#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
DIP2C	22982	broad.mit.edu	37	10	395301	395301	+	Missense_Mutation	SNP	C	C	T	rs548883145		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr10:395301C>T	ENST00000280886.6	-	25	3166	c.3079G>A	c.(3079-3081)Ggc>Agc	p.G1027S		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1027						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ACGTGGTCGCCGTCCTGAAGG	0.652																																						ENST00000280886.6	1.000000	0.180000	0.760000	0.300000	0.480000	0.527398	0.480000	0.400000																										0				81						c.(3079-3081)Ggc>Agc		DIP2 disco-interacting protein 2 homolog C (Drosophila)							96.0	70.0	79.0					10																	395301		2203	4300	6503	SO:0001583	missense	22982	1	121398	30				g.chr10:395301C>T	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3079G>A	chr10.hg19:g.395301C>T	ENSP00000280886:p.Gly1027Ser	0						p.G1027S	NM_014974.2	NP_055789.1	1	2	3	2.004724	Q9Y2E4	DIP2C_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.136)	25	3166	-		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	0	1	hg19	c.3079G>A	CCDS7054.1	0	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501679	0.85176	.	.	ENSG00000151240	ENST00000280886	T	0.19532	2.14	5.18	5.18	0.71444	5.180000	5.180000	0.714440	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.52451	0.1735	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59606	-0.7423	10	0.87932	D	0	-23.0966	18.7109	0.91656	0.0:1.0:0.0:0.0	.	1027	Q9Y2E4	DIP2C_HUMAN	S	1027	ENSP00000280886:G1027S	ENSP00000280886:G1027S	G	-	1	0	0	DIP2C	385301	385301	1.000000	0.71417	0.421000	0.26609	0.302000	0.27658	7.811000	0.86092	2.409000	0.81822	0.563000	0.77884	GGC	0.135060		TCGA-FB-A4P5-01A-11D-A26I-08	0.652	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	0	0	0	2	2	2	2	0	0	0	0	40	40	40	40	1	2	-6.941940	1	0.130000	NM_014974		0	5	5	0	175	175	0		1	0		0	0	40	0	0	0.938422	1.155322e-02	0	0	0	5	0	5	175
TCN1	6947	broad.mit.edu	37	11	59629067	59629067	+	Silent	SNP	G	G	A	rs185999138	byFrequency	TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr11:59629067G>A	ENST00000257264.3	-	4	593	c.489C>T	c.(487-489)acC>acT	p.T163T	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	163	Globular N-terminal alpha domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAACTTCGGCGGTTGAGTAGT	0.448													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18199	0.001		0.0	False		,,,				2504	0.0					ENST00000257264.3	1.000000	0.170000	0.480000	0.240000	0.330000	0.396079	0.330000	0.310000																										0				29						c.(487-489)acC>acT		transcobalamin I (vitamin B12 binding protein, R binder family)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						120.0	119.0	119.0					11																	59629067		2201	4295	6496	SO:0001819	synonymous_variant	6947	58	121412	51				g.chr11:59629067G>A	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.489C>T	chr11.hg19:g.59629067G>A		0					TCN1_ENST00000532419.1_5'UTR	p.T163T	NM_001062.3	NP_001053.2	1	2	3	2.009813	P20061	TCO1_HUMAN		4	593	-		all_epithelial(135;0.198)	A8KAC5|Q8WV77	Silent	SNP	ENST00000257264.3	0	1	hg19	c.489C>T	CCDS7978.1	0																																																																																								0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.448	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	0	0	1	2	2	2	2	0	0	0	0	72	72	72	69	1	2	-2.406236	0	0.130000	NM_001062		0	12	12	0	577	574	0		1	1		0	0	72	0	0	0.999099	6.595281e-01	0	14	0	93	0	12	577
CCDC87	55231	broad.mit.edu	37	11	66360267	66360267	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr11:66360267C>T	ENST00000333861.3	-	1	287	c.220G>A	c.(220-222)Gga>Aga	p.G74R	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	74					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGAGGCACTCCCGCTGCTATC	0.657											OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000333861.3	1.000000	0.290000	0.900000	0.430000	0.610000	0.646764	0.610000	1.000000																										0				28						c.(220-222)Gga>Aga		coiled-coil domain containing 87							29.0	30.0	30.0					11																	66360267		2200	4293	6493	SO:0001583	missense	55231	0	0					g.chr11:66360267C>T	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.220G>A	chr11.hg19:g.66360267C>T	ENSP00000328487:p.Gly74Arg	0		OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1091	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	p.G74R	NM_018219.2	NP_060689.2	1	2	3	2.009813	Q9NVE4	CCD87_HUMAN		1	287	-			Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	1	1	hg19	c.220G>A	CCDS8145.1	0	.	.	.	.	.	.	.	.	.	.	G	4.935	0.173708	0.09391	.	.	ENSG00000182791	ENST00000333861	T	0.27890	1.64	5.39	2.33	0.28932	5.390000	2.330000	0.289320	.	1.311630	0.05373	N	0.535892	T	0.08492	0.0211	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26950	-1.0088	10	0.11485	T	0.65	-0.9844	8.4993	0.33148	0.0872:0.4903:0.4226:0.0	.	74	Q9NVE4	CCD87_HUMAN	R	74	ENSP00000328487:G74R	ENSP00000328487:G74R	G	-	1	0	0	CCDC87	66116843	66116843	0.004000	0.15560	0.000000	0.03702	0.003000	0.03518	1.494000	0.35616	0.405000	0.25532	-0.120000	0.15030	GGA	0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.657	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2	-3.319084	1	0.130000	NM_018219		0	9	9	0	234	231	0		1			0	0	48	0	0	0.994143	0	0	0	0	0	0	9	234
LRP5	4041	broad.mit.edu	37	11	68115353	68115353	+	Missense_Mutation	SNP	C	C	T	rs371690402		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr11:68115353C>T	ENST00000294304.7	+	2	236	c.130C>T	c.(130-132)Cgg>Tgg	p.R44W		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	44	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCGGGACGTACGGCTGGTGGA	0.647																																						ENST00000294304.7	1.000000	0.280000	0.730000	0.390000	0.520000	0.569099	0.520000	0.490000																										0				63						c.(130-132)Cgg>Tgg		low density lipoprotein receptor-related protein 5		C	TRP/ARG	0,4312		0,0,2156	37.0	39.0	38.0		130	2.2	1.0	11		38	1,8375		0,1,4187	no	missense	LRP5	NM_002335.2	101	0,1,6343	TT,TC,CC		0.0119,0.0,0.0079	probably-damaging	44/1616	68115353	1,12687	2156	4188	6344	SO:0001583	missense	4041	1	121000	27				g.chr11:68115353C>T	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.130C>T	chr11.hg19:g.68115353C>T	ENSP00000294304:p.Arg44Trp	0						p.R44W	NM_002335.2	NP_002326.2	1	2	3	2.009813	O75197	LRP5_HUMAN		2	236	+			Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	1	1	hg19	c.130C>T	CCDS8181.1	0	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342253	0.41498	0.0	1.19E-4	ENSG00000162337	ENST00000294304	D	0.91792	-2.91	4.23	2.22	0.28083	4.230000	2.220000	0.280830	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.38436	U	0.001695	D	0.96513	0.8862	H	0.95079	3.62	0.49483	D	0.999798	D	0.89917	1.0	D	0.97110	1.0	D	0.95702	0.8750	10	0.87932	D	0	.	8.5936	0.33701	0.2119:0.7033:0.0:0.0848	.	44	O75197	LRP5_HUMAN	W	44	ENSP00000294304:R44W	ENSP00000294304:R44W	R	+	1	2	2	LRP5	67871929	67871929	0.948000	0.32251	0.964000	0.40570	0.037000	0.13140	2.186000	0.42593	1.148000	0.42385	-0.215000	0.12644	CGG	0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.647	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	2	-3.703704	1	0.130000	NM_002335		0	13	12	0	390	380	0		1	0		0	0	76	0	0	0.999461	4.665106e-02	0	0	0	10	0	13	390
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.090000	0.850000	0.210000	0.430000	0.498729	0.430000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.009941	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4			hg19	c.35G>A	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1		0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	2	-3.568862	1	0.130000	NM_033360		353	2	2	7668	91	90		1	1	0	1	0	0	15	180	9.999940e-01	0.681391	7.364601e-03	9.683217e-01	1	7	3	341	2	91
CCDC60	160777	broad.mit.edu	37	12	119773039	119773039	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr12:119773039C>T	ENST00000327554.2	+	1	523	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	CCDC60_ENST00000536742.1_Missense_Mutation_p.R20W|CCDC60_ENST00000539847.1_Missense_Mutation_p.R20W|CCDC60_ENST00000546345.1_3'UTR	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	20										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGGGGCTGTCCGGCCCTTTTA	0.502																																						ENST00000327554.2	1.000000	0.280000	0.720000	0.380000	0.520000	0.559715	0.520000	0.490000																										0				40						c.(58-60)Cgg>Tgg		coiled-coil domain containing 60							69.0	77.0	74.0					12																	119773039		2203	4300	6503	SO:0001583	missense	160777	4	121410	38				g.chr12:119773039C>T	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.58C>T	chr12.hg19:g.119773039C>T	ENSP00000333374:p.Arg20Trp	0					CCDC60_ENST00000546345.1_3'UTR|CCDC60_ENST00000539847.1_Missense_Mutation_p.R20W|CCDC60_ENST00000536742.1_Missense_Mutation_p.R20W	p.R20W	NM_178499.3	NP_848594.2	1	2	3	2.001364	Q8IWA6	CCD60_HUMAN		1	523	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			Missense_Mutation	SNP	ENST00000327554.2	1	1	hg19	c.58C>T	CCDS9190.1	0	.	.	.	.	.	.	.	.	.	.	C	6.197	0.404573	0.11754	.	.	ENSG00000183273	ENST00000536742;ENST00000327554;ENST00000539847	T;T;T	0.48836	0.8;1.83;0.95	4.42	-3.66	0.04489	4.420000	-3.660000	0.044890	.	1.591660	0.03532	N	0.222527	T	0.17492	0.0420	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09773	-1.0659	9	.	.	.	0.016	3.2878	0.06937	0.3849:0.3158:0.0:0.2993	.	20	Q8IWA6	CCD60_HUMAN	W	20	ENSP00000445505:R20W;ENSP00000333374:R20W;ENSP00000443403:R20W	.	R	+	1	2	2	CCDC60	118257422	118257422	0.000000	0.05858	0.001000	0.08648	0.056000	0.15407	-0.894000	0.04123	-0.330000	0.08514	-0.377000	0.06932	CGG	0.134501		TCGA-FB-A4P5-01A-11D-A26I-08	0.502	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	2	-2.748327	1	0.130000	NM_178499		0	12	11	0	359	351	0		1			0	0	61	0	0	0.999014	0	0	0	0	0	0	12	359
FREM2	341640	broad.mit.edu	37	13	39357268	39357268	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr13:39357268C>A	ENST00000280481.7	+	5	5919	c.5703C>A	c.(5701-5703)ttC>ttA	p.F1901L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1901	Calx-beta 2.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTGAGCTGTTCATTCCCATCA	0.448																																						ENST00000280481.7	1.000000	0.260000	0.600000	0.340000	0.440000	0.492457	0.440000	0.420000																										0				148						c.(5701-5703)ttC>ttA		FRAS1 related extracellular matrix protein 2							211.0	196.0	201.0					13																	39357268		2203	4300	6503	SO:0001583	missense	341640	0	0					g.chr13:39357268C>A	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5703C>A	chr13.hg19:g.39357268C>A	ENSP00000280481:p.Phe1901Leu	0						p.F1901L	NM_207361.4	NP_997244.3	1	2	3	2.007468	Q5SZK8	FREM2_HUMAN		5	5919	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	0	1	hg19	c.5703C>A	CCDS31960.1	0	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.513669	0.00975	.	.	ENSG00000150893	ENST00000280481	T	0.28454	1.61	5.84	3.09	0.35607	5.840000	3.090000	0.356070	Na-Ca exchanger/integrin-beta4 (2);	0.154739	0.64402	N	0.000015	T	0.09555	0.0235	N	0.03177	-0.4	0.41029	D	0.985147	B	0.02656	0.0	B	0.09377	0.004	T	0.22487	-1.0215	10	0.05620	T	0.96	.	4.3073	0.10953	0.1488:0.4504:0.0:0.4008	.	1901	Q5SZK8	FREM2_HUMAN	L	1901	ENSP00000280481:F1901L	ENSP00000280481:F1901L	F	+	3	2	2	FREM2	38255268	38255268	0.416000	0.25424	0.826000	0.32828	0.043000	0.13939	-0.373000	0.07494	0.334000	0.23590	0.514000	0.50259	TTC	0.135618		TCGA-FB-A4P5-01A-11D-A26I-08	0.448	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	2	-2.882516	1	0.130000	NM_207361		0	17	17	0	597	593	0		1			0	0	64	0	0	0.999963	0	0	0	0	0	0	17	597
DGKH	160851	broad.mit.edu	37	13	42774011	42774011	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr13:42774011C>T	ENST00000337343.4	+	20	2480	c.2459C>T	c.(2458-2460)tCg>tTg	p.S820L	DGKH_ENST00000538674.1_Missense_Mutation_p.S575L|DGKH_ENST00000536612.1_Missense_Mutation_p.S684L|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000540693.1_Missense_Mutation_p.S820L|DGKH_ENST00000261491.5_Missense_Mutation_p.S820L|DGKH_ENST00000379274.2_Missense_Mutation_p.S684L	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	820					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TTACAGAGATCGTACAAGAAT	0.333																																						ENST00000337343.4	1.000000	0.250000	0.940000	0.400000	0.610000	0.640236	0.610000	1.000000																										0				43						c.(2458-2460)tCg>tTg		diacylglycerol kinase, eta							54.0	59.0	57.0					13																	42774011		2203	4300	6503	SO:0001583	missense	160851	0	0					g.chr13:42774011C>T	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2459C>T	chr13.hg19:g.42774011C>T	ENSP00000337572:p.Ser820Leu	0					DGKH_ENST00000540693.1_Missense_Mutation_p.S820L|DGKH_ENST00000261491.5_Missense_Mutation_p.S820L|DGKH_ENST00000379274.2_Missense_Mutation_p.S684L|DGKH_ENST00000536612.1_Missense_Mutation_p.S684L|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.S575L	p.S820L	NM_178009.3	NP_821077.1	1	2	3	2.007468	Q86XP1	DGKH_HUMAN		20	2480	+		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	0	1	hg19	c.2459C>T	CCDS9381.1	0	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184618	0.78677	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.69	5.69	0.88448	5.690000	5.690000	0.884480	Diacylglycerol kinase, accessory domain (2);	0.059562	0.64402	D	0.000004	T	0.49304	0.1549	M	0.75615	2.305	0.58432	D	0.999998	P;P;P;P	0.46952	0.874;0.644;0.887;0.824	B;B;B;B	0.40375	0.3;0.22;0.22;0.327	T	0.58869	-0.7560	10	0.87932	D	0	.	19.8013	0.96509	0.0:1.0:0.0:0.0	.	575;684;820;820	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	L	820;820;820;684;684;575	ENSP00000440823:S820L;ENSP00000337572:S820L;ENSP00000261491:S820L;ENSP00000368576:S684L;ENSP00000445114:S684L;ENSP00000441308:S575L	ENSP00000261491:S820L	S	+	2	0	0	DGKH	41672011	41672011	1.000000	0.71417	0.963000	0.40424	0.825000	0.46686	7.818000	0.86416	2.670000	0.90874	0.591000	0.81541	TCG	0.135618		TCGA-FB-A4P5-01A-11D-A26I-08	0.333	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	0	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	2	-2.787793	1	0.130000	NM_178009		0	6	6	0	161	159	0		1			0	0	14	0	0	0.964522	0	0	0	0	0	0	6	161
SPSB3	90864	broad.mit.edu	37	16	1828584	1828584	+	Silent	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr16:1828584G>A	ENST00000566339.1	-	3	486	c.156C>T	c.(154-156)taC>taT	p.Y52Y	SPSB3_ENST00000301717.4_Silent_p.Y52Y	NM_080861.3	NP_543137.2	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box containing 3	52					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(1)|kidney(4)|lung(3)|prostate(2)	10						GCAGCGTGGAGTACTCGGGGT	0.652																																						ENST00000566339.1	1.000000	0.290000	0.830000	0.410000	0.560000	0.606832	0.560000	0.520000																										0				10						c.(154-156)taC>taT		splA/ryanodine receptor domain and SOCS box containing 3							95.0	98.0	97.0					16																	1828584		2199	4300	6499	SO:0001819	synonymous_variant	90864	0	0					g.chr16:1828584G>A		CCDS32365.1	16p13.3	2008-02-05				ENSG00000162032			30629	protein-coding gene	gene with protein product		611659	"""chromosome 16 open reading frame 31"""	C16orf31		12076535	Standard	NM_080861		Approved	SSB-3	uc002cmu.3	Q6PJ21		ENST00000566339.1:c.156C>T	chr16.hg19:g.1828584G>A		0					SPSB3_ENST00000301717.4_Silent_p.Y52Y	p.Y52Y	NM_080861.3	NP_543137.2	1	2	3	2.019557	Q6PJ21	SPSB3_HUMAN		3	486	-			D3DU78|Q49A96|Q86X18|Q8WXK5|Q96IE6|Q96RY2	Silent	SNP	ENST00000566339.1	1	1	hg19	c.156C>T	CCDS32365.1	0																																																																																								0.138401		TCGA-FB-A4P5-01A-11D-A26I-08	0.652	SPSB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433512.1	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	2	-12.158340	1	0.130000	NM_080861		0	12	12	0	344	340	0		1	1		0	0	115	0	0	0.999093	8.226456e-01	0	5	0	88	0	12	344
CACNB1	782	broad.mit.edu	37	17	37339981	37339981	+	Silent	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr17:37339981C>T	ENST00000394303.3	-	11	1242	c.1035G>A	c.(1033-1035)aaG>aaA	p.K345K	CACNB1_ENST00000394310.3_Silent_p.K345K|CACNB1_ENST00000582877.1_5'Flank|CACNB1_ENST00000344140.5_Silent_p.K390K	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	345					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.K390N(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGAGGTGATCTTGATGTAAA	0.567																																					Esophageal Squamous(5;100 366 38393 41452 45827)	ENST00000394303.3	1.000000	0.310000	1.000000	0.550000	0.880000	0.813457	0.880000	1.000000																										1	Substitution - Missense(1)	p.K390N(1)	ovary(1)	16						c.(1033-1035)aaG>aaA		calcium channel, voltage-dependent, beta 1 subunit	Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)						40.0	33.0	35.0					17																	37339981		2203	4299	6502	SO:0001819	synonymous_variant	782	0	0					g.chr17:37339981C>T		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.1035G>A	chr17.hg19:g.37339981C>T		0					CACNB1_ENST00000344140.5_Silent_p.K390K|CACNB1_ENST00000582877.1_5'Flank|CACNB1_ENST00000394310.3_Silent_p.K345K	p.K345K	NM_000723.4	NP_000714.3	0	1	1	1.989980	Q02641	CACB1_HUMAN		11	1242	-			A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Silent	SNP	ENST00000394303.3	0	1	hg19	c.1035G>A	CCDS42311.1	1																																																																																								0.123735		TCGA-FB-A4P5-01A-11D-A26I-08	0.567	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3	0	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	2	-8.518474	1	0.130000			0	4	4	0	66	64	0		1	1		0	0	11	0	0	0.885455	1.819839e-01	0	3	0	8	0	4	66
KCTD11	147040	broad.mit.edu	37	17	7256580	7256580	+	Missense_Mutation	SNP	C	C	T	rs35280612		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr17:7256580C>T	ENST00000333751.3	+	1	1373	c.319C>T	c.(319-321)Cgg>Tgg	p.R107W	RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000576060.1_5'Flank|TMEM95_ENST00000330767.4_5'Flank|TMEM95_ENST00000389982.4_5'Flank	NM_001002914.2	NP_001002914.1	Q693B1	KCD11_HUMAN	potassium channel tetramerization domain containing 11	107					cell cycle (GO:0007049)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)				kidney(1)|large_intestine(2)|lung(1)	4		Prostate(122;0.157)				CTCTGCTCGCCGGGGACCCCA	0.642																																						ENST00000333751.3	0.880000	0.280000	0.710000	0.400000	0.540000	0.563833	0.540000	0.520000																										0				4						c.(319-321)Cgg>Tgg		potassium channel tetramerization domain containing 11							55.0	50.0	52.0					17																	7256580		2203	4300	6503	SO:0001583	missense	147040	0	0					g.chr17:7256580C>T	AK056227	CCDS32545.1	17p13.2	2013-06-20	2013-06-20	2003-11-26	ENSG00000213859	ENSG00000213859			21302	protein-coding gene	gene with protein product		609848	"""chromosome 17 open reading frame 36"", ""potassium channel tetramerisation domain containing 11"""	C17orf36		12186855, 21472142	Standard	NM_001002914		Approved	REN, KCASH1	uc002gge.4	Q693B1	OTTHUMG00000132061	ENST00000333751.3:c.319C>T	chr17.hg19:g.7256580C>T	ENSP00000328352:p.Arg107Trp	0					RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000330767.4_5'Flank|TMEM95_ENST00000576060.1_5'Flank|TMEM95_ENST00000389982.4_5'Flank	p.R107W	NM_001002914.2	NP_001002914.1	0	0	0	1.967944	Q693B1	KCD11_HUMAN		1	1373	+		Prostate(122;0.157)	B3KPE0	Missense_Mutation	SNP	ENST00000333751.3	1	1	hg19	c.319C>T	CCDS32545.1	0	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382499	0.61845	.	.	ENSG00000213859	ENST00000333751	T	0.71698	-0.59	5.38	-3.06	0.05379	5.380000	-3.060000	0.053790	.	0.158994	0.26979	U	0.021525	T	0.47002	0.1422	N	0.19112	0.55	0.09310	N	1	P	0.51537	0.946	B	0.33521	0.165	T	0.55471	-0.8136	10	0.72032	D	0.01	.	15.0564	0.71917	0.774:0.226:0.0:0.0	.	107	Q693B1	KCD11_HUMAN	W	107	ENSP00000328352:R107W	ENSP00000328352:R107W	R	+	1	2	2	KCTD11	7197304	7197304	0.646000	0.27295	0.873000	0.34254	0.874000	0.50279	0.512000	0.22755	-0.389000	0.07786	0.462000	0.41574	CGG	0.111520		TCGA-FB-A4P5-01A-11D-A26I-08	0.642	KCTD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255084.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	2	-3.149275	1	0.130000	NM_001002914		0	11	11	0	299	298	0		1	0		0	0	61	0	0	0.998382	1.941789e-01	0	1	0	20	0	11	299
CA10	56934	broad.mit.edu	37	17	50008436	50008436	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr17:50008436G>A	ENST00000285273.4	-	4	1304	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	CA10_ENST00000451037.2_Missense_Mutation_p.R65W|CA10_ENST00000570565.1_De_novo_Start_OutOfFrame|CA10_ENST00000340813.6_Missense_Mutation_p.R71W|CA10_ENST00000442502.2_Missense_Mutation_p.R65W	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	65					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	GGCGACTGCCGTTTCCCCACA	0.473																																						ENST00000285273.4	0.670000	0.290000	0.570000	0.370000	0.460000	0.474524	0.460000	0.450000																										0				41						c.(193-195)Cgg>Tgg		carbonic anhydrase X	Zonisamide(DB00909)						201.0	187.0	192.0					17																	50008436		2203	4300	6503	SO:0001583	missense	56934	3	121410	38				g.chr17:50008436G>A	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.193C>T	chr17.hg19:g.50008436G>A	ENSP00000285273:p.Arg65Trp	0					CA10_ENST00000442502.2_Missense_Mutation_p.R65W|CA10_ENST00000570565.1_De_novo_Start_OutOfFrame|CA10_ENST00000451037.2_Missense_Mutation_p.R65W|CA10_ENST00000340813.6_Missense_Mutation_p.R71W	p.R65W	NM_001082533.1	NP_001076002.1	0	1	1	1.989980	Q9NS85	CAH10_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.74e-06)	4	1304	-			B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	0	1	hg19	c.193C>T	CCDS32684.1	0	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725381	0.89298	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	5.93	4.93	0.64822	5.930000	4.930000	0.648220	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.64402	D	0.000001	D	0.84875	0.5569	M	0.86502	2.82	0.46061	D	0.998844	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	D	0.86086	0.1547	9	.	.	.	.	13.5205	0.61566	0.0:0.0:0.6936:0.3064	.	65;71	Q9NS85;Q68D28	CAH10_HUMAN;.	W	65;65;65;71	ENSP00000390666:R65W;ENSP00000285273:R65W;ENSP00000405388:R65W;ENSP00000340363:R71W	.	R	-	1	2	2	CA10	47363435	47363435	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.008000	0.57103	2.826000	0.97356	0.655000	0.94253	CGG	0.123735		TCGA-FB-A4P5-01A-11D-A26I-08	0.473	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	0	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	2	-2.468949	0	0.130000	NM_020178		0	21	21	0	678	675	0		1			0	0	93	0	0	0.999997	0	0	0	0	0	0	21	678
ITGB4	3691	broad.mit.edu	37	17	73748594	73748594	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr17:73748594G>A	ENST00000200181.3	+	32	4231	c.4044G>A	c.(4042-4044)atG>atA	p.M1348I	ITGB4_ENST00000449880.2_Missense_Mutation_p.M1348I|ITGB4_ENST00000339591.3_Missense_Mutation_p.M1348I|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000450894.3_Missense_Mutation_p.M1348I|ITGB4_ENST00000579662.1_Missense_Mutation_p.M1348I	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1348					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCTTCCTTATGTACAGCGATG	0.627																																						ENST00000200181.3	0.700000	0.280000	0.590000	0.370000	0.460000	0.483548	0.460000	0.470000																										0				43						c.(4042-4044)atG>atA		integrin, beta 4							116.0	111.0	112.0					17																	73748594		2203	4300	6503	SO:0001583	missense	3691	0	0					g.chr17:73748594G>A		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4044G>A	chr17.hg19:g.73748594G>A	ENSP00000200181:p.Met1348Ile	0					ITGB4_ENST00000579662.1_Missense_Mutation_p.M1348I|ITGB4_ENST00000339591.3_Missense_Mutation_p.M1348I|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000450894.3_Missense_Mutation_p.M1348I|ITGB4_ENST00000449880.2_Missense_Mutation_p.M1348I	p.M1348I	NM_000213.3	NP_000204.3	0	1	1	1.989980	P16144	ITB4_HUMAN	all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)	32	4231	+	all_cancers(13;1.5e-07)		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	1	1	hg19	c.4044G>A	CCDS11727.1	0	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667504	0.47677	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.75938	-0.98;-0.94;-0.94	4.31	4.31	0.51392	4.310000	4.310000	0.513920	.	0.000000	0.85682	D	0.000000	T	0.80449	0.4625	L	0.36672	1.1	0.80722	D	1	D;D;D	0.69078	0.997;0.995;0.995	D;D;D	0.80764	0.994;0.987;0.987	T	0.81342	-0.0976	10	0.46703	T	0.11	.	16.9575	0.86263	0.0:0.0:1.0:0.0	.	1348;1348;1348	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	I	1348	ENSP00000200181:M1348I;ENSP00000344079:M1348I;ENSP00000400217:M1348I	ENSP00000200181:M1348I	M	+	3	0	0	ITGB4	71260189	71260189	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	9.571000	0.98176	2.207000	0.71202	0.561000	0.74099	ATG	0.123735		TCGA-FB-A4P5-01A-11D-A26I-08	0.627	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1	0	0	1	2	2	2	2	0	0	0	0	129	129	129	128	1	2	-3.524704	1	0.130000			0	18	18	0	573	562	1		1	1		0	0	129	0	0	0.999979	9.885349e-01	0	124	0	107	0	18	573
RCVRN	5957	broad.mit.edu	37	17	9808122	9808122	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr17:9808122C>T	ENST00000226193.5	-	1	816	c.376G>A	c.(376-378)Gtc>Atc	p.V126I		NM_002903.2	NP_002894.1	P35243	RECO_HUMAN	recoverin	126	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of calcium ion transport (GO:0051924)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	dendrite (GO:0030425)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	12						CTGACCATGACGATCTCCAGC	0.642																																						ENST00000226193.5	0.820000	0.330000	0.690000	0.430000	0.540000	0.564653	0.540000	0.540000																										0				12						c.(376-378)Gtc>Atc		recoverin							124.0	102.0	109.0					17																	9808122		2203	4300	6503	SO:0001583	missense	5957	0	0					g.chr17:9808122C>T	BC001720	CCDS11151.1	17p13.1	2013-01-10		2006-09-26	ENSG00000109047	ENSG00000109047		"""EF-hand domain containing"""	9937	protein-coding gene	gene with protein product		179618		RCV1		1387789, 12507501, 1467959, 12789533	Standard	NM_002903		Approved		uc002gme.1	P35243	OTTHUMG00000130268	ENST00000226193.5:c.376G>A	chr17.hg19:g.9808122C>T	ENSP00000226193:p.Val126Ile	0						p.V126I	NM_002903.2	NP_002894.1	0	0	0	1.967944	P35243	RECO_HUMAN		1	816	-			Q53XL0	Missense_Mutation	SNP	ENST00000226193.5	1	1	hg19	c.376G>A	CCDS11151.1	0	.	.	.	.	.	.	.	.	.	.	C	8.226	0.803586	0.16467	.	.	ENSG00000109047	ENST00000226193	T	0.66280	-0.2	4.86	1.66	0.24008	4.860000	1.660000	0.240080	EF-hand-like domain (1);	0.252761	0.39909	N	0.001225	T	0.41282	0.1152	N	0.21508	0.67	0.80722	D	1	B	0.11235	0.004	B	0.04013	0.001	T	0.11542	-1.0583	10	0.26408	T	0.33	.	7.0455	0.25042	0.0:0.6107:0.0:0.3893	.	126	P35243	RECO_HUMAN	I	126	ENSP00000226193:V126I	ENSP00000226193:V126I	V	-	1	0	0	RCVRN	9748847	9748847	0.052000	0.20516	0.997000	0.53966	0.306000	0.27790	0.015000	0.13355	0.554000	0.29061	0.655000	0.94253	GTC	0.111520		TCGA-FB-A4P5-01A-11D-A26I-08	0.642	RCVRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252600.2	0	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	2	-3.764973	1	0.130000	NM_002903		0	17	17	0	453	449	0		1	0		0	0	112	0	0	0.999964	8.611770e-03	0	0	0	4	0	17	453
SEPT9	10801	broad.mit.edu	37	17	75398245	75398245	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr17:75398245C>T	ENST00000427177.1	+	3	307	c.181C>T	c.(181-183)Cag>Tag	p.Q61*	SEPT9_ENST00000592420.1_5'UTR|SEPT9_ENST00000585930.1_5'Flank|SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000423034.2_Nonsense_Mutation_p.Q54*|SEPT9_ENST00000591198.1_Nonsense_Mutation_p.Q42*|SEPT9_ENST00000329047.8_Nonsense_Mutation_p.Q43*|SEPT9_ENST00000590294.1_Nonsense_Mutation_p.Q43*|SEPT9_ENST00000427674.2_5'UTR|SEPT9_ENST00000588690.1_5'UTR|SEPT9_ENST00000431235.2_5'UTR	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	61					cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			CAGCTCCACCCAGAAATTCCA	0.627																																						ENST00000427177.1	1.000000	0.390000	0.960000	0.540000	0.730000	0.741941	0.730000	1.000000																										0				16						c.(181-183)Cag>Tag		septin 9							31.0	35.0	34.0					17																	75398245		1926	4138	6064	SO:0001587	stop_gained	10801	0	0					g.chr17:75398245C>T	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.181C>T	chr17.hg19:g.75398245C>T	ENSP00000391249:p.Gln61*	0					SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000588690.1_5'UTR|SEPT9_ENST00000590294.1_Nonsense_Mutation_p.Q43*|SEPT9_ENST00000592420.1_5'UTR|SEPT9_ENST00000431235.2_5'UTR|SEPT9_ENST00000585930.1_5'Flank|SEPT9_ENST00000423034.2_Nonsense_Mutation_p.Q54*|SEPT9_ENST00000427674.2_5'UTR|SEPT9_ENST00000591198.1_Nonsense_Mutation_p.Q42*|SEPT9_ENST00000329047.8_Nonsense_Mutation_p.Q43*	p.Q61*	NM_001113491.1	NP_001106963.1	0	1	1	1.989980	Q9UHD8	SEPT9_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.153)	3	307	+			A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Nonsense_Mutation	SNP	ENST00000427177.1	0	1	hg19	c.181C>T	CCDS45790.1	0	.	.	.	.	.	.	.	.	.	.	C	45	11.389194	0.99555	.	.	ENSG00000184640	ENST00000427177;ENST00000329047;ENST00000423034	.	.	.	4.89	4.89	0.63831	4.890000	4.890000	0.638310	.	2.942800	0.01335	U	0.011366	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.0435	0.86496	0.0:1.0:0.0:0.0	.	.	.	.	X	61;43;54	.	ENSP00000329161:Q43X	Q	+	1	0	0	SEPT9	72909840	72909840	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.105000	0.57797	2.262000	0.75019	0.555000	0.69702	CAG	0.123735		TCGA-FB-A4P5-01A-11D-A26I-08	0.627	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	2	-2.943210	1	0.130000	NM_006640		0	11	11	0	221	216	0		1	0		0	0	46	0	0	0.998250	8.677940e-01	0	0	0	75	0	11	221
SERPINB11	89778	broad.mit.edu	37	18	61377522	61377522	+	RNA	SNP	C	C	T	rs375026731		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr18:61377522C>T	ENST00000382749.5	+	0	340				SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000489748.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				TTCTTTTCTTCGCTGAGTCTG	0.428																																					Ovarian(27;496 784 5942 8975 23930)	ENST00000382749.5	1.000000	0.230000	0.780000	0.360000	0.540000	0.573279	0.540000	1.000000																										0				6								serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)		C	LEU/SER	1,3831		0,1,1915	126.0	117.0	120.0		95	4.3	0.1	18		120	0,8290		0,0,4145	no	missense	SERPINB11	NM_080475.2	145	0,1,6060	TT,TC,CC		0.0,0.0261,0.0082	benign	32/393	61377522	1,12121	1916	4145	6061			89778	4	120850	35				g.chr18:61377522C>T			18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		chr18.hg19:g.61377522C>T		0					SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000538847.1_RNA				0	1	1	1.997298	Q96P15	SPB11_HUMAN		0	340	+		Esophageal squamous(42;0.129)	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	RNA	SNP	ENST00000382749.5	0	1	hg19			0	.	.	.	.	.	.	.	.	.	.	C	9.959	1.222256	0.22457	2.61E-4	0.0	ENSG00000206072	ENST00000544088;ENST00000538847	D;D	0.82526	-1.62;-1.62	5.14	4.27	0.50696	5.140000	4.270000	0.506960	Serpin domain (3);	0.266677	0.26734	N	0.022770	T	0.73329	0.3573	L	0.28649	0.875	0.80722	D	1	B;B	0.31611	0.098;0.331	B;B	0.28385	0.033;0.089	T	0.73920	-0.3830	10	0.87932	D	0	.	11.7438	0.51809	0.0:0.9128:0.0:0.0872	.	32;32	F5GY69;Q96P15	.;SPB11_HUMAN	L	32	ENSP00000441497:S32L;ENSP00000440795:S32L	ENSP00000421854:S32L	S	+	2	0	0	SERPINB11	59528502	59528502	0.717000	0.27966	0.110000	0.21437	0.034000	0.12701	3.569000	0.53827	1.284000	0.44531	0.655000	0.94253	TCG	0.125452		TCGA-FB-A4P5-01A-11D-A26I-08	0.428	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	0	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	2	-8.067376	1	0.130000	NM_080475		0	6	6	0	170	170	0		1			0	0	21	0	0	0.965782	0	0	0	0	0	0	6	170
ZNF430	80264	broad.mit.edu	37	19	21239860	21239860	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr19:21239860C>T	ENST00000261560.5	+	5	927	c.746C>T	c.(745-747)aCt>aTt	p.T249I	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	249					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						TCAACCCTTACTAGACACAGA	0.348																																						ENST00000261560.5	1.000000	0.240000	0.760000	0.350000	0.500000	0.555958	0.500000	0.460000																										0				23						c.(745-747)aCt>aTt		zinc finger protein 430							53.0	58.0	57.0					19																	21239860		2203	4300	6503	SO:0001583	missense	80264	0	0					g.chr19:21239860C>T	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.746C>T	chr19.hg19:g.21239860C>T	ENSP00000261560:p.Thr249Ile	0					AC012627.1_ENST00000578233.1_RNA	p.T249I	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	1	2	3	2.014925	Q9H8G1	ZN430_HUMAN		5	927	+			Q86V70	Missense_Mutation	SNP	ENST00000261560.5	1	1	hg19	c.746C>T	CCDS32978.1	0	.	.	.	.	.	.	.	.	.	.	.	3.684	-0.064825	0.07273	.	.	ENSG00000118620	ENST00000261560	T	0.33865	1.39	1.04	-0.123	0.13527	1.040000	-0.123000	0.135270	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26195	0.0639	N	0.12471	0.22	0.09310	N	1	D;P	0.56968	0.978;0.723	P;B	0.53760	0.734;0.41	T	0.12915	-1.0529	9	0.38643	T	0.18	.	4.5907	0.12306	0.0:0.5789:0.0:0.4211	.	248;249	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	I	249	ENSP00000261560:T249I	ENSP00000261560:T249I	T	+	2	0	0	ZNF430	21031700	21031700	0.000000	0.05858	0.015000	0.15790	0.014000	0.08584	-3.561000	0.00430	0.452000	0.26830	0.455000	0.32223	ACT	0.137290		TCGA-FB-A4P5-01A-11D-A26I-08	0.348	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	2	-9.985004	1	0.130000	NM_025189		0	9	9	0	290	288	0		1	0		0	0	30	0	0	0.994233	3.534434e-03	0	0	0	3	0	9	290
ZNF208	7757	broad.mit.edu	37	19	22171675	22171675	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr19:22171675A>T	ENST00000397126.4	-	2	188	c.40T>A	c.(40-42)Tct>Act	p.S14T	ZNF208_ENST00000601773.1_Missense_Mutation_p.S14T|ZNF208_ENST00000599916.1_Missense_Mutation_p.S14T|ZNF208_ENST00000597040.1_5'UTR	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	14	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCCTCCAGAGAGAATTCTATG	0.403																																						ENST00000397126.4	1.000000	0.190000	0.480000	0.260000	0.340000	0.410127	0.340000	0.320000																										0				113						c.(40-42)Tct>Act		zinc finger protein 208							121.0	131.0	128.0					19																	22171675		2203	4300	6503	SO:0001583	missense	7757	0	0					g.chr19:22171675A>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.40T>A	chr19.hg19:g.22171675A>T	ENSP00000380315:p.Ser14Thr	0					ZNF208_ENST00000601773.1_Missense_Mutation_p.S14T|ZNF208_ENST00000599916.1_Missense_Mutation_p.S14T|ZNF208_ENST00000597040.1_5'UTR	p.S14T	NM_007153.3	NP_009084.2	1	2	3	2.014925	O43345	ZN208_HUMAN		2	188	-		all_lung(12;0.0961)|Lung NSC(12;0.103)		Missense_Mutation	SNP	ENST00000397126.4	1	1	hg19	c.40T>A	CCDS54240.1	0	.	.	.	.	.	.	.	.	.	.	A	3.819	-0.038200	0.07497	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.01484	4.84	1.32	-0.168	0.13343	1.320000	-0.168000	0.133430	Krueppel-associated box (4);	.	.	.	.	T	0.02304	0.0071	.	.	.	0.09310	N	1	D;P	0.63046	0.992;0.876	P;P	0.60012	0.867;0.652	T	0.27640	-1.0068	8	0.07175	T	0.84	.	3.607	0.08046	0.3597:0.0:0.0:0.6403	.	14;14	O43345;F8WEA0	ZN208_HUMAN;.	T	14	ENSP00000380315:S14T	ENSP00000380315:S14T	S	-	1	0	0	ZNF208	21963515	21963515	0.002000	0.14202	0.009000	0.14445	0.641000	0.38312	-0.021000	0.12504	-0.610000	0.05716	0.234000	0.17832	TCT	0.137290		TCGA-FB-A4P5-01A-11D-A26I-08	0.403	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	2	-3.179099	1	0.130000	NM_007153		0	16	16	0	748	744	0		1	0		0	0	87	0	0	0.999929	0	0	0	0	1	0	16	748
ZNF561	93134	broad.mit.edu	37	19	9721440	9721440	+	Silent	SNP	G	G	A	rs532347484		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr19:9721440G>A	ENST00000302851.3	-	6	1260	c.897C>T	c.(895-897)caC>caT	p.H299H	ZNF561_ENST00000495503.1_5'Flank|ZNF561_ENST00000354661.4_Silent_p.H163H|ZNF561_ENST00000424629.1_Silent_p.H230H|ZNF561_ENST00000326044.5_3'UTR	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	299					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						GAATTTGAATGTGATCATTAA	0.373													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22312	0.0		0.0	False		,,,				2504	0.0					ENST00000302851.3	1.000000	0.380000	0.760000	0.480000	0.590000	0.629087	0.590000	0.570000																										0				14						c.(895-897)caC>caT		zinc finger protein 561							113.0	108.0	110.0					19																	9721440		2203	4300	6503	SO:0001819	synonymous_variant	93134	1	121412	34				g.chr19:9721440G>A	AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.897C>T	chr19.hg19:g.9721440G>A		0					ZNF561_ENST00000424629.1_Silent_p.H230H|ZNF561_ENST00000354661.4_Silent_p.H163H|ZNF561_ENST00000495503.1_5'Flank|ZNF561_ENST00000326044.5_3'UTR	p.H299H	NM_152289.2	NP_689502.2	1	2	3	2.009114	Q8N587	ZN561_HUMAN		6	1260	-			B4E2Q8|Q6PJS0	Silent	SNP	ENST00000302851.3	1	1	hg19	c.897C>T	CCDS12216.2	0																																																																																								0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.373	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347272.2	0	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	2	-3.901997	1	0.130000	NM_152289		0	25	25	0	646	641	0		1	0		0	0	57	0	0	1.000000	1.137424e-01	0	1	0	14	0	25	646
ZNF616	90317	broad.mit.edu	37	19	52619638	52619638	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr19:52619638T>C	ENST00000600228.1	-	4	1040	c.779A>G	c.(778-780)cAa>cGa	p.Q260R	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		GTGACTCCTTTGGTGTCTTAC	0.383																																						ENST00000600228.1	1.000000	0.360000	0.830000	0.460000	0.590000	0.641063	0.590000	0.570000																										0				48						c.(778-780)cAa>cGa		zinc finger protein 616							88.0	86.0	87.0					19																	52619638		2203	4300	6503	SO:0001583	missense	90317	0	0					g.chr19:52619638T>C	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.779A>G	chr19.hg19:g.52619638T>C	ENSP00000471000:p.Gln260Arg	0					ZNF616_ENST00000330123.5_3'UTR	p.Q260R	NM_178523.3	NP_848618.2	1	2	3	2.022814	Q08AN1	ZN616_HUMAN		4	1040	-			B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	1	1	hg19	c.779A>G	CCDS33090.1	0	.	.	.	.	.	.	.	.	.	.	T	9.538	1.112700	0.20795	.	.	ENSG00000204611	ENST00000330123	.	.	.	0.954	-0.118	0.13547	0.954000	-0.118000	0.135470	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25457	0.0619	L	0.28344	0.845	0.09310	N	1	B	0.27594	0.182	B	0.28638	0.092	T	0.20874	-1.0262	8	0.35671	T	0.21	.	4.2259	0.10580	0.0:0.2336:0.0:0.7664	.	260	Q08AN1	ZN616_HUMAN	R	260	.	ENSP00000328722:Q260R	Q	-	2	0	0	ZNF616	57311450	57311450	0.000000	0.05858	0.004000	0.12327	0.858000	0.48976	-0.069000	0.11542	-0.101000	0.12219	0.254000	0.18369	CAA	0.138955		TCGA-FB-A4P5-01A-11D-A26I-08	0.383	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	0	0	1	2	2	2	2	0	0	0	0	35	35	35	34	1	2	-4.024561	1	0.130000	XM_030892		0	19	19	0	500	495	0		1	0		0	0	35	0	0	0.999990	4.503075e-03	0	0	0	3	0	19	500
HMCN1	83872	broad.mit.edu	37	1	186057376	186057376	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr1:186057376C>T	ENST00000271588.4	+	62	9774	c.9545C>T	c.(9544-9546)aCg>aTg	p.T3182M	HMCN1_ENST00000367492.2_Missense_Mutation_p.T3182M	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3182	Ig-like C2-type 30.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCACCTCCCACGATAGCATGG	0.443																																						ENST00000271588.4	1.000000	0.210000	0.780000	0.330000	0.500000	0.548638	0.500000	0.440000																										0				308						c.(9544-9546)aCg>aTg		hemicentin 1							95.0	83.0	87.0					1																	186057376		2203	4300	6503	SO:0001583	missense	83872	3	121398	32				g.chr1:186057376C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9545C>T	chr1.hg19:g.186057376C>T	ENSP00000271588:p.Thr3182Met	0					HMCN1_ENST00000367492.2_Missense_Mutation_p.T3182M	p.T3182M	NM_031935.2	NP_114141.2	1	2	3	2.010868	Q96RW7	HMCN1_HUMAN		62	9774	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	0	1	hg19	c.9545C>T	CCDS30956.1	0	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535093	0.27475	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68479	-0.33;-0.33	5.63	-1.85	0.07784	5.630000	-1.850000	0.077840	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.735216	0.13487	N	0.384223	T	0.62925	0.2468	M	0.78456	2.415	0.09310	N	1	B	0.27791	0.189	B	0.24155	0.051	T	0.54234	-0.8324	10	0.48119	T	0.1	.	11.2133	0.48813	0.0:0.5779:0.0:0.4221	.	3182	Q96RW7	HMCN1_HUMAN	M	3182	ENSP00000271588:T3182M;ENSP00000356462:T3182M	ENSP00000271588:T3182M	T	+	2	0	0	HMCN1	184323999	184323999	0.002000	0.14202	0.000000	0.03702	0.741000	0.42261	0.371000	0.20450	-0.692000	0.05128	-0.471000	0.05019	ACG	0.136733		TCGA-FB-A4P5-01A-11D-A26I-08	0.443	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	0	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	2	-3.586890	1	0.130000	NM_031935		0	7	6	0	232	229	0		1	0		0	0	27	0	0	0.979869	1.234526e-03	0	0	0	2	0	7	232
CHD5	26038	broad.mit.edu	37	1	6202252	6202252	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr1:6202252C>T	ENST00000262450.3	-	15	2471	c.2372G>A	c.(2371-2373)cGg>cAg	p.R791Q	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCGTTCTCCCGAATCACCGA	0.557																																						ENST00000262450.3	1.000000	0.290000	0.600000	0.360000	0.450000	0.508542	0.450000	0.430000																										0				16						c.(2371-2373)cGg>cAg		chromodomain helicase DNA binding protein 5							153.0	144.0	147.0					1																	6202252		2203	4300	6503	SO:0001583	missense	26038	1	121412	34				g.chr1:6202252C>T	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2372G>A	chr1.hg19:g.6202252C>T	ENSP00000262450:p.Arg791Gln	0					CHD5_ENST00000378021.1_5'UTR	p.R791Q	NM_015557.2	NP_056372.1	1	2	3	2.013303	O00258	WRB_HUMAN		15	2471	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	1	1	hg19	c.2372G>A	CCDS57.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.152028	0.94645	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	D	0.93712	-3.27	4.07	4.07	0.47477	4.070000	4.070000	0.474770	DEAD-like helicase (2);SNF2-related (1);	0.076633	0.49305	D	0.000151	D	0.95475	0.8530	L	0.56769	1.78	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.94752	0.7928	10	0.35671	T	0.21	-22.1812	16.6218	0.84932	0.0:1.0:0.0:0.0	.	791	Q8TDI0	CHD5_HUMAN	Q	791;307;199;199	ENSP00000262450:R791Q	ENSP00000262450:R791Q	R	-	2	0	0	CHD5	6124839	6124839	1.000000	0.71417	0.996000	0.52242	0.952000	0.60782	7.693000	0.84214	1.977000	0.57605	0.561000	0.74099	CGG	0.137290		TCGA-FB-A4P5-01A-11D-A26I-08	0.557	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	0	0	1	2	2	2	2	0	0	0	0	152	152	152	152	1	2	-1.968955	0	0.130000	NM_015557		0	24	24	0	827	820	0		1			0	0	152	0	0	1.000000	0	0	0	0	0	0	24	827
EPHA8	2046	broad.mit.edu	37	1	22923888	22923888	+	Missense_Mutation	SNP	G	G	A	rs371894783		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr1:22923888G>A	ENST00000166244.3	+	10	1921	c.1849G>A	c.(1849-1851)Gag>Aag	p.E617K		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	617	Mediates interaction with PIK3CG and required for endocytosis. {ECO:0000250}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCACACCTACGAGGAGCCAGG	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		13338	0.0		0.0	False		,,,				2504	0.001					ENST00000166244.3	0.500000	0.200000	0.420000	0.260000	0.330000	0.344520	0.330000	0.330000																										0				61						c.(1849-1851)Gag>Aag		EPH receptor A8		G	LYS/GLU	0,4406		0,0,2203	63.0	78.0	73.0		1849	4.6	1.0	1		73	1,8599	1.2+/-3.3	0,1,4299	no	missense	EPHA8	NM_020526.3	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	617/1006	22923888	1,13005	2203	4300	6503	SO:0001583	missense	2046	9	121412	44				g.chr1:22923888G>A	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1849G>A	chr1.hg19:g.22923888G>A	ENSP00000166244:p.Glu617Lys	0						p.E617K	NM_020526.3	NP_065387.1	0	1	1	1.999275	P29322	EPHA8_HUMAN		10	1921	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	0	1	hg19	c.1849G>A	CCDS225.1	0	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987973	0.74589	0.0	1.16E-4	ENSG00000070886	ENST00000166244	T	0.23754	1.89	4.63	4.63	0.57726	4.630000	4.630000	0.577260	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	M	0.82716	2.605	0.80722	D	1	D	0.71674	0.998	D	0.65987	0.94	T	0.61407	-0.7069	10	0.87932	D	0	.	16.2101	0.82150	0.0:0.0:1.0:0.0	.	617	P29322	EPHA8_HUMAN	K	617	ENSP00000166244:E617K	ENSP00000166244:E617K	E	+	1	0	0	EPHA8	22796475	22796475	1.000000	0.71417	0.978000	0.43139	0.105000	0.19272	9.657000	0.98554	2.412000	0.81896	0.491000	0.48974	GAG	0.125452		TCGA-FB-A4P5-01A-11D-A26I-08	0.637	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	0	0	1	2	2	2	2	0	0	0	0	138	138	138	136	1	2	-2.302281	0	0.130000	NM_020526		0	18	16	0	817	807	0		1	0		0	0	138	0	0	0.999979	3.143196e-03	0	0	0	4	0	18	817
EPHA8	2046	broad.mit.edu	37	1	22927844	22927844	+	Silent	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr1:22927844C>T	ENST00000166244.3	+	16	2853	c.2781C>T	c.(2779-2781)agC>agT	p.S927S		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	927					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAGGGGGCAGCGGTGGCGGTG	0.692																																						ENST00000166244.3	0.580000	0.170000	0.470000	0.250000	0.340000	0.364320	0.340000	0.330000																										0				61						c.(2779-2781)agC>agT		EPH receptor A8							34.0	41.0	39.0					1																	22927844		2178	4228	6406	SO:0001819	synonymous_variant	2046	1	121136	38				g.chr1:22927844C>T	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2781C>T	chr1.hg19:g.22927844C>T		0						p.S927S	NM_020526.3	NP_065387.1	0	1	1	1.999275	P29322	EPHA8_HUMAN		16	2853	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	0	1	hg19	c.2781C>T	CCDS225.1	0																																																																																								0.125452		TCGA-FB-A4P5-01A-11D-A26I-08	0.692	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	73	1	2	-3.016787	1	0.130000	NM_020526		0	10	10	0	443	434	0		1	0		0	0	76	0	0	0.996623	0	0	0	0	1	0	10	443
PRG4	10216	broad.mit.edu	37	1	186281436	186281436	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr1:186281436T>A	ENST00000445192.2	+	11	3968	c.3923T>A	c.(3922-3924)aTa>aAa	p.I1308K	PRG4_ENST00000367483.4_Missense_Mutation_p.I1267K|PRG4_ENST00000367486.3_Missense_Mutation_p.I1265K|TPR_ENST00000367478.4_3'UTR|PRG4_ENST00000367484.3_Missense_Mutation_p.I837K|RNU6-1240P_ENST00000365155.1_RNA|PRG4_ENST00000367485.4_Missense_Mutation_p.I1215K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1308					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GAACGTGCTATAGGACCTTCT	0.418																																						ENST00000445192.2	1.000000	0.280000	0.620000	0.360000	0.460000	0.515411	0.460000	0.440000																										0				102						c.(3922-3924)aTa>aAa		proteoglycan 4							144.0	143.0	143.0					1																	186281436		2203	4300	6503	SO:0001583	missense	10216	0	0					g.chr1:186281436T>A	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.3923T>A	chr1.hg19:g.186281436T>A	ENSP00000399679:p.Ile1308Lys	0					PRG4_ENST00000367485.4_Missense_Mutation_p.I1215K|PRG4_ENST00000367483.4_Missense_Mutation_p.I1267K|PRG4_ENST00000367486.3_Missense_Mutation_p.I1265K|TPR_ENST00000367478.4_3'UTR|RNU6-1240P_ENST00000365155.1_RNA|PRG4_ENST00000367484.3_Missense_Mutation_p.I837K	p.I1308K	NM_005807.3	NP_005798.2	1	2	3	2.010868	Q92954	PRG4_HUMAN		11	3968	+			Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	1	1	hg19	c.3923T>A	CCDS1369.1	0	.	.	.	.	.	.	.	.	.	.	T	11.11	1.543642	0.27563	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.07688	3.17;3.29;3.27;3.18;3.27	5.48	1.86	0.25419	5.480000	1.860000	0.254190	Hemopexin/matrixin (1);	0.514144	0.16080	N	0.230549	T	0.15652	0.0377	L	0.47716	1.5	0.09310	N	1	D;D;D;D	0.71674	0.988;0.988;0.998;0.988	P;P;P;P	0.62014	0.851;0.851;0.897;0.851	T	0.08534	-1.0717	10	0.87932	D	0	-2.0141	5.7754	0.18277	0.0:0.1475:0.1412:0.7113	.	1174;1215;1308;1267	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	K	1265;837;1267;1215;1308	ENSP00000356456:I1265K;ENSP00000356454:I837K;ENSP00000356453:I1267K;ENSP00000356455:I1215K;ENSP00000399679:I1308K	ENSP00000356453:I1267K	I	+	2	0	0	PRG4	184548059	184548059	0.007000	0.16637	0.001000	0.08648	0.291000	0.27294	1.709000	0.37909	0.121000	0.18284	0.477000	0.44152	ATA	0.136733		TCGA-FB-A4P5-01A-11D-A26I-08	0.418	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	0	0	1	2	2	2	2	0	0	0	0	78	78	78	77	1	2	-16.596960	1	0.130000	NM_005807		0	20	20	0	674	666	0		1	0		0	0	78	0	0	0.999995	1.330862e-01	0	0	0	21	0	20	674
APOB	338	broad.mit.edu	37	2	21251239	21251239	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr2:21251239T>C	ENST00000233242.1	-	13	1916	c.1789A>G	c.(1789-1791)Att>Gtt	p.I597V	APOB_ENST00000399256.4_Missense_Mutation_p.I597V	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	597	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATATTGGCAATATGGGAAGCC	0.418																																						ENST00000233242.1	1.000000	0.460000	0.900000	0.580000	0.730000	0.744823	0.730000	1.000000																										0				305						c.(1789-1791)Att>Gtt		apolipoprotein B							99.0	101.0	101.0					2																	21251239		2203	4300	6503	SO:0001583	missense	338	0	0					g.chr2:21251239T>C	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1789A>G	chr2.hg19:g.21251239T>C	ENSP00000233242:p.Ile597Val	0					APOB_ENST00000399256.4_Missense_Mutation_p.I597V	p.I597V	NM_000384.2	NP_000375	0	1	1	1.997827	P04114	APOB_HUMAN		13	1916	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	0	1	hg19	c.1789A>G	CCDS1703.1	0	.	.	.	.	.	.	.	.	.	.	T	14.51	2.558392	0.45590	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.57436	0.4;0.4	5.69	3.17	0.36434	5.690000	3.170000	0.364340	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.352961	0.27764	N	0.017944	T	0.47229	0.1434	L	0.56769	1.78	0.36909	D	0.890822	P	0.42908	0.793	B	0.38655	0.278	T	0.57757	-0.7756	10	0.42905	T	0.14	.	12.4341	0.55590	0.0:0.0:0.2866:0.7134	.	597	P04114	APOB_HUMAN	V	597	ENSP00000233242:I597V;ENSP00000382200:I597V	ENSP00000233242:I597V	I	-	1	0	0	APOB	21104744	21104744	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.596000	0.24044	1.098000	0.41479	0.533000	0.62120	ATT	0.125452		TCGA-FB-A4P5-01A-11D-A26I-08	0.418	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1	0	0	1	2	32	2	2	1	1	1	1	35	35	35	35	1	2	-19.987640	1	0.130000			0	20	20	0	399	395	0		0			1	0	35	0	0	0.052275	0	0	0	0	0	0	20	399
CNGA3	1261	broad.mit.edu	37	2	99013339	99013339	+	Missense_Mutation	SNP	G	G	A	rs201782746		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr2:99013339G>A	ENST00000272602.2	+	7	1745	c.1706G>A	c.(1705-1707)cGc>cAc	p.R569H	CNGA3_ENST00000409937.1_Missense_Mutation_p.R573H|CNGA3_ENST00000436404.2_Missense_Mutation_p.R551H|CNGA3_ENST00000393504.1_Missense_Mutation_p.R569H			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	569			R -> H (in ACHM2). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:14757870}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GCCAACATCCGCAGCATTGGC	0.582																																						ENST00000272602.2	1.000000	0.470000	0.880000	0.570000	0.690000	0.720339	0.690000	0.670000																										0				49	GRCh37	CM014559	CNGA3	M		c.(1705-1707)cGc>cAc		cyclic nucleotide gated channel alpha 3		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	114.0	110.0	111.0		1652,1706	5.4	1.0	2		111	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CNGA3	NM_001079878.1,NM_001298.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	551/677,569/695	99013339	1,13005	2203	4300	6503	SO:0001583	missense	1261	3	121412	41				g.chr2:99013339G>A	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1706G>A	chr2.hg19:g.99013339G>A	ENSP00000272602:p.Arg569His	0					CNGA3_ENST00000393504.1_Missense_Mutation_p.R569H|CNGA3_ENST00000409937.1_Missense_Mutation_p.R573H|CNGA3_ENST00000436404.2_Missense_Mutation_p.R551H	p.R569H			1	2	3	2.015221	Q16281	CNGA3_HUMAN		7	1745	+			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	1	1	hg19	c.1706G>A	CCDS2034.1	0	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832457	0.71258	0.0	1.16E-4	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27	5.42	5.42	0.78866	5.420000	5.420000	0.788660	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.98833	0.9606	H	0.96208	3.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.988;0.988;0.991	D	0.98965	1.0799	10	0.87932	D	0	.	12.1196	0.53883	0.0815:0.0:0.9185:0.0	.	573;551;569	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	H	569;551;569;573	ENSP00000377140:R569H;ENSP00000410070:R551H;ENSP00000272602:R569H;ENSP00000386761:R573H	ENSP00000272602:R569H	R	+	2	0	0	CNGA3	98379771	98379771	0.987000	0.35691	1.000000	0.80357	0.697000	0.40408	4.514000	0.60482	2.826000	0.97356	0.563000	0.77884	CGC	0.137290		TCGA-FB-A4P5-01A-11D-A26I-08	0.582	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	0	0	1	2	21	2	2	1	1	1	1	111	111	111	111	1	2	-4.165749	1	0.130000	NM_001298		0	31	31	0	682	678	0		1	0		1	0	111	0	0	0.937179	0	0	0	0	1	0	31	682
DCBLD2	131566	broad.mit.edu	37	3	98518461	98518461	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr3:98518461G>A	ENST00000326840.6	-	16	2445	c.2083C>T	c.(2083-2085)Cag>Tag	p.Q695*	DCBLD2_ENST00000326857.9_Nonsense_Mutation_p.Q709*	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	695					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						GTGGAGGGCTGACCAACTGAA	0.527																																						ENST00000326840.6	1.000000	0.240000	0.620000	0.330000	0.440000	0.497699	0.440000	0.420000																										0				25						c.(2083-2085)Cag>Tag		discoidin, CUB and LCCL domain containing 2							154.0	156.0	156.0					3																	98518461		1954	4159	6113	SO:0001587	stop_gained	131566	0	0					g.chr3:98518461G>A		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.2083C>T	chr3.hg19:g.98518461G>A	ENSP00000321573:p.Gln695*	0					DCBLD2_ENST00000326857.9_Nonsense_Mutation_p.Q709*	p.Q695*	NM_080927.3	NP_563615.3	1	2	3	2.009434	Q96PD2	DCBD2_HUMAN		16	2445	-			B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Nonsense_Mutation	SNP	ENST00000326840.6	0	1	hg19	c.2083C>T	CCDS46878.1	0	.	.	.	.	.	.	.	.	.	.	G	37	6.627228	0.97718	.	.	ENSG00000057019	ENST00000326840;ENST00000326857	.	.	.	5.65	2.79	0.32731	5.650000	2.790000	0.327310	.	0.592892	0.15545	N	0.256738	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-6.2138	1.8248	0.03118	0.1818:0.169:0.4938:0.1554	.	.	.	.	X	695;709	.	ENSP00000321573:Q695X	Q	-	1	0	0	DCBLD2	100001151	100001151	0.025000	0.19082	0.703000	0.30354	0.563000	0.35712	1.076000	0.30729	1.393000	0.46605	0.655000	0.94253	CAG	0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.527	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	2	-3.088139	1	0.130000	NM_080927		0	13	13	0	462	461	0		1	1		0	0	70	0	0	0.999532	1.376979e-01	0	3	0	19	0	13	462
PCDHGB3	56102	broad.mit.edu	37	5	140751764	140751764	+	Silent	SNP	C	C	T	rs57763341	byFrequency	TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr5:140751764C>T	ENST00000576222.1	+	1	1934	c.1803C>T	c.(1801-1803)aaC>aaT	p.N601N	PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	601	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGATACAACGCCTGGCTGT	0.672													.|||	5	0.000998403	0.0	0.0	5008	,	,		16837	0.005		0.0	False		,,,				2504	0.0					ENST00000576222.1	1.000000	0.130000	0.440000	0.190000	0.290000	0.358387	0.290000	0.270000																										0				5						c.(1801-1803)aaC>aaT		protocadherin gamma subfamily B, 3		C	,,,,,,,,	0,4406		0,0,2203	58.0	67.0	64.0		,,,,,,,1803,1803	-4.6	0.2	5	dbSNP_129	64	1,8599		0,1,4299	no	intron,intron,intron,intron,intron,intron,intron,coding-synonymous,coding-synonymous	PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018918.2,NM_018922.2,NM_018923.2,NM_018924.2,NM_032097.1	,,,,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,,,	,,,,,,,601/930,601/815	140751764	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56102	50	121404	50				g.chr5:140751764C>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1803C>T	chr5.hg19:g.140751764C>T		0					PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank	p.N601N	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	1	2	3	2.010250	Q9Y5G1	PCDGF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1934	+			A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	0	1	hg19	c.1803C>T	CCDS58980.1	0																																																																																								0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.672	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	0	0	1	2	2	2	2	0	0	0	0	114	114	114	112	1	2	-6.967111	1	0.130000	NM_018924		0	8	8	0	455	449	0		1			0	0	114	0	0	0.988919	0	0	0	0	0	0	8	455
PCDHGB4	8641	broad.mit.edu	37	5	140769030	140769030	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr5:140769030G>A	ENST00000519479.1	+	1	1579	c.1579G>A	c.(1579-1581)Gaa>Aaa	p.E527K	PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	527	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGCCTTCGAACTCACACT	0.677																																						ENST00000519479.1	1.000000	0.190000	0.650000	0.290000	0.430000	0.485255	0.430000	0.390000																										0				37						c.(1579-1581)Gaa>Aaa		protocadherin gamma subfamily B, 4							38.0	43.0	42.0					5																	140769030		2038	4188	6226	SO:0001583	missense	8641	0	0					g.chr5:140769030G>A	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1579G>A	chr5.hg19:g.140769030G>A	ENSP00000428288:p.Glu527Lys	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron	p.E527K	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	1	2	3	2.010250	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1579	+			O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	1	1	hg19	c.1579G>A	CCDS54928.1	0	.	.	.	.	.	.	.	.	.	.	.	8.696	0.908490	0.17833	.	.	ENSG00000253953	ENST00000519479	T	0.54071	0.59	4.95	-1.96	0.07525	4.950000	-1.960000	0.075250	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.43831	0.1265	L	0.46947	1.48	0.09310	N	1	P;P	0.44478	0.836;0.697	B;B	0.38458	0.261;0.274	T	0.29336	-1.0015	9	0.33940	T	0.23	.	15.7771	0.78232	0.1245:0.6211:0.2544:0.0	.	527;527	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	K	527	ENSP00000428288:E527K	ENSP00000428288:E527K	E	+	1	0	0	PCDHGB4	140749214	140749214	0.000000	0.05858	0.688000	0.30117	0.248000	0.25809	-2.903000	0.00703	-1.088000	0.03077	-2.589000	0.00165	GAA	0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.677	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	0	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	2	-8.433194	1	0.130000	NM_003736		0	8	8	0	304	301	0		1	0		0	0	59	0	0	0.989189	9.099181e-04	0	0	0	2	0	8	304
SLC6A7	6534	broad.mit.edu	37	5	149576606	149576606	+	Splice_Site	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr5:149576606C>T	ENST00000230671.2	+	4	722	c.351C>T	c.(349-351)ggC>ggT	p.G117G	SLC6A7_ENST00000524041.1_Splice_Site_p.G117G	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	117					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	CCACACCAGGCGCCGGCGCAG	0.637																																						ENST00000230671.2	1.000000	0.230000	1.000000	0.390000	0.620000	0.653703	0.620000	1.000000																										0				16						c.(349-351)ggC>ggT		solute carrier family 6 (neurotransmitter transporter), member 7	L-Proline(DB00172)						62.0	59.0	60.0					5																	149576606		2203	4300	6503	SO:0001630	splice_region_variant	6534	3	121398	35				g.chr5:149576606C>T	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.350-1C>T	chr5.hg19:g.149576606C>T		0					SLC6A7_ENST00000524041.1_Splice_Site_p.G117G	p.G117G	NM_014228.3	NP_055043.2	1	2	3	2.010250	Q99884	SC6A7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	4	722	+		all_hematologic(541;0.224)	Q0VG81|Q52LU6	Splice_Site	SNP	ENST00000230671.2	1	0	hg19	c.351C>T	CCDS4305.1	0																																																																																								0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.637	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252325.1	1	0	0	2	2	2	2	0	0	0	0	36	36	36	36	1	2	-7.986053	1	0.130000	NM_014228	Silent	0	5	5	0	133	131	0		1			0	0	36	0	0	0.936303	0	0	0	0	0	0	5	133
SEMA5A	9037	broad.mit.edu	37	5	9066644	9066644	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr5:9066644G>A	ENST00000382496.5	-	17	2853	c.2188C>T	c.(2188-2190)Cga>Tga	p.R730*		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	730	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CATGTGTATCGGAATCGTTGC	0.557																																						ENST00000382496.5	1.000000	0.340000	0.670000	0.420000	0.520000	0.565041	0.520000	0.500000																										0				81						c.(2188-2190)Cga>Tga		sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A							158.0	147.0	151.0					5																	9066644		2203	4300	6503	SO:0001587	stop_gained	9037	0	0					g.chr5:9066644G>A	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2188C>T	chr5.hg19:g.9066644G>A	ENSP00000371936:p.Arg730*	0						p.R730*	NM_003966.2	NP_003957.2	1	2	3	2.010809	Q13591	SEM5A_HUMAN		17	2853	-			D3DTC6|O60408|Q1RLL9	Nonsense_Mutation	SNP	ENST00000382496.5	0	1	hg19	c.2188C>T	CCDS3875.1	0	.	.	.	.	.	.	.	.	.	.	G	44	10.876622	0.99482	.	.	ENSG00000112902	ENST00000382496	.	.	.	5.52	4.65	0.58169	5.520000	4.650000	0.581690	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9373	0.64032	0.0:0.0:0.8468:0.1532	.	.	.	.	X	730	.	ENSP00000371936:R730X	R	-	1	2	2	SEMA5A	9119644	9119644	1.000000	0.71417	0.961000	0.40146	0.351000	0.29236	2.938000	0.48987	1.468000	0.48064	-0.230000	0.12252	CGA	0.136733		TCGA-FB-A4P5-01A-11D-A26I-08	0.557	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2	0	0	1	2	2	2	2	0	0	0	0	89	89	89	87	1	2	-2.391692	0	0.130000			0	26	26	0	773	767	0		1	0		0	0	89	0	0	1.000000	2.184866e-02	0	0	0	7	0	26	773
GRM6	2916	broad.mit.edu	37	5	178410024	178410024	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr5:178410024C>T	ENST00000517717.1	-	10	2361	c.2323G>A	c.(2323-2325)Gtg>Atg	p.V775M	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Missense_Mutation_p.V775M			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	775					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)	p.V775M(2)		NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GTCTCGGGCACGCCACGGGCC	0.597																																						ENST00000517717.1	1.000000	0.210000	0.630000	0.310000	0.430000	0.487587	0.430000	0.400000																										2	Substitution - Missense(2)	p.V775M(2)	urinary_tract(1)|large_intestine(1)	55						c.(2323-2325)Gtg>Atg		glutamate receptor, metabotropic 6							131.0	107.0	115.0					5																	178410024		2203	4300	6503	SO:0001583	missense	2916	5	121412	41				g.chr5:178410024C>T	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.2323G>A	chr5.hg19:g.178410024C>T	ENSP00000430767:p.Val775Met	0					RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Missense_Mutation_p.V775M	p.V775M			1	2	3	2.010250	O15303	GRM6_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	10	2361	-	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)		Missense_Mutation	SNP	ENST00000517717.1	0	1	hg19	c.2323G>A	CCDS4442.1	0	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379871	0.61845	.	.	ENSG00000113262	ENST00000231188;ENST00000517717	D;D	0.89485	-2.52;-2.52	5.18	5.18	0.71444	5.180000	5.180000	0.714440	GPCR, family 3, C-terminal (2);	.	.	.	.	D	0.94823	0.8328	M	0.84683	2.71	0.54753	D	0.999987	D;D	0.76494	0.999;0.998	D;D	0.77557	0.99;0.967	D	0.95314	0.8414	9	0.72032	D	0.01	.	16.5534	0.84478	0.0:1.0:0.0:0.0	.	775;69	O15303;Q5HYM4	GRM6_HUMAN;.	M	775	ENSP00000231188:V775M;ENSP00000430767:V775M	ENSP00000231188:V775M	V	-	1	0	0	GRM6	178342630	178342630	1.000000	0.71417	0.767000	0.31495	0.036000	0.12997	7.658000	0.83755	2.591000	0.87537	0.313000	0.20887	GTG	0.136176		TCGA-FB-A4P5-01A-11D-A26I-08	0.597	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	2	-9.742636	1	0.130000			0	10	10	0	371	367	0		1			0	0	70	0	0	0.996806	0	0	0	0	0	0	10	371
RADIL	55698	broad.mit.edu	37	7	4917630	4917630	+	Silent	SNP	G	G	A	rs368969739		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr7:4917630G>A	ENST00000399583.3	-	2	328	c.141C>T	c.(139-141)ggC>ggT	p.G47G	RADIL_ENST00000536091.1_Silent_p.G47G	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	47					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CATCGCTGGCGCCCAGGCTGG	0.627																																						ENST00000399583.3	1.000000	0.370000	1.000000	0.590000	0.900000	0.828945	0.900000	1.000000																										0				41						c.(139-141)ggC>ggT		Ras association and DIL domains																																				SO:0001819	synonymous_variant	55698	7	120894	34				g.chr7:4917630G>A	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.141C>T	chr7.hg19:g.4917630G>A		0					RADIL_ENST00000536091.1_Silent_p.G47G	p.G47G	NM_018059.4	NP_060529.4	1	2	3	2.012047	Q96JH8	RADIL_HUMAN		2	328	-		Ovarian(82;0.0175)	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	0	1	hg19	c.141C>T	CCDS43544.1	1																																																																																								0.136733		TCGA-FB-A4P5-01A-11D-A26I-08	0.627	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	2	-9.908031	1	0.130000	NM_018059		0	6	5	0	106	105	0		1	0		0	0	20	0	0	0.964368	0	0	0	0	1	0	6	106
SP4	6671	broad.mit.edu	37	7	21516727	21516727	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr7:21516727T>C	ENST00000222584.3	+	4	1927	c.1709T>C	c.(1708-1710)gTc>gCc	p.V570A		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	570					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GGAGTAAAAGTCCAGCAAGCT	0.378																																						ENST00000222584.3	1.000000	0.170000	0.760000	0.280000	0.460000	0.514766	0.460000	0.390000																										0				35						c.(1708-1710)gTc>gCc		Sp4 transcription factor							74.0	68.0	70.0					7																	21516727		2203	4300	6503	SO:0001583	missense	6671	0	0					g.chr7:21516727T>C		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1709T>C	chr7.hg19:g.21516727T>C	ENSP00000222584:p.Val570Ala	0						p.V570A	NM_003112.3	NP_003103.2	1	2	3	2.012047	Q02446	SP4_HUMAN		4	1927	+			O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	0	1	hg19	c.1709T>C	CCDS5373.1	0	.	.	.	.	.	.	.	.	.	.	T	17.25	3.341432	0.60963	.	.	ENSG00000105866	ENST00000222584;ENST00000432066	T	0.10099	2.91	6.17	6.17	0.99709	6.170000	6.170000	0.997090	.	0.000000	0.85682	D	0.000000	T	0.26195	0.0639	L	0.49126	1.545	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.01858	-1.1259	10	0.18276	T	0.48	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	570	Q02446	SP4_HUMAN	A	570;13	ENSP00000222584:V570A	ENSP00000222584:V570A	V	+	2	0	0	SP4	21483252	21483252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.611000	0.82962	2.371000	0.80710	0.533000	0.62120	GTC	0.136733		TCGA-FB-A4P5-01A-11D-A26I-08	0.378	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	0	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	2	-7.234855	1	0.130000	NM_003112		0	5	5	0	187	182	0		1	0		0	0	28	0	0	0.933953	1.110230e-03	0	0	0	2	0	5	187
HAS2	3037	broad.mit.edu	37	8	122641537	122641537	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr8:122641537G>T	ENST00000303924.4	-	2	581	c.44C>A	c.(43-45)aCc>aAc	p.T15N		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	15					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AAAGAGTGTGGTTCCAATTAT	0.378																																						ENST00000303924.4	0.660000	0.170000	0.520000	0.260000	0.370000	0.398157	0.370000	0.360000																									HAS2/PLAG1(10)	0				38						c.(43-45)aCc>aAc		hyaluronan synthase 2							58.0	56.0	56.0					8																	122641537		2203	4299	6502	SO:0001583	missense	3037	0	0					g.chr8:122641537G>T	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.44C>A	chr8.hg19:g.122641537G>T	ENSP00000306991:p.Thr15Asn	0						p.T15N	NM_005328.2	NP_005319.1	0	1	1	1.991578	Q92819	HYAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)	2	581	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	0	1	hg19	c.44C>A	CCDS6335.1	0	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369297	0.82463	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.57107	0.42	6.17	6.17	0.99709	6.170000	6.170000	0.997090	.	0.000000	0.85682	D	0.000000	T	0.70780	0.3263	M	0.79123	2.44	0.80722	D	1	D	0.56035	0.974	P	0.55615	0.78	T	0.69495	-0.5130	10	0.49607	T	0.09	-22.0036	20.8794	0.99867	0.0:0.0:1.0:0.0	.	15	Q92819	HAS2_HUMAN	N	15	ENSP00000306991:T15N	ENSP00000306991:T15N	T	-	2	0	0	HAS2	122710718	122710718	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.800000	0.99124	2.941000	0.99782	0.655000	0.94253	ACC	0.123735		TCGA-FB-A4P5-01A-11D-A26I-08	0.378	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	0	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	2	-8.452718	1	0.130000	NM_005328		0	8	8	0	328	326	0		1			0	0	26	0	0	0.989325	0	0	0	0	0	0	8	328
TRAPPC9	83696	broad.mit.edu	37	8	141461429	141461429	+	Missense_Mutation	SNP	G	G	A	rs142839408		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr8:141461429G>A	ENST00000438773.2	-	2	177	c.44C>T	c.(43-45)aCg>aTg	p.T15M	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.T113M|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.T15M	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	15					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CACGAGCAGCGTCTGGTGGTC	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22017	0.0		0.0	False		,,,				2504	0.0					ENST00000438773.2	1.000000	0.350000	0.940000	0.500000	0.700000	0.712860	0.700000	1.000000																										0				47						c.(43-45)aCg>aTg		trafficking protein particle complex 9		G	MET/THR,MET/THR	5,4395		0,5,2195	30.0	31.0	31.0		44,338	4.4	0.9	8	dbSNP_134	31	2,8594		0,2,4296	yes	missense,missense	TRAPPC9	NM_001160372.1,NM_031466.5	81,81	0,7,6491	AA,AG,GG		0.0233,0.1136,0.0539	probably-damaging,probably-damaging	15/1149,113/1247	141461429	7,12989	2200	4298	6498	SO:0001583	missense	83696	28	121346	44				g.chr8:141461429G>A	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.44C>T	chr8.hg19:g.141461429G>A	ENSP00000405060:p.Thr15Met	0					TRAPPC9_ENST00000389327.3_Missense_Mutation_p.T15M|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.T113M	p.T15M	NM_001160372.1	NP_001153844.1	0	1	1	1.991578	Q96Q05	TPPC9_HUMAN		2	177	-			Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	1	1	hg19	c.44C>T	CCDS55278.1	0	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921045	0.73213	0.001136	2.33E-4	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	5.26	4.39	0.52855	5.260000	4.390000	0.528550	.	0.046901	0.85682	D	0.000000	T	0.70369	0.3216	L	0.54323	1.7	0.44221	D	0.99705	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.967;0.967	T	0.71474	-0.4582	9	0.51188	T	0.08	.	13.9017	0.63809	0.0735:0.0:0.9265:0.0	.	15;15;113	Q96Q05;Q96Q05-3;Q96Q05-2	TPPC9_HUMAN;.;.	M	113;15;15	.	ENSP00000373978:T15M	T	-	2	0	0	TRAPPC9	141530611	141530611	1.000000	0.71417	0.924000	0.36721	0.956000	0.61745	9.640000	0.98453	1.210000	0.43336	0.650000	0.86243	ACG	0.123735		TCGA-FB-A4P5-01A-11D-A26I-08	0.537	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	0	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	2	-11.483710	1	0.130000	NM_031466		0	9	9	0	191	190	0		1	0		0	0	35	0	0	0.994411	8.851073e-02	0	0	0	10	0	9	191
TRPM6	140803	broad.mit.edu	37	9	77386696	77386696	+	Silent	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr9:77386696G>A	ENST00000360774.1	-	25	3696	c.3459C>T	c.(3457-3459)tgC>tgT	p.C1153C	TRPM6_ENST00000451710.3_Silent_p.C1153C|TRPM6_ENST00000449912.2_Silent_p.C1148C|TRPM6_ENST00000376864.4_Silent_p.C1153C|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Silent_p.C1148C	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1153					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATTTTTCCACGCACTGCTCCT	0.358																																						ENST00000360774.1	1.000000	0.350000	0.900000	0.490000	0.680000	0.697920	0.680000	1.000000																										0				126						c.(3457-3459)tgC>tgT		transient receptor potential cation channel, subfamily M, member 6							116.0	105.0	109.0					9																	77386696		2203	4300	6503	SO:0001819	synonymous_variant	140803	4	121410	34				g.chr9:77386696G>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3459C>T	chr9.hg19:g.77386696G>A		0					TRPM6_ENST00000451710.3_Silent_p.C1153C|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Silent_p.C1153C|TRPM6_ENST00000361255.3_Silent_p.C1148C|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000449912.2_Silent_p.C1148C	p.C1153C	NM_017662.4	NP_060132.3	0	0	0	1.965775	Q9BX84	TRPM6_HUMAN		25	3696	-			Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	0	1	hg19	c.3459C>T	CCDS6647.1	0																																																																																								0.110338		TCGA-FB-A4P5-01A-11D-A26I-08	0.358	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	2	-2.978244	1	0.130000	NM_017662		0	10	9	0	213	211	0		1			0	0	20	0	0	0.996865	0	0	0	0	0	0	10	213
PPAPDC3	84814	broad.mit.edu	37	9	134165668	134165668	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chr9:134165668G>A	ENST00000372264.3	+	1	588	c.284G>A	c.(283-285)cGg>cAg	p.R95Q	PPAPDC3_ENST00000372261.1_Missense_Mutation_p.R95Q	NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	95					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		ATGTCCAAGCGGCTGGGGGTG	0.652																																						ENST00000372264.3	1.000000	0.170000	0.470000	0.230000	0.330000	0.388362	0.330000	0.300000																										0				16						c.(283-285)cGg>cAg		phosphatidic acid phosphatase type 2 domain containing 3							73.0	74.0	73.0					9																	134165668		2203	4300	6503	SO:0001583	missense	84814	0	0					g.chr9:134165668G>A	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.284G>A	chr9.hg19:g.134165668G>A	ENSP00000361338:p.Arg95Gln	0					PPAPDC3_ENST00000372261.1_Missense_Mutation_p.R95Q	p.R95Q	NM_032728.3	NP_116117.3	1	2	3	2.005945	Q8NBV4	PPAC3_HUMAN		1	588	+	all_hematologic(7;0.0119)		Q5T6P0|Q96SS7|Q9BRC3	Missense_Mutation	SNP	ENST00000372264.3	0	1	hg19	c.284G>A	CCDS6942.1	0	.	.	.	.	.	.	.	.	.	.	G	37	6.011501	0.97200	.	.	ENSG00000160539	ENST00000372264;ENST00000372261	T;T	0.50548	1.8;0.74	5.69	5.69	0.88448	5.690000	5.690000	0.884480	.	0.000000	0.85682	D	0.000000	T	0.68961	0.3058	M	0.71581	2.175	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.70174	-0.4944	10	0.62326	D	0.03	-40.1758	18.802	0.92022	0.0:0.0:1.0:0.0	.	95	Q8NBV4	PPAC3_HUMAN	Q	95	ENSP00000361338:R95Q;ENSP00000361335:R95Q	ENSP00000361335:R95Q	R	+	2	0	0	PPAPDC3	133155489	133155489	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.608000	0.82898	2.682000	0.91365	0.561000	0.74099	CGG	0.135618		TCGA-FB-A4P5-01A-11D-A26I-08	0.652	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	118	1	2	-3.034886	1	0.130000	NM_032728		0	11	11	0	536	530	0		1	0		0	0	119	0	0	0.998256	5.166418e-04	0	0	0	2	0	11	536
DCAF12L2	340578	broad.mit.edu	37	X	125299285	125299285	+	Missense_Mutation	SNP	G	G	C	rs199739505		TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:125299285G>C	ENST00000360028.2	-	1	649	c.623C>G	c.(622-624)gCt>gGt	p.A208G	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.A208G			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	208										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GCCGCTCACAGCTACGGTGTC	0.647																																						ENST00000360028.2	0.710000	0.210000	0.570000	0.300000	0.420000	0.445498	0.420000	0.410000																										0				64						c.(622-624)gCt>gGt		DDB1 and CUL4 associated factor 12-like 2							45.0	48.0	47.0					X																	125299285		2203	4299	6502	SO:0001583	missense	340578	0	0					g.chrX:125299285G>C	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.623C>G	chrX.hg19:g.125299285G>C	ENSP00000353128:p.Ala208Gly						DCAF12L2_ENST00000538699.1_Missense_Mutation_p.A208G	p.A208G			0	1	1		Q5VW00	DC122_HUMAN		1	649	-			B2RN42	Missense_Mutation	SNP	ENST00000360028.2	1	1	hg19	c.623C>G	CCDS43991.1	0	.	.	.	.	.	.	.	.	.	.	G	11.11	1.543243	0.27563	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.60171	0.21;0.21	3.87	0.855	0.19013	3.870000	0.855000	0.190130	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.817806	0.10000	N	0.728605	T	0.56702	0.2003	L	0.51422	1.61	0.30815	N	0.738405	P	0.44659	0.84	P	0.48552	0.581	T	0.57717	-0.7763	10	0.87932	D	0	.	6.7549	0.23507	0.4053:0.0:0.5947:0.0	.	208	Q5VW00	DC122_HUMAN	G	208	ENSP00000441489:A208G;ENSP00000353128:A208G	ENSP00000353128:A208G	A	-	2	0	0	DCAF12L2	125126966	125126966	0.998000	0.40836	0.002000	0.10522	0.010000	0.07245	2.707000	0.47143	0.042000	0.15717	0.544000	0.68410	GCT	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.647	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	2	-9.829924	1	0.130000	NM_001013628		0	10	10	0	361	357	0		1			0	0	68	0	0	0.996805	0	0	0	0	0	0	10	361
MED14	9282	broad.mit.edu	37	X	40573077	40573077	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:40573077C>T	ENST00000324817.1	-	5	723	c.605G>A	c.(604-606)cGg>cAg	p.R202Q		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	202	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTTACAAGCCGATGTCTAAG	0.383																																						ENST00000324817.1	0.730000	0.280000	0.610000	0.370000	0.480000	0.496449	0.480000	0.470000																										0				39						c.(604-606)cGg>cAg		mediator complex subunit 14							171.0	158.0	162.0					X																	40573077		2203	4300	6503	SO:0001583	missense	9282	0	0					g.chrX:40573077C>T	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.605G>A	chrX.hg19:g.40573077C>T	ENSP00000323720:p.Arg202Gln							p.R202Q	NM_004229.3	NP_004220.2	0	1	1		O60244	MED14_HUMAN		5	723	-			Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	0	1	hg19	c.605G>A	CCDS14254.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.665183	0.96745	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.17	5.17	0.71159	5.170000	5.170000	0.711590	.	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	M	0.88105	2.93	0.80722	D	1	D	0.54397	0.966	P	0.47645	0.553	T	0.82108	-0.0620	9	0.72032	D	0.01	.	18.0658	0.89390	0.0:1.0:0.0:0.0	.	202	O60244	MED14_HUMAN	Q	202	.	ENSP00000323720:R202Q	R	-	2	0	0	MED14	40458021	40458021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.400000	0.79949	2.290000	0.77057	0.544000	0.68410	CGG	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.383	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	0	0	1	2	33	3	2	1	1	1	1	42	42	42	41	1	2	-2.679387	1	0.130000	NM_004229		0	16	16	0	502	493	0		0	0		1	0	42	0	0	0.007580	6.986228e-03	0	0	0	12	0	16	502
TBC1D25	4943	broad.mit.edu	37	X	48418156	48418156	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:48418156C>T	ENST00000376771.4	+	6	1201	c.860C>T	c.(859-861)aCg>aTg	p.T287M	TBC1D25_ENST00000537536.1_Missense_Mutation_p.T33M|snoU13_ENST00000459609.1_RNA	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	287	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						ATCCGCAGCACGGTCCTCAAG	0.627																																						ENST00000376771.4	1.000000	0.250000	0.780000	0.380000	0.550000	0.584820	0.550000	1.000000																										0				4						c.(859-861)aCg>aTg		TBC1 domain family, member 25							51.0	44.0	46.0					X																	48418156		2202	4300	6502	SO:0001583	missense	4943	0	0					g.chrX:48418156C>T	L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.860C>T	chrX.hg19:g.48418156C>T	ENSP00000365962:p.Thr287Met						snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_Missense_Mutation_p.T33M	p.T287M	NM_002536.2	NP_002527.1	0	1	1		Q3MII6	TBC25_HUMAN		6	1201	+			Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	1	1	hg19	c.860C>T	CCDS35242.1	0	.	.	.	.	.	.	.	.	.	.	C	10.15	1.272312	0.23221	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.12361	2.69;2.69	5.89	4.95	0.65309	5.890000	4.950000	0.653090	Rab-GAP/TBC domain (4);	0.053790	0.64402	D	0.000001	T	0.03178	0.0093	N	0.00765	-1.205	0.34569	D	0.713181	B;B;B	0.25441	0.126;0.023;0.013	B;B;B	0.14023	0.01;0.01;0.01	T	0.28996	-1.0026	10	0.02654	T	1	-2.3984	9.7287	0.40348	0.3521:0.6479:0.0:0.0	.	291;229;287	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	M	287;33	ENSP00000365962:T287M;ENSP00000444091:T33M	ENSP00000365962:T287M	T	+	2	0	0	TBC1D25	48303100	48303100	0.998000	0.40836	0.967000	0.41034	0.807000	0.45602	3.928000	0.56506	2.499000	0.84300	0.529000	0.55759	ACG	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.627	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	0	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	2	-9.311809	1	0.130000	NM_002536		0	7	7	0	193	192	0		1	0		0	0	36	0	0	0.980828	2.188141e-01	0	0	0	22	0	7	193
TFE3	7030	broad.mit.edu	37	X	48896768	48896768	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:48896768C>T	ENST00000315869.7	-	3	657	c.398G>A	c.(397-399)cGt>cAt	p.R133H	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	133					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						CTGTTCCCGACGCTCACGCCT	0.662			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																	ENST00000315869.7	1.000000	0.250000	1.000000	0.440000	0.710000	0.713265	0.710000	1.000000				Dom	yes			Dom	yes		X	Xp11.22	Xp11.22	7030	T	transcription factor binding to IGHM enhancer 3				E	E	SFPQ, ASPSCR1, PRCC, NONO, CLTC		papillary renal, alveolar soft part sarcoma, renal	NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	0				1						c.(397-399)cGt>cAt		transcription factor binding to IGHM enhancer 3							23.0	22.0	22.0					X																	48896768		2200	4295	6495	SO:0001583	missense	7030	0	0					g.chrX:48896768C>T	X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.398G>A	chrX.hg19:g.48896768C>T	ENSP00000314129:p.Arg133His						TFE3_ENST00000487451.1_5'UTR	p.R133H	NM_006521.4	NP_006512.2	0	1	1		P19532	TFE3_HUMAN		3	657	-			A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Missense_Mutation	SNP	ENST00000315869.7	0	1	hg19	c.398G>A	CCDS14315.3	0	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834420	0.50951	.	.	ENSG00000068323	ENST00000315869	T	0.17370	2.28	5.36	4.49	0.54785	5.360000	4.490000	0.547850	.	0.207799	0.40554	N	0.001077	T	0.12646	0.0307	L	0.52011	1.625	0.30557	N	0.764871	P	0.49783	0.928	B	0.35813	0.211	T	0.23797	-1.0178	10	0.72032	D	0.01	-7.8369	6.4239	0.21758	0.0:0.8025:0.0:0.1975	.	133	P19532	TFE3_HUMAN	H	133	ENSP00000314129:R133H	ENSP00000314129:R133H	R	-	2	0	0	TFE3	48783712	48783712	0.253000	0.23982	0.998000	0.56505	0.716000	0.41182	0.777000	0.26718	2.224000	0.72417	0.513000	0.50165	CGT	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.662	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	0	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	2	-8.189270	1	0.130000	NM_006521		0	4	4	0	87	83	0		1	0		0	0	13	0	0	0.881091	4.734416e-01	0	0	0	31	0	4	87
SLC7A3	84889	broad.mit.edu	37	X	70146745	70146745	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:70146745T>C	ENST00000374299.3	-	9	1577	c.1433A>G	c.(1432-1434)tAt>tGt	p.Y478C	SLC7A3_ENST00000298085.4_Missense_Mutation_p.Y478C			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	478					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GGAACAAACATAGACAATTTG	0.488																																						ENST00000374299.3	0.940000	0.230000	0.730000	0.350000	0.520000	0.547459	0.520000	0.480000																										0				31						c.(1432-1434)tAt>tGt		solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						90.0	79.0	83.0					X																	70146745		2203	4300	6503	SO:0001583	missense	84889	0	0					g.chrX:70146745T>C	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1433A>G	chrX.hg19:g.70146745T>C	ENSP00000363417:p.Tyr478Cys						SLC7A3_ENST00000298085.4_Missense_Mutation_p.Y478C	p.Y478C			0	1	1		Q8WY07	CTR3_HUMAN		9	1577	-	Renal(35;0.156)		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	0	1	hg19	c.1433A>G	CCDS14404.1	0	.	.	.	.	.	.	.	.	.	.	T	13.07	2.126783	0.37533	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88431	-2.38;-2.38	5.31	5.31	0.75309	5.310000	5.310000	0.753090	.	0.111999	0.64402	D	0.000006	D	0.89626	0.6769	M	0.86028	2.79	0.52099	D	0.999945	B	0.26081	0.141	B	0.25759	0.063	D	0.88089	0.2812	10	0.51188	T	0.08	.	13.061	0.59008	0.0:0.0:0.0:1.0	.	478	Q8WY07	CTR3_HUMAN	C	478	ENSP00000363417:Y478C;ENSP00000298085:Y478C	ENSP00000298085:Y478C	Y	-	2	0	0	SLC7A3	70063470	70063470	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.912000	0.69948	1.968000	0.57251	0.430000	0.28490	TAT	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.488	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	2	-9.330272	1	0.130000	NM_032803		0	7	7	0	208	206	0		1			0	0	18	0	0	0.980475	0	0	0	0	0	0	7	208
TGIF2LX	90316	broad.mit.edu	37	X	89177404	89177404	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:89177404G>A	ENST00000561129.2	+	1	450	c.320G>A	c.(319-321)cGc>cAc	p.R107H	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.R107H			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						GCTCGCAGACGCATTCTCCCG	0.493																																						ENST00000561129.2	0.520000	0.220000	0.440000	0.280000	0.350000	0.363915	0.350000	0.350000																										0				40						c.(319-321)cGc>cAc		TGFB-induced factor homeobox 2-like, X-linked							136.0	123.0	127.0					X																	89177404		2203	4300	6503	SO:0001583	missense	90316	0	0					g.chrX:89177404G>A	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.320G>A	chrX.hg19:g.89177404G>A	ENSP00000453704:p.Arg107His						TGIF2LX_ENST00000283891.5_Missense_Mutation_p.R107H	p.R107H			0	1	1		Q8IUE1	TF2LX_HUMAN		1	450	+			Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	0	1	hg19	c.320G>A	CCDS14459.1	0	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041557	0.55003	.	.	ENSG00000153779	ENST00000283891	D	0.98617	-5.03	3.08	2.18	0.27775	3.080000	2.180000	0.277750	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	.	.	.	.	D	0.99245	0.9737	H	0.96048	3.76	0.18873	N	0.999989	D	0.76494	0.999	D	0.70227	0.968	D	0.95720	0.8765	8	.	.	.	-22.4853	8.1044	0.30877	0.1341:0.0:0.8659:0.0	.	107	Q8IUE1	TF2LX_HUMAN	H	107	ENSP00000355119:R107H	.	R	+	2	0	0	TGIF2LX	89064060	89064060	0.232000	0.23762	0.001000	0.08648	0.285000	0.27093	3.495000	0.53280	0.663000	0.31027	0.513000	0.50165	CGC	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.493	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	0	0	1	2	2	2	2	0	0	0	0	108	108	108	126	1	2	-2.560905	1	0.130000	NM_138960		0	20	18	0	859	822	0		1			0	0	108	0	0	0.999992	0	0	0	0	0	0	20	859
FRMD7	90167	broad.mit.edu	37	X	131216469	131216469	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A4P5-01A-11D-A26I-08	TCGA-FB-A4P5-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c284834-b0e8-490a-a7c7-e7b880122282	e9984562-78e0-444d-92ca-64a3135fb628	g.chrX:131216469G>A	ENST00000298542.4	-	9	1002	c.827C>T	c.(826-828)gCt>gTt	p.A276V	FRMD7_ENST00000370879.1_Missense_Mutation_p.A156V|FRMD7_ENST00000464296.1_Missense_Mutation_p.A261V	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	276	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					CCTGAAGAAAGCATGGTATTC	0.468																																						ENST00000298542.4	0.550000	0.300000	0.490000	0.350000	0.410000	0.428266	0.410000	0.420000																										0				24						c.(826-828)gCt>gTt		FERM domain containing 7							220.0	208.0	212.0					X																	131216469		2203	4300	6503	SO:0001583	missense	90167	0	0					g.chrX:131216469G>A	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.827C>T	chrX.hg19:g.131216469G>A	ENSP00000298542:p.Ala276Val						FRMD7_ENST00000370879.1_Missense_Mutation_p.A156V|FRMD7_ENST00000464296.1_Missense_Mutation_p.A261V	p.A276V	NM_194277.2	NP_919253.1	0	1	1		Q6ZUT3	FRMD7_HUMAN		9	1002	-	Acute lymphoblastic leukemia(192;0.000127)		C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	1	1	hg19	c.827C>T	CCDS35397.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.112065	0.94339	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.87650	-2.28;-2.28;-2.28	5.2	5.2	0.72013	5.200000	5.200000	0.720130	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.116646	0.56097	D	0.000024	D	0.94686	0.8286	M	0.90019	3.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	D	0.95702	0.8750	10	0.87932	D	0	.	16.9793	0.86323	0.0:0.0:1.0:0.0	.	261;276	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	V	156;276;261	ENSP00000359916:A156V;ENSP00000298542:A276V;ENSP00000417996:A261V	ENSP00000298542:A276V	A	-	2	0	0	FRMD7	131044150	131044150	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.813000	0.99286	2.305000	0.77605	0.544000	0.68410	GCT	0.130000		TCGA-FB-A4P5-01A-11D-A26I-08	0.468	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	0	0	1	2	2	2	2	0	0	0	0	175	175	175	175	1	2	-3.378389	1	0.130000	NM_194277		0	41	41	0	1459	1447	0		1			0	0	175	0	0	1.000000	0	0	0	0	0	0	41	1459
