> E (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V197M(10)|p.0?(8)|p.V197L(6)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.V104L(1)|p.V65L(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTTCCTTCCACTCGGATAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999985	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		42	Substitution - Missense(18)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Complex - deletion inframe(5)|Complex - frameshift(1)	p.V197M(10)|p.0?(8)|p.V197L(6)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.V104L(1)|p.V65L(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)	breast(6)|biliary_tract(5)|large_intestine(5)|liver(5)|skin(4)|bone(4)|central_nervous_system(3)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|stomach(1)|oesophagus(1)|ovary(1)	24185	GRCh37	CM070297	TP53	M		c.(589-591)Gtg>Atg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						108.0	96.0	100.0					17																	7578260		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578260C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.589G>A	chr17.hg19:g.7578260C>T	ENSP00000269305:p.Val197Met	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.V197M|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.V197M|TP53_ENST00000420246.2_Missense_Mutation_p.V197M|TP53_ENST00000359597.4_Missense_Mutation_p.V197M|TP53_ENST00000413465.2_Missense_Mutation_p.V197M	p.V197M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.793387	P04637	P53_HUMAN		6	778	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.589G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638630	0.47153	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99837	-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06	5.41	4.44	0.53790	5.41	4.44	0.53790	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.059878	0.64402	D	0.000004	D	0.99743	0.9898	M	0.77820	2.39	0.52099	D	0.999948	D;D;D;D;D;D;D	0.89917	1.0;0.992;0.999;1.0;0.988;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.972;0.996;1.0;0.97;0.999;1.0	D	0.97268	0.9909	10	0.66056	D	0.02	-16.054	12.3714	0.55256	0.0:0.9175:0.0:0.0824	.	158;197;197;104;197;197;197	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	197;197;197;197;197;197;186;104;65;104;65	ENSP00000410739:V197M;ENSP00000352610:V197M;ENSP00000269305:V197M;ENSP00000398846:V197M;ENSP00000391127:V197M;ENSP00000391478:V197M;ENSP00000425104:V65M;ENSP00000423862:V104M	ENSP00000269305:V197M	V	-	1	0	0	TP53	7518985	7518985	0.994000	0.37717	0.999000	0.59377	0.021000	0.10359	3.252000	0.51461	1.420000	0.47138	0.655000	0.94253	GTG	0.190000		TCGA-F2-A7TX-01A-33D-A38G-08	0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	3.450000	-20.000000	1	0.190000	NM_000546		0	32	32	0	144	139	1		1	1	1	0	0	75	885	0	1.000000	9.999606e-01	1	40	189	35	866	32	144
HOXB3	3213	broad.mit.edu	37	17	46627995	46627995	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr17:46627995C>T	ENST00000470495.1	-	2	2444	c.997G>A	c.(997-999)Gtc>Atc	p.V333I	HOXB3_ENST00000489475.1_Missense_Mutation_p.V260I|HOXB3_ENST00000472863.1_Missense_Mutation_p.V260I|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000476342.1_Missense_Mutation_p.V333I|HOXB3_ENST00000498678.1_Missense_Mutation_p.V333I|HOXB3_ENST00000460160.1_Missense_Mutation_p.V201I|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000490677.1_Missense_Mutation_p.V199I|HOXB3_ENST00000311626.4_Missense_Mutation_p.V333I|HOXB3_ENST00000485909.2_Missense_Mutation_p.V201I|HOXB-AS1_ENST00000508688.1_RNA			P14651	HXB3_HUMAN	homeobox B3	333					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						GCTTGGAGGACGTGCGGCTCA	0.721											OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000470495.1	1.000000	0.620000	1.000000	0.780000	0.970000	0.916743	0.970000	1.000000																										0				30						c.(997-999)Gtc>Atc		homeobox B3							20.0	27.0	25.0					17																	46627995		2194	4287	6481	SO:0001583	missense	3213	0	0					g.chr17:46627995C>T		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.997G>A	chr17.hg19:g.46627995C>T	ENSP00000417207:p.Val333Ile	0		OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	940	HOXB3_ENST00000490677.1_Missense_Mutation_p.V199I|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000498678.1_Missense_Mutation_p.V333I|HOXB3_ENST00000460160.1_Missense_Mutation_p.V201I|HOXB3_ENST00000311626.4_Missense_Mutation_p.V333I|HOXB3_ENST00000485909.2_Missense_Mutation_p.V201I|HOXB3_ENST00000476342.1_Missense_Mutation_p.V333I|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000489475.1_Missense_Mutation_p.V260I|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000472863.1_Missense_Mutation_p.V260I	p.V333I			1	2	3	1.957126	P14651	HXB3_HUMAN		2	2444	-			A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	ENST00000470495.1	1	1	hg19	c.997G>A	CCDS11528.1	1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348351	0.24426	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000490677;ENST00000460160;ENST00000485909;ENST00000489475;ENST00000476342	D;D;D;D;D;D;D;D;D	0.90844	-2.66;-2.63;-2.66;-2.66;-2.74;-2.74;-2.74;-2.63;-2.66	3.8	2.83	0.33086	3.8	2.83	0.33086	.	0.243879	0.32671	N	0.005796	D	0.83815	0.5336	L	0.38175	1.15	0.80722	D	1	B	0.12013	0.005	B	0.04013	0.001	T	0.77653	-0.2507	10	0.37606	T	0.19	.	9.3477	0.38118	0.0:0.8227:0.0:0.1773	.	333	P14651	HXB3_HUMAN	I	333;260;333;333;199;201;201;260;333	ENSP00000417207:V333I;ENSP00000419676:V260I;ENSP00000308252:V333I;ENSP00000420595:V333I;ENSP00000449977:V199I;ENSP00000418035:V201I;ENSP00000438747:V201I;ENSP00000418729:V260I;ENSP00000418892:V333I	ENSP00000308252:V333I	V	-	1	0	0	HOXB3	43982994	43982994	0.002000	0.14202	1.000000	0.80357	0.921000	0.55340	-0.007000	0.12810	0.950000	0.37743	-0.448000	0.05591	GTC	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.721	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1	1	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	3.450000	-20.000000	1	0.190000			0	21	21	0	229	220	0		1	1		0	0	60	0	0	0.999997	9.317986e-01	0	8	0	44	0	21	229
NWD1	284434	broad.mit.edu	37	19	16860012	16860012	+	Missense_Mutation	SNP	G	G	A	rs142661674		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr19:16860012G>A	ENST00000552788.1	+	4	559	c.559G>A	c.(559-561)Gtc>Atc	p.V187I	NWD1_ENST00000339803.6_Missense_Mutation_p.V52I|NWD1_ENST00000379808.3_Missense_Mutation_p.V187I|NWD1_ENST00000524140.2_Missense_Mutation_p.V187I|NWD1_ENST00000549814.1_Missense_Mutation_p.V187I|NWD1_ENST00000523826.1_5'UTR			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	187							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGGAGCCACCGTCTTCCTTAG	0.582																																						ENST00000552788.1	0.480000	0.080000	0.360000	0.150000	0.230000	0.258449	0.230000	0.220000																										0				67						c.(559-561)Gtc>Atc		NACHT and WD repeat domain containing 1		G	ILE/VAL	1,4405		0,1,2202	80.0	62.0	68.0		559	-1.6	0.0	19	dbSNP_134	68	0,8600		0,0,4300	no	missense	NWD1	NM_001007525.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	187/1433	16860012	1,13005	2203	4300	6503	SO:0001583	missense	284434	4	121412	41				g.chr19:16860012G>A	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.559G>A	chr19.hg19:g.16860012G>A	ENSP00000447224:p.Val187Ile	1					NWD1_ENST00000379808.3_Missense_Mutation_p.V187I|NWD1_ENST00000524140.2_Missense_Mutation_p.V187I|NWD1_ENST00000339803.6_Missense_Mutation_p.V52I|NWD1_ENST00000523826.1_5'UTR|NWD1_ENST00000549814.1_Missense_Mutation_p.V187I	p.V187I			0	2	2	1.796486	Q149M9	NWD1_HUMAN		4	559	+			C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	0	1	hg19	c.559G>A		0	.	.	.	.	.	.	.	.	.	.	N	0.072	-1.200132	0.01581	2.27E-4	0.0	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000552788;ENST00000339803	T;T;T;T;T	0.56941	1.77;1.77;1.77;1.77;0.43	4.45	-1.62	0.08372	4.45	-1.62	0.08372	.	0.464471	0.20800	N	0.085444	T	0.32406	0.0828	L	0.42686	1.345	0.22066	N	0.999385	B;B	0.18013	0.025;0.006	B;B	0.12837	0.008;0.003	T	0.34378	-0.9831	10	0.05351	T	0.99	-15.3841	7.6641	0.28421	0.4955:0.0:0.5045:0.0	.	187;52	Q149M9-3;C9J2Y8	.;.	I	52;187;187;187;187;52	ENSP00000428579:V187I;ENSP00000447548:V187I;ENSP00000369136:V187I;ENSP00000447224:V187I;ENSP00000340159:V52I	ENSP00000340159:V52I	V	+	1	0	0	NWD1	16721012	16721012	0.001000	0.12720	0.004000	0.12327	0.013000	0.08279	-0.267000	0.08619	0.027000	0.15297	-0.497000	0.04613	GTC	0.190000		TCGA-F2-A7TX-01A-33D-A38G-08	0.582	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	3.450000	-6.089308	1	0.190000	NM_001007525		0	5	5	0	233	227	0		1			0	0	85	0	0	0.933925	0	0	0	0	0	0	5	233
MYO9B	4650	broad.mit.edu	37	19	17313080	17313080	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr19:17313080G>A	ENST00000594824.1	+	28	4951	c.4804G>A	c.(4804-4806)Ggc>Agc	p.G1602S	MYO9B_ENST00000397274.2_Missense_Mutation_p.G1602S|MYO9B_ENST00000595618.1_Missense_Mutation_p.G1602S			Q13459	MYO9B_HUMAN	myosin IXB	1602	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GTTCACCCGTGGCTACACCAA	0.597																																						ENST00000594824.1	1.000000	0.930000	1.000000	0.990000	0.990000	0.995399	0.990000	1.000000																										0				39						c.(4804-4806)Ggc>Agc		myosin IXB							31.0	34.0	33.0					19																	17313080		2112	4221	6333	SO:0001583	missense	4650	0	0					g.chr19:17313080G>A		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4804G>A	chr19.hg19:g.17313080G>A	ENSP00000471367:p.Gly1602Ser	1					MYO9B_ENST00000397274.2_Missense_Mutation_p.G1602S|MYO9B_ENST00000595618.1_Missense_Mutation_p.G1602S	p.G1602S			0	2	2	1.796486	Q13459	MYO9B_HUMAN		28	4951	+			O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	0	1	hg19	c.4804G>A		1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246218	0.22796	.	.	ENSG00000099331	ENST00000397274	D	0.84070	-1.8	4.51	2.29	0.28610	4.51	2.29	0.28610	.	0.243175	0.28859	N	0.013909	T	0.69342	0.3100	L	0.35854	1.095	0.39346	D	0.965669	B;B;B;B	0.29341	0.131;0.242;0.131;0.156	B;B;B;B	0.28784	0.031;0.094;0.031;0.043	T	0.56986	-0.7888	10	0.08837	T	0.75	.	7.8424	0.29406	0.0931:0.1643:0.7426:0.0	.	1602;1602;1602;1608	Q13459;Q13459-2;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.;.	S	1602	ENSP00000380444:G1602S	ENSP00000380444:G1602S	G	+	1	0	0	MYO9B	17174080	17174080	0.896000	0.30565	0.042000	0.18584	0.868000	0.49771	1.890000	0.39728	0.290000	0.22444	0.313000	0.20887	GGC	0.190000		TCGA-F2-A7TX-01A-33D-A38G-08	0.597	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	3.450000	-19.572200	1	0.190000			0	10	10	0	45	42	1		1	1		0	0	18	0	0	0.997023	9.999092e-01	0	29	0	64	0	10	45
RYR1	6261	broad.mit.edu	37	19	38976774	38976774	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr19:38976774C>T	ENST00000359596.3	+	34	5479	c.5479C>T	c.(5479-5481)Cgc>Tgc	p.R1827C	RYR1_ENST00000355481.4_Missense_Mutation_p.R1827C|RYR1_ENST00000360985.3_Missense_Mutation_p.R1827C			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1827	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCAGCACGCTCGCGACCCCGT	0.692																																						ENST00000359596.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				285						c.(5479-5481)Cgc>Tgc		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						81.0	79.0	80.0					19																	38976774		2197	4290	6487	SO:0001583	missense	6261	0	0					g.chr19:38976774C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5479C>T	chr19.hg19:g.38976774C>T	ENSP00000352608:p.Arg1827Cys	1					RYR1_ENST00000360985.3_Missense_Mutation_p.R1827C|RYR1_ENST00000355481.4_Missense_Mutation_p.R1827C	p.R1827C			3	3	6	2.237334	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	34	5479	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	1	1	hg19	c.5479C>T	CCDS33011.1	1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897596	0.33535	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.75821	-0.97;-0.97;-0.97	3.7	1.45	0.22620	3.7	1.45	0.22620	.	0.000000	0.56097	U	0.000022	D	0.83257	0.5215	M	0.84082	2.675	0.45390	D	0.998377	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	T	0.80471	-0.1368	10	0.87932	D	0	.	5.8485	0.18679	0.4699:0.4345:0.0:0.0956	.	1827;1827	P21817-2;P21817	.;RYR1_HUMAN	C	1827	ENSP00000352608:R1827C;ENSP00000347667:R1827C;ENSP00000354254:R1827C	ENSP00000347667:R1827C	R	+	1	0	0	RYR1	43668614	43668614	0.042000	0.20092	0.218000	0.23776	0.839000	0.47603	0.423000	0.21313	0.215000	0.20761	-0.237000	0.12165	CGC	0.364008		TCGA-F2-A7TX-01A-33D-A38G-08	0.692	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	1	0	1	2	2	2	2	0	0	0	0	172	172	172	170	1	3.450000	-20.000000	1	0.190000			0	107	107	0	392	385	1		1			0	0	172	0	0	1.000000	0	0	0	0	0	0	107	392
CCDC8	83987	broad.mit.edu	37	19	46915715	46915715	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr19:46915715C>T	ENST00000307522.3	-	1	1126	c.353G>A	c.(352-354)cGc>cAc	p.R118H		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	118					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CGGGCCCTGGCGGCTCTTGTC	0.637																																						ENST00000307522.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				23						c.(352-354)cGc>cAc		coiled-coil domain containing 8							52.0	58.0	56.0					19																	46915715		2203	4300	6503	SO:0001583	missense	83987	0	0					g.chr19:46915715C>T	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.353G>A	chr19.hg19:g.46915715C>T	ENSP00000303158:p.Arg118His	1						p.R118H	NM_032040.4	NP_114429.2	3	4	7	2.326965	Q9H0W5	CCDC8_HUMAN		1	1126	-			Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	1	1	hg19	c.353G>A	CCDS12685.1	1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592819	0.28357	.	.	ENSG00000169515	ENST00000307522;ENST00000540252	T	0.13420	2.59	3.78	-7.56	0.01322	3.78	-7.56	0.01322	.	2.515660	0.01447	N	0.015325	T	0.06188	0.0160	N	0.11560	0.145	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28713	-1.0035	10	0.13108	T	0.6	.	8.1402	0.31078	0.0:0.1367:0.4249:0.4384	.	118	Q9H0W5	CCDC8_HUMAN	H	118	ENSP00000303158:R118H	ENSP00000303158:R118H	R	-	2	0	0	CCDC8	51607555	51607555	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	-3.843000	0.00352	-1.722000	0.01377	-0.345000	0.07892	CGC	0.389945		TCGA-F2-A7TX-01A-33D-A38G-08	0.637	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	1	0	1	2	2	2	2	0	0	0	0	157	157	157	154	1	3.450000	-20.000000	1	0.190000	NM_032040		0	74	73	0	461	446	1		1	0		0	0	157	0	0	1.000000	9.445916e-01	0	0	0	32	0	74	461
ACTL9	284382	broad.mit.edu	37	19	8808381	8808381	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr19:8808381G>A	ENST00000324436.3	-	1	791	c.671C>T	c.(670-672)gCg>gTg	p.A224V		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	224						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						GTGGTTGCCCGCCAGGTCCAG	0.662																																						ENST00000324436.3	0.440000	0.060000	0.320000	0.120000	0.200000	0.225519	0.200000	0.180000																										0				36						c.(670-672)gCg>gTg		actin-like 9							41.0	40.0	41.0					19																	8808381		2203	4299	6502	SO:0001583	missense	284382	0	0					g.chr19:8808381G>A		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.671C>T	chr19.hg19:g.8808381G>A	ENSP00000316674:p.Ala224Val	1						p.A224V	NM_178525.3	NP_848620.3	0	2	2	1.796486	Q8TC94	ACTL9_HUMAN		1	791	-			A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	0	1	hg19	c.671C>T	CCDS12207.1	0	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832211	0.71258	.	.	ENSG00000181786	ENST00000324436	T	0.14640	2.49	4.55	1.18	0.20946	4.55	1.18	0.20946	.	0.301968	0.23206	N	0.050737	T	0.23965	0.0580	H	0.97491	4.015	0.38031	D	0.935152	P	0.51351	0.944	B	0.37091	0.241	T	0.37753	-0.9692	10	0.87932	D	0	.	6.2393	0.20780	0.1648:0.0:0.686:0.1493	.	224	Q8TC94	ACTL9_HUMAN	V	224	ENSP00000316674:A224V	ENSP00000316674:A224V	A	-	2	0	0	ACTL9	8669381	8669381	1.000000	0.71417	0.222000	0.23844	0.723000	0.41478	5.869000	0.69613	0.251000	0.21505	0.462000	0.41574	GCG	0.190000		TCGA-F2-A7TX-01A-33D-A38G-08	0.662	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	0	0	0	2	10	2	2	1	1	1	1	98	98	98	95	1	3.450000	-5.067402	1	0.190000	NM_178525		0	4	4	0	223	219	0		0			1	0	98	0	0	0.079875	0	0	0	0	0	0	4	223
ZNF154	7710	broad.mit.edu	37	19	58216263	58216263	+	Missense_Mutation	SNP	G	G	A	rs376733811		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr19:58216263G>A	ENST00000512439.2	-	2	314	c.118C>T	c.(118-120)Cgt>Tgt	p.R40C	ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000599221.1_Intron|ZNF154_ENST00000426889.1_Missense_Mutation_p.R40C|AC003006.7_ENST00000594684.1_Intron			Q13106	ZN154_HUMAN	zinc finger protein 154	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(7)|lung(3)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ATCACATCACGGTACAGGCAT	0.507																																						ENST00000512439.2	0.910000	0.440000	0.790000	0.540000	0.650000	0.672686	0.650000	0.650000																										0				12						c.(118-120)Cgt>Tgt		zinc finger protein 154		G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	177.0	168.0	171.0		118	1.7	0.4	19		171	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF154	NM_001085384.1	180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	40/438	58216263	3,13003	2203	4300	6503	SO:0001583	missense	7710	3	121412	42				g.chr19:58216263G>A	U20648	CCDS42639.1	19q13.4	2013-01-08	2006-08-22		ENSG00000179909	ENSG00000179909		"""Zinc fingers, C2H2-type"", ""-"""	12939	protein-coding gene	gene with protein product		604085	"""zinc finger protein 154 (pHZ-92)"""			7557990	Standard	XR_243957		Approved	pHZ-92	uc010euf.3	Q13106	OTTHUMG00000140375	ENST00000512439.2:c.118C>T	chr19.hg19:g.58216263G>A	ENSP00000421258:p.Arg40Cys	1					ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000599221.1_Intron|ZNF154_ENST00000426889.1_Missense_Mutation_p.R40C|AC003006.7_ENST00000594684.1_Intron	p.R40C			2	3	5	2.310303	Q13106	ZN154_HUMAN		2	314	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	A7MCY3|Q8IVG7|Q8NAR0	Missense_Mutation	SNP	ENST00000512439.2	1	1	hg19	c.118C>T	CCDS42639.1	0	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650024	0.29336	2.27E-4	2.33E-4	ENSG00000179909	ENST00000512439;ENST00000426889	T;T	0.02812	4.15;4.15	2.78	1.73	0.24493	2.78	1.73	0.24493	Krueppel-associated box (4);	.	.	.	.	T	0.04227	0.0117	M	0.67569	2.06	0.18873	N	0.999987	B	0.14438	0.01	B	0.11329	0.006	T	0.32079	-0.9920	9	0.52906	T	0.07	.	5.3394	0.15974	0.1627:0.0:0.8373:0.0	.	40	Q13106	ZN154_HUMAN	C	40	ENSP00000421258:R40C;ENSP00000442370:R40C	ENSP00000442370:R40C	R	-	1	0	0	ZNF154	62908075	62908075	0.000000	0.05858	0.360000	0.25837	0.915000	0.54546	-0.647000	0.05397	0.741000	0.32674	0.313000	0.20887	CGT	0.369650		TCGA-F2-A7TX-01A-33D-A38G-08	0.507	ZNF154-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277102.2	1	0	1	2	2	2	2	0	0	0	0	199	199	199	197	1	3.450000	-2.386563	0	0.190000			0	28	28	0	551	542	0		1	0		0	0	199	0	0	1.000000	2.310342e-02	0	0	0	5	0	28	551
FBXO44	93611	broad.mit.edu	37	1	11716084	11716084	+	Silent	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:11716084C>T	ENST00000251547.5	+	2	274	c.192C>T	c.(190-192)ccC>ccT	p.P64P	FBXO44_ENST00000376770.1_Silent_p.P64P|FBXO2_ENST00000475961.1_5'Flank|FBXO2_ENST00000354287.4_5'Flank|FBXO44_ENST00000251546.4_Silent_p.P64P|FBXO44_ENST00000376768.1_Silent_p.P64P|FBXO44_ENST00000376760.1_Silent_p.P64P|FBXO44_ENST00000376762.4_Silent_p.P64P	NM_033182.5	NP_149438.2	Q9H4M3	FBX44_HUMAN	F-box protein 44	64						SCF ubiquitin ligase complex (GO:0019005)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GGGACCAGCCCGTGGCCGACT	0.627																																						ENST00000251547.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				8						c.(190-192)ccC>ccT		F-box protein 44							93.0	99.0	97.0					1																	11716084		2203	4300	6503	SO:0001819	synonymous_variant	93611	1	121412	30				g.chr1:11716084C>T	AY040878	CCDS131.1, CCDS132.1	1p36.21	2008-03-26			ENSG00000132879	ENSG00000132879		"""F-boxes /  ""other"""""	24847	protein-coding gene	gene with protein product		609111				12383498	Standard	XM_005263535		Approved	FBX30, FBG3, MGC14140, Fbxo6a, Fbx44	uc001asm.3	Q9H4M3	OTTHUMG00000002071	ENST00000251547.5:c.192C>T	chr1.hg19:g.11716084C>T		0					FBXO2_ENST00000354287.4_5'Flank|FBXO44_ENST00000251546.4_Silent_p.P64P|FBXO44_ENST00000376768.1_Silent_p.P64P|FBXO44_ENST00000376760.1_Silent_p.P64P|FBXO44_ENST00000376762.4_Silent_p.P64P|FBXO44_ENST00000376770.1_Silent_p.P64P|FBXO2_ENST00000475961.1_5'Flank	p.P64P	NM_033182.5	NP_149438.2	1	3	4	1.995362	Q9H4M3	FBX44_HUMAN		2	274	+	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	B3KNZ2|B7Z743|Q5TGX2|Q5TGX4|Q5TGX5|Q68DJ9|Q8WWY2	Silent	SNP	ENST00000251547.5	1	1	hg19	c.192C>T	CCDS132.1	1																																																																																								0.280256		TCGA-F2-A7TX-01A-33D-A38G-08	0.627	FBXO44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005761.1	1	0	1	2	2	2	2	0	0	0	0	137	137	137	136	1	3.450000	-2.543487	1	0.190000	NM_183412		0	52	49	0	300	294	1		1	1		0	0	137	0	0	1.000000	8.708504e-01	0	3	0	20	0	52	300
KIFAP3	22920	broad.mit.edu	37	1	169985603	169985603	+	Splice_Site	SNP	C	C	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:169985603C>A	ENST00000361580.2	-	10	1410	c.1183G>T	c.(1183-1185)Ggc>Tgc	p.G395C	KIFAP3_ENST00000538366.1_Splice_Site_p.G317C|KIFAP3_ENST00000367765.1_Splice_Site_p.G355C|KIFAP3_ENST00000540905.1_Splice_Site_p.G97C|KIFAP3_ENST00000367767.1_Splice_Site_p.G351C	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	395					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AAAAGCATACCTAGGAGTGCA	0.413																																						ENST00000361580.2	1.000000	0.060000	0.310000	0.110000	0.190000	0.238024	0.190000	0.170000																										0				35						c.(1183-1185)Ggc>Tgc		kinesin-associated protein 3							109.0	100.0	103.0					1																	169985603		2203	4300	6503	SO:0001630	splice_region_variant	22920	0	0					g.chr1:169985603C>A	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.1183+1G>T	chr1.hg19:g.169985603C>A		0					KIFAP3_ENST00000367767.1_Splice_Site_p.G351C|KIFAP3_ENST00000540905.1_Splice_Site_p.G97C|KIFAP3_ENST00000538366.1_Splice_Site_p.G317C|KIFAP3_ENST00000367765.1_Splice_Site_p.G355C	p.G395C	NM_014970.3	NP_055785.2	1	2	3	1.935404	Q92845	KIFA3_HUMAN		10	1410	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Splice_Site	SNP	ENST00000361580.2	0	1	hg19	c.1183G>T	CCDS1288.1	0	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200786	0.79015	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000540905;ENST00000538366	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.83	5.83	0.93111	5.83	5.83	0.93111	Armadillo-like helical (1);Armadillo-type fold (1);	0.146179	0.64402	D	0.000010	T	0.29061	0.0722	L	0.43152	1.355	0.80722	D	1	P	0.37061	0.58	B	0.38683	0.279	T	0.03493	-1.1031	9	.	.	.	-14.7883	19.7221	0.96147	0.0:1.0:0.0:0.0	.	395	Q92845	KIFA3_HUMAN	C	395;355;351;97;317	ENSP00000354560:G395C;ENSP00000356739:G355C;ENSP00000356741:G351C;ENSP00000442712:G97C;ENSP00000444622:G317C	.	G	-	1	0	0	KIFAP3	168252227	168252227	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.357000	0.66058	2.758000	0.94735	0.563000	0.77884	GGC	0.257051		TCGA-F2-A7TX-01A-33D-A38G-08	0.413	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	0	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	3.450000	-3.253723	1	0.190000	NM_014970	Missense_Mutation	0	4	4	0	267	264	0		1	0		0	0	99	0	0	0.888434	1.974041e-01	0	0	0	44	0	4	267
DDX59	83479	broad.mit.edu	37	1	200613582	200613582	+	Missense_Mutation	SNP	T	T	C			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:200613582T>C	ENST00000331314.6	-	8	1873	c.1660A>G	c.(1660-1662)Aaa>Gaa	p.K554E	DDX59_ENST00000367348.3_Intron|DDX59_ENST00000447706.2_Intron	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	554	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						AAGAGTCTTTTTGAATTATTA	0.363																																						ENST00000331314.6	1.000000	0.640000	1.000000	0.770000	0.920000	0.898708	0.920000	1.000000																										0				21						c.(1660-1662)Aaa>Gaa		DEAD (Asp-Glu-Ala-Asp) box polypeptide 59							124.0	128.0	126.0					1																	200613582		2203	4300	6503	SO:0001583	missense	83479	0	0					g.chr1:200613582T>C	BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.1660A>G	chr1.hg19:g.200613582T>C	ENSP00000330460:p.Lys554Glu	0					DDX59_ENST00000447706.2_Intron|DDX59_ENST00000367348.3_Intron	p.K554E	NM_001031725.4	NP_001026895.2	1	2	3	1.935404	Q5T1V6	DDX59_HUMAN		8	1873	-			Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	ENST00000331314.6	1	1	hg19	c.1660A>G	CCDS30964.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.77|19.77	3.888564|3.888564	0.72524|0.72524	.|.	.|.	ENSG00000118197|ENSG00000118197	ENST00000367346;ENST00000331314;ENST00000433235|ENST00000429498	D;T|.	0.90676|.	-2.71;3.6|.	5.5|5.5	5.5|5.5	0.81552|0.81552	5.5|5.5	5.5|5.5	0.81552|0.81552	Helicase, C-terminal (1);|.	0.050113|0.050113	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.50871|0.50871	0.1641|0.1641	L|L	0.28014|0.28014	0.82|0.82	0.80722|0.80722	D|D	1|1	P|.	0.51791|.	0.948|.	P|.	0.48815|.	0.591|.	T|T	0.48127|0.48127	-0.9062|-0.9062	10|6	0.07813|.	T|.	0.8|.	-28.0703|-28.0703	11.583|11.583	0.50902|0.50902	0.0:0.0:0.1489:0.851|0.0:0.0:0.1489:0.851	.|.	554|.	Q5T1V6|.	DDX59_HUMAN|.	E|R	140;554;197|131	ENSP00000330460:K554E;ENSP00000409954:K197E|.	ENSP00000330460:K554E|.	K|K	-|-	1|2	0|0	0|0	DDX59|DDX59	198880205|198880205	198880205|198880205	1.000000|1.000000	0.71417|0.71417	0.921000|0.921000	0.36526|0.36526	0.998000|0.998000	0.95712|0.95712	5.995000|5.995000	0.70631|0.70631	2.073000|2.073000	0.62155|0.62155	0.523000|0.523000	0.50628|0.50628	AAA|AAA	0.257051		TCGA-F2-A7TX-01A-33D-A38G-08	0.363	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	1	0	1	2	2	2	2	0	0	0	0	163	163	163	160	1	3.450000	-20.000000	1	0.190000	NM_001031725.4		0	32	31	0	371	370	0		1	1		0	0	163	0	0	1.000000	5.143882e-01	0	5	0	16	0	32	371
CYB5R1	51706	broad.mit.edu	37	1	202935980	202935980	+	Missense_Mutation	SNP	A	A	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:202935980A>T	ENST00000367249.4	-	2	136	c.62T>A	c.(61-63)cTc>cAc	p.L21H	CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	21					sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	AGCCAGGCCGAGCAGAGTGAC	0.657																																						ENST00000367249.4	1.000000	0.440000	1.000000	0.650000	0.930000	0.860707	0.930000	1.000000																										0				12						c.(61-63)cTc>cAc		cytochrome b5 reductase 1	Flavin adenine dinucleotide(DB03147)						26.0	30.0	29.0					1																	202935980		2203	4300	6503	SO:0001583	missense	51706	0	0					g.chr1:202935980A>T	AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.62T>A	chr1.hg19:g.202935980A>T	ENSP00000356218:p.Leu21His	0					CYB5R1_ENST00000497655.1_5'Flank	p.L21H	NM_016243.2	NP_057327.2	1	2	3	1.935404	Q9UHQ9	NB5R1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.141)	2	136	-			A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	ENST00000367249.4	1	1	hg19	c.62T>A	CCDS1431.1	1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.423509	0.83559	.	.	ENSG00000159348	ENST00000367249	D	0.87966	-2.32	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.513564	0.20313	N	0.094786	T	0.77922	0.4203	N	0.08118	0	0.45318	D	0.998319	D	0.59767	0.986	P	0.46718	0.525	T	0.76929	-0.2777	10	0.22109	T	0.4	.	13.506	0.61483	1.0:0.0:0.0:0.0	.	21	Q9UHQ9	NB5R1_HUMAN	H	21	ENSP00000356218:L21H	ENSP00000356218:L21H	L	-	2	0	0	CYB5R1	201202603	201202603	0.110000	0.22057	0.991000	0.47740	0.991000	0.79684	3.864000	0.56024	2.081000	0.62600	0.533000	0.62120	CTC	0.257051		TCGA-F2-A7TX-01A-33D-A38G-08	0.657	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099155.1	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	3.450000	-13.298910	1	0.190000	NM_016243		0	8	8	0	95	93	0		1	1		0	0	45	0	0	0.989496	9.533489e-01	0	6	0	61	0	8	95
KLHDC8A	55220	broad.mit.edu	37	1	205312564	205312564	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:205312564C>T	ENST00000367156.3	-	5	985	c.169G>A	c.(169-171)Gac>Aac	p.D57N	KLHDC8A_ENST00000367155.3_Missense_Mutation_p.D57N|KLHDC8A_ENST00000606529.1_5'Flank|KLHDC8A_ENST00000460687.1_Intron|KLHDC8A_ENST00000539253.1_Missense_Mutation_p.D57N|KLHDC8A_ENST00000537168.1_Intron	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	57										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GTCCACTGGTCGGCCTCCGGG	0.701																																						ENST00000367156.3	1.000000	0.630000	1.000000	0.770000	0.950000	0.909468	0.950000	1.000000																										0				14						c.(169-171)Gac>Aac		kelch domain containing 8A							40.0	42.0	42.0					1																	205312564		2202	4299	6501	SO:0001583	missense	55220	0	0					g.chr1:205312564C>T		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.169G>A	chr1.hg19:g.205312564C>T	ENSP00000356124:p.Asp57Asn	0					KLHDC8A_ENST00000367155.3_Missense_Mutation_p.D57N|KLHDC8A_ENST00000537168.1_Intron|KLHDC8A_ENST00000539253.1_Missense_Mutation_p.D57N|KLHDC8A_ENST00000460687.1_Intron|KLHDC8A_ENST00000606529.1_5'Flank	p.D57N	NM_001271863.1	NP_001258792.1	1	2	3	1.935404	Q8IYD2	KLD8A_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.117)	5	985	-	Breast(84;0.23)		B3KU70|Q9NVG5	Missense_Mutation	SNP	ENST00000367156.3	1	1	hg19	c.169G>A	CCDS30985.1	1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041237	0.55003	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253	T;T;T	0.73789	-0.78;-0.78;-0.78	5.55	5.55	0.83447	5.55	5.55	0.83447	Kelch-type beta propeller (1);	0.048810	0.85682	D	0.000000	T	0.53367	0.1792	N	0.25144	0.715	0.45690	D	0.998606	B	0.25809	0.135	B	0.18561	0.022	T	0.51148	-0.8742	10	0.02654	T	1	-33.1818	9.7742	0.40609	0.0:0.8459:0.0:0.1541	.	57	Q8IYD2	KLD8A_HUMAN	N	57	ENSP00000356123:D57N;ENSP00000356124:D57N;ENSP00000442229:D57N	ENSP00000356123:D57N	D	-	1	0	0	KLHDC8A	203579187	203579187	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.678000	0.46900	2.590000	0.87494	0.655000	0.94253	GAC	0.257051		TCGA-F2-A7TX-01A-33D-A38G-08	0.701	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	0	0	1	2	10	2	2	1	1	1	1	127	127	127	126	1	3.450000	-8.480209	1	0.190000	NM_018203		0	24	24	0	269	261	0		1	0		1	0	127	0	0	0.995288	2.097822e-02	0	0	0	3	0	24	269
ARID1A	8289	broad.mit.edu	37	1	27099479	27099479	+	Splice_Site	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:27099479G>A	ENST00000324856.7	+	14	4086		c.e14+1		ARID1A_ENST00000457599.2_Splice_Site|ARID1A_ENST00000374152.2_Splice_Site|ARID1A_ENST00000540690.1_Splice_Site	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)						androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATGAGGAAAGGTGACTGATCT	0.488			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	ENST00000324856.7	1.000000	0.990000	1.000000	0.990000	0.990000	0.999647	0.990000	1.000000				Rec	yes			Rec	yes		1	1p35.3	1p35.3	8289	Mis, N, F, S, D	AT rich interactive domain 1A (SWI-like)				E	E			clear cell ovarian carcinoma, RCC	ARID1A/MAST2_ENST00000361297(2)	0				411						c.e14+1		AT rich interactive domain 1A (SWI-like)							94.0	103.0	100.0					1																	27099479		2203	4300	6503	SO:0001630	splice_region_variant	8289	0	0					g.chr1:27099479G>A	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3715+1G>A	chr1.hg19:g.27099479G>A		0					ARID1A_ENST00000374152.2_Splice_Site|ARID1A_ENST00000540690.1_Splice_Site|ARID1A_ENST00000457599.2_Splice_Site		NM_006015.4	NP_006006.3	1	2	3	1.959096	O14497	ARI1A_HUMAN		14	4086	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Splice_Site	SNP	ENST00000324856.7	1	1	hg19		CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619732	0.66787	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000430799	.	.	.	5.34	5.34	0.76211	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2435	0.93893	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ARID1A	26972066	26972066	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.263000	0.95617	2.791000	0.96007	0.655000	0.94253	.	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.488	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	3.450000	-20.000000	1	0.190000	NM_139135	Intron	0	26	26	0	155	153	1		1	0	1	0	0	80	176	0	1.000000	0	1	1	47	0	220	26	155
ARID1A	8289	broad.mit.edu	37	1	27099947	27099947	+	Nonsense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:27099947C>T	ENST00000324856.7	+	15	4197	c.3826C>T	c.(3826-3828)Cga>Tga	p.R1276*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.R1276*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.R893*|ARID1A_ENST00000540690.1_5'UTR	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1276					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1276*(7)|p.G1274fs*7(2)|p.M1273fs(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GATGGGACCACGACAGCACTA	0.602			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	ENST00000324856.7	1.000000	0.580000	1.000000	0.800000	0.990000	0.932034	0.990000	1.000000				Rec	yes			Rec	yes		1	1p35.3	1p35.3	8289	Mis, N, F, S, D	AT rich interactive domain 1A (SWI-like)				E	E			clear cell ovarian carcinoma, RCC	ARID1A/MAST2_ENST00000361297(2)	10	Substitution - Nonsense(7)|Deletion - Frameshift(2)|Complex(1)	p.R1276*(7)|p.G1274fs*7(2)|p.M1273fs(1)	haematopoietic_and_lymphoid_tissue(3)|liver(3)|endometrium(2)|pancreas(2)	411						c.(3826-3828)Cga>Tga		AT rich interactive domain 1A (SWI-like)							73.0	65.0	67.0					1																	27099947		2203	4300	6503	SO:0001587	stop_gained	8289	0	0					g.chr1:27099947C>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3826C>T	chr1.hg19:g.27099947C>T	ENSP00000320485:p.Arg1276*	0					ARID1A_ENST00000374152.2_Nonsense_Mutation_p.R893*|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.R1276*	p.R1276*	NM_006015.4	NP_006006.3	1	2	3	1.959096	O14497	ARI1A_HUMAN		15	4197	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	0	1	hg19	c.3826C>T	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.564494|8.564494	0.98866|0.98866	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152|ENST00000430799	.|.	.|.	.|.	4.72|4.72	3.74|3.74	0.42951|0.42951	4.72|4.72	3.74|3.74	0.42951|0.42951	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.68650	.|0.3024	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66893	.|-0.5808	.|4	0.02654|.	T|.	1|.	-1.2857|-1.2857	14.0159|14.0159	0.64523|0.64523	0.227:0.773:0.0:0.0|0.227:0.773:0.0:0.0	.|.	.|.	.|.	.|.	X|M	1276;1276;893|172	.|.	ENSP00000320485:R1276X|.	R|T	+|+	1|2	2|0	2|0	ARID1A|ARID1A	26972534|26972534	26972534|26972534	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.516000|1.516000	0.35856|0.35856	2.627000|2.627000	0.88993|0.88993	0.655000|0.655000	0.94253|0.94253	CGA|ACG	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.602	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	1	0	1	2	2	2	7	0	0	0	0	55	55	55	55	1	3.450000	-17.125700	1	0.190000	NM_139135		0	11	11	0	108	103	1		1	1	1	0	1	55	627	0	0.998212	9.205517e-01	9.999999e-01	6	63	40	792	11	108
MANEAL	149175	broad.mit.edu	37	1	38260133	38260133	+	Silent	SNP	C	C	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:38260133C>A	ENST00000373045.6	+	1	660	c.279C>A	c.(277-279)ccC>ccA	p.P93P	MANEAL_ENST00000329006.5_5'Flank|MANEAL_ENST00000397631.3_Silent_p.P93P|MANEAL_ENST00000525897.1_5'Flank	NM_001113482.1	NP_001106954.1	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like	93	Pro-rich.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|liver(1)|lung(1)|prostate(3)	7	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AGGCCGAGCCCGCCCCCGTGC	0.791																																						ENST00000373045.6	1.000000	0.370000	1.000000	0.710000	0.990000	0.901922	0.990000	1.000000																										0				7						c.(277-279)ccC>ccA		mannosidase, endo-alpha-like							4.0	4.0	4.0					1																	38260133		1268	3044	4312	SO:0001819	synonymous_variant	149175	0	0					g.chr1:38260133C>A	AK055996	CCDS426.1, CCDS44110.1, CCDS44111.1	1p34.3	2008-02-05			ENSG00000185090	ENSG00000185090			26452	protein-coding gene	gene with protein product							Standard	NM_152496		Approved	FLJ31434	uc001cby.2	Q5VSG8	OTTHUMG00000004317	ENST00000373045.6:c.279C>A	chr1.hg19:g.38260133C>A		0					MANEAL_ENST00000525897.1_5'Flank|MANEAL_ENST00000329006.5_5'Flank|MANEAL_ENST00000397631.3_Silent_p.P93P	p.P93P	NM_001113482.1	NP_001106954.1	1	2	3	1.959096	Q5VSG8	MANEL_HUMAN		1	660	+	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	Q6DD86|Q6P497|Q8N5P8|Q96G55|Q96N42	Silent	SNP	ENST00000373045.6	0	1	hg19	c.279C>A	CCDS44110.1	1																																																																																								0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.791	MANEAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012469.2	0	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	3.450000	-9.557345	1	0.190000	NM_152496		0	3	3	0	27	26	0		1	0		0	0	8	0	0	0.801814	1.770969e-01	0	0	0	6	0	3	27
TIE1	7075	broad.mit.edu	37	1	43778910	43778910	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:43778910G>A	ENST00000372476.3	+	13	2111	c.2032G>A	c.(2032-2034)Gtt>Att	p.V678I	TIE1_ENST00000433781.2_Missense_Mutation_p.V323I	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	678	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATCCAAGTACGTTGTGGAGGT	0.632																																						ENST00000372476.3	1.000000	0.590000	1.000000	0.750000	0.940000	0.900490	0.940000	1.000000																										0				70						c.(2032-2034)Gtt>Att		tyrosine kinase with immunoglobulin-like and EGF-like domains 1							118.0	94.0	102.0					1																	43778910		2203	4300	6503	SO:0001583	missense	7075	0	0					g.chr1:43778910G>A	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2032G>A	chr1.hg19:g.43778910G>A	ENSP00000361554:p.Val678Ile	0					TIE1_ENST00000433781.2_Missense_Mutation_p.V323I	p.V678I	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	1	2	3	1.959096	P35590	TIE1_HUMAN		13	2111	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	1	1	hg19	c.2032G>A	CCDS482.1	1	.	.	.	.	.	.	.	.	.	.	G	0.048	-1.258294	0.01445	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000433781	T;T	0.57107	0.42;0.42	5.08	1.24	0.21308	5.08	1.24	0.21308	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.179360	0.26563	N	0.023668	T	0.18215	0.0437	N	0.00642	-1.3	0.19775	N	0.999952	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.27536	-1.0071	10	0.13853	T	0.58	.	11.398	0.49854	0.8638:0.0:0.1362:0.0	.	323;633;678;323;678	E9PG63;B4DTW8;B5A952;B4DKW0;P35590	.;.;.;.;TIE1_HUMAN	I	678;81;323	ENSP00000361554:V678I;ENSP00000411728:V323I	ENSP00000361553:V81I	V	+	1	0	0	TIE1	43551497	43551497	1.000000	0.71417	0.908000	0.35775	0.331000	0.28603	2.067000	0.41461	-0.002000	0.14469	-2.033000	0.00422	GTT	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.632	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	1	0	1	2	2	2	2	0	0	0	0	110	110	110	108	1	3.450000	-19.999980	1	0.190000	NM_005424		0	19	18	0	214	210	0		1	0		0	0	110	0	0	0.999991	7.021878e-01	0	0	0	29	0	19	214
SGIP1	84251	broad.mit.edu	37	1	67137671	67137671	+	Missense_Mutation	SNP	C	C	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:67137671C>A	ENST00000371037.4	+	11	630	c.553C>A	c.(553-555)Ctt>Att	p.L185I	AL139147.1_ENST00000502413.2_Intron|SGIP1_ENST00000371036.3_Missense_Mutation_p.L152I|SGIP1_ENST00000468286.1_3'UTR|SGIP1_ENST00000371035.3_Missense_Mutation_p.L142I|SGIP1_ENST00000237247.6_Missense_Mutation_p.L189I|SGIP1_ENST00000371039.1_Missense_Mutation_p.L153I	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	185	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						AACTCCAGAACTTATAAGGTG	0.403																																						ENST00000371037.4	1.000000	0.550000	1.000000	0.720000	0.930000	0.884406	0.930000	1.000000																										0				71						c.(553-555)Ctt>Att		SH3-domain GRB2-like (endophilin) interacting protein 1							115.0	109.0	111.0					1																	67137671		2203	4300	6503	SO:0001583	missense	84251	0	0					g.chr1:67137671C>A	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.553C>A	chr1.hg19:g.67137671C>A	ENSP00000360076:p.Leu185Ile	0					SGIP1_ENST00000468286.1_3'UTR|SGIP1_ENST00000371036.3_Missense_Mutation_p.L152I|SGIP1_ENST00000237247.6_Missense_Mutation_p.L189I|SGIP1_ENST00000371035.3_Missense_Mutation_p.L142I|SGIP1_ENST00000371039.1_Missense_Mutation_p.L153I|AL139147.1_ENST00000502413.2_Intron	p.L185I	NM_032291.2	NP_115667.2	1	2	3	1.959096	Q9BQI5	SGIP1_HUMAN		11	630	+			A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	1	1	hg19	c.553C>A	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893702	0.33442	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000424320;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T;T	0.17370	2.28;3.98;3.98;2.28;3.98;2.28	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.251717	0.41001	D	0.000975	T	0.08223	0.0205	L	0.36672	1.1	0.28969	N	0.889373	B	0.06786	0.001	B	0.06405	0.002	T	0.06972	-1.0797	10	0.37606	T	0.19	-17.8373	19.4593	0.94910	0.0:1.0:0.0:0.0	.	185	Q9BQI5	SGIP1_HUMAN	I	189;153;177;142;188;188;152;185	ENSP00000237247:L189I;ENSP00000360078:L153I;ENSP00000410439:L177I;ENSP00000360074:L142I;ENSP00000360075:L152I;ENSP00000360076:L185I	ENSP00000237247:L189I	L	+	1	0	0	SGIP1	66910259	66910259	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.925000	0.70062	2.601000	0.87937	0.563000	0.77884	CTT	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.403	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	3.450000	-19.842020	1	0.190000	NM_032291		0	15	15	0	173	167	0		1	0		0	0	91	0	0	0.999863	3.955721e-02	0	0	0	4	0	15	173
AIDA	64853	broad.mit.edu	37	1	222885606	222885606	+	Missense_Mutation	SNP	T	T	G			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr1:222885606T>G	ENST00000340020.6	-	1	260	c.54A>C	c.(52-54)agA>agC	p.R18S	AIDA_ENST00000541237.1_Intron|AIDA_ENST00000474863.1_5'UTR|BROX_ENST00000537020.1_5'Flank|BROX_ENST00000539697.1_5'Flank|BROX_ENST00000340934.5_5'Flank|AIDA_ENST00000355727.2_Missense_Mutation_p.R18S	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	18					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						AGTCGGCGCCTCTCCTAAAAC	0.672																																						ENST00000340020.6	1.000000	0.360000	1.000000	0.630000	0.990000	0.864705	0.990000	1.000000																										0				10						c.(52-54)agA>agC		axin interactor, dorsalization associated							18.0	15.0	16.0					1																	222885606		2200	4293	6493	SO:0001583	missense	64853	0	0					g.chr1:222885606T>G	BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.54A>C	chr1.hg19:g.222885606T>G	ENSP00000339161:p.Arg18Ser	0					BROX_ENST00000539697.1_5'Flank|AIDA_ENST00000541237.1_Intron|BROX_ENST00000340934.5_5'Flank|AIDA_ENST00000355727.2_Missense_Mutation_p.R18S|BROX_ENST00000537020.1_5'Flank|AIDA_ENST00000474863.1_5'UTR	p.R18S	NM_022831.2	NP_073742.2	1	2	3	1.938198	Q96BJ3	AIDA_HUMAN		1	260	-			A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Missense_Mutation	SNP	ENST00000340020.6	0	1	hg19	c.54A>C	CCDS1533.1	1	.	.	.	.	.	.	.	.	.	.	T	17.50	3.404232	0.62288	.	.	ENSG00000186063	ENST00000340020;ENST00000355727	.	.	.	5.51	-0.695	0.11291	5.51	-0.695	0.11291	Axin interactor, dorsalization-associated protein, N-terminal (2);	0.043570	0.85682	D	0.000000	T	0.40222	0.1108	N	0.22421	0.69	0.80722	D	1	B	0.09022	0.002	B	0.20577	0.03	T	0.26849	-1.0091	9	0.72032	D	0.01	.	10.6482	0.45632	0.0:0.4119:0.0:0.5881	.	18	Q96BJ3	AIDA_HUMAN	S	18	.	ENSP00000339161:R18S	R	-	3	2	2	AIDA	220952229	220952229	0.998000	0.40836	0.998000	0.56505	0.988000	0.76386	0.355000	0.20163	0.071000	0.16664	-0.432000	0.05891	AGA	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.672	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091818.1	0	0	1	2	2	2	2	0	0	0	0	21	21	21	29	1	3.450000	-4.885313	1	0.190000	NM_022831		0	4	4	0	44	41	0		1	0		0	0	21	0	0	0.877436	1.176471e-02	0	1	0	1	0	4	44
TAF4	6874	broad.mit.edu	37	20	60585136	60585136	+	Missense_Mutation	SNP	A	A	G			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr20:60585136A>G	ENST00000252996.4	-	4	1726	c.1727T>C	c.(1726-1728)gTa>gCa	p.V576A	TAF4_ENST00000609045.1_5'UTR	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	576					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CGCCCCTGGTACCGTGCGCTG	0.617																																						ENST00000252996.4	1.000000	0.560000	1.000000	0.750000	0.980000	0.905490	0.980000	1.000000																										0				37						c.(1726-1728)gTa>gCa		TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa							97.0	77.0	84.0					20																	60585136		2203	4300	6503	SO:0001583	missense	6874	0	0					g.chr20:60585136A>G	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1727T>C	chr20.hg19:g.60585136A>G	ENSP00000252996:p.Val576Ala	0					TAF4_ENST00000609045.1_5'UTR	p.V576A	NM_003185.3	NP_003176.2	1	2	3	1.923650	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)	4	1726	-	Breast(26;1e-08)		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	1	1	hg19	c.1727T>C	CCDS33500.1	1	.	.	.	.	.	.	.	.	.	.	A	8.390	0.839537	0.16891	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.23348	1.92;1.91	4.8	3.65	0.41850	4.8	3.65	0.41850	.	0.449437	0.23513	N	0.047377	T	0.15782	0.0380	L	0.44542	1.39	0.43471	D	0.995686	P	0.34699	0.464	B	0.28709	0.093	T	0.03739	-1.1008	10	0.02654	T	1	-10.3553	10.7964	0.46464	0.8585:0.0:0.0:0.1414	.	576	O00268	TAF4_HUMAN	A	576;440	ENSP00000252996:V576A;ENSP00000399091:V440A	ENSP00000252996:V576A	V	-	2	0	0	TAF4	60018531	60018531	1.000000	0.71417	0.628000	0.29241	0.112000	0.19704	6.400000	0.73252	1.805000	0.52779	0.260000	0.18958	GTA	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.617	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	1	0	1	2	2	2	2	0	0	0	0	56	56	56	54	1	3.450000	-18.778180	1	0.190000	NM_003185		0	13	12	0	141	140	0		1	1		0	0	56	0	0	0.999574	6.682631e-01	0	6	0	20	0	13	141
MYO7B	4648	broad.mit.edu	37	2	128354060	128354060	+	Silent	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr2:128354060G>A	ENST00000409816.2	+	18	2300	c.2268G>A	c.(2266-2268)gaG>gaA	p.E756E	MYO7B_ENST00000389524.4_Silent_p.E756E|MYO7B_ENST00000428314.1_Silent_p.E756E			Q6PIF6	MYO7B_HUMAN	myosin VIIB	756	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTCTGCTGGAGGTACAGAGAA	0.637																																						ENST00000409816.2	1.000000	0.200000	0.910000	0.370000	0.600000	0.626412	0.600000	1.000000																										0				75						c.(2266-2268)gaG>gaA		myosin VIIB							44.0	49.0	48.0					2																	128354060		1964	4165	6129	SO:0001819	synonymous_variant	4648	0	0					g.chr2:128354060G>A		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2268G>A	chr2.hg19:g.128354060G>A		0					MYO7B_ENST00000428314.1_Silent_p.E756E|MYO7B_ENST00000389524.4_Silent_p.E756E	p.E756E			1	2	3	1.927264	Q6PIF6	MYO7B_HUMAN		18	2300	+	Colorectal(110;0.1)		Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	0	1	hg19	c.2268G>A	CCDS46405.1	0																																																																																								0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.637	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	3.450000	-7.555060	1	0.190000	XM_291001		0	4	4	0	80	75	0		1	0		0	0	50	0	0	0.877059	4.009623e-03	0	1	0	1	0	4	80
KCNK3	3777	broad.mit.edu	37	2	26950912	26950912	+	Missense_Mutation	SNP	G	G	A	rs398123041		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr2:26950912G>A	ENST00000302909.3	+	2	786	c.661G>A	c.(661-663)Gtg>Atg	p.V221M		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	221			V -> L (in PPH4; loss of function). {ECO:0000269|PubMed:23883380}.		brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	GCCGCAGTACGTGGCCTTCAG	0.617																																					GBM(80;1457 1631 27100 45946)	ENST00000302909.3	1.000000	0.930000	1.000000	0.990000	0.990000	0.995873	0.990000	1.000000																										0				14						c.(661-663)Gtg>Atg		potassium channel, subfamily K, member 3	Doxapram(DB00561)|Halothane(DB01159)						85.0	66.0	73.0					2																	26950912		2203	4300	6503	SO:0001583	missense	3777	0	0					g.chr2:26950912G>A	AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.661G>A	chr2.hg19:g.26950912G>A	ENSP00000306275:p.Val221Met	0						p.V221M	NM_002246.2	NP_002237.1	1	2	3	1.927760	O14649	KCNK3_HUMAN		2	786	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	1	1	hg19	c.661G>A	CCDS1727.1	1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236658	0.79800	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.28895	1.59	4.72	4.72	0.59763	4.72	4.72	0.59763	Ion transport 2 (1);	0.206931	0.40818	N	0.001017	T	0.52092	0.1713	L	0.59967	1.855	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.55471	-0.8136	10	0.87932	D	0	.	15.5289	0.75936	0.0:0.0:1.0:0.0	.	221	O14649	KCNK3_HUMAN	M	98;221	ENSP00000306275:V221M	ENSP00000306275:V221M	V	+	1	0	0	KCNK3	26804416	26804416	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.638000	0.98445	2.303000	0.77524	0.556000	0.70494	GTG	0.258988		TCGA-F2-A7TX-01A-33D-A38G-08	0.617	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	3.450000	-20.000000	1	0.190000	NM_002246		0	17	16	0	113	112	1		1	0		0	0	47	0	0	0.999973	8.640744e-01	0	0	0	26	0	17	113
PLEKHH2	130271	broad.mit.edu	37	2	43958705	43958705	+	Silent	SNP	C	C	T	rs371260816		TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr2:43958705C>T	ENST00000282406.4	+	19	3017	c.2907C>T	c.(2905-2907)tcC>tcT	p.S969S		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	969	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTCTACCTTCCGAAGCCCTGC	0.328																																						ENST00000282406.4	1.000000	0.640000	1.000000	0.780000	0.940000	0.907093	0.940000	1.000000																										0				56						c.(2905-2907)tcC>tcT		pleckstrin homology domain containing, family H (with MyTH4 domain) member 2		C		1,4405	2.1+/-5.4	0,1,2202	84.0	84.0	84.0		2907	-10.6	0.7	2		84	0,8600		0,0,4300	no	coding-synonymous	PLEKHH2	NM_172069.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		969/1494	43958705	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	130271	1	121412	35				g.chr2:43958705C>T	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2907C>T	chr2.hg19:g.43958705C>T		0						p.S969S	NM_172069.3	NP_742066.2	1	2	3	1.927760	Q8IVE3	PKHH2_HUMAN		19	3017	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	ENST00000282406.4	1	1	hg19	c.2907C>T	CCDS1812.1	1																																																																																								0.258988		TCGA-F2-A7TX-01A-33D-A38G-08	0.328	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	1	0	1	2	2	2	2	0	0	0	0	146	146	146	145	1	3.450000	-2.402338	0	0.190000	NM_172069		0	27	27	0	305	295	0		1	0		0	0	146	0	0	1.000000	6.015676e-02	0	1	0	4	0	27	305
STK16	8576	broad.mit.edu	37	2	220113194	220113194	+	Silent	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr2:220113194G>A	ENST00000409638.3	+	8	1003	c.831G>A	c.(829-831)ccG>ccA	p.P277P	GLB1L_ENST00000392089.2_5'Flank|GLB1L_ENST00000295759.7_5'Flank|STK16_ENST00000409516.3_Silent_p.P159P|STK16_ENST00000409260.1_Silent_p.P322P|STK16_ENST00000409743.1_Silent_p.P245P|STK16_ENST00000396738.2_Silent_p.P277P|TUBA4A_ENST00000498660.1_5'Flank	NM_001008910.2	NP_001008910.1	O75716	STK16_HUMAN	serine/threonine kinase 16	277	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in dbSNP:rs35454203). {ECO:0000269|PubMed:17344846}.		cellular response to transforming growth factor beta stimulus (GO:0071560)|protein autophosphorylation (GO:0046777)	Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCGTGGACCCGCATCAGCGTC	0.567																																					Pancreas(34;887 922 17165 36961 39622)	ENST00000409638.3	0.290000	0.040000	0.220000	0.080000	0.140000	0.156156	0.140000	0.130000																										0				1						c.(829-831)ccG>ccA		serine/threonine kinase 16							106.0	113.0	111.0					2																	220113194		2073	4207	6280	SO:0001819	synonymous_variant	8576	0	0					g.chr2:220113194G>A	AF060798	CCDS42822.1	2q35	2010-04-16			ENSG00000115661	ENSG00000115661			11394	protein-coding gene	gene with protein product		604719				9712705	Standard	NM_001008910		Approved	PKL12, MPSK	uc002vko.2	O75716	OTTHUMG00000154520	ENST00000409638.3:c.831G>A	chr2.hg19:g.220113194G>A		0					STK16_ENST00000409260.1_Silent_p.P322P|STK16_ENST00000396738.2_Silent_p.P277P|STK16_ENST00000409516.3_Silent_p.P159P|GLB1L_ENST00000295759.7_5'Flank|STK16_ENST00000409743.1_Silent_p.P245P|GLB1L_ENST00000392089.2_5'Flank|TUBA4A_ENST00000498660.1_5'Flank	p.P277P	NM_001008910.2	NP_001008910.1	1	2	3	1.948827	O75716	STK16_HUMAN		8	1003	+		Renal(207;0.0474)	A8K9H9|Q5U0F8|Q96KI2|Q9BUH4|Q9UEN3|Q9UP78	Silent	SNP	ENST00000409638.3	0	1	hg19	c.831G>A	CCDS42822.1	0																																																																																								0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.567	STK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335679.1	0	0	1	2	2	2	2	0	0	0	0	154	154	154	154	1	3.450000	-1.934586	0	0.190000			0	5	5	0	433	425	0		1	0		0	0	154	0	0	0.934819	4.805670e-01	0	0	0	124	0	5	433
TXK	7294	broad.mit.edu	37	4	48114421	48114421	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr4:48114421G>A	ENST00000264316.4	-	4	368	c.283C>T	c.(283-285)Ccc>Tcc	p.P95S	TXK_ENST00000510457.1_5'UTR|RNU6-868P_ENST00000517241.1_RNA	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	95	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						GGTTCTCTGGGCAGAAAATCA	0.502																																						ENST00000264316.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				25						c.(283-285)Ccc>Tcc		TXK tyrosine kinase							167.0	171.0	170.0					4																	48114421		2203	4300	6503	SO:0001583	missense	7294	0	0					g.chr4:48114421G>A	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.283C>T	chr4.hg19:g.48114421G>A	ENSP00000264316:p.Pro95Ser	0					TXK_ENST00000510457.1_5'UTR|RNU6-868P_ENST00000517241.1_RNA	p.P95S	NM_003328.2	NP_003319.2	1	2	3	1.960368	P42681	TXK_HUMAN		4	368	-			Q14220	Missense_Mutation	SNP	ENST00000264316.4	1	1	hg19	c.283C>T	CCDS3480.1	1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.813681	0.70912	.	.	ENSG00000074966	ENST00000264316;ENST00000506073	T;T	0.48201	0.82;0.82	5.12	5.12	0.69794	5.12	5.12	0.69794	Src homology-3 domain (4);	0.083055	0.47852	D	0.000215	T	0.59101	0.2169	L	0.55743	1.74	0.80722	D	1	P;P	0.52692	0.955;0.952	P;P	0.60541	0.876;0.685	T	0.52917	-0.8511	10	0.31617	T	0.26	.	13.9414	0.64057	0.0:0.0:1.0:0.0	.	95;95	E7EQN8;P42681	.;TXK_HUMAN	S	95	ENSP00000264316:P95S;ENSP00000422798:P95S	ENSP00000264316:P95S	P	-	1	0	0	TXK	47809178	47809178	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	2.572000	0.45999	2.681000	0.91329	0.563000	0.77884	CCC	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.502	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	1	0	1	2	2	2	2	0	0	0	0	225	225	225	224	1	3.450000	-20.000000	1	0.190000	NM_003328		0	81	81	0	448	443	1		1	0		0	0	225	0	0	1.000000	0	0	0	0	1	0	81	448
NUDT6	11162	broad.mit.edu	37	4	123843664	123843664	+	Missense_Mutation	SNP	G	G	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr4:123843664G>T	ENST00000304430.5	-	1	97	c.64C>A	c.(64-66)Cct>Act	p.P22T	SPATA5_ENST00000274008.4_5'Flank|NUDT6_ENST00000339154.2_Intron	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	22						mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)			endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						CCCGCCGAAGGCCCGGGGCCG	0.682																																						ENST00000304430.5	1.000000	0.850000	1.000000	0.990000	0.990000	0.991082	0.990000	1.000000																										0				6						c.(64-66)Cct>Act		nudix (nucleoside diphosphate linked moiety X)-type motif 6							14.0	18.0	17.0					4																	123843664		1883	4051	5934	SO:0001583	missense	11162	0	0					g.chr4:123843664G>T	AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.64C>A	chr4.hg19:g.123843664G>T	ENSP00000306070:p.Pro22Thr	0					SPATA5_ENST00000274008.4_5'Flank|NUDT6_ENST00000339154.2_Intron	p.P22T	NM_007083.4	NP_009014.2	1	2	3	1.960368	P53370	NUDT6_HUMAN		1	97	-			A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	ENST00000304430.5	1	1	hg19	c.64C>A	CCDS43268.1	1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689167	0.29962	.	.	ENSG00000170917	ENST00000304430	T	0.21543	2.0	3.97	0.0578	0.14325	3.97	0.0578	0.14325	.	1.142310	0.06669	N	0.765837	T	0.09598	0.0236	N	0.08118	0	0.09310	N	0.999995	B	0.11235	0.004	B	0.09377	0.004	T	0.36212	-0.9757	10	0.23891	T	0.37	-1.8931	4.3631	0.11211	0.3094:0.1653:0.5254:0.0	.	22	P53370	NUDT6_HUMAN	T	22	ENSP00000306070:P22T	ENSP00000306070:P22T	P	-	1	0	0	NUDT6	124063114	124063114	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.055000	0.11807	-0.141000	0.11374	-0.467000	0.05162	CCT	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.682	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095331.3	0	0	1	2	12	2	2	1	1	1	1	30	30	30	29	1	3.450000	-19.993370	1	0.190000	NM_007083		0	13	12	0	89	85	1		1	0		1	0	30	0	0	0.604563	9.354611e-02	0	0	0	4	0	13	89
DNAH5	1767	broad.mit.edu	37	5	13811871	13811871	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr5:13811871G>A	ENST00000265104.4	-	44	7396	c.7292C>T	c.(7291-7293)tCt>tTt	p.S2431F		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2431	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTCTGGGAAAGACTCGGTGTA	0.428									Kartagener syndrome																													ENST00000265104.4	1.000000	0.800000	1.000000	0.960000	0.990000	0.980079	0.990000	1.000000																										0				378						c.(7291-7293)tCt>tTt		dynein, axonemal, heavy chain 5							92.0	89.0	90.0					5																	13811871		2203	4300	6503	SO:0001583	missense	1767	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr5:13811871G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7292C>T	chr5.hg19:g.13811871G>A	ENSP00000265104:p.Ser2431Phe	0						p.S2431F	NM_001369.2	NP_001360.1	2	2	4	2.072376	Q8TE73	DYH5_HUMAN		44	7396	-	Lung NSC(4;0.00476)		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	1	1	hg19	c.7292C>T	CCDS3882.1	1	.	.	.	.	.	.	.	.	.	.	G	4.470	0.087128	0.08583	.	.	ENSG00000039139	ENST00000265104	T	0.22945	1.93	5.78	4.9	0.64082	5.78	4.9	0.64082	.	0.168536	0.53938	D	0.000044	T	0.30885	0.0779	M	0.74647	2.275	0.58432	D	0.999996	B	0.06786	0.001	B	0.11329	0.006	T	0.12604	-1.0541	10	0.16896	T	0.51	.	16.0245	0.80532	0.0:0.0:0.8645:0.1355	.	2431	Q8TE73	DYH5_HUMAN	F	2431	ENSP00000265104:S2431F	ENSP00000265104:S2431F	S	-	2	0	0	DNAH5	13864871	13864871	1.000000	0.71417	0.799000	0.32177	0.128000	0.20619	7.880000	0.87243	1.403000	0.46800	0.650000	0.86243	TCT	0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.428	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	1	0	1	2	2	2	2	0	0	0	0	154	154	154	153	1	3.450000	-20.000000	1	0.190000	NM_001369		0	34	33	0	342	340	0		1	0		0	0	154	0	0	1.000000	0	0	0	0	1	0	34	342
SLC1A3	6507	broad.mit.edu	37	5	36608640	36608640	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr5:36608640G>A	ENST00000265113.4	+	2	591	c.115G>A	c.(115-117)Gag>Aag	p.E39K	SLC1A3_ENST00000506725.1_3'UTR|SLC1A3_ENST00000381918.3_Missense_Mutation_p.E39K	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	39					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATTACAAAGGAGGATGTTAA	0.453																																						ENST00000265113.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				41						c.(115-117)Gag>Aag		solute carrier family 1 (glial high affinity glutamate transporter), member 3							185.0	185.0	185.0					5																	36608640		2203	4300	6503	SO:0001583	missense	6507	0	0					g.chr5:36608640G>A		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.115G>A	chr5.hg19:g.36608640G>A	ENSP00000265113:p.Glu39Lys	0					SLC1A3_ENST00000506725.1_3'UTR|SLC1A3_ENST00000381918.3_Missense_Mutation_p.E39K	p.E39K	NM_004172.4	NP_004163.3	2	2	4	2.072376	P43003	EAA1_HUMAN	Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	2	591	+	all_lung(31;0.000245)		B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	1	1	hg19	c.115G>A	CCDS3919.1	1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517899	0.64634	.	.	ENSG00000079215	ENST00000265113;ENST00000513903;ENST00000427100;ENST00000416645;ENST00000505202;ENST00000513646;ENST00000381918	T;T;T;T;T	0.55588	0.51;1.91;1.91;1.91;0.51	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.244001	0.42548	D	0.000695	T	0.35711	0.0941	N	0.08118	0	0.39293	D	0.964762	B;B	0.12013	0.002;0.005	B;B	0.11329	0.003;0.006	T	0.19745	-1.0296	10	0.18710	T	0.47	-22.2818	19.812	0.96551	0.0:0.0:1.0:0.0	.	39;39	Q4JCQ8;P43003	.;EAA1_HUMAN	K	39	ENSP00000265113:E39K;ENSP00000427203:E39K;ENSP00000424986:E39K;ENSP00000420992:E39K;ENSP00000371343:E39K	ENSP00000265113:E39K	E	+	1	0	0	SLC1A3	36644397	36644397	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.777000	0.68931	2.685000	0.91497	0.655000	0.94253	GAG	0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.453	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	1	0	1	2	2	2	2	0	0	0	0	317	317	317	317	1	3.450000	-20.000000	1	0.190000	NM_004172		0	123	120	0	686	670	1		1	1		0	0	317	0	0	1.000000	9.640867e-01	0	6	0	26	0	123	686
ZNF366	167465	broad.mit.edu	37	5	71739855	71739855	+	Missense_Mutation	SNP	C	C	T	rs112462947	byFrequency	TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr5:71739855C>T	ENST00000318442.5	-	5	2453	c.1963G>A	c.(1963-1965)Gcc>Acc	p.A655T	RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	655	Interaction with CTBP1.|Interaction with NRIP1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		ACCTCGGGGGCGTGCTCCGAC	0.642																																						ENST00000318442.5	1.000000	0.100000	0.290000	0.150000	0.210000	0.243308	0.210000	0.200000																										0				35						c.(1963-1965)Gcc>Acc		zinc finger protein 366		C	THR/ALA	3,4403	8.1+/-20.4	0,3,2200	139.0	144.0	142.0		1963	4.1	0.0	5	dbSNP_132	142	0,8600		0,0,4300	no	missense	ZNF366	NM_152625.1	58	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	655/745	71739855	3,13003	2203	4300	6503	SO:0001583	missense	167465	20	121412	49				g.chr5:71739855C>T	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.1963G>A	chr5.hg19:g.71739855C>T	ENSP00000313158:p.Ala655Thr	0					RP11-389C8.2_ENST00000564956.1_RNA	p.A655T	NM_152625.1	NP_689838.1	2	2	4	2.072376	Q8N895	ZN366_HUMAN		5	2453	-		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	0	1	hg19	c.1963G>A	CCDS4015.1	0	.	.	.	.	.	.	.	.	.	.	C	12.46	1.943458	0.34283	6.81E-4	0.0	ENSG00000178175	ENST00000318442	T	0.08546	3.08	5.87	4.08	0.47627	5.87	4.08	0.47627	.	1.645490	0.02889	N	0.133862	T	0.04679	0.0127	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.38329	-0.9666	10	0.15499	T	0.54	-1.5779	7.1067	0.25368	0.0:0.6577:0.1261:0.2163	.	655	Q8N895	ZN366_HUMAN	T	655	ENSP00000313158:A655T	ENSP00000313158:A655T	A	-	1	0	0	ZNF366	71775611	71775611	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	0.255000	0.18333	0.919000	0.36945	0.655000	0.94253	GCC	0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.642	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3	0	0	1	2	2	2	2	0	0	0	0	239	239	239	236	1	3.450000	-2.814858	1	0.190000			0	11	10	0	661	638	0		1	0		0	0	239	0	0	0.997980	3.408704e-04	0	0	0	2	0	11	661
PCDHGA2	56113	broad.mit.edu	37	5	140720414	140720414	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr5:140720414G>A	ENST00000394576.2	+	1	1876	c.1876G>A	c.(1876-1878)Gtg>Atg	p.V626M	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	626	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V626L(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGGGCGAGGTGCGCACGGC	0.687																																						ENST00000394576.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										2	Substitution - Missense(2)	p.V626L(2)	lung(2)	77						c.(1876-1878)Gtg>Atg		protocadherin gamma subfamily A, 2							35.0	42.0	40.0					5																	140720414		2194	4286	6480	SO:0001583	missense	56113	0	0					g.chr5:140720414G>A	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1876G>A	chr5.hg19:g.140720414G>A	ENSP00000378077:p.Val626Met	0					PCDHGA1_ENST00000517417.1_Intron	p.V626M	NM_018915.2	NP_061738.1	2	2	4	2.072376	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1876	+			Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	1	1	hg19	c.1876G>A	CCDS47289.1	1	.	.	.	.	.	.	.	.	.	.	.	12.96	2.094710	0.36952	.	.	ENSG00000081853	ENST00000394576	T	0.55930	0.49	5.14	2.93	0.34026	5.14	2.93	0.34026	Cadherin (4);Cadherin-like (1);	0.553780	0.13797	U	0.362080	T	0.64724	0.2624	M	0.65677	2.01	0.25520	N	0.987372	D;D	0.76494	0.99;0.999	D;D	0.72338	0.923;0.977	T	0.52578	-0.8557	10	0.87932	D	0	.	4.7999	0.13292	0.2293:0.1939:0.5767:0.0	.	626;626	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	M	626	ENSP00000378077:V626M	ENSP00000378077:V626M	V	+	1	0	0	PCDHGA2	140700598	140700598	1.000000	0.71417	0.998000	0.56505	0.098000	0.18820	2.136000	0.42121	1.315000	0.45114	0.485000	0.47835	GTG	0.314953		TCGA-F2-A7TX-01A-33D-A38G-08	0.687	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	1	0	1	2	2	2	2	0	0	0	0	202	202	202	223	1	3.450000	-20.000000	1	0.190000	NM_018915		0	83	65	0	385	314	0		1			0	0	202	0	0	1.000000	0	0	0	0	0	0	83	385
UBR2	23304	broad.mit.edu	37	6	42620364	42620364	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr6:42620364C>T	ENST00000372899.1	+	25	3008	c.2750C>T	c.(2749-2751)tCa>tTa	p.S917L	UBR2_ENST00000372883.3_Missense_Mutation_p.S421L|UBR2_ENST00000372901.1_Missense_Mutation_p.S917L	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	917					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TATGCCTGGTCAGAGTCCATG	0.373																																						ENST00000372899.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				64						c.(2749-2751)tCa>tTa		ubiquitin protein ligase E3 component n-recognin 2							146.0	131.0	136.0					6																	42620364		2203	4300	6503	SO:0001583	missense	23304	1	121412	28				g.chr6:42620364C>T	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2750C>T	chr6.hg19:g.42620364C>T	ENSP00000361990:p.Ser917Leu	1					UBR2_ENST00000372901.1_Missense_Mutation_p.S917L|UBR2_ENST00000372883.3_Missense_Mutation_p.S421L	p.S917L	NM_015255.2	NP_056070.1	0	3	3	1.924341	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)	25	3008	+	Colorectal(47;0.196)		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	1	1	hg19	c.2750C>T	CCDS4870.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751128	0.89753	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.58797	0.31;0.31;0.31	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.061971	0.64402	D	0.000002	T	0.66886	0.2835	M	0.73962	2.25	0.80722	D	1	P;D	0.62365	0.95;0.991	P;P	0.56127	0.487;0.792	T	0.68284	-0.5449	10	0.49607	T	0.09	-15.9844	19.4267	0.94743	0.0:1.0:0.0:0.0	.	917;917	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	L	917;917;421	ENSP00000361990:S917L;ENSP00000361992:S917L;ENSP00000361974:S421L	ENSP00000361974:S421L	S	+	2	0	0	UBR2	42728342	42728342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.084000	0.76866	2.582000	0.87167	0.655000	0.94253	TCA	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.373	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	1	0	1	2	2	2	2	0	0	0	0	201	201	201	200	1	3.450000	-7.758702	1	0.190000	NM_015255		0	125	122	0	324	317	1		1	1		0	0	201	0	0	1.000000	9.999018e-01	0	20	0	18	0	125	324
SYNE1	23345	broad.mit.edu	37	6	152527344	152527344	+	Missense_Mutation	SNP	G	G	A	rs202017153	byFrequency	TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr6:152527344G>A	ENST00000367255.5	-	126	23579	c.22978C>T	c.(22978-22980)Cgg>Tgg	p.R7660W	SYNE1_ENST00000265368.4_Missense_Mutation_p.R7660W|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2184W|SYNE1_ENST00000341594.5_Missense_Mutation_p.R7272W|SYNE1_ENST00000423061.1_Missense_Mutation_p.R7589W|SYNE1_ENST00000448038.1_Missense_Mutation_p.R7589W	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7660					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTCCAGCCGCATGCTGGCT	0.478										HNSCC(10;0.0054)			G|||	2	0.000399361	0.0	0.0	5008	,	,		17907	0.002		0.0	False		,,,				2504	0.0					ENST00000367255.5	0.420000	0.080000	0.320000	0.140000	0.210000	0.233948	0.210000	0.210000																										0				524						c.(22978-22980)Cgg>Tgg		spectrin repeat containing, nuclear envelope 1							75.0	73.0	74.0					6																	152527344		2203	4300	6503	SO:0001583	missense	23345	9	121410	40				g.chr6:152527344G>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.22978C>T	chr6.hg19:g.152527344G>A	ENSP00000356224:p.Arg7660Trp	1	HNSCC(10;0.0054)				SYNE1_ENST00000341594.5_Missense_Mutation_p.R7272W|SYNE1_ENST00000265368.4_Missense_Mutation_p.R7660W|SYNE1_ENST00000448038.1_Missense_Mutation_p.R7589W|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2184W|SYNE1_ENST00000423061.1_Missense_Mutation_p.R7589W	p.R7660W	NM_182961.3	NP_892006.3	0	3	3	1.924341	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	126	23579	-		Ovarian(120;0.0955)	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	0	1	hg19	c.22978C>T	CCDS5236.2	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.46	1.645098	0.29246	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.51	-2.62	0.06152	5.51	-2.62	0.06152	.	0.910031	0.09366	N	0.811992	T	0.25232	0.0613	L	0.57536	1.79	0.09310	N	1	D;D;D;D	0.67145	0.994;0.994;0.996;0.994	P;P;P;P	0.55824	0.487;0.487;0.785;0.614	T	0.10337	-1.0634	10	0.59425	D	0.04	.	4.8395	0.13483	0.3197:0.0:0.3036:0.3767	.	7660;7660;7589;7589	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	W	7660;306;7589;7660;7589;7272;2184;582	ENSP00000356224:R7660W;ENSP00000356226:R306W;ENSP00000396024:R7589W;ENSP00000265368:R7660W;ENSP00000390975:R7589W;ENSP00000341887:R7272W;ENSP00000349276:R2184W;ENSP00000356220:R582W	ENSP00000265368:R7660W	R	-	1	2	2	SYNE1	152569037	152569037	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	0.089000	0.15002	-0.469000	0.06911	-0.293000	0.09583	CGG	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	0	0	1	2	2	2	2	0	0	0	0	137	137	137	136	1	3.450000	-2.642126	1	0.190000	NM_182961		0	6	6	0	334	329	0		1	0		0	0	137	0	0	0.963693	7.268970e-02	0	0	0	21	0	6	334
CYP2W1	54905	broad.mit.edu	37	7	1026862	1026862	+	Silent	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr7:1026862C>T	ENST00000308919.7	+	6	952	c.939C>T	c.(937-939)ggC>ggT	p.G313G	CYP2W1_ENST00000340150.6_Silent_p.G257G	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	313					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		TTCTGATGGGCCGGCACCCGG	0.716																																						ENST00000308919.7	1.000000	0.610000	1.000000	0.990000	0.990000	0.973268	0.990000	1.000000																										0				7						c.(937-939)ggC>ggT		cytochrome P450, family 2, subfamily W, polypeptide 1							9.0	11.0	11.0					7																	1026862		2104	4141	6245	SO:0001819	synonymous_variant	54905	0	0					g.chr7:1026862C>T	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.939C>T	chr7.hg19:g.1026862C>T		0					CYP2W1_ENST00000340150.6_Silent_p.G257G	p.G313G	NM_017781.2	NP_060251.2	2	2	4	2.085861	Q8TAV3	CP2W1_HUMAN		6	952	+		Ovarian(82;0.0112)		Silent	SNP	ENST00000308919.7	0	1	hg19	c.939C>T	CCDS5319.2	1																																																																																								0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.716	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	0	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	3.450000	-10.317190	1	0.190000	NM_017781		0	3	3	0	17	16	0		1	0		0	0	8	0	0	0.796258	8.283302e-01	0	0	0	21	0	3	17
DNAH11	8701	broad.mit.edu	37	7	21611423	21611423	+	Splice_Site	SNP	G	G	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr7:21611423G>T	ENST00000409508.3	+	8	1456		c.e8-1		DNAH11_ENST00000328843.6_Splice_Site	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTTTTACAAAGGATATATTTG	0.338									Kartagener syndrome																													ENST00000409508.3	1.000000	0.290000	0.920000	0.450000	0.660000	0.678463	0.660000	1.000000																										0				230						c.e8-1		dynein, axonemal, heavy chain 11							71.0	65.0	67.0					7																	21611423		1795	4066	5861	SO:0001630	splice_region_variant	8701	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21611423G>T	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.1426-1G>T	chr7.hg19:g.21611423G>T		0					DNAH11_ENST00000328843.6_Splice_Site		NM_001277115.1	NP_001264044.1	2	2	4	2.085861	Q96DT5	DYH11_HUMAN		8	1456	+			Q9UJ82	Splice_Site	SNP	ENST00000409508.3	0	1	hg19			0	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980317	0.53827	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.86	4.99	0.66335	5.86	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9369	0.64029	0.074:0.0:0.926:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	DNAH11	21577948	21577948	1.000000	0.71417	0.983000	0.44433	0.577000	0.36160	5.384000	0.66225	1.489000	0.48450	0.650000	0.86243	.	0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.338	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	3.450000	-2.907756	1	0.190000	NM_003777	Intron	0	7	7	0	133	131	0		1			0	0	56	0	0	0.980483	0	0	0	0	0	0	7	133
ASZ1	136991	broad.mit.edu	37	7	117008694	117008694	+	Missense_Mutation	SNP	A	A	G			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr7:117008694A>G	ENST00000284629.2	-	11	1195	c.1133T>C	c.(1132-1134)aTt>aCt	p.I378T		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			TAACTCAGTAATAACATTCTG	0.308																																						ENST00000284629.2	0.240000	0.030000	0.180000	0.060000	0.110000	0.125380	0.110000	0.120000																										0				24						c.(1132-1134)aTt>aCt		ankyrin repeat, SAM and basic leucine zipper domain containing 1							99.0	107.0	104.0					7																	117008694		2202	4292	6494	SO:0001583	missense	136991	0	0					g.chr7:117008694A>G	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.1133T>C	chr7.hg19:g.117008694A>G	ENSP00000284629:p.Ile378Thr	0						p.I378T	NM_130768.2	NP_570124.1	2	2	4	2.083015			STAD - Stomach adenocarcinoma(10;0.000512)	11	1195	-	Lung NSC(10;0.00156)|all_lung(10;0.00175)			Missense_Mutation	SNP	ENST00000284629.2	0	1	hg19	c.1133T>C	CCDS5772.1	0	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166072	0.57476	.	.	ENSG00000154438	ENST00000284629	T	0.29917	1.55	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.287809	0.37437	N	0.002082	T	0.39009	0.1062	L	0.56769	1.78	0.35036	D	0.759246	D;D	0.58970	0.984;0.984	P;P	0.53360	0.724;0.724	T	0.50833	-0.8781	10	0.29301	T	0.29	-0.4577	9.8129	0.40835	0.745:0.0:0.0:0.255	.	378;378	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	T	378	ENSP00000284629:I378T	ENSP00000284629:I378T	I	-	2	0	0	ASZ1	116795930	116795930	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	2.628000	0.46477	2.102000	0.63906	0.459000	0.35465	ATT	0.319328		TCGA-F2-A7TX-01A-33D-A38G-08	0.308	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	0	0	0	2	2	2	2	0	0	0	0	239	239	239	237	1	3.450000	-4.541776	1	0.190000	NM_130768		0	5	5	0	590	580	0		1			0	0	239	0	0	0.934956	0	0	0	0	0	0	5	590
FAM135B	51059	broad.mit.edu	37	8	139209792	139209792	+	Missense_Mutation	SNP	G	G	A			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr8:139209792G>A	ENST00000395297.1	-	8	960	c.790C>T	c.(790-792)Cgg>Tgg	p.R264W		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	264										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGGATGTCCCGCATGATCACC	0.622										HNSCC(54;0.14)																												ENST00000395297.1	0.540000	0.070000	0.390000	0.150000	0.250000	0.276679	0.250000	0.240000																										0				238						c.(790-792)Cgg>Tgg		family with sequence similarity 135, member B							57.0	65.0	62.0					8																	139209792		2139	4258	6397	SO:0001583	missense	51059	3	121146	33				g.chr8:139209792G>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.790C>T	chr8.hg19:g.139209792G>A	ENSP00000378710:p.Arg264Trp	1	HNSCC(54;0.14)					p.R264W	NM_015912.3	NP_056996.2	3	3	6	2.460283	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)	8	960	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	0	1	hg19	c.790C>T	CCDS6375.2	0	.	.	.	.	.	.	.	.	.	.	G	17.23	3.335664	0.60853	.	.	ENSG00000147724	ENST00000395297	T	0.79554	-1.28	4.74	0.945	0.19543	4.74	0.945	0.19543	.	0.242007	0.40818	N	0.001010	T	0.73552	0.3601	L	0.44542	1.39	0.34180	D	0.670854	D	0.61697	0.99	P	0.44477	0.451	T	0.78529	-0.2169	10	0.72032	D	0.01	-13.6729	11.2554	0.49050	0.0:0.0:0.6066:0.3934	.	264	Q49AJ0	F135B_HUMAN	W	264	ENSP00000378710:R264W	ENSP00000276737:R264W	R	-	1	2	2	FAM135B	139278974	139278974	0.999000	0.42202	0.998000	0.56505	0.628000	0.37860	0.437000	0.21543	0.002000	0.14630	-0.309000	0.09137	CGG	0.413043		TCGA-F2-A7TX-01A-33D-A38G-08	0.622	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	0	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	3.450000	-3.010639	1	0.190000	NM_015912		0	4	4	0	255	252	0		1			0	0	92	0	0	0.888331	0	0	0	0	0	0	4	255
FAM135B	51059	broad.mit.edu	37	8	139380170	139380170	+	Missense_Mutation	SNP	A	A	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr8:139380170A>T	ENST00000395297.1	-	2	227	c.57T>A	c.(55-57)aaT>aaA	p.N19K		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	19										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGAGATCCACATTATAAAATT	0.378										HNSCC(54;0.14)																												ENST00000395297.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				238						c.(55-57)aaT>aaA		family with sequence similarity 135, member B							139.0	132.0	134.0					8																	139380170		1862	4104	5966	SO:0001583	missense	51059	0	0					g.chr8:139380170A>T	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.57T>A	chr8.hg19:g.139380170A>T	ENSP00000378710:p.Asn19Lys	1	HNSCC(54;0.14)					p.N19K	NM_015912.3	NP_056996.2	3	3	6	2.460283	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)	2	227	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	1	1	hg19	c.57T>A	CCDS6375.2	1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982567	0.74474	.	.	ENSG00000147724	ENST00000395297;ENST00000160713;ENST00000520380	T	0.49720	0.77	5.54	1.82	0.25136	5.54	1.82	0.25136	.	0.000000	0.56097	U	0.000024	T	0.58424	0.2121	M	0.83774	2.66	0.43683	D	0.996128	D	0.59767	0.986	P	0.53266	0.722	T	0.62081	-0.6929	10	0.87932	D	0	-4.8353	8.7599	0.34667	0.7748:0.0:0.2252:0.0	.	19	Q49AJ0	F135B_HUMAN	K	19	ENSP00000378710:N19K	ENSP00000160713:N19K	N	-	3	2	2	FAM135B	139449352	139449352	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.914000	0.56401	0.460000	0.27045	0.459000	0.35465	AAT	0.413043		TCGA-F2-A7TX-01A-33D-A38G-08	0.378	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	1	0	1	2	2	2	2	0	0	0	0	138	138	138	135	1	3.450000	-20.000000	1	0.190000	NM_015912		0	70	68	0	358	343	1		1			0	0	138	0	0	1.000000	0	0	0	0	0	0	70	358
OR13C2	392376	broad.mit.edu	37	9	107367884	107367884	+	Missense_Mutation	SNP	G	G	C			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr9:107367884G>C	ENST00000542196.1	-	1	67	c.25C>G	c.(25-27)Ctg>Gtg	p.L9V		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L9V(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AATTCCACCAGAATGGTGTGG	0.373																																						ENST00000542196.1	1.000000	0.450000	0.880000	0.570000	0.710000	0.731514	0.710000	1.000000																										1	Substitution - Missense(1)	p.L9V(1)	cervix(1)	22						c.(25-27)Ctg>Gtg		olfactory receptor, family 13, subfamily C, member 2							47.0	52.0	50.0					9																	107367884		2195	4299	6494	SO:0001583	missense	392376	0	0					g.chr9:107367884G>C		CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.25C>G	chr9.hg19:g.107367884G>C	ENSP00000438815:p.Leu9Val	1						p.L9V	NM_001004481.1	NP_001004481.1	0	3	3	1.925915	Q8NGS9	O13C2_HUMAN		1	67	-			B9EGV8|Q6IF54	Missense_Mutation	SNP	ENST00000542196.1	1	1	hg19	c.25C>G	CCDS35092.1	0	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.111042	0.00353	.	.	ENSG00000257019	ENST00000542196	T	0.00299	8.22	3.39	-1.19	0.09585	3.39	-1.19	0.09585	.	0.313759	0.16689	U	0.203629	T	0.00039	0.0001	N	0.00081	-2.22	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47114	-0.9142	10	0.02654	T	1	.	0.7009	0.00908	0.3362:0.1654:0.331:0.1674	.	9	Q8NGS9	O13C2_HUMAN	V	9	ENSP00000438815:L9V	ENSP00000438815:L9V	L	-	1	2	2	OR13C2	106407705	106407705	0.000000	0.05858	0.093000	0.20910	0.892000	0.51952	-2.895000	0.00707	-0.123000	0.11745	-0.379000	0.06801	CTG	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.373	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	1	0	1	2	2	2	2	0	0	0	0	166	166	166	234	1	3.450000	-3.319213	1	0.190000	NM_001004481		0	20	20	0	304	300	0		1			0	0	166	0	0	0.999995	0	0	0	0	0	0	20	304
RXRA	6256	broad.mit.edu	37	9	137328351	137328351	+	Missense_Mutation	SNP	C	C	T			TCGA-F2-A7TX-01A-33D-A38G-08	TCGA-F2-A7TX-10B-01D-A38J-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	04d11793-f998-472a-81df-bca545178c43	d52d53f1-cb19-490a-853c-a8d6f6a5b7aa	g.chr9:137328351C>T	ENST00000481739.1	+	10	1332	c.1280C>T	c.(1279-1281)tCc>tTc	p.S427F	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Missense_Mutation_p.S330F	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	427	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCTCTGCGCTCCATCGGGCTC	0.607																																						ENST00000481739.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				19						c.(1279-1281)tCc>tTc		retinoid X receptor, alpha	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)						132.0	117.0	122.0					9																	137328351		2203	4300	6503	SO:0001583	missense	6256	0	0					g.chr9:137328351C>T	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1280C>T	chr9.hg19:g.137328351C>T	ENSP00000419692:p.Ser427Phe	1					RXRA_ENST00000540193.1_Missense_Mutation_p.S330F|RXRA_ENST00000356384.4_3'UTR	p.S427F	NM_002957.4	NP_002948.1	0	3	3	1.925915	P19793	RXRA_HUMAN		10	1332	+			B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	1	1	hg19	c.1280C>T	CCDS35172.1	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825420	0.90955	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96940	-4.18;-4.18	4.76	4.76	0.60689	4.76	4.76	0.60689	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99744	1.1016	10	0.87932	D	0	.	17.7817	0.88526	0.0:1.0:0.0:0.0	.	427	P19793	RXRA_HUMAN	F	427;330	ENSP00000419692:S427F;ENSP00000442123:S330F	ENSP00000419692:S427F	S	+	2	0	0	RXRA	136468172	136468172	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.532000	0.81985	2.193000	0.70182	0.591000	0.81541	TCC	0.260274		TCGA-F2-A7TX-01A-33D-A38G-08	0.607	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	1	0	1	2	2	2	2	0	0	0	0	134	134	134	132	1	3.450000	-20.000000	1	0.190000	NM_002957		0	92	91	0	282	272	1		1	1		0	0	134	0	0	1.000000	1	0	47	0	39	0	92	282
