#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CUBN	8029	broad.mit.edu	37	10	16982060	16982060	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr10:16982060C>T	ENST00000377833.4	-	37	5584	c.5519G>A	c.(5518-5520)gGc>gAc	p.G1840D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1840	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.		G -> S (in dbSNP:rs2271462).		cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAGCCCGTGCCGCTGCCAGA	0.413																																						ENST00000377833.4	0.330000	0.060000	0.250000	0.110000	0.160000	0.182462	0.160000	0.160000																										0				241						c.(5518-5520)gGc>gAc		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						143.0	157.0	152.0					10																	16982060		2203	4300	6503	SO:0001583	missense	8029	0	0					g.chr10:16982060C>T	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5519G>A	chr10.hg19:g.16982060C>T	ENSP00000367064:p.Gly1840Asp	0						p.G1840D	NM_001081.3	NP_001072.2	0	1	1	1.983061	O60494	CUBN_HUMAN		37	5584	-			B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	0	1	hg19	c.5519G>A	CCDS7113.1	0	.	.	.	.	.	.	.	.	.	.	C	5.381	0.255505	0.10185	.	.	ENSG00000107611	ENST00000377833	T	0.17528	2.27	6.16	2.85	0.33270	6.16	2.85	0.33270	CUB (5);	0.284524	0.25305	N	0.031636	T	0.12902	0.0313	L	0.28400	0.85	0.80722	D	1	B	0.27013	0.166	B	0.32289	0.143	T	0.10683	-1.0619	10	0.30854	T	0.27	.	9.5798	0.39481	0.0:0.6956:0.1232:0.1812	.	1840	O60494	CUBN_HUMAN	D	1840	ENSP00000367064:G1840D	ENSP00000367064:G1840D	G	-	2	0	0	CUBN	17022066	17022066	0.000000	0.05858	0.051000	0.19133	0.016000	0.09150	0.060000	0.14342	0.907000	0.36646	0.650000	0.86243	GGC	0.090450		TCGA-FB-AAPS-01A-12D-A397-08	0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	0	0	1	2	2	2	2	0	0	0	0	152	0	152	152	1	2	-1.877142	0	0.100000	NM_001081		0	6	6	0	741	737	0		1			0	0	152	0	0	0.964475	0	0	0	0	0	0	6	741
CUBN	8029	broad.mit.edu	37	10	17145151	17145151	+	Silent	SNP	G	G	A	rs373833244		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr10:17145151G>A	ENST00000377833.4	-	13	1568	c.1503C>T	c.(1501-1503)ttC>ttT	p.F501F		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	501	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGATAACCCAGAAGCAGTTAA	0.358																																						ENST00000377833.4	1.000000	0.370000	1.000000	0.530000	0.740000	0.752425	0.740000	1.000000																										0				241						c.(1501-1503)ttC>ttT		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	G		1,4405	2.1+/-5.4	0,1,2202	100.0	99.0	99.0		1503	4.8	1.0	10		99	0,8600		0,0,4300	no	coding-synonymous	CUBN	NM_001081.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		501/3624	17145151	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8029	1	121410	34				g.chr10:17145151G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1503C>T	chr10.hg19:g.17145151G>A		0						p.F501F	NM_001081.3	NP_001072.2	0	1	1	1.983061	O60494	CUBN_HUMAN		13	1568	-			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	1	1	hg19	c.1503C>T	CCDS7113.1	0																																																																																								0.090450		TCGA-FB-AAPS-01A-12D-A397-08	0.358	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	1	0	1	2	2	2	2	0	0	0	0	46	0	46	45	1	2	-10.659270	1	0.100000	NM_001081		0	9	9	0	232	230	0		1			0	0	46	0	0	0.994255	0	0	0	0	0	0	9	232
LGR4	55366	broad.mit.edu	37	11	27390249	27390249	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr11:27390249G>A	ENST00000379214.4	-	18	2464	c.2021C>T	c.(2020-2022)aCa>aTa	p.T674I	LGR4_ENST00000389858.4_Missense_Mutation_p.T650I	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	674					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						GCCTGCTACTGTAGCACCTAG	0.438																																						ENST00000379214.4	1.000000	0.670000	1.000000	0.860000	0.990000	0.951537	0.990000	1.000000																										0				32						c.(2020-2022)aCa>aTa		leucine-rich repeat containing G protein-coupled receptor 4							91.0	84.0	86.0					11																	27390249		2202	4298	6500	SO:0001583	missense	55366	0	0					g.chr11:27390249G>A	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2021C>T	chr11.hg19:g.27390249G>A	ENSP00000368516:p.Thr674Ile	0					LGR4_ENST00000389858.4_Missense_Mutation_p.T650I	p.T674I	NM_018490.2	NP_060960.2	1	2	3	2.013211	Q9BXB1	LGR4_HUMAN		18	2464	-			A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	ENST00000379214.4	1	1	hg19	c.2021C>T	CCDS31449.1	1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.985958	0.00443	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	T;T	0.71103	-0.54;1.32	5.72	2.87	0.33458	5.72	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.806293	0.11920	N	0.516808	T	0.45115	0.1326	N	0.03608	-0.345	0.26019	N	0.981899	B;B	0.15930	0.001;0.015	B;B	0.21917	0.004;0.037	T	0.31806	-0.9930	10	0.15952	T	0.53	.	8.7411	0.34558	0.3575:0.0:0.6425:0.0	.	650;674	G5E9B3;Q9BXB1	.;LGR4_HUMAN	I	674;650	ENSP00000368516:T674I;ENSP00000374508:T650I	ENSP00000368516:T674I	T	-	2	0	0	LGR4	27346825	27346825	0.499000	0.26083	0.001000	0.08648	0.565000	0.35776	2.094000	0.41719	0.359000	0.24239	-0.142000	0.14014	ACA	0.108470		TCGA-FB-AAPS-01A-12D-A397-08	0.438	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	1	0	1	2	2	2	2	0	0	0	0	67	0	67	67	1	2	-3.322246	1	0.100000	NM_018490		0	19	20	0	345	342	0		1	0		0	0	67	0	0	0.999991	1.979922e-01	0	1	0	14	0	19	345
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.530000	1.000000	0.720000	0.950000	0.888046	0.950000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	1	1	1.997310	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.093656		TCGA-FB-AAPS-01A-12D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	12	2	2	2	0	5	0	0	49	8006	49	48	1	2	-4.741986	1	0.100000	NM_033360		524	13	13	7493	259	256	0	1	1	0	1	0	0	49	582	1	0.999536	6.188499e-02	9.996447e-01	0	14	8	266	13	259
UHRF1BP1L	23074	broad.mit.edu	37	12	100466468	100466468	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr12:100466468C>T	ENST00000279907.7	-	12	1743	c.1531G>A	c.(1531-1533)Gat>Aat	p.D511N	UHRF1BP1L_ENST00000356828.3_Missense_Mutation_p.D511N|UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.D161N	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	511										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TCCTTTCCATCTGGATAGTAA	0.274																																						ENST00000279907.7	1.000000	0.520000	1.000000	0.700000	0.930000	0.878306	0.930000	1.000000																										0				50						c.(1531-1533)Gat>Aat		UHRF1 binding protein 1-like							59.0	67.0	64.0					12																	100466468		2201	4298	6499	SO:0001583	missense	23074	0	0					g.chr12:100466468C>T		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1531G>A	chr12.hg19:g.100466468C>T	ENSP00000279907:p.Asp511Asn	0					UHRF1BP1L_ENST00000356828.3_Missense_Mutation_p.D511N|UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.D161N	p.D511N	NM_015054.1	NP_055869.1	0	1	1	1.997310	A0JNW5	UH1BL_HUMAN		12	1743	-			A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	1	1	hg19	c.1531G>A	CCDS31882.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.308215	0.95629	.	.	ENSG00000111647	ENST00000279907;ENST00000545232;ENST00000356828;ENST00000548045	T;T;T	0.38077	2.71;2.67;1.16	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.63260	0.2496	M	0.75264	2.295	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.81914	0.995;0.985	T	0.65240	-0.6216	10	0.72032	D	0.01	-21.0396	19.7072	0.96079	0.0:1.0:0.0:0.0	.	511;511	A0JNW5-2;A0JNW5	.;UH1BL_HUMAN	N	511;161;511;100	ENSP00000279907:D511N;ENSP00000444824:D161N;ENSP00000349285:D511N	ENSP00000279907:D511N	D	-	1	0	0	UHRF1BP1L	98990599	98990599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.729000	0.84864	2.662000	0.90505	0.591000	0.81541	GAT	0.093656		TCGA-FB-AAPS-01A-12D-A397-08	0.274	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	1	0	1	2	2	2	2	0	0	0	0	63	0	63	63	1	2	-3.225711	1	0.100000	NM_001006947		0	13	13	0	265	265	0		1	0		0	0	63	0	0	0.999567	7.704248e-03	0	0	0	3	0	13	265
MTUS2	23281	broad.mit.edu	37	13	29599068	29599068	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr13:29599068T>A	ENST00000431530.3	+	1	321	c.263T>A	c.(262-264)tTt>tAt	p.F88Y		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	78						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CATAAGGAATTTCACCAACTT	0.453																																						ENST00000431530.3	1.000000	0.760000	1.000000	0.990000	0.990000	0.982546	0.990000	1.000000																										0				20						c.(262-264)tTt>tAt		microtubule associated tumor suppressor candidate 2							35.0	34.0	34.0					13																	29599068		1827	4077	5904	SO:0001583	missense	23281	0	0					g.chr13:29599068T>A	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.263T>A	chr13.hg19:g.29599068T>A	ENSP00000392057:p.Phe88Tyr	0						p.F88Y	NM_001033602.2	NP_001028774.2	1	2	3	2.017051	Q5JR59	MTUS2_HUMAN		1	321	+			A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	1	1	hg19	c.263T>A	CCDS45022.1	1	.	.	.	.	.	.	.	.	.	.	t	8.487	0.861180	0.17178	.	.	ENSG00000132938	ENST00000431530	T	0.12672	2.66	5.37	-0.252	0.12999	5.37	-0.252	0.12999	.	0.731038	0.11928	N	0.515982	T	0.08179	0.0204	L	0.36672	1.1	0.09310	N	1	P	0.34757	0.467	B	0.34138	0.176	T	0.29058	-1.0024	9	.	.	.	.	0.7446	0.00980	0.2493:0.3104:0.1316:0.3087	.	78	Q5JR59	MTUS2_HUMAN	Y	88	ENSP00000392057:F88Y	.	F	+	2	0	0	MTUS2	28497068	28497068	0.000000	0.05858	0.001000	0.08648	0.040000	0.13550	0.521000	0.22893	-0.033000	0.13736	-0.418000	0.06021	TTT	0.109352		TCGA-FB-AAPS-01A-12D-A397-08	0.453	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	1	0	1	2	2	2	2	0	0	0	0	33	0	33	33	1	2	-16.712310	1	0.100000	XM_166270		0	12	12	0	168	163	0		1			0	0	33	0	0	0.999070	0	0	0	0	0	0	12	168
FREM2	341640	broad.mit.edu	37	13	39425162	39425162	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr13:39425162G>A	ENST00000280481.7	+	10	6875	c.6659G>A	c.(6658-6660)gGc>gAc	p.G2220D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2220	Calx-beta 4.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTGGTACTCGGCACTCCACAA	0.468																																						ENST00000280481.7	1.000000	0.100000	0.690000	0.170000	0.280000	0.394946	0.280000	0.240000																										0				148						c.(6658-6660)gGc>gAc		FRAS1 related extracellular matrix protein 2							96.0	89.0	91.0					13																	39425162		2203	4300	6503	SO:0001583	missense	341640	0	0					g.chr13:39425162G>A	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6659G>A	chr13.hg19:g.39425162G>A	ENSP00000280481:p.Gly2220Asp	0						p.G2220D	NM_207361.4	NP_997244.3	1	2	3	2.017051	Q5SZK8	FREM2_HUMAN		10	6875	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	0	1	hg19	c.6659G>A	CCDS31960.1	0	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725627	0.68959	.	.	ENSG00000150893	ENST00000280481	T	0.27890	1.64	5.8	5.8	0.92144	5.8	5.8	0.92144	Na-Ca exchanger/integrin-beta4 (1);	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68678	-0.5345	10	0.87932	D	0	.	19.0387	0.92989	0.0:0.0:1.0:0.0	.	2220;2220	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	D	2220	ENSP00000280481:G2220D	ENSP00000280481:G2220D	G	+	2	0	0	FREM2	38323162	38323162	1.000000	0.71417	0.291000	0.24904	0.025000	0.11179	9.457000	0.97630	2.749000	0.94314	0.650000	0.86243	GGC	0.109352		TCGA-FB-AAPS-01A-12D-A397-08	0.468	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	0	0	1	2	2	2	2	0	0	0	0	88	0	88	88	1	2	-2.664359	1	0.100000	NM_207361		0	5	5	0	415	414	0		1			0	0	88	0	0	0.937502	0	0	0	0	0	0	5	415
MYO16	23026	broad.mit.edu	37	13	109859074	109859074	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr13:109859074G>A	ENST00000357550.2	+	34	5508	c.5467G>A	c.(5467-5469)Gag>Aag	p.E1823K	MYO16_ENST00000356711.2_Missense_Mutation_p.E1823K	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GCACCACGCTGAGCCCAGGGT	0.602																																						ENST00000357550.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999850	0.990000	1.000000																										0				121						c.(5467-5469)Gag>Aag		myosin XVI							61.0	57.0	58.0					13																	109859074		2203	4300	6503	SO:0001583	missense	23026	0	0					g.chr13:109859074G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.5467G>A	chr13.hg19:g.109859074G>A	ENSP00000350160:p.Glu1823Lys	0					MYO16_ENST00000356711.2_Missense_Mutation_p.E1823K	p.E1823K	NM_001198950.1	NP_001185879.1	1	2	3	2.017051			BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)	34	5508	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)			Missense_Mutation	SNP	ENST00000357550.2	1	1	hg19	c.5467G>A	CCDS32008.1	1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016418	0.54468	.	.	ENSG00000041515	ENST00000356711;ENST00000357550	D;D	0.82344	-1.6;-1.6	4.34	4.34	0.51931	4.34	4.34	0.51931	.	0.000000	0.40818	U	0.001003	D	0.84023	0.5381	L	0.53249	1.67	0.80722	D	1	D	0.55172	0.97	P	0.51833	0.681	D	0.83751	0.0209	9	.	.	.	.	14.1841	0.65592	0.0:0.0:1.0:0.0	.	1823	Q9Y6X6	MYO16_HUMAN	K	1823	ENSP00000349145:E1823K;ENSP00000350160:E1823K	.	E	+	1	0	0	MYO16	108657075	108657075	1.000000	0.71417	0.914000	0.36105	0.088000	0.18126	6.105000	0.71505	2.248000	0.74166	0.563000	0.77884	GAG	0.109352		TCGA-FB-AAPS-01A-12D-A397-08	0.602	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	1	0	1	2	2	2	2	0	0	0	0	49	0	49	48	1	2	-20.000000	1	0.100000	NM_015011		0	20	20	0	181	178	1		1	0		0	0	49	0	0	0.999996	0	0	0	0	1	0	20	181
PTGER2	5732	broad.mit.edu	37	14	52781689	52781689	+	Silent	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr14:52781689C>T	ENST00000245457.5	+	1	577	c.423C>T	c.(421-423)ccC>ccT	p.P141P	PTGER2_ENST00000557436.1_Intron	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	141					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TCGGGCACCCCTACTTCTACC	0.642																																						ENST00000245457.5	1.000000	0.540000	1.000000	0.700000	0.920000	0.876183	0.920000	1.000000																										0				15						c.(421-423)ccC>ccT		prostaglandin E receptor 2 (subtype EP2), 53kDa	Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)						58.0	61.0	60.0					14																	52781689		2201	4299	6500	SO:0001819	synonymous_variant	5732	0	0					g.chr14:52781689C>T		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.423C>T	chr14.hg19:g.52781689C>T		0					PTGER2_ENST00000557436.1_Intron	p.P141P	NM_000956.3	NP_000947.2	1	2	3	2.015332	P43116	PE2R2_HUMAN		1	577	+	Breast(41;0.0639)|all_epithelial(31;0.0729)		D3DSC0|Q52LG8	Silent	SNP	ENST00000245457.5	1	1	hg19	c.423C>T	CCDS9708.1	1																																																																																								0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.642	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1	1	0	1	2	2	2	2	0	0	0	0	95	0	95	94	1	2	-2.778193	1	0.100000			0	17	17	0	378	375	0		1	0		0	0	95	0	0	0.999965	2.627026e-01	0	0	0	22	0	17	378
SMOC1	64093	broad.mit.edu	37	14	70418995	70418995	+	Silent	SNP	C	C	T	rs111874562		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr14:70418995C>T	ENST00000381280.4	+	2	493	c.240C>T	c.(238-240)ggC>ggT	p.G80G	SMOC1_ENST00000555917.1_3'UTR|SMOC1_ENST00000361956.3_Silent_p.G80G	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	80	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		CGACCCTGGGCGTGGTGCATC	0.597																																						ENST00000381280.4	1.000000	0.490000	1.000000	0.670000	0.900000	0.858754	0.900000	1.000000																										0				21						c.(238-240)ggC>ggT		SPARC related modular calcium binding 1							107.0	93.0	98.0					14																	70418995		2203	4300	6503	SO:0001819	synonymous_variant	64093	6	121412	40				g.chr14:70418995C>T	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.240C>T	chr14.hg19:g.70418995C>T		0					SMOC1_ENST00000555917.1_3'UTR|SMOC1_ENST00000361956.3_Silent_p.G80G	p.G80G	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	1	2	3	2.015332	Q9H4F8	SMOC1_HUMAN		2	493	+			A8K1S3|B2R7P5|Q96F78	Silent	SNP	ENST00000381280.4	1	1	hg19	c.240C>T	CCDS9798.1	1																																																																																								0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.597	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1	1	0	1	2	2	2	2	0	0	0	0	87	0	87	86	1	2	-4.266652	1	0.100000			0	13	12	0	298	295	0		1	0		0	0	87	0	0	0.999522	1.196952e-02	0	0	0	4	0	13	298
KCNK10	54207	broad.mit.edu	37	14	88729828	88729828	+	Silent	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr14:88729828C>T	ENST00000340700.5	-	2	556	c.105G>A	c.(103-105)ccG>ccA	p.P35P	KCNK10_ENST00000319231.5_Silent_p.P40P|KCNK10_ENST00000312350.5_Silent_p.P40P	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	35					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GAGTCGGAGCCGGAGCCGGGG	0.642																																						ENST00000340700.5	1.000000	0.110000	0.550000	0.180000	0.280000	0.386236	0.280000	0.240000																										0				47						c.(103-105)ccG>ccA		potassium channel, subfamily K, member 10							52.0	58.0	56.0					14																	88729828		2203	4300	6503	SO:0001819	synonymous_variant	54207	0	0					g.chr14:88729828C>T	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.105G>A	chr14.hg19:g.88729828C>T		0					KCNK10_ENST00000312350.5_Silent_p.P40P|KCNK10_ENST00000319231.5_Silent_p.P40P	p.P35P	NM_021161.4	NP_066984.1	1	2	3	2.015332	P57789	KCNKA_HUMAN		2	556	-			B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	ENST00000340700.5	0	1	hg19	c.105G>A	CCDS9880.1	0																																																																																								0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.642	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	0	0	0	2	2	2	2	0	0	0	0	117	0	117	117	1	2	-5.115172	1	0.100000	NM_021161		0	7	6	0	567	560	0		1			0	0	117	0	0	0.979716	0	0	0	0	0	0	7	567
ATG2B	55102	broad.mit.edu	37	14	96779761	96779761	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr14:96779761G>T	ENST00000359933.4	-	24	4547	c.3654C>A	c.(3652-3654)ttC>ttA	p.F1218L	ATG2B_ENST00000261834.5_5'Flank	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1218					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CAATATTCAAGAAGTATAAAA	0.303																																						ENST00000359933.4	1.000000	0.710000	1.000000	0.920000	0.990000	0.967627	0.990000	1.000000																										0				64						c.(3652-3654)ttC>ttA		autophagy related 2B							43.0	44.0	44.0					14																	96779761		2203	4292	6495	SO:0001583	missense	55102	0	0					g.chr14:96779761G>T	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3654C>A	chr14.hg19:g.96779761G>T	ENSP00000353010:p.Phe1218Leu	0					ATG2B_ENST00000261834.5_5'Flank	p.F1218L	NM_018036.5	NP_060506	1	2	3	2.015332	Q96BY7	ATG2B_HUMAN		24	4547	-		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	1	1	hg19	c.3654C>A	CCDS9944.2	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122650	0.77436	.	.	ENSG00000066739	ENST00000359933	T	0.11169	2.8	5.73	4.83	0.62350	5.73	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.26702	0.0653	M	0.71036	2.16	0.58432	D	0.999994	D	0.69078	0.997	D	0.70716	0.97	T	0.01587	-1.1318	10	0.40728	T	0.16	.	7.5215	0.27631	0.2796:0.0:0.7204:0.0	.	1218	Q96BY7	ATG2B_HUMAN	L	1218	ENSP00000353010:F1218L	ENSP00000353010:F1218L	F	-	3	2	2	ATG2B	95849514	95849514	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.278000	0.51662	1.394000	0.46624	0.655000	0.94253	TTC	0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.303	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	1	0	1	2	2	2	2	0	0	0	0	56	0	56	56	1	2	-19.342700	1	0.100000	NM_018036		0	17	17	0	284	282	0		1	1		0	0	56	0	0	0.999967	9.850936e-02	0	2	0	7	0	17	284
ASPG	374569	broad.mit.edu	37	14	104570767	104570767	+	Missense_Mutation	SNP	G	G	A	rs373529574		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr14:104570767G>A	ENST00000551177.1	+	8	972	c.880G>A	c.(880-882)Gtc>Atc	p.V294I	ASPG_ENST00000546892.2_Missense_Mutation_p.V294I|ASPG_ENST00000455920.2_Missense_Mutation_p.V294I	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	294	Asparaginase.|Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						CCTGGTCATCGTCAACTGTAC	0.657																																						ENST00000551177.1	1.000000	0.160000	0.980000	0.280000	0.460000	0.536739	0.460000	0.380000																										0				11						c.(880-882)Gtc>Atc		asparaginase		G	ILE/VAL	1,4279		0,1,2139	33.0	43.0	40.0		880	-0.3	0.9	14		40	0,8512		0,0,4256	no	missense	ASPG	NM_001080464.2	29	0,1,6395	AA,AG,GG		0.0,0.0234,0.0078	benign	294/574	104570767	1,12791	2140	4256	6396	SO:0001583	missense	374569	0	0					g.chr14:104570767G>A		CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.880G>A	chr14.hg19:g.104570767G>A	ENSP00000450040:p.Val294Ile	0					ASPG_ENST00000455920.2_Missense_Mutation_p.V294I|ASPG_ENST00000546892.2_Missense_Mutation_p.V294I	p.V294I	NM_001080464.2	NP_001073933.2	1	2	3	2.015332	Q86U10	LPP60_HUMAN		8	972	+			B9EGQ2|Q8IV80	Missense_Mutation	SNP	ENST00000551177.1	0	1	hg19	c.880G>A	CCDS45170.2	0	.	.	.	.	.	.	.	.	.	.	G	9.447	1.089554	0.20390	2.34E-4	0.0	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920	T;T;T	0.32988	1.43;1.43;1.43	4.1	-0.315	0.12746	4.1	-0.315	0.12746	.	0.591503	0.16314	N	0.219861	T	0.17280	0.0415	L	0.40543	1.245	0.31470	N	0.668549	P;B;B;B	0.35542	0.508;0.097;0.303;0.239	B;B;B;B	0.28385	0.089;0.026;0.021;0.058	T	0.18840	-1.0324	10	0.27082	T	0.32	-10.5745	5.8295	0.18572	0.186:0.5239:0.2901:0.0	.	294;294;294;322	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	I	294;322;294;294	ENSP00000450040:V294I;ENSP00000448911:V294I;ENSP00000389003:V294I	ENSP00000299234:V322I	V	+	1	0	0	ASPG	103640520	103640520	0.000000	0.05858	0.875000	0.34327	0.497000	0.33675	-0.095000	0.11077	-0.132000	0.11557	0.462000	0.41574	GTC	0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.657	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407005.1	0	0	1	2	2	2	2	0	0	0	0	54	0	54	53	1	2	-6.047062	1	0.100000	NM_001080464		0	5	5	0	251	250	0		1	0		0	0	54	0	0	0.937505	0	0	0	0	1	0	5	251
MAPKBP1	23005	broad.mit.edu	37	15	42109604	42109604	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr15:42109604G>A	ENST00000456763.2	+	16	1944	c.1748G>A	c.(1747-1749)cGc>cAc	p.R583H	MAPKBP1_ENST00000260357.7_Missense_Mutation_p.R416H|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.R577H|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.R460H|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.R577H	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	583										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GGGCAAGTCCGCATGATCAGC	0.612																																						ENST00000456763.2	0.590000	0.110000	0.440000	0.180000	0.290000	0.319078	0.290000	0.270000																										0				56						c.(1747-1749)cGc>cAc		mitogen-activated protein kinase binding protein 1							93.0	76.0	81.0					15																	42109604		2203	4300	6503	SO:0001583	missense	23005	6	121412	38				g.chr15:42109604G>A	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1748G>A	chr15.hg19:g.42109604G>A	ENSP00000393099:p.Arg583His	0					MAPKBP1_ENST00000514566.1_Missense_Mutation_p.R577H|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.R460H|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.R577H|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.R416H	p.R583H	NM_001128608.1	NP_001122080.1	0	1	1	1.984148	O60336	MABP1_HUMAN		16	1944	+		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	0	1	hg19	c.1748G>A	CCDS45239.1	0	.	.	.	.	.	.	.	.	.	.	g	32	5.110217	0.94292	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23	5.67	5.67	0.87782	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71443	0.3340	L	0.43152	1.355	0.51767	D	0.99993	D;D;D;P;P	0.89917	1.0;0.999;1.0;0.92;0.892	D;D;D;P;P	0.79108	0.992;0.921;0.977;0.658;0.452	T	0.71705	-0.4512	10	0.59425	D	0.04	-17.6502	19.7785	0.96405	0.0:0.0:1.0:0.0	.	416;460;577;583;577	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	H	577;460;416;583;577	ENSP00000397570:R577H;ENSP00000221214:R460H;ENSP00000260357:R416H;ENSP00000393099:R583H;ENSP00000426154:R577H	ENSP00000221214:R460H	R	+	2	0	0	MAPKBP1	39896896	39896896	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.059000	0.89462	2.667000	0.90743	0.563000	0.77884	CGC	0.090909		TCGA-FB-AAPS-01A-12D-A397-08	0.612	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	0	0	1	2	2	2	2	0	0	0	0	81	0	81	81	1	2	-2.411422	0	0.100000	NM_014994		0	5	5	0	355	352	0		1	0		0	0	81	0	0	0.936580	8.197939e-03	0	0	0	8	0	5	355
FSD2	123722	broad.mit.edu	37	15	83438550	83438550	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr15:83438550T>C	ENST00000334574.8	-	8	1535	c.1354A>G	c.(1354-1356)Aac>Gac	p.N452D	FSD2_ENST00000541889.1_Intron			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	452	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						CCAGCCCTGTTGTGAGCTGTG	0.478																																						ENST00000334574.8	1.000000	0.990000	1.000000	0.990000	0.990000	0.999896	0.990000	1.000000																										0				18						c.(1354-1356)Aac>Gac		fibronectin type III and SPRY domain containing 2							95.0	94.0	94.0					15																	83438550		1856	4100	5956	SO:0001583	missense	123722	0	0					g.chr15:83438550T>C	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.1354A>G	chr15.hg19:g.83438550T>C	ENSP00000335651:p.Asn452Asp	0					FSD2_ENST00000541889.1_Intron	p.N452D			0	1	1	1.987728	A1L4K1	FSD2_HUMAN		8	1535	-			B3KVG1|B7ZM02	Missense_Mutation	SNP	ENST00000334574.8	0	1	hg19	c.1354A>G	CCDS45332.1	1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843035	0.91197	.	.	ENSG00000186628	ENST00000334574	T	0.61859	0.07	5.82	5.82	0.92795	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76456	0.3990	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78298	-0.2258	10	0.52906	T	0.07	-44.4125	15.3589	0.74453	0.0:0.0:0.0:1.0	.	452	A1L4K1	FSD2_HUMAN	D	452	ENSP00000335651:N452D	ENSP00000335651:N452D	N	-	1	0	0	FSD2	81235604	81235604	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.299000	0.78831	2.225000	0.72522	0.459000	0.35465	AAC	0.091368		TCGA-FB-AAPS-01A-12D-A397-08	0.478	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	0	0	1	2	16	2	2	1	0	1	1	70	0	70	68	1	2	-20.000000	1	0.100000	NM_001007122		0	30	30	0	295	292	0		1			1	0	70	0	0	0.988309	0	0	0	0	0	0	30	295
ATP2C2	9914	broad.mit.edu	37	16	84476138	84476138	+	Missense_Mutation	SNP	C	C	T	rs370258691		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr16:84476138C>T	ENST00000262429.4	+	15	1423	c.1334C>T	c.(1333-1335)gCg>gTg	p.A445V	ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000416219.2_Missense_Mutation_p.A445V	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	445					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GCCAACAATGCGGTCATCAGA	0.552																																						ENST00000262429.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999797	0.990000	1.000000																										0				33						c.(1333-1335)gCg>gTg		ATPase, Ca++ transporting, type 2C, member 2		C	VAL/ALA	0,3772		0,0,1886	177.0	179.0	179.0		1334	4.9	0.9	16		179	1,8231		0,1,4115	no	missense	ATP2C2	NM_014861.2	64	0,1,6001	TT,TC,CC		0.0121,0.0,0.0083	possibly-damaging	445/947	84476138	1,12003	1886	4116	6002	SO:0001583	missense	9914	0	0					g.chr16:84476138C>T	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1334C>T	chr16.hg19:g.84476138C>T	ENSP00000262429:p.Ala445Val	0					ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000416219.2_Missense_Mutation_p.A445V	p.A445V	NM_014861.2	NP_055676.2	0	1	1	1.948083	O75185	AT2C2_HUMAN		15	1423	+			B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	1	1	hg19	c.1334C>T	CCDS42207.1	1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.015619	0.93404	0.0	1.21E-4	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	T;T	0.74002	-0.8;-0.8	4.92	4.92	0.64577	4.92	4.92	0.64577	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.416605	0.24280	N	0.039912	D	0.86851	0.6032	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;0.989;1.0	D;D;P;D	0.81914	0.918;0.987;0.79;0.995	D	0.88725	0.3232	10	0.87932	D	0	.	17.4464	0.87579	0.0:1.0:0.0:0.0	.	445;294;462;445	E7ES94;F8WAA5;O75185-2;O75185	.;.;.;AT2C2_HUMAN	V	445;445;294	ENSP00000397925:A445V;ENSP00000262429:A445V	ENSP00000262429:A445V	A	+	2	0	0	ATP2C2	83033639	83033639	1.000000	0.71417	0.938000	0.37757	0.625000	0.37756	7.069000	0.76755	2.436000	0.82500	0.491000	0.48974	GCG	0.075501		TCGA-FB-AAPS-01A-12D-A397-08	0.552	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	0	0	0	2	16	2	2	1	0	1	1	246	0	246	245	1	2	-12.787620	1	0.100000	NM_014861		0	77	76	0	1026	1021	0		1			1	0	246	0	0	1.000000	0	0	0	0	0	0	77	1026
TUBG1	7283	broad.mit.edu	37	17	40767013	40767013	+	Missense_Mutation	SNP	C	C	T	rs375839941		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr17:40767013C>T	ENST00000251413.3	+	11	1372	c.1310C>T	c.(1309-1311)gCg>gTg	p.A437V		NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	437					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	GAGTACCATGCGGCCACACGG	0.577																																					Colon(20;114 698 11420 22864)	ENST00000251413.3	0.600000	0.110000	0.450000	0.190000	0.300000	0.327160	0.300000	0.270000																										0				12						c.(1309-1311)gCg>gTg		tubulin, gamma 1	Vinblastine(DB00570)	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	96.0	94.0	95.0		1310	5.0	1.0	17		95	0,8600		0,0,4300	no	missense	TUBG1	NM_001070.4	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	437/452	40767013	1,13005	2203	4300	6503	SO:0001583	missense	7283	3	121412	36				g.chr17:40767013C>T	BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.1310C>T	chr17.hg19:g.40767013C>T	ENSP00000251413:p.Ala437Val	1						p.A437V	NM_001070.4	NP_001061.2	1	2	3	2.157769	P23258	TBG1_HUMAN		11	1372	+		Breast(137;0.00116)	Q53X79|Q9BW59	Missense_Mutation	SNP	ENST00000251413.3	0	1	hg19	c.1310C>T	CCDS11433.1	0	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912393	0.72983	2.27E-4	0.0	ENSG00000131462	ENST00000251413	D	0.84873	-1.91	5.02	5.02	0.67125	5.02	5.02	0.67125	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.83008	0.5161	M	0.82517	2.595	0.80722	D	1	P	0.46621	0.881	B	0.20184	0.028	D	0.87729	0.2578	10	0.72032	D	0.01	-12.5776	18.361	0.90374	0.0:1.0:0.0:0.0	.	437	P23258	TBG1_HUMAN	V	437	ENSP00000251413:A437V	ENSP00000251413:A437V	A	+	2	0	0	TUBG1	38020539	38020539	1.000000	0.71417	0.959000	0.39883	0.970000	0.65996	7.794000	0.85869	2.339000	0.79563	0.563000	0.77884	GCG	0.142857		TCGA-FB-AAPS-01A-12D-A397-08	0.577	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450548.1	0	0	1	2	2	2	2	0	0	0	0	58	0	58	58	1	2	-2.371365	0	0.100000	NM_001070		0	5	5	0	372	372	0		1	0		0	0	58	0	0	0.937937	3.374605e-01	0	0	0	77	0	5	372
AOC3	8639	broad.mit.edu	37	17	41006599	41006599	+	Missense_Mutation	SNP	G	G	A	rs151291423		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr17:41006599G>A	ENST00000308423.2	+	2	1895	c.1735G>A	c.(1735-1737)Gtg>Atg	p.V579M	AOC3_ENST00000591562.1_Missense_Mutation_p.V36M	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	579					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	CGCCTTCCTCGTGGGAAGCGC	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		16238	0.001		0.0	False		,,,				2504	0.0				NSCLC(3;192 220 10664 11501 16477)	ENST00000308423.2	1.000000	0.620000	1.000000	0.830000	0.990000	0.942594	0.990000	1.000000																										0				41						c.(1735-1737)Gtg>Atg		amine oxidase, copper containing 3	Hydralazine(DB01275)|Phenelzine(DB00780)	G	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	41.0	38.0	39.0		1735	-2.9	0.9	17	dbSNP_134	39	0,8600		0,0,4300	no	missense	AOC3	NM_003734.2	21	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	579/764	41006599	2,13004	2203	4300	6503	SO:0001583	missense	8639	5	121410	35				g.chr17:41006599G>A	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1735G>A	chr17.hg19:g.41006599G>A	ENSP00000312326:p.Val579Met	1					AOC3_ENST00000591562.1_Missense_Mutation_p.V36M	p.V579M	NM_003734.2	NP_003725.1	1	2	3	2.157769	Q16853	AOC3_HUMAN		2	1895	+		Breast(137;0.000143)	B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	ENST00000308423.2	1	1	hg19	c.1735G>A	CCDS11444.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	6.783	0.513399	0.12944	4.54E-4	0.0	ENSG00000131471	ENST00000308423	T	0.04119	3.7	5.32	-2.88	0.05682	5.32	-2.88	0.05682	Copper amine oxidase, C-terminal (3);	0.357546	0.26549	N	0.023746	T	0.01835	0.0058	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.14023	0.01	T	0.39292	-0.9621	10	0.39692	T	0.17	.	2.3969	0.04392	0.3096:0.3338:0.2405:0.1161	.	579	Q16853	AOC3_HUMAN	M	579	ENSP00000312326:V579M	ENSP00000312326:V579M	V	+	1	0	0	AOC3	38260125	38260125	0.001000	0.12720	0.879000	0.34478	0.007000	0.05969	0.172000	0.16704	-0.045000	0.13468	-1.127000	0.01993	GTG	0.142857		TCGA-FB-AAPS-01A-12D-A397-08	0.652	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452444.1	1	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	2	-15.466960	1	0.100000	NM_003734		0	13	13	0	238	233	0		1	0		0	0	46	0	0	0.999512	9.321191e-01	0	0	0	87	0	13	238
TP53	7157	broad.mit.edu	37	17	7578395	7578395	+	Missense_Mutation	SNP	G	G	A	rs587780070		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr17:7578395G>A	ENST00000269305.4	-	5	724	c.535C>T	c.(535-537)Cat>Tat	p.H179Y	TP53_ENST00000359597.4_Missense_Mutation_p.H179Y|TP53_ENST00000455263.2_Missense_Mutation_p.H179Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.H179Y|TP53_ENST00000445888.2_Missense_Mutation_p.H179Y|TP53_ENST00000413465.2_Missense_Mutation_p.H179Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179Y(98)|p.H179N(16)|p.H179D(13)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47Y(6)|p.H86Y(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.H47D(1)|p.R174fs*3(1)|p.H86D(1)|p.H178_H179>QY(1)|p.H47N(1)|p.H86N(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCGCTCATGGTGGGGGCAG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.710000	0.980000	0.830000	0.920000	0.913308	0.920000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		197	Substitution - Missense(143)|Deletion - In frame(25)|Deletion - Frameshift(19)|Whole gene deletion(8)|Complex - deletion inframe(1)|Complex - compound substitution(1)	p.H179Y(98)|p.H179N(16)|p.H179D(13)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47Y(6)|p.H86Y(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.H47D(1)|p.R174fs*3(1)|p.H86D(1)|p.H178_H179>QY(1)|p.H47N(1)|p.H86N(1)|p.E171fs*61(1)	skin(28)|upper_aerodigestive_tract(27)|large_intestine(27)|lung(27)|breast(18)|haematopoietic_and_lymphoid_tissue(11)|oesophagus(11)|central_nervous_system(8)|ovary(8)|stomach(7)|liver(7)|bone(5)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|cervix(1)|vulva(1)|eye(1)|kidney(1)|endometrium(1)|prostate(1)	24185	GRCh37	CM067054	TP53	M		c.(535-537)Cat>Tat	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						47.0	47.0	47.0					17																	7578395		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578395G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.535C>T	chr17.hg19:g.7578395G>A	ENSP00000269305:p.His179Tyr	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.H179Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.H179Y|TP53_ENST00000420246.2_Missense_Mutation_p.H179Y|TP53_ENST00000359597.4_Missense_Mutation_p.H179Y|TP53_ENST00000413465.2_Missense_Mutation_p.H179Y	p.H179Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.896288	P04637	P53_HUMAN		5	724	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.535C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.137178	0.94517	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.59	5.59	0.84812	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	D	0.000000	D	0.99914	0.9959	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.992;1.0;0.989;1.0;0.999;1.0;0.997	D;D;D;D;D;D;D	0.97110	0.953;0.997;0.941;1.0;0.993;0.995;0.958	D	0.96190	0.9137	10	0.87932	D	0	-15.4889	17.4784	0.87667	0.0:0.0:1.0:0.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179Y;ENSP00000352610:H179Y;ENSP00000269305:H179Y;ENSP00000398846:H179Y;ENSP00000391127:H179Y;ENSP00000391478:H179Y;ENSP00000425104:H47Y;ENSP00000423862:H86Y	ENSP00000269305:H179Y	H	-	1	0	0	TP53	7519120	7519120	1.000000	0.71417	0.990000	0.47175	0.864000	0.49448	9.813000	0.99286	2.804000	0.96469	0.655000	0.94253	CAT	0.052632		TCGA-FB-AAPS-01A-12D-A397-08	0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	6	0	0	0	0	72	0	72	72	1	2	-3.221897	1	0.100000	NM_000546		0	24	24	0	307	306	0		1	1	1	0	1	72	1207	0	1.000000	7.205393e-01	1	2	51	32	738	24	307
AMZ2	51321	broad.mit.edu	37	17	66251858	66251858	+	Silent	SNP	C	C	T	rs138911562		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr17:66251858C>T	ENST00000359904.3	+	6	1900	c.768C>T	c.(766-768)atC>atT	p.I256I	AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000392720.2_Silent_p.I256I|AMZ2_ENST00000580753.1_Silent_p.I256I|AMZ2_ENST00000359783.4_Silent_p.I198I|AMZ2_ENST00000577866.1_Silent_p.I256I|AMZ2_ENST00000577985.1_Silent_p.I256I|AMZ2_ENST00000585050.1_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	256							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCCATGAGATCGGACACATAT	0.478																																						ENST00000359904.3	0.500000	0.090000	0.370000	0.150000	0.240000	0.270353	0.240000	0.230000																										0				9						c.(766-768)atC>atT		archaelysin family metallopeptidase 2		C	,,,,,	0,4406		0,0,2203	121.0	108.0	113.0		768,768,768,768,594,768	-6.7	0.8	17	dbSNP_134	113	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	AMZ2	NM_001033569.1,NM_001033570.1,NM_001033571.1,NM_001033572.1,NM_001033574.1,NM_016627.4	,,,,,	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	,,,,,	256/361,256/361,256/361,256/361,198/303,256/361	66251858	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	51321	26	121412	47				g.chr17:66251858C>T	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.768C>T	chr17.hg19:g.66251858C>T		0					AMZ2_ENST00000359783.4_Silent_p.I198I|AMZ2_ENST00000580753.1_Silent_p.I256I|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000392720.2_Silent_p.I256I|AMZ2_ENST00000577866.1_Silent_p.I256I|AMZ2_ENST00000577985.1_Silent_p.I256I	p.I256I	NM_016627.4	NP_057711.3	0	1	1	1.991006	Q86W34	AMZ2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)	6	1900	+	all_cancers(12;1.12e-09)		A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Silent	SNP	ENST00000359904.3	0	1	hg19	c.768C>T	CCDS11674.1	0																																																																																								0.092284		TCGA-FB-AAPS-01A-12D-A397-08	0.478	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	0	0	1	2	2	2	2	0	0	0	0	89	0	89	88	1	2	-2.621214	1	0.100000	NM_016627		0	5	5	0	423	417	0		1	1		0	0	89	0	0	0.935544	6.311465e-01	0	4	0	164	0	5	423
NAPG	8774	broad.mit.edu	37	18	10530778	10530778	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr18:10530778G>T	ENST00000322897.6	+	2	137	c.68G>T	c.(67-69)gGt>gTt	p.G23V	NAPG_ENST00000542979.1_Intron	NM_003826.2	NP_003817.1	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, gamma	23					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)				large_intestine(2)|lung(2)	4						CTGAAAACTGGTTTTTTAAAA	0.353																																						ENST00000322897.6	1.000000	0.560000	1.000000	0.870000	0.990000	0.949109	0.990000	1.000000																										0				4						c.(67-69)gGt>gTt		N-ethylmaleimide-sensitive factor attachment protein, gamma							127.0	121.0	123.0					18																	10530778		1825	4066	5891	SO:0001583	missense	8774	0	0					g.chr18:10530778G>T	U78107	CCDS45827.1	18p11.21	2013-02-28			ENSG00000134265	ENSG00000134265			7642	protein-coding gene	gene with protein product	"""gamma SNAP"""	603216				9269766	Standard	NM_003826		Approved		uc002kon.3	Q99747	OTTHUMG00000179119	ENST00000322897.6:c.68G>T	chr18.hg19:g.10530778G>T	ENSP00000324628:p.Gly23Val	0					NAPG_ENST00000542979.1_Intron	p.G23V	NM_003826.2	NP_003817.1	0	0	0	1.969049	Q99747	SNAG_HUMAN		2	137	+			B4DFC9|Q9BUV1	Missense_Mutation	SNP	ENST00000322897.6	0	1	hg19	c.68G>T	CCDS45827.1	1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697849	0.48307	.	.	ENSG00000134265	ENST00000322897	T	0.38240	1.15	5.42	5.42	0.78866	5.42	5.42	0.78866	Tetratricopeptide-like helical (1);	0.139931	0.64402	D	0.000004	T	0.33411	0.0862	N	0.19112	0.55	0.80722	D	1	P	0.44429	0.835	P	0.44477	0.451	T	0.15464	-1.0436	10	0.66056	D	0.02	-4.1077	19.4084	0.94658	0.0:0.0:1.0:0.0	.	23	Q99747	SNAG_HUMAN	V	23	ENSP00000324628:G23V	ENSP00000324628:G23V	G	+	2	0	0	NAPG	10520778	10520778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.009000	0.93606	2.820000	0.97059	0.650000	0.86243	GGT	0.079755		TCGA-FB-AAPS-01A-12D-A397-08	0.353	NAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444873.1	0	0	1	2	2	2	2	0	0	0	0	12	0	12	12	1	2	-10.347180	1	0.100000	NM_003826		0	5	5	0	49	49	1		1	0		0	0	12	0	0	0.940652	3.299676e-01	0	1	0	10	0	5	49
NXNL1	115861	broad.mit.edu	37	19	17571500	17571500	+	Missense_Mutation	SNP	C	C	T	rs371790764		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr19:17571500C>T	ENST00000301944.2	-	1	263	c.179G>A	c.(178-180)cGg>cAg	p.R60Q	CTD-2521M24.10_ENST00000594663.1_5'UTR	NM_138454.1	NP_612463.1	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	60	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				photoreceptor cell maintenance (GO:0045494)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	6						ATCTGTGAGCCGCACGAAGAA	0.612																																						ENST00000301944.2	1.000000	0.800000	1.000000	0.990000	0.990000	0.984599	0.990000	1.000000																										0				6						c.(178-180)cGg>cAg		nucleoredoxin-like 1		C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	77.0	73.0	74.0		179	1.6	0.9	19		74	0,8600		0,0,4300	no	missense	NXNL1	NM_138454.1	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	60/213	17571500	1,13005	2203	4300	6503	SO:0001583	missense	115861	5	121410	35				g.chr19:17571500C>T	BC014127	CCDS12360.1	19p13.11	2014-05-21	2007-08-16	2007-08-16	ENSG00000171773	ENSG00000171773			25179	protein-coding gene	gene with protein product		608791	"""thioredoxin-like 6"""	TXNL6		12477932	Standard	NM_138454		Approved	RDCVF	uc002ngs.3	Q96CM4	OTTHUMG00000182798	ENST00000301944.2:c.179G>A	chr19.hg19:g.17571500C>T	ENSP00000305631:p.Arg60Gln	0					CTD-2521M24.10_ENST00000594663.1_5'UTR	p.R60Q	NM_138454.1	NP_612463.1	1	2	3	2.026383	Q96CM4	NXNL1_HUMAN		1	263	-			Q0QD37	Missense_Mutation	SNP	ENST00000301944.2	1	1	hg19	c.179G>A	CCDS12360.1	1	.	.	.	.	.	.	.	.	.	.	c	10.87	1.472826	0.26423	2.27E-4	0.0	ENSG00000171773	ENST00000301944	T	0.80123	-1.34	3.92	1.63	0.23807	3.92	1.63	0.23807	Thioredoxin-like fold (3);	0.201829	0.37012	N	0.002283	T	0.55353	0.1915	N	0.16708	0.43	0.29006	N	0.887146	P	0.49635	0.926	B	0.33339	0.162	T	0.55805	-0.8083	10	0.25106	T	0.35	-24.7216	7.195	0.25847	0.0:0.7457:0.0:0.2543	.	60	Q96CM4	NXNL1_HUMAN	Q	60	ENSP00000305631:R60Q	ENSP00000305631:R60Q	R	-	2	0	0	NXNL1	17432500	17432500	0.000000	0.05858	0.919000	0.36401	0.529000	0.34654	0.379000	0.20585	0.860000	0.35481	0.467000	0.42956	CGG	0.111550		TCGA-FB-AAPS-01A-12D-A397-08	0.612	NXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463803.1	1	0	1	2	2	2	2	0	0	0	0	61	0	61	60	1	2	-2.921031	1	0.100000	NM_138454		0	21	21	0	327	325	0		1			0	0	61	0	0	0.999998	0	0	0	0	0	0	21	327
WDR62	284403	broad.mit.edu	37	19	36572414	36572414	+	Missense_Mutation	SNP	G	G	T	rs387907082		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr19:36572414G>T	ENST00000270301.7	+	10	1313	c.1313G>T	c.(1312-1314)cGc>cTc	p.R438L	WDR62_ENST00000388999.3_Missense_Mutation_p.R438L|WDR62_ENST00000401500.2_Missense_Mutation_p.R438L			O43379	WDR62_HUMAN	WD repeat domain 62	438			R -> H (in MCPH2; the mutant protein does not localize to the spindle pole during mitosis). {ECO:0000269|PubMed:20890279}.		cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AACACCATTCGCTTCTGGAAC	0.463																																						ENST00000270301.7	1.000000	0.670000	1.000000	0.830000	0.990000	0.937851	0.990000	1.000000																										0				43						c.(1312-1314)cGc>cTc		WD repeat domain 62							190.0	171.0	177.0					19																	36572414		2203	4300	6503	SO:0001583	missense	284403	0	0					g.chr19:36572414G>T	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1313G>T	chr19.hg19:g.36572414G>T	ENSP00000270301:p.Arg438Leu	0					WDR62_ENST00000388999.3_Missense_Mutation_p.R438L|WDR62_ENST00000401500.2_Missense_Mutation_p.R438L	p.R438L			1	2	3	2.026383	O43379	WDR62_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)	10	1313	+	Esophageal squamous(110;0.162)		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	1	1	hg19	c.1313G>T	CCDS33001.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.246220	0.95272	.	.	ENSG00000075702	ENST00000401500;ENST00000388999;ENST00000270301	T;T;T	0.67698	-0.28;-0.28;-0.28	5.23	5.23	0.72850	5.23	5.23	0.72850	WD40/YVTN repeat-like-containing domain (2);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84524	0.5491	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87579	0.2483	10	0.87932	D	0	-37.3853	16.3039	0.82841	0.0:0.0:1.0:0.0	.	438;438	O43379-4;O43379	.;WDR62_HUMAN	L	438	ENSP00000384792:R438L;ENSP00000373651:R438L;ENSP00000270301:R438L	ENSP00000270301:R438L	R	+	2	0	0	WDR62	41264254	41264254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.460000	0.97641	2.462000	0.83206	0.655000	0.94253	CGC	0.111550		TCGA-FB-AAPS-01A-12D-A397-08	0.463	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	1	0	0	2	2	2	2	0	0	0	0	112	0	112	111	1	2	-4.767748	1	0.100000	NM_015671		0	27	27	0	534	531	0		1	0		0	0	112	0	0	1.000000	7.400104e-03	0	1	0	2	0	27	534
CATSPERG	57828	broad.mit.edu	37	19	38858385	38858385	+	Missense_Mutation	SNP	G	G	A	rs147603617		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr19:38858385G>A	ENST00000409235.3	+	25	3014	c.2899G>A	c.(2899-2901)Gaa>Aaa	p.E967K	CATSPERG_ENST00000410018.1_Missense_Mutation_p.E927K|CATSPERG_ENST00000215069.4_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	967					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						CAGTGAGGACGAAATCTACCG	0.592																																						ENST00000409235.3	1.000000	0.950000	1.000000	0.990000	0.990000	0.997294	0.990000	1.000000																										0				40						c.(2899-2901)Gaa>Aaa		catsper channel auxiliary subunit gamma		G	LYS/GLU	0,4406		0,0,2203	221.0	233.0	229.0		2899	3.9	0.8	19	dbSNP_134	229	1,8599	1.2+/-3.3	0,1,4299	no	missense	CATSPERG	NM_021185.4	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	967/1160	38858385	1,13005	2203	4300	6503	SO:0001583	missense	57828	5	121412	42				g.chr19:38858385G>A	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.2899G>A	chr19.hg19:g.38858385G>A	ENSP00000386962:p.Glu967Lys	0					CATSPERG_ENST00000215069.4_3'UTR|CATSPERG_ENST00000410018.1_Missense_Mutation_p.E927K	p.E967K	NM_021185.4	NP_067008.3	1	2	3	2.026383	Q6ZRH7	CTSRG_HUMAN		25	3014	+			A6NEG6|Q659E1	Missense_Mutation	SNP	ENST00000409235.3	1	1	hg19	c.2899G>A	CCDS12514.2	1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811016	0.50421	0.0	1.16E-4	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T	0.57273	0.41;0.41	3.93	3.93	0.45458	3.93	3.93	0.45458	.	0.165988	0.28214	N	0.016180	T	0.47857	0.1468	L	0.29908	0.895	0.80722	D	1	D;P	0.60160	0.987;0.876	P;B	0.50162	0.633;0.176	T	0.52593	-0.8555	10	0.72032	D	0.01	-10.9001	11.3115	0.49366	0.0:0.0:1.0:0.0	.	967;927	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	K	927;967;967	ENSP00000387057:E927K;ENSP00000386962:E967K	ENSP00000386962:E967K	E	+	1	0	0	CATSPERG	43550225	43550225	0.982000	0.34865	0.772000	0.31596	0.164000	0.22412	2.970000	0.49240	2.002000	0.58637	0.484000	0.47621	GAA	0.111550		TCGA-FB-AAPS-01A-12D-A397-08	0.592	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	1	0	1	2	2	2	2	0	0	0	0	284	0	284	283	1	2	-10.075920	1	0.100000	NM_021185		0	75	75	0	1204	1195	0		1			0	0	284	0	0	1.000000	0	0	0	0	0	0	75	1204
XRCC1	7515	broad.mit.edu	37	19	44055781	44055781	+	Missense_Mutation	SNP	C	C	A	rs2271980		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr19:44055781C>A	ENST00000262887.5	-	10	1688	c.1141G>T	c.(1141-1143)Gtg>Ttg	p.V381L	XRCC1_ENST00000543982.1_Missense_Mutation_p.V350L|L34079.3_ENST00000597119.1_RNA			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	381	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				TCCTTACGCACGATGCGGCCT	0.622								Other BER factors																														ENST00000262887.5	1.000000	0.640000	1.000000	0.800000	0.990000	0.923661	0.990000	1.000000																										0				19						c.(1141-1143)Gtg>Ttg	Other BER factors	X-ray repair complementing defective repair in Chinese hamster cells 1							90.0	83.0	85.0					19																	44055781		2203	4300	6503	SO:0001583	missense	7515	0	0					g.chr19:44055781C>A	M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1141G>T	chr19.hg19:g.44055781C>A	ENSP00000262887:p.Val381Leu	0					L34079.3_ENST00000597119.1_RNA|XRCC1_ENST00000543982.1_Missense_Mutation_p.V350L	p.V381L			1	2	3	2.026383	P18887	XRCC1_HUMAN		10	1688	-		Prostate(69;0.0153)	Q6IBS4|Q9HCB1	Missense_Mutation	SNP	ENST00000262887.5	0	1	hg19	c.1141G>T	CCDS12624.1	1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907354	0.92107	.	.	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982	D;D	0.82619	-1.63;-1.63	5.16	4.11	0.48088	5.16	4.11	0.48088	BRCT (4);	0.000000	0.85682	D	0.000000	D	0.89329	0.6684	M	0.72479	2.2	0.80722	D	1	B;D	0.69078	0.041;0.997	B;D	0.71656	0.028;0.974	D	0.89976	0.4097	10	0.56958	D	0.05	-22.7288	13.6093	0.62068	0.1567:0.8433:0.0:0.0	.	350;381	F5H8D7;P18887	.;XRCC1_HUMAN	L	395;381;350	ENSP00000262887:V381L;ENSP00000443671:V350L	ENSP00000262887:V381L	V	-	1	0	0	XRCC1	48747621	48747621	1.000000	0.71417	0.977000	0.42913	0.996000	0.88848	5.071000	0.64382	1.472000	0.48140	0.655000	0.94253	GTG	0.111550		TCGA-FB-AAPS-01A-12D-A397-08	0.622	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463194.1	1	0	1	2	2	2	2	0	0	0	0	126	0	126	124	1	2	-4.886227	1	0.100000	NM_006297		0	26	26	0	533	523	0		1	1		0	0	126	0	0	1.000000	7.250238e-01	0	3	0	51	0	26	533
BAI2	576	broad.mit.edu	37	1	32196581	32196581	+	Silent	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr1:32196581G>A	ENST00000373658.3	-	29	4541	c.4200C>T	c.(4198-4200)tcC>tcT	p.S1400S	BAI2_ENST00000257070.4_Silent_p.S1367S|BAI2_ENST00000398547.1_Silent_p.S1333S|BAI2_ENST00000373655.2_Silent_p.S1400S|BAI2_ENST00000527361.1_Silent_p.S1367S|BAI2_ENST00000440175.2_Silent_p.S1009S|BAI2_ENST00000398556.3_Silent_p.S1315S|BAI2_ENST00000398542.1_Silent_p.S1300S|BAI2_ENST00000398538.1_Silent_p.S1388S|BAI2_ENST00000465256.1_5'UTR	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1400					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		AGTGGTCCACGGACAGGAAGC	0.692																																						ENST00000373658.3	1.000000	0.550000	1.000000	0.760000	0.990000	0.914315	0.990000	1.000000																										0				55						c.(4198-4200)tcC>tcT		brain-specific angiogenesis inhibitor 2							25.0	33.0	30.0					1																	32196581		2203	4300	6503	SO:0001819	synonymous_variant	576	2	121212	33				g.chr1:32196581G>A	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4200C>T	chr1.hg19:g.32196581G>A		0					BAI2_ENST00000257070.4_Silent_p.S1367S|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000440175.2_Silent_p.S1009S|BAI2_ENST00000398542.1_Silent_p.S1300S|BAI2_ENST00000398556.3_Silent_p.S1315S|BAI2_ENST00000398547.1_Silent_p.S1333S|BAI2_ENST00000527361.1_Silent_p.S1367S|BAI2_ENST00000398538.1_Silent_p.S1388S|BAI2_ENST00000373655.2_Silent_p.S1400S	p.S1400S	NM_001703.2	NP_001694.2	1	2	3	2.019608	O60241	BAI2_HUMAN		29	4541	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	1	1	hg19	c.4200C>T	CCDS346.2	1																																																																																								0.109792		TCGA-FB-AAPS-01A-12D-A397-08	0.692	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	1	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	2	-3.240184	1	0.100000	NM_001703		0	12	12	0	238	237	0		1	0		0	0	46	0	0	0.999161	3.679733e-01	0	0	0	25	0	12	238
RSPO1	284654	broad.mit.edu	37	1	38079563	38079563	+	Splice_Site	SNP	C	C	T	rs202233461		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr1:38079563C>T	ENST00000401069.1	-	6	1150	c.438G>A	c.(436-438)gcG>gcA	p.A146A	RSPO1_ENST00000401070.1_Intron|RSPO1_ENST00000401068.1_Splice_Site_p.A146A|RSPO1_ENST00000373059.1_Splice_Site_p.A119A|RSPO1_ENST00000401071.2_Intron|RSPO1_ENST00000356545.2_Splice_Site_p.A146A	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	146					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTTCACATTGCGCTGGCAGGA	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20078	0.0		0.0	False		,,,				2504	0.0				GBM(122;680 2230 27822 42821)	ENST00000401069.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				12						c.(436-438)gcG>gcA		R-spondin 1		C	,,,	1,3913		0,1,1956	46.0	49.0	48.0		438,438,357,	-1.3	1.0	1		48	0,8282		0,0,4141	yes	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,intron	RSPO1	NM_001038633.3,NM_001242908.1,NM_001242909.1,NM_001242910.1	,,,	0,1,6097	TT,TC,CC		0.0,0.0255,0.0082	,,,	146/264,146/264,119/237,	38079563	1,12195	1957	4141	6098	SO:0001630	splice_region_variant	284654	5	120878	40				g.chr1:38079563C>T	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.437-1G>A	chr1.hg19:g.38079563C>T		0					RSPO1_ENST00000356545.2_Splice_Site_p.A146A|RSPO1_ENST00000401071.2_Intron|RSPO1_ENST00000401070.1_Intron|RSPO1_ENST00000373059.1_Splice_Site_p.A119A|RSPO1_ENST00000401068.1_Splice_Site_p.A146A	p.A146A	NM_001242908.1	NP_001229837.1	1	2	3	2.019608	Q2MKA7	RSPO1_HUMAN		6	1150	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Splice_Site	SNP	ENST00000401069.1	1	0	hg19	c.438G>A	CCDS41304.1	1																																																																																								0.109792		TCGA-FB-AAPS-01A-12D-A397-08	0.617	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	1	0	1	2	2	2	2	0	0	0	0	60	0	60	59	1	2	-3.017769	1	0.100000	NM_173640	Silent	0	37	37	0	293	291	1		1	0		0	0	60	0	0	1.000000	0	0	0	0	1	0	37	293
RNF220	55182	broad.mit.edu	37	1	44878230	44878230	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr1:44878230G>A	ENST00000355387.2	+	2	911	c.461G>A	c.(460-462)cGc>cAc	p.R154H	RNF220_ENST00000372247.2_Missense_Mutation_p.R154H|RNF220_ENST00000361799.2_Missense_Mutation_p.R154H			Q5VTB9	RN220_HUMAN	ring finger protein 220	154					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						CCCCACTTGCGCTTCTCAGAT	0.537																																						ENST00000355387.2	1.000000	0.570000	1.000000	0.720000	0.920000	0.881410	0.920000	1.000000																										0				29						c.(460-462)cGc>cAc		ring finger protein 220							92.0	87.0	89.0					1																	44878230		2203	4300	6503	SO:0001583	missense	55182	0	0					g.chr1:44878230G>A	AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.461G>A	chr1.hg19:g.44878230G>A	ENSP00000347548:p.Arg154His	0					RNF220_ENST00000361799.2_Missense_Mutation_p.R154H|RNF220_ENST00000372247.2_Missense_Mutation_p.R154H	p.R154H			1	2	3	2.019608	Q5VTB9	RN220_HUMAN		2	911	+			B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	ENST00000355387.2	1	1	hg19	c.461G>A	CCDS510.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405361	0.83230	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.114405	0.64402	N	0.000010	T	0.66867	0.2833	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.70011	-0.4989	9	0.87932	D	0	.	19.8074	0.96536	0.0:0.0:1.0:0.0	.	154	Q5VTB9	RN220_HUMAN	H	154	.	ENSP00000347548:R154H	R	+	2	0	0	RNF220	44650817	44650817	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.476000	0.97823	2.684000	0.91462	0.655000	0.94253	CGC	0.109792		TCGA-FB-AAPS-01A-12D-A397-08	0.537	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	1	0	1	2	2	2	2	0	0	0	0	97	0	97	97	1	2	-3.292624	1	0.100000	NM_018150		0	21	21	0	467	464	0		1	0		0	0	97	0	0	0.999997	0	0	0	0	1	0	21	467
SPTA1	6708	broad.mit.edu	37	1	158592846	158592846	+	Missense_Mutation	SNP	C	C	T	rs199993378		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr1:158592846C>T	ENST00000368147.4	-	43	6227	c.6047G>A	c.(6046-6048)cGc>cAc	p.R2016H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2016					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R2016H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGTTCCCAGCGCTTCAGCAG	0.478																																						ENST00000368147.4	1.000000	0.760000	1.000000	0.880000	0.990000	0.958069	0.990000	1.000000																										1	Substitution - Missense(1)	p.R2016H(1)	lung(1)	307						c.(6046-6048)cGc>cAc		spectrin, alpha, erythrocytic 1		C	HIS/ARG	3,3867		0,3,1932	231.0	230.0	231.0		6047	-1.5	0.6	1		231	1,8273		0,1,4136	yes	missense	SPTA1	NM_003126.2	29	0,4,6068	TT,TC,CC		0.0121,0.0775,0.0329	benign	2016/2420	158592846	4,12140	1935	4137	6072	SO:0001583	missense	6708	19	120846	49				g.chr1:158592846C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6047G>A	chr1.hg19:g.158592846C>T	ENSP00000357129:p.Arg2016His	0						p.R2016H	NM_003126.2	NP_003117.2	1	2	3	2.019297	P02549	SPTA1_HUMAN		43	6227	-	all_hematologic(112;0.0378)		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	1	1	hg19	c.6047G>A	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.288856	0.23478	7.75E-4	1.21E-4	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.40476	1.03;1.03	4.78	-1.49	0.08718	4.78	-1.49	0.08718	.	.	.	.	.	T	0.17619	0.0423	L	0.56340	1.77	0.38903	D	0.957367	P	0.47106	0.89	B	0.41723	0.365	T	0.10132	-1.0643	9	0.40728	T	0.16	.	5.6431	0.17575	0.1234:0.5367:0.0:0.3399	.	2016	P02549	SPTA1_HUMAN	H	2016;2013	ENSP00000357130:R2016H;ENSP00000357129:R2013H	ENSP00000357129:R2013H	R	-	2	0	0	SPTA1	156859470	156859470	0.999000	0.42202	0.633000	0.29310	0.020000	0.10135	0.741000	0.26202	-0.360000	0.08138	-0.136000	0.14681	CGC	0.109792		TCGA-FB-AAPS-01A-12D-A397-08	0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	1	0	1	2	16	2	2	1	0	1	1	259	0	259	259	1	2	-6.495884	1	0.100000	NM_003126		0	56	54	0	1083	1079	0		1			1	0	259	0	0	1.000000	0	0	0	0	0	0	56	1083
DGCR2	9993	broad.mit.edu	37	22	19050735	19050735	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr22:19050735C>A	ENST00000263196.7	-	5	852	c.605G>T	c.(604-606)cGc>cTc	p.R202L	DGCR2_ENST00000473832.1_5'UTR|DGCR2_ENST00000537045.1_Missense_Mutation_p.R161L|DGCR2_ENST00000545799.1_Missense_Mutation_p.R199L	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	202	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					CACCTCCCAGCGACCTTCCAA	0.587																																						ENST00000263196.7	1.000000	0.560000	1.000000	0.850000	0.990000	0.945300	0.990000	1.000000																										0				18						c.(604-606)cGc>cTc		DiGeorge syndrome critical region gene 2							116.0	90.0	99.0					22																	19050735		2203	4300	6503	SO:0001583	missense	9993	0	0					g.chr22:19050735C>A	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.605G>T	chr22.hg19:g.19050735C>A	ENSP00000263196:p.Arg202Leu	0					DGCR2_ENST00000473832.1_5'UTR|DGCR2_ENST00000545799.1_Missense_Mutation_p.R199L|DGCR2_ENST00000537045.1_Missense_Mutation_p.R161L	p.R202L	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	1	2	3	2.034923	P98153	IDD_HUMAN		5	852	-	Colorectal(54;0.0993)		A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	ENST00000263196.7	1	1	hg19	c.605G>T	CCDS33598.1	1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000644	0.54254	.	.	ENSG00000070413	ENST00000537045;ENST00000263196;ENST00000545799;ENST00000447928	T;T;T	0.18960	2.18;2.18;2.18	5.66	-2.03	0.07365	5.66	-2.03	0.07365	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.399207	0.32081	N	0.006611	T	0.16557	0.0398	L	0.35854	1.095	0.47341	D	0.999393	B;B	0.33826	0.427;0.196	B;B	0.36504	0.226;0.162	T	0.06303	-1.0834	10	0.62326	D	0.03	.	12.3598	0.55197	0.0:0.4555:0.0:0.5445	.	158;202	B7Z3T5;P98153	.;IDD_HUMAN	L	161;202;199;202	ENSP00000440062:R161L;ENSP00000263196:R202L;ENSP00000445069:R199L	ENSP00000263196:R202L	R	-	2	0	0	DGCR2	17430735	17430735	0.973000	0.33851	0.958000	0.39756	0.716000	0.41182	0.164000	0.16542	-0.258000	0.09446	-0.253000	0.11424	CGC	0.113300		TCGA-FB-AAPS-01A-12D-A397-08	0.587	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	1	0	1	2	2	2	2	0	0	0	0	35	0	35	35	1	2	-10.572680	1	0.100000	NM_005137		0	7	7	0	116	114	0		1	1		0	0	35	0	0	0.980487	7.143354e-01	0	2	0	40	0	7	116
MIOX	55586	broad.mit.edu	37	22	50926164	50926164	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr22:50926164G>A	ENST00000216075.6	+	3	244	c.170G>A	c.(169-171)aGg>aAg	p.R57K	MIOX_ENST00000395732.3_Missense_Mutation_p.R57K|MIOX_ENST00000395733.3_Missense_Mutation_p.R57K	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	57					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GACTTCGTCAGGAGCAAGGTA	0.657																																						ENST00000216075.6	1.000000	0.150000	0.840000	0.270000	0.460000	0.526200	0.460000	0.380000																										0				13						c.(169-171)aGg>aAg		myo-inositol oxygenase							87.0	63.0	71.0					22																	50926164		2203	4300	6503	SO:0001583	missense	55586	0	0					g.chr22:50926164G>A	AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.170G>A	chr22.hg19:g.50926164G>A	ENSP00000216075:p.Arg57Lys	0					MIOX_ENST00000395732.3_Missense_Mutation_p.R57K|MIOX_ENST00000395733.3_Missense_Mutation_p.R57K	p.R57K	NM_017584.5	NP_060054.4	1	2	3	2.003670	Q9UGB7	MIOX_HUMAN		3	244	+		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	ENST00000216075.6	0	1	hg19	c.170G>A	CCDS14092.1	0	.	.	.	.	.	.	.	.	.	.	G	1.319	-0.599983	0.03744	.	.	ENSG00000100253	ENST00000395733;ENST00000216075;ENST00000395732;ENST00000451761	.	.	.	4.38	1.07	0.20283	4.38	1.07	0.20283	.	0.221539	0.46145	D	0.000306	T	0.08714	0.0216	N	0.05050	-0.12	0.23023	N	0.998415	B;B;B	0.26708	0.157;0.001;0.0	B;B;B	0.15484	0.013;0.003;0.002	T	0.31138	-0.9954	9	0.02654	T	1	-12.0146	3.2253	0.06730	0.3012:0.0:0.5132:0.1857	.	57;57;57	Q9UGB7-2;A6PVH2;Q9UGB7	.;.;MIOX_HUMAN	K	57;57;57;52	.	ENSP00000216075:R57K	R	+	2	0	0	MIOX	49273030	49273030	0.973000	0.33851	0.254000	0.24359	0.539000	0.34962	2.035000	0.41155	0.107000	0.17824	0.491000	0.48974	AGG	0.106256		TCGA-FB-AAPS-01A-12D-A397-08	0.657	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316835.1	0	0	1	2	2	2	2	0	0	0	0	37	0	37	36	1	2	-5.710787	1	0.100000	NM_017584		0	4	4	0	200	196	0		1			0	0	37	0	0	0.886503	0	0	0	0	0	0	4	200
MAP4K4	9448	broad.mit.edu	37	2	102486181	102486181	+	Missense_Mutation	SNP	C	C	T	rs545368433		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr2:102486181C>T	ENST00000347699.4	+	20	2318	c.2318C>T	c.(2317-2319)aCg>aTg	p.T773M	MAP4K4_ENST00000302217.5_Missense_Mutation_p.T576M|MAP4K4_ENST00000456652.1_Missense_Mutation_p.T572M|MAP4K4_ENST00000350878.4_Missense_Mutation_p.T749M|MAP4K4_ENST00000498066.1_3'UTR|MAP4K4_ENST00000350198.4_Missense_Mutation_p.T692M|MAP4K4_ENST00000413150.2_Missense_Mutation_p.T688M|MAP4K4_ENST00000425019.1_Missense_Mutation_p.T742M|MAP4K4_ENST00000324219.4_Missense_Mutation_p.T854M	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	773					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GAGTCGGGGACGACGGATGAG	0.582																																						ENST00000347699.4	1.000000	0.370000	1.000000	0.710000	0.990000	0.901463	0.990000	1.000000																										0				41						c.(2317-2319)aCg>aTg		mitogen-activated protein kinase kinase kinase kinase 4							37.0	41.0	40.0					2																	102486181		2055	4196	6251	SO:0001583	missense	9448	0	0					g.chr2:102486181C>T	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2318C>T	chr2.hg19:g.102486181C>T	ENSP00000314363:p.Thr773Met	0					MAP4K4_ENST00000498066.1_3'UTR|MAP4K4_ENST00000456652.1_Missense_Mutation_p.T572M|MAP4K4_ENST00000350198.4_Missense_Mutation_p.T692M|MAP4K4_ENST00000425019.1_Missense_Mutation_p.T742M|MAP4K4_ENST00000324219.4_Missense_Mutation_p.T854M|MAP4K4_ENST00000350878.4_Missense_Mutation_p.T749M|MAP4K4_ENST00000302217.5_Missense_Mutation_p.T576M|MAP4K4_ENST00000413150.2_Missense_Mutation_p.T688M	p.T773M	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	1	2	3	2.009522	O95819	M4K4_HUMAN		20	2318	+			O75172|Q9NST7	Missense_Mutation	SNP	ENST00000347699.4	0	1	hg19	c.2318C>T	CCDS56130.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394360	0.83011	.	.	ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878	T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	5.19	5.19	0.71726	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.85204	0.5643	L	0.47716	1.5	0.48632	D	0.999681	D;D;P;D;D;D;D;D;D;D	0.89917	0.998;0.996;0.573;0.996;0.998;1.0;1.0;0.998;1.0;0.998	P;P;B;P;P;D;D;P;D;D	0.81914	0.858;0.764;0.051;0.764;0.881;0.98;0.995;0.881;0.956;0.938	D	0.86374	0.1725	10	0.66056	D	0.02	.	18.7238	0.91705	0.0:1.0:0.0:0.0	.	749;769;572;576;691;773;742;692;745;854	B7Z388;B7Z3V5;E7EX83;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948	.;.;.;.;.;M4K4_HUMAN;.;.;.;.	M	742;854;692;576;688;572;773;704;749	ENSP00000392830:T742M;ENSP00000313644:T854M;ENSP00000281111:T692M;ENSP00000303600:T576M;ENSP00000389752:T688M;ENSP00000387370:T572M;ENSP00000314363:T773M;ENSP00000409720:T704M;ENSP00000343658:T749M	ENSP00000303600:T576M	T	+	2	0	0	MAP4K4	101852613	101852613	1.000000	0.71417	0.957000	0.39632	0.950000	0.60333	4.574000	0.60900	2.420000	0.82092	0.563000	0.77884	ACG	0.107586		TCGA-FB-AAPS-01A-12D-A397-08	0.582	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	0	0	1	2	2	2	2	0	0	0	0	11	0	11	11	1	2	-7.425266	1	0.100000	NM_004834		0	3	3	0	49	49	0		1	0		0	0	11	0	0	0.812588	9.508411e-01	0	0	0	100	0	3	49
APOB	338	broad.mit.edu	37	2	21234547	21234547	+	Silent	SNP	G	G	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr2:21234547G>T	ENST00000233242.1	-	26	5320	c.5193C>A	c.(5191-5193)gtC>gtA	p.V1731V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1731					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCTTGACTGACCTTGAAGT	0.453																																						ENST00000233242.1	1.000000	0.720000	1.000000	0.850000	0.990000	0.944420	0.990000	1.000000																										0				305						c.(5191-5193)gtC>gtA		apolipoprotein B							222.0	209.0	213.0					2																	21234547		2203	4300	6503	SO:0001819	synonymous_variant	338	1	121412	35				g.chr2:21234547G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5193C>A	chr2.hg19:g.21234547G>T		0						p.V1731V	NM_000384.2	NP_000375	1	2	3	2.009522	P04114	APOB_HUMAN		26	5320	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	1	1	hg19	c.5193C>A	CCDS1703.1	1																																																																																								0.107586		TCGA-FB-AAPS-01A-12D-A397-08	0.453	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1	1	0	1	2	2	2	2	0	0	0	0	175	0	175	175	1	2	-5.403890	1	0.100000			0	42	41	0	824	819	0		1			0	0	175	0	0	1.000000	0	0	0	0	0	0	42	824
TTN	7273	broad.mit.edu	37	2	179444687	179444687	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr2:179444687G>A	ENST00000591111.1	-	268	62628	c.62404C>T	c.(62404-62406)Cgt>Tgt	p.R20802C	TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R13503C|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R13570C|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R13378C|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R22443C|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R19875C|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20802	Fibronectin type-III 50. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGCATCACGAGTTTCACCG	0.413																																						ENST00000591111.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999241	0.990000	1.000000																										0				1448						c.(62404-62406)Cgt>Tgt		titin							127.0	120.0	122.0					2																	179444687		1920	4132	6052	SO:0001583	missense	7273	0	0					g.chr2:179444687G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62404C>T	chr2.hg19:g.179444687G>A	ENSP00000465570:p.Arg20802Cys	0					RP11-171I2.2_ENST00000603521.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R19875C|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R13378C|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R22443C|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R13570C|TTN_ENST00000359218.5_Missense_Mutation_p.R13503C|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.R20802C			1	2	3	2.009522	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	268	62628	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.62404C>T		1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448776	0.26074	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.1	5.1	0.69264	5.1	5.1	0.69264	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41511	0.1162	N	0.04880	-0.145	0.45354	D	0.998348	D;D;D;D	0.69078	0.99;0.99;0.99;0.997	P;P;P;P	0.47299	0.543;0.543;0.543;0.543	T	0.55648	-0.8108	9	0.87932	D	0	.	18.8515	0.92232	0.0:0.0:1.0:0.0	.	13378;13503;13570;20802	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	19875;13378;13570;13503;13376	ENSP00000343764:R19875C;ENSP00000434586:R13378C;ENSP00000340554:R13570C;ENSP00000352154:R13503C	ENSP00000340554:R13570C	R	-	1	0	0	TTN	179152933	179152933	0.997000	0.39634	0.998000	0.56505	0.988000	0.76386	3.412000	0.52679	2.525000	0.85131	0.313000	0.20887	CGT	0.107586		TCGA-FB-AAPS-01A-12D-A397-08	0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	100	0	100	99	1	2	-2.879461	1	0.100000	NM_133378		0	28	28	0	337	335	0		1	0		0	0	100	0	0	1.000000	6.441772e-03	0	0	0	2	0	28	337
LHCGR	3973	broad.mit.edu	37	2	48915275	48915275	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr2:48915275C>T	ENST00000294954.7	-	11	1682	c.1661G>A	c.(1660-1662)cGa>cAa	p.R554Q	LHCGR_ENST00000405626.1_Missense_Mutation_p.R527Q|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000401907.1_Silent_p.S317S|LHCGR_ENST00000344775.3_Missense_Mutation_p.R492Q	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	554					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TTCTGGGTTTCGAACTGCAAA	0.368																																						ENST00000294954.7	1.000000	0.680000	1.000000	0.870000	0.990000	0.955799	0.990000	1.000000																										0				56						c.(1660-1662)cGa>cAa		luteinizing hormone/choriogonadotropin receptor	Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)						98.0	100.0	99.0					2																	48915275		2203	4300	6503	SO:0001583	missense	3973	5	121410	38				g.chr2:48915275C>T		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1661G>A	chr2.hg19:g.48915275C>T	ENSP00000294954:p.Arg554Gln	0					LHCGR_ENST00000344775.3_Missense_Mutation_p.R492Q|LHCGR_ENST00000401907.1_Silent_p.S317S|LHCGR_ENST00000405626.1_Missense_Mutation_p.R527Q|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_3'UTR	p.R554Q	NM_000233.3	NP_000224.2	1	2	3	2.009522	P22888	LSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)	11	1682	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	1	1	hg19	c.1661G>A	CCDS1842.1	1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255868	0.22965	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.42131	0.98;0.98;0.98	5.68	2.07	0.26955	5.68	2.07	0.26955	GPCR, rhodopsin-like superfamily (1);	0.241683	0.44285	N	0.000473	T	0.34861	0.0912	L	0.60904	1.88	0.27994	N	0.93555	B	0.14012	0.009	B	0.10450	0.005	T	0.22977	-1.0201	9	.	.	.	.	8.7189	0.34428	0.0:0.2173:0.0:0.7827	.	554	P22888	LSHR_HUMAN	Q	492;554;527	ENSP00000344301:R492Q;ENSP00000294954:R554Q;ENSP00000386033:R527Q	.	R	-	2	0	0	LHCGR	48768779	48768779	0.996000	0.38824	1.000000	0.80357	0.892000	0.51952	0.438000	0.21559	0.444000	0.26612	-1.273000	0.01405	CGA	0.107586		TCGA-FB-AAPS-01A-12D-A397-08	0.368	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	1	0	1	2	2	2	2	0	0	0	0	87	0	87	87	1	2	-5.207089	1	0.100000	NM_000233.3		0	19	19	0	338	338	0		1			0	0	87	0	0	0.999992	0	0	0	0	0	0	19	338
SPHKAP	80309	broad.mit.edu	37	2	228882781	228882781	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr2:228882781G>A	ENST00000392056.3	-	7	2835	c.2789C>T	c.(2788-2790)gCg>gTg	p.A930V	SPHKAP_ENST00000344657.5_Missense_Mutation_p.A930V	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	930	PKA-RII subunit binding domain. {ECO:0000250}.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.A930V(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TAATTCTTCCGCAAAGTCTGT	0.473																																						ENST00000392056.3	1.000000	0.080000	0.400000	0.140000	0.220000	0.327103	0.220000	0.190000																										2	Substitution - Missense(2)	p.A930V(2)	large_intestine(2)	185						c.(2788-2790)gCg>gTg		SPHK1 interactor, AKAP domain containing							192.0	174.0	180.0					2																	228882781		2203	4300	6503	SO:0001583	missense	80309	0	0					g.chr2:228882781G>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2789C>T	chr2.hg19:g.228882781G>A	ENSP00000375909:p.Ala930Val	0					SPHKAP_ENST00000344657.5_Missense_Mutation_p.A930V	p.A930V	NM_001142644.1	NP_001136116.1	1	2	3	2.009522	Q2M3C7	SPKAP_HUMAN		7	2835	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	0	1	hg19	c.2789C>T	CCDS46537.1	0	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036317	0.75617	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.27557	1.68;1.66	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.60521	0.2275	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.61058	-0.7139	10	0.87932	D	0	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	930;930	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	V	930	ENSP00000375909:A930V;ENSP00000339886:A930V	ENSP00000339886:A930V	A	-	2	0	0	SPHKAP	228591025	228591025	1.000000	0.71417	0.980000	0.43619	0.385000	0.30292	9.096000	0.94182	2.894000	0.99253	0.655000	0.94253	GCG	0.107586		TCGA-FB-AAPS-01A-12D-A397-08	0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	0	0	1	2	17	2	2	1	0	1	1	129	0	129	129	1	2	-2.073107	0	0.100000	NM_030623		0	6	6	0	613	611	0		0			1	0	129	0	0	0.016049	0	0	0	0	0	0	6	613
SETD2	29072	broad.mit.edu	37	3	47098594	47098594	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr3:47098594G>A	ENST00000409792.3	-	15	6722	c.6680C>T	c.(6679-6681)cCa>cTa	p.P2227L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2227	Low charge region.|Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGCCACATGTGGCACCACTGG	0.552			"""N, F, S, Mis"""		clear cell renal carcinoma																																	ENST00000409792.3	0.870000	0.150000	0.660000	0.260000	0.430000	0.466928	0.430000	0.390000				Rec	yes			Rec	yes		3	3p21.31	3p21.31	29072	N, F, S, Mis	SET domain containing 2				E	E			clear cell renal carcinoma		0				141						c.(6679-6681)cCa>cTa		SET domain containing 2							52.0	50.0	51.0					3																	47098594		2203	4300	6503	SO:0001583	missense	29072	0	0					g.chr3:47098594G>A	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6680C>T	chr3.hg19:g.47098594G>A	ENSP00000386759:p.Pro2227Leu	1						p.P2227L	NM_014159.6	NP_054878.5	0	1	1	1.893915	Q9BYW2	SETD2_HUMAN		15	6722	-		Acute lymphoblastic leukemia(5;0.0169)	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	0	1	hg19	c.6680C>T	CCDS2749.2	0	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607273	0.46527	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.40476	1.03	5.1	4.16	0.48862	5.1	4.16	0.48862	.	0.230823	0.30556	N	0.009361	T	0.21509	0.0518	N	0.08118	0	0.36605	D	0.874906	B;B	0.32245	0.361;0.361	B;B	0.27608	0.081;0.081	T	0.21280	-1.0250	10	0.46703	T	0.11	.	11.2548	0.49048	0.0:0.0:0.6575:0.3425	.	2227;2227	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	2227	ENSP00000386759:P2227L	ENSP00000386759:P2227L	P	-	2	0	0	SETD2	47073598	47073598	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.205000	0.51090	2.814000	0.96858	0.655000	0.94253	CCA	0.057098		TCGA-FB-AAPS-01A-12D-A397-08	0.552	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	0	0	0	2	2	2	2	0	0	0	0	43	0	43	42	1	2	-6.023894	1	0.100000	NM_014159		0	4	3	0	178	177	0		1	0		0	0	43	0	0	0.888672	2.751910e-01	0	0	0	38	0	4	178
SCD5	79966	broad.mit.edu	37	4	83719510	83719510	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr4:83719510C>T	ENST00000319540.4	-	1	500	c.181G>A	c.(181-183)Gtg>Atg	p.V61M	SCD5_ENST00000273908.4_Missense_Mutation_p.V61M|SCD5_ENST00000282709.4_Missense_Mutation_p.V61M	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	61					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				AGGGAGTACACGGCCCCCAAG	0.711																																						ENST00000319540.4	1.000000	0.130000	1.000000	0.250000	0.430000	0.517930	0.430000	0.340000																										0				13						c.(181-183)Gtg>Atg		stearoyl-CoA desaturase 5							52.0	45.0	47.0					4																	83719510		2203	4300	6503	SO:0001583	missense	79966	0	0					g.chr4:83719510C>T	AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.181G>A	chr4.hg19:g.83719510C>T	ENSP00000316329:p.Val61Met	0					SCD5_ENST00000273908.4_Missense_Mutation_p.V61M|SCD5_ENST00000282709.4_Missense_Mutation_p.V61M	p.V61M	NM_001037582.2	NP_001032671.2	1	2	3	2.020384	Q86SK9	SCD5_HUMAN		1	500	-		Colorectal(4;0.0323)|Hepatocellular(203;0.115)	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	ENST00000319540.4	0	1	hg19	c.181G>A	CCDS34024.1	0	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782740	0.70222	.	.	ENSG00000145284	ENST00000319540;ENST00000273908;ENST00000282709	T	0.49432	0.78	4.77	0.537	0.17144	4.77	0.537	0.17144	.	0.566432	0.17256	N	0.180944	T	0.56217	0.1970	L	0.51422	1.61	0.32879	D	0.510265	D;D;D	0.76494	0.999;0.998;0.963	D;D;P	0.65233	0.913;0.933;0.489	T	0.64859	-0.6308	10	0.72032	D	0.01	0.0619	10.0677	0.42315	0.1298:0.4496:0.4206:0.0	.	61;61;61	Q9BSN4;Q86SK9-2;Q86SK9	.;.;SCD5_HUMAN	M	61	ENSP00000316329:V61M	ENSP00000273908:V61M	V	-	1	0	0	SCD5	83938534	83938534	0.797000	0.28877	0.996000	0.52242	0.989000	0.77384	0.069000	0.14552	0.158000	0.19367	0.542000	0.68232	GTG	0.110232		TCGA-FB-AAPS-01A-12D-A397-08	0.711	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	0	0	1	2	2	2	2	0	0	0	0	45	0	45	45	1	2	-3.180008	1	0.100000	NM_024906		0	4	4	0	226	224	0		1	0		0	0	45	0	0	0.889083	4.524183e-02	0	0	0	15	0	4	226
SYNPO2	171024	broad.mit.edu	37	4	119978661	119978661	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr4:119978661G>A	ENST00000307142.4	+	5	3554	c.3358G>A	c.(3358-3360)Gat>Aat	p.D1120N	SYNPO2_ENST00000448416.2_Silent_p.P121P	NM_133477.2	NP_597734.2	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	0						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TAAACCAACCGATGGACTAGA	0.488																																						ENST00000307142.4	1.000000	0.750000	1.000000	0.940000	0.990000	0.973398	0.990000	1.000000																										0				64						c.(3358-3360)Gat>Aat		synaptopodin 2							100.0	95.0	97.0					4																	119978661		2203	4300	6503	SO:0001583	missense	171024	0	0					g.chr4:119978661G>A	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000307142.4:c.3358G>A	chr4.hg19:g.119978661G>A	ENSP00000306015:p.Asp1120Asn	0					SYNPO2_ENST00000448416.2_Silent_p.P121P	p.D1120N	NM_133477.2	NP_597734.2	1	2	3	2.020384	Q9UMS6	SYNP2_HUMAN		5	3554	+			B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000307142.4	1	1	hg19	c.3358G>A	CCDS34054.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.142|9.142	1.014167|1.014167	0.19277|0.19277	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142|ENST00000504178	T|.	0.07800|.	3.16|.	5.7|5.7	0.624|0.624	0.17659|0.17659	5.7|5.7	0.624|0.624	0.17659|0.17659	.|.	0.847324|.	0.09877|.	N|.	0.744219|.	T|T	0.19446|0.19446	0.0467|0.0467	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B;B|.	0.29253|.	0.154;0.239|.	B;B|.	0.14023|.	0.006;0.01|.	T|T	0.21381|0.21381	-1.0247|-1.0247	9|5	.|.	.|.	.|.	-2.2565|-2.2565	1.0387|1.0387	0.01554|0.01554	0.1675:0.2459:0.2102:0.3763|0.1675:0.2459:0.2102:0.3763	.|.	1120;1120|.	B9EG60;Q9UMS6-2|.	.;.|.	N|Q	1120|1013	ENSP00000306015:D1120N|.	.|.	D|R	+|+	1|2	0|0	0|0	SYNPO2|SYNPO2	120198109|120198109	120198109|120198109	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	0.357000|0.357000	0.20199|0.20199	0.051000|0.051000	0.15978|0.15978	0.655000|0.655000	0.94253|0.94253	GAT|CGA	0.110232		TCGA-FB-AAPS-01A-12D-A397-08	0.488	SYNPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364018.1	1	0	1	2	2	2	2	0	0	0	0	83	0	83	81	1	2	-3.317620	1	0.100000			0	22	21	0	371	371	0		1	0		0	0	83	0	0	0.999999	1.943950e-02	0	0	0	4	0	22	371
FTMT	94033	broad.mit.edu	37	5	121187809	121187809	+	Missense_Mutation	SNP	G	G	A	rs368526431		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr5:121187809G>A	ENST00000321339.1	+	1	160	c.151G>A	c.(151-153)Gca>Aca	p.A51T		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	51					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CCCCCTGGCCGCAGCCGCCTC	0.771																																						ENST00000321339.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999430	0.990000	1.000000																										0				33						c.(151-153)Gca>Aca		ferritin mitochondrial		G	THR/ALA	2,4064		0,2,2031	6.0	8.0	7.0		151	-6.9	0.0	5		7	0,7978		0,0,3989	no	missense	FTMT	NM_177478.1	58	0,2,6020	AA,AG,GG		0.0,0.0492,0.0166	benign	51/243	121187809	2,12042	2033	3989	6022	SO:0001583	missense	94033	4	117630	30				g.chr5:121187809G>A	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.151G>A	chr5.hg19:g.121187809G>A	ENSP00000313691:p.Ala51Thr	0						p.A51T	NM_177478.1	NP_803431.1	1	2	3	2.012762	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	1	160	+		all_cancers(142;0.0124)|Prostate(80;0.0322)		Missense_Mutation	SNP	ENST00000321339.1	0	1	hg19	c.151G>A	CCDS4128.1	1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.491220	0.26774	4.92E-4	0.0	ENSG00000181867	ENST00000321339	T	0.64618	-0.11	3.46	-6.93	0.01638	3.46	-6.93	0.01638	.	.	.	.	.	T	0.36963	0.0986	L	0.27053	0.805	0.09310	N	1	B	0.15141	0.012	B	0.06405	0.002	T	0.16276	-1.0408	9	0.20046	T	0.44	.	3.7474	0.08554	0.1643:0.0997:0.1353:0.6006	.	51	Q8N4E7	FTMT_HUMAN	T	51	ENSP00000313691:A51T	ENSP00000313691:A51T	A	+	1	0	0	FTMT	121215708	121215708	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.539000	0.06113	-1.953000	0.01026	0.650000	0.86243	GCA	0.108470		TCGA-FB-AAPS-01A-12D-A397-08	0.771	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	1	0	1	2	2	2	2	0	0	0	0	9	0	9	9	1	2	-17.609310	1	0.100000	NM_177478		0	9	9	0	46	46	0		1			0	0	9	0	0	0.995547	0	0	0	0	0	0	9	46
CHSY3	337876	broad.mit.edu	37	5	129520070	129520070	+	Missense_Mutation	SNP	G	G	A	rs140992502		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr5:129520070G>A	ENST00000305031.4	+	3	1593	c.1235G>A	c.(1234-1236)cGc>cAc	p.R412H	CHSY3_ENST00000507545.1_3'UTR	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	412					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ATGCTCAGCCGCAAAATTTCT	0.478																																						ENST00000305031.4	1.000000	0.130000	0.730000	0.220000	0.360000	0.451263	0.360000	0.290000																										0				28						c.(1234-1236)cGc>cAc		chondroitin sulfate synthase 3		G	HIS/ARG	0,4406		0,0,2203	98.0	89.0	92.0		1235	4.5	1.0	5	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CHSY3	NM_175856.4	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	412/883	129520070	2,13004	2203	4300	6503	SO:0001583	missense	337876	22	121412	45				g.chr5:129520070G>A	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1235G>A	chr5.hg19:g.129520070G>A	ENSP00000302629:p.Arg412His	0					CHSY3_ENST00000507545.1_3'UTR	p.R412H	NM_175856.4	NP_787052.3	1	2	3	2.012762	Q70JA7	CHSS3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	3	1593	+		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	0	1	hg19	c.1235G>A	CCDS34223.1	0	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647807	0.87958	0.0	2.33E-4	ENSG00000198108	ENST00000305031	T	0.15834	2.39	4.5	4.5	0.54988	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000016	T	0.27241	0.0668	M	0.65975	2.015	0.80722	D	1	P	0.48998	0.918	P	0.45998	0.5	T	0.03017	-1.1082	9	.	.	.	-2.8659	18.5119	0.90920	0.0:0.0:1.0:0.0	.	412	Q70JA7	CHSS3_HUMAN	H	412	ENSP00000302629:R412H	.	R	+	2	0	0	CHSY3	129547969	129547969	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.601000	0.98297	2.779000	0.95612	0.650000	0.86243	CGC	0.108470		TCGA-FB-AAPS-01A-12D-A397-08	0.478	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	0	0	1	2	2	2	2	0	0	0	0	68	0	68	68	1	2	-2.304637	0	0.100000	NM_175856		0	5	5	0	323	321	0		1	0		0	0	68	0	0	0.936998	5.515068e-02	0	0	0	20	0	5	323
FAT2	2196	broad.mit.edu	37	5	150932824	150932824	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr5:150932824G>A	ENST00000261800.5	-	5	4082	c.4070C>T	c.(4069-4071)aCg>aTg	p.T1357M		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1357	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCCATGACCGTAAAGCTGTA	0.587																																						ENST00000261800.5	1.000000	0.120000	0.710000	0.210000	0.350000	0.444216	0.350000	0.290000																										0				196						c.(4069-4071)aCg>aTg		FAT atypical cadherin 2							110.0	95.0	100.0					5																	150932824		2203	4300	6503	SO:0001583	missense	2196	3	121412	37				g.chr5:150932824G>A	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4070C>T	chr5.hg19:g.150932824G>A	ENSP00000261800:p.Thr1357Met	0						p.T1357M	NM_001447.2	NP_001438.1	1	2	3	2.012762	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	5	4082	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	0	1	hg19	c.4070C>T	CCDS4317.1	0	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942923	0.73672	.	.	ENSG00000086570	ENST00000261800	T	0.54071	0.59	5.38	4.47	0.54385	5.38	4.47	0.54385	Cadherin (3);Cadherin-like (1);	0.325213	0.25762	N	0.028464	T	0.63343	0.2503	M	0.74881	2.28	0.09310	N	0.999997	D	0.63880	0.993	P	0.55055	0.767	T	0.59257	-0.7488	10	0.66056	D	0.02	.	10.3587	0.43980	0.0:0.1453:0.704:0.1507	.	1357	Q9NYQ8	FAT2_HUMAN	M	1357	ENSP00000261800:T1357M	ENSP00000261800:T1357M	T	-	2	0	0	FAT2	150913017	150913017	0.967000	0.33354	0.795000	0.32087	0.986000	0.74619	5.130000	0.64745	2.524000	0.85096	0.561000	0.74099	ACG	0.108470		TCGA-FB-AAPS-01A-12D-A397-08	0.587	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	0	0	1	2	16	2	2	1	0	1	1	72	0	72	70	1	2	-2.411124	0	0.100000	NM_001447		0	5	5	0	331	328	0		0	0		1	0	72	0	0	0.011315	2.130984e-03	0	0	0	4	0	5	331
SNCB	6620	broad.mit.edu	37	5	176053513	176053513	+	Silent	SNP	A	A	G	rs111621148		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr5:176053513A>G	ENST00000310112.3	-	5	418	c.168T>C	c.(166-168)gcT>gcC	p.A56A	SNCB_ENST00000510387.1_Silent_p.A56A|SNCB_ENST00000393693.2_Silent_p.A56A|SNCB_ENST00000506696.1_Silent_p.A56A|MIR4281_ENST00000580852.1_RNA	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	56	4 X 11 AA tandem repeats of [EGS]-K-T-K- [EQ]-[GQ]-V-X(4).				dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)			breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGTTTTTTCAGCCACTGGAG	0.607																																						ENST00000310112.3	1.000000	0.160000	1.000000	0.300000	0.510000	0.572164	0.510000	1.000000																										0				10						c.(166-168)gcT>gcC		synuclein, beta							69.0	62.0	64.0					5																	176053513		2203	4300	6503	SO:0001819	synonymous_variant	6620	0	0					g.chr5:176053513A>G	AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.168T>C	chr5.hg19:g.176053513A>G		0					MIR4281_ENST00000580852.1_RNA|SNCB_ENST00000506696.1_Silent_p.A56A|SNCB_ENST00000393693.2_Silent_p.A56A|SNCB_ENST00000510387.1_Silent_p.A56A	p.A56A	NM_001001502.1	NP_001001502.1	1	2	3	2.012762	Q16143	SYUB_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	5	418	-	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Q6IAX7	Silent	SNP	ENST00000310112.3	0	1	hg19	c.168T>C	CCDS4406.1	0																																																																																								0.108470		TCGA-FB-AAPS-01A-12D-A397-08	0.607	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253152.2	0	0	1	2	2	2	2	0	0	0	0	38	0	38	35	1	2	-3.483445	1	0.100000	NM_001001502		0	4	4	0	186	176	0		1	0		0	0	38	0	0	0.878077	0	0	0	0	1	0	4	186
RREB1	6239	broad.mit.edu	37	6	7229268	7229269	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr6:7229268_7229269GC>TT	ENST00000349384.6	+	10	1250_1251	c.936_937GC>TT	c.(934-939)gaGCaa>gaTTaa	p.312_313EQ>D*	RREB1_ENST00000379933.3_Nonsense_Mutation_p.312_313EQ>D*|RREB1_ENST00000334984.6_Nonsense_Mutation_p.312_313EQ>D*|RREB1_ENST00000379938.2_Nonsense_Mutation_p.312_313EQ>D*	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	312					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GCATCAGCGAGCAACACCGTTT	0.52																																						ENST00000349384.6	1.000000	0.590000|0.660000	1.000000	0.830000|0.900000	0.990000	0.939806|0.961217	0.990000	1.000000																										0				58						c.(934-936)gaG>gaT|c.(937-939)Caa>Taa		ras responsive element binding protein 1																																				SO:0001587	stop_gained	6239	0	0					g.chr6:7229268G>T|g.chr6:7229269C>T	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	Exception_encountered	chr6.hg19:g.7229268_7229269delinsTT	ENSP00000305560:p.E312_Q313delinsD*	0					RREB1_ENST00000379938.2_Missense_Mutation_p.E312D|RREB1_ENST00000334984.6_Missense_Mutation_p.E312D|RREB1_ENST00000379933.3_Missense_Mutation_p.E312D|RREB1_ENST00000379938.2_Nonsense_Mutation_p.Q313*|RREB1_ENST00000334984.6_Nonsense_Mutation_p.Q313*|RREB1_ENST00000379933.3_Nonsense_Mutation_p.Q313*	p.E312D|p.Q313*	NM_001003698.3	NP_001003698.1	1	2	3	2.013121	Q92766	RREB1_HUMAN		10	1250|1251	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000349384.6	1|0	1	hg19	c.936G>T|c.937C>T	CCDS34336.1	1																									5.71	2.22|4.74	0.28083|0.60224																																												2|0			7174267|7174268														0.108470		TCGA-FB-AAPS-01A-12D-A397-08	0.520	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	1	0	1	2	2	2	2	0	0	0	0	34	0	34	34	1	2	-13.744850|-15.184970	1	0.100000			0	11|12	11|12	0	196	195	0		1	0		0	0	34	0	0	0.998428|0.999176	4.460308e-02|5.092807e-02	0	0	0	6	0	11	196
HECW1	23072	broad.mit.edu	37	7	43484438	43484438	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr7:43484438C>T	ENST00000395891.2	+	11	2272	c.1667C>T	c.(1666-1668)cCg>cTg	p.P556L	HECW1_ENST00000453890.1_Missense_Mutation_p.P556L	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	556					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CCCGAGACCCCGCGGACACAC	0.692																																						ENST00000395891.2	1.000000	0.730000	1.000000	0.950000	0.990000	0.973234	0.990000	1.000000																										0				125						c.(1666-1668)cCg>cTg		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1							40.0	49.0	46.0					7																	43484438		2091	4214	6305	SO:0001583	missense	23072	2	120980	33				g.chr7:43484438C>T	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1667C>T	chr7.hg19:g.43484438C>T	ENSP00000379228:p.Pro556Leu	0					HECW1_ENST00000453890.1_Missense_Mutation_p.P556L	p.P556L	NM_015052.3	NP_055867.3	1	2	3	2.014117	Q76N89	HECW1_HUMAN		11	2272	+			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	1	1	hg19	c.1667C>T	CCDS5469.2	1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.948443	0.92593	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.53857	0.82;0.6	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.268140	0.43747	D	0.000526	T	0.69797	0.3151	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.66288	-0.5961	10	0.33141	T	0.24	.	19.0047	0.92846	0.0:1.0:0.0:0.0	.	556;556	B4DH42;Q76N89	.;HECW1_HUMAN	L	556	ENSP00000379228:P556L;ENSP00000407774:P556L	ENSP00000265522:P556L	P	+	2	0	0	HECW1	43450963	43450963	1.000000	0.71417	0.772000	0.31596	0.952000	0.60782	7.680000	0.84062	2.475000	0.83589	0.655000	0.94253	CCG	0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.692	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	1	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	2	-2.430770	0	0.100000	NM_015052		0	17	17	0	275	271	0		1	0		0	0	54	0	0	0.999965	0	0	0	0	1	0	17	275
KRBA1	84626	broad.mit.edu	37	7	149421894	149421894	+	Silent	SNP	A	A	G			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr7:149421894A>G	ENST00000485033.2	+	8	1080	c.1080A>G	c.(1078-1080)ggA>ggG	p.G360G	KRBA1_ENST00000255992.10_Silent_p.G360G|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Silent_p.G360G			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	360										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGCCACTGGAGACACCAGAG	0.642																																						ENST00000485033.2	1.000000	0.320000	1.000000	0.630000	0.990000	0.869622	0.990000	1.000000																										0				27						c.(1078-1080)ggA>ggG		KRAB-A domain containing 1							16.0	20.0	18.0					7																	149421894		1914	4111	6025	SO:0001819	synonymous_variant	84626	1	120398	23				g.chr7:149421894A>G	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1080A>G	chr7.hg19:g.149421894A>G		0					KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000255992.10_Silent_p.G360G|KRBA1_ENST00000319551.8_Silent_p.G360G	p.G360G			1	2	3	2.014117	A5PL33	KRBA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)	8	1080	+	Melanoma(164;0.165)|Ovarian(565;0.177)		A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Silent	SNP	ENST00000485033.2	0	1	hg19	c.1080A>G		1																																																																																								0.108911		TCGA-FB-AAPS-01A-12D-A397-08	0.642	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	0	0	1	2	2	2	2	0	0	0	0	11	0	11	11	1	2	-7.435300	1	0.100000	NM_032534		0	3	3	0	59	59	0		1	0		0	0	11	0	0	0.812562	1.786021e-01	0	0	0	12	0	3	59
CSMD1	64478	broad.mit.edu	37	8	4494899	4494899	+	Silent	SNP	G	G	A	rs375942865		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr8:4494899G>A	ENST00000520002.1	-	2	822	c.267C>T	c.(265-267)taC>taT	p.Y89Y	CSMD1_ENST00000539096.1_Silent_p.Y89Y|CSMD1_ENST00000602557.1_Silent_p.Y89Y|CSMD1_ENST00000537824.1_Silent_p.Y89Y|CSMD1_ENST00000602723.1_Silent_p.Y89Y|CSMD1_ENST00000400186.3_Silent_p.Y89Y|CSMD1_ENST00000542608.1_Silent_p.Y89Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	89	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCTGTCCATCGTAAACTGATA	0.378																																						ENST00000520002.1	1.000000	0.670000	1.000000	0.840000	0.990000	0.944592	0.990000	1.000000																										0				25						c.(265-267)taC>taT		CUB and Sushi multiple domains 1		G		1,3763		0,1,1881	115.0	116.0	116.0		267	-7.2	0.0	8		116	0,8242		0,0,4121	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6002	AA,AG,GG		0.0,0.0266,0.0083		89/3565	4494899	1,12005	1882	4121	6003	SO:0001819	synonymous_variant	64478	5	120802	39				g.chr8:4494899G>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.267C>T	chr8.hg19:g.4494899G>A		0					CSMD1_ENST00000542608.1_Silent_p.Y89Y|CSMD1_ENST00000602557.1_Silent_p.Y89Y|CSMD1_ENST00000537824.1_Silent_p.Y89Y|CSMD1_ENST00000400186.3_Silent_p.Y89Y|CSMD1_ENST00000602723.1_Silent_p.Y89Y|CSMD1_ENST00000539096.1_Silent_p.Y89Y	p.Y89Y			1	2	3	2.016160	Q96PZ7	CSMD1_HUMAN		2	822	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	1	1	hg19	c.267C>T		1																																																																																								0.109352		TCGA-FB-AAPS-01A-12D-A397-08	0.378	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	1	0	1	2	2	2	2	0	0	0	0	105	0	105	105	1	2	-3.310993	1	0.100000	NM_033225		0	23	23	0	437	431	0		1			0	0	105	0	0	0.999999	0	0	0	0	0	0	23	437
SGK223	157285	broad.mit.edu	37	8	8176529	8176529	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr8:8176529C>T	ENST00000520004.1	-	6	3620	c.3356G>A	c.(3355-3357)cGc>cAc	p.R1119H	SGK223_ENST00000330777.4_Missense_Mutation_p.R1119H			Q86YV5	SG223_HUMAN		1121	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GAAGCACACGCGCCGCTCGTA	0.667																																					GBM(34;731 755 10259 33573 33867)	ENST00000520004.1	1.000000	0.730000	1.000000	0.870000	0.990000	0.956312	0.990000	1.000000																										0										c.(3355-3357)cGc>cAc									84.0	94.0	90.0					8																	8176529		2103	4209	6312	SO:0001583	missense	0	0	0					g.chr8:8176529C>T																												ENST00000520004.1:c.3356G>A	chr8.hg19:g.8176529C>T	ENSP00000428054:p.Arg1119His	0					SGK223_ENST00000330777.4_Missense_Mutation_p.R1119H	p.R1119H			1	2	3	2.020077	Q86YV5	SG223_HUMAN		6	3620	-			Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	1	1	hg19	c.3356G>A	CCDS43706.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426873	0.83667	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.65178	-0.14;-0.14	5.48	4.58	0.56647	5.48	4.58	0.56647	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053692	0.85682	D	0.000000	T	0.68531	0.3011	L	0.36672	1.1	0.44042	D	0.996772	D	0.89917	1.0	D	0.91635	0.999	T	0.69339	-0.5171	10	0.66056	D	0.02	.	10.7678	0.46303	0.0:0.8505:0.0:0.1495	.	1119	Q86YV5	SG223_HUMAN	H	1119	ENSP00000330930:R1119H;ENSP00000428054:R1119H	ENSP00000330930:R1119H	R	-	2	0	0	AC068353.1	8213939	8213939	0.883000	0.30277	1.000000	0.80357	0.979000	0.70002	1.757000	0.38400	2.750000	0.94351	0.467000	0.42956	CGC	0.110232		TCGA-FB-AAPS-01A-12D-A397-08	0.667	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1	1	0	1	2	2	2	2	0	0	0	0	146	0	146	144	1	2	-20.000000	1	0.100000			0	35	35	0	663	659	0		1	1		0	0	146	0	0	1.000000	3.507502e-01	0	3	0	21	0	35	663
MOS	4342	broad.mit.edu	37	8	57025548	57025548	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr8:57025548G>A	ENST00000311923.1	-	1	993	c.994C>T	c.(994-996)Cgg>Tgg	p.R332W		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	332	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AAAAGCAGCCGCGCGCTCGGC	0.572																																					Esophageal Squamous(124;373 2870 4778)	ENST00000311923.1	1.000000	0.380000	1.000000	0.570000	0.840000	0.806727	0.840000	1.000000																										0				22						c.(994-996)Cgg>Tgg		v-mos Moloney murine sarcoma viral oncogene homolog							21.0	24.0	23.0					8																	57025548		2203	4300	6503	SO:0001583	missense	4342	0	0					g.chr8:57025548G>A		CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.994C>T	chr8.hg19:g.57025548G>A	ENSP00000310722:p.Arg332Trp	0						p.R332W	NM_005372.1	NP_005363.1	1	2	3	2.020077	P00540	MOS_HUMAN	Epithelial(17;0.00117)|all cancers(17;0.00879)	1	993	-			Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	1	1	hg19	c.994C>T	CCDS6164.1	0	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488891	0.64074	.	.	ENSG00000172680	ENST00000311923	T	0.66995	-0.24	5.8	4.02	0.46733	5.8	4.02	0.46733	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.731480	0.03583	N	0.230552	T	0.77651	0.4162	L	0.53729	1.69	0.09310	N	1	P	0.51791	0.948	P	0.57057	0.812	T	0.59118	-0.7514	10	0.87932	D	0	.	11.5859	0.50918	0.0:0.8023:0.13:0.0677	.	332	P00540	MOS_HUMAN	W	332	ENSP00000310722:R332W	ENSP00000310722:R332W	R	-	1	2	2	MOS	57188102	57188102	0.000000	0.05858	0.002000	0.10522	0.053000	0.15095	0.330000	0.19715	0.818000	0.34468	-0.311000	0.09066	CGG	0.110232		TCGA-FB-AAPS-01A-12D-A397-08	0.572	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	0	0	1	2	2	2	2	0	0	0	0	47	0	47	47	1	2	-4.010672	1	0.100000	NM_005372		0	8	8	0	207	206	0		1			0	0	47	0	0	0.989568	0	0	0	0	0	0	8	207
RPL12	6136	broad.mit.edu	37	9	130213570	130213570	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr9:130213570C>A	ENST00000361436.5	-	1	114	c.27G>T	c.(25-27)gaG>gaT	p.E9D	RPL12_ENST00000497322.1_5'UTR|LRSAM1_ENST00000373322.1_5'Flank|LRSAM1_ENST00000373324.4_5'Flank|RPL12_ENST00000536368.1_Missense_Mutation_p.E9D|LRSAM1_ENST00000323301.4_5'Flank|SNORA65_ENST00000364432.1_RNA|LRSAM1_ENST00000300417.6_5'Flank	NM_000976.3	NP_000967.1	P30050	RL12_HUMAN	ribosomal protein L12	9					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	4						CGACTTTGATCTCGTTGGGGT	0.642																																						ENST00000361436.5	0.690000	0.150000	0.530000	0.250000	0.370000	0.397356	0.370000	0.350000																										0				4						c.(25-27)gaG>gaT		ribosomal protein L12							33.0	37.0	36.0					9																	130213570		2200	4295	6495	SO:0001583	missense	6136	0	0					g.chr9:130213570C>A		CCDS6872.1	9q34	2011-04-06			ENSG00000197958	ENSG00000197958		"""L ribosomal proteins"""	10302	protein-coding gene	gene with protein product		180475				8441690	Standard	NM_000976		Approved	L12	uc004bqy.2	P30050	OTTHUMG00000020704	ENST00000361436.5:c.27G>T	chr9.hg19:g.130213570C>A	ENSP00000354739:p.Glu9Asp	1					LRSAM1_ENST00000373324.4_5'Flank|LRSAM1_ENST00000300417.6_5'Flank|LRSAM1_ENST00000373322.1_5'Flank|LRSAM1_ENST00000323301.4_5'Flank|SNORA65_ENST00000364432.1_RNA|RPL12_ENST00000497322.1_5'UTR|RPL12_ENST00000536368.1_Missense_Mutation_p.E9D	p.E9D	NM_000976.3	NP_000967.1	0	0	0	1.896116	P30050	RL12_HUMAN		1	114	-			Q5VVV2|Q6PB27	Missense_Mutation	SNP	ENST00000361436.5	0	1	hg19	c.27G>T	CCDS6872.1	0	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697336	0.68386	.	.	ENSG00000197958	ENST00000361436;ENST00000536368	.	.	.	5.58	1.42	0.22433	5.58	1.42	0.22433	Ribosomal protein L11, N-terminal (2);	0.000000	0.85682	U	0.000000	T	0.61515	0.2353	M	0.80508	2.5	0.45318	D	0.998318	B;B	0.17038	0.02;0.002	B;B	0.25987	0.065;0.006	T	0.58364	-0.7649	9	0.51188	T	0.08	0.0134	8.795	0.34874	0.0:0.652:0.0:0.348	.	9;9	P30050-2;P30050	.;RL12_HUMAN	D	9	.	ENSP00000354739:E9D	E	-	3	2	2	RPL12	129253391	129253391	0.929000	0.31497	0.998000	0.56505	0.998000	0.95712	0.418000	0.21230	0.247000	0.21414	0.561000	0.74099	GAG	0.044586		TCGA-FB-AAPS-01A-12D-A397-08	0.642	RPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054189.1	0	0	1	2	2	2	2	0	0	0	0	78	0	78	77	1	2	-6.607434	1	0.100000			0	6	6	0	298	297	0		1	1		0	0	78	0	0	0.965028	9.999974e-01	0	12	0	2196	0	6	298
TMEM215	401498	broad.mit.edu	37	9	32784266	32784266	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr9:32784266G>A	ENST00000342743.5	+	2	450	c.85G>A	c.(85-87)Gtc>Atc	p.V29I		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	29						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CATGTTCACCGTCTCTGGGAT	0.582																																						ENST00000342743.5	1.000000	0.510000	1.000000	0.690000	0.900000	0.867744	0.900000	1.000000																										0				12						c.(85-87)Gtc>Atc		transmembrane protein 215							106.0	98.0	101.0					9																	32784266		2203	4300	6503	SO:0001583	missense	401498	0	0					g.chr9:32784266G>A		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.85G>A	chr9.hg19:g.32784266G>A	ENSP00000345468:p.Val29Ile	0						p.V29I	NM_212558.2	NP_997723.2	0	0	0	1.959414	Q68D42	TM215_HUMAN		2	450	+			Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	1	1	hg19	c.85G>A	CCDS6530.1	1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343493	0.41498	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.31	4.39	0.52855	5.31	4.39	0.52855	.	0.000000	0.64402	D	0.000011	T	0.40171	0.1106	L	0.27053	0.805	0.42899	D	0.994226	P	0.49635	0.926	B	0.40038	0.317	T	0.44847	-0.9301	9	0.87932	D	0	-24.8349	13.4943	0.61416	0.0:0.1582:0.8418:0.0	.	29	Q68D42	TM215_HUMAN	I	29	.	ENSP00000345468:V29I	V	+	1	0	0	TMEM215	32774266	32774266	1.000000	0.71417	0.869000	0.34112	0.936000	0.57629	7.480000	0.81109	1.185000	0.42971	0.462000	0.41574	GTC	0.075026		TCGA-FB-AAPS-01A-12D-A397-08	0.582	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	1	0	1	2	2	2	2	0	0	0	0	60	0	60	60	1	2	-4.719854	1	0.100000	NM_212558		0	13	13	0	261	259	0		1	0		0	0	60	0	0	0.999547	2.746822e-03	0	0	0	2	0	13	261
CERCAM	51148	broad.mit.edu	37	9	131186737	131186737	+	Missense_Mutation	SNP	C	C	T	rs143495365		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chr9:131186737C>T	ENST00000372838.4	+	5	1008	c.610C>T	c.(610-612)Cgc>Tgc	p.R204C	CERCAM_ENST00000372842.1_Missense_Mutation_p.R126C	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	204					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						GAACCGCCAGCGCCGGGGCTG	0.647																																						ENST00000372838.4	0.830000	0.380000	0.780000	0.510000	0.650000	0.645453	0.650000	0.700000																										0				20						c.(610-612)Cgc>Tgc		cerebral endothelial cell adhesion molecule		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	62.0	65.0	64.0		610	4.9	1.0	9	dbSNP_134	64	0,8600		0,0,4300	no	missense	CERCAM	NM_016174.4	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	204/596	131186737	1,13005	2203	4300	6503	SO:0001583	missense	51148	1	121412	30				g.chr9:131186737C>T	AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.610C>T	chr9.hg19:g.131186737C>T	ENSP00000361929:p.Arg204Cys	1					CERCAM_ENST00000372842.1_Missense_Mutation_p.R126C	p.R204C	NM_016174.4	NP_057258.3	0	0	0	1.896116	Q5T4B2	GT253_HUMAN		5	1008	+			A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	1	1	hg19	c.610C>T	CCDS6901.2	0	.	.	.	.	.	.	.	.	.	.	C	34	5.312852	0.95655	2.27E-4	0.0	ENSG00000167123	ENST00000372842;ENST00000420512;ENST00000372838;ENST00000413863	T;T;T	0.20738	2.05;2.05;2.05	4.9	4.9	0.64082	4.9	4.9	0.64082	.	0.119685	0.56097	D	0.000026	T	0.44540	0.1298	M	0.84326	2.69	0.80722	D	1	D	0.71674	0.998	P	0.55455	0.776	T	0.52586	-0.8556	10	0.87932	D	0	-2.5648	16.8166	0.85735	0.0:1.0:0.0:0.0	.	204	Q5T4B2	GT253_HUMAN	C	126;126;204;157	ENSP00000361933:R126C;ENSP00000416676:R126C;ENSP00000361929:R204C	ENSP00000361929:R204C	R	+	1	0	0	CERCAM	130226558	130226558	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.680000	0.54641	2.543000	0.85770	0.467000	0.42956	CGC	0.044586		TCGA-FB-AAPS-01A-12D-A397-08	0.647	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	0	0	1	2	2	2	2	0	0	0	0	68	0	68	64	1	2	-3.284561	1	0.100000	NM_016174		0	12	12	0	293	275	0		1	0		0	0	68	0	0	0.998795	9.999124e-01	0	1	0	425	0	12	293
ACSL4	2182	broad.mit.edu	37	X	108924283	108924283	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chrX:108924283C>T	ENST00000469796.2	-	6	1118	c.722G>A	c.(721-723)gGa>gAa	p.G241E	ACSL4_ENST00000348502.6_Missense_Mutation_p.G200E|ACSL4_ENST00000340800.2_Missense_Mutation_p.G241E			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	241					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	AATCTCAAATCCTTCAGGGTA	0.343																																					Pancreas(188;358 2127 38547 41466 45492)	ENST00000469796.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				22						c.(721-723)gGa>gAa		acyl-CoA synthetase long-chain family member 4	Icosapent(DB00159)|Rosiglitazone(DB00412)						131.0	118.0	122.0					X																	108924283		2203	4300	6503	SO:0001583	missense	2182	0	0					g.chrX:108924283C>T	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.722G>A	chrX.hg19:g.108924283C>T	ENSP00000419171:p.Gly241Glu						ACSL4_ENST00000348502.6_Missense_Mutation_p.G200E|ACSL4_ENST00000340800.2_Missense_Mutation_p.G241E	p.G241E			0	1	1		O60488	ACSL4_HUMAN		6	1118	-			D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	1	1	hg19	c.722G>A	CCDS14548.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050788	0.75960	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.38560	1.13;1.13;1.13	6.04	6.04	0.98038	6.04	6.04	0.98038	AMP-dependent synthetase/ligase (1);	0.257801	0.44097	D	0.000485	T	0.57666	0.2069	M	0.78223	2.4	0.58432	D	0.999997	P	0.35575	0.51	P	0.47705	0.555	T	0.61013	-0.7148	10	0.72032	D	0.01	-15.5815	13.0039	0.58692	0.0:0.9159:0.0:0.0841	.	241	O60488	ACSL4_HUMAN	E	200;241;241	ENSP00000262835:G200E;ENSP00000419171:G241E;ENSP00000339787:G241E	ENSP00000339787:G241E	G	-	2	0	0	ACSL4	108810939	108810939	0.998000	0.40836	1.000000	0.80357	0.665000	0.39181	3.776000	0.55356	2.555000	0.86185	0.513000	0.50165	GGA	0.100000		TCGA-FB-AAPS-01A-12D-A397-08	0.343	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	1	0	1	2	2	2	2	0	0	0	0	103	0	103	103	1	2	-17.487650	1	0.100000	NM_004458		0	53	52	0	457	455	1		1	0		0	0	103	0	0	1.000000	5.447140e-01	0	0	0	17	0	53	457
CXorf21	80231	broad.mit.edu	37	X	30577641	30577641	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chrX:30577641A>T	ENST00000378962.3	-	3	1154	c.832T>A	c.(832-834)Ttg>Atg	p.L278M		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	278										kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						GTTGACATCAATTGCAATAGG	0.398																																						ENST00000378962.3	1.000000	0.540000	1.000000	0.710000	0.920000	0.880822	0.920000	1.000000																										0				20						c.(832-834)Ttg>Atg		chromosome X open reading frame 21							78.0	69.0	72.0					X																	30577641		2202	4300	6502	SO:0001583	missense	80231	0	0					g.chrX:30577641A>T	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.832T>A	chrX.hg19:g.30577641A>T	ENSP00000368245:p.Leu278Met							p.L278M	NM_025159.2	NP_079435.1	0	1	1		Q9HAI6	CX021_HUMAN		3	1154	-				Missense_Mutation	SNP	ENST00000378962.3	1	1	hg19	c.832T>A	CCDS14224.1	1	.	.	.	.	.	.	.	.	.	.	A	9.213	1.031426	0.19590	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.11	1.36	0.22044	5.11	1.36	0.22044	.	0.417714	0.22387	N	0.060739	T	0.36963	0.0986	L	0.51422	1.61	0.25525	N	0.987333	P	0.50617	0.937	P	0.53809	0.735	T	0.14392	-1.0474	9	0.45353	T	0.12	-3.0314	3.1843	0.06596	0.4426:0.0:0.238:0.3193	.	278	Q9HAI6	CX021_HUMAN	M	278	.	ENSP00000368245:L278M	L	-	1	2	2	CXorf21	30487562	30487562	0.999000	0.42202	0.692000	0.30179	0.104000	0.19210	0.733000	0.26087	0.251000	0.21505	-0.509000	0.04479	TTG	0.100000		TCGA-FB-AAPS-01A-12D-A397-08	0.398	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	1	0	1	2	2	2	2	0	0	0	0	62	0	62	61	1	2	-17.092950	1	0.100000	NM_025159		0	15	15	0	310	309	0		1	0		0	0	62	0	0	0.999878	4.434276e-02	0	0	0	7	0	15	310
CNGA2	1260	broad.mit.edu	37	X	150912423	150912423	+	Missense_Mutation	SNP	G	G	A	rs374694060		TCGA-FB-AAPS-01A-12D-A397-08	TCGA-FB-AAPS-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7597a785-60fd-4969-a7bc-8db1532e2ab8	65fd8e5e-e00c-4519-a8b4-456ec71e2c34	g.chrX:150912423G>A	ENST00000329903.4	+	6	1481	c.1448G>A	c.(1447-1449)cGc>cAc	p.R483H		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	483					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					tacatttgccgcaaaggggac	0.527													G|||	1	0.000264901	0.0008	0.0	3775	,	,		16316	0.0		0.0	False		,,,				2504	0.0					ENST00000329903.4	0.510000	0.120000	0.400000	0.190000	0.270000	0.297841	0.270000	0.260000																										0				49						c.(1447-1449)cGc>cAc		cyclic nucleotide gated channel alpha 2		G	HIS/ARG	5,3830		0,4,1,1628,570	131.0	112.0	118.0		1448	4.4	1.0	X		118	0,6728		0,0,0,2428,1872	no	missense	CNGA2	NM_005140.1	29	0,4,1,4056,2442	AA,AG,A,GG,G		0.0,0.1304,0.0473	probably-damaging	483/665	150912423	5,10558	2203	4300	6503	SO:0001583	missense	1260	23	121410	47				g.chrX:150912423G>A	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1448G>A	chrX.hg19:g.150912423G>A	ENSP00000328478:p.Arg483His							p.R483H	NM_005140.1	NP_005131.1	0	1	1		Q16280	CNGA2_HUMAN		6	1481	+	Acute lymphoblastic leukemia(192;6.56e-05)		A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	0	1	hg19	c.1448G>A	CCDS14701.1	0	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205767	0.58234	0.001304	0.0	ENSG00000183862	ENST00000329903	D	0.93247	-3.19	5.27	4.41	0.53225	5.27	4.41	0.53225	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.050712	0.85682	N	0.000000	D	0.95896	0.8664	M	0.74389	2.26	0.53688	D	0.999978	D	0.89917	1.0	D	0.91635	0.999	D	0.95498	0.8575	10	0.72032	D	0.01	.	10.9848	0.47516	0.0938:0.0:0.9062:0.0	.	483	Q16280	CNGA2_HUMAN	H	483	ENSP00000328478:R483H	ENSP00000328478:R483H	R	+	2	0	0	CNGA2	150663079	150663079	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.629000	0.83207	1.005000	0.39183	-0.260000	0.10688	CGC	0.100000		TCGA-FB-AAPS-01A-12D-A397-08	0.527	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	0	0	1	2	2	2	2	0	0	0	0	85	0	85	85	1	2	-2.310244	0	0.100000	NM_005140		0	7	7	0	519	509	0		1			0	0	85	0	0	0.979362	0	0	0	0	0	0	7	519
