#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
MBIP	51562	broad.mit.edu	37	14	36783734	36783735	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr14:36783734_36783735insT	ENST00000416007.4	-	4	641_642	c.554_555insA	c.(553-555)gttfs	p.V185fs	MBIP_ENST00000359527.7_Frame_Shift_Ins_p.V185fs|MBIP_ENST00000603913.1_5'Flank|MBIP_ENST00000318473.7_Frame_Shift_Ins_p.V185fs	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	185	Interaction with MAP3K12.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		TACAATCAATAACATTGCAAAA	0.277																																						ENST00000416007.4	0.840000	3.900000e-01	0.720000	0.480000	0.590000	0.604070	0.590000	0.580000																										0				8						c.(553-555)gttfs		MAP3K12 binding inhibitory protein 1																																				SO:0001589	frameshift_variant	51562	0	0					g.chr14:36783734_36783735insT	BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.554_555insA	chr14.hg19:g.36783734_36783735insT	ENSP00000399718:p.Val185fs	0					MBIP_ENST00000318473.7_Frame_Shift_Ins_p.V185fs|MBIP_ENST00000603913.1_5'Flank|MBIP_ENST00000359527.7_Frame_Shift_Ins_p.V185fs	p.V185fs	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	1	2	3	2.049610	Q9NS73	MBIP1_HUMAN	Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	4	641_642	-	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Frame_Shift_Ins	INS	ENST00000416007.4	0	1	hg19	c.554_555insA	CCDS9658.1	0																																																																																								0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.277	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276685.2	1	0	1		2	2		0	0	0	0	24	0	24	24	1	1.940000	-20.000000	1	0.550000	NM_016586		0	22	22	0	114	114	0	0	1	0		0	0	24	0	0	0.999999	9.101949e-01		1	0	23	0	22	114
CDKN2A	1029	broad.mit.edu	37	9	21971143	21971152	+	Frame_Shift_Del	DEL	CAGTTGGGCT	CAGTTGGGCT	-	rs559848002|rs372670098		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			CAGTTGGGCT	-	CAGTTGGGCT	CAGTTGGGCT		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr9:21971143_21971152delCAGTTGGGCT	ENST00000304494.5	-	2	476_485	c.206_215delAGCCCAACTG	c.(205-216)gagcccaactgcfs	p.EPNC69fs	RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000498628.2_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000497750.1_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.GAQL83fs|CDKN2A_ENST00000479692.2_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.EPNC69fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.EPNC69fs|CDKN2A_ENST00000579755.1_Frame_Shift_Del_p.GAQL83fs|CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.GAQL124fs|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.EPNC69fs|CDKN2A_ENST00000578845.2_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000494262.1_Frame_Shift_Del_p.EPNC18fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	69			E -> G (found in some patients with melanoma; partial loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.|E -> K (in a bladder tumor).|E -> V (in a lung tumor).|Missing (in melanoma; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.E69V(3)|p.N71K(3)|p.P70L(2)|p.C72fs*74(2)|p.N71D(2)|p.E61fs*49(2)|p.N71fs*50(1)|p.P70A(1)|p.V59fs*45(1)|p.P70S(1)|p.N71N(1)|p.N71I(1)|p.E61fs*50(1)|p.C72S(1)|p.C72Y(1)|p.C72fs*71(1)|p.L65fs*38(1)|p.L65fs*77(1)|p.C72G(1)|p.A68fs*3(1)|p.0(1)|p.L127fs*>47(1)|p.L63fs*75(1)|p.E69fs*51(1)|p.Q126R(1)|p.R122fs*49(1)|p.E61_L94del(1)|p.N71fs*1(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GGGGTCGGCGCAGTTGGGCTCCGCGCCGTG	0.719		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	0.710000	3.000000e-01	0.600000	0.380000	0.480000	0.499702	0.480000	0.480000		17																								1395	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(17)|Deletion - Frameshift(13)|Insertion - Frameshift(2)|Deletion - In frame(1)|Complex - frameshift(1)|Substitution - coding silent(1)	p.0?(1315)|p.?(44)|p.E69V(3)|p.N71K(3)|p.P70L(2)|p.C72fs*74(2)|p.N71D(2)|p.E61fs*49(2)|p.N71fs*50(1)|p.P70A(1)|p.V59fs*45(1)|p.P70S(1)|p.N71N(1)|p.N71I(1)|p.E61fs*50(1)|p.C72S(1)|p.C72Y(1)|p.C72fs*71(1)|p.L65fs*38(1)|p.L65fs*77(1)|p.C72G(1)|p.A68fs*3(1)|p.0(1)|p.L127fs*>47(1)|p.L63fs*75(1)|p.E69fs*51(1)|p.Q126R(1)|p.R122fs*49(1)|p.E61_L94del(1)|p.N71fs*1(1)	haematopoietic_and_lymphoid_tissue(286)|skin(178)|central_nervous_system(168)|lung(148)|urinary_tract(91)|bone(74)|upper_aerodigestive_tract(61)|soft_tissue(57)|oesophagus(56)|pleura(51)|ovary(37)|pancreas(34)|kidney(32)|breast(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|endometrium(3)|vulva(2)|prostate(2)	4199	GRCh37	CD044135|CM023691|CM040398|CM065061|CM940228|CM980328|CM983987	CDKN2A|p14arf	D|M		c.(205-216)gagcccaactgcfs		cyclin-dependent kinase inhibitor 2A																																				SO:0001589	frameshift_variant	1029	0	0					g.chr9:21971143_21971152delCAGTTGGGCT	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.206_215delAGCCCAACTG	chr9.hg19:g.21971143_21971152delCAGTTGGGCT	ENSP00000307101:p.Glu69fs	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.GAQL83fs|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.EPNC69fs|CDKN2A_ENST00000579755.1_Frame_Shift_Del_p.GAQL83fs|CDKN2A_ENST00000494262.1_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000497750.1_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000578845.2_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.EPNC69fs|CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.GAQL124fs|CDKN2A_ENST00000498628.2_Frame_Shift_Del_p.EPNC18fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.EPNC69fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Frame_Shift_Del_p.EPNC18fs	p.EPNC69fs	NM_000077.4	NP_000068.1	0	1	1	1.485344	P42771	CD2A1_HUMAN		2	476_485	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	ENST00000304494.5	0	1	hg19	c.206_215delAGCCCAACTG	CCDS6510.1	0																																																																																								0.379310		TCGA-FB-A78T-01A-12D-A32N-08	0.719	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1		16	2	2	0	0	0	2	26	0	26	28	1	1.940000	-20.000000	1	0.550000	NM_000077		0	16	26	0	70	75	0	0	1	0	1	0	0	26	38	0	0.745196	9.999871e-01	9.997617e-01	0	18	97	50	16	70
MRC1	4360	broad.mit.edu	37	10	17949700	17949700	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr10:17949700G>C	ENST00000331429.2	+	28	4167	c.4064G>C	c.(4063-4065)tGt>tCt	p.C1355S																	breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GGATATATTTGTAAAAGACCA	0.373																																						ENST00000331429.2	0.210000	8.000000e-02	0.170000	0.100000	0.130000	0.146242	0.130000	0.140000																										0				14						c.(4063-4065)tGt>tCt									168.0	180.0	176.0					10																	17949700		2183	4286	6469	SO:0001583	missense	0	0	0					g.chr10:17949700G>C																												ENST00000331429.2:c.4064G>C	chr10.hg19:g.17949700G>C	ENSP00000332124:p.Cys1355Ser	0						p.C1355S			1	2	3	2.059689				28	4167	+				Missense_Mutation	SNP	ENST00000331429.2	0	1	hg19	c.4064G>C		0	.	.	.	.	.	.	.	.	.	.	.	18.38	3.612124	0.66672	.	.	ENSG00000183748	ENST00000331429	D	0.97688	-4.49	4.04	4.04	0.47022	4.04	4.04	0.47022	.	0.000000	0.64402	U	0.000012	D	0.98654	0.9549	.	.	.	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.99797	1.1034	8	0.87932	D	0	-10.5846	16.4284	0.83832	0.0:0.0:1.0:0.0	.	1355	B9EJA8	.	S	1355	ENSP00000332124:C1355S	ENSP00000332124:C1355S	C	+	2	0	0	AL928580.1	17989706	17989706	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.223000	0.78033	2.086000	0.62901	0.508000	0.49915	TGT	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.373	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1	0	0	1	2	2	2	2	0	0	0	0	141	141	141	152	1	1.940000	-3.702262	1	0.550000			0	23	23	0	611	591	0		1	0		0	0	141	0	0	0.999999	4.436704e-01	0	0	0	40	0	23	611
ATRNL1	26033	broad.mit.edu	37	10	117061456	117061456	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr10:117061456G>C	ENST00000355044.3	+	17	2847	c.2721G>C	c.(2719-2721)atG>atC	p.M907I	ATRNL1_ENST00000303745.7_5'Flank|ATRNL1_ENST00000423111.2_Missense_Mutation_p.M4I	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	907	PSI 4.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGGAGTGTATGTGGTGCAGCA	0.453																																						ENST00000355044.3	1.000000	7.700000e-01	1.000000	0.860000	0.970000	0.946177	0.970000	1.000000																										0				95						c.(2719-2721)atG>atC		attractin-like 1							283.0	203.0	230.0					10																	117061456		2203	4300	6503	SO:0001583	missense	26033	0	0					g.chr10:117061456G>C	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2721G>C	chr10.hg19:g.117061456G>C	ENSP00000347152:p.Met907Ile	0					ATRNL1_ENST00000303745.7_5'Flank|ATRNL1_ENST00000423111.2_Missense_Mutation_p.M4I	p.M907I	NM_207303.2	NP_997186.1	1	2	3	2.081957	Q5VV63	ATRN1_HUMAN		17	2847	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	1	1	hg19	c.2721G>C	CCDS7592.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.24|19.24	3.789583|3.789583	0.70337|0.70337	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;T|.	0.21932|.	2.34;1.98|.	5.64|5.64	5.64|5.64	0.86602|0.86602	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68668|0.68668	0.3026|0.3026	L|L	0.45228|0.45228	1.405|1.405	0.80722|0.80722	D|D	1|1	P;D|.	0.54964|.	0.936;0.969|.	P;D|.	0.70227|.	0.885;0.968|.	T|T	0.63413|0.63413	-0.6643|-0.6643	10|5	0.30854|.	T|.	0.27|.	-11.4902|-11.4902	19.7031|19.7031	0.96063|0.96063	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4;907|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	I|L	907;4|37	ENSP00000347152:M907I;ENSP00000409624:M4I|.	ENSP00000347152:M907I|.	M|V	+|+	3|1	0|0	0|0	ATRNL1|ATRNL1	117051446|117051446	117051446|117051446	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.754000|9.754000	0.98908|0.98908	2.664000|2.664000	0.90586|0.90586	0.591000|0.591000	0.81541|0.81541	ATG|GTG	0.556104		TCGA-FB-A78T-01A-12D-A32N-08	0.453	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.940000	-5.492914	1	0.550000	XM_049349		0	67	67	0	188	187	1		1	0		0	0	64	0	0	1.000000	0	0	0	0	1	0	67	188
CASP1	834	broad.mit.edu	37	11	104904955	104904955	+	Missense_Mutation	SNP	C	C	T	rs2509649		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:104904955C>T	ENST00000533400.1	-	2	289	c.254G>A	c.(253-255)gGg>gAg	p.G85E	CASP1_ENST00000393136.4_Missense_Mutation_p.G85E|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000436863.3_Missense_Mutation_p.G85E|CASP1_ENST00000528974.1_Missense_Mutation_p.G46E|CASP1_ENST00000527979.1_Missense_Mutation_p.G69E|CASP1_ENST00000526568.1_Intron|CASP1_ENST00000525825.1_Missense_Mutation_p.G85E|CASP1_ENST00000598974.1_Missense_Mutation_p.G85E|CASP1_ENST00000593315.1_Missense_Mutation_p.G85E|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000415981.2_Intron	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	85	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)	p.G85E(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	TCCCAGCGTCCCTGCCAGGTA	0.468																																					NSCLC(41;1246 1743 4934)	ENST00000533400.1	0.070000	0	0.050000	0.020000	0.030000	0.040314	0.030000	0.040000																										2	Substitution - Missense(2)	p.G85E(2)	NS(1)|endometrium(1)	5						c.(253-255)gGg>gAg		caspase 1, apoptosis-related cysteine peptidase	Minocycline(DB01017)						185.0	166.0	172.0					11																	104904955		2202	4299	6501	SO:0001583	missense	834	6	121412	33				g.chr11:104904955C>T	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.254G>A	chr11.hg19:g.104904955C>T	ENSP00000433138:p.Gly85Glu	1					CASP1_ENST00000353247.5_Intron|CASP1_ENST00000598974.1_Missense_Mutation_p.G85E|CASP1_ENST00000436863.3_Missense_Mutation_p.G85E|CASP1_ENST00000528974.1_Missense_Mutation_p.G46E|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000593315.1_Missense_Mutation_p.G85E|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000525825.1_Missense_Mutation_p.G85E|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000526568.1_Intron|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000527979.1_Missense_Mutation_p.G69E|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000393136.4_Missense_Mutation_p.G85E	p.G85E	NM_001257118.1	NP_001244047.1	0	1	1	1.512023	P29466	CASP1_HUMAN		2	289	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	0	1	hg19	c.254G>A	CCDS8330.1	0	.	.	.	.	.	.	.	.	.	.	.	0.205	-1.041669	0.02013	.	.	ENSG00000137752	ENST00000527979;ENST00000533400;ENST00000436863;ENST00000393136;ENST00000525825;ENST00000528974	T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16	4.83	-8.48	0.00935	4.83	-8.48	0.00935	DEATH-like (2);Caspase Recruitment (3);	0.759254	0.12546	N	0.459494	T	0.05823	0.0152	N	0.05608	-0.01	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.003;0.001;0.0;0.001;0.001	T	0.38908	-0.9639	10	0.02654	T	1	.	8.2173	0.31519	0.0:0.3778:0.1052:0.517	rs2509649	85;46;85;85;69	B4DKN4;B4DVD8;P29466-2;P29466;G3V169	.;.;.;CASP1_HUMAN;.	E	69;85;85;85;85;46	ENSP00000432340:G69E;ENSP00000433138:G85E;ENSP00000410076:G85E;ENSP00000376844:G85E;ENSP00000434779:G85E;ENSP00000434259:G46E	ENSP00000376844:G85E	G	-	2	0	0	CASP1	104410165	104410165	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.454000	0.06770	-1.188000	0.02705	-1.472000	0.01007	GGG	0.381656		TCGA-FB-A78T-01A-12D-A32N-08	0.468	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	0	0	1	2	11	3	2	1	1	1	1	162	162	162	160	1	1.940000	-1.774916	0	0.550000	NM_033292		0	6	6	0	450	435	0		0	0		1	0	162	0	0	0.145984	3.261431e-02	0	0	0	42	0	6	450
PSMA1	5682	broad.mit.edu	37	11	14536026	14536026	+	Missense_Mutation	SNP	C	C	T	rs371834255		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:14536026C>T	ENST00000396394.2	-	5	662	c.266G>A	c.(265-267)cGt>cAt	p.R89H	PSMA1_ENST00000555531.1_Missense_Mutation_p.R89H|PSMA1_ENST00000396393.1_Missense_Mutation_p.R89H|PSMA1_ENST00000530457.1_Missense_Mutation_p.R64H|PSMA1_ENST00000418988.2_Missense_Mutation_p.R95H|PSMA1_ENST00000419365.2_Missense_Mutation_p.R89H	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	89					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						ACACTCCTGACGCATAAAATT	0.308																																						ENST00000396394.2	0.620000	2.000000e-01	0.480000	0.270000	0.360000	0.383872	0.360000	0.350000																										0				3						c.(265-267)cGt>cAt		proteasome (prosome, macropain) subunit, alpha type, 1		C	HIS/ARG,HIS/ARG,HIS/ARG	1,4399	2.1+/-5.4	0,1,2199	38.0	37.0	37.0		266,266,284	5.7	1.0	11		37	0,8588		0,0,4294	no	missense,missense,missense	PSMA1	NM_001143937.1,NM_002786.3,NM_148976.2	29,29,29	0,1,6493	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	89/131,89/264,95/270	14536026	1,12987	2200	4294	6494	SO:0001583	missense	5682	2	121400	26				g.chr11:14536026C>T	X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.266G>A	chr11.hg19:g.14536026C>T	ENSP00000379676:p.Arg89His	0					PSMA1_ENST00000419365.2_Missense_Mutation_p.R89H|PSMA1_ENST00000530457.1_Missense_Mutation_p.R64H|PSMA1_ENST00000418988.2_Missense_Mutation_p.R95H|PSMA1_ENST00000555531.1_Missense_Mutation_p.R89H|PSMA1_ENST00000396393.1_Missense_Mutation_p.R89H	p.R89H	NM_002786.3	NP_002777.1	1	2	3	2.055466	P25786	PSA1_HUMAN		5	662	-			A8K400|Q53YE8|Q9BRV9	Missense_Mutation	SNP	ENST00000396394.2	0	1	hg19	c.266G>A	CCDS7816.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.096602	0.94197	2.27E-4	0.0	ENSG00000129084	ENST00000419365;ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.48554	0.1506	H	0.94542	3.55	0.80722	D	1	B;P;P	0.41710	0.389;0.76;0.543	B;B;B	0.34931	0.047;0.192;0.18	T	0.66380	-0.5938	10	0.66056	D	0.02	-2.5165	19.813	0.96554	0.0:1.0:0.0:0.0	.	89;95;89	B4E0X6;P25786-2;P25786	.;.;PSA1_HUMAN	H	89;89;89;64;95	ENSP00000392242:R89H;ENSP00000379676:R89H;ENSP00000379675:R89H;ENSP00000441166:R64H;ENSP00000414359:R95H	ENSP00000379675:R89H	R	-	2	0	0	PSMA1	14492602	14492602	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.018000	0.76406	2.683000	0.91414	0.591000	0.81541	CGT	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.308	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386421.3	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.940000	-18.325790	1	0.550000	NM_002786		0	12	12	0	111	111	1		1	1		0	0	17	0	0	0.999275	9.999999e-01	0	61	0	325	0	12	111
KCNJ11	3767	broad.mit.edu	37	11	17408690	17408690	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:17408690G>A	ENST00000339994.4	-	1	1516	c.949C>T	c.(949-951)Ccc>Tcc	p.P317S	KCNJ11_ENST00000528731.1_Missense_Mutation_p.P230S|KCNJ11_ENST00000526747.1_5'Flank	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	317					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	GCTACAATGGGCACAAAGCGC	0.607											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000339994.4	0.090000	0	0.060000	0.010000	0.030000	0.052414	0.030000	0.040000																										0				16						c.(949-951)Ccc>Tcc		potassium inwardly-rectifying channel, subfamily J, member 11	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)						151.0	131.0	138.0					11																	17408690		2200	4293	6493	SO:0001583	missense	3767	0	0					g.chr11:17408690G>A	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.949C>T	chr11.hg19:g.17408690G>A	ENSP00000345708:p.Pro317Ser	0		OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	717	KCNJ11_ENST00000526747.1_5'Flank|KCNJ11_ENST00000528731.1_Missense_Mutation_p.P230S	p.P317S	NM_000525.3	NP_000516.3	1	2	3	2.055466	Q14654	KCJ11_HUMAN		1	1516	-			B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	0	1	hg19	c.949C>T	CCDS31436.1	0	.	.	.	.	.	.	.	.	.	.	G	13.40	2.227133	0.39399	.	.	ENSG00000187486	ENST00000339994;ENST00000528731	D;D	0.91996	-2.95;-2.95	5.43	5.43	0.79202	5.43	5.43	0.79202	.	0.055715	0.64402	D	0.000001	D	0.89283	0.6671	L	0.47078	1.49	0.58432	D	0.999999	P	0.34977	0.478	B	0.30646	0.118	D	0.87963	0.2731	10	0.38643	T	0.18	.	19.2428	0.93891	0.0:0.0:1.0:0.0	.	317	B2RC52	.	S	317;230	ENSP00000345708:P317S;ENSP00000434755:P230S	ENSP00000345708:P317S	P	-	1	0	0	KCNJ11	17365266	17365266	1.000000	0.71417	0.993000	0.49108	0.826000	0.46750	8.062000	0.89475	2.548000	0.85928	0.561000	0.74099	CCC	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.607	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	0	0	1	2	2	2	2	0	0	0	0	123	123	123	121	1	1.940000	-2.279353	0	0.550000	NM_000525		0	5	5	0	498	492	0		1	0		0	0	123	0	0	0.935841	1.320010e-02	0	0	0	14	0	5	498
NR1H3	10062	broad.mit.edu	37	11	47281348	47281348	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:47281348C>T	ENST00000467728.1	+	2	1288	c.50C>T	c.(49-51)gCg>gTg	p.A17V	NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000395397.3_5'UTR|NR1H3_ENST00000481889.2_5'UTR|NR1H3_ENST00000407404.1_Missense_Mutation_p.A17V|NR1H3_ENST00000441012.2_Missense_Mutation_p.A17V|NR1H3_ENST00000527949.1_5'Flank|NR1H3_ENST00000405853.3_Missense_Mutation_p.A17V|NR1H3_ENST00000405576.1_5'UTR			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	17					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						TCAGACTCTGCGGTGGAGCTG	0.632											OREG0020956	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000467728.1	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.073323	0.050000	0.060000																										0				20						c.(49-51)gCg>gTg		nuclear receptor subfamily 1, group H, member 3							37.0	37.0	37.0					11																	47281348		2201	4297	6498	SO:0001583	missense	10062	1	121406	31				g.chr11:47281348C>T	U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.50C>T	chr11.hg19:g.47281348C>T	ENSP00000420656:p.Ala17Val	0		OREG0020956	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	945	NR1H3_ENST00000481889.2_5'UTR|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000441012.2_Missense_Mutation_p.A17V|NR1H3_ENST00000405853.3_Missense_Mutation_p.A17V|NR1H3_ENST00000527949.1_5'Flank|NR1H3_ENST00000407404.1_Missense_Mutation_p.A17V|NR1H3_ENST00000395397.3_5'UTR|NR1H3_ENST00000405576.1_5'UTR	p.A17V			1	2	3	2.055466	Q13133	NR1H3_HUMAN		2	1288	+			A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	0	1	hg19	c.50C>T	CCDS7929.1	0	.	.	.	.	.	.	.	.	.	.	C	4.490	0.090832	0.08632	.	.	ENSG00000025434	ENST00000436778;ENST00000407404;ENST00000444396;ENST00000457932;ENST00000449369;ENST00000441012;ENST00000437276;ENST00000436029;ENST00000467728;ENST00000405853	T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.66	1.22	0.21188	5.66	1.22	0.21188	.	0.815641	0.10624	N	0.652953	T	0.25005	0.0607	N	0.14661	0.345	0.28499	N	0.914104	B;B;B	0.10296	0.001;0.002;0.003	B;B;B	0.08055	0.0;0.0;0.003	T	0.21759	-1.0236	10	0.30078	T	0.28	.	9.8669	0.41150	0.0:0.8063:0.0:0.1937	.	23;17;17	B4DXU5;Q13133;Q13133-2	.;NR1H3_HUMAN;.	V	17	ENSP00000403798:A17V;ENSP00000385801:A17V;ENSP00000391005:A17V;ENSP00000413095:A17V;ENSP00000415591:A17V;ENSP00000387946:A17V;ENSP00000396132:A17V;ENSP00000403696:A17V;ENSP00000420656:A17V;ENSP00000384745:A17V	ENSP00000384745:A17V	A	+	2	0	0	NR1H3	47237924	47237924	0.723000	0.28027	0.131000	0.22000	0.025000	0.11179	1.163000	0.31798	0.341000	0.23771	0.462000	0.41574	GCG	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.632	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	1.940000	-3.191113	1	0.550000			0	5	5	0	334	333	0		1	0		0	0	73	0	0	0.937503	3.973996e-01	0	1	0	78	0	5	334
ZDHHC5	25921	broad.mit.edu	37	11	57456082	57456082	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:57456082G>A	ENST00000287169.3	+	4	1691	c.329G>A	c.(328-330)cGc>cAc	p.R110H	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.R57H	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	110					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						GCCACCTGCCGCTTTTACCGT	0.522																																						ENST00000287169.3	1.000000	1.000000e-02	0.100000	0.030000	0.060000	0.097699	0.060000	0.060000																										0				18						c.(328-330)cGc>cAc		zinc finger, DHHC-type containing 5							113.0	93.0	100.0					11																	57456082		2201	4296	6497	SO:0001583	missense	25921	3	121412	33				g.chr11:57456082G>A	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.329G>A	chr11.hg19:g.57456082G>A	ENSP00000287169:p.Arg110His	0					ZDHHC5_ENST00000527985.1_Missense_Mutation_p.R57H	p.R110H	NM_015457.2	NP_056272.2	1	2	3	2.075358	Q9C0B5	ZDHC5_HUMAN		4	1691	+			Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	ENST00000287169.3	0	1	hg19	c.329G>A	CCDS7965.1	0	.	.	.	.	.	.	.	.	.	.	G	10.58	1.389594	0.25118	.	.	ENSG00000156599	ENST00000527985;ENST00000287169;ENST00000528177;ENST00000532842;ENST00000529447	D;D;D;D;D	0.96041	-3.89;-3.89;-3.89;-3.89;-3.89	5.02	4.11	0.48088	5.02	4.11	0.48088	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.84397	0.5463	N	0.01809	-0.71	0.80722	D	1	B	0.26445	0.149	B	0.27076	0.076	T	0.79557	-0.1754	10	0.13470	T	0.59	-5.0695	9.536	0.39222	0.1612:0.0:0.8388:0.0	.	110	Q9C0B5	ZDHC5_HUMAN	H	57;110;8;8;36	ENSP00000432202:R57H;ENSP00000287169:R110H;ENSP00000431209:R8H;ENSP00000435593:R8H;ENSP00000435722:R36H	ENSP00000287169:R110H	R	+	2	0	0	ZDHHC5	57212658	57212658	1.000000	0.71417	0.966000	0.40874	0.990000	0.78478	4.362000	0.59467	1.355000	0.45865	0.561000	0.74099	CGC	0.554896		TCGA-FB-A78T-01A-12D-A32N-08	0.522	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1	0	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	1.940000	-3.118173	1	0.550000	NM_015457		0	5	5	0	303	303	0		1	0		0	0	78	0	0	0.938036	4.778097e-01	0	1	0	86	0	5	303
MEN1	4221	broad.mit.edu	37	11	64577300	64577300	+	Silent	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:64577300G>A	ENST00000337652.1	-	2	785	c.282C>T	c.(280-282)acC>acT	p.T94T	MEN1_ENST00000377326.3_Silent_p.T94T|MEN1_ENST00000443283.1_Silent_p.T94T|MEN1_ENST00000315422.4_Silent_p.T94T|MEN1_ENST00000377321.1_Silent_p.T94T|MEN1_ENST00000394376.1_Silent_p.T94T|MEN1_ENST00000377313.1_Silent_p.T94T|MEN1_ENST00000377316.2_Silent_p.T94T|MEN1_ENST00000394374.2_Silent_p.T94T|MEN1_ENST00000312049.6_Silent_p.T94T	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	94			Missing (in MEN1). {ECO:0000269|PubMed:17555499}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.A95fs*24(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						GGATCTGGGCGGTGAAGCGGG	0.647			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)	ENST00000337652.1	0.250000	2.000000e-02	0.160000	0.050000	0.100000	0.121655	0.100000	0.100000			yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	11q13	4221	D, Mis, N, F, S	multiple endocrine neoplasia type 1 gene				E	E		parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid	parathyroid tumors, Pancreatic neuroendocrine tumors		1	Deletion - Frameshift(1)	p.A95fs*24(1)	pancreas(1)	337						c.(280-282)acC>acT		multiple endocrine neoplasia I							33.0	38.0	36.0					11																	64577300		2201	4297	6498	SO:0001819	synonymous_variant	4221	2	121386	31	Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	g.chr11:64577300G>A	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.282C>T	chr11.hg19:g.64577300G>A		0					MEN1_ENST00000443283.1_Silent_p.T94T|MEN1_ENST00000377326.3_Silent_p.T94T|MEN1_ENST00000394376.1_Silent_p.T94T|MEN1_ENST00000315422.4_Silent_p.T94T|MEN1_ENST00000377313.1_Silent_p.T94T|MEN1_ENST00000312049.6_Silent_p.T94T|MEN1_ENST00000377321.1_Silent_p.T94T|MEN1_ENST00000377316.2_Silent_p.T94T|MEN1_ENST00000394374.2_Silent_p.T94T	p.T94T	NM_130803.2	NP_570715	1	2	3	2.064088	O00255	MEN1_HUMAN		2	785	-			A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000337652.1	0	1	hg19	c.282C>T	CCDS8083.1	0																																																																																								0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.647	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1	0	0	1	2	2	2	2	0	0	0	0	22	22	22	21	1	1.940000	-6.157350	1	0.550000			0	4	4	0	155	153	0		1	0		0	0	22	0	0	0.888386	6.288170e-01	0	0	0	76	0	4	155
NPAS4	266743	broad.mit.edu	37	11	66188745	66188745	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:66188745C>T	ENST00000311034.2	+	1	271	c.95C>T	c.(94-96)gCg>gTg	p.A32V		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	32	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CTGGCCGAAGCGGACAAGGTC	0.647																																						ENST00000311034.2	0.160000	2.000000e-02	0.120000	0.040000	0.070000	0.088529	0.070000	0.080000																										0				49						c.(94-96)gCg>gTg		neuronal PAS domain protein 4							66.0	53.0	57.0					11																	66188745		2200	4295	6495	SO:0001583	missense	266743	0	0					g.chr11:66188745C>T	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.95C>T	chr11.hg19:g.66188745C>T	ENSP00000311196:p.Ala32Val	1						p.A32V	NM_178864.3	NP_849195.2	0	1	1	1.516217	Q8IUM7	NPAS4_HUMAN		1	271	+			B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	0	1	hg19	c.95C>T	CCDS8138.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.313768	0.95655	.	.	ENSG00000174576	ENST00000311034	T	0.51071	0.72	5.19	5.19	0.71726	5.19	5.19	0.71726	Helix-loop-helix DNA-binding (1);	0.228511	0.31102	N	0.008255	T	0.42314	0.1197	N	0.14661	0.345	0.54753	D	0.99998	D	0.63880	0.993	P	0.53490	0.727	T	0.41016	-0.9532	10	0.62326	D	0.03	-4.3398	11.8591	0.52454	0.0:0.8243:0.1757:0.0	.	32	Q8IUM7	NPAS4_HUMAN	V	32	ENSP00000311196:A32V	ENSP00000311196:A32V	A	+	2	0	0	NPAS4	65945321	65945321	0.998000	0.40836	0.999000	0.59377	0.948000	0.59901	1.746000	0.38288	2.691000	0.91804	0.563000	0.77884	GCG	0.379310		TCGA-FB-A78T-01A-12D-A32N-08	0.647	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	0	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	1.940000	-3.681346	1	0.550000	NM_178864		0	5	5	0	170	169	0		1			0	0	59	0	0	0.937511	0	0	0	0	0	0	5	170
ARAP1	116985	broad.mit.edu	37	11	72406856	72406856	+	Silent	SNP	C	C	G			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:72406856C>G	ENST00000393609.3	-	24	3529	c.3327G>C	c.(3325-3327)gtG>gtC	p.V1109V	ARAP1_ENST00000455638.2_Silent_p.V1109V|ARAP1_ENST00000429686.1_Silent_p.V803V|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000393605.3_Silent_p.V869V|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000359373.5_Silent_p.V1109V|ARAP1_ENST00000334211.8_Silent_p.V864V|ARAP1_ENST00000426523.1_Silent_p.V864V	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1109	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TGGGCCCAAACACAATTGCCA	0.552																																					Ovarian(102;1198 1520 13195 17913 37529)	ENST00000393609.3	0.390000	1.100000e-01	0.310000	0.160000	0.230000	0.242899	0.230000	0.220000																										0				27						c.(3325-3327)gtG>gtC		ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1							124.0	91.0	102.0					11																	72406856		2200	4293	6493	SO:0001819	synonymous_variant	116985	0	0					g.chr11:72406856C>G	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3327G>C	chr11.hg19:g.72406856C>G		1					ARAP1_ENST00000429686.1_Silent_p.V803V|ARAP1_ENST00000426523.1_Silent_p.V864V|ARAP1_ENST00000334211.8_Silent_p.V864V|ARAP1_ENST00000393605.3_Silent_p.V869V|ARAP1_ENST00000455638.2_Silent_p.V1109V|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000359373.5_Silent_p.V1109V|ARAP1-AS1_ENST00000542022.1_RNA	p.V1109V	NM_001040118.2	NP_001035207.1	0	1	1	1.507829	Q96P48	ARAP1_HUMAN		24	3529	-			A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	ENST00000393609.3	1	1	hg19	c.3327G>C	CCDS41687.1	0																																																																																								0.390863		TCGA-FB-A78T-01A-12D-A32N-08	0.552	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	1	0	1	2	2	2	2	0	0	0	0	40	40	40	39	1	1.940000	-14.376700	1	0.550000	NM_001040118		0	9	9	0	98	97	0		1	1		0	0	40	0	0	0.994649	9.994930e-01	0	14	0	152	0	9	98
TEX12	56158	broad.mit.edu	37	11	112040055	112040055	+	Splice_Site	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr11:112040055G>A	ENST00000280358.4	+	2	195		c.e2+1		RP11-356J5.4_ENST00000527589.1_RNA|AP002884.3_ENST00000532612.1_5'Flank|TEX12_ENST00000530752.1_Splice_Site|SDHD_ENST00000532699.1_Intron|SDHD_ENST00000525468.1_Splice_Site	NM_031275.4	NP_112565.1	Q9BXU0	TEX12_HUMAN	testis expressed 12						meiotic DNA repair synthesis (GO:0000711)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				endometrium(1)|large_intestine(2)|lung(1)	4		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.2e-06)|BRCA - Breast invasive adenocarcinoma(274;1.4e-06)|all cancers(92;1.97e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		AGAATTGGAGGTAAGCTGTAT	0.373																																						ENST00000280358.4	0.090000	1.000000e-02	0.060000	0.020000	0.030000	0.046483	0.030000	0.040000																										0				4						c.e2+1		testis expressed 12							205.0	221.0	216.0					11																	112040055		2201	4297	6498	SO:0001630	splice_region_variant	56158	0	0					g.chr11:112040055G>A	AF285600	CCDS31679.1	11q23.1	2013-09-20	2007-03-13						11734	protein-coding gene	gene with protein product		605791	"""testis expressed sequence 12"""			11279525	Standard	NM_031275		Approved		uc001pnc.3	Q9BXU0		ENST00000280358.4:c.63+1G>A	chr11.hg19:g.112040055G>A		1					TEX12_ENST00000530752.1_Splice_Site|RP11-356J5.4_ENST00000527589.1_RNA|AP002884.3_ENST00000532612.1_5'Flank|SDHD_ENST00000532699.1_Intron|SDHD_ENST00000525468.1_Splice_Site		NM_031275.4	NP_112565.1	0	1	1	1.512023	Q9BXU0	TEX12_HUMAN		2	195	+		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	A6NDL9|B0YIX3	Splice_Site	SNP	ENST00000280358.4	0	1	hg19		CCDS31679.1	0	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289894	0.23478	.	.	ENSG00000150783	ENST00000530752;ENST00000280358	.	.	.	5.24	5.24	0.73138	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.511	0.67787	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	TEX12	111545265	111545265	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	4.383000	0.59600	2.880000	0.98712	0.650000	0.86243	.	0.381656		TCGA-FB-A78T-01A-12D-A32N-08	0.373	TEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392417.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	104	1	1.940000	-2.583959	1	0.550000		Intron	0	5	5	0	333	332	0		1			0	0	104	0	0	0.937503	0	0	0	0	0	0	5	333
BRAP	8315	broad.mit.edu	37	12	112103575	112103575	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:112103575A>T	ENST00000327551.6	-	6	814	c.674T>A	c.(673-675)gTg>gAg	p.V225E	BRAP_ENST00000539060.1_Missense_Mutation_p.V76E|BRAP_ENST00000419234.4_Missense_Mutation_p.V255E			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						CAGGTCCATCACTGGGAGGCT	0.502																																					Pancreas(146;846 1904 7830 25130 26065)	ENST00000327551.6	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.064636	0.050000	0.060000																										0				20						c.(673-675)gTg>gAg		BRCA1 associated protein							116.0	83.0	94.0					12																	112103575		2203	4300	6503	SO:0001583	missense	8315	0	0					g.chr12:112103575A>T	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.674T>A	chr12.hg19:g.112103575A>T	ENSP00000330813:p.Val225Glu	0					BRAP_ENST00000419234.4_Missense_Mutation_p.V255E|BRAP_ENST00000539060.1_Missense_Mutation_p.V76E	p.V225E			0	0	0	2.002479	Q6UWU4	CF089_HUMAN		6	814	-			B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000327551.6	0	1	hg19	c.674T>A		0	.	.	.	.	.	.	.	.	.	.	A	15.64	2.892889	0.52121	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	T;T;T	0.47177	0.85;0.94;0.86	5.22	5.22	0.72569	5.22	5.22	0.72569	BRCA1-associated 2 (1);	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.68483	0.954;0.958	T	0.55153	-0.8185	10	0.07325	T	0.83	-17.4067	15.0833	0.72130	1.0:0.0:0.0:0.0	.	76;255	B4DRM1;Q7Z569	.;BRAP_HUMAN	E	255;76;225;37	ENSP00000403524:V255E;ENSP00000441659:V76E;ENSP00000330813:V225E	ENSP00000330813:V225E	V	-	2	0	0	BRAP	110587958	110587958	1.000000	0.71417	0.990000	0.47175	0.852000	0.48524	8.773000	0.91762	1.967000	0.57214	0.254000	0.18369	GTG	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.502	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2	0	0	0	2	17	2	2	0	0	0	1	52	52	52	51	1	1.940000	-5.255748	1	0.550000			0	4	1	0	271	269	0		0	0		0	0	52	0	0	0.002643	1.322653e-01	0	0	0	34	0	4	271
NANOG	79923	broad.mit.edu	37	12	7945647	7945647	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:7945647G>A	ENST00000229307.4	+	2	472	c.253G>A	c.(253-255)Gca>Aca	p.A85T	NANOG_ENST00000526286.1_Missense_Mutation_p.A85T	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	85					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		GAAGAGTGTCGCAAAAAAGGA	0.478																																						ENST00000229307.4	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.059922	0.050000	0.060000																										0				14						c.(253-255)Gca>Aca		Nanog homeobox							69.0	61.0	64.0					12																	7945647		2202	4292	6494	SO:0001583	missense	79923	1	121394	27				g.chr12:7945647G>A	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.253G>A	chr12.hg19:g.7945647G>A	ENSP00000229307:p.Ala85Thr	0					NANOG_ENST00000526286.1_Missense_Mutation_p.A85T	p.A85T	NM_024865.2	NP_079141.2	0	0	0	2.029173	Q9H9S0	NANOG_HUMAN		2	472	+			D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	ENST00000229307.4	0	1	hg19	c.253G>A	CCDS31736.1	0	.	.	.	.	.	.	.	.	.	.	.	0.035	-1.311903	0.01342	.	.	ENSG00000111704	ENST00000541267;ENST00000229307;ENST00000526286	D;D;D	0.91237	-2.81;-2.81;-2.78	4.1	0.704	0.18121	4.1	0.704	0.18121	Homeodomain-related (1);	3.012810	0.00789	N	0.001330	T	0.81230	0.4779	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.68534	-0.5383	10	0.13108	T	0.6	1.3277	8.8453	0.35166	0.3408:0.0:0.6592:0.0	.	85	Q9H9S0	NANOG_HUMAN	T	61;85;85	ENSP00000444434:A61T;ENSP00000229307:A85T;ENSP00000435288:A85T	ENSP00000229307:A85T	A	+	1	0	0	NANOG	7836914	7836914	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.200000	0.17257	-0.023000	0.13963	-1.749000	0.00680	GCA	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.478	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2	0	0	1	2	2	2	2	0	0	0	0	91	91	91	89	1	1.940000	-2.398895	0	0.550000	NM_024865		0	6	6	0	416	410	0		1			0	0	91	0	0	0.963651	0	0	0	0	0	0	6	416
KRAS	3845	broad.mit.edu	37	12	25398282	25398284	+	Missense_Mutation	TNP	CAC	CAC	AGG	rs121913535|rs121913529		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C|A|C	A|G|G	C|A|C	C|A|C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:25398282_25398284CAC>AGG	ENST00000256078.4	-	2	98_100	c.35_37GTG>CCT	c.(34-39)gGTGgc>gCCTgc	p.12_13GG>AC	KRAS_ENST00000556131.1_Missense_Mutation_p.12_13GG>AC|KRAS_ENST00000311936.3_Missense_Mutation_p.12_13GG>AC|KRAS_ENST00000557334.1_Missense_Mutation_p.12_13GG>AC	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G13C(213)|p.G13S(59)|p.G12F(46)|p.G13R(43)|p.G12G(9)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12_G13insG(3)|p.G12Y(2)|p.G12C(1)|p.G12N(1)|p.G13N(1)|p.G13I(1)|p.G12fs*3(1)|p.G12_G13insA(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TTGCCTACGCCACCAGCTCCAAC	0.345	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)|G13C(MORCPR_LUNG)|G13C(NCIH1355_LUNG)|G13C(NCIH1734_LUNG)|G13C(TOV21G_OVARY)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.800000|0.790000|0.760000	3.100000e-01|3.000000e-01|2.800000e-01	0.670000|0.660000|0.640000	0.410000|0.400000|0.380000	0.530000|0.520000|0.490000	0.545668|0.540214|0.514521	0.530000|0.520000|0.490000	0.510000|0.510000|0.490000	G13C(MORCPR_LUNG)|G13C(NCIH1355_LUNG)|G13C(NCIH1734_LUNG)|G13C(TOV21G_OVARY)||G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	16143	Substitution - Missense(16129)|Substitution - coding silent(9)|Insertion - In frame(4)|Deletion - Frameshift(1)	p.G13C(213)|p.G13S(59)|p.G13R(43)|p.G12_G13insG(3)|p.G13N(1)|p.G13I(1)|p.G12_G13insA(1)|p.G12G(9)|p.G12V(5)|p.G12E(3)|p.G12W(3)|p.G12_G13insG(3)|p.G12D(2)|p.G12C(1)|p.G13C(1)|p.G12_G13insA(1)|p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9582)|pancreas(3010)|lung(1624)|ovary(508)|biliary_tract(382)|endometrium(328)|haematopoietic_and_lymphoid_tissue(170)|stomach(138)|thyroid(68)|prostate(62)|small_intestine(43)|upper_aerodigestive_tract(34)|soft_tissue(32)|urinary_tract(31)|skin(27)|cervix(22)|liver(17)|breast(11)|oesophagus(10)|testis(9)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|thymus(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|autonomic_ganglia(2)|salivary_gland(2)|bone(1)	25349						c.(37-39)Ggc>Tgc|c.(34-36)ggT>ggC|c.(34-36)gGt>gCt		Kirsten rat sarcoma viral oncogene homolog																																				SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398282C>A|g.chr12:25398283A>G|g.chr12:25398284C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35_37GTG>CCT	chr12.hg19:g.25398282CAC>AGG	ENSP00000256078:p.G12_G13delinsAC	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G13C|KRAS_ENST00000557334.1_Missense_Mutation_p.G13C|KRAS_ENST00000311936.3_Missense_Mutation_p.G13C|KRAS_ENST00000556131.1_Silent_p.G12G|KRAS_ENST00000557334.1_Silent_p.G12G|KRAS_ENST00000311936.3_Silent_p.G12G|KRAS_ENST00000556131.1_Missense_Mutation_p.G12A|KRAS_ENST00000557334.1_Missense_Mutation_p.G12A|KRAS_ENST00000311936.3_Missense_Mutation_p.G12A	p.G13C|p.G12G|p.G12A	NM_033360.2	NP_203524.1	0	0	0	2.002479	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	100|99|98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation|Silent|Missense_Mutation	SNP	ENST00000256078.4	1|0|0	0	hg19	c.37G>T|c.36T>C|c.35G>C	CCDS8703.1	0																									5.68||5.68	5.68||5.68	0.88126||0.88126																																												0||0			25289549||25289551														0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.345	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	0	2	2	2	2	0	0	0	0	20	20	20	20	1	1.940000	-3.366330|-9.747177|-9.265699	1	0.550000	NM_033360		2435|2445|2428	14|14|13	14|14|13	5585|5559|5548	82|83|82	81|82|81	1	1	1	1	1	0	0	20	204|206|206	1	0.999819|0.999819|0.999638	8.740183e-01|8.560386e-01|8.354283e-01	1	7	65|63|63	17|16|16	283|278|276	13	82
RBMS2	5939	broad.mit.edu	37	12	56956368	56956368	+	Splice_Site	SNP	G	G	A	rs140037879		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:56956368G>A	ENST00000262031.5	+	2	328		c.e2+1		RBMS2_ENST00000552247.2_Splice_Site|RBMS2_ENST00000542360.1_Intron|RBMS2_ENST00000549945.1_Splice_Site|RBMS2_ENST00000550726.1_Intron	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						TGTGTCAGCCGTAAGTTGGAG	0.488																																						ENST00000262031.5	0.080000	0	0.060000	0.010000	0.030000	0.044356	0.030000	0.040000																										0				18						c.e2+1		RNA binding motif, single stranded interacting protein 2		G		0,4406		0,0,2203	147.0	131.0	136.0			4.7	1.0	12	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	yes	splice-5	RBMS2	NM_002898.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077			56956368	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	5939	1	121410	39				g.chr12:56956368G>A	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	ENST00000262031.5:c.233+1G>A	chr12.hg19:g.56956368G>A		0					RBMS2_ENST00000550726.1_Intron|RBMS2_ENST00000552247.2_Splice_Site|RBMS2_ENST00000542360.1_Intron|RBMS2_ENST00000549945.1_Splice_Site		NM_002898.3	NP_002889.1	0	0	0	2.002479	Q15434	RBMS2_HUMAN		2	328	+				Splice_Site	SNP	ENST00000262031.5	0	1	hg19		CCDS8923.1	0	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402870	0.83230	0.0	1.16E-4	ENSG00000076067	ENST00000262031;ENST00000552247	.	.	.	4.66	4.66	0.58398	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8474	0.85984	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	RBMS2	55242635	55242635	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.989000	0.93506	2.589000	0.87451	0.555000	0.69702	.	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.488	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409366.2	0	0	1	2	22	2	2	1	1	1	1	69	69	69	68	1	1.940000	-2.571941	1	0.550000	NM_002898	Intron	0	5	5	0	476	467	0		0	0		1	0	69	0	0	0.000538	5.330597e-04	0	0	0	3	0	5	476
GLI1	2735	broad.mit.edu	37	12	57859598	57859598	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:57859598C>T	ENST00000228682.2	+	7	743	c.652C>T	c.(652-654)Cgg>Tgg	p.R218W	GLI1_ENST00000543426.1_Missense_Mutation_p.R90W|GLI1_ENST00000546141.1_Missense_Mutation_p.R177W	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	218					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			GCTGGATGGGCGGGAGGACCT	0.552																																					Pancreas(157;841 1936 10503 41495 50368)	ENST00000228682.2	0.240000	1.000000e-01	0.200000	0.130000	0.160000	0.170959	0.160000	0.160000																										0				69						c.(652-654)Cgg>Tgg		GLI family zinc finger 1							91.0	91.0	91.0					12																	57859598		2203	4300	6503	SO:0001583	missense	2735	0	0					g.chr12:57859598C>T		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.652C>T	chr12.hg19:g.57859598C>T	ENSP00000228682:p.Arg218Trp	0					GLI1_ENST00000543426.1_Missense_Mutation_p.R90W|GLI1_ENST00000546141.1_Missense_Mutation_p.R177W	p.R218W	NM_005269.2	NP_005260.1	0	0	0	2.002479	P08151	GLI1_HUMAN	GBM - Glioblastoma multiforme(3;3.99e-32)	7	743	+			D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	1	1	hg19	c.652C>T	CCDS8940.1	0	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596133	0.66332	.	.	ENSG00000111087	ENST00000532291;ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T;T	0.74315	-0.83;2.57;2.49;2.57;2.57	4.45	2.42	0.29668	4.45	2.42	0.29668	.	0.000000	0.47093	D	0.000256	T	0.81597	0.4856	L	0.57536	1.79	0.53688	D	0.999972	D	0.89917	1.0	D	0.71414	0.973	D	0.83420	0.0032	10	0.87932	D	0	.	12.4989	0.55944	0.2978:0.7022:0.0:0.0	.	218	P08151	GLI1_HUMAN	W	90;90;218;177;177;90	ENSP00000436671:R90W;ENSP00000437607:R90W;ENSP00000228682:R218W;ENSP00000441006:R177W;ENSP00000434408:R177W	ENSP00000228682:R218W	R	+	1	2	2	GLI1	56145865	56145865	0.984000	0.35163	0.999000	0.59377	0.915000	0.54546	0.836000	0.27545	1.196000	0.43129	0.591000	0.81541	CGG	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.552	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	1	0	1	2	2	2	2	0	0	0	0	119	119	119	118	1	1.940000	-3.214541	1	0.550000	NM_005269		0	22	22	0	459	453	0		1	0		0	0	119	0	0	0.999999	6.684559e-02	0	0	0	9	0	22	459
TRHDE	29953	broad.mit.edu	37	12	72955964	72955964	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:72955964A>C	ENST00000261180.4	+	8	1769	c.1673A>C	c.(1672-1674)aAg>aCg	p.K558T	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	558					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ACCATTCATAAGTATGGTAAT	0.269																																						ENST00000261180.4	0.380000	1.200000e-01	0.310000	0.170000	0.230000	0.245424	0.230000	0.230000																										0				79						c.(1672-1674)aAg>aCg		thyrotropin-releasing hormone degrading enzyme							36.0	37.0	37.0					12																	72955964		2197	4267	6464	SO:0001583	missense	29953	0	0					g.chr12:72955964A>C	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1673A>C	chr12.hg19:g.72955964A>C	ENSP00000261180:p.Lys558Thr	0					TRHDE_ENST00000549138.1_3'UTR	p.K558T	NM_013381.2	NP_037513.1	0	0	0	2.002479	Q9UKU6	TRHDE_HUMAN		8	1769	+			A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	1	1	hg19	c.1673A>C	CCDS9004.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.16|15.16	2.751192|2.751192	0.49257|0.49257	.|.	.|.	ENSG00000072657|ENSG00000072657	ENST00000261180|ENST00000547300	T|.	0.05258|.	3.47|.	5.98|5.98	5.98|5.98	0.97165|0.97165	5.98|5.98	5.98|5.98	0.97165|0.97165	.|.	0.045759|.	0.85682|.	D|.	0.000000|.	T|.	0.75889|.	0.3911|.	M|M	0.75150|0.75150	2.29|2.29	0.47819|0.47819	D|D	0.99952|0.99952	P|.	0.40144|.	0.704|.	B|.	0.30716|.	0.119|.	T|.	0.75941|.	-0.3140|.	10|.	0.33141|.	T|.	0.24|.	.|.	16.4696|16.4696	0.84102|0.84102	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	558|.	Q9UKU6|.	TRHDE_HUMAN|.	T|Y	558|145	ENSP00000261180:K558T|.	ENSP00000261180:K558T|.	K|X	+|+	2|3	0|2	0|2	TRHDE|TRHDE	71242231|71242231	71242231|71242231	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.855000|3.855000	0.55957|0.55957	2.289000|2.289000	0.77006|0.77006	0.482000|0.482000	0.46254|0.46254	AAG|TAA	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.269	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	1	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	1.940000	-5.100022	1	0.550000	NM_013381		0	11	11	0	162	161	0		1	0		0	0	33	0	0	0.998454	2.699433e-02	0	0	0	4	0	11	162
CEP83	51134	broad.mit.edu	37	12	94761622	94761622	+	Missense_Mutation	SNP	G	G	A	rs111647062	byFrequency	TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:94761622G>A	ENST00000397809.5	-	11	1840	c.1291C>T	c.(1291-1293)Cgg>Tgg	p.R431W	CCDC41_ENST00000549352.1_5'Flank|CCDC41_ENST00000397807.2_Missense_Mutation_p.R398W|CCDC41_ENST00000339839.5_Missense_Mutation_p.R431W	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		423					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						TGTGAAGCCCGCAATTTCTCT	0.373													G|||	3	0.000599042	0.0008	0.0	5008	,	,		17571	0.0		0.002	False		,,,				2504	0.0					ENST00000397809.5	0.070000	0	0.060000	0.010000	0.030000	0.038814	0.030000	0.040000																										0				27						c.(1291-1293)Cgg>Tgg				G	TRP/ARG,TRP/ARG	1,3709		0,1,1854	149.0	137.0	141.0		1291,1291	4.9	1.0	12	dbSNP_132	141	2,8212		0,2,4105	yes	missense,missense	CCDC41	NM_001042399.1,NM_016122.2	101,101	0,3,5959	AA,AG,GG		0.0243,0.027,0.0252	probably-damaging,probably-damaging	431/702,431/702	94761622	3,11921	1855	4107	5962	SO:0001583	missense	0	50	120824	52				g.chr12:94761622G>A																												ENST00000397809.5:c.1291C>T	chr12.hg19:g.94761622G>A	ENSP00000380911:p.Arg431Trp	0					CCDC41_ENST00000549352.1_5'Flank|CCDC41_ENST00000397807.2_Missense_Mutation_p.R398W|CCDC41_ENST00000339839.5_Missense_Mutation_p.R431W	p.R431W	NM_016122.2	NP_057206.2	0	0	0	2.002479	Q9Y592	CEP83_HUMAN		11	1840	-			A4FVB1|Q08AP1	Missense_Mutation	SNP	ENST00000397809.5	0	1	hg19	c.1291C>T	CCDS41820.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.11	2.438221	0.43326	2.7E-4	2.43E-4	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807	T;T;T	0.53857	1.94;1.94;0.6	5.83	4.94	0.65067	5.83	4.94	0.65067	.	.	.	.	.	T	0.56761	0.2007	L	0.56769	1.78	0.36865	D	0.888618	D;D	0.76494	0.999;0.993	P;P	0.50896	0.653;0.534	T	0.67515	-0.5651	9	0.87932	D	0	-8.5225	10.5268	0.44954	0.0683:0.0:0.7969:0.1348	.	398;423	Q9Y592-2;Q9Y592	.;CCD41_HUMAN	W	431;431;398	ENSP00000344655:R431W;ENSP00000380911:R431W;ENSP00000380909:R398W	ENSP00000344655:R431W	R	-	1	2	2	CCDC41	93285753	93285753	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	6.105000	0.71505	1.461000	0.47929	-0.181000	0.13052	CGG	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.373	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3	0	0	1	2	15	2	2	1	1	1	1	130	130	130	128	1	1.940000	-1.807892	0	0.550000			0	5	6	0	542	530	0		0	0		1	0	130	0	0	0.017512	1.459946e-02	0	0	0	16	0	5	542
P2RX7	5027	broad.mit.edu	37	12	121592733	121592733	+	Missense_Mutation	SNP	G	G	A	rs201451288		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr12:121592733G>A	ENST00000546057.1	+	2	414	c.271G>A	c.(271-273)Gca>Aca	p.A91T	P2RX7_ENST00000541446.1_5'UTR|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000535250.1_5'UTR|P2RX7_ENST00000328963.5_5'UTR|P2RX7_ENST00000377162.2_Missense_Mutation_p.A91T	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	91					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTTTGACACCGCAGACTACAC	0.557																																						ENST00000546057.1	0.100000	0	0.070000	0.020000	0.040000	0.052428	0.040000	0.040000																										0				19						c.(271-273)Gca>Aca		purinergic receptor P2X, ligand-gated ion channel, 7							253.0	172.0	199.0					12																	121592733		2203	4300	6503	SO:0001583	missense	5027	1	121412	34				g.chr12:121592733G>A	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.271G>A	chr12.hg19:g.121592733G>A	ENSP00000442349:p.Ala91Thr	0					P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000541446.1_5'UTR|P2RX7_ENST00000535250.1_5'UTR|P2RX7_ENST00000377162.2_Missense_Mutation_p.A91T|P2RX7_ENST00000328963.5_5'UTR	p.A91T	NM_002562.5	NP_002553	0	0	0	2.002479	Q99572	P2RX7_HUMAN		2	414	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	ENST00000546057.1	0	1	hg19	c.271G>A	CCDS9213.1	0	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377781	0.61735	.	.	ENSG00000089041	ENST00000546057;ENST00000377162	T;T	0.05649	3.41;3.41	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.297398	0.28883	N	0.013825	T	0.27278	0.0669	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00653	-1.1625	10	0.87932	D	0	.	14.8617	0.70387	0.0:0.0:1.0:0.0	.	91	Q99572	P2RX7_HUMAN	T	91	ENSP00000442349:A91T;ENSP00000366367:A91T	ENSP00000261826:A91T	A	+	1	0	0	P2RX7	120077116	120077116	0.941000	0.31946	0.230000	0.23976	0.265000	0.26407	4.960000	0.63673	2.578000	0.87016	0.591000	0.81541	GCA	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.557	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	0	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	1.940000	-2.118295	0	0.550000	NM_002562		0	5	5	0	403	398	0		1	0		0	0	112	0	0	0.935863	7.380508e-04	0	0	0	3	0	5	403
LNX2	222484	broad.mit.edu	37	13	28136823	28136823	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr13:28136823C>G	ENST00000316334.3	-	5	1080	c.951G>C	c.(949-951)gaG>gaC	p.E317D		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	317	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CAAAGCGCCTCTCTCGAAGCA	0.488																																						ENST00000316334.3	0.940000	6.300000e-01	0.860000	0.700000	0.770000	0.786753	0.770000	0.780000																										0				31						c.(949-951)gaG>gaC		ligand of numb-protein X 2							124.0	118.0	120.0					13																	28136823		2203	4300	6503	SO:0001583	missense	222484	0	0					g.chr13:28136823C>G	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.951G>C	chr13.hg19:g.28136823C>G	ENSP00000325929:p.Glu317Asp	1						p.E317D	NM_153371.3	NP_699202.1	0	2	2	2.040892	Q8N448	LNX2_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	5	1080	-		Lung SC(185;0.0156)	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	1	1	hg19	c.951G>C	CCDS9323.1	0	.	.	.	.	.	.	.	.	.	.	C	28.5	4.922741	0.92319	.	.	ENSG00000139517	ENST00000316334	T	0.27890	1.64	5.88	5.04	0.67666	5.88	5.04	0.67666	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	L	0.39245	1.2	0.80722	D	1	D	0.65815	0.995	P	0.61722	0.893	T	0.16070	-1.0415	10	0.32370	T	0.25	.	14.8997	0.70670	0.0:0.9315:0.0:0.0685	.	317	Q8N448	LNX2_HUMAN	D	317	ENSP00000325929:E317D	ENSP00000325929:E317D	E	-	3	2	2	LNX2	27034823	27034823	1.000000	0.71417	0.978000	0.43139	0.988000	0.76386	3.788000	0.55446	1.480000	0.48289	0.655000	0.94253	GAG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.488	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.940000	-20.000000	1	0.550000			0	76	75	0	277	276	1		1	1		0	0	66	0	0	1.000000	9.634700e-01	0	6	0	16	0	76	277
ZIC2	7546	broad.mit.edu	37	13	100635062	100635062	+	Silent	SNP	G	G	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr13:100635062G>C	ENST00000376335.3	+	1	1037	c.744G>C	c.(742-744)cgG>cgC	p.R248R		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	248	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.				brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTATATGCGGCAGCAGTGCA	0.562																																					Pancreas(97;119 1522 31925 44771 48764)	ENST00000376335.3	0.150000	4.000000e-02	0.130000	0.060000	0.090000	0.100233	0.090000	0.100000																										0				13						c.(742-744)cgG>cgC		Zic family member 2							75.0	79.0	77.0					13																	100635062		2203	4300	6503	SO:0001819	synonymous_variant	7546	0	0					g.chr13:100635062G>C	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.744G>C	chr13.hg19:g.100635062G>C		1						p.R248R	NM_007129.3	NP_009060.2	0	2	2	2.040892	O95409	ZIC2_HUMAN		1	1037	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		Q5VYA9|Q9H309	Silent	SNP	ENST00000376335.3	1	1	hg19	c.744G>C	CCDS9495.1	0																																																																																								0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.562	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	0	0	1	2	2	2	2	0	0	0	0	111	111	111	111	1	1.940000	-3.404393	1	0.550000	NM_007129		0	13	13	0	492	485	0		1	0		0	0	111	0	0	0.999499	1.120056e-02	0	0	0	6	0	13	492
TMEM30B	161291	broad.mit.edu	37	14	61746986	61746986	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr14:61746986G>A	ENST00000555868.1	-	1	1572	c.880C>T	c.(880-882)Cgc>Tgc	p.R294C	TMEM30B_ENST00000355702.2_Missense_Mutation_p.R294C|TMEM30B_ENST00000557163.1_5'UTR	NM_001017970.2	NP_001017970.1	Q3MIR4	CC50B_HUMAN	transmembrane protein 30B	294					lipid transport (GO:0006869)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V293fs*>57(1)		breast(2)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.107)|BRCA - Breast invasive adenocarcinoma(234;0.181)		CCGAACGCGCGCACCGGGTAG	0.657																																						ENST00000555868.1	0.220000	2.000000e-02	0.150000	0.050000	0.090000	0.107985	0.090000	0.090000																										1	Deletion - Frameshift(1)	p.V293fs*>57(1)	breast(1)	6						c.(880-882)Cgc>Tgc		transmembrane protein 30B							51.0	49.0	49.0					14																	61746986		2203	4300	6503	SO:0001583	missense	161291	0	0					g.chr14:61746986G>A	AK091169	CCDS32093.1	14q23.1	2006-09-20				ENSG00000182107			27254	protein-coding gene	gene with protein product		611029				15375526	Standard	NM_001017970		Approved	CDC50B	uc001xfl.3	Q3MIR4		ENST00000555868.1:c.880C>T	chr14.hg19:g.61746986G>A	ENSP00000450842:p.Arg294Cys	0					TMEM30B_ENST00000355702.2_Missense_Mutation_p.R294C|TMEM30B_ENST00000557163.1_5'UTR	p.R294C	NM_001017970.2	NP_001017970.1	1	2	3	2.049610	Q3MIR4	CC50B_HUMAN		1	1572	-			B3KR84|Q14D00	Missense_Mutation	SNP	ENST00000555868.1	0	1	hg19	c.880C>T	CCDS32093.1	0	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030021	0.75504	.	.	ENSG00000182107	ENST00000555868;ENST00000355702	.	.	.	4.67	3.77	0.43336	4.67	3.77	0.43336	.	0.167016	0.39759	N	0.001265	T	0.60907	0.2305	M	0.79926	2.475	0.40875	D	0.983942	D	0.54397	0.966	B	0.44224	0.444	T	0.68123	-0.5492	9	0.52906	T	0.07	-30.0625	12.0352	0.53420	0.0:0.0:0.8264:0.1735	.	294	Q3MIR4	CC50B_HUMAN	C	294	.	ENSP00000347930:R294C	R	-	1	0	0	TMEM30B	60816739	60816739	1.000000	0.71417	0.992000	0.48379	0.999000	0.98932	2.801000	0.47908	1.163000	0.42636	0.650000	0.86243	CGC	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.657	TMEM30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413358.1	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.940000	-6.138692	1	0.550000	XM_090844		0	4	4	0	162	161	0		1	1		0	0	46	0	0	0.889923	7.472071e-01	0	2	0	103	0	4	162
APBA2	321	broad.mit.edu	37	15	29397624	29397624	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr15:29397624G>T	ENST00000558402.1	+	12	2166	c.1567G>T	c.(1567-1569)Gcc>Tcc	p.A523S	APBA2_ENST00000558259.1_Missense_Mutation_p.A523S|APBA2_ENST00000558330.1_Missense_Mutation_p.A511S|APBA2_ENST00000561069.1_Missense_Mutation_p.A523S|APBA2_ENST00000411764.1_Missense_Mutation_p.A511S			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	523	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CTTCAGCGTGGCCTACCAGGA	0.612																																						ENST00000558402.1	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.997810	0.990000	1.000000																										0				59						c.(1567-1569)Gcc>Tcc		amyloid beta (A4) precursor protein-binding, family A, member 2							97.0	70.0	79.0					15																	29397624		2201	4300	6501	SO:0001583	missense	321	0	0					g.chr15:29397624G>T	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1567G>T	chr15.hg19:g.29397624G>T	ENSP00000453293:p.Ala523Ser	0					APBA2_ENST00000411764.1_Missense_Mutation_p.A511S|APBA2_ENST00000558259.1_Missense_Mutation_p.A523S|APBA2_ENST00000558330.1_Missense_Mutation_p.A511S|APBA2_ENST00000561069.1_Missense_Mutation_p.A523S	p.A523S			1	2	3	2.081375	Q99767	APBA2_HUMAN		12	2166	+		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	1	1	hg19	c.1567G>T	CCDS10022.1	1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292777	0.80914	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.22336	1.96	4.32	3.4	0.38934	4.32	3.4	0.38934	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.211286	0.40385	N	0.001111	T	0.50017	0.1591	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	0.985;0.999;1.0	P;D;D	0.91635	0.865;0.993;0.999	T	0.59343	-0.7472	10	0.72032	D	0.01	.	13.037	0.58877	0.0:0.0:0.8378:0.1622	.	511;511;523	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	S	511;523	ENSP00000409312:A511S	ENSP00000219865:A523S	A	+	1	0	0	APBA2	27184916	27184916	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.352000	0.97076	1.130000	0.42092	-0.310000	0.09108	GCC	0.556104		TCGA-FB-A78T-01A-12D-A32N-08	0.612	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.940000	-20.000000	1	0.550000	NM_005503		0	54	54	0	109	109	1		1	0		0	0	48	0	0	1.000000	9.828461e-01	0	0	0	16	0	54	109
LMAN1L	79748	broad.mit.edu	37	15	75109005	75109005	+	Silent	SNP	C	C	T	rs535407762		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr15:75109005C>T	ENST00000309664.5	+	4	610	c.471C>T	c.(469-471)gaC>gaT	p.D157D	LMAN1L_ENST00000379709.3_Silent_p.D157D	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	157	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGCCAGCGACGGGCACATCC	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		15450	0.001		0.0	False		,,,				2504	0.0					ENST00000309664.5	1.000000	6.200000e-01	0.910000	0.710000	0.800000	0.814487	0.800000	0.810000																										0				19						c.(469-471)gaC>gaT		lectin, mannose-binding, 1 like							66.0	63.0	64.0					15																	75109005		2197	4296	6493	SO:0001819	synonymous_variant	79748	2	121412	29				g.chr15:75109005C>T	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.471C>T	chr15.hg19:g.75109005C>T		0					LMAN1L_ENST00000379709.3_Silent_p.D157D	p.D157D	NM_021819.2	NP_068591.2	1	2	3	2.052737	Q9HAT1	LMA1L_HUMAN		4	610	+			Q6UWN2	Silent	SNP	ENST00000309664.5	1	1	hg19	c.471C>T	CCDS10270.1	0																																																																																								0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.677	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.940000	-20.000000	1	0.550000			0	52	50	0	182	180	1		1			0	0	76	0	0	1.000000	0	0	0	0	0	0	52	182
ADAMTS7	11173	broad.mit.edu	37	15	79051843	79051843	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr15:79051843G>A	ENST00000388820.4	-	24	5191	c.4981C>T	c.(4981-4983)Cgc>Tgc	p.R1661C		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1661	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CACTGGGTGCGGATGGTGGGC	0.726																																						ENST00000388820.4	0.850000	3.100000e-01	0.690000	0.410000	0.540000	0.555781	0.540000	0.530000																										0				54						c.(4981-4983)Cgc>Tgc		ADAM metallopeptidase with thrombospondin type 1 motif, 7							9.0	11.0	10.0					15																	79051843		2109	4183	6292	SO:0001583	missense	11173	0	0					g.chr15:79051843G>A	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4981C>T	chr15.hg19:g.79051843G>A	ENSP00000373472:p.Arg1661Cys	0						p.R1661C	NM_014272.3	NP_055087.2	1	2	3	2.052737	Q9UKP4	ATS7_HUMAN		24	5191	-			Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	0	1	hg19	c.4981C>T	CCDS32303.1	0	.	.	.	.	.	.	.	.	.	.	g	13.00	2.107509	0.37145	.	.	ENSG00000136378	ENST00000388820	T	0.62105	0.05	2.92	1.86	0.25419	2.92	1.86	0.25419	PLAC (1);	0.082330	0.49305	U	0.000156	T	0.74898	0.3777	M	0.75264	2.295	0.46678	D	0.99915	D	0.89917	1.0	D	0.83275	0.996	T	0.77661	-0.2504	10	0.87932	D	0	.	10.268	0.43466	0.0:0.0:0.8027:0.1973	.	1661	Q9UKP4	ATS7_HUMAN	C	1661	ENSP00000373472:R1661C	ENSP00000373472:R1661C	R	-	1	0	0	ADAMTS7	76838898	76838898	0.960000	0.32886	0.217000	0.23759	0.006000	0.05464	3.130000	0.50508	1.639000	0.50556	0.282000	0.19409	CGC	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.726	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	0	0	0	2	2	2	2	0	0	0	0	29	29	29	29	1	1.940000	-19.996920	1	0.550000	NM_014272		0	13	12	0	76	75	0		1	0		0	0	29	0	0	0.999618	8.441452e-01	0	0	0	22	0	13	76
SETD1A	9739	broad.mit.edu	37	16	30976932	30976932	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr16:30976932G>C	ENST00000262519.8	+	8	2416	c.1730G>C	c.(1729-1731)tGc>tCc	p.C577S		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	577	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GCTTCTCCATGCTCTTCTGGA	0.657																																						ENST00000262519.8	0.150000	1.000000e-02	0.100000	0.030000	0.050000	0.077059	0.050000	0.060000																										0				59						c.(1729-1731)tGc>tCc		SET domain containing 1A							22.0	26.0	25.0					16																	30976932		2191	4292	6483	SO:0001583	missense	9739	0	0					g.chr16:30976932G>C	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1730G>C	chr16.hg19:g.30976932G>C	ENSP00000262519:p.Cys577Ser	0						p.C577S	NM_014712.1	NP_055527.1	1	2	3	2.066930	O15047	SET1A_HUMAN		8	2416	+			A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	0	1	hg19	c.1730G>C	CCDS32435.1	0	.	.	.	.	.	.	.	.	.	.	G	5.311	0.242720	0.10077	.	.	ENSG00000099381	ENST00000262519	D	0.93189	-3.18	4.41	3.37	0.38596	4.41	3.37	0.38596	.	0.764642	0.12331	N	0.478349	T	0.81182	0.4769	N	0.08118	0	0.24087	N	0.995927	B	0.19935	0.04	B	0.14023	0.01	T	0.68273	-0.5452	10	0.08837	T	0.75	.	5.2236	0.15381	0.2079:0.0:0.7921:0.0	.	577	O15047	SET1A_HUMAN	S	577	ENSP00000262519:C577S	ENSP00000262519:C577S	C	+	2	0	0	SETD1A	30884433	30884433	0.979000	0.34478	0.999000	0.59377	0.934000	0.57294	1.378000	0.34328	2.269000	0.75478	0.561000	0.74099	TGC	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.657	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	0	0	0	2	2	2	2	0	0	0	0	62	62	62	59	1	1.940000	-5.182952	1	0.550000	NM_014712		0	4	0	0	262	257	0		0	0		0	0	62	0	0	0.882801	3.942212e-02	0	0	0	16	0	4	262
SLC5A2	6524	broad.mit.edu	37	16	31500513	31500513	+	Missense_Mutation	SNP	G	G	C	rs372027584		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr16:31500513G>C	ENST00000330498.3	+	12	1538	c.1519G>C	c.(1519-1521)Ggc>Cgc	p.G507R	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	507					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	GTTCTCCTTCGGCTCGGGCAG	0.637																																						ENST00000330498.3	1.000000	8.900000e-01	1.000000	0.980000	0.990000	0.990202	0.990000	1.000000																										0				25						c.(1519-1521)Ggc>Cgc		solute carrier family 5 (sodium/glucose cotransporter), member 2	Canagliflozin(DB08907)|Dapagliflozin(DB06292)						71.0	57.0	62.0					16																	31500513		2197	4300	6497	SO:0001583	missense	6524	0	0					g.chr16:31500513G>C		CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1519G>C	chr16.hg19:g.31500513G>C	ENSP00000327943:p.Gly507Arg	0					AC026471.6_ENST00000565137.1_RNA	p.G507R	NM_003041.3	NP_003032.1	1	2	3	2.066930	P31639	SC5A2_HUMAN		12	1538	+			A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	1	1	hg19	c.1519G>C	CCDS10714.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.81|18.81	3.702935|3.702935	0.68501|0.68501	.|.	.|.	ENSG00000140675|ENSG00000140675	ENST00000330498|ENST00000419665	D|D	0.86769|0.86366	-2.17|-2.11	4.78|4.78	4.78|4.78	0.61160|0.61160	4.78|4.78	4.78|4.78	0.61160|0.61160	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90950|0.90950	0.7155|0.7155	M|M	0.68728|0.68728	2.09|2.09	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.91742|0.91742	0.5405|0.5405	10|7	0.11794|0.66056	T|D	0.64|0.02	.|.	15.362|15.362	0.74483|0.74483	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	507|.	P31639|.	SC5A2_HUMAN|.	R|P	507|400	ENSP00000327943:G507R|ENSP00000410601:R400P	ENSP00000327943:G507R|ENSP00000410601:R400P	G|R	+|+	1|2	0|0	0|0	SLC5A2|SLC5A2	31408014|31408014	31408014|31408014	1.000000|1.000000	0.71417|0.71417	0.587000|0.587000	0.28692|0.28692	0.658000|0.658000	0.38924|0.38924	3.548000|3.548000	0.53670|0.53670	2.491000|2.491000	0.84063|0.84063	0.561000|0.561000	0.74099|0.74099	GGC|CGG	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.637	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2	1	0	1	2	2	2	2	0	0	0	0	93	93	93	91	1	1.940000	-20.000000	1	0.550000			0	102	102	0	246	237	1		1	1		0	0	93	0	0	1.000000	4.594686e-01	0	2	0	3	0	102	246
ZFHX3	463	broad.mit.edu	37	16	72828136	72828136	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr16:72828136G>T	ENST00000268489.5	-	9	9117	c.8445C>A	c.(8443-8445)agC>agA	p.S2815R	RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.S1901R	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2815					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				ACATGGAGGGGCTTTCAAAGT	0.463																																						ENST00000268489.5	1.000000	2.000000e-02	0.100000	0.040000	0.060000	0.121997	0.060000	0.060000																										0				153						c.(8443-8445)agC>agA		zinc finger homeobox 3							120.0	113.0	115.0					16																	72828136		2198	4300	6498	SO:0001583	missense	463	0	0					g.chr16:72828136G>T	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8445C>A	chr16.hg19:g.72828136G>T	ENSP00000268489:p.Ser2815Arg	0					RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.S1901R	p.S2815R	NM_006885.3	NP_008816.3	1	2	3	2.110861	Q15911	ZFHX3_HUMAN		9	9117	-		Ovarian(137;0.13)	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	0	1	hg19	c.8445C>A	CCDS10908.1	0	.	.	.	.	.	.	.	.	.	.	G	6.983	0.551346	0.13374	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.74421	-0.84;-0.81	5.96	3.78	0.43462	5.96	3.78	0.43462	.	0.000000	0.64402	D	0.000013	T	0.76926	0.4056	L	0.44542	1.39	0.51482	D	0.999926	D	0.76494	0.999	D	0.80764	0.994	T	0.73506	-0.3961	10	0.30854	T	0.27	.	6.6486	0.22949	0.365:0.0:0.635:0.0	.	2815	Q15911	ZFHX3_HUMAN	R	2815;1901	ENSP00000268489:S2815R;ENSP00000438926:S1901R	ENSP00000268489:S2815R	S	-	3	2	2	ZFHX3	71385637	71385637	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.411000	0.34702	1.459000	0.47892	0.650000	0.86243	AGC	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.463	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	0	0	1	2	2	2	2	0	0	0	0	101	101	101	100	1	1.940000	-3.045602	1	0.550000	NM_006885		0	7	7	0	413	411	0		1	0		0	0	101	0	0	0.980470	7.829677e-03	0	0	0	7	0	7	413
ZFHX3	463	broad.mit.edu	37	16	72992317	72992317	+	Silent	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr16:72992317G>A	ENST00000268489.5	-	2	2400	c.1728C>T	c.(1726-1728)ggC>ggT	p.G576G	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	576					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGGCCCTGACGCCCTCACTGT	0.502																																						ENST00000268489.5	1.000000	7.700000e-01	1.000000	0.850000	0.930000	0.931769	0.930000	1.000000																										0				153						c.(1726-1728)ggC>ggT		zinc finger homeobox 3							100.0	95.0	96.0					16																	72992317		2198	4300	6498	SO:0001819	synonymous_variant	463	5	121412	39				g.chr16:72992317G>A	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1728C>T	chr16.hg19:g.72992317G>A		0					ZFHX3_ENST00000397992.5_Intron	p.G576G	NM_006885.3	NP_008816.3	1	2	3	2.110861	Q15911	ZFHX3_HUMAN		2	2400	-		Ovarian(137;0.13)	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	1	1	hg19	c.1728C>T	CCDS10908.1	1																																																																																								0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.502	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	0	0	1	2	17	2	2	1	1	1	1	76	76	76	76	1	1.940000	-20.000000	1	0.550000	NM_006885		0	96	95	0	284	279	1		1	1		1	0	76	1	0	1.000000	2.688855e-01	0	2	0	2	0	96	284
SRR	63826	broad.mit.edu	37	17	2224891	2224891	+	Missense_Mutation	SNP	G	G	C	rs141694122	byFrequency	TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:2224891G>C	ENST00000344595.5	+	6	893	c.575G>C	c.(574-576)gGa>gCa	p.G192A	SRR_ENST00000576848.1_Intron	NM_021947.1	NP_068766.1	Q9GZT4	SRR_HUMAN	serine racemase	192					aging (GO:0007568)|brain development (GO:0007420)|D-serine biosynthetic process (GO:0070179)|D-serine metabolic process (GO:0070178)|L-serine metabolic process (GO:0006563)|protein homotetramerization (GO:0051289)|pyruvate biosynthetic process (GO:0042866)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|serine family amino acid metabolic process (GO:0009069)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|D-serine ammonia-lyase activity (GO:0008721)|glycine binding (GO:0016594)|L-serine ammonia-lyase activity (GO:0003941)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|serine racemase activity (GO:0030378)|threonine racemase activity (GO:0018114)			NS(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)	ATGCTTGCTGGAATAGCAATT	0.403													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17599	0.0		0.001	False		,,,				2504	0.0					ENST00000344595.5	0.290000	1.100000e-01	0.240000	0.150000	0.190000	0.198934	0.190000	0.190000																										0				8						c.(574-576)gGa>gCa		serine racemase	L-Serine(DB00133)	G	ALA/GLY	0,4406		0,0,2203	105.0	100.0	102.0		575	5.9	1.0	17	dbSNP_134	102	2,8598	2.2+/-6.3	0,2,4298	no	missense	SRR	NM_021947.1	60	0,2,6501	CC,CG,GG		0.0233,0.0,0.0154	probably-damaging	192/341	2224891	2,13004	2203	4300	6503	SO:0001583	missense	63826	7	121408	41				g.chr17:2224891G>C	AF169974	CCDS11017.1	17p13	2007-01-18			ENSG00000167720	ENSG00000167720			14398	protein-coding gene	gene with protein product		606477				17067558, 15953485, 15193426	Standard	NM_021947		Approved	ILV1, ISO1	uc002fue.1	Q9GZT4	OTTHUMG00000090583	ENST00000344595.5:c.575G>C	chr17.hg19:g.2224891G>C	ENSP00000339435:p.Gly192Ala	1					SRR_ENST00000576848.1_Intron	p.G192A	NM_021947.1	NP_068766.1	0	1	1	1.564152	Q9GZT4	SRR_HUMAN		6	893	+		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)	D3DTI5|Q6IA55	Missense_Mutation	SNP	ENST00000344595.5	1	1	hg19	c.575G>C	CCDS11017.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.8	4.460526	0.84317	0.0	2.33E-4	ENSG00000167720	ENST00000344595	D	0.98419	-4.92	5.95	5.95	0.96441	5.95	5.95	0.96441	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.99372	0.9779	H	0.96398	3.815	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.98740	1.0716	10	0.87932	D	0	3.4694	19.4464	0.94849	0.0:0.0:1.0:0.0	.	192	Q9GZT4	SRR_HUMAN	A	192	ENSP00000339435:G192A	ENSP00000339435:G192A	G	+	2	0	0	SRR	2171641	2171641	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.265000	0.72534	2.836000	0.97738	0.650000	0.86243	GGA	0.390863		TCGA-FB-A78T-01A-12D-A32N-08	0.403	SRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207129.2	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.940000	-6.564403	1	0.550000	NM_021947		0	18	17	0	235	233	0		1	0		0	0	62	0	0	0.999983	4.146225e-01	0	0	0	19	0	18	235
UNC45B	146862	broad.mit.edu	37	17	33501285	33501285	+	Missense_Mutation	SNP	C	C	T	rs183680447	byFrequency	TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:33501285C>T	ENST00000268876.5	+	14	1958	c.1861C>T	c.(1861-1863)Cgg>Tgg	p.R621W	UNC45B_ENST00000378449.1_Missense_Mutation_p.R540W|UNC45B_ENST00000433649.1_Missense_Mutation_p.R619W|UNC45B_ENST00000591048.1_Missense_Mutation_p.R540W|UNC45B_ENST00000394570.2_Missense_Mutation_p.R619W	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	621					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TATAGACATGCGGGTGAAGCG	0.547													C|||	3	0.000599042	0.0	0.0	5008	,	,		18490	0.0		0.003	False		,,,				2504	0.0					ENST00000268876.5	1.000000	0	0.060000	0.010000	0.030000	0.089972	0.030000	0.040000																										0				59						c.(1861-1863)Cgg>Tgg		unc-45 homolog B (C. elegans)							132.0	129.0	130.0					17																	33501285		2203	4300	6503	SO:0001583	missense	146862	5	121412	40				g.chr17:33501285C>T	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1861C>T	chr17.hg19:g.33501285C>T	ENSP00000268876:p.Arg621Trp	0					UNC45B_ENST00000591048.1_Missense_Mutation_p.R540W|UNC45B_ENST00000433649.1_Missense_Mutation_p.R619W|UNC45B_ENST00000378449.1_Missense_Mutation_p.R540W|UNC45B_ENST00000394570.2_Missense_Mutation_p.R619W	p.R621W	NM_173167.2	NP_775259.1	1	2	3	2.104250	Q8IWX7	UN45B_HUMAN		14	1958	+		Ovarian(249;0.17)	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	0	1	hg19	c.1861C>T	CCDS11292.1	0	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	16.11	3.031224	0.54790	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T	0.70045	-0.45;-0.45;-0.45	5.03	2.91	0.33838	5.03	2.91	0.33838	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82944	0.5147	M	0.88906	2.99	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;1.0	D	0.86536	0.1825	10	0.87932	D	0	-28.04	13.2095	0.59817	0.2876:0.7124:0.0:0.0	.	540;619;621	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	W	621;621;619;540	ENSP00000268876:R621W;ENSP00000412840:R619W;ENSP00000367710:R540W	ENSP00000268876:R621W	R	+	1	2	2	UNC45B	30525398	30525398	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.897000	0.56273	1.316000	0.45131	0.591000	0.81541	CGG	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.547	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	0	0	1	2	16	2	2	1	1	1	1	154	154	154	153	1	1.940000	-1.798791	0	0.550000	NM_173167		0	6	6	0	694	680	0		0			1	0	154	0	0	0.022453	0	0	0	0	0	0	6	694
NUP88	4927	broad.mit.edu	37	17	5322895	5322895	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:5322895G>A	ENST00000573584.1	-	1	585	c.76C>T	c.(76-78)Cgg>Tgg	p.R26W	RPAIN_ENST00000381208.5_5'Flank|RPAIN_ENST00000536255.2_5'Flank|RPAIN_ENST00000574003.1_5'Flank|RPAIN_ENST00000327154.6_5'Flank|RPAIN_ENST00000381209.3_5'Flank|RPAIN_ENST00000405578.4_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	26					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						TCCCGGAGCCGCAAGAACACG	0.632																																						ENST00000573584.1	0.080000	1.000000e-02	0.060000	0.020000	0.030000	0.044823	0.030000	0.040000																										0				15						c.(76-78)Cgg>Tgg		nucleoporin 88kDa							73.0	72.0	73.0					17																	5322895		2203	4300	6503	SO:0001583	missense	4927	1	121412	36				g.chr17:5322895G>A	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.76C>T	chr17.hg19:g.5322895G>A	ENSP00000458954:p.Arg26Trp	1					RPAIN_ENST00000381209.3_5'Flank|RPAIN_ENST00000405578.4_5'Flank|RPAIN_ENST00000574003.1_5'Flank|RPAIN_ENST00000327154.6_5'Flank|RPAIN_ENST00000381208.5_5'Flank|RPAIN_ENST00000536255.2_5'Flank	p.R26W	NM_002532.4	NP_002523.2	0	1	1	1.549237	Q99567	NUP88_HUMAN		1	585	-			D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	0	1	hg19	c.76C>T	CCDS11070.1	0	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020434	0.75275	.	.	ENSG00000108559	ENST00000225696	.	.	.	5.19	4.22	0.49857	5.19	4.22	0.49857	.	0.284904	0.36482	N	0.002578	T	0.69351	0.3101	L	0.51422	1.61	0.45914	D	0.998751	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.72527	-0.4266	9	0.72032	D	0.01	-5.8985	13.2216	0.59892	0.0:0.0:0.8397:0.1603	.	26;26	B7Z5I6;Q99567	.;NUP88_HUMAN	W	26	.	ENSP00000225696:R26W	R	-	1	2	2	NUP88	5263619	5263619	0.557000	0.26546	0.958000	0.39756	0.439000	0.31926	1.231000	0.32624	1.548000	0.49413	0.655000	0.94253	CGG	0.390863		TCGA-FB-A78T-01A-12D-A32N-08	0.632	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	0	0	1	2	2	2	2	0	0	0	0	127	127	127	127	1	1.940000	-2.068661	0	0.550000	NM_002532		0	5	5	0	351	345	0		1	0		0	0	127	0	0	0.935139	4.369938e-02	0	0	0	19	0	5	351
HSPB9	94086	broad.mit.edu	37	17	40275109	40275109	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:40275109G>A	ENST00000355067.3	+	1	354	c.241G>A	c.(241-243)Gga>Aga	p.G81R	CTD-2132N18.3_ENST00000592574.1_Intron|KAT2A_ENST00000225916.5_5'Flank	NM_033194.2	NP_149971.1	Q9BQS6	HSPB9_HUMAN	heat shock protein, alpha-crystallin-related, B9	81					response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4		all_cancers(22;0.00064)|Breast(137;0.00104)|all_epithelial(22;0.00866)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GATGGTGACCGGACAGCAGCA	0.597																																						ENST00000355067.3	1.000000	0	0.070000	0.020000	0.040000	0.100709	0.040000	0.040000																										0				4						c.(241-243)Gga>Aga		heat shock protein, alpha-crystallin-related, B9							116.0	103.0	107.0					17																	40275109		2203	4300	6503	SO:0001583	missense	94086	0	0					g.chr17:40275109G>A	AJ302068	CCDS11418.1	17q21	2011-09-02			ENSG00000197723	ENSG00000260325		"""Heat shock proteins / HSPB"""	30589	protein-coding gene	gene with protein product	"""cancer/testis antigen 51"""	608344				11470154, 12820654	Standard	NM_033194		Approved	CT51	uc002hyy.2	Q9BQS6	OTTHUMG00000133500	ENST00000355067.3:c.241G>A	chr17.hg19:g.40275109G>A	ENSP00000347178:p.Gly81Arg	0					CTD-2132N18.3_ENST00000592574.1_Intron|KAT2A_ENST00000225916.5_5'Flank	p.G81R	NM_033194.2	NP_149971.1	1	2	3	2.104250	Q9BQS6	HSPB9_HUMAN		1	354	+		all_cancers(22;0.00064)|Breast(137;0.00104)|all_epithelial(22;0.00866)	B3KSG6|Q52LB4	Missense_Mutation	SNP	ENST00000355067.3	0	1	hg19	c.241G>A	CCDS11418.1	0	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174878	0.57692	.	.	ENSG00000197723	ENST00000355067	D	0.95622	-3.76	3.68	-0.645	0.11475	3.68	-0.645	0.11475	Heat shock protein Hsp20 (2);	0.000000	0.85682	D	0.000000	D	0.92886	0.7737	M	0.84511	2.7	0.31280	N	0.690707	P	0.43352	0.804	B	0.37144	0.242	D	0.89203	0.3559	10	0.87932	D	0	-18.9973	4.7991	0.13287	0.2826:0.1571:0.5603:0.0	.	81	Q9BQS6	HSPB9_HUMAN	R	81	ENSP00000347178:G81R	ENSP00000347178:G81R	G	+	1	0	0	HSPB9	37528635	37528635	0.976000	0.34144	0.716000	0.30569	0.009000	0.06853	2.377000	0.44300	-0.047000	0.13423	-1.157000	0.01802	GGA	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.597	HSPB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257438.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	125	1	1.940000	-2.426670	0	0.550000	NM_033194		0	6	6	0	535	530	0		1	0		0	0	127	0	0	0.964126	5.624745e-04	0	0	0	3	0	6	535
TRIM37	4591	broad.mit.edu	37	17	57093004	57093004	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:57093004G>A	ENST00000262294.7	-	21	2802	c.2543C>T	c.(2542-2544)gCg>gTg	p.A848V	TRIM37_ENST00000376149.3_Missense_Mutation_p.A726V|TRIM37_ENST00000393065.2_Missense_Mutation_p.A814V|TRIM37_ENST00000393066.3_Missense_Mutation_p.A848V	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	848					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A848V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTCTCAACCGCAGGCAAGCC	0.398									Mulibrey Nanism																													ENST00000262294.7	1.000000	0	0.050000	0.010000	0.020000	0.075691	0.020000	0.020000																										1	Substitution - Missense(1)	p.A848V(1)	large_intestine(1)	37						c.(2542-2544)gCg>gTg		tripartite motif containing 37							125.0	133.0	130.0					17																	57093004		2203	4300	6503	SO:0001583	missense	4591	7	121412	43	Mulibrey Nanism	Familial Cancer Database	Perheentupa syndrome	g.chr17:57093004G>A	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.2543C>T	chr17.hg19:g.57093004G>A	ENSP00000262294:p.Ala848Val	0					TRIM37_ENST00000376149.3_Missense_Mutation_p.A726V|TRIM37_ENST00000393065.2_Missense_Mutation_p.A814V|TRIM37_ENST00000393066.3_Missense_Mutation_p.A848V	p.A848V	NM_015294.3	NP_056109.1	1	2	3	2.090902	O94972	TRI37_HUMAN		21	2802	-	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	0	1	hg19	c.2543C>T	CCDS32694.1	0	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661961	0.29515	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	4.93	2.9	0.33743	4.93	2.9	0.33743	.	0.843050	0.10578	N	0.658234	T	0.21267	0.0512	N	0.24115	0.695	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.17531	-1.0366	10	0.48119	T	0.1	-0.0368	9.163	0.37035	0.1801:0.0:0.8199:0.0	.	814;726;848	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	V	848;848;726;814	ENSP00000376785:A848V;ENSP00000262294:A848V;ENSP00000365319:A726V;ENSP00000376784:A814V	ENSP00000262294:A848V	A	-	2	0	0	TRIM37	54447786	54447786	0.197000	0.23362	0.437000	0.26809	0.721000	0.41392	1.507000	0.35758	1.082000	0.41137	0.313000	0.20887	GCG	0.557304		TCGA-FB-A78T-01A-12D-A32N-08	0.398	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	0	0	1	2	2	2	2	0	0	0	0	169	169	169	165	1	1.940000	-1.930905	0	0.550000	NM_015294		0	5	4	0	708	696	0		1	0		0	0	169	0	0	0.934666	5.728428e-02	0	0	0	44	0	5	708
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	A	rs11540652		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:7577538C>A	ENST00000269305.4	-	7	932	c.743G>T	c.(742-744)cGg>cTg	p.R248L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248L|TP53_ENST00000445888.2_Missense_Mutation_p.R248L|TP53_ENST00000359597.4_Missense_Mutation_p.R248L|TP53_ENST00000455263.2_Missense_Mutation_p.R248L|TP53_ENST00000413465.2_Missense_Mutation_p.R248L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.940000	6.300000e-01	0.870000	0.700000	0.780000	0.793180	0.780000	0.790000	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	24185	GRCh37	CM920675	TP53	M	rs11540652	c.(742-744)cGg>cTg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						152.0	112.0	126.0					17																	7577538		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577538C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>T	chr17.hg19:g.7577538C>A	ENSP00000269305:p.Arg248Leu	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R248L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248L|TP53_ENST00000420246.2_Missense_Mutation_p.R248L|TP53_ENST00000359597.4_Missense_Mutation_p.R248L|TP53_ENST00000413465.2_Missense_Mutation_p.R248L	p.R248L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.549237	P04637	P53_HUMAN		7	932	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.743G>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488044	0.84854	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	4.62	3.65	0.41850	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	M	0.92507	3.315	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.91635	0.996;0.996;0.999;0.996;0.996;0.997	D	0.96931	0.9681	10	0.87932	D	0	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	L	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248L;ENSP00000352610:R248L;ENSP00000269305:R248L;ENSP00000398846:R248L;ENSP00000391127:R248L;ENSP00000391478:R248L;ENSP00000425104:R116L;ENSP00000423862:R155L	ENSP00000269305:R248L	R	-	2	0	0	TP53	7518263	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	0.390863		TCGA-FB-A78T-01A-12D-A32N-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	0	2	2	2	2	0	0	0	0	74	74	74	74	1	1.940000	-6.215367	1	0.550000	NM_000546		0	68	67	0	162	158	1		1	1	1	0	0	74	462	0	1.000000	1	1	40	208	31	425	68	162
FOXJ1	2302	broad.mit.edu	37	17	74136135	74136135	+	Silent	SNP	G	G	A	rs200854622		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:74136135G>A	ENST00000322957.6	-	2	696	c.342C>T	c.(340-342)taC>taT	p.Y114Y	RNF157-AS1_ENST00000586627.1_RNA|RNF157_ENST00000589912.1_5'Flank|RNF157-AS1_ENST00000585542.1_RNA|RNF157-AS1_ENST00000590137.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	114					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			GATTGGTGGCGTAGTCCACGT	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		10843	0.001		0.0	False		,,,				2504	0.0					ENST00000322957.6	1.000000	7.800000e-01	1.000000	0.880000	0.990000	0.958046	0.990000	1.000000																										0				4						c.(340-342)taC>taT		forkhead box J1							61.0	47.0	52.0					17																	74136135		2203	4300	6503	SO:0001819	synonymous_variant	2302	1	121256	28				g.chr17:74136135G>A	X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.342C>T	chr17.hg19:g.74136135G>A		0					RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000586627.1_RNA|RNF157_ENST00000589912.1_5'Flank|RNF157-AS1_ENST00000585542.1_RNA	p.Y114Y	NM_001454.3	NP_001445.2	1	2	3	2.090902	Q92949	FOXJ1_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.187)	2	696	-			O00630	Silent	SNP	ENST00000322957.6	1	1	hg19	c.342C>T	CCDS32739.1	1																																																																																								0.557304		TCGA-FB-A78T-01A-12D-A32N-08	0.692	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449856.1	1	0	0	2	2	2	2	0	0	0	0	50	50	50	50	1	1.940000	-20.000000	1	0.550000	NM_001454		0	59	59	0	160	157	0		1	0		0	0	50	0	0	1.000000	7.393043e-02	0	1	0	1	0	59	160
TNRC6C	57690	broad.mit.edu	37	17	76046827	76046827	+	Missense_Mutation	SNP	G	G	A	rs200217894		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr17:76046827G>A	ENST00000588061.1	+	5	2411	c.1684G>A	c.(1684-1686)Gca>Aca	p.A562T	TNRC6C_ENST00000541771.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000335749.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000301624.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000544502.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000588847.1_Missense_Mutation_p.A562T			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	562	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GAGTGGGGCCGCAAATCAGGA	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		17135	0.0		0.0	False		,,,				2504	0.001					ENST00000588061.1	1.000000	0	0.080000	0.020000	0.040000	0.095194	0.040000	0.040000																										0				40						c.(1684-1686)Gca>Aca		trinucleotide repeat containing 6C		G	THR/ALA,THR/ALA	0,4056		0,0,2028	53.0	59.0	57.0		1684,1684	3.8	0.6	17		57	1,8375		0,1,4187	no	missense,missense	TNRC6C	NM_001142640.1,NM_018996.3	58,58	0,1,6215	AA,AG,GG		0.0119,0.0,0.0080	benign,benign	562/1727,562/1691	76046827	1,12431	2028	4188	6216	SO:0001583	missense	57690	32	120932	47				g.chr17:76046827G>A	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1684G>A	chr17.hg19:g.76046827G>A	ENSP00000468647:p.Ala562Thr	0					TNRC6C_ENST00000335749.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000301624.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000544502.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000588847.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000541771.1_Missense_Mutation_p.A562T	p.A562T			1	2	3	2.090902	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)	5	2411	+			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	0	1	hg19	c.1684G>A	CCDS45798.1	0	.	.	.	.	.	.	.	.	.	.	G	6.103	0.387346	0.11581	0.0	1.19E-4	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.14516	2.5;2.51;2.51;2.5	5.75	3.79	0.43588	5.75	3.79	0.43588	.	0.922167	0.09205	N	0.834117	T	0.10680	0.0261	L	0.29908	0.895	0.26878	N	0.9676	B;B;B	0.13145	0.005;0.007;0.004	B;B;B	0.08055	0.002;0.003;0.001	T	0.38286	-0.9668	10	0.13108	T	0.6	0.8073	10.4778	0.44676	0.2076:0.0:0.7924:0.0	.	562;562;562	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	T	562	ENSP00000336783:A562T;ENSP00000301624:A562T;ENSP00000440310:A562T;ENSP00000442421:A562T	ENSP00000301624:A562T	A	+	1	0	0	TNRC6C	73558422	73558422	0.864000	0.29904	0.557000	0.28306	0.995000	0.86356	3.175000	0.50855	0.800000	0.34041	0.655000	0.94253	GCA	0.557304		TCGA-FB-A78T-01A-12D-A32N-08	0.582	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	0	0	1	2	2	2	2	0	0	0	0	89	89	89	87	1	1.940000	-1.995788	0	0.550000	NM_018996		0	5	5	0	429	425	0		1	0		0	0	89	0	0	0.935970	4.317370e-03	0	0	0	7	0	5	429
SMAD4	4089	broad.mit.edu	37	18	48604736	48604736	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr18:48604736G>T	ENST00000342988.3	+	12	2096	c.1558G>T	c.(1558-1560)Gaa>Taa	p.E520*	SMAD4_ENST00000398417.2_Nonsense_Mutation_p.E520*|SMAD4_ENST00000588745.1_Nonsense_Mutation_p.E424*|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	520	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.E520*(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GAGCATCAAAGAAACACCTTG	0.488																																						ENST00000342988.3	1.000000	8.300000e-01	0.990000	0.890000	0.950000	0.946942	0.950000	1.000000																										39	Whole gene deletion(36)|Unknown(2)|Substitution - Nonsense(1)	p.0?(36)|p.?(2)|p.E520*(1)	pancreas(26)|large_intestine(4)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1558-1560)Gaa>Taa		SMAD family member 4							98.0	94.0	96.0					18																	48604736		2203	4300	6503	SO:0001587	stop_gained	4089	0	0					g.chr18:48604736G>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1558G>T	chr18.hg19:g.48604736G>T	ENSP00000341551:p.Glu520*	1					SMAD4_ENST00000588745.1_Nonsense_Mutation_p.E424*|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.E520*	p.E520*	NM_005359.5	NP_005350.1	0	1	1	1.507173	Q13485	SMAD4_HUMAN		12	2096	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Nonsense_Mutation	SNP	ENST00000342988.3	0	1	hg19	c.1558G>T	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.212720	0.99101	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	.	.	.	6.08	5.21	0.72293	6.08	5.21	0.72293	.	0.097880	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	14.5385	0.67979	0.0714:0.0:0.9286:0.0	.	.	.	.	X	520	.	ENSP00000341551:E520X	E	+	1	0	0	SMAD4	46858734	46858734	1.000000	0.71417	0.986000	0.45419	0.978000	0.69477	7.414000	0.80117	1.582000	0.49881	0.655000	0.94253	GAA	0.381656		TCGA-FB-A78T-01A-12D-A32N-08	0.488	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.940000	-20.000000	1	0.550000	NM_005359		0	126	126	0	211	207	1		1	1	1	0	0	96	404	0	1.000000	1	1	52	187	47	318	126	211
ABHD8	79575	broad.mit.edu	37	19	17412239	17412239	+	Missense_Mutation	SNP	C	C	T	rs374386420		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:17412239C>T	ENST00000247706.3	-	2	426	c.187G>A	c.(187-189)Gca>Aca	p.A63T	MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000595444.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	63							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						TCCGAGGATGCGGATGATGGT	0.667																																					Ovarian(156;1368 2543 15275 41187)	ENST00000247706.3	1.000000	2.000000e-02	0.130000	0.040000	0.070000	0.135691	0.070000	0.070000																										0				9						c.(187-189)Gca>Aca		abhydrolase domain containing 8							20.0	25.0	23.0					19																	17412239		2195	4289	6484	SO:0001583	missense	79575	2	121142	37				g.chr19:17412239C>T	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.187G>A	chr19.hg19:g.17412239C>T	ENSP00000247706:p.Ala63Thr	0					MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	p.A63T	NM_024527.4	NP_078803.4	1	2	3	2.102795	Q96I13	ABHD8_HUMAN		2	426	-			Q9HAE9	Missense_Mutation	SNP	ENST00000247706.3	0	1	hg19	c.187G>A	CCDS12355.1	0	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.395488	0.01175	.	.	ENSG00000127220	ENST00000247706;ENST00000544788	T	0.31769	1.48	1.59	-3.18	0.05186	1.59	-3.18	0.05186	.	0.496656	0.14259	U	0.330929	T	0.10078	0.0247	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15636	-1.0430	10	0.34782	T	0.22	.	4.2714	0.10789	0.0:0.3731:0.4229:0.204	.	63	Q96I13	ABHD8_HUMAN	T	63;9	ENSP00000247706:A63T	ENSP00000247706:A63T	A	-	1	0	0	ABHD8	17273239	17273239	0.730000	0.28100	0.000000	0.03702	0.023000	0.10783	0.878000	0.28126	-0.771000	0.04608	-0.339000	0.08088	GCA	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.667	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1	0	0	0	2	13	3	2	1	1	1	1	58	58	58	56	1	1.940000	-5.154503	1	0.550000	NM_024527		0	4	4	0	212	204	0		0	0		1	0	58	0	0	0.018003	1.455949e-02	0	0	0	20	0	4	212
KIAA0355	9710	broad.mit.edu	37	19	34832943	34832943	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:34832943G>T	ENST00000299505.6	+	10	2977	c.2104G>T	c.(2104-2106)Gca>Tca	p.A702S		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	702										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					TCCACCACGGGCACCCCAGGC	0.612																																						ENST00000299505.6	0.870000	5.800000e-01	0.800000	0.650000	0.720000	0.731396	0.720000	0.720000																										0				41						c.(2104-2106)Gca>Tca		KIAA0355							74.0	77.0	76.0					19																	34832943		2203	4300	6503	SO:0001583	missense	9710	1	121406	28				g.chr19:34832943G>T		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2104G>T	chr19.hg19:g.34832943G>T	ENSP00000299505:p.Ala702Ser	0						p.A702S	NM_014686.3	NP_055501.2	0	0	0	2.033974	O15063	K0355_HUMAN		10	2977	+	Esophageal squamous(110;0.162)		Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	1	1	hg19	c.2104G>T	CCDS12436.1	0	.	.	.	.	.	.	.	.	.	.	G	11.78	1.742098	0.30865	.	.	ENSG00000166398	ENST00000299505	T	0.20463	2.07	5.21	3.03	0.35002	5.21	3.03	0.35002	.	0.227351	0.35262	N	0.003338	T	0.12689	0.0308	N	0.08118	0	0.21416	N	0.999696	B	0.11235	0.004	B	0.16289	0.015	T	0.26189	-1.0110	10	0.87932	D	0	-24.5999	15.1737	0.72894	0.0:0.7283:0.2717:0.0	.	702	O15063	K0355_HUMAN	S	702	ENSP00000299505:A702S	ENSP00000299505:A702S	A	+	1	0	0	KIAA0355	39524783	39524783	0.134000	0.22483	0.405000	0.26409	0.928000	0.56348	0.848000	0.27710	0.697000	0.31718	-0.147000	0.13772	GCA	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.612	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	1	0	1	2	2	2	2	0	0	0	0	116	116	116	115	1	1.940000	-20.000000	1	0.550000	NM_014686		0	76	76	0	304	302	1		1	1		0	0	116	0	0	1.000000	9.951010e-01	0	3	0	32	0	76	304
ZNF585A	199704	broad.mit.edu	37	19	37643141	37643141	+	Missense_Mutation	SNP	C	C	T	rs572122130		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:37643141C>T	ENST00000356958.4	-	5	1918	c.1660G>A	c.(1660-1662)Gaa>Aaa	p.E554K	ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.E499K|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000292841.5_Missense_Mutation_p.E499K			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	554					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E499K(1)		breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCCCACATTCGTGGCATTCA	0.403																																						ENST00000356958.4	1.000000	7.600000e-01	1.000000	0.830000	0.920000	0.920319	0.920000	1.000000																										1	Substitution - Missense(1)	p.E499K(1)	breast(1)	42						c.(1660-1662)Gaa>Aaa		zinc finger protein 585A							60.0	61.0	61.0					19																	37643141		2203	4297	6500	SO:0001583	missense	199704	2	121412	31				g.chr19:37643141C>T	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1660G>A	chr19.hg19:g.37643141C>T	ENSP00000349440:p.Glu554Lys	0					ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000292841.5_Missense_Mutation_p.E499K|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.E499K	p.E554K			0	0	0	2.033974	Q6P3V2	Z585A_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	1918	-			Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	1	1	hg19	c.1660G>A		1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.624049	0.46840	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157	T;T;T	0.07327	3.2;3.2;3.2	2.87	2.87	0.33458	2.87	2.87	0.33458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.198022	0.24828	N	0.035278	T	0.19886	0.0478	.	.	.	0.09310	N	1	D	0.57571	0.98	P	0.58130	0.833	T	0.01729	-1.1286	9	0.62326	D	0.03	.	12.9943	0.58638	0.0:1.0:0.0:0.0	.	554	Q6P3V2	Z585A_HUMAN	K	554;499;499	ENSP00000349440:E554K;ENSP00000292841:E499K;ENSP00000375998:E499K	ENSP00000292841:E499K	E	-	1	0	0	ZNF585A	42334981	42334981	0.000000	0.05858	0.499000	0.27577	0.833000	0.47200	0.153000	0.16323	1.621000	0.50320	0.650000	0.86243	GAA	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.403	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	1	0	1	2	2	2	2	0	0	0	0	74	74	74	126	1	1.940000	-5.501252	1	0.550000	NM_152655		0	84	79	0	245	244	0		1	0		0	0	74	0	0	1.000000	0	0	0	0	1	0	84	245
SARS2	54938	broad.mit.edu	37	19	39421234	39421234	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:39421234G>A	ENST00000221431.6	-	1	302	c.143C>T	c.(142-144)gCg>gTg	p.A48V	MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000594171.1_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000600042.1_Missense_Mutation_p.A48V|MRPS12_ENST00000407800.2_5'Flank|MRPS12_ENST00000308018.4_5'UTR|SARS2_ENST00000430193.3_Missense_Mutation_p.A48V	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	48					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCCCTCGCGCGCATACTCGTA	0.627											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000221431.6	0.080000	0	0.060000	0.020000	0.030000	0.042681	0.030000	0.040000																										0				15						c.(142-144)gCg>gTg		seryl-tRNA synthetase 2, mitochondrial							97.0	84.0	88.0					19																	39421234		2203	4300	6503	SO:0001583	missense	54938	2	121412	37				g.chr19:39421234G>A	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.143C>T	chr19.hg19:g.39421234G>A	ENSP00000221431:p.Ala48Val	0		OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	885	MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000600042.1_Missense_Mutation_p.A48V|SARS2_ENST00000430193.3_Missense_Mutation_p.A48V|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000448145.2_Intron|CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000594171.1_5'Flank	p.A48V	NM_017827.3	NP_060297.1	0	0	0	2.033974	Q9NP81	SYSM_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)	1	302	-	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	0	1	hg19	c.143C>T	CCDS33017.1	0	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512002	0.44660	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.55588	0.51;0.51;1.49	5.65	4.57	0.56435	5.65	4.57	0.56435	.	0.122893	0.53938	D	0.000045	T	0.40979	0.1139	L	0.43923	1.385	.	.	.	D;B;B	0.56746	0.977;0.206;0.257	B;B;B	0.43623	0.425;0.014;0.007	T	0.44952	-0.9294	9	0.16896	T	0.51	.	8.6175	0.33840	0.1027:0.0:0.8973:0.0	.	48;48;48	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	V	48	ENSP00000406754:A48V;ENSP00000221431:A48V;ENSP00000414954:A48V	ENSP00000221431:A48V	A	-	2	0	0	FBXO17	44113074	44113074	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	3.764000	0.55264	2.941000	0.99782	0.655000	0.94253	GCG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.627	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	0	0	1	2	2	2	2	0	0	0	0	174	174	174	172	1	1.940000	-1.741491	0	0.550000	NM_017827		0	7	7	0	671	666	0		1	0		0	0	174	0	0	0.980155	6.752113e-02	0	0	0	35	0	7	671
PLIN4	729359	broad.mit.edu	37	19	4511842	4511842	+	Silent	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:4511842G>A	ENST00000301286.3	-	3	2087	c.2088C>T	c.(2086-2088)gtC>gtT	p.V696V		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	696	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TCCCTTTGGCGACATTCACTG	0.602																																						ENST00000301286.3	1.000000	4.000000e-01	0.500000	0.430000	0.460000	0.493496	0.460000	0.460000																										0				41						c.(2086-2088)gtC>gtT		perilipin 4							252.0	273.0	266.0					19																	4511842		2157	4252	6409	SO:0001819	synonymous_variant	729359	11	121194	43				g.chr19:4511842G>A	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2088C>T	chr19.hg19:g.4511842G>A		0						p.V696V	NM_001080400.1	NP_001073869.1	1	2	3	2.102795	Q96Q06	PLIN4_HUMAN		3	2087	-			A6NEI2	Silent	SNP	ENST00000301286.3	1	1	hg19	c.2088C>T	CCDS45927.1	0																																																																																								0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.602	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	0	0	1	2	14	2	2	1	1	1	1	493	493	493	488	1	1.940000	-2.920853	1	0.550000	XM_170901		0	236	230	0	1656	1493	0		1	0		1	0	493	0	0	1.000000	7.889491e-02	0	0	0	4	0	236	1656
ZNF546	339327	broad.mit.edu	37	19	40520557	40520557	+	Silent	SNP	T	T	C	rs201944442		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:40520557T>C	ENST00000347077.4	+	7	1596	c.1380T>C	c.(1378-1380)caT>caC	p.H460H	ZNF546_ENST00000600094.1_Silent_p.H434H|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	460					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTCGGCATCATAGAACTCATA	0.413																																						ENST00000347077.4	1.000000	8.200000e-01	1.000000	0.900000	0.990000	0.965306	0.990000	1.000000																										0				34						c.(1378-1380)caT>caC		zinc finger protein 546							72.0	75.0	74.0					19																	40520557		2203	4300	6503	SO:0001819	synonymous_variant	339327	0	0					g.chr19:40520557T>C	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1380T>C	chr19.hg19:g.40520557T>C		0					ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Silent_p.H434H	p.H460H	NM_178544.3	NP_848639.2	0	0	0	2.033974	Q86UE3	ZN546_HUMAN		7	1596	+	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		A8K913	Silent	SNP	ENST00000347077.4	1	0	hg19	c.1380T>C	CCDS12548.1	1																																																																																								0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.413	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	0	0	1	2	2	2	2	1	1	1	0	70	70	70	70	1	1.940000	-6.665620	1	0.550000	NM_178544		0	96	96	0	254	252	1		1	0		1	0	70	0	0	1.000000	5.243608e-01	0	1	0	5	0	96	254
GYS1	2997	broad.mit.edu	37	19	49485993	49485993	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:49485993G>A	ENST00000323798.3	-	6	1121	c.925C>T	c.(925-927)Cgg>Tgg	p.R309W	GYS1_ENST00000544287.1_Intron|GYS1_ENST00000263276.6_Missense_Mutation_p.R245W|GYS1_ENST00000540532.1_Intron|GYS1_ENST00000541188.1_Missense_Mutation_p.R229W	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	309					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		AAATGGCCCCGCACAAACTCC	0.542																																						ENST00000323798.3	1.000000	0	0.060000	0.010000	0.020000	0.088283	0.020000	0.030000																										0				22						c.(925-927)Cgg>Tgg		glycogen synthase 1 (muscle)							99.0	105.0	103.0					19																	49485993		2203	4300	6503	SO:0001583	missense	2997	1	121412	36				g.chr19:49485993G>A		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.925C>T	chr19.hg19:g.49485993G>A	ENSP00000317904:p.Arg309Trp	0					GYS1_ENST00000540532.1_Intron|GYS1_ENST00000263276.6_Missense_Mutation_p.R245W|GYS1_ENST00000544287.1_Intron|GYS1_ENST00000541188.1_Missense_Mutation_p.R229W	p.R309W	NM_002103.4	NP_002094.2	1	2	3	2.110002	P13807	GYS1_HUMAN		6	1121	-		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	0	1	hg19	c.925C>T	CCDS12747.1	0	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728447	0.69074	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188	T;T;T	0.73363	-0.74;-0.74;-0.74	4.98	3.88	0.44766	4.98	3.88	0.44766	.	0.000000	0.85682	D	0.000000	D	0.87346	0.6154	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.77557	0.99;0.95;0.967	D	0.89154	0.3525	10	0.87932	D	0	-25.235	11.3306	0.49473	0.0:0.0:0.7259:0.2741	.	229;245;309	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	W	309;245;229	ENSP00000317904:R309W;ENSP00000263276:R245W;ENSP00000437922:R229W	ENSP00000263276:R245W	R	-	1	2	2	GYS1	54177805	54177805	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.141000	0.58038	2.491000	0.84063	0.561000	0.74099	CGG	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.542	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	0	0	1	2	2	2	2	0	0	0	0	141	141	141	138	1	1.940000	-1.969395	0	0.550000	NM_002103		0	5	5	0	624	617	0		1	0		0	0	141	0	0	0.935909	9.941693e-02	0	0	0	54	0	5	624
MYBPC2	4606	broad.mit.edu	37	19	50963351	50963351	+	Missense_Mutation	SNP	C	C	T	rs201756677		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:50963351C>T	ENST00000357701.5	+	24	2897	c.2846C>T	c.(2845-2847)gCg>gTg	p.A949V		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	949	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GGCACGAACGCGCTGGTGGAG	0.537																																						ENST00000357701.5	1.000000	2.800000e-01	0.950000	0.440000	0.660000	0.676695	0.660000	1.000000																										0				1						c.(2845-2847)gCg>gTg		myosin binding protein C, fast type		C	VAL/ALA	0,3962		0,0,1981	26.0	31.0	29.0		2846	3.5	1.0	19		29	1,8273		0,1,4136	yes	missense	MYBPC2	NM_004533.3	64	0,1,6117	TT,TC,CC		0.0121,0.0,0.0082	benign	949/1142	50963351	1,12235	1981	4137	6118	SO:0001583	missense	4606	6	120130	35				g.chr19:50963351C>T		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2846C>T	chr19.hg19:g.50963351C>T	ENSP00000350332:p.Ala949Val	0						p.A949V	NM_004533.3	NP_004524.3	1	2	3	2.106774	Q14324	MYPC2_HUMAN		24	2897	+		all_neural(266;0.057)	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	0	1	hg19	c.2846C>T	CCDS46152.1	0	.	.	.	.	.	.	.	.	.	.	c	6.279	0.419576	0.11928	0.0	1.21E-4	ENSG00000086967	ENST00000357701	T	0.54279	0.58	3.51	3.51	0.40186	3.51	3.51	0.40186	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.191988	0.22737	U	0.056252	T	0.25717	0.0626	N	0.03084	-0.415	0.38226	D	0.940895	B	0.18610	0.029	B	0.19148	0.024	T	0.23013	-1.0200	10	0.02654	T	1	.	14.6643	0.68896	0.0:1.0:0.0:0.0	.	949	Q14324	MYPC2_HUMAN	V	949	ENSP00000350332:A949V	ENSP00000350332:A949V	A	+	2	0	0	MYBPC2	55655163	55655163	0.263000	0.24083	0.991000	0.47740	0.978000	0.69477	0.788000	0.26872	1.894000	0.54839	0.450000	0.29827	GCG	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.537	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	1	0	0	2	2	2	2	0	0	0	0	9	9	9	6	1	1.940000	-13.425340	1	0.550000	NM_004533		0	6	5	0	30	22	1		1			0	0	9	0	0	0.928474	0	0	0	0	0	0	6	30
HAS1	3036	broad.mit.edu	37	19	52220299	52220299	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr19:52220299G>A	ENST00000222115.1	-	3	884	c.850C>T	c.(850-852)Cga>Tga	p.R284*	HAS1_ENST00000601714.1_Nonsense_Mutation_p.R291*|HAS1_ENST00000594621.1_Nonsense_Mutation_p.R138*|HAS1_ENST00000540069.2_Nonsense_Mutation_p.R283*	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	284					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACCCAGTATCGCAGGCTGCTT	0.602																																					NSCLC(132;636 2450 45807 47979)	ENST00000222115.1	1.000000	9.000000e-01	1.000000	0.960000	0.990000	0.988535	0.990000	1.000000																										0				40						c.(850-852)Cga>Tga		hyaluronan synthase 1							111.0	106.0	108.0					19																	52220299		2203	4300	6503	SO:0001587	stop_gained	3036	0	0					g.chr19:52220299G>A	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.850C>T	chr19.hg19:g.52220299G>A	ENSP00000222115:p.Arg284*	0					HAS1_ENST00000601714.1_Nonsense_Mutation_p.R291*|HAS1_ENST00000594621.1_Nonsense_Mutation_p.R138*|HAS1_ENST00000540069.2_Nonsense_Mutation_p.R283*	p.R284*	NM_001523.2	NP_001514.2	1	2	3	2.106774	Q92839	HYAS1_HUMAN		3	884	-		all_neural(266;0.0189)|Medulloblastoma(540;0.146)	Q14470|Q9NS49	Nonsense_Mutation	SNP	ENST00000222115.1	0	1	hg19	c.850C>T	CCDS12838.1	1	.	.	.	.	.	.	.	.	.	.	g	36	5.695940	0.96802	.	.	ENSG00000105509	ENST00000540069;ENST00000222115;ENST00000376737;ENST00000376738	.	.	.	4.08	2.95	0.34219	4.08	2.95	0.34219	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9004	9.8479	0.41039	0.0:0.0:0.6878:0.3122	.	.	.	.	X	283;284;141;138	.	ENSP00000222115:R284X	R	-	1	2	2	HAS1	56912111	56912111	0.220000	0.23631	1.000000	0.80357	0.993000	0.82548	0.628000	0.24522	2.014000	0.59158	0.489000	0.48404	CGA	0.558499		TCGA-FB-A78T-01A-12D-A32N-08	0.602	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	1	0	1	2	2	2	2	0	0	0	0	116	116	116	115	1	1.940000	-8.885100	1	0.550000	NM_001523		0	153	150	0	392	391	1		1			0	0	116	0	0	1.000000	0	0	0	0	0	0	153	392
ADAMTSL4	54507	broad.mit.edu	37	1	150528719	150528719	+	Missense_Mutation	SNP	C	C	T	rs375355414		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:150528719C>T	ENST00000369038.2	+	7	1654	c.1453C>T	c.(1453-1455)Cgc>Tgc	p.R485C	ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R485C|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R508C|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R485C			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	485					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TTCTACCTGTCGCCTTGTTTC	0.612																																						ENST00000369038.2	1.000000	7.700000e-01	1.000000	0.830000	0.910000	0.918200	0.910000	0.890000																										0				32						c.(1453-1455)Cgc>Tgc		ADAMTS-like 4		C	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	99.0	96.0	97.0		1453,1453	4.7	0.9	1		97	0,8600		0,0,4300	no	missense,missense	ADAMTSL4	NM_019032.4,NM_025008.3	180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	485/1075,485/878	150528719	1,13005	2203	4300	6503	SO:0001583	missense	54507	2	121412	39				g.chr1:150528719C>T	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1453C>T	chr1.hg19:g.150528719C>T	ENSP00000358034:p.Arg485Cys	1					ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R508C|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R485C|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R485C	p.R485C			1	2	3	2.344206	Q6UY14	ATL4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)	7	1654	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	1	1	hg19	c.1453C>T	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599584	0.66332	2.27E-4	0.0	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	4.72	4.72	0.59763	4.72	4.72	0.59763	.	.	.	.	.	T	0.71626	0.3362	M	0.71871	2.18	0.44570	D	0.997533	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;P;P;P	0.63113	0.911;0.901;0.88;0.809	T	0.75736	-0.3213	9	0.87932	D	0	.	10.2988	0.43639	0.1967:0.8033:0.0:0.0	.	508;508;485;485	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	C	485;485;508;485	ENSP00000358037:R485C;ENSP00000271643:R485C;ENSP00000358035:R508C;ENSP00000358034:R485C	ENSP00000271643:R485C	R	+	1	0	0	ADAMTSL4	148795343	148795343	0.400000	0.25295	0.898000	0.35279	0.996000	0.88848	2.063000	0.41423	2.449000	0.82847	0.462000	0.41574	CGC	0.606299		TCGA-FB-A78T-01A-12D-A32N-08	0.612	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	1	0	1	2	2	2	2	0	0	0	0	169	169	169	166	1	1.940000	-4.017719	1	0.550000	NM_019032		0	155	154	0	568	560	1		1	1		0	0	169	0	0	1.000000	9.999993e-01	0	3	0	72	0	155	568
LCE1A	353131	broad.mit.edu	37	1	152800035	152800035	+	Silent	SNP	C	C	T	rs548821315		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:152800035C>T	ENST00000335123.2	+	1	87	c.87C>T	c.(85-87)tgC>tgT	p.C29C		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	29	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ctcctaagtgccccccaaagt	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		11983	0.001		0.0	False		,,,				2504	0.0					ENST00000335123.2	1.000000	0	1.000000	0.020000	0.050000	0.281685	0.050000	0.050000																										0				8						c.(85-87)tgC>tgT		late cornified envelope 1A							60.0	65.0	63.0					1																	152800035		2203	4300	6503	SO:0001819	synonymous_variant	353131	3	121412	38				g.chr1:152800035C>T		CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.87C>T	chr1.hg19:g.152800035C>T		1						p.C29C	NM_178348.2	NP_848125.1	1	2	3	2.344206	Q5T7P2	LCE1A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	1	87	+	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)			Silent	SNP	ENST00000335123.2	0	1	hg19	c.87C>T	CCDS1028.1	0																																																																																								0.606299		TCGA-FB-A78T-01A-12D-A32N-08	0.667	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034660.2	0	0	1	2	2	2	2	0	0	0	0	132	132	132	128	1	1.940000	-2.266049	0	0.550000	NM_178348		0	6	6	0	545	534	0		1			0	0	132	0	0	0.962894	0	0	0	0	0	0	6	545
PBXIP1	57326	broad.mit.edu	37	1	154918319	154918319	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:154918319G>A	ENST00000368463.3	-	10	1902	c.1831C>T	c.(1831-1833)Cgg>Tgg	p.R611W	PBXIP1_ENST00000539880.1_Missense_Mutation_p.R438W|PBXIP1_ENST00000542459.1_Missense_Mutation_p.R456W|PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000368465.1_Missense_Mutation_p.R582W	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	611					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCCTGTTGCCGCACTGGGGCT	0.627																																						ENST00000368463.3	1.000000	0	1.000000	0.030000	0.050000	0.285034	0.050000	0.050000																										0				24						c.(1831-1833)Cgg>Tgg		pre-B-cell leukemia homeobox interacting protein 1							54.0	54.0	54.0					1																	154918319		2203	4300	6503	SO:0001583	missense	57326	2	121410	30				g.chr1:154918319G>A	AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.1831C>T	chr1.hg19:g.154918319G>A	ENSP00000357448:p.Arg611Trp	1					PBXIP1_ENST00000368465.1_Missense_Mutation_p.R582W|PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000539880.1_Missense_Mutation_p.R438W|PBXIP1_ENST00000542459.1_Missense_Mutation_p.R456W	p.R611W	NM_020524.2	NP_065385.2	1	2	3	2.344206	Q96AQ6	PBIP1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)	10	1902	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	SNP	ENST00000368463.3	0	1	hg19	c.1831C>T	CCDS1074.1	0	.	.	.	.	.	.	.	.	.	.	G	17.10	3.303611	0.60305	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000539880;ENST00000543593;ENST00000542459	T;T;T;T	0.16743	2.32;2.34;2.38;2.36	4.72	3.79	0.43588	4.72	3.79	0.43588	.	0.612341	0.15264	N	0.271642	T	0.23289	0.0563	M	0.62723	1.935	0.30294	N	0.790065	D	0.89917	1.0	D	0.66196	0.942	T	0.03121	-1.1070	10	0.87932	D	0	-17.2576	11.8382	0.52338	0.0:0.0:0.8238:0.1762	.	611	Q96AQ6	PBIP1_HUMAN	W	582;611;438;387;456	ENSP00000357450:R582W;ENSP00000357448:R611W;ENSP00000440142:R438W;ENSP00000438584:R456W	ENSP00000357448:R611W	R	-	1	2	2	PBXIP1	153184943	153184943	0.564000	0.26602	0.999000	0.59377	0.959000	0.62525	1.282000	0.33226	1.157000	0.42530	0.462000	0.41574	CGG	0.606299		TCGA-FB-A78T-01A-12D-A32N-08	0.627	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	1.940000	-2.659484	1	0.550000	NM_020524		0	5	5	0	430	428	0		1	0		0	0	85	0	0	0.937122	8.854273e-01	0	0	0	338	0	5	430
TRIM46	80128	broad.mit.edu	37	1	155149492	155149492	+	Missense_Mutation	SNP	C	C	T	rs573947622		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:155149492C>T	ENST00000334634.4	+	4	754	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W	TRIM46_ENST00000368383.3_Missense_Mutation_p.R252W|TRIM46_ENST00000545012.1_Missense_Mutation_p.R126W|TRIM46_ENST00000368385.4_Missense_Mutation_p.R252W|TRIM46_ENST00000543729.1_Missense_Mutation_p.R259W|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368382.1_Missense_Mutation_p.R229W|TRIM46_ENST00000392451.2_Missense_Mutation_p.R252W|TRIM46_ENST00000468878.1_3'UTR	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	252						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGCCGGGTGCGGCGCACCCA	0.572											OREG0013855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0014	5008	,	,		21075	0.0		0.0	False		,,,				2504	0.0					ENST00000334634.4	1.000000	0	1.000000	0.020000	0.050000	0.281090	0.050000	0.050000																										0				29						c.(754-756)Cgg>Tgg		tripartite motif containing 46							101.0	100.0	100.0					1																	155149492		2203	4300	6503	SO:0001583	missense	80128	1	121412	34				g.chr1:155149492C>T		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.754C>T	chr1.hg19:g.155149492C>T	ENSP00000334657:p.Arg252Trp	1		OREG0013855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1768	RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368383.3_Missense_Mutation_p.R252W|TRIM46_ENST00000543729.1_Missense_Mutation_p.R259W|TRIM46_ENST00000368382.1_Missense_Mutation_p.R229W|TRIM46_ENST00000392451.2_Missense_Mutation_p.R252W|TRIM46_ENST00000368385.4_Missense_Mutation_p.R252W|TRIM46_ENST00000545012.1_Missense_Mutation_p.R126W|TRIM46_ENST00000468878.1_3'UTR	p.R252W	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	1	2	3	2.344206	Q7Z4K8	TRI46_HUMAN	Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)	4	754	+	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	0	1	hg19	c.754C>T	CCDS1097.1	0	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082698	0.76528	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000545012;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.43	3.49	0.39957	5.43	3.49	0.39957	Zinc finger, B-box (3);	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	L	0.59436	1.845	0.40970	D	0.984693	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.77557	0.938;0.99;0.981;0.99;0.987	T	0.48445	-0.9035	10	0.49607	T	0.09	.	12.1901	0.54266	0.4685:0.5314:0.0:0.0	.	239;252;229;252;252	F5H5Z2;Q5VT61;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;.;TRI46_HUMAN;.	W	259;239;252;126;252;252;229;252	ENSP00000442719:R259W;ENSP00000357369:R252W;ENSP00000440254:R126W;ENSP00000376245:R252W;ENSP00000357367:R252W;ENSP00000357366:R229W;ENSP00000334657:R252W	ENSP00000334657:R252W	R	+	1	2	2	TRIM46	153416116	153416116	0.985000	0.35326	1.000000	0.80357	0.998000	0.95712	0.515000	0.22801	0.690000	0.31570	0.655000	0.94253	CGG	0.606299		TCGA-FB-A78T-01A-12D-A32N-08	0.572	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	108	1	1.940000	-2.502898	1	0.550000	NM_025058		0	6	6	0	553	544	0		1	0		0	0	108	0	0	0.963337	0	0	0	0	1	0	6	553
POU2F1	5451	broad.mit.edu	37	1	167384904	167384904	+	Missense_Mutation	SNP	G	G	A	rs561712054		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:167384904G>A	ENST00000541643.3	+	17	2251	c.2089G>A	c.(2089-2091)Gca>Aca	p.A697T	POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Missense_Mutation_p.A709T|POU2F1_ENST00000420254.3_Intron|POU2F1_ENST00000429375.2_Missense_Mutation_p.A657T|POU2F1_ENST00000367866.2_Missense_Mutation_p.A720T			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	697					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						CTCTGCCGCCGCAGCATCTGC	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		17636	0.0		0.0	False		,,,				2504	0.001					ENST00000541643.3	1.000000	0	1.000000	0.010000	0.020000	0.264545	0.020000	0.030000																										0				30						c.(2089-2091)Gca>Aca		POU class 2 homeobox 1							150.0	139.0	142.0					1																	167384904		2203	4300	6503	SO:0001583	missense	5451	2	121412	40				g.chr1:167384904G>A	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.2089G>A	chr1.hg19:g.167384904G>A	ENSP00000441285:p.Ala697Thr	1					POU2F1_ENST00000420254.3_Intron|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Missense_Mutation_p.A709T|POU2F1_ENST00000429375.2_Missense_Mutation_p.A657T|POU2F1_ENST00000367866.2_Missense_Mutation_p.A720T	p.A697T			1	2	3	2.329890	P14859	PO2F1_HUMAN		17	2251	+			B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	ENST00000541643.3	0	1	hg19	c.2089G>A		0	.	.	.	.	.	.	.	.	.	.	G	19.83	3.901045	0.72754	.	.	ENSG00000143190	ENST00000367866;ENST00000429375;ENST00000367865;ENST00000541643;ENST00000367862	D;D;D;D;D	0.89746	-2.55;-2.53;-2.53;-2.52;-2.56	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.188821	0.44902	D	0.000419	T	0.81211	0.4775	N	0.19112	0.55	0.35590	D	0.806972	D;D;D;P	0.56521	0.96;0.976;0.976;0.892	B;B;P;B	0.46510	0.151;0.29;0.519;0.151	D	0.85609	0.1257	9	0.87932	D	0	.	17.295	0.87168	0.0:0.0:1.0:0.0	.	657;709;695;697	B4E029;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	T	720;657;695;697;709	ENSP00000356840:A720T;ENSP00000401217:A657T;ENSP00000356839:A695T;ENSP00000441285:A697T;ENSP00000356836:A709T	ENSP00000356836:A709T	A	+	1	0	0	POU2F1	165651528	165651528	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.572000	0.60886	2.746000	0.94184	0.591000	0.81541	GCA	0.605350		TCGA-FB-A78T-01A-12D-A32N-08	0.602	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	194	194	194	194	1	1.940000	-1.903956	0	0.550000	NM_002697		0	6	6	0	957	941	0		1	0		0	0	194	0	0	0.963151	8.313247e-03	0	0	0	18	0	6	957
PRELP	5549	broad.mit.edu	37	1	203452587	203452587	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:203452587G>A	ENST00000343110.2	+	2	402	c.275G>A	c.(274-276)cGc>cAc	p.R92H		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	92					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			TGTGATAGCCGCAACCTGCGA	0.587																																						ENST00000343110.2	1.000000	0	1.000000	0.020000	0.050000	0.279287	0.050000	0.050000																										0				36						c.(274-276)cGc>cAc		proline/arginine-rich end leucine-rich repeat protein							108.0	100.0	103.0					1																	203452587		2203	4300	6503	SO:0001583	missense	5549	0	0					g.chr1:203452587G>A	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.275G>A	chr1.hg19:g.203452587G>A	ENSP00000343924:p.Arg92His	1						p.R92H	NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	1	2	3	2.349500	P51888	PRELP_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)	2	402	+			Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	0	1	hg19	c.275G>A	CCDS1438.1	0	.	.	.	.	.	.	.	.	.	.	G	21.3	4.136216	0.77662	.	.	ENSG00000188783	ENST00000343110	D	0.97066	-4.23	4.71	4.71	0.59529	4.71	4.71	0.59529	Leucine-rich repeat-containing N-terminal (2);	0.065635	0.64402	D	0.000012	D	0.98115	0.9378	M	0.76727	2.345	0.54753	D	0.999984	D	0.89917	1.0	D	0.83275	0.996	D	0.98206	1.0470	10	0.40728	T	0.16	-15.1291	16.2483	0.82460	0.0:0.0:1.0:0.0	.	92	P51888	PRELP_HUMAN	H	92	ENSP00000343924:R92H	ENSP00000343924:R92H	R	+	2	0	0	PRELP	201719210	201719210	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.990000	0.56965	2.165000	0.68154	0.462000	0.41574	CGC	0.603437		TCGA-FB-A78T-01A-12D-A32N-08	0.587	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	0	0	1	2	2	2	2	0	0	0	0	141	141	141	140	1	1.940000	-1.922904	0	0.550000	NM_002725		0	6	6	0	579	567	0		1	0		0	0	141	0	0	0.962615	4.885853e-01	0	0	0	144	0	6	579
CR2	1380	broad.mit.edu	37	1	207642232	207642232	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:207642232T>A	ENST00000367058.3	+	4	911	c.722T>A	c.(721-723)tTc>tAc	p.F241Y	CR2_ENST00000367057.3_Missense_Mutation_p.F241Y|CR2_ENST00000458541.2_Missense_Mutation_p.F241Y|CR2_ENST00000367059.3_Missense_Mutation_p.F241Y|CR2_ENST00000485707.1_3'UTR	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	241	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						GCAAACTTTTTCTGTGATGAA	0.433																																						ENST00000367058.3	1.000000	1.100000e-01	1.000000	0.150000	0.210000	0.394126	0.210000	0.190000																										0				69						c.(721-723)tTc>tAc		complement component (3d/Epstein Barr virus) receptor 2							70.0	66.0	68.0					1																	207642232		2203	4300	6503	SO:0001583	missense	1380	0	0					g.chr1:207642232T>A	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.722T>A	chr1.hg19:g.207642232T>A	ENSP00000356025:p.Phe241Tyr	1					CR2_ENST00000458541.2_Missense_Mutation_p.F241Y|CR2_ENST00000367057.3_Missense_Mutation_p.F241Y|CR2_ENST00000367059.3_Missense_Mutation_p.F241Y|CR2_ENST00000485707.1_3'UTR	p.F241Y	NM_001877.4	NP_001868.2	1	2	3	2.349500	P20023	CR2_HUMAN		4	911	+			C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	1	1	hg19	c.722T>A	CCDS1478.1	0	.	.	.	.	.	.	.	.	.	.	T	7.620	0.676604	0.14841	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.36	-0.327	0.12694	5.36	-0.327	0.12694	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.46092	0.1375	N	0.11284	0.12	0.09310	N	1	B;P;B	0.40578	0.376;0.722;0.325	B;P;B	0.48921	0.426;0.595;0.3	T	0.37596	-0.9699	9	0.51188	T	0.08	.	3.5273	0.07763	0.3165:0.4366:0.0:0.2469	.	241;241;241	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	Y	241	ENSP00000356025:F241Y;ENSP00000356024:F241Y;ENSP00000356026:F241Y;ENSP00000404222:F241Y	ENSP00000356024:F241Y	F	+	2	0	0	CR2	205708855	205708855	0.003000	0.15002	0.016000	0.15963	0.002000	0.02628	0.038000	0.13862	-0.015000	0.14150	-1.098000	0.02139	TTC	0.603437		TCGA-FB-A78T-01A-12D-A32N-08	0.433	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.940000	-16.783320	1	0.550000	NM_001877		0	15	15	0	312	306	0		1			0	0	50	0	0	0.999863	0	0	0	0	0	0	15	312
MANEAL	149175	broad.mit.edu	37	1	38265867	38265867	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:38265867C>T	ENST00000373045.6	+	4	1747	c.1366C>T	c.(1366-1368)Ctc>Ttc	p.L456F	MANEAL_ENST00000397631.3_3'UTR|RP11-109P14.9_ENST00000433474.1_RNA|MANEAL_ENST00000329006.5_Missense_Mutation_p.L234F|MANEAL_ENST00000525897.1_Missense_Mutation_p.L262F	NM_001113482.1	NP_001106954.1	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like	456						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|liver(1)|lung(1)|prostate(3)	7	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGAGCAGTGGCTCATGTGAGG	0.582																																						ENST00000373045.6	0.500000	2.700000e-01	0.450000	0.320000	0.380000	0.389232	0.380000	0.380000																										0				7						c.(1366-1368)Ctc>Ttc		mannosidase, endo-alpha-like							40.0	43.0	42.0					1																	38265867		2196	4289	6485	SO:0001583	missense	149175	0	0					g.chr1:38265867C>T	AK055996	CCDS426.1, CCDS44110.1, CCDS44111.1	1p34.3	2008-02-05			ENSG00000185090	ENSG00000185090			26452	protein-coding gene	gene with protein product							Standard	NM_152496		Approved	FLJ31434	uc001cby.2	Q5VSG8	OTTHUMG00000004317	ENST00000373045.6:c.1366C>T	chr1.hg19:g.38265867C>T	ENSP00000362136:p.Leu456Phe	1					MANEAL_ENST00000525897.1_Missense_Mutation_p.L262F|RP11-109P14.9_ENST00000433474.1_RNA|MANEAL_ENST00000329006.5_Missense_Mutation_p.L234F|MANEAL_ENST00000397631.3_3'UTR	p.L456F	NM_001113482.1	NP_001106954.1	0	1	1	1.824016	Q5VSG8	MANEL_HUMAN		4	1747	+	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	Q6DD86|Q6P497|Q8N5P8|Q96G55|Q96N42	Missense_Mutation	SNP	ENST00000373045.6	1	1	hg19	c.1366C>T	CCDS44110.1	0	.	.	.	.	.	.	.	.	.	.	C	19.42	3.824681	0.71143	.	.	ENSG00000185090	ENST00000373045;ENST00000525897;ENST00000329006	.	.	.	5.62	4.51	0.55191	5.62	4.51	0.55191	.	0.063428	0.64402	D	0.000006	T	0.68284	0.2984	M	0.65975	2.015	0.51767	D	0.999932	D;D	0.64830	0.962;0.994	P;P	0.59889	0.528;0.865	T	0.70414	-0.4878	9	0.62326	D	0.03	-8.2914	11.3578	0.49625	0.0:0.8696:0.0:0.1304	.	234;456	Q5VSG8-2;Q5VSG8	.;MANEL_HUMAN	F	456;262;234	.	ENSP00000328770:L234F	L	+	1	0	0	MANEAL	38038454	38038454	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.014000	0.49590	2.662000	0.90505	0.655000	0.94253	CTC	0.488055		TCGA-FB-A78T-01A-12D-A32N-08	0.582	MANEAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012469.2	1	0	1	2	2	2	2	0	0	0	0	83	83	83	79	1	1.940000	-20.000000	1	0.550000	NM_152496		0	37	37	0	272	261	1		1	1		0	0	83	0	0	1.000000	8.166006e-01	0	5	0	20	0	37	272
OBSCN	84033	broad.mit.edu	37	1	228480445	228480445	+	Missense_Mutation	SNP	G	G	A	rs374049885		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr1:228480445G>A	ENST00000422127.1	+	40	10869	c.10825G>A	c.(10825-10827)Gtg>Atg	p.V3609M	OBSCN_ENST00000366709.4_Missense_Mutation_p.V728M|OBSCN_ENST00000359599.6_Missense_Mutation_p.V2456M|OBSCN_ENST00000284548.11_Missense_Mutation_p.V3609M|OBSCN_ENST00000366707.4_Missense_Mutation_p.V728M|OBSCN_ENST00000570156.2_Missense_Mutation_p.V4038M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3609	Ig-like 36.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTACTCGTGCGTGTGCGGGCA	0.577																																						ENST00000422127.1	1.000000	8.200000e-01	1.000000	0.890000	0.980000	0.960648	0.980000	1.000000																										0				223						c.(10825-10827)Gtg>Atg		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF		G	MET/VAL,MET/VAL	1,4289		0,1,2144	120.0	122.0	121.0		10825,10825	1.5	0.0	1		121	1,8483		0,1,4241	no	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	21,21	0,2,6385	AA,AG,GG		0.0118,0.0233,0.0157	benign,benign	3609/7969,3609/6621	228480445	2,12772	2145	4242	6387	SO:0001583	missense	84033	5	121168	42				g.chr1:228480445G>A	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.10825G>A	chr1.hg19:g.228480445G>A	ENSP00000409493:p.Val3609Met	1					OBSCN_ENST00000284548.11_Missense_Mutation_p.V3609M|OBSCN_ENST00000366707.4_Missense_Mutation_p.V728M|OBSCN_ENST00000570156.2_Missense_Mutation_p.V4038M|OBSCN_ENST00000359599.6_Missense_Mutation_p.V2456M|OBSCN_ENST00000366709.4_Missense_Mutation_p.V728M	p.V3609M	NM_001098623.2	NP_001092093.2	1	2	3	2.333656	Q5VST9	OBSCN_HUMAN		40	10869	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	1	1	hg19	c.10825G>A	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499541	0.44455	2.33E-4	1.18E-4	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	5.38	1.45	0.22620	5.38	1.45	0.22620	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.167348	0.41097	N	0.000958	T	0.68348	0.2991	M	0.81112	2.525	0.22266	N	0.999248	P;P	0.48407	0.91;0.89	P;P	0.46585	0.521;0.454	T	0.60860	-0.7179	10	0.33940	T	0.23	.	10.045	0.42182	0.2732:0.0:0.7268:0.0	.	3609;3609	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	M	3609;3609;728;728;2456	ENSP00000284548:V3609M;ENSP00000409493:V3609M;ENSP00000355668:V728M;ENSP00000355670:V728M;ENSP00000352613:V2456M	ENSP00000284548:V3609M	V	+	1	0	0	OBSCN	226547068	226547068	0.000000	0.05858	0.005000	0.12908	0.025000	0.11179	-0.104000	0.10923	0.017000	0.15025	0.561000	0.74099	GTG	0.603437		TCGA-FB-A78T-01A-12D-A32N-08	0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	140	140	140	137	1	1.940000	-4.848147	1	0.550000	NM_052843		0	139	139	0	459	452	1		1	0		0	0	140	0	0	1.000000	5.474210e-02	0	0	0	2	0	139	459
NCOA6	23054	broad.mit.edu	37	20	33345146	33345146	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr20:33345146G>A	ENST00000374796.2	-	8	3975	c.1405C>T	c.(1405-1407)Cag>Tag	p.Q469*	NCOA6_ENST00000359003.2_Nonsense_Mutation_p.Q469*			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	469	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CTGACAGGCTGCTGAAATCCC	0.557																																						ENST00000374796.2	1.000000	8.400000e-01	1.000000	0.900000	0.960000	0.958971	0.960000	1.000000																										0				107						c.(1405-1407)Cag>Tag		nuclear receptor coactivator 6							118.0	121.0	120.0					20																	33345146		2203	4300	6503	SO:0001587	stop_gained	23054	0	0					g.chr20:33345146G>A	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.1405C>T	chr20.hg19:g.33345146G>A	ENSP00000363929:p.Gln469*	0					NCOA6_ENST00000359003.2_Nonsense_Mutation_p.Q469*	p.Q469*			0	0	0	2.037065	Q14686	NCOA6_HUMAN		8	3975	-			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Nonsense_Mutation	SNP	ENST00000374796.2	0	1	hg19	c.1405C>T	CCDS13241.1	1	.	.	.	.	.	.	.	.	.	.	G	55	23.676371	0.99956	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	.	.	.	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-2.9148	19.8745	0.96864	0.0:0.0:1.0:0.0	.	.	.	.	X	469	.	ENSP00000351894:Q469X	Q	-	1	0	0	NCOA6	32808807	32808807	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.229000	0.95273	2.704000	0.92352	0.467000	0.42956	CAG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.557	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	0	0	1	2	2	2	2	0	0	0	0	137	137	137	136	1	1.940000	-20.000000	1	0.550000	NM_014071		0	159	155	0	435	430	1		1	1		0	0	137	0	0	1.000000	9.896963e-01	0	5	0	17	0	159	435
PTPRT	11122	broad.mit.edu	37	20	40980846	40980846	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr20:40980846T>C	ENST00000373187.1	-	10	1639	c.1640A>G	c.(1639-1641)aAt>aGt	p.N547S	PTPRT_ENST00000356100.2_Missense_Mutation_p.N547S|PTPRT_ENST00000373184.1_Missense_Mutation_p.N547S|PTPRT_ENST00000373193.3_Missense_Mutation_p.N547S|PTPRT_ENST00000373190.1_Missense_Mutation_p.N547S|PTPRT_ENST00000373201.1_Missense_Mutation_p.N547S|PTPRT_ENST00000373198.4_Missense_Mutation_p.N547S			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	547	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTGGGTTTCATTCCGGAGCTT	0.567																																						ENST00000373187.1	1.000000	8.100000e-01	1.000000	0.880000	0.960000	0.953353	0.960000	1.000000																										0				176						c.(1639-1641)aAt>aGt		protein tyrosine phosphatase, receptor type, T							86.0	92.0	91.0					20																	40980846		1962	4144	6106	SO:0001583	missense	11122	0	0					g.chr20:40980846T>C	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1640A>G	chr20.hg19:g.40980846T>C	ENSP00000362283:p.Asn547Ser	0					PTPRT_ENST00000373198.4_Missense_Mutation_p.N547S|PTPRT_ENST00000356100.2_Missense_Mutation_p.N547S|PTPRT_ENST00000373184.1_Missense_Mutation_p.N547S|PTPRT_ENST00000373201.1_Missense_Mutation_p.N547S|PTPRT_ENST00000373190.1_Missense_Mutation_p.N547S|PTPRT_ENST00000373193.3_Missense_Mutation_p.N547S	p.N547S			0	0	0	2.037065	O14522	PTPRT_HUMAN		10	1639	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	1	1	hg19	c.1640A>G	CCDS42874.1	1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112398	0.56398	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44	6.03	6.03	0.97812	6.03	6.03	0.97812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.093376	0.64402	D	0.000001	T	0.49541	0.1563	L	0.47190	1.495	0.58432	D	0.999992	B;B	0.32893	0.337;0.389	B;B	0.33454	0.102;0.164	T	0.48340	-0.9044	10	0.46703	T	0.11	.	16.5549	0.84482	0.0:0.0:0.0:1.0	.	547;547	O14522-1;O14522	.;PTPRT_HUMAN	S	547	ENSP00000362286:N547S;ENSP00000362283:N547S;ENSP00000362289:N547S;ENSP00000348408:N547S;ENSP00000362294:N547S;ENSP00000362280:N547S;ENSP00000362297:N547S	ENSP00000348408:N547S	N	-	2	0	0	PTPRT	40414260	40414260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.289000	0.72696	2.310000	0.77875	0.450000	0.29827	AAT	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.567	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1	0	0	0	2	2	2	2	0	0	0	0	103	103	103	101	1	1.940000	-20.000000	1	0.550000			0	114	114	0	313	311	1		1	0		0	0	103	0	0	1.000000	7.231528e-02	0	0	0	2	0	114	313
TOX2	84969	broad.mit.edu	37	20	42695426	42695426	+	Silent	SNP	A	A	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr20:42695426A>T	ENST00000358131.5	+	7	1567	c.1359A>T	c.(1357-1359)ccA>ccT	p.P453P	TOX2_ENST00000341197.4_Silent_p.P471P|TOX2_ENST00000372999.1_Silent_p.P429P|TOX2_ENST00000423191.2_Silent_p.P429P|TOX2_ENST00000435864.2_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	453	Pro-rich.				female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CACCTGGCCCATCCAACCCCA	0.627																																						ENST00000358131.5	0.200000	9.000000e-02	0.180000	0.110000	0.140000	0.149179	0.140000	0.140000																										0				26						c.(1357-1359)ccA>ccT		TOX high mobility group box family member 2							131.0	122.0	125.0					20																	42695426		2203	4300	6503	SO:0001819	synonymous_variant	84969	0	0					g.chr20:42695426A>T	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1359A>T	chr20.hg19:g.42695426A>T		0					TOX2_ENST00000372999.1_Silent_p.P429P|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000341197.4_Silent_p.P471P|TOX2_ENST00000423191.2_Silent_p.P429P	p.P453P	NM_001098798.1	NP_001092268.1	0	0	0	2.037065	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)	7	1567	+		Myeloproliferative disorder(115;0.00452)	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	0	1	hg19	c.1359A>T	CCDS42875.1	0	.	.	.	.	.	.	.	.	.	.	A	5.215	0.225183	0.09916	.	.	ENSG00000124191	ENST00000372992;ENST00000413823	.	.	.	5.78	-11.3	0.00108	5.78	-11.3	0.00108	.	.	.	.	.	T	0.74997	0.3790	.	.	.	0.38329	D	0.943755	.	.	.	.	.	.	D	0.87310	0.2311	5	0.87932	D	0	.	20.2522	0.98409	0.8527:0.0:0.1473:0.0	.	.	.	.	L	78	.	ENSP00000362083:H78L	H	+	2	0	0	TOX2	42128840	42128840	0.071000	0.21146	0.033000	0.17914	0.065000	0.16274	-0.405000	0.07196	-3.008000	0.00273	-2.200000	0.00306	CAT	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.627	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2	1	0	1	2	2	2	2	0	0	0	0	158	158	158	158	1	1.940000	-4.558762	1	0.550000			0	28	28	0	676	663	0		1	0		0	0	158	0	0	1.000000	5.076338e-03	0	0	0	3	0	28	676
VSNL1	7447	broad.mit.edu	37	2	17830679	17830679	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr2:17830679C>A	ENST00000406397.1	+	3	690	c.165C>A	c.(163-165)ttC>ttA	p.F55L	VSNL1_ENST00000295156.4_Missense_Mutation_p.F55L|VSNL1_ENST00000404666.2_Missense_Mutation_p.F55L			P62760	VISL1_HUMAN	visinin-like 1	55	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)		calcium ion binding (GO:0005509)			NS(1)|breast(1)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CTTTGCAGTTCTTTCCTTATG	0.572																																						ENST00000406397.1	0.570000	3.400000e-01	0.510000	0.390000	0.440000	0.456292	0.440000	0.450000																										0				13						c.(163-165)ttC>ttA		visinin-like 1							114.0	115.0	115.0					2																	17830679		2203	4300	6503	SO:0001583	missense	7447	0	0					g.chr2:17830679C>A		CCDS1689.1	2p24.3	2013-01-10			ENSG00000163032	ENSG00000163032		"""EF-hand domain containing"""	12722	protein-coding gene	gene with protein product	"""hippocalcin-like protein 3"""	600817				8530085, 2202488	Standard	NM_003385		Approved	VILIP, HPCAL3, HUVISL1, HLP3, VILIP-1	uc002rcm.3	P62760	OTTHUMG00000090645	ENST00000406397.1:c.165C>A	chr2.hg19:g.17830679C>A	ENSP00000384719:p.Phe55Leu	0					VSNL1_ENST00000295156.4_Missense_Mutation_p.F55L|VSNL1_ENST00000404666.2_Missense_Mutation_p.F55L	p.F55L			0	0	0	2.020472	P62760	VISL1_HUMAN		3	690	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		D6W515|P28677|P29103|P42323|Q9UM20	Missense_Mutation	SNP	ENST00000406397.1	1	1	hg19	c.165C>A	CCDS1689.1	0	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911958	0.52439	.	.	ENSG00000163032	ENST00000404666;ENST00000457525;ENST00000295156;ENST00000451533;ENST00000406397	T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72	4.34	3.44	0.39384	4.34	3.44	0.39384	EF-hand-like domain (1);	0.104574	0.64402	D	0.000002	T	0.28134	0.0694	M	0.79123	2.44	0.58432	D	0.999991	B	0.12013	0.005	B	0.10450	0.005	T	0.28713	-1.0035	10	0.72032	D	0.01	.	7.306	0.26447	0.0:0.7406:0.0:0.2594	.	55	P62760	VISL1_HUMAN	L	55	ENSP00000384014:F55L;ENSP00000405511:F55L;ENSP00000295156:F55L;ENSP00000390124:F55L;ENSP00000384719:F55L	ENSP00000295156:F55L	F	+	3	2	2	VSNL1	17694160	17694160	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	2.151000	0.42263	2.122000	0.65172	0.454000	0.30748	TTC	0.547511		TCGA-FB-A78T-01A-12D-A32N-08	0.572	VSNL1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323803.1	1	0	1	2	2	2	2	0	0	0	0	120	120	120	120	1	1.940000	-19.993120	1	0.550000	NM_003385		0	55	55	0	386	382	1		1	0		0	0	120	0	0	1.000000	8.095731e-02	0	1	0	2	0	55	386
ZC3H6	376940	broad.mit.edu	37	2	113089550	113089550	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr2:113089550G>A	ENST00000409871.1	+	12	3456	c.3055G>A	c.(3055-3057)Ggg>Agg	p.G1019R	AC115115.2_ENST00000607612.1_RNA|ZC3H6_ENST00000343936.4_Missense_Mutation_p.G1019R	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	1019							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						TTCTGGTTCCGGGGCTCTGCC	0.507																																						ENST00000409871.1	0.980000	5.600000e-01	0.880000	0.660000	0.760000	0.771945	0.760000	0.770000																										0				35						c.(3055-3057)Ggg>Agg		zinc finger CCCH-type containing 6							57.0	54.0	55.0					2																	113089550		1901	4124	6025	SO:0001583	missense	376940	0	0					g.chr2:113089550G>A	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.3055G>A	chr2.hg19:g.113089550G>A	ENSP00000386764:p.Gly1019Arg	0					ZC3H6_ENST00000343936.4_Missense_Mutation_p.G1019R|AC115115.2_ENST00000607612.1_RNA	p.G1019R	NM_198581.2	NP_940983.2	0	0	0	2.020472	P61129	ZC3H6_HUMAN		12	3456	+			A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	1	1	hg19	c.3055G>A	CCDS46393.1	0	.	.	.	.	.	.	.	.	.	.	G	5.393	0.257724	0.10239	.	.	ENSG00000188177	ENST00000409871;ENST00000343936	T;T	0.13538	2.58;2.58	5.33	3.27	0.37495	5.33	3.27	0.37495	.	0.565940	0.18877	N	0.128691	T	0.11452	0.0279	L	0.44542	1.39	0.09310	N	1	B	0.15719	0.014	B	0.06405	0.002	T	0.25152	-1.0140	10	0.33141	T	0.24	-0.002	8.1676	0.31237	0.2758:0.0:0.7242:0.0	.	1019	P61129	ZC3H6_HUMAN	R	1019	ENSP00000386764:G1019R;ENSP00000340298:G1019R	ENSP00000340298:G1019R	G	+	1	0	0	ZC3H6	112806021	112806021	1.000000	0.71417	0.162000	0.22713	0.473000	0.32948	4.501000	0.60393	0.434000	0.26340	0.591000	0.81541	GGG	0.547511		TCGA-FB-A78T-01A-12D-A32N-08	0.507	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.940000	-3.114658	1	0.550000	NM_198581		0	40	40	0	149	146	1		1	0		0	0	51	0	0	1.000000	3.801537e-01	0	0	0	6	0	40	149
TTN	7273	broad.mit.edu	37	2	179425623	179425623	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr2:179425623A>C	ENST00000591111.1	-	276	80537	c.80313T>G	c.(80311-80313)caT>caG	p.H26771Q	TTN_ENST00000342175.6_Missense_Mutation_p.H19539Q|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.H19472Q|TTN_ENST00000342992.6_Missense_Mutation_p.H25844Q|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.H19347Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.H28412Q			Q8WZ42	TITIN_HUMAN	titin	26771	Ig-like 128.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAACAAAGTATGATTGTCTG	0.433																																						ENST00000591111.1	0.250000	5.000000e-02	0.200000	0.090000	0.130000	0.146980	0.130000	0.130000																										0				1448						c.(80311-80313)caT>caG		titin							147.0	125.0	132.0					2																	179425623		1924	4139	6063	SO:0001583	missense	7273	0	0					g.chr2:179425623A>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80313T>G	chr2.hg19:g.179425623A>C	ENSP00000465570:p.His26771Gln	0					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.H25844Q|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.H19347Q|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.H28412Q|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.H19539Q|TTN_ENST00000359218.5_Missense_Mutation_p.H19472Q|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.H26771Q			0	0	0	2.020472	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	80537	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.80313T>G		0	.	.	.	.	.	.	.	.	.	.	A	3.073	-0.190763	0.06299	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.97	-0.842	0.10748	5.97	-0.842	0.10748	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49795	0.1578	L	0.41961	1.31	0.09310	N	0.999996	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.17979	0.011;0.011;0.02;0.02	T	0.49360	-0.8948	9	0.87932	D	0	.	6.1603	0.20360	0.543:0.0:0.3354:0.1216	.	19347;19472;19539;26771	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	25844;19347;19539;19472;19345	ENSP00000343764:H25844Q;ENSP00000434586:H19347Q;ENSP00000340554:H19539Q;ENSP00000352154:H19472Q	ENSP00000340554:H19539Q	H	-	3	2	2	TTN	179133869	179133869	0.000000	0.05858	0.039000	0.18376	0.227000	0.25037	-0.205000	0.09411	0.170000	0.19704	0.533000	0.62120	CAT	0.547511		TCGA-FB-A78T-01A-12D-A32N-08	0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.940000	-9.667730	1	0.550000	NM_133378		0	7	7	0	187	185	0		1			0	0	43	0	0	0.980476	0	0	0	0	0	0	7	187
NCAPH	23397	broad.mit.edu	37	2	97033078	97033078	+	Silent	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr2:97033078G>A	ENST00000240423.4	+	15	2008	c.1965G>A	c.(1963-1965)ctG>ctA	p.L655L	NCAPH_ENST00000455200.1_Silent_p.L644L|NCAPH_ENST00000427946.1_Silent_p.L519L	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	655					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				GGAGTCTGCTGACAGCGCTCT	0.478																																						ENST00000240423.4	0.260000	9.000000e-02	0.220000	0.130000	0.160000	0.177770	0.160000	0.170000																										0				28						c.(1963-1965)ctG>ctA		non-SMC condensin I complex, subunit H							87.0	85.0	85.0					2																	97033078		2203	4300	6503	SO:0001819	synonymous_variant	23397	0	0					g.chr2:97033078G>A	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1965G>A	chr2.hg19:g.97033078G>A		0					NCAPH_ENST00000455200.1_Silent_p.L644L|NCAPH_ENST00000427946.1_Silent_p.L519L	p.L655L	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	0	0	0	2.020472	Q15003	CND2_HUMAN		15	2008	+		Ovarian(717;0.0221)	B4E189|Q8TB87	Silent	SNP	ENST00000240423.4	1	1	hg19	c.1965G>A	CCDS2021.1	0	.	.	.	.	.	.	.	.	.	.	G	4.855	0.158883	0.09236	.	.	ENSG00000121152	ENST00000435349	.	.	.	6.07	6.07	0.98685	6.07	6.07	0.98685	.	.	.	.	.	T	0.64000	0.2559	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60895	-0.7172	4	.	.	.	-11.9218	11.4063	0.49900	0.0812:0.0:0.9188:0.0	.	.	.	.	N	96	.	.	D	+	1	0	0	NCAPH	96396805	96396805	1.000000	0.71417	0.995000	0.50966	0.514000	0.34195	2.854000	0.48325	2.890000	0.99128	0.650000	0.86243	GAC	0.547511		TCGA-FB-A78T-01A-12D-A32N-08	0.478	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	1	0	1	2	2	2	2	0	0	0	0	86	86	86	86	1	1.940000	-4.807584	1	0.550000	NM_015341		0	16	16	0	327	323	0		1	0		0	0	86	0	0	0.999932	3.309498e-01	0	1	0	23	0	16	327
TMEM131	23505	broad.mit.edu	37	2	98377121	98377121	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr2:98377121G>T	ENST00000186436.5	-	38	5271	c.5043C>A	c.(5041-5043)aaC>aaA	p.N1681K		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1681	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						AACCTGTTTTGTTTGAAGAAA	0.507																																						ENST00000186436.5	1.000000	9.300000e-01	1.000000	0.990000	0.990000	0.996526	0.990000	1.000000																										0				57						c.(5041-5043)aaC>aaA		transmembrane protein 131							103.0	106.0	105.0					2																	98377121		1976	4153	6129	SO:0001583	missense	23505	0	0					g.chr2:98377121G>T	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.5043C>A	chr2.hg19:g.98377121G>T	ENSP00000186436:p.Asn1681Lys	0						p.N1681K	NM_015348.1	NP_056163.1	0	0	0	2.020472	Q92545	TM131_HUMAN		38	5271	-				Missense_Mutation	SNP	ENST00000186436.5	1	1	hg19	c.5043C>A	CCDS46368.1	1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992820	0.35131	.	.	ENSG00000075568	ENST00000186436	T	0.30714	1.52	5.39	2.12	0.27331	5.39	2.12	0.27331	.	0.600408	0.18546	N	0.138053	T	0.13927	0.0337	N	0.24115	0.695	0.80722	D	1	B;B	0.16396	0.002;0.017	B;B	0.12837	0.001;0.008	T	0.12734	-1.0536	10	0.05721	T	0.95	-8.0245	4.4318	0.11531	0.3871:0.0:0.4636:0.1493	.	1681;61	Q92545;Q0P631	TM131_HUMAN;.	K	1681	ENSP00000186436:N1681K	ENSP00000186436:N1681K	N	-	3	2	2	TMEM131	97743553	97743553	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	1.997000	0.40786	0.764000	0.33197	0.643000	0.83706	AAC	0.547511		TCGA-FB-A78T-01A-12D-A32N-08	0.507	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	1	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	1.940000	-20.000000	1	0.550000	XM_371542		0	35	35	0	65	65	1		1	1		0	0	33	0	0	1.000000	1	0	29	0	70	0	35	65
TNS1	7145	broad.mit.edu	37	2	218683151	218683151	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr2:218683151G>A	ENST00000171887.4	-	24	4044	c.3592C>T	c.(3592-3594)Cgg>Tgg	p.R1198W	TNS1_ENST00000430930.1_Missense_Mutation_p.R1177W|TNS1_ENST00000419504.1_Missense_Mutation_p.R1185W	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1198					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TTGATGGCCCGCCAGCCGAAG	0.632																																						ENST00000171887.4	0.090000	0	0.070000	0.020000	0.030000	0.047008	0.030000	0.040000																										0				79						c.(3592-3594)Cgg>Tgg		tensin 1							52.0	56.0	54.0					2																	218683151		2203	4300	6503	SO:0001583	missense	7145	6	121412	37				g.chr2:218683151G>A	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.3592C>T	chr2.hg19:g.218683151G>A	ENSP00000171887:p.Arg1198Trp	0					TNS1_ENST00000419504.1_Missense_Mutation_p.R1185W|TNS1_ENST00000430930.1_Missense_Mutation_p.R1177W	p.R1198W	NM_022648.4	NP_072174.3	0	0	0	2.020472	Q9HBL0	TENS1_HUMAN		24	4044	-		Renal(207;0.0483)|Lung NSC(271;0.213)	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	0	1	hg19	c.3592C>T	CCDS2407.1	0	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344661	0.61073	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.92965	-3.14;1.75;-3.13;-3.13	4.61	4.61	0.57282	4.61	4.61	0.57282	.	0.275476	0.28784	N	0.014151	D	0.93569	0.7947	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.976;0.995;0.994	D	0.93425	0.6780	10	0.72032	D	0.01	.	10.717	0.46019	0.0:0.0:0.6693:0.3307	.	1198;1177;1185	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	W	1198;336;1185;1177	ENSP00000171887:R1198W;ENSP00000394171:R336W;ENSP00000408724:R1185W;ENSP00000406016:R1177W	ENSP00000171887:R1198W	R	-	1	2	2	TNS1	218391396	218391396	0.758000	0.28405	0.999000	0.59377	0.780000	0.44128	0.682000	0.25335	2.403000	0.81681	0.563000	0.77884	CGG	0.547511		TCGA-FB-A78T-01A-12D-A32N-08	0.632	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	0	0	1	2	2	2	2	0	0	0	0	140	140	140	138	1	1.940000	-2.414124	0	0.550000	NM_022648		0	6	6	0	529	516	0		1	0		0	0	140	0	0	0.962393	1.836221e-01	0	1	0	57	0	6	529
ARHGAP31	57514	broad.mit.edu	37	3	119132851	119132851	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr3:119132851C>T	ENST00000264245.4	+	12	2607	c.2075C>T	c.(2074-2076)cCc>cTc	p.P692L		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	692	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AGTCTGGGGCCCTTTATTCCC	0.562																																					Pancreas(7;176 297 5394 51128 51241)	ENST00000264245.4	0.910000	7.000000e-01	0.860000	0.750000	0.800000	0.811256	0.800000	0.810000																										0				67						c.(2074-2076)cCc>cTc		Rho GTPase activating protein 31							127.0	129.0	128.0					3																	119132851		1949	4146	6095	SO:0001583	missense	57514	0	0					g.chr3:119132851C>T		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2075C>T	chr3.hg19:g.119132851C>T	ENSP00000264245:p.Pro692Leu	0						p.P692L	NM_020754.2	NP_065805.2	0	0	0	2.030228	Q2M1Z3	RHG31_HUMAN		12	2607	+			Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	1	1	hg19	c.2075C>T	CCDS43135.1	0	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896949	0.33535	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.06142	3.34	4.89	4.01	0.46588	4.89	4.01	0.46588	.	0.998160	0.08112	N	0.996113	T	0.06325	0.0163	L	0.32530	0.975	0.09310	N	0.999999	B	0.27229	0.172	B	0.22386	0.039	T	0.34750	-0.9816	10	0.48119	T	0.1	.	7.3783	0.26841	0.1709:0.7374:0.0:0.0917	.	692	Q2M1Z3	RHG31_HUMAN	L	692	ENSP00000264245:P692L	ENSP00000264245:P692L	P	+	2	0	0	ARHGAP31	120615541	120615541	0.000000	0.05858	0.016000	0.15963	0.012000	0.07955	1.015000	0.29963	1.284000	0.44531	-0.169000	0.13324	CCC	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.562	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2	1	0	1	2	2	2	2	0	0	0	0	177	177	177	175	1	1.940000	-4.594515	1	0.550000			0	179	178	0	625	617	1		1	0		0	0	177	0	0	1.000000	4.850921e-01	0	0	0	7	0	179	625
PARP9	83666	broad.mit.edu	37	3	122274267	122274267	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr3:122274267C>A	ENST00000360356.2	-	4	1083	c.856G>T	c.(856-858)Gct>Tct	p.A286S	PARP9_ENST00000477522.2_Missense_Mutation_p.A251S|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Missense_Mutation_p.A251S|PARP9_ENST00000462315.1_Missense_Mutation_p.A251S	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	286	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TTAAAGGCAGCAACAGTAGGG	0.448																																						ENST00000360356.2	1.000000	7.900000e-01	0.970000	0.850000	0.900000	0.913388	0.900000	1.000000																										0				34						c.(856-858)Gct>Tct		poly (ADP-ribose) polymerase family, member 9							169.0	166.0	167.0					3																	122274267		2203	4300	6503	SO:0001583	missense	83666	0	0					g.chr3:122274267C>A	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.856G>T	chr3.hg19:g.122274267C>A	ENSP00000353512:p.Ala286Ser	0					PARP9_ENST00000477522.2_Missense_Mutation_p.A251S|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Missense_Mutation_p.A251S|PARP9_ENST00000462315.1_Missense_Mutation_p.A251S	p.A286S	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	0	0	0	2.030228	Q8IXQ6	PARP9_HUMAN		4	1083	-			A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	ENST00000360356.2	1	1	hg19	c.856G>T	CCDS3014.1	1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.746139	0.49151	.	.	ENSG00000138496	ENST00000360356;ENST00000477522;ENST00000471785;ENST00000452457;ENST00000462315	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.38	4.37	0.52481	5.38	4.37	0.52481	Appr-1-p processing (1);	0.787865	0.11079	N	0.601994	T	0.23965	0.0580	L	0.58428	1.81	0.28693	N	0.904515	B;P;P	0.46395	0.094;0.877;0.835	B;B;P	0.45794	0.056;0.339;0.493	T	0.05241	-1.0897	10	0.15499	T	0.54	.	7.7777	0.29048	0.0:0.7824:0.0:0.2176	.	251;286;251	E9PFM7;Q8IXQ6;Q8IXQ6-2	.;PARP9_HUMAN;.	S	286;251;251;209;251	ENSP00000353512:A286S;ENSP00000419506:A251S;ENSP00000419001:A251S;ENSP00000418894:A251S	ENSP00000353512:A286S	A	-	1	0	0	PARP9	123756957	123756957	0.010000	0.17322	0.992000	0.48379	0.940000	0.58332	0.631000	0.24568	1.254000	0.44035	0.655000	0.94253	GCT	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.448	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	1	0	1	2	2	2	2	0	0	0	0	148	148	148	146	1	1.940000	-20.000000	1	0.550000	NM_031458		0	182	181	0	542	537	1		1	1		0	0	148	0	0	1.000000	9.999949e-01	0	22	0	32	0	182	542
CLSTN2	64084	broad.mit.edu	37	3	140282022	140282022	+	Missense_Mutation	SNP	G	G	A	rs560530846		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr3:140282022G>A	ENST00000458420.3	+	15	2649	c.2459G>A	c.(2458-2460)cGg>cAg	p.R820Q		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	820					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCTGAGTCCCGGAGTAGCATC	0.512										HNSCC(16;0.037)			G|||	1	0.000199681	0.0	0.0	5008	,	,		21521	0.0		0.0	False		,,,				2504	0.001				GBM(45;858 913 3709 36904 37282)	ENST00000458420.3	1.000000	7.400000e-01	0.960000	0.810000	0.880000	0.889191	0.880000	1.000000																										0				87						c.(2458-2460)cGg>cAg		calsyntenin 2							137.0	121.0	126.0					3																	140282022		2203	4300	6503	SO:0001583	missense	64084	2	121412	37				g.chr3:140282022G>A	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2459G>A	chr3.hg19:g.140282022G>A	ENSP00000402460:p.Arg820Gln	0	HNSCC(16;0.037)					p.R820Q	NM_022131.2	NP_071414.2	0	0	0	2.030228	Q9H4D0	CSTN2_HUMAN		15	2649	+			B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	1	1	hg19	c.2459G>A	CCDS3112.1	1	.	.	.	.	.	.	.	.	.	.	G	9.283	1.048756	0.19827	.	.	ENSG00000158258	ENST00000458420	T	0.32515	1.45	5.4	-1.53	0.08611	5.4	-1.53	0.08611	.	1.541910	0.04448	N	0.372030	T	0.11239	0.0274	N	0.01352	-0.895	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.27157	-1.0082	9	.	.	.	-9.2662	9.9589	0.41684	0.5434:0.0:0.4566:0.0	.	820	Q9H4D0	CSTN2_HUMAN	Q	820	ENSP00000402460:R820Q	.	R	+	2	0	0	CLSTN2	141764712	141764712	0.000000	0.05858	0.988000	0.46212	0.992000	0.81027	0.351000	0.20096	-0.222000	0.09958	0.655000	0.94253	CGG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.512	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	1	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	1.940000	-4.421752	1	0.550000	NM_022131		0	112	109	0	346	342	1		1	0		0	0	110	0	0	1.000000	6.074696e-02	0	0	0	2	0	112	346
ZNF385D	79750	broad.mit.edu	37	3	21706481	21706481	+	Missense_Mutation	SNP	C	C	T	rs571099747		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr3:21706481C>T	ENST00000281523.2	-	2	580	c.62G>A	c.(61-63)cGt>cAt	p.R21H	ZNF385D_ENST00000494118.1_Intron	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	21						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GGCTGGTGGACGGACAAGGGC	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		17923	0.0		0.001	False		,,,				2504	0.0					ENST00000281523.2	1.000000	6.600000e-01	0.980000	0.760000	0.860000	0.868427	0.860000	1.000000																										0				46						c.(61-63)cGt>cAt		zinc finger protein 385D							77.0	72.0	73.0					3																	21706481		2203	4300	6503	SO:0001583	missense	79750	4	121404	37				g.chr3:21706481C>T	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.62G>A	chr3.hg19:g.21706481C>T	ENSP00000281523:p.Arg21His	0					ZNF385D_ENST00000494118.1_Intron	p.R21H	NM_024697.2	NP_078973.1	0	0	0	2.030228	Q9H6B1	Z385D_HUMAN		2	580	-				Missense_Mutation	SNP	ENST00000281523.2	1	1	hg19	c.62G>A	CCDS2636.1	1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106592	0.56291	.	.	ENSG00000151789	ENST00000281523	T	0.33654	1.4	5.62	4.75	0.60458	5.62	4.75	0.60458	.	0.129051	0.52532	N	0.000066	T	0.35189	0.0923	L	0.55481	1.735	0.38752	D	0.954131	B	0.09022	0.002	B	0.04013	0.001	T	0.23048	-1.0199	10	0.51188	T	0.08	-8.954	13.2857	0.60241	0.0:0.924:0.0:0.076	.	21	Q9H6B1	Z385D_HUMAN	H	21	ENSP00000281523:R21H	ENSP00000281523:R21H	R	-	2	0	0	ZNF385D	21681485	21681485	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	4.054000	0.57434	1.376000	0.46267	0.591000	0.81541	CGT	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.517	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.940000	-20.000000	1	0.550000	NM_024697		0	50	49	0	159	158	1		1	0		0	0	58	0	0	1.000000	0	0	0	0	1	0	50	159
UBP1	7342	broad.mit.edu	37	3	33467138	33467138	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr3:33467138G>A	ENST00000283629.3	-	2	738	c.209C>T	c.(208-210)gCt>gTt	p.A70V	UBP1_ENST00000283628.5_Missense_Mutation_p.A70V|UBP1_ENST00000447368.2_Missense_Mutation_p.A70V	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	70					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TGACGTTGCAGCACACATCAC	0.423																																						ENST00000283629.3	0.250000	3.000000e-02	0.180000	0.060000	0.110000	0.128174	0.110000	0.100000																										0				23						c.(208-210)gCt>gTt		upstream binding protein 1 (LBP-1a)							96.0	77.0	83.0					3																	33467138		2203	4300	6503	SO:0001583	missense	7342	0	0					g.chr3:33467138G>A	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.209C>T	chr3.hg19:g.33467138G>A	ENSP00000283629:p.Ala70Val	0					UBP1_ENST00000283628.5_Missense_Mutation_p.A70V|UBP1_ENST00000447368.2_Missense_Mutation_p.A70V	p.A70V	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	0	0	0	2.030228	Q9NZI7	UBIP1_HUMAN		2	738	-			Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	0	1	hg19	c.209C>T	CCDS2659.1	0	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478314	0.84747	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628;ENST00000456378	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.92	5.92	0.95590	5.92	5.92	0.95590	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	M	0.92459	3.31	0.80722	D	1	B;D	0.54207	0.275;0.965	B;P	0.55161	0.046;0.77	T	0.74259	-0.3723	10	0.87932	D	0	-11.8325	20.33	0.98713	0.0:0.0:1.0:0.0	.	70;70	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	V	70	ENSP00000283629:A70V;ENSP00000395558:A70V;ENSP00000283628:A70V;ENSP00000401614:A70V	ENSP00000283628:A70V	A	-	2	0	0	UBP1	33442142	33442142	1.000000	0.71417	0.961000	0.40146	0.928000	0.56348	9.869000	0.99810	2.810000	0.96702	0.585000	0.79938	GCT	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.423	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	0	0	0	2	2	2	2	0	0	0	0	39	39	39	39	1	1.940000	-6.255616	1	0.550000	NM_014517		0	4	3	0	135	134	0		1	0		0	0	39	0	0	0.888059	3.671485e-01	0	0	0	37	0	4	135
ABCF3	55324	broad.mit.edu	37	3	183911015	183911015	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr3:183911015A>G	ENST00000429586.2	+	19	2061	c.1876A>G	c.(1876-1878)Atg>Gtg	p.M626V	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.M620V	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	626	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCAGATGACTATGCCCTGGTG	0.557																																						ENST00000429586.2	1.000000	8.000000e-01	1.000000	0.860000	0.930000	0.931625	0.930000	1.000000																										0				39						c.(1876-1878)Atg>Gtg		ATP-binding cassette, sub-family F (GCN20), member 3							90.0	89.0	90.0					3																	183911015		2203	4300	6503	SO:0001583	missense	55324	0	0					g.chr3:183911015A>G	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1876A>G	chr3.hg19:g.183911015A>G	ENSP00000411471:p.Met626Val	0					ABCF3_ENST00000292808.5_Missense_Mutation_p.M620V|EIF2B5_ENST00000444495.1_Intron	p.M626V	NM_018358.2	NP_060828.2	0	0	0	2.030228	Q9NUQ8	ABCF3_HUMAN	Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)	19	2061	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	1	1	hg19	c.1876A>G	CCDS3254.1	1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.107864	0.56291	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.84800	-1.9;-1.9	4.8	4.8	0.61643	4.8	4.8	0.61643	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	T	0.76040	0.3932	N	0.10945	0.07	0.80722	D	1	P;P	0.43352	0.619;0.804	B;B	0.44044	0.341;0.439	T	0.80070	-0.1536	10	0.52906	T	0.07	-29.4571	13.9755	0.64271	1.0:0.0:0.0:0.0	.	620;626	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	V	626;620	ENSP00000411471:M626V;ENSP00000292808:M620V	ENSP00000292808:M620V	M	+	1	0	0	ABCF3	185393709	185393709	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.064000	0.71169	2.140000	0.66376	0.460000	0.39030	ATG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.557	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	1	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	1.940000	-20.000000	1	0.550000	NM_018358		0	144	142	0	415	410	1		1	1		0	0	135	0	0	1.000000	1	0	54	0	138	0	144	415
WDFY3	23001	broad.mit.edu	37	4	85708746	85708746	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr4:85708746G>A	ENST00000295888.4	-	23	4197	c.3790C>T	c.(3790-3792)Cgc>Tgc	p.R1264C	WDFY3_ENST00000322366.6_Missense_Mutation_p.R1264C	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1264					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGTCCCAGGCGCCAAACCAAT	0.473																																						ENST00000295888.4	0.150000	1.000000e-02	0.100000	0.030000	0.060000	0.079008	0.060000	0.060000																										0				134						c.(3790-3792)Cgc>Tgc		WD repeat and FYVE domain containing 3							78.0	73.0	75.0					4																	85708746		2203	4300	6503	SO:0001583	missense	23001	0	0					g.chr4:85708746G>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3790C>T	chr4.hg19:g.85708746G>A	ENSP00000295888:p.Arg1264Cys	0					WDFY3_ENST00000322366.6_Missense_Mutation_p.R1264C	p.R1264C	NM_014991.4	NP_055806.2	1	2	3	2.065685	Q8IZQ1	WDFY3_HUMAN		23	4197	-		Hepatocellular(203;0.114)	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	0	1	hg19	c.3790C>T	CCDS3609.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.384949	0.95967	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.67865	-0.29;-0.29	5.94	5.94	0.96194	5.94	5.94	0.96194	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	T	0.76969	0.4062	M	0.75777	2.31	0.80722	D	1	D	0.69078	0.997	P	0.50791	0.65	T	0.79472	-0.1789	10	0.87932	D	0	.	20.3523	0.98815	0.0:0.0:1.0:0.0	.	1264	Q8IZQ1	WDFY3_HUMAN	C	1264	ENSP00000318466:R1264C;ENSP00000295888:R1264C	ENSP00000295888:R1264C	R	-	1	0	0	WDFY3	85927770	85927770	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.464000	0.97655	2.821000	0.97095	0.484000	0.47621	CGC	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.473	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	0	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.940000	-2.657713	1	0.550000	NM_014991		0	5	5	0	306	303	0		1	0		0	0	80	0	0	0.936433	4.060952e-03	0	0	0	5	0	5	306
TRIO	7204	broad.mit.edu	37	5	14369548	14369548	+	Silent	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr5:14369548G>A	ENST00000344204.4	+	18	3156	c.3132G>A	c.(3130-3132)gcG>gcA	p.A1044A	TRIO_ENST00000509967.2_Silent_p.A995A|TRIO_ENST00000537187.1_Silent_p.A1044A	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1044					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTGGCGGGGCGGATAAGCTGG	0.587																																						ENST00000344204.4	0.110000	0	0.080000	0.020000	0.040000	0.055476	0.040000	0.040000																										0				118						c.(3130-3132)gcG>gcA		trio Rho guanine nucleotide exchange factor							87.0	88.0	87.0					5																	14369548		2203	4300	6503	SO:0001819	synonymous_variant	7204	1	121412	26				g.chr5:14369548G>A	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3132G>A	chr5.hg19:g.14369548G>A		0					TRIO_ENST00000509967.2_Silent_p.A995A|TRIO_ENST00000537187.1_Silent_p.A1044A	p.A1044A	NM_007118.2	NP_009049.2	1	2	3	2.051732	O75962	TRIO_HUMAN		18	3156	+	Lung NSC(4;0.000742)		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	0	1	hg19	c.3132G>A	CCDS3883.1	0																																																																																								0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.587	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	84	1	1.940000	-5.116934	1	0.550000	NM_007118		0	5	5	0	386	377	0		1	1		0	0	87	0	0	0.934026	6.874335e-02	0	2	0	25	0	5	386
PCDHA9	9752	broad.mit.edu	37	5	140229343	140229343	+	Nonsense_Mutation	SNP	C	C	A	rs150560525		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr5:140229343C>A	ENST00000532602.1	+	1	2296	c.1263C>A	c.(1261-1263)taC>taA	p.Y421*	PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000378122.3_Nonsense_Mutation_p.Y421*|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCCGCCTACGAGCTGGTGG	0.642																																					Melanoma(55;1800 1972 14909)	ENST00000532602.1	1.000000	8.200000e-01	1.000000	0.880000	0.930000	0.939302	0.930000	1.000000																										0				59						c.(1261-1263)taC>taA		protocadherin alpha 9							100.0	93.0	95.0					5																	140229343		2196	4273	6469	SO:0001587	stop_gained	9752	27	120848	50				g.chr5:140229343C>A	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1263C>A	chr5.hg19:g.140229343C>A	ENSP00000436042:p.Tyr421*	0					PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Nonsense_Mutation_p.Y421*|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	p.Y421*	NM_031857.1	NP_114063.1	1	2	3	2.051732	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2296	+			O15053|Q2M3S5	Nonsense_Mutation	SNP	ENST00000532602.1	0	1	hg19	c.1263C>A	CCDS54920.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.376177	0.97515	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	.	.	.	3.6	-1.97	0.07503	3.6	-1.97	0.07503	.	0.000000	0.29522	U	0.011906	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2054	0.43109	0.0:0.5102:0.0:0.4898	.	.	.	.	X	421	.	ENSP00000367362:Y421X	Y	+	3	2	2	PCDHA9	140209527	140209527	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-0.684000	0.05173	-0.474000	0.06862	-0.752000	0.03492	TAC	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.642	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	1	0	1	2	2	2	2	0	0	0	0	215	215	215	212	1	1.940000	-3.142717	1	0.550000	NM_031857		0	200	199	0	573	564	1		1			0	0	215	0	0	1.000000	0	0	0	0	0	0	200	573
POLK	51426	broad.mit.edu	37	5	74886218	74886218	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr5:74886218G>C	ENST00000241436.4	+	11	1481	c.1309G>C	c.(1309-1311)Gaa>Caa	p.E437Q	POLK_ENST00000504026.1_Missense_Mutation_p.E437Q|POLK_ENST00000506928.1_3'UTR|POLK_ENST00000515295.1_Missense_Mutation_p.E437Q|POLK_ENST00000508526.1_Intron|POLK_ENST00000380481.3_Missense_Mutation_p.E347Q|POLK_ENST00000352007.5_Intron	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	437					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		CCTATGTCAAGAACTTTGCAG	0.338								DNA polymerases (catalytic subunits)																														ENST00000241436.4	0.300000	1.300000e-01	0.260000	0.160000	0.200000	0.213020	0.200000	0.200000																										0				27						c.(1309-1311)Gaa>Caa	DNA polymerases (catalytic subunits)	polymerase (DNA directed) kappa							139.0	142.0	141.0					5																	74886218		2203	4300	6503	SO:0001583	missense	51426	0	0					g.chr5:74886218G>C	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.1309G>C	chr5.hg19:g.74886218G>C	ENSP00000241436:p.Glu437Gln	0					POLK_ENST00000506928.1_3'UTR|POLK_ENST00000508526.1_Intron|POLK_ENST00000380481.3_Missense_Mutation_p.E347Q|POLK_ENST00000504026.1_Missense_Mutation_p.E437Q|POLK_ENST00000352007.5_Intron|POLK_ENST00000515295.1_Missense_Mutation_p.E437Q	p.E437Q	NM_016218.2	NP_057302.1	1	2	3	2.051732	Q9UBT6	POLK_HUMAN		11	1481	+		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	1	1	hg19	c.1309G>C	CCDS4030.1	0	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845069	0.71603	.	.	ENSG00000122008	ENST00000241436;ENST00000515295;ENST00000504026;ENST00000380481	T;T;T;T	0.44083	1.25;0.93;0.93;1.25	5.41	5.41	0.78517	5.41	5.41	0.78517	DNA polymerase IV/DinB homologue, little finger domain (1);DNA polymerase, Y-family, little finger domain (2);	0.088157	0.85682	D	0.000000	T	0.56587	0.1995	L	0.43152	1.355	0.80722	D	1	P;D;D	0.56746	0.603;0.969;0.977	P;P;D	0.65573	0.457;0.662;0.936	T	0.52931	-0.8509	10	0.46703	T	0.11	-19.1778	17.7307	0.88376	0.0:0.0:1.0:0.0	.	437;437;437	Q5Q9G5;Q9UBT6-2;Q9UBT6	.;.;POLK_HUMAN	Q	437;437;437;347	ENSP00000241436:E437Q;ENSP00000424174:E437Q;ENSP00000425075:E437Q;ENSP00000369848:E347Q	ENSP00000241436:E437Q	E	+	1	0	0	POLK	74921974	74921974	1.000000	0.71417	0.998000	0.56505	0.465000	0.32709	9.536000	0.98067	2.701000	0.92244	0.591000	0.81541	GAA	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.338	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	1	0	1	2	2	2	2	0	0	0	0	89	89	89	87	1	1.940000	-5.449141	1	0.550000	NM_016218		0	23	23	0	385	382	0		1	0		0	0	89	0	0	0.999999	2.844600e-01	0	1	0	17	0	23	385
NOP16	51491	broad.mit.edu	37	5	175815524	175815524	+	Missense_Mutation	SNP	C	C	T	rs371311461		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr5:175815524C>T	ENST00000389158.5	-	1	452	c.17G>A	c.(16-18)gGc>gAc	p.G6D	NOP16_ENST00000509257.1_Missense_Mutation_p.G6D|HIGD2A_ENST00000274787.2_5'Flank|NOP16_ENST00000510123.1_Missense_Mutation_p.G6D|NOP16_ENST00000507413.1_Missense_Mutation_p.G6D			Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein	6						intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	8						CCGGGTTTTGCCCTTGGCCTT	0.602																																						ENST00000389158.5	0.090000	0	0.060000	0.020000	0.030000	0.045481	0.030000	0.040000																										0				8						c.(16-18)gGc>gAc		NOP16 nucleolar protein		C	ASP/GLY	0,4344		0,0,2172	60.0	67.0	65.0		17	5.6	1.0	5		65	1,8577		0,1,4288	no	missense	NOP16	NM_016391.4	94	0,1,6460	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	6/179	175815524	1,12921	2172	4289	6461	SO:0001583	missense	51491	0	0					g.chr5:175815524C>T		CCDS43403.1, CCDS58991.1	5q35.2	2012-12-10	2012-12-10		ENSG00000048162	ENSG00000048162			26934	protein-coding gene	gene with protein product	"""hypothetical protein HSPC111"", ""HBV pre-S2 trans-regulated protein 3"""	612861	"""nucleolar protein 16 homolog (yeast)"", ""NOP16 nucleolar protein homolog (yeast)"""			10810093, 11042152	Standard	NM_001291308		Approved	HSPC111, HSPC185, LOC51491	uc003mee.4	Q9Y3C1	OTTHUMG00000163186	ENST00000389158.5:c.17G>A	chr5.hg19:g.175815524C>T	ENSP00000373810:p.Gly6Asp	0					NOP16_ENST00000510123.1_Missense_Mutation_p.G6D|NOP16_ENST00000509257.1_Missense_Mutation_p.G6D|HIGD2A_ENST00000274787.2_5'Flank|NOP16_ENST00000507413.1_Missense_Mutation_p.G6D	p.G6D			1	2	3	2.051732	Q9Y3C1	NOP16_HUMAN		1	452	-			B4DV13|D6RGD3|Q05D05|Q6IAI6|Q8IXL5	Missense_Mutation	SNP	ENST00000389158.5	0	1	hg19	c.17G>A	CCDS43403.1	0	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532671	0.85812	0.0	1.17E-4	ENSG00000048162	ENST00000389158;ENST00000510123;ENST00000507413;ENST00000451293;ENST00000509257	.	.	.	5.55	5.55	0.83447	5.55	5.55	0.83447	.	.	.	.	.	T	0.67050	0.2852	L	0.47716	1.5	0.40902	D	0.984165	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.988;0.999;0.999	T	0.61579	-0.7034	8	0.25751	T	0.34	.	12.1692	0.54148	0.0:0.9225:0.0:0.0775	.	6;6;6;6	B4E098;Q9Y3C1;Q6PIM0;D6RGD3	.;NOP16_HUMAN;.;.	D	6	.	ENSP00000373810:G6D	G	-	2	0	0	NOP16	175748130	175748130	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	2.518000	0.45537	2.894000	0.99253	0.655000	0.94253	GGC	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.602	NOP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371963.1	0	0	1	2	2	2	2	0	0	0	0	170	170	170	169	1	1.940000	-2.294449	0	0.550000	NM_016391		0	6	6	0	551	541	0		1	0		0	0	170	0	0	0.963124	6.700683e-01	0	0	0	201	0	6	551
HIST1H2BM	8342	broad.mit.edu	37	6	27782982	27782982	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr6:27782982G>A	ENST00000359465.4	+	1	161	c.161G>A	c.(160-162)gGc>gAc	p.G54D	HIST1H2AJ_ENST00000333151.3_5'Flank	NM_003521.2	NP_003512.1	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm	54					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	12						CCCGACACCGGCATCTCTTCC	0.542																																						ENST00000359465.4	0.070000	0	0.050000	0.010000	0.020000	0.034970	0.020000	0.040000																										0				12						c.(160-162)gGc>gAc		histone cluster 1, H2bm							187.0	177.0	181.0					6																	27782982		2203	4300	6503	SO:0001583	missense	8342	0	0					g.chr6:27782982G>A	Z83738	CCDS4629.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196374	ENSG00000273703		"""Histones / Replication-dependent"""	4750	protein-coding gene	gene with protein product		602802	"""H2B histone family, member E"", ""histone 1, H2bm"""	H2BFE		9439656, 12408966	Standard	NM_003521		Approved	H2B/e, dJ160A22.3	uc003njo.3	Q99879	OTTHUMG00000014489	ENST00000359465.4:c.161G>A	chr6.hg19:g.27782982G>A	ENSP00000352442:p.Gly54Asp	0					HIST1H2AJ_ENST00000333151.3_5'Flank	p.G54D	NM_003521.2	NP_003512.1	0	0	0	2.011151	Q99879	H2B1M_HUMAN		1	161	+			Q6NWQ3	Missense_Mutation	SNP	ENST00000359465.4	0	1	hg19	c.161G>A	CCDS4629.1	0	.	.	.	.	.	.	.	.	.	.	.	13.76	2.332818	0.41297	.	.	ENSG00000196374	ENST00000359465	T	0.69435	-0.4	4.29	4.29	0.51040	4.29	4.29	0.51040	Histone-fold (2);Histone core (1);	0.000000	0.64402	U	0.000016	D	0.86648	0.5983	H	0.98487	4.245	0.80722	D	1	D	0.58970	0.984	D	0.65140	0.932	D	0.91772	0.5428	10	0.87932	D	0	.	16.2598	0.82535	0.0:0.0:1.0:0.0	.	54	Q99879	H2B1M_HUMAN	D	54	ENSP00000352442:G54D	ENSP00000352442:G54D	G	+	2	0	0	HIST1H2BM	27890961	27890961	1.000000	0.71417	0.997000	0.53966	0.033000	0.12548	9.147000	0.94646	2.373000	0.80994	0.563000	0.77884	GGC	0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.542	HIST1H2BM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040157.1	0	0	1	2	2	2	2	0	0	0	0	207	207	207	204	1	1.940000	-1.711836	0	0.550000	NM_003521		0	7	7	0	802	801	0		1	0		0	0	207	0	0	0.980556	0	0	0	0	1	0	7	802
MAS1L	116511	broad.mit.edu	37	6	29455344	29455344	+	Silent	SNP	G	G	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr6:29455344G>T	ENST00000377127.3	-	1	394	c.336C>A	c.(334-336)atC>atA	p.I112I		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	112					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						CCAGGTGGAGGATGTATACCA	0.527																																					NSCLC(153;755 1987 3859 11251 32945)	ENST00000377127.3	1.000000	7.200000e-01	1.000000	0.810000	0.900000	0.903010	0.900000	1.000000																										0				28						c.(334-336)atC>atA		MAS1 proto-oncogene like, G protein-coupled receptor							72.0	67.0	69.0					6																	29455344		2203	4300	6503	SO:0001819	synonymous_variant	116511	0	0					g.chr6:29455344G>T	S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.336C>A	chr6.hg19:g.29455344G>T		0						p.I112I	NM_052967.1	NP_443199.1	0	0	0	2.011151	P35410	MAS1L_HUMAN		1	394	-			Q5SUN5	Silent	SNP	ENST00000377127.3	1	1	hg19	c.336C>A	CCDS4661.1	1																																																																																								0.544995		TCGA-FB-A78T-01A-12D-A32N-08	0.527	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.940000	-20.000000	1	0.550000	NM_052967		0	64	63	0	189	189	1		1			0	0	52	0	0	1.000000	0	0	0	0	0	0	64	189
PIK3CG	5294	broad.mit.edu	37	7	106508903	106508903	+	Silent	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr7:106508903C>T	ENST00000359195.3	+	2	1207	c.897C>T	c.(895-897)aaC>aaT	p.N299N	PIK3CG_ENST00000496166.1_Silent_p.N299N|PIK3CG_ENST00000440650.2_Silent_p.N299N	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	299	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N299N(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GCCTCAAGAACGGAGAAGAGA	0.587																																						ENST00000359195.3	1.000000	6.200000e-01	0.900000	0.700000	0.800000	0.807597	0.800000	0.800000																										1	Substitution - coding silent(1)	p.N299N(1)	endometrium(1)	132						c.(895-897)aaC>aaT		phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma							49.0	48.0	48.0					7																	106508903		2203	4300	6503	SO:0001819	synonymous_variant	5294	0	0					g.chr7:106508903C>T		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.897C>T	chr7.hg19:g.106508903C>T		0					PIK3CG_ENST00000496166.1_Silent_p.N299N|PIK3CG_ENST00000440650.2_Silent_p.N299N	p.N299N	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	1	2	3	2.056105	P48736	PK3CG_HUMAN		2	1207	+			A4D0Q6|Q8IV23|Q9BZC8	Silent	SNP	ENST00000359195.3	1	1	hg19	c.897C>T	CCDS5739.1	0																																																																																								0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.587	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	1.940000	-20.000000	1	0.550000			0	55	55	0	196	196	1		1	0		0	0	66	0	0	1.000000	0	0	0	0	1	0	55	196
ZC3HAV1	56829	broad.mit.edu	37	7	138738203	138738203	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr7:138738203C>T	ENST00000242351.5	-	12	2759	c.2443G>A	c.(2443-2445)Gga>Aga	p.G815R	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.G937R	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	815	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TAACCTTTTCCGTATTTGTTT	0.363																																						ENST00000242351.5	0.180000	4.000000e-02	0.130000	0.060000	0.090000	0.111585	0.090000	0.100000																										0				37						c.(2443-2445)Gga>Aga		zinc finger CCCH-type, antiviral 1							117.0	121.0	120.0					7																	138738203		2203	4300	6503	SO:0001583	missense	56829	0	0					g.chr7:138738203C>T	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2443G>A	chr7.hg19:g.138738203C>T	ENSP00000242351:p.Gly815Arg	0					ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.G937R	p.G815R	NM_020119.3	NP_064504.2	1	2	3	2.056105	Q7Z2W4	ZCCHV_HUMAN		12	2759	-			A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	1	1	hg19	c.2443G>A	CCDS5851.1	0	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550249	0.65311	.	.	ENSG00000105939	ENST00000242351;ENST00000464606	T;T	0.78364	-1.17;-1.17	5.2	5.2	0.72013	5.2	5.2	0.72013	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.48767	D	0.000172	D	0.90971	0.7161	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93057	0.6471	10	0.87932	D	0	.	14.6188	0.68569	0.0:1.0:0.0:0.0	.	815	Q7Z2W4	ZCCHV_HUMAN	R	815;937	ENSP00000242351:G815R;ENSP00000418385:G937R	ENSP00000242351:G815R	G	-	1	0	0	ZC3HAV1	138388743	138388743	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	5.613000	0.67688	2.584000	0.87258	0.563000	0.77884	GGA	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.363	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	0	0	1	2	2	2	2	0	0	0	0	81	81	81	80	1	1.940000	-2.445877	0	0.550000	NM_020119		0	11	10	0	413	408	0		1	0		0	0	81	0	0	0.998246	6.813275e-02	0	1	0	14	0	11	413
CYP11B2	1585	broad.mit.edu	37	8	143994080	143994080	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr8:143994080G>A	ENST00000323110.2	-	8	1266	c.1264C>T	c.(1264-1266)Cgg>Tgg	p.R422W		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	422					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GGATTATACCGCTCAGGCCTC	0.622									Familial Hyperaldosteronism type I																													ENST00000323110.2	1.000000	1.000000e-02	0.080000	0.020000	0.040000	0.098035	0.040000	0.040000																										0				39						c.(1264-1266)Cgg>Tgg		cytochrome P450, family 11, subfamily B, polypeptide 2	Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)						86.0	90.0	89.0					8																	143994080		2203	4300	6503	SO:0001583	missense	1585	4	121412	41	Familial Hyperaldosteronism type I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	g.chr8:143994080G>A	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1264C>T	chr8.hg19:g.143994080G>A	ENSP00000325822:p.Arg422Trp	0						p.R422W	NM_000498.3	NP_000489.3	1	2	3	2.090910	P19099	C11B2_HUMAN		8	1266	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	0	1	hg19	c.1264C>T	CCDS6393.1	0	.	.	.	.	.	.	.	.	.	.	.	14.36	2.511841	0.44660	.	.	ENSG00000179142	ENST00000323110	T	0.70164	-0.46	3.52	0.551	0.17225	3.52	0.551	0.17225	.	0.399630	0.21610	N	0.071815	T	0.78272	0.4257	M	0.89968	3.075	0.26442	N	0.975755	D	0.76494	0.999	D	0.64877	0.93	T	0.67142	-0.5745	10	0.87932	D	0	.	3.2888	0.06942	0.1067:0.1729:0.5433:0.1771	.	422	P19099	C11B2_HUMAN	W	422	ENSP00000325822:R422W	ENSP00000325822:R422W	R	-	1	2	2	CYP11B2	143991082	143991082	0.994000	0.37717	0.171000	0.22900	0.001000	0.01503	1.534000	0.36051	0.253000	0.21552	-0.302000	0.09304	CGG	0.557304		TCGA-FB-A78T-01A-12D-A32N-08	0.622	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1	0	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	1.940000	-2.964584	1	0.550000			0	6	5	0	474	472	0		1			0	0	99	0	0	0.964501	0	0	0	0	0	0	6	474
ZNF483	158399	broad.mit.edu	37	9	114304261	114304261	+	Missense_Mutation	SNP	G	G	A	rs201645923		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr9:114304261G>A	ENST00000309235.5	+	6	1204	c.1046G>A	c.(1045-1047)cGc>cAc	p.R349H	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R349H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						GTTCTGAACCGCAAGGAGAAA	0.423																																						ENST00000309235.5	0.090000	0	0.070000	0.020000	0.030000	0.046073	0.030000	0.040000																										1	Substitution - Missense(1)	p.R349H(1)	large_intestine(1)	31						c.(1045-1047)cGc>cAc		zinc finger protein 483							80.0	91.0	87.0					9																	114304261		2203	4299	6502	SO:0001583	missense	158399	4	121412	41				g.chr9:114304261G>A	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1046G>A	chr9.hg19:g.114304261G>A	ENSP00000311679:p.Arg349His	0					ZNF483_ENST00000358151.4_Intron	p.R349H	NM_133464.2	NP_597721.2	1	2	3	2.051407	Q8TF39	ZN483_HUMAN		6	1204	+			Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	0	1	hg19	c.1046G>A	CCDS35106.1	0	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281994	0.23392	.	.	ENSG00000173258	ENST00000309235	T	0.04917	3.53	4.55	2.71	0.32032	4.55	2.71	0.32032	.	0.470780	0.18592	N	0.136701	T	0.01489	0.0048	N	0.00138	-2.015	0.25163	N	0.990339	B	0.18968	0.032	B	0.10450	0.005	T	0.43798	-0.9369	10	0.30854	T	0.27	-6.2832	9.1112	0.36730	0.1807:0.0:0.8193:0.0	.	349	Q8TF39	ZN483_HUMAN	H	349	ENSP00000311679:R349H	ENSP00000311679:R349H	R	+	2	0	0	ZNF483	113344082	113344082	0.000000	0.05858	0.765000	0.31456	0.035000	0.12851	0.761000	0.26489	0.858000	0.35431	-0.150000	0.13652	CGC	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.423	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.940000	-2.056923	0	0.550000	XM_088567		0	6	6	0	544	537	0		1	0		0	0	107	0	0	0.963730	0	0	0	0	1	0	6	544
FAM129B	64855	broad.mit.edu	37	9	130271305	130271305	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr9:130271305C>A	ENST00000373312.3	-	10	1480	c.1267G>T	c.(1267-1269)Gtg>Ttg	p.V423L	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.V410L	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	423					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GTGCTGGACACATCAAATCGC	0.622																																						ENST00000373312.3	0.300000	7.000000e-02	0.220000	0.110000	0.160000	0.178680	0.160000	0.160000																										0				25						c.(1267-1269)Gtg>Ttg		family with sequence similarity 129, member B							110.0	80.0	90.0					9																	130271305		2203	4300	6503	SO:0001583	missense	64855	0	0					g.chr9:130271305C>A	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.1267G>T	chr9.hg19:g.130271305C>A	ENSP00000362409:p.Val423Leu	0					FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.V410L	p.V423L	NM_022833.2	NP_073744.2	1	2	3	2.066662	Q96TA1	NIBL1_HUMAN		10	1480	-			Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	0	1	hg19	c.1267G>T	CCDS35145.1	0	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695162	0.68386	.	.	ENSG00000136830	ENST00000373314;ENST00000538931;ENST00000373312	T;T	0.26067	1.76;1.76	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	L	0.61218	1.895	0.53688	D	0.999974	D;P;P	0.57899	0.981;0.763;0.763	P;P;P	0.58780	0.845;0.453;0.453	T	0.09707	-1.0662	10	0.25106	T	0.35	-28.7207	16.6857	0.85304	0.0:1.0:0.0:0.0	.	73;410;423	F5H3T0;Q96TA1-2;Q96TA1	.;.;NIBL1_HUMAN	L	410;73;423	ENSP00000362411:V410L;ENSP00000362409:V423L	ENSP00000362409:V423L	V	-	1	0	0	FAM129B	129311126	129311126	1.000000	0.71417	0.991000	0.47740	0.708000	0.40852	4.604000	0.61112	2.532000	0.85374	0.561000	0.74099	GTG	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.622	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	0	0	0	2	2	2	2	0	0	0	0	61	61	61	59	1	1.940000	-12.259800	1	0.550000	NM_022833		0	10	0	0	223	221	0		0	1		0	0	61	0	0	0.996165	9.999889e-01	0	2	0	557	0	10	223
RIC1	57589	broad.mit.edu	37	9	5720313	5720313	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr9:5720313A>G	ENST00000414202.2	+	5	763	c.572A>G	c.(571-573)cAg>cGg	p.Q191R	KIAA1432_ENST00000251879.6_Missense_Mutation_p.Q191R|KIAA1432_ENST00000418622.3_Missense_Mutation_p.Q112R|KIAA1432_ENST00000449720.2_Missense_Mutation_p.Q112R|KIAA1432_ENST00000381532.2_Missense_Mutation_p.Q112R|RP11-207C16.4_ENST00000426764.1_RNA	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GTAGACCTGCAGTCATCTAGA	0.388																																						ENST00000414202.2	1.000000	7.800000e-01	0.970000	0.840000	0.900000	0.907069	0.900000	1.000000																										0				45						c.(571-573)cAg>cGg									206.0	203.0	204.0					9																	5720313		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr9:5720313A>G																												ENST00000414202.2:c.572A>G	chr9.hg19:g.5720313A>G	ENSP00000416696:p.Gln191Arg	0					KIAA1432_ENST00000449720.2_Missense_Mutation_p.Q112R|KIAA1432_ENST00000251879.6_Missense_Mutation_p.Q191R|KIAA1432_ENST00000418622.3_Missense_Mutation_p.Q112R|KIAA1432_ENST00000381532.2_Missense_Mutation_p.Q112R|RP11-207C16.4_ENST00000426764.1_RNA	p.Q191R	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2	1	2	3	2.046515				5	763	+		Acute lymphoblastic leukemia(23;0.154)		Missense_Mutation	SNP	ENST00000414202.2	1	1	hg19	c.572A>G	CCDS34982.2	1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316285	0.60524	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	T;T;T	0.70282	-0.47;-0.47;-0.47	5.8	5.8	0.92144	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65048	0.2654	L	0.55990	1.75	0.58432	D	0.999999	P;B;P	0.39665	0.682;0.103;0.634	B;B;B	0.36766	0.154;0.034;0.232	T	0.63171	-0.6697	10	0.16896	T	0.51	-13.9966	16.1502	0.81611	1.0:0.0:0.0:0.0	.	112;191;191	B7ZM67;Q4ADV7;G5E932	.;RIC1_HUMAN;.	R	191;191;112;112;112	ENSP00000370943:Q112R;ENSP00000402240:Q112R;ENSP00000398823:Q112R	ENSP00000251879:Q191R	Q	+	2	0	0	KIAA1432	5710313	5710313	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	8.057000	0.89457	2.203000	0.70933	0.460000	0.39030	CAG	0.551234		TCGA-FB-A78T-01A-12D-A32N-08	0.388	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3	1	0	1	2	2	2	2	0	0	0	0	160	160	160	156	1	1.940000	-20.000000	1	0.550000			0	166	165	0	501	494	1		1	1		0	0	160	0	0	1.000000	8.702241e-01	0	5	0	8	0	166	501
EDF1	8721	broad.mit.edu	37	9	139756786	139756786	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chr9:139756786G>A	ENST00000224073.1	-	5	424	c.397C>T	c.(397-399)Cgg>Tgg	p.R133W	EDF1_ENST00000371649.1_3'UTR	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1	133	HTH cro/C1-type. {ECO:0000255|PROSITE- ProRule:PRU00257}.				endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TCCTTTCCCCGGAGCTTGAGG	0.597																																						ENST00000224073.1	0.070000	0	0.050000	0.010000	0.020000	0.043684	0.020000	0.040000																										0				1						c.(397-399)Cgg>Tgg		endothelial differentiation-related factor 1							202.0	178.0	186.0					9																	139756786		2203	4300	6503	SO:0001583	missense	8721	0	0					g.chr9:139756786G>A	AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948	ENST00000224073.1:c.397C>T	chr9.hg19:g.139756786G>A	ENSP00000224073:p.Arg133Trp	0					EDF1_ENST00000371649.1_3'UTR	p.R133W	NM_003792.2	NP_003783.1	1	2	3	2.066662	O60869	EDF1_HUMAN		5	424	-	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)	Q5T5T2|Q9UIM1	Missense_Mutation	SNP	ENST00000224073.1	0	1	hg19	c.397C>T	CCDS7011.1	0	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836360	0.71373	.	.	ENSG00000107223	ENST00000224073	.	.	.	5.05	3.16	0.36331	5.05	3.16	0.36331	Helix-turn-helix type 3 (2);	0.055037	0.85682	D	0.000000	T	0.77246	0.4102	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.76982	-0.2757	9	0.87932	D	0	.	8.8018	0.34914	0.0792:0.0:0.771:0.1497	.	133	O60869	EDF1_HUMAN	W	133	.	ENSP00000224073:R133W	R	-	1	2	2	EDF1	138876607	138876607	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	5.545000	0.67237	0.513000	0.28278	-0.136000	0.14681	CGG	0.552461		TCGA-FB-A78T-01A-12D-A32N-08	0.597	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055143.1	0	0	0	2	2	2	2	0	0	0	0	205	205	205	201	1	1.940000	-2.052955	0	0.550000			0	6	7	0	723	714	0		1	1		0	0	205	0	0	0.963851	9.998472e-01	0	2	0	2594	0	6	723
STAG2	10735	broad.mit.edu	37	X	123181288	123181288	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chrX:123181288A>C	ENST00000371160.1	+	9	1042	c.752A>C	c.(751-753)gAa>gCa	p.E251A	STAG2_ENST00000354548.5_Missense_Mutation_p.E182A|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371145.3_Missense_Mutation_p.E251A|STAG2_ENST00000218089.9_Missense_Mutation_p.E251A|STAG2_ENST00000371157.3_Missense_Mutation_p.E251A|STAG2_ENST00000371144.3_Missense_Mutation_p.E251A	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	251					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TATGAAGCAGAACGGAATAAA	0.338																																						ENST00000371160.1	0.260000	1.000000e-01	0.220000	0.130000	0.170000	0.184186	0.170000	0.180000																										0				78						c.(751-753)gAa>gCa		stromal antigen 2							86.0	84.0	85.0					X																	123181288		2203	4300	6503	SO:0001583	missense	10735	0	0					g.chrX:123181288A>C	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.752A>C	chrX.hg19:g.123181288A>C	ENSP00000360202:p.Glu251Ala						STAG2_ENST00000354548.5_Missense_Mutation_p.E182A|STAG2_ENST00000371157.3_Missense_Mutation_p.E251A|STAG2_ENST00000218089.9_Missense_Mutation_p.E251A|STAG2_ENST00000371145.3_Missense_Mutation_p.E251A|STAG2_ENST00000371144.3_Missense_Mutation_p.E251A|STAG2_ENST00000469481.1_Intron	p.E251A	NM_001282418.1	NP_001269347.1	0	1	1		Q8N3U4	STAG2_HUMAN		9	1042	+			B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	1	1	hg19	c.752A>C	CCDS14607.1	0	.	.	.	.	.	.	.	.	.	.	A	26.6	4.756245	0.89843	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5	5.58	5.58	0.84498	5.58	5.58	0.84498	STAG (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79822	0.4512	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.983	D	0.84849	0.0812	10	0.52906	T	0.07	-8.161	14.6793	0.69004	1.0:0.0:0.0:0.0	.	251;251	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	A	251;251;182;251;251;251;251	ENSP00000218089:E251A;ENSP00000397265:E251A;ENSP00000346555:E182A;ENSP00000360202:E251A;ENSP00000360199:E251A;ENSP00000360187:E251A;ENSP00000360186:E251A	ENSP00000218089:E251A	E	+	2	0	0	STAG2	123008969	123008969	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.335000	0.96500	1.847000	0.53656	0.486000	0.48141	GAA	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.338	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.940000	-5.002641	1	0.550000	NM_006603		0	19	19	0	373	370	0		1	0		0	0	79	0	0	0.999991	6.573628e-01	0	0	0	45	0	19	373
DCAF12L1	139170	broad.mit.edu	37	X	125685938	125685938	+	Silent	SNP	C	C	T			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chrX:125685938C>T	ENST00000371126.1	-	1	896	c.654G>A	c.(652-654)gcG>gcA	p.A218A		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	218										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TCCGCCACAGCGCCACAGTGC	0.652																																						ENST00000371126.1	1.000000	8.400000e-01	1.000000	0.930000	0.990000	0.976239	0.990000	1.000000																										0				68						c.(652-654)gcG>gcA		DDB1 and CUL4 associated factor 12-like 1							32.0	34.0	33.0					X																	125685938		2201	4296	6497	SO:0001819	synonymous_variant	139170	0	0					g.chrX:125685938C>T	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.654G>A	chrX.hg19:g.125685938C>T								p.A218A	NM_178470.4	NP_848565.2	0	1	1		Q5VU92	DC121_HUMAN		1	896	-			Q8IYK3	Silent	SNP	ENST00000371126.1	1	1	hg19	c.654G>A	CCDS14610.1	1																																																																																								0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.652	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	1	0	0	2	2	2	2	0	0	0	0	101	101	101	104	1	1.940000	-20.000000	1	0.550000	NM_178470		0	83	74	0	210	230	1		1	0		0	0	101	0	0	1.000000	0	0	0	0	1	0	83	210
ARHGAP36	158763	broad.mit.edu	37	X	130222630	130222630	+	Silent	SNP	C	C	T	rs375497123		TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chrX:130222630C>T	ENST00000276211.5	+	12	1860	c.1515C>T	c.(1513-1515)tcC>tcT	p.S505S	ARHGAP36_ENST00000370921.1_Silent_p.S369S|ARHGAP36_ENST00000370922.1_Silent_p.S493S	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	505					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CTGTGCCTTCCGGCACTGCCC	0.542																																						ENST00000276211.5	1.000000	7.100000e-01	1.000000	0.810000	0.930000	0.920112	0.930000	1.000000																										0				71						c.(1513-1515)tcC>tcT		Rho GTPase activating protein 36		C		1,3834		0,1,1631,571	51.0	44.0	47.0		1515	-0.8	0.1	X		47	0,6728		0,0,2428,1872	no	coding-synonymous	ARHGAP36	NM_144967.3		0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095		505/548	130222630	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	158763	5	121408	37				g.chrX:130222630C>T		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1515C>T	chrX.hg19:g.130222630C>T							ARHGAP36_ENST00000370921.1_Silent_p.S369S|ARHGAP36_ENST00000370922.1_Silent_p.S493S	p.S505S	NM_144967.3	NP_659404.2	0	1	1		Q6ZRI8	RHG36_HUMAN		12	1860	+			B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	1	1	hg19	c.1515C>T	CCDS14628.1	1																																																																																								0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.542	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.940000	-4.551987	1	0.550000	NM_144967		0	42	42	0	120	119	1		1	0		0	0	47	0	0	1.000000	6.991870e-02	0	0	0	2	0	42	120
PHKA2	5256	broad.mit.edu	37	X	18929061	18929061	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chrX:18929061G>A	ENST00000379942.4	-	20	2820	c.2155C>T	c.(2155-2157)Ccg>Tcg	p.P719S		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	719					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ACTTTAGTCGGCAAAGTCATG	0.363																																						ENST00000379942.4	0.090000	0	0.070000	0.020000	0.040000	0.050128	0.040000	0.040000																										0				61						c.(2155-2157)Ccg>Tcg		phosphorylase kinase, alpha 2 (liver)							120.0	115.0	117.0					X																	18929061		2203	4300	6503	SO:0001583	missense	5256	0	0					g.chrX:18929061G>A		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2155C>T	chrX.hg19:g.18929061G>A	ENSP00000369274:p.Pro719Ser							p.P719S	NM_000292.2	NP_000283.1	0	1	1		P46019	KPB2_HUMAN		20	2820	-	Hepatocellular(33;0.183)		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	0	1	hg19	c.2155C>T	CCDS14190.1	0	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922393	0.33908	.	.	ENSG00000044446	ENST00000379942	D	0.90563	-2.69	5.75	5.75	0.90469	5.75	5.75	0.90469	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.90504	0.7025	L	0.60455	1.87	0.58432	D	0.999996	B	0.24576	0.106	B	0.36378	0.223	D	0.86944	0.2081	10	0.26408	T	0.33	-10.3521	17.078	0.86591	0.0:0.0:1.0:0.0	.	719	P46019	KPB2_HUMAN	S	719	ENSP00000369274:P719S	ENSP00000369274:P719S	P	-	1	0	0	PHKA2	18838982	18838982	1.000000	0.71417	0.999000	0.59377	0.465000	0.32709	6.010000	0.70753	2.412000	0.81896	0.600000	0.82982	CCG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.363	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	0	0	1	2	2	2	2	0	0	0	0	134	134	134	133	1	1.940000	-2.109078	0	0.550000	NM_000292		0	5	5	0	426	425	0		1	0		0	0	134	0	0	0.937502	1.393399e-01	0	0	0	46	0	5	426
MAGEB6	158809	broad.mit.edu	37	X	26213152	26213152	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chrX:26213152G>C	ENST00000379034.1	+	2	1338	c.1189G>C	c.(1189-1191)Gat>Cat	p.D397H		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	397										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						CGCTTTGATAGATGAGGTAGA	0.502																																						ENST00000379034.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999978	0.990000	1.000000																										0				33						c.(1189-1191)Gat>Cat		melanoma antigen family B, 6							120.0	111.0	114.0					X																	26213152		2202	4300	6502	SO:0001583	missense	158809	0	0					g.chrX:26213152G>C	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1189G>C	chrX.hg19:g.26213152G>C	ENSP00000368320:p.Asp397His							p.D397H	NM_173523.2	NP_775794.2	0	1	1		Q8N7X4	MAGB6_HUMAN		2	1338	+			Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	1	1	hg19	c.1189G>C	CCDS14217.1	1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906303	0.33628	.	.	ENSG00000176746	ENST00000379034	T	0.02837	4.14	3.29	2.4	0.29515	3.29	2.4	0.29515	.	0.345998	0.25771	U	0.028418	T	0.12347	0.0300	M	0.83012	2.62	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.02860	-1.1101	10	0.87932	D	0	.	6.0678	0.19873	0.1475:0.0:0.8525:0.0	.	397	Q8N7X4	MAGB6_HUMAN	H	397	ENSP00000368320:D397H	ENSP00000368320:D397H	D	+	1	0	0	MAGEB6	26123073	26123073	0.020000	0.18652	0.001000	0.08648	0.001000	0.01503	1.154000	0.31688	0.742000	0.32697	0.594000	0.82650	GAT	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.502	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	1	0	1	2	2	2	2	0	0	0	0	195	195	195	192	1	1.940000	-20.000000	1	0.550000	NM_173523		0	184	182	0	366	362	1		1			0	0	195	0	0	1.000000	0	0	0	0	0	0	184	366
GPR112	139378	broad.mit.edu	37	X	135487991	135487991	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-A78T-01A-12D-A32N-08	TCGA-FB-A78T-10A-01D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b11642c-98d8-4ff5-bcd6-ced9bdc1e088	d08ddfec-c4ce-47c9-b4c0-3195db8bd2ce	g.chrX:135487991G>A	ENST00000394143.1	+	23	9086	c.8795G>A	c.(8794-8796)cGg>cAg	p.R2932Q	GPR112_ENST00000370652.1_Missense_Mutation_p.R2932Q|GPR112_ENST00000287534.4_Missense_Mutation_p.R2685Q|GPR112_ENST00000394141.1_Missense_Mutation_p.R2727Q|GPR112_ENST00000412101.1_Missense_Mutation_p.R2727Q	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2932					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R2932Q(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AAGACTCGGCGGAAGATGATC	0.458																																						ENST00000394143.1	0.060000	0	0.050000	0.010000	0.020000	0.030667	0.020000	0.020000																										1	Substitution - Missense(1)	p.R2932Q(1)	lung(1)	199						c.(8794-8796)cGg>cAg		G protein-coupled receptor 112							150.0	131.0	137.0					X																	135487991		2203	4300	6503	SO:0001583	missense	139378	0	0					g.chrX:135487991G>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8795G>A	chrX.hg19:g.135487991G>A	ENSP00000377699:p.Arg2932Gln						GPR112_ENST00000412101.1_Missense_Mutation_p.R2727Q|GPR112_ENST00000370652.1_Missense_Mutation_p.R2932Q|GPR112_ENST00000394141.1_Missense_Mutation_p.R2727Q|GPR112_ENST00000287534.4_Missense_Mutation_p.R2685Q	p.R2932Q	NM_153834.3	NP_722576.3	0	1	1		Q8IZF6	GP112_HUMAN		23	9086	+	Acute lymphoblastic leukemia(192;0.000127)		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	0	1	hg19	c.8795G>A	CCDS35409.1	0	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883870	0.33255	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	4.71	-2.74	0.05932	4.71	-2.74	0.05932	GPCR, family 2-like (1);	.	.	.	.	T	0.28300	0.0699	L	0.39147	1.195	0.09310	N	1	P;B	0.36048	0.534;0.129	B;B	0.33750	0.059;0.169	T	0.13176	-1.0519	9	0.66056	D	0.02	.	13.1032	0.59233	0.6964:0.0:0.3036:0.0	.	2727;2932	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	Q	2932;2932;2727;2685;2727	ENSP00000377699:R2932Q;ENSP00000359686:R2932Q;ENSP00000416526:R2727Q;ENSP00000287534:R2685Q;ENSP00000377697:R2727Q	ENSP00000287534:R2685Q	R	+	2	0	0	GPR112	135315657	135315657	0.000000	0.05858	0.001000	0.08648	0.385000	0.30292	-0.544000	0.06077	-0.868000	0.04058	-0.208000	0.12717	CGG	0.550000		TCGA-FB-A78T-01A-12D-A32N-08	0.458	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1	0	0	1	2	2	2	2	0	0	0	0	136	136	136	135	1	1.940000	-2.165546	0	0.550000			0	5	5	0	685	676	0		1			0	0	136	0	0	0.935561	0	0	0	0	0	0	5	685
