#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
BRCA2	675	broad.mit.edu	37	13	32937480	32937480	+	Frame_Shift_Del	DEL	A	A	-	rs80359059		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			A	-	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr13:32937480delA	ENST00000380152.3	+	18	8374	c.8141delA	c.(8140-8142)caafs	p.Q2714fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.Q2714fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2714					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GCAGATACCCAAAAAGTGGCC	0.398			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	ENST00000380152.3	0.660000	4.700000e-01	6.100000e-01	5.100000e-01	0.560000	0.567008	0.560000	0.560000			yes	Rec	yes	Hereditary breast/ovarian cancer	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	13q12	675	D, Mis, N, F, S	familial breast/ovarian cancer gene 2				"""L, E"""	L, E		breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)	breast, ovarian, pancreatic		0				183						c.(8140-8142)caafs	Homologous recombination	breast cancer 2, early onset							138.0	135.0	136.0					13																	32937480		2203	4300	6503	SO:0001589	frameshift_variant	675	0	0		Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	g.chr13:32937480delA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8141delA	chr13.hg19:g.32937480delA	ENSP00000369497:p.Gln2714fs	0	TCGA Ovarian(8;0.087)				BRCA2_ENST00000544455.1_Frame_Shift_Del_p.Q2714fs	p.Q2714fs			0	1	1	1.989277	P51587	BRCA2_HUMAN		18	8374	+		Lung SC(185;0.0262)	O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	ENST00000380152.3	1	0	hg19	c.8141delA	CCDS9344.1	0																																																																																								0.698946		TCGA-FB-AAPU-01A-31D-A40W-08	0.398	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	1	0	1		56	2	5	0		0	11	157		157	156	1	2	-2.970215	1	0.700000	NM_000059			113	127		457	454	0		1	0	1	0	1	157	978		1.000000	1.802622e-01	1	0	199	4	640	113	457
TNRC6C	57690	broad.mit.edu	37	17	76047129	76047153	+	Frame_Shift_Del	DEL	CCCCCAACAGAACTGGGCTAGCAAA	CCCCCAACAGAACTGGGCTAGCAAA	-	rs114241857|rs373111046	byFrequency	TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:76047129_76047153delCCCCCAACAGAACTGGGCTAGCAAA	ENST00000588061.1	+	5	2713_2737	c.1986_2010delCCCCCAACAGAACTGGGCTAGCAAA	c.(1984-2010)ggcccccaacagaactgggctagcaaafs	p.GPQQNWASK662fs	TNRC6C_ENST00000335749.4_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000544502.1_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000588847.1_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000301624.4_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000541771.1_Frame_Shift_Del_p.GPQQNWASK662fs			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	662	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TAAAACCTGGCCCCCAACAGAACTGGGCTAGCAAACCCCAAGACA	0.538																																						ENST00000588061.1	0.750000	2.200000e-01	6.100000e-01	3.300000e-01	0.450000	0.474433	0.450000	0.450000																										0				40						c.(1984-2010)ggcccccaacagaactgggctagcaaafs		trinucleotide repeat containing 6C																																				SO:0001589	frameshift_variant	57690	0	0					g.chr17:76047129_76047153delCCCCCAACAGAACTGGGCTAGCAAA	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1986_2010delCCCCCAACAGAACTGGGCTAGCAAA	chr17.hg19:g.76047129_76047153delCCCCCAACAGAACTGGGCTAGCAAA	ENSP00000468647:p.Gly662fs	1					TNRC6C_ENST00000335749.4_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000301624.4_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000544502.1_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000588847.1_Frame_Shift_Del_p.GPQQNWASK662fs|TNRC6C_ENST00000541771.1_Frame_Shift_Del_p.GPQQNWASK662fs	p.GPQQNWASK662fs			1	2	3	2.677864	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)	5	2713_2737	+			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Frame_Shift_Del	DEL	ENST00000588061.1	0	1	hg19	c.1986_2010delCCCCCAACAGAACTGGGCTAGCAAA	CCDS45798.1	0																																																																																								0.777778		TCGA-FB-AAPU-01A-31D-A40W-08	0.538	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	1	0	1		2	2		0		0	0	20		20	20	1	2	-15.673500	1	0.700000	NM_018996			9	27		70	86	0		1	0		0	0	20	0		0.999242	3.524145e-01		0	0	10	0	9	70
PRSS1	5644	broad.mit.edu	37	7	142459745	142459747	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			CAT	-	CAT	CAT		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr7:142459745_142459747delCAT	ENST00000311737.7	+	3	327_329	c.321_323delCAT	c.(319-324)gacatc>gac	p.I108del	PRSS1_ENST00000486171.1_In_Frame_Del_p.I122del	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	108	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TGAACAATGACATCATGTTAATC	0.547																																						ENST00000311737.7	1.000000	7.900000e-01	1	8.400000e-01	0.900000	0.912016	0.900000	0.890000																										0				38						c.(319-324)gacatc>gac		protease, serine, 1 (trypsin 1)	Aprotinin(DB06692)																																			SO:0001651	inframe_deletion	5644	0	0					g.chr7:142459745_142459747delCAT	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.321_323delCAT	chr7.hg19:g.142459748_142459750delCAT	ENSP00000308720:p.Ile108del	1					PRSS1_ENST00000486171.1_In_Frame_Del_p.I122del	p.I108del	NM_002769.4	NP_002760.1	1	2	3	2.507732	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)	3	327_329	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	In_Frame_Del	DEL	ENST00000311737.7	1	1	hg19	c.321_323delCAT	CCDS5872.1	1																																																																																								0.760383		TCGA-FB-AAPU-01A-31D-A40W-08	0.547	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2	1	0	0		49	2	9	0		0	4	140		140	126	1	2	-20.000000	1	0.700000				241	271		728	660	0		1	1	1	0	2	140	2111		1.000000	8.703207e-01	1	2	710	11	1974	241	728
ABCA1	19	broad.mit.edu	37	9	107591266	107591282	+	Frame_Shift_Del	DEL	CCAGAGGATGCTGTTGT	CCAGAGGATGCTGTTGT	-	rs144845639|rs2853579	byFrequency	TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:107591266_107591282delCCAGAGGATGCTGTTGT	ENST00000374736.3	-	15	2424_2440	c.2030_2046delACAACAGCATCCTCTGG	c.(2029-2046)gacaacagcatcctctggfs	p.DNSILW677fs	ABCA1_ENST00000494467.1_5'UTR	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	677					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ACCAGCTAAACCAGAGGATGCTGTTGTCCAGGCCCAT	0.539																																						ENST00000374736.3	0.450000	1.900000e-01	3.700000e-01	2.400000e-01	0.300000	0.311601	0.300000	0.300000																										0				115						c.(2029-2046)gacaacagcatcctctggfs		ATP-binding cassette, sub-family A (ABC1), member 1	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)																																			SO:0001589	frameshift_variant	19	0	0					g.chr9:107591266_107591282delCCAGAGGATGCTGTTGT	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2030_2046delACAACAGCATCCTCTGG	chr9.hg19:g.107591266_107591282delCCAGAGGATGCTGTTGT	ENSP00000363868:p.Asp677fs	0					ABCA1_ENST00000494467.1_5'UTR	p.DNSILW677fs	NM_005502.3	NP_005493.2	1	2	3	2.013462	O95477	ABCA1_HUMAN		15	2424_2440	-			Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Frame_Shift_Del	DEL	ENST00000374736.3	0	1	hg19	c.2030_2046delACAACAGCATCCTCTGG	CCDS6762.1	0																																																																																								0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.539	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	1	0	1		27	2		0		0	2	42		42	44	1	2	-20.000000	1	0.700000	NM_005502			21	60		179	217	0		1	0		0	0	42	0		0.659346	1.233966e-02		0	0	2	0	21	179
OR56A3	390083	broad.mit.edu	37	11	5969013	5969013	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr11:5969013T>A	ENST00000329564.6	+	1	444	c.437T>A	c.(436-438)gTc>gAc	p.V146D	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTTTGTAGTCAAGGCTGCC	0.448																																						ENST00000329564.6	1.000000	7.900000e-01	9.800000e-01	8.500000e-01	0.910000	0.918971	0.910000	1.000000																										0				41						c.(436-438)gTc>gAc		olfactory receptor, family 56, subfamily A, member 3							150.0	148.0	149.0					11																	5969013		2200	4296	6496	SO:0001583	missense	390083	0	0					g.chr11:5969013T>A		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.437T>A	chr11.hg19:g.5969013T>A	ENSP00000331572:p.Val146Asp	0					AC025016.1_ENST00000528915.1_lincRNA	p.V146D	NM_001003443.2	NP_001003443.2	0	0	0	2.001647	Q8NH54	O56A3_HUMAN		1	444	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	1	1	hg19	c.437T>A	CCDS41614.1	1	.	.	.	.	.	.	.	.	.	.	T	4.194	0.034682	0.08101	.	.	ENSG00000184478	ENST00000329564	T	0.39406	1.08	5.13	-0.302	0.12796	5.13	-0.302	0.12796	GPCR, rhodopsin-like superfamily (1);	0.277746	0.18223	U	0.147820	T	0.43809	0.1264	M	0.82056	2.57	0.18873	N	0.999989	B	0.26041	0.14	B	0.34779	0.189	T	0.48927	-0.8991	10	0.72032	D	0.01	-6.0991	5.5314	0.16987	0.1326:0.4555:0.0:0.4119	.	146	Q8NH54	O56A3_HUMAN	D	146	ENSP00000331572:V146D	ENSP00000331572:V146D	V	+	2	0	0	OR56A3	5925589	5925589	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-4.036000	0.00308	-0.225000	0.09913	-1.200000	0.01667	GTC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.448	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	1	0	1		2	2	2	0		0	0	139		139	137	1	2	-20.000000	1	0.700000	NM_001003443			147	146		309	304	1		1			0	0	139	0		1.000000	0	0	0	0	0	0	147	309
EIF3F	8665	broad.mit.edu	37	11	8014505	8014505	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr11:8014505A>C	ENST00000533626.1	+	6	1213	c.587A>C	c.(586-588)aAc>aCc	p.N196T	EIF3F_ENST00000309828.4_Missense_Mutation_p.N196T|EIF3F_ENST00000537635.1_Missense_Mutation_p.N211T|EIF3F_ENST00000449102.2_Missense_Mutation_p.N47T					eukaryotic translation initiation factor 3, subunit F											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)	13				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GAGGCCCCCAACCCCATCCAC	0.557																																						ENST00000533626.1	0.120000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.074884	0.060000	0.070000																										0				13						c.(586-588)aAc>aCc		eukaryotic translation initiation factor 3, subunit F							104.0	95.0	98.0					11																	8014505		2201	4293	6494	SO:0001583	missense	8665	0	0					g.chr11:8014505A>C	U94855, AK093511	CCDS7785.1	11p15.4	2010-03-10	2007-07-27	2007-07-27	ENSG00000175390	ENSG00000175390			3275	protein-coding gene	gene with protein product		603914	"""eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa"""	EIF3S5		9341143	Standard	NM_003754		Approved	eIF3-epsilon, eIF3-p47, eIF3f	uc001mfw.3	O00303		ENST00000533626.1:c.587A>C	chr11.hg19:g.8014505A>C	ENSP00000431800:p.Asn196Thr	0					EIF3F_ENST00000309828.4_Missense_Mutation_p.N196T|EIF3F_ENST00000449102.2_Missense_Mutation_p.N47T|EIF3F_ENST00000537635.1_Missense_Mutation_p.N211T	p.N196T			0	0	0	2.001647				6	1213	+				Missense_Mutation	SNP	ENST00000533626.1	0	1	hg19	c.587A>C	CCDS7785.1	0	.	.	.	.	.	.	.	.	.	.	A	24.9	4.586482	0.86851	.	.	ENSG00000175390	ENST00000533626;ENST00000537635;ENST00000309828;ENST00000538607;ENST00000449102	T;T;T;T	0.47869	1.39;1.39;1.39;0.83	4.97	4.97	0.65823	4.97	4.97	0.65823	.	0.042963	0.85682	D	0.000000	T	0.67221	0.2870	M	0.77406	2.37	0.80722	D	1	D	0.56521	0.976	D	0.67725	0.953	T	0.71490	-0.4577	10	0.66056	D	0.02	-18.8904	13.2394	0.59987	1.0:0.0:0.0:0.0	.	196	O00303	EIF3F_HUMAN	T	196;211;196;146;47	ENSP00000431800:N196T;ENSP00000442283:N211T;ENSP00000310040:N196T;ENSP00000396929:N47T	ENSP00000310040:N196T	N	+	2	0	0	EIF3F	7971081	7971081	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.162000	0.58177	2.158000	0.67659	0.460000	0.39030	AAC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.557	EIF3F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385713.2	0	0	1		16	23	2	1		1	1	83		83	85	1	2	-9.057876	1	0.700000	NM_003754			9	9		370	367	0		0	0		1	0	83	0		0.105819	1.390535e-01	0	19	0	578	0	9	370
AMPD3	272	broad.mit.edu	37	11	10500085	10500085	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr11:10500085C>G	ENST00000396554.3	+	3	602	c.261C>G	c.(259-261)ttC>ttG	p.F87L	AMPD3_ENST00000444303.2_Intron	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	78					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		AGAAAAGTTTCAAGATGATTC	0.537																																						ENST00000396554.3	0.120000	4.000000e-02	1.000000e-01	6.000000e-02	0.080000	0.087016	0.080000	0.080000																										0				25						c.(259-261)ttC>ttG		adenosine monophosphate deaminase 3							156.0	186.0	176.0					11																	10500085		2201	4294	6495	SO:0001583	missense	272	1	121410	40				g.chr11:10500085C>G	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.261C>G	chr11.hg19:g.10500085C>G	ENSP00000379802:p.Phe87Leu	0					AMPD3_ENST00000444303.2_Intron	p.F87L	NM_000480.2	NP_000471.1	0	0	0	2.001647	Q01432	AMPD3_HUMAN		3	602	+			A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	1	1	hg19	c.261C>G	CCDS7802.1	0	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538677	0.45176	.	.	ENSG00000133805	ENST00000532250;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66	5.6	3.69	0.42338	5.6	3.69	0.42338	.	0.092497	0.85682	D	0.000000	T	0.36441	0.0967	L	0.47716	1.5	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.002	T	0.10917	-1.0609	10	0.18276	T	0.48	-21.7032	8.8973	0.35472	0.0:0.7682:0.0:0.2318	.	85;78;87	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	L	78;87;78;78;85;78	ENSP00000432707:F78L;ENSP00000379802:F87L;ENSP00000433284:F78L;ENSP00000379801:F78L;ENSP00000436987:F85L;ENSP00000431648:F78L	ENSP00000379801:F78L	F	+	3	2	2	AMPD3	10456661	10456661	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.165000	0.31822	0.690000	0.31570	0.643000	0.83706	TTC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.537	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	0	0	1		2	2	2	0		0	0	271		271	269	1	2	-3.058579	1	0.700000	NM_000480			33	33		1081	1065	0		1	0		0	0	271	0		1.000000	8.915581e-03	0	1	0	4	0	33	1081
KCNC1	3746	broad.mit.edu	37	11	17794037	17794037	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr11:17794037C>A	ENST00000379472.3	+	2	1426	c.1396C>A	c.(1396-1398)Ctg>Atg	p.L466M	KCNC1_ENST00000265969.6_Missense_Mutation_p.L466M	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	466					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	GCCACCGCAGCTGGGATCTCC	0.448																																						ENST00000379472.3	1.000000	7.900000e-01	1	8.700000e-01	0.950000	0.946332	0.950000	1.000000																										0				33						c.(1396-1398)Ctg>Atg		potassium voltage-gated channel, Shaw-related subfamily, member 1	Dalfampridine(DB06637)						51.0	59.0	56.0					11																	17794037		2200	4293	6493	SO:0001583	missense	3746	0	0					g.chr11:17794037C>A	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.1396C>A	chr11.hg19:g.17794037C>A	ENSP00000368785:p.Leu466Met	0					KCNC1_ENST00000265969.6_Missense_Mutation_p.L466M	p.L466M	NM_004976.4	NP_004967.1	0	0	0	2.001647	P48547	KCNC1_HUMAN		2	1426	+			K4DI87	Missense_Mutation	SNP	ENST00000379472.3	1	1	hg19	c.1396C>A	CCDS7827.1	1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639495	0.29157	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.97279	-4.32;-4.3	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.155348	0.45606	D	0.000355	D	0.96978	0.9013	L	0.39020	1.185	0.49915	D	0.999838	B;D	0.60160	0.116;0.987	B;P	0.61070	0.062;0.883	D	0.96559	0.9414	10	0.35671	T	0.21	.	18.8514	0.92232	0.0:1.0:0.0:0.0	.	466;466	Q3KNS8;P48547	.;KCNC1_HUMAN	M	466	ENSP00000265969:L466M;ENSP00000368785:L466M	ENSP00000265969:L466M	L	+	1	2	2	KCNC1	17750613	17750613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.999000	0.70665	2.445000	0.82738	0.561000	0.74099	CTG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.448	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	1	0	1		2	2	2	0		0	0	75		75	75	1	2	-20.000000	1	0.700000	NM_004976			88	85		173	170	1		1			0	0	75	0		1.000000	0	0	0	0	0	0	88	173
UCP3	7352	broad.mit.edu	37	11	73718034	73718034	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr11:73718034C>T	ENST00000314032.4	-	2	606	c.54G>A	c.(52-54)ctG>ctA	p.L18L	UCP3_ENST00000426995.2_Silent_p.L18L|UCP3_ENST00000348534.4_Silent_p.L18L	NM_003356.3	NP_003347.1	P55916	UCP3_HUMAN	uncoupling protein 3 (mitochondrial, proton carrier)	18					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to hormone stimulus (GO:0032870)|fatty acid metabolic process (GO:0006631)|lipid metabolic process (GO:0006629)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to activity (GO:0014823)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12	Breast(11;2.08e-05)					TGCCTGCCCCCAGGAACTTCA	0.597																																						ENST00000314032.4	1.000000	7.200000e-01	1	8.300000e-01	0.940000	0.927447	0.940000	1.000000																										0				12						c.(52-54)ctG>ctA		uncoupling protein 3 (mitochondrial, proton carrier)							100.0	76.0	84.0					11																	73718034		2200	4293	6493	SO:0001819	synonymous_variant	7352	0	0					g.chr11:73718034C>T	AF001787	CCDS8229.1, CCDS44677.1	11q13.4	2013-05-22				ENSG00000175564		"""Solute carriers"""	12519	protein-coding gene	gene with protein product		602044				9480760, 9196039	Standard	NM_003356		Approved	SLC25A9	uc001our.3	P55916		ENST00000314032.4:c.54G>A	chr11.hg19:g.73718034C>T		0					UCP3_ENST00000348534.4_Silent_p.L18L|UCP3_ENST00000426995.2_Silent_p.L18L	p.L18L	NM_003356.3	NP_003347.1	0	0	0	1.997612	P55916	UCP3_HUMAN		2	606	-	Breast(11;2.08e-05)		O60475|Q96HL3	Silent	SNP	ENST00000314032.4	1	1	hg19	c.54G>A	CCDS8229.1	1																																																																																								0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.597	UCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398200.1	1	0	1		2	2	2	0		0	0	28		28	26	1	2	-20.000000	1	0.700000	NM_003356			42	42		84	83	1		1			0	0	28	0		1.000000	0	0	0	0	0	0	42	84
BIRC2	329	broad.mit.edu	37	11	102221640	102221640	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr11:102221640G>C	ENST00000227758.2	+	3	2360	c.961G>C	c.(961-963)Gat>Cat	p.D321H	BIRC2_ENST00000532672.1_Missense_Mutation_p.D300H|BIRC2_ENST00000530675.1_Missense_Mutation_p.D272H|BIRC2_ENST00000527910.1_3'UTR	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	321					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		ATCTGGAGATGATCCATGGGT	0.383																																						ENST00000227758.2	0.080000	1.000000e-02	6.000000e-02	2.000000e-02	0.040000	0.049344	0.040000	0.040000																										0				26						c.(961-963)Gat>Cat		baculoviral IAP repeat containing 2							330.0	311.0	317.0					11																	102221640		2203	4299	6502	SO:0001583	missense	329	0	0					g.chr11:102221640G>C	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.961G>C	chr11.hg19:g.102221640G>C	ENSP00000227758:p.Asp321His	0					BIRC2_ENST00000532672.1_Missense_Mutation_p.D300H|BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000530675.1_Missense_Mutation_p.D272H	p.D321H	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	0	0	0	1.997612	Q13490	BIRC2_HUMAN	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	3	2360	+	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	0	1	hg19	c.961G>C	CCDS8316.1	0	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175075	0.78564	.	.	ENSG00000110330	ENST00000530675;ENST00000227758;ENST00000541741;ENST00000532672	T;T;T	0.05786	3.39;3.39;3.39	5.86	5.86	0.93980	5.86	5.86	0.93980	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52238	-0.8602	10	0.87932	D	0	-17.6801	20.2019	0.98263	0.0:0.0:1.0:0.0	.	321	Q13490	BIRC2_HUMAN	H	272;321;321;300	ENSP00000431723:D272H;ENSP00000227758:D321H;ENSP00000434979:D300H	ENSP00000227758:D321H	D	+	1	0	0	BIRC2	101726850	101726850	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.428000	0.73383	2.776000	0.95493	0.655000	0.94253	GAT	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.383	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	0	0	1		2	2	2	0		0	0	163		163	161	1	2	-2.584069	1	0.700000	NM_001166			11	11		683	668	0		1	1		0	0	163	0		0.998132	5.249592e-01	0	3	0	102	0	11	683
RAD52	5893	broad.mit.edu	37	12	1023204	1023204	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr12:1023204G>C	ENST00000358495.3	-	11	1189	c.1051C>G	c.(1051-1053)Cca>Gca	p.P351A	RAD52_ENST00000535376.1_5'UTR|RAD52_ENST00000539046.1_Missense_Mutation_p.P274A|RAD52_ENST00000430095.2_Missense_Mutation_p.P351A	NM_134424.2	NP_602296.2	P43351	RAD52_HUMAN	RAD52 homolog (S. cerevisiae)	351					DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			GTCTGGGCTGGGTCTGCTCTA	0.527								Homologous recombination																														ENST00000358495.3	1.000000	5.000000e-02	1	8.000000e-02	0.120000	0.329215	0.120000	0.120000																										0				19						c.(1051-1053)Cca>Gca	Homologous recombination	RAD52 homolog (S. cerevisiae)							142.0	132.0	135.0					12																	1023204		1987	4151	6138	SO:0001583	missense	5893	0	0					g.chr12:1023204G>C		CCDS8507.2	12p13-p12.2	2008-08-05	2001-11-28		ENSG00000002016	ENSG00000002016			9824	protein-coding gene	gene with protein product		600392	"""RAD52 (S. cerevisiae) homolog"""			7774919, 18313388	Standard	XM_005253721		Approved		uc001qis.1	P43351	OTTHUMG00000090361	ENST00000358495.3:c.1051C>G	chr12.hg19:g.1023204G>C	ENSP00000351284:p.Pro351Ala	1					RAD52_ENST00000535376.1_5'UTR|RAD52_ENST00000430095.2_Missense_Mutation_p.P351A|RAD52_ENST00000539046.1_Missense_Mutation_p.P274A	p.P351A	NM_134424.2	NP_602296.2	1	3	4	2.833998	P43351	RAD52_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)	11	1189	-	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		Q13205|Q9Y5T7|Q9Y5T8|Q9Y5T9	Missense_Mutation	SNP	ENST00000358495.3	0	1	hg19	c.1051C>G	CCDS8507.2	0	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438716	0.25900	.	.	ENSG00000002016	ENST00000358495;ENST00000430095;ENST00000539046	T;T;T	0.36878	1.65;1.65;1.23	5.11	1.13	0.20643	5.11	1.13	0.20643	.	0.341611	0.34245	N	0.004125	T	0.28001	0.0690	L	0.52364	1.645	0.19300	N	0.999976	B	0.09022	0.002	B	0.08055	0.003	T	0.23332	-1.0191	10	0.59425	D	0.04	-14.8336	6.5135	0.22234	0.163:0.2837:0.5532:0.0	.	351	P43351	RAD52_HUMAN	A	351;351;274	ENSP00000351284:P351A;ENSP00000387901:P351A;ENSP00000445245:P274A	ENSP00000351284:P351A	P	-	1	0	0	RAD52	893465	893465	0.000000	0.05858	0.014000	0.15608	0.007000	0.05969	-0.129000	0.10515	0.378000	0.24764	0.561000	0.74099	CCA	0.786629		TCGA-FB-AAPU-01A-31D-A40W-08	0.527	RAD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206733.2	0	0	1		2	2	2	0		0	0	73		73	72	1	2	-2.988197	1	0.700000	NM_134424			10	9		350	346	0		1	0		0	0	73	0		0.996758	1.466164e-01	0	0	0	22	0	10	350
TULP3	7289	broad.mit.edu	37	12	3042674	3042674	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr12:3042674G>A	ENST00000448120.2	+	7	838	c.787G>A	c.(787-789)Gaa>Aaa	p.E263K	TULP3_ENST00000397132.2_Missense_Mutation_p.E263K	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	263					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TCGTGAAGGAGAAAGTTATGT	0.398																																						ENST00000448120.2	1.000000	6.900000e-01	9.900000e-01	7.800000e-01	0.880000	0.884371	0.880000	1.000000																										0				22						c.(787-789)Gaa>Aaa		tubby like protein 3							130.0	118.0	122.0					12																	3042674		2203	4300	6503	SO:0001583	missense	7289	0	0					g.chr12:3042674G>A	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.787G>A	chr12.hg19:g.3042674G>A	ENSP00000410051:p.Glu263Lys	0					TULP3_ENST00000397132.2_Missense_Mutation_p.E263K	p.E263K	NM_003324.4	NP_003315.2	0	0	0	1.997446	O75386	TULP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)	7	838	+			B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	1	1	hg19	c.787G>A	CCDS8519.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082869	0.76642	.	.	ENSG00000078246	ENST00000228245;ENST00000542730;ENST00000448120;ENST00000397132	D;D	0.85702	-2.02;-2.02	5.3	3.42	0.39159	5.3	3.42	0.39159	Tubby, C-terminal (4);	0.254970	0.46442	D	0.000292	D	0.88775	0.6528	M	0.72479	2.2	0.50632	D	0.999881	P;P;D	0.59357	0.755;0.868;0.985	P;P;P	0.59288	0.752;0.854;0.855	D	0.87634	0.2518	10	0.72032	D	0.01	-0.7952	9.1654	0.37048	0.0765:0.0:0.7778:0.1457	.	120;263;263	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	K	263;120;263;263	ENSP00000410051:E263K;ENSP00000380321:E263K	ENSP00000228245:E263K	E	+	1	0	0	TULP3	2912935	2912935	1.000000	0.71417	0.878000	0.34440	0.654000	0.38779	7.869000	0.87170	0.573000	0.29400	0.561000	0.74099	GAA	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.398	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	1	0	1		2	2	2	0		0	0	44		44	44	1	2	-20.000000	1	0.700000	NM_003324			51	51		113	110	1		1	1		0	0	44	0		1.000000	9.996761e-01	0	15	0	16	0	51	113
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	7.600000e-01	1	8.700000e-01	0.980000	0.950762	0.980000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	2	3	2.011295	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	48		48	48	1	2	-20.000000	1	0.700000	NM_033360			47	47		89	89	1		1	1	1	0	0	48	642		1.000000	1	1	45	90	31	246	47	89
CABP1	9478	broad.mit.edu	37	12	121098645	121098645	+	Splice_Site	SNP	T	T	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr12:121098645T>C	ENST00000316803.3	+	4	1073		c.e4+2		CABP1_ENST00000351200.2_Splice_Site|CABP1_ENST00000453000.1_Splice_Site|CABP1_ENST00000288616.3_Splice_Site	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTCCGAGAGGTAACGGACAGA	0.498																																						ENST00000316803.3	0.290000	1.300000e-01	2.500000e-01	1.600000e-01	0.200000	0.211182	0.200000	0.200000																										0				9						c.e4+2		calcium binding protein 1							113.0	110.0	111.0					12																	121098645		2203	4300	6503	SO:0001630	splice_region_variant	9478	0	0					g.chr12:121098645T>C	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.939+2T>C	chr12.hg19:g.121098645T>C		0					CABP1_ENST00000453000.1_Splice_Site|CABP1_ENST00000351200.2_Splice_Site|CABP1_ENST00000288616.3_Splice_Site		NM_001033677.1	NP_001028849.1	0	0	0	1.987351	Q9NZU7	CABP1_HUMAN		4	1073	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		O95663|Q8N6H5|Q9NZU8	Splice_Site	SNP	ENST00000316803.3	1	1	hg19		CCDS31913.1	0	.	.	.	.	.	.	.	.	.	.	T	16.63	3.177845	0.57692	.	.	ENSG00000157782	ENST00000316803;ENST00000288616;ENST00000351200;ENST00000453000	.	.	.	5.25	4.11	0.48088	5.25	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0835	0.25244	0.1314:0.0726:0.0:0.796	.	.	.	.	.	-1	.	.	.	+	.	.	.	CABP1	119583028	119583028	0.809000	0.29036	0.875000	0.34327	0.825000	0.46686	0.594000	0.24014	0.850000	0.35239	0.528000	0.53228	.	0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.498	CABP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345822.1	1	0	1		2	2	2	0		0	0	102		102	101	1	2	-20.000000	1	0.700000	NM_001033677	Intron		23	23		297	294	0		1			0	0	102	0		0.999999	0	0	0	0	0	0	23	297
OXGR1	27199	broad.mit.edu	37	13	97639242	97639242	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr13:97639242G>T	ENST00000298440.1	-	4	1015	c.772C>A	c.(772-774)Cat>Aat	p.H258N	OXGR1_ENST00000543457.1_Missense_Mutation_p.H258N	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	258					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			CTCAAGATATGGAAGGGTAAA	0.438																																						ENST00000298440.1	1.000000	2.000000e-02	1	4.000000e-02	0.070000	0.228548	0.070000	0.070000																										0				15						c.(772-774)Cat>Aat		oxoglutarate (alpha-ketoglutarate) receptor 1							110.0	106.0	107.0					13																	97639242		2203	4300	6503	SO:0001583	missense	27199	0	0					g.chr13:97639242G>T	AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.772C>A	chr13.hg19:g.97639242G>T	ENSP00000298440:p.His258Asn	1					OXGR1_ENST00000543457.1_Missense_Mutation_p.H258N	p.H258N	NM_080818.3	NP_543008.3	1	2	3	2.101185	Q96P68	OXGR1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.186)	4	1015	-	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		Q5T5A7|Q86TL1	Missense_Mutation	SNP	ENST00000298440.1	0	1	hg19	c.772C>A	CCDS9482.1	0	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617808	0.66787	.	.	ENSG00000165621	ENST00000298440;ENST00000543457	T;T	0.38077	1.16;1.16	5.83	5.83	0.93111	5.83	5.83	0.93111	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.47911	0.1471	L	0.42581	1.335	0.39180	D	0.962769	D	0.89917	1.0	D	0.91635	0.999	T	0.22347	-1.0219	10	0.06757	T	0.87	.	15.3005	0.73945	0.0:0.0:0.8601:0.1399	.	258	Q96P68	OXGR1_HUMAN	N	258	ENSP00000298440:H258N;ENSP00000438800:H258N	ENSP00000298440:H258N	H	-	1	0	0	OXGR1	96437243	96437243	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	6.455000	0.73497	2.937000	0.99478	0.650000	0.86243	CAT	0.721448		TCGA-FB-AAPU-01A-31D-A40W-08	0.438	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045521.3	0	0	1		2	2	2	0		0	0	69		69	68	1	2	-3.473646	1	0.700000	NM_080818			6	6		268	263	0		1			0	0	69	0		0.963408	0	0	0	0	0	0	6	268
POTEG	404785	broad.mit.edu	37	14	19566012	19566012	+	Splice_Site	SNP	A	A	C	rs542455346	byFrequency	TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr14:19566012A>C	ENST00000409832.3	+	6	1108	c.1056A>C	c.(1054-1056)gtA>gtC	p.V352V	CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	352										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TTATACATAGAATTTGCCAGT	0.269													A|||	2	0.000399361	0.0	0.0	5008	,	,		35095	0.0		0.0	False		,,,				2504	0.002					ENST00000409832.3	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.031733	0.020000	0.030000																										0				47						c.(1054-1056)gtA>gtC		POTE ankyrin domain family, member G							38.0	47.0	44.0					14																	19566012		1464	2606	4070	SO:0001630	splice_region_variant	404785	5	119882	26				g.chr14:19566012A>C		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1056-1A>C	chr14.hg19:g.19566012A>C		1					CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	p.V352V	NM_001005356.2	NP_001005356.1	0	0	0	1.422466	Q6S5H5	POTEG_HUMAN		6	1108	+			A1L153|A6NMI9|Q6S5H6|Q6S8J2	Splice_Site	SNP	ENST00000409832.3	0	1	hg19	c.1056A>C	CCDS32018.1	0																																																																																								0.579243		TCGA-FB-AAPU-01A-31D-A40W-08	0.269	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	0	0	0		2	2	2	0		0	0	114		114	123	1	2	-5.541767	1	0.700000	NM_001005356	Silent		4	1		313	158	0		0			0	0	114	0		0.650224	0	0	0	0	0	0	4	313
MAP4K5	11183	broad.mit.edu	37	14	50911762	50911762	+	Missense_Mutation	SNP	T	T	C	rs55815015	byFrequency	TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr14:50911762T>C	ENST00000013125.4	-	18	1654	c.1336A>G	c.(1336-1338)Att>Gtt	p.I446V		NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase kinase 5	446			I -> V (in dbSNP:rs55815015). {ECO:0000269|PubMed:17344846}.		activation of JUN kinase activity (GO:0007257)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_epithelial(31;0.000415)|Breast(41;0.0102)					GCCATACCAATAGAAGAAGTC	0.413													T|||	9	0.00179712	0.0	0.0	5008	,	,		16081	0.0089		0.0	False		,,,				2504	0.0					ENST00000013125.4	0.380000	1.200000e-01	3.100000e-01	1.700000e-01	0.230000	0.244166	0.230000	0.230000																										0				15						c.(1336-1338)Att>Gtt		mitogen-activated protein kinase kinase kinase kinase 5							87.0	81.0	83.0					14																	50911762		1850	4093	5943	SO:0001583	missense	11183	0	0					g.chr14:50911762T>C	U77129		14q11.2-q21	2011-06-09				ENSG00000012983		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6867	protein-coding gene	gene with protein product	"""germinal center kinase-related"""	604923				9038372, 8274451	Standard	NM_198794		Approved	KHS1, GCKR, KHS	uc001wyb.3	Q9Y4K4		ENST00000013125.4:c.1336A>G	chr14.hg19:g.50911762T>C	ENSP00000013125:p.Ile446Val	0						p.I446V	NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	0	0	0	1.985127	Q9Y4K4	M4K5_HUMAN		18	1654	-	all_epithelial(31;0.000415)|Breast(41;0.0102)		Q8IYF6	Missense_Mutation	SNP	ENST00000013125.4	1	1	hg19	c.1336A>G		0	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	T	8.406	0.843090	0.16963	.	.	ENSG00000012983	ENST00000013125	T	0.13657	2.57	5.38	-0.756	0.11057	5.38	-0.756	0.11057	Protein kinase-like domain (1);	0.528155	0.20244	N	0.096221	T	0.03095	0.0091	N	0.08118	0	0.36535	D	0.870936	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.09377	0.004;0.004;0.004	T	0.41305	-0.9516	10	0.15952	T	0.53	.	4.6228	0.12463	0.1045:0.0688:0.2378:0.5889	rs55815015	120;446;446	B3KWC4;B2R928;Q9Y4K4	.;.;M4K5_HUMAN	V	446	ENSP00000013125:I446V	ENSP00000013125:I446V	I	-	1	0	0	MAP4K5	49981512	49981512	0.750000	0.28316	0.991000	0.47740	0.887000	0.51463	-0.221000	0.09202	-0.008000	0.14320	-0.323000	0.08544	ATT	0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.413	MAP4K5-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410880.1	1	0	1		2	2	2	0		0	0	44		44	44	1	2	-6.780243	1	0.700000	NM_006575			11	11		126	123	0		1	1		0	0	44	0		0.998366	8.612261e-01	0	7	0	36	0	11	126
BDKRB2	624	broad.mit.edu	37	14	96703485	96703485	+	Missense_Mutation	SNP	G	G	A	rs200131401		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr14:96703485G>A	ENST00000306005.3	+	2	237	c.41G>A	c.(40-42)cGt>cAt	p.R14H	BDKRB2_ENST00000539359.1_5'UTR|BDKRB2_ENST00000542454.2_5'UTR|BDKRB2_ENST00000554311.1_Missense_Mutation_p.R14H|RP11-404P21.8_ENST00000553811.1_Missense_Mutation_p.R14H	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	14			R -> C (in dbSNP:rs1046248). {ECO:0000269|PubMed:7779090, ECO:0000269|Ref.8}.		arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	CTGTCTGTTCGTGAGGACTCC	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21667	0.0		0.0	False		,,,				2504	0.0					ENST00000306005.3	0.120000	2.000000e-02	9.000000e-02	3.000000e-02	0.060000	0.067943	0.060000	0.060000																										0				24						c.(40-42)cGt>cAt		bradykinin receptor B2	Icatibant(DB06196)						196.0	157.0	170.0					14																	96703485		2203	4300	6503	SO:0001583	missense	624	1	121412	40				g.chr14:96703485G>A	S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.41G>A	chr14.hg19:g.96703485G>A	ENSP00000307713:p.Arg14His	1					BDKRB2_ENST00000539359.1_5'UTR|BDKRB2_ENST00000542454.2_5'UTR|RP11-404P21.8_ENST00000553811.1_Missense_Mutation_p.R14H|BDKRB2_ENST00000554311.1_Missense_Mutation_p.R14H	p.R14H	NM_000623.3	NP_000614.1	0	1	1	1.365525	P30411	BKRB2_HUMAN		2	237	+		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		Missense_Mutation	SNP	ENST00000306005.3	1	1	hg19	c.41G>A	CCDS9942.1	0	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247970	0.39697	.	.	ENSG00000168398;ENSG00000168398;ENSG00000258691	ENST00000554311;ENST00000306005;ENST00000553811	T;T;T	0.71934	-0.61;-0.61;1.71	3.71	-2.22	0.06952	3.71	-2.22	0.06952	.	2.399830	0.01945	N	0.042183	T	0.41050	0.1142	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41787	-0.9489	10	0.05351	T	0.99	.	0.5426	0.00648	0.3331:0.1884:0.2948:0.1837	.	14	P30411	BKRB2_HUMAN	H	14	ENSP00000450482:R14H;ENSP00000307713:R14H;ENSP00000450984:R14H	ENSP00000307713:R14H	R	+	2	0	0	RP11-404P21.8;BDKRB2	95773238	95773238	0.019000	0.18553	0.000000	0.03702	0.002000	0.02628	-0.001000	0.12947	-0.415000	0.07484	-1.880000	0.00545	CGT	0.540933		TCGA-FB-AAPU-01A-31D-A40W-08	0.527	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1	0	0	1		11	3	2	1		1	1	80		80	80	1	2	-3.120890	1	0.700000				7	7		210	209	0		0	0		1	0	80	0		0.229490	6.409125e-02	0	1	0	23	0	7	210
CPEB1	64506	broad.mit.edu	37	15	83215935	83215935	+	Missense_Mutation	SNP	G	G	T	rs374011661		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr15:83215935G>T	ENST00000562019.1	-	10	1783	c.1467C>A	c.(1465-1467)agC>agA	p.S489R	CPEB1_ENST00000568757.1_Missense_Mutation_p.S409R|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000398591.2_Missense_Mutation_p.S414R|CPEB1_ENST00000423133.2_Missense_Mutation_p.S409R|CPEB1_ENST00000398592.2_Missense_Mutation_p.S258R|CPEB1_ENST00000261723.6_Missense_Mutation_p.S487R|CPEB1_ENST00000564522.1_Missense_Mutation_p.S409R|CPEB1_ENST00000568128.1_Missense_Mutation_p.S484R|CPEB1_ENST00000450751.2_Missense_Mutation_p.S409R|CPEB1_ENST00000563800.1_Missense_Mutation_p.S511R|RP11-152F13.10_ENST00000562833.1_Missense_Mutation_p.A219E			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	489	Necessary for stress granule assembly and correct localization in dcp1 bodies.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			CAAAAGCAGCGCTGACTGCTT	0.463																																						ENST00000562019.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				28						c.(1465-1467)agC>agA		cytoplasmic polyadenylation element binding protein 1							92.0	87.0	89.0					15																	83215935		1918	4146	6064	SO:0001583	missense	64506	0	0					g.chr15:83215935G>T	AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.1467C>A	chr15.hg19:g.83215935G>T	ENSP00000457836:p.Ser489Arg	1					RP11-152F13.10_ENST00000562833.1_Missense_Mutation_p.A219E|CPEB1_ENST00000563800.1_Missense_Mutation_p.S511R|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000564522.1_Missense_Mutation_p.S409R|CPEB1_ENST00000398591.2_Missense_Mutation_p.S414R|CPEB1_ENST00000568128.1_Missense_Mutation_p.S484R|CPEB1_ENST00000568757.1_Missense_Mutation_p.S409R|CPEB1_ENST00000261723.6_Missense_Mutation_p.S487R|CPEB1_ENST00000398592.2_Missense_Mutation_p.S258R|CPEB1_ENST00000450751.2_Missense_Mutation_p.S409R|CPEB1_ENST00000423133.2_Missense_Mutation_p.S409R	p.S489R			1	3	4	3.164811	Q9BZB8	CPEB1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)	10	1783	-			B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	ENST00000562019.1	1	1	hg19	c.1467C>A		1	.	.	.	.	.	.	.	.	.	.	g	14.03	2.412804	0.42817	.	.	ENSG00000214575	ENST00000450751;ENST00000398593;ENST00000423133;ENST00000398591;ENST00000261723;ENST00000398592	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.18	-2.21	0.06973	5.18	-2.21	0.06973	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.284954	0.37348	U	0.002129	T	0.10723	0.0262	N	0.14661	0.345	0.44736	D	0.997731	B;B;B;B	0.25351	0.124;0.024;0.021;0.024	B;B;B;B	0.20184	0.015;0.01;0.028;0.01	T	0.08493	-1.0719	10	0.54805	T	0.06	-7.0429	11.4101	0.49921	0.5705:0.0:0.4295:0.0	.	487;484;489;484	B7Z237;Q9BZB8-3;Q9BZB8;E7ET70	.;.;CPEB1_HUMAN;.	R	484;484;409;414;487;258	ENSP00000397526:S409R;ENSP00000381591:S414R;ENSP00000261723:S487R;ENSP00000381592:S258R	ENSP00000261723:S487R	S	-	3	2	2	CPEB1	81012990	81012990	0.145000	0.22656	0.984000	0.44739	0.985000	0.73830	-0.371000	0.07513	-0.518000	0.06452	-0.423000	0.05987	AGC	0.813549		TCGA-FB-AAPU-01A-31D-A40W-08	0.463	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000421102.1	1	0	1		2	2	2	0		0	0	83		83	83	1	2	-20.000000	1	0.700000	NM_030594			207	205		169	168	0		1	0		0	0	83	0		1.000000	3.002625e-01	0	0	0	2	0	207	169
CDH8	1006	broad.mit.edu	37	16	62055298	62055298	+	Missense_Mutation	SNP	G	G	A	rs139797882		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr16:62055298G>A	ENST00000577390.1	-	2	964	c.10C>T	c.(10-12)Cgg>Tgg	p.R4W	CDH8_ENST00000299345.6_Missense_Mutation_p.R4W|CDH8_ENST00000584337.1_Missense_Mutation_p.R4W|CDH8_ENST00000577730.1_Missense_Mutation_p.R4W	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	4					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TCCGCTAGCCGTTCTGGCATG	0.443																																						ENST00000577390.1	0.410000	2.100000e-01	3.600000e-01	2.500000e-01	0.300000	0.314121	0.300000	0.300000																										0				112						c.(10-12)Cgg>Tgg		cadherin 8, type 2							63.0	66.0	65.0					16																	62055298		2201	4295	6496	SO:0001583	missense	1006	0	0					g.chr16:62055298G>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.10C>T	chr16.hg19:g.62055298G>A	ENSP00000462701:p.Arg4Trp	0					CDH8_ENST00000577730.1_Missense_Mutation_p.R4W|CDH8_ENST00000299345.6_Missense_Mutation_p.R4W|CDH8_ENST00000584337.1_Missense_Mutation_p.R4W	p.R4W	NM_001796.4	NP_001787.2	0	0	0	2.004961	P55286	CADH8_HUMAN		2	964	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	1	1	hg19	c.10C>T	CCDS10802.1	0	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920100	0.73098	.	.	ENSG00000150394	ENST00000299345	T	0.59083	0.29	6.17	5.2	0.72013	6.17	5.2	0.72013	.	0.068663	0.64402	D	0.000020	T	0.69360	0.3102	L	0.47716	1.5	0.39308	D	0.965029	D	0.89917	1.0	D	0.77557	0.99	T	0.73792	-0.3871	10	0.87932	D	0	.	13.5257	0.61593	0.0:0.0:0.5605:0.4395	.	4	P55286	CADH8_HUMAN	W	4	ENSP00000299345:R4W	ENSP00000299345:R4W	R	-	1	2	2	CDH8	60612799	60612799	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.750000	0.47500	1.564000	0.49628	0.655000	0.94253	CGG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.443	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	1	0	1		2	2	2	0		0	0	103		103	102	1	2	-3.318796	1	0.700000	NM_001796			35	33		290	285	1		1			0	0	103	0		1.000000	0	0	0	0	0	0	35	290
MEOX1	4222	broad.mit.edu	37	17	41738449	41738449	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:41738449T>C	ENST00000318579.4	-	1	873	c.454A>G	c.(454-456)Aga>Gga	p.R152G	MEOX1_ENST00000329168.3_Missense_Mutation_p.R152G|MEOX1_ENST00000393661.2_Missense_Mutation_p.R37G|MEOX1_ENST00000549132.1_Silent_p.G122G	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	152					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		CTCTCCTTTCTCCGCCTGGAT	0.572																																						ENST00000318579.4	0.100000	3.000000e-02	9.000000e-02	4.000000e-02	0.060000	0.070436	0.060000	0.060000																										0				8						c.(454-456)Aga>Gga		mesenchyme homeobox 1							197.0	196.0	196.0					17																	41738449		2203	4300	6503	SO:0001583	missense	4222	0	0					g.chr17:41738449T>C		CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.454A>G	chr17.hg19:g.41738449T>C	ENSP00000321684:p.Arg152Gly	0					MEOX1_ENST00000329168.3_Missense_Mutation_p.R152G|MEOX1_ENST00000549132.1_Silent_p.G122G|MEOX1_ENST00000393661.2_Missense_Mutation_p.R37G	p.R152G	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	0	0	0	1.996979	P50221	MEOX1_HUMAN		1	873	-		Breast(137;0.00908)	A8K524|A8MWF9|Q15069	Missense_Mutation	SNP	ENST00000318579.4	1	1	hg19	c.454A>G	CCDS11466.1	0	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857712	0.51376	.	.	ENSG00000005102	ENST00000318579;ENST00000329168;ENST00000393661	D;T;D	0.91180	-2.8;0.64;-2.78	4.99	4.99	0.66335	4.99	4.99	0.66335	.	0.048523	0.85682	D	0.000000	T	0.82135	0.4971	N	0.14661	0.345	0.37695	D	0.923982	B;B	0.29835	0.152;0.258	B;B	0.26969	0.023;0.075	T	0.83253	-0.0052	10	0.48119	T	0.1	-25.6858	13.4121	0.60948	0.0:0.0:0.0:1.0	.	152;152	Q15069;P50221	.;MEOX1_HUMAN	G	152;152;37	ENSP00000321684:R152G;ENSP00000328678:R152G;ENSP00000377271:R37G	ENSP00000321684:R152G	R	-	1	2	2	MEOX1	39093975	39093975	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.734000	0.74801	2.092000	0.63282	0.533000	0.62120	AGA	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.572	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409452.1	0	0	1		2	2	2	0		0	0	178		178	174	1	2	-14.375500	1	0.700000				19	19		790	781	0		1	0		0	0	178	0		0.999989	3.690088e-03	0	0	0	4	0	19	790
B4GALNT2	124872	broad.mit.edu	37	17	47230177	47230177	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:47230177C>T	ENST00000300404.2	+	4	608	c.549C>T	c.(547-549)cgC>cgT	p.R183R	B4GALNT2_ENST00000393354.2_Silent_p.R123R|B4GALNT2_ENST00000504681.1_Silent_p.R97R	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	183					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			GGCTGCCCCGCCCACTGCCCC	0.617																																					GBM(124;244 1635 8663 18097 33175)	ENST00000300404.2	1.000000	5.600000e-01	1	7.300000e-01	0.920000	0.885801	0.920000	1.000000																										0				24						c.(547-549)cgC>cgT		beta-1,4-N-acetyl-galactosaminyl transferase 2							39.0	29.0	32.0					17																	47230177		2203	4300	6503	SO:0001819	synonymous_variant	124872	0	0					g.chr17:47230177C>T	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.549C>T	chr17.hg19:g.47230177C>T		0					B4GALNT2_ENST00000393354.2_Silent_p.R123R|B4GALNT2_ENST00000504681.1_Silent_p.R97R	p.R183R	NM_153446.2	NP_703147.2	0	0	0	1.996979	Q8NHY0	B4GN2_HUMAN	all cancers(6;0.000316)	4	608	+			B4DZE4|Q14CP1|Q86Y40	Silent	SNP	ENST00000300404.2	1	1	hg19	c.549C>T	CCDS11544.1	1																																																																																								0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.617	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	1	0	1		2	2	2	0		0	0	20		20	20	1	2	-20.000000	1	0.700000	NM_153446			13	13		27	25	1		1			0	0	20	0		0.999740	0	0	0	0	0	0	13	27
HELZ	9931	broad.mit.edu	37	17	65163782	65163782	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:65163782T>A	ENST00000358691.5	-	14	1727	c.1561A>T	c.(1561-1563)Act>Tct	p.T521S	HELZ_ENST00000580168.1_Missense_Mutation_p.T521S	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	521						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CCAGCCAAAGTATCTTCAGAA	0.433																																						ENST00000358691.5	0.190000	4.000000e-02	1.500000e-01	7.000000e-02	0.110000	0.117974	0.110000	0.120000																										0				69						c.(1561-1563)Act>Tct		helicase with zinc finger							115.0	102.0	106.0					17																	65163782		1866	4114	5980	SO:0001583	missense	9931	0	0					g.chr17:65163782T>A	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1561A>T	chr17.hg19:g.65163782T>A	ENSP00000351524:p.Thr521Ser	1					HELZ_ENST00000580168.1_Missense_Mutation_p.T521S	p.T521S	NM_014877.3	NP_055692	1	2	3	2.677864	P42694	HELZ_HUMAN		14	1727	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)		I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	1	1	hg19	c.1561A>T	CCDS42374.1	0	.	.	.	.	.	.	.	.	.	.	T	15.61	2.885504	0.51908	.	.	ENSG00000198265	ENST00000358691	D	0.85484	-1.99	5.4	5.4	0.78164	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.89955	0.6865	L	0.56280	1.765	0.80722	D	1	D;P	0.76494	0.999;0.922	D;P	0.68192	0.956;0.655	D	0.90316	0.4341	10	0.52906	T	0.07	-16.6549	15.4547	0.75302	0.0:0.0:0.0:1.0	.	521;521	B7ZLW2;P42694	.;HELZ_HUMAN	S	521	ENSP00000351524:T521S	ENSP00000351524:T521S	T	-	1	0	0	HELZ	62594244	62594244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.662000	0.68032	2.045000	0.60652	0.460000	0.39030	ACT	0.777778		TCGA-FB-AAPU-01A-31D-A40W-08	0.433	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	0	0	1		2	2	2	0		0	0	99		99	99	1	2	-11.152460	1	0.700000	NM_014877			11	11		379	375	0		1	0		0	0	99	0		0.998292	1.370005e-01	0	1	0	20	0	11	379
WIPI1	55062	broad.mit.edu	37	17	66430712	66430712	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:66430712C>A	ENST00000262139.5	-	7	676	c.677G>T	c.(676-678)cGg>cTg	p.R226L	WIPI1_ENST00000546360.1_Missense_Mutation_p.R144L|WIPI1_ENST00000589459.1_5'UTR	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	226					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						CATCCCTCTCCGGAACTCATA	0.512																																						ENST00000262139.5	1.000000	7.200000e-01	1	8.100000e-01	0.910000	0.910945	0.910000	1.000000																										0				18						c.(676-678)cGg>cTg		WD repeat domain, phosphoinositide interacting 1							95.0	92.0	93.0					17																	66430712		2203	4300	6503	SO:0001583	missense	55062	0	0					g.chr17:66430712C>A		CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.677G>T	chr17.hg19:g.66430712C>A	ENSP00000262139:p.Arg226Leu	1					WIPI1_ENST00000546360.1_Missense_Mutation_p.R144L|WIPI1_ENST00000589459.1_5'UTR	p.R226L	NM_017983.5	NP_060453.3	1	2	3	2.677864	Q5MNZ9	WIPI1_HUMAN		7	676	-			Q8IXM5|Q9NWF8	Missense_Mutation	SNP	ENST00000262139.5	1	1	hg19	c.677G>T	CCDS11677.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322237	0.81580	.	.	ENSG00000070540	ENST00000262139;ENST00000546360	T;T	0.52057	0.68;2.32	5.32	5.32	0.75619	5.32	5.32	0.75619	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.116368	0.56097	D	0.000025	T	0.65565	0.2703	H	0.95043	3.615	0.80722	D	1	P	0.35328	0.495	B	0.35931	0.214	T	0.75673	-0.3236	10	0.72032	D	0.01	-15.4145	19.0599	0.93085	0.0:1.0:0.0:0.0	.	226	Q5MNZ9	WIPI1_HUMAN	L	226;144	ENSP00000262139:R226L;ENSP00000437345:R144L	ENSP00000262139:R226L	R	-	2	0	0	WIPI1	63942307	63942307	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.326000	0.79133	2.505000	0.84491	0.485000	0.47835	CGG	0.777778		TCGA-FB-AAPU-01A-31D-A40W-08	0.512	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1	1	0	1		2	2	2	0		0	0	39		39	39	1	2	-3.828835	1	0.700000	NM_017983			57	57		182	180	1		1	1		0	0	39	0		1.000000	1	0	22	0	70	0	57	182
WIPI1	55062	broad.mit.edu	37	17	66430734	66430734	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:66430734C>A	ENST00000262139.5	-	7	654	c.655G>T	c.(655-657)Ggg>Tgg	p.G219W	WIPI1_ENST00000546360.1_Missense_Mutation_p.G137W|WIPI1_ENST00000589459.1_5'UTR	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	219					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						AGCTTTTGCCCATCAGGGACA	0.498																																						ENST00000262139.5	1.000000	6.700000e-01	9.900000e-01	7.600000e-01	0.870000	0.874206	0.870000	1.000000																										0				18						c.(655-657)Ggg>Tgg		WD repeat domain, phosphoinositide interacting 1							90.0	87.0	88.0					17																	66430734		2203	4300	6503	SO:0001583	missense	55062	0	0					g.chr17:66430734C>A		CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.655G>T	chr17.hg19:g.66430734C>A	ENSP00000262139:p.Gly219Trp	1					WIPI1_ENST00000546360.1_Missense_Mutation_p.G137W|WIPI1_ENST00000589459.1_5'UTR	p.G219W	NM_017983.5	NP_060453.3	1	2	3	2.677864	Q5MNZ9	WIPI1_HUMAN		7	654	-			Q8IXM5|Q9NWF8	Missense_Mutation	SNP	ENST00000262139.5	1	1	hg19	c.655G>T	CCDS11677.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559525	0.86335	.	.	ENSG00000070540	ENST00000262139;ENST00000546360	T;T	0.57595	0.39;2.03	5.32	5.32	0.75619	5.32	5.32	0.75619	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.105797	0.64402	D	0.000004	T	0.80788	0.4690	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85997	0.1492	10	0.87932	D	0	-22.2488	19.0599	0.93085	0.0:1.0:0.0:0.0	.	219	Q5MNZ9	WIPI1_HUMAN	W	219;137	ENSP00000262139:G219W;ENSP00000437345:G137W	ENSP00000262139:G219W	G	-	1	0	0	WIPI1	63942329	63942329	1.000000	0.71417	0.936000	0.37596	0.891000	0.51852	7.326000	0.79133	2.505000	0.84491	0.485000	0.47835	GGG	0.777778		TCGA-FB-AAPU-01A-31D-A40W-08	0.498	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1	1	0	0		2	2	2	0		0	0	35		35	35	1	2	-3.496361	1	0.700000	NM_017983			51	51		174	173	1		1	1		0	0	35	0		1.000000	9.999994e-01	0	24	0	54	0	51	174
KIAA0195	9772	broad.mit.edu	37	17	73488859	73488859	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr17:73488859C>T	ENST00000314256.7	+	15	2295	c.1901C>T	c.(1900-1902)gCc>gTc	p.A634V	KIAA0195_ENST00000579208.1_Missense_Mutation_p.A285V|KIAA0195_ENST00000375248.5_Missense_Mutation_p.A644V	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	634						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGCGAGCTTGCCCGCCTCATT	0.647																																						ENST00000314256.7	0.100000	0	7.000000e-02	2.000000e-02	0.040000	0.051290	0.040000	0.050000																										0				42						c.(1900-1902)gCc>gTc		KIAA0195							53.0	53.0	53.0					17																	73488859		2203	4300	6503	SO:0001583	missense	9772	0	0					g.chr17:73488859C>T		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1901C>T	chr17.hg19:g.73488859C>T	ENSP00000313885:p.Ala634Val	1					KIAA0195_ENST00000579208.1_Missense_Mutation_p.A285V|KIAA0195_ENST00000375248.5_Missense_Mutation_p.A644V	p.A634V	NM_014738.4	NP_055553.3	1	2	3	2.677864	Q12767	K0195_HUMAN	all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)	15	2295	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	0	1	hg19	c.1901C>T	CCDS32732.1	0	.	.	.	.	.	.	.	.	.	.	C	16.32	3.088956	0.55968	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	D;D	0.87650	-2.28;-2.28	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.053643	0.85682	D	0.000000	D	0.86251	0.5888	L	0.54323	1.7	0.80722	D	1	B;B;B	0.34329	0.079;0.449;0.321	B;B;B	0.33960	0.043;0.173;0.084	D	0.85706	0.1316	10	0.62326	D	0.03	-29.8003	19.9787	0.97318	0.0:1.0:0.0:0.0	.	644;644;634	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	V	634;644	ENSP00000313885:A634V;ENSP00000364397:A644V	ENSP00000313885:A634V	A	+	2	0	0	KIAA0195	71000454	71000454	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	5.785000	0.68998	2.733000	0.93635	0.561000	0.74099	GCC	0.777778		TCGA-FB-AAPU-01A-31D-A40W-08	0.647	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	0	0	1		2	2	2	0		0	0	69		69	68	1	2	-2.686105	1	0.700000	NM_014738			5	5		435	429	0		1	0		0	0	69	0		0.935599	2.092269e-01	0	0	0	62	0	5	435
RNF125	54941	broad.mit.edu	37	18	29622203	29622203	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr18:29622203G>C	ENST00000217740.3	+	3	872	c.380G>C	c.(379-381)gGa>gCa	p.G127A	RNF125_ENST00000583384.1_3'UTR|RP11-53I6.2_ENST00000583184.1_RNA	NM_017831.3	NP_060301.2	Q96EQ8	RN125_HUMAN	ring finger protein 125, E3 ubiquitin protein ligase	127					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						GATAAGTATGGACCACTACAA	0.328																																						ENST00000217740.3	0.190000	2.000000e-02	1.400000e-01	5.000000e-02	0.080000	0.097865	0.080000	0.080000																										0				6						c.(379-381)gGa>gCa		ring finger protein 125, E3 ubiquitin protein ligase							81.0	78.0	79.0					18																	29622203		2203	4300	6503	SO:0001583	missense	54941	0	0					g.chr18:29622203G>C	AK000463	CCDS11902.1	18q12.1	2013-01-09	2012-02-23		ENSG00000101695	ENSG00000101695		"""RING-type (C3HC4) zinc fingers"""	21150	protein-coding gene	gene with protein product		610432	"""ring finger protein 125"""				Standard	NM_017831		Approved	FLJ20456	uc002kxf.1	Q96EQ8	OTTHUMG00000132266	ENST00000217740.3:c.380G>C	chr18.hg19:g.29622203G>C	ENSP00000217740:p.Gly127Ala	1					RNF125_ENST00000583384.1_3'UTR|RP11-53I6.2_ENST00000583184.1_RNA	p.G127A	NM_017831.3	NP_060301.2	0	1	1	1.369046	Q96EQ8	RN125_HUMAN		3	872	+			Q9NX39	Missense_Mutation	SNP	ENST00000217740.3	0	1	hg19	c.380G>C	CCDS11902.1	0	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686264	0.47991	.	.	ENSG00000101695	ENST00000217740	D	0.82255	-1.59	5.55	5.55	0.83447	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000024	D	0.88040	0.6330	L	0.54323	1.7	0.50813	D	0.999893	D	0.76494	0.999	D	0.83275	0.996	T	0.83353	-0.0002	10	0.13853	T	0.58	0.442	16.7717	0.85539	0.0:0.0:1.0:0.0	.	127	Q96EQ8	RN125_HUMAN	A	127	ENSP00000217740:G127A	ENSP00000217740:G127A	G	+	2	0	0	RNF125	27876201	27876201	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.059000	0.64306	2.767000	0.95098	0.563000	0.77884	GGA	0.538462		TCGA-FB-AAPU-01A-31D-A40W-08	0.328	RNF125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255354.1	0	0	1		2	2	2	0		0	0	40		40	40	1	2	-7.348601	1	0.700000	NM_017831			4	4		88	84	0		1	0		0	0	40	0		0.881200	0	0	0	0	1	0	4	88
CARM1	10498	broad.mit.edu	37	19	11022882	11022882	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr19:11022882G>A	ENST00000327064.4	+	5	771	c.581G>A	c.(580-582)gGc>gAc	p.G194D	CARM1_ENST00000344150.4_Missense_Mutation_p.G194D	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	194	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						GTTGGCTGTGGCTCTGGGATC	0.592																																						ENST00000327064.4	0.090000	3.000000e-02	8.000000e-02	4.000000e-02	0.060000	0.067300	0.060000	0.060000																										0				13						c.(580-582)gGc>gAc		coactivator-associated arginine methyltransferase 1							351.0	279.0	303.0					19																	11022882		2203	4300	6503	SO:0001583	missense	10498	0	0					g.chr19:11022882G>A	AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.581G>A	chr19.hg19:g.11022882G>A	ENSP00000325690:p.Gly194Asp	0					CARM1_ENST00000344150.4_Missense_Mutation_p.G194D	p.G194D	NM_199141.1	NP_954592.1	0	0	0	1.983682	Q86X55	CARM1_HUMAN		5	771	+			A6NN38	Missense_Mutation	SNP	ENST00000327064.4	1	1	hg19	c.581G>A	CCDS12250.1	0	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987583	0.93106	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.77620	-1.11;-1.11	5.67	4.64	0.57946	5.67	4.64	0.57946	.	0.058076	0.64402	N	0.000002	D	0.93354	0.7881	H	0.99770	4.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95477	0.8557	10	0.87932	D	0	-4.2354	13.3148	0.60401	0.077:0.0:0.923:0.0	.	194	Q86X55	CARM1_HUMAN	D	194	ENSP00000325690:G194D;ENSP00000340934:G194D	ENSP00000325690:G194D	G	+	2	0	0	CARM1	10883882	10883882	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.233000	0.95337	1.403000	0.46800	0.655000	0.94253	GGC	0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.592	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452625.1	0	0	1		2	2	2	0		0	0	314		314	310	1	2	-2.655911	1	0.700000	XM_032719			29	29		1232	1206	0		1	1		0	0	314	0		1.000000	8.384789e-01	0	3	0	139	0	29	1232
AKAP8	10270	broad.mit.edu	37	19	15483674	15483674	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr19:15483674C>T	ENST00000269701.2	-	5	909	c.849G>A	c.(847-849)cgG>cgA	p.R283R		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	283					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GATCCCGATCCCGCATCCGAG	0.592																																					GBM(190;1671 2163 3274 27186 30476)	ENST00000269701.2	0.860000	4.400000e-01	7.600000e-01	5.400000e-01	0.640000	0.654099	0.640000	0.640000																										0				26						c.(847-849)cgG>cgA		A kinase (PRKA) anchor protein 8							23.0	25.0	25.0					19																	15483674		2203	4299	6502	SO:0001819	synonymous_variant	10270	0	0					g.chr19:15483674C>T	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.849G>A	chr19.hg19:g.15483674C>T		0						p.R283R	NM_005858.3	NP_005849.1	0	0	0	1.983682	O43823	AKAP8_HUMAN		5	909	-				Silent	SNP	ENST00000269701.2	1	1	hg19	c.849G>A	CCDS12329.1	0																																																																																								0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.592	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	1	0	1		2	2	2	0		0	0	23		23	23	1	2	-20.000000	1	0.700000	NM_005858			27	26		92	89	1		1	1		0	0	23	0		1.000000	9.998683e-01	0	20	0	33	0	27	92
UPK1A	11045	broad.mit.edu	37	19	36168781	36168781	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr19:36168781C>G	ENST00000222275.2	+	6	716	c.716C>G	c.(715-717)gCc>gGc	p.A239G	UPK1A_ENST00000379013.2_Missense_Mutation_p.P272A	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	239					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TTTGGGTTTGCCATCCTGATG	0.657																																						ENST00000222275.2	0.280000	5.000000e-02	2.100000e-01	8.000000e-02	0.140000	0.154139	0.140000	0.130000																										0				9						c.(715-717)gCc>gGc		uroplakin 1A							77.0	63.0	67.0					19																	36168781		2203	4300	6503	SO:0001583	missense	11045	0	0					g.chr19:36168781C>G	AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.716C>G	chr19.hg19:g.36168781C>G	ENSP00000222275:p.Ala239Gly	0					UPK1A_ENST00000379013.2_Missense_Mutation_p.P272A	p.A239G	NM_007000.2	NP_008931.1	0	0	0	1.983682	O00322	UPK1A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)	6	716	+	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		Q3KNU5|Q3KNU6	Missense_Mutation	SNP	ENST00000222275.2	0	1	hg19	c.716C>G	CCDS12470.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.45|18.45	3.625613|3.625613	0.66901|0.66901	.|.	.|.	ENSG00000105668|ENSG00000105668	ENST00000222275|ENST00000379013	T|T	0.77750|0.07216	-1.12|3.21	5.61|5.61	5.61|5.61	0.85477|0.85477	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	.|.	.|.	.|.	.|.	T|T	0.09423|0.09423	0.0232|0.0232	L|L	0.48642|0.48642	1.525|1.525	0.39783|0.39783	D|D	0.97232|0.97232	P|P	0.35328|0.37330	0.495|0.59	B|B	0.39339|0.30572	0.297|0.117	T|T	0.04607|0.04607	-1.0939|-1.0939	9|9	0.06236|0.87932	T|D	0.91|0	-5.748|-5.748	15.1232|15.1232	0.72460|0.72460	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	239|272	O00322|O00322-2	UPK1A_HUMAN|.	G|A	239|272	ENSP00000222275:A239G|ENSP00000368298:P272A	ENSP00000222275:A239G|ENSP00000368298:P272A	A|P	+|+	2|1	0|0	0|0	UPK1A|UPK1A	40860621|40860621	40860621|40860621	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	5.013000|5.013000	0.64023|0.64023	2.643000|2.643000	0.89663|0.89663	0.462000|0.462000	0.41574|0.41574	GCC|CCA	0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.657	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3	0	0	1		2	2	2	0		0	0	30		30	30	1	2	-3.272686	1	0.700000				5	5		103	99	0		1			0	0	30	0		0.932708	0	0	0	0	0	0	5	103
SIPA1L3	23094	broad.mit.edu	37	19	38590667	38590667	+	Silent	SNP	G	G	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr19:38590667G>T	ENST00000222345.6	+	5	2240	c.1731G>T	c.(1729-1731)ggG>ggT	p.G577G		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	577					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ATGGGACCGGGCGGGGCCTGC	0.632																																						ENST00000222345.6	1.000000	7.600000e-01	1	8.400000e-01	0.920000	0.920984	0.920000	1.000000																										0				59						c.(1729-1731)ggG>ggT		signal-induced proliferation-associated 1 like 3							67.0	62.0	63.0					19																	38590667		2203	4300	6503	SO:0001819	synonymous_variant	23094	0	0					g.chr19:38590667G>T	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.1731G>T	chr19.hg19:g.38590667G>T		0						p.G577G	NM_015073.1	NP_055888.1	0	0	0	1.983682	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)	5	2240	+			Q2TV87	Silent	SNP	ENST00000222345.6	1	1	hg19	c.1731G>T	CCDS33007.1	1																																																																																								0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.632	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	0	0	1		2	2	2	0		0	0	68		68	68	1	2	-20.000000	1	0.700000	XM_032278			87	88		179	176	1		1	1		0	0	68	0		1.000000	9.999996e-01	0	28	0	21	0	87	179
ZNF600	162966	broad.mit.edu	37	19	53270312	53270312	+	Missense_Mutation	SNP	G	G	T	rs566513144		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr19:53270312G>T	ENST00000338230.3	-	3	964	c.697C>A	c.(697-699)Ctt>Att	p.L233I		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		TGGCATGTAAGGGATGATACC	0.408																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)	ENST00000338230.3	0.250000	1.200000e-01	2.200000e-01	1.500000e-01	0.180000	0.188282	0.180000	0.180000																										0				30						c.(697-699)Ctt>Att		zinc finger protein 600																																				SO:0001583	missense	162966	0	0					g.chr19:53270312G>T	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.697C>A	chr19.hg19:g.53270312G>T	ENSP00000344791:p.Leu233Ile	0						p.L233I	NM_198457.2	NP_940859	1	2	3	2.023319	Q6ZNG1	ZN600_HUMAN		3	964	-			Q6MZR0	Missense_Mutation	SNP	ENST00000338230.3	1	1	hg19	c.697C>A	CCDS12856.1	0	.	.	.	.	.	.	.	.	.	.	.	16.90	3.250086	0.59212	.	.	ENSG00000189190	ENST00000338230	T	0.10860	2.83	1.62	1.62	0.23740	1.62	1.62	0.23740	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37019	0.0988	M	0.89715	3.055	0.09310	N	1	D	0.69078	0.997	D	0.85130	0.997	T	0.08066	-1.0740	9	0.87932	D	0	.	10.1661	0.42882	0.0:0.0:1.0:0.0	.	233	Q6ZNG1	ZN600_HUMAN	I	233	ENSP00000344791:L233I	ENSP00000344791:L233I	L	-	1	0	0	ZNF600	57962124	57962124	0.152000	0.22762	0.093000	0.20910	0.519000	0.34347	2.239000	0.43079	0.888000	0.36160	0.313000	0.20887	CTT	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.408	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463093.1	1	0	1		2	2	2	0		0	0	208		208	205	1	2	-2.619816	1	0.700000	NM_198457			36	35		525	518	0		1	0		0	0	208	0		1.000000	4.704596e-01	0	1	0	23	0	36	525
DCST2	127579	broad.mit.edu	37	1	154998864	154998864	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:154998864G>T	ENST00000368424.3	-	10	1583	c.1525C>A	c.(1525-1527)Cta>Ata	p.L509I	DCST2_ENST00000295536.5_Missense_Mutation_p.L509I	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	509						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AAGAAGCATAGGCCATACATG	0.637																																						ENST00000368424.3	1.000000	8.500000e-01	1	9.400000e-01	0.990000	0.979592	0.990000	1.000000																										0				38						c.(1525-1527)Cta>Ata		DC-STAMP domain containing 2							55.0	54.0	54.0					1																	154998864		2203	4300	6503	SO:0001583	missense	127579	0	0					g.chr1:154998864G>T	AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1525C>A	chr1.hg19:g.154998864G>T	ENSP00000357409:p.Leu509Ile	1					DCST2_ENST00000295536.5_Missense_Mutation_p.L509I	p.L509I	NM_144622.2	NP_653223.2	2	2	4	3.240808	Q5T1A1	DCST2_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)	10	1583	-	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	1	1	hg19	c.1525C>A	CCDS1082.2	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477203	0.44044	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.34667	1.35;1.35	4.75	4.75	0.60458	4.75	4.75	0.60458	Dendritic cell-specific transmembrane protein-like (1);	0.218950	0.30392	N	0.009722	T	0.25082	0.0609	M	0.78637	2.42	0.28184	N	0.92805	P	0.47604	0.898	B	0.42138	0.377	T	0.12993	-1.0526	10	0.36615	T	0.2	-8.1492	10.3498	0.43927	0.0:0.0:0.8042:0.1958	.	509	Q5T1A1	DCST2_HUMAN	I	509	ENSP00000357409:L509I;ENSP00000295536:L509I	ENSP00000295536:L509I	L	-	1	2	2	DCST2	153265488	153265488	0.483000	0.25956	0.991000	0.47740	0.961000	0.63080	0.167000	0.16602	2.466000	0.83321	0.655000	0.94253	CTA	0.815157		TCGA-FB-AAPU-01A-31D-A40W-08	0.637	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	1	0	1		2	2	2	0		0	0	80		80	80	1	2	-20.000000	1	0.700000	NM_144622			98	98		344	342	1		1	1		0	0	80	1		1.000000	6.852107e-01	0	4	0	6	0	98	344
CFAP45	25790	broad.mit.edu	37	1	159850480	159850480	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:159850480C>T	ENST00000368099.4	-	8	972	c.908G>A	c.(907-909)cGa>cAa	p.R303Q	CCDC19_ENST00000426543.2_Missense_Mutation_p.R218Q|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			TTGCTGCCTTCGTTCCATGTC	0.478																																						ENST00000368099.4	1.000000	1.000000e-02	1.400000e-01	4.000000e-02	0.080000	0.162526	0.080000	0.080000																										0				26						c.(907-909)cGa>cAa									103.0	88.0	93.0					1																	159850480		2203	4300	6503	SO:0001583	missense	0	1	121412	27				g.chr1:159850480C>T																												ENST00000368099.4:c.908G>A	chr1.hg19:g.159850480C>T	ENSP00000357079:p.Arg303Gln	1					CCDC19_ENST00000426543.2_Missense_Mutation_p.R218Q|CCDC19_ENST00000476696.1_5'UTR	p.R303Q	NM_012337.2	NP_036469.2	2	2	4	3.264818			BRCA - Breast invasive adenocarcinoma(70;0.151)	8	972	-	all_hematologic(112;0.0597)			Missense_Mutation	SNP	ENST00000368099.4	0	1	hg19	c.908G>A	CCDS30914.1	0	.	.	.	.	.	.	.	.	.	.	C	1.086	-0.665561	0.03428	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.10099	2.91;2.91	4.94	-0.338	0.12651	4.94	-0.338	0.12651	.	0.596147	0.17329	N	0.178193	T	0.01730	0.0055	N	0.16567	0.415	0.21915	N	0.999471	B;B	0.11235	0.004;0.004	B;B	0.10450	0.005;0.005	T	0.45629	-0.9248	9	.	.	.	-0.0898	11.3354	0.49500	0.0:0.6301:0.0:0.3699	.	303;303	A8K884;Q9UL16	.;CCD19_HUMAN	Q	303;218	ENSP00000357079:R303Q;ENSP00000403044:R218Q	.	R	-	2	0	0	CCDC19	158117104	158117104	0.000000	0.05858	0.194000	0.23346	0.168000	0.22595	-0.761000	0.04751	-0.337000	0.08426	-1.786000	0.00637	CGA	0.815951		TCGA-FB-AAPU-01A-31D-A40W-08	0.478	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1	0	0	1		2	2	2	0		0	0	63		63	63	1	2	-3.091975	1	0.700000				5	5		306	300	0		1	0		0	0	63	0		0.934788	1.367304e-02	0	0	0	9	0	5	306
ADCY10	55811	broad.mit.edu	37	1	167830232	167830232	+	Silent	SNP	G	G	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:167830232G>T	ENST00000367851.4	-	15	1870	c.1686C>A	c.(1684-1686)gcC>gcA	p.A562A	ADCY10_ENST00000545172.1_Silent_p.A409A|ADCY10_ENST00000367848.1_Silent_p.A470A	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	562					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CTAGGACATTGGCCATGAACA	0.373																																						ENST00000367851.4	1.000000	4.000000e-02	1.600000e-01	6.000000e-02	0.100000	0.179126	0.100000	0.110000																										0				63						c.(1684-1686)gcC>gcA		adenylate cyclase 10 (soluble)							174.0	166.0	169.0					1																	167830232		2203	4300	6503	SO:0001819	synonymous_variant	55811	0	0					g.chr1:167830232G>T	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1686C>A	chr1.hg19:g.167830232G>T		1					ADCY10_ENST00000367848.1_Silent_p.A470A|ADCY10_ENST00000545172.1_Silent_p.A409A	p.A562A	NM_018417.4	NP_060887.2	2	2	4	3.264818	Q96PN6	ADCYA_HUMAN		15	1870	-			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	1	1	hg19	c.1686C>A	CCDS1265.1	0																																																																																								0.815951		TCGA-FB-AAPU-01A-31D-A40W-08	0.373	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	0	0	1		2	2	2	0		0	0	77		77	77	1	2	-3.044378	1	0.700000	NM_018417			9	10		425	418	0		1			0	0	77	0		0.993951	0	0	0	0	0	0	9	425
PAPPA2	60676	broad.mit.edu	37	1	176564265	176564265	+	Silent	SNP	T	T	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:176564265T>C	ENST00000367662.3	+	3	2689	c.1525T>C	c.(1525-1527)Ttg>Ctg	p.L509L	PAPPA2_ENST00000367661.3_Silent_p.L509L	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	509	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CAATGTGGAATTGATCTCCCA	0.537																																						ENST00000367662.3	1.000000	8.300000e-01	1	9.400000e-01	0.990000	0.978593	0.990000	1.000000																										0				226						c.(1525-1527)Ttg>Ctg		pappalysin 2							56.0	57.0	56.0					1																	176564265		1976	4162	6138	SO:0001819	synonymous_variant	60676	0	0					g.chr1:176564265T>C	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1525T>C	chr1.hg19:g.176564265T>C		1					PAPPA2_ENST00000367661.3_Silent_p.L509L	p.L509L	NM_020318.2	NP_064714.2	2	2	4	3.310555	Q9BXP8	PAPP2_HUMAN		3	2689	+			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	1	1	hg19	c.1525T>C	CCDS41438.1	1																																																																																								0.819059		TCGA-FB-AAPU-01A-31D-A40W-08	0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1	0	0	1		19	2	2	1		1	1	50		50	50	1	2	-20.000000	1	0.700000				67	67		236	234	1		1			1	0	50	0		1.000000	0	0	0	0	0	0	67	236
TMEM52	339456	broad.mit.edu	37	1	1849760	1849760	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:1849760G>A	ENST00000310991.3	-	4	288	c.281C>T	c.(280-282)gCa>gTa	p.A94V	TMEM52_ENST00000378602.3_Missense_Mutation_p.A79V	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	94						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGGCTGCCGTGCTGGTGGCAG	0.637																																						ENST00000310991.3	1.000000	8.500000e-01	1	9.100000e-01	0.960000	0.961243	0.960000	1.000000																										0				3						c.(280-282)gCa>gTa		transmembrane protein 52							47.0	49.0	48.0					1																	1849760		2203	4297	6500	SO:0001583	missense	339456	0	0					g.chr1:1849760G>A	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.281C>T	chr1.hg19:g.1849760G>A	ENSP00000311122:p.Ala94Val	1					TMEM52_ENST00000378602.3_Missense_Mutation_p.A79V	p.A94V	NM_178545.3	NP_848640.1	0	1	1	1.359352	Q8NDY8	TMM52_HUMAN		4	288	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	Q4VXS6|Q6UX25	Missense_Mutation	SNP	ENST00000310991.3	1	1	hg19	c.281C>T	CCDS35.1	1	.	.	.	.	.	.	.	.	.	.	.	10.32	1.317752	0.23994	.	.	ENSG00000178821	ENST00000378602;ENST00000310991	T;T	0.38401	1.14;1.14	3.71	1.75	0.24633	3.71	1.75	0.24633	.	1.039220	0.07675	N	0.936067	T	0.33294	0.0858	L	0.40543	1.245	0.09310	N	1	P;P	0.50819	0.884;0.939	B;P	0.48524	0.396;0.58	T	0.16660	-1.0395	10	0.48119	T	0.1	-8.9629	2.56	0.04770	0.1093:0.1857:0.5143:0.1906	.	94;79	Q8NDY8;Q8NDY8-2	TMM52_HUMAN;.	V	79;94	ENSP00000367865:A79V;ENSP00000311122:A94V	ENSP00000311122:A94V	A	-	2	0	0	TMEM52	1839620	1839620	0.010000	0.17322	0.000000	0.03702	0.009000	0.06853	1.727000	0.38095	0.188000	0.20168	0.511000	0.50034	GCA	0.540933		TCGA-FB-AAPU-01A-31D-A40W-08	0.637	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	0	0	1		12	2	2	1		1	1	35		35	35	1	2	-20.000000	1	0.700000	NM_178545			72	68		54	52	0		1	1		1	0	35	0		1.000000	9.393969e-01	0	6	0	0	0	72	54
C1QB	713	broad.mit.edu	37	1	22986137	22986137	+	Splice_Site	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:22986137G>A	ENST00000314933.6	+	2	319		c.e2+1		C1QB_ENST00000509305.1_Splice_Site	NM_000491.3	NP_000482.3	P02746	C1QB_HUMAN	complement component 1, q subcomponent, B chain						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|inner ear development (GO:0048839)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(1)|lung(9)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.06e-27)|Colorectal(126;1.58e-07)|GBM - Glioblastoma multiforme(114;6.72e-06)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000551)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GGAGAGAAAGGTACCATGGGA	0.577																																						ENST00000314933.6	1.000000	6.600000e-01	9.800000e-01	7.800000e-01	0.890000	0.887354	0.890000	1.000000																										0				14						c.e2+1		complement component 1, q subcomponent, B chain	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						24.0	26.0	26.0					1																	22986137		2203	4299	6502	SO:0001630	splice_region_variant	713	0	0					g.chr1:22986137G>A	X03084	CCDS228.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173369	ENSG00000173369		"""Complement system"""	1242	protein-coding gene	gene with protein product		120570	"""complement component 1, q subcomponent, beta polypeptide"""			1537612	Standard	XM_005245982		Approved		uc001bgd.3	P02746	OTTHUMG00000002896	ENST00000314933.6:c.187+1G>A	chr1.hg19:g.22986137G>A		1					C1QB_ENST00000509305.1_Splice_Site		NM_000491.3	NP_000482.3	0	1	1	1.339633	P02746	C1QB_HUMAN		2	319	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q5T959|Q96H17	Splice_Site	SNP	ENST00000314933.6	0	1	hg19		CCDS228.1	1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336484	0.60963	.	.	ENSG00000173369	ENST00000510260;ENST00000509305;ENST00000432749;ENST00000314933	.	.	.	4.71	4.71	0.59529	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6031	0.62031	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	C1QB	22858724	22858724	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	6.184000	0.72008	2.350000	0.79820	0.549000	0.68633	.	0.540933		TCGA-FB-AAPU-01A-31D-A40W-08	0.577	C1QB-201	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	13		13	13	1	2	-20.000000	1	0.700000	NM_000491	Intron		21	21		18	17	1		1			0	0	13	0		1.000000	0	0	0	0	0	0	21	18
PAPPA2	60676	broad.mit.edu	37	1	176659486	176659486	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:176659486G>A	ENST00000367662.3	+	5	3515	c.2351G>A	c.(2350-2352)cGg>cAg	p.R784Q	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R784Q	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	784					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GAGCTGTGCCGGGAACCAGAG	0.577																																						ENST00000367662.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				226						c.(2350-2352)cGg>cAg		pappalysin 2							88.0	92.0	90.0					1																	176659486		1966	4133	6099	SO:0001583	missense	60676	5	120900	39				g.chr1:176659486G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2351G>A	chr1.hg19:g.176659486G>A	ENSP00000356634:p.Arg784Gln	1					PAPPA2_ENST00000367661.3_Missense_Mutation_p.R784Q	p.R784Q	NM_020318.2	NP_064714.2	2	2	4	3.310555	Q9BXP8	PAPP2_HUMAN		5	3515	+			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	1	1	hg19	c.2351G>A	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	G	2.709	-0.269311	0.05716	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.29917	4.8;1.55	5.51	-1.73	0.08081	5.51	-1.73	0.08081	Peptidase M43, pregnancy-associated plasma-A (1);	0.652550	0.16106	N	0.229335	T	0.17704	0.0425	N	0.25647	0.755	0.30128	N	0.805098	B;B	0.24483	0.104;0.024	B;B	0.21917	0.037;0.012	T	0.34750	-0.9816	10	0.09843	T	0.71	-0.187	13.3144	0.60399	0.3731:0.0:0.6269:0.0	.	784;784	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	Q	784	ENSP00000356634:R784Q;ENSP00000356633:R784Q	ENSP00000356633:R784Q	R	+	2	0	0	PAPPA2	174926109	174926109	1.000000	0.71417	0.863000	0.33907	0.014000	0.08584	1.367000	0.34204	-0.594000	0.05836	-0.251000	0.11542	CGG	0.819059		TCGA-FB-AAPU-01A-31D-A40W-08	0.577	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1	1	0	1		2	2	2	0		0	0	84		84	83	1	2	-20.000000	1	0.700000				252	252		382	373	1		1			0	0	84	0		1.000000	0	0	0	0	0	0	252	382
TMEM53	79639	broad.mit.edu	37	1	45120689	45120689	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:45120689G>C	ENST00000372237.3	-	3	539	c.376C>G	c.(376-378)Ctc>Gtc	p.L126V	TMEM53_ENST00000372235.3_Missense_Mutation_p.L96V|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000476724.1_5'UTR|TMEM53_ENST00000372243.3_Intron|TMEM53_ENST00000372242.3_Missense_Mutation_p.L126V	NM_024587.2	NP_078863.2	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	126						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(3)|ovary(2)|urinary_tract(1)	10	Acute lymphoblastic leukemia(166;0.155)					GTCTGCAGGAGCTCCAGCACG	0.612											OREG0013446	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000372237.3	0.240000	4.000000e-02	1.700000e-01	7.000000e-02	0.110000	0.130346	0.110000	0.100000																										0				10						c.(376-378)Ctc>Gtc		transmembrane protein 53							50.0	51.0	51.0					1																	45120689		2203	4300	6503	SO:0001583	missense	79639	0	0					g.chr1:45120689G>C		CCDS511.1, CCDS72773.1	1p34.1	2008-02-26			ENSG00000126106	ENSG00000126106			26186	protein-coding gene	gene with protein product						12958361	Standard	XR_425151		Approved	FLJ22353, NET4	uc001cmc.3	Q6P2H8	OTTHUMG00000007833	ENST00000372237.3:c.376C>G	chr1.hg19:g.45120689G>C	ENSP00000361311:p.Leu126Val	0		OREG0013446	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	929	TMEM53_ENST00000372242.3_Missense_Mutation_p.L126V|TMEM53_ENST00000476724.1_5'UTR|TMEM53_ENST00000372235.3_Missense_Mutation_p.L96V|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000372243.3_Intron	p.L126V	NM_024587.2	NP_078863.2	1	2	3	2.031693	Q6P2H8	TMM53_HUMAN		3	539	-	Acute lymphoblastic leukemia(166;0.155)		B4DKG0|Q5JPH2|Q6IA07|Q9H6E2	Missense_Mutation	SNP	ENST00000372237.3	1	1	hg19	c.376C>G	CCDS511.1	0	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521758	0.64747	.	.	ENSG00000126106	ENST00000372242;ENST00000372237;ENST00000372235;ENST00000420706	.	.	.	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.129271	0.52532	D	0.000064	T	0.69305	0.3096	M	0.67953	2.075	0.58432	D	0.999997	D	0.69078	0.997	D	0.70716	0.97	T	0.65278	-0.6207	9	0.22706	T	0.39	.	10.263	0.43438	0.0751:0.1477:0.7771:0.0	.	126	Q6P2H8	TMM53_HUMAN	V	126;126;96;95	.	ENSP00000361309:L96V	L	-	1	0	0	TMEM53	44893276	44893276	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.322000	0.52007	2.687000	0.91594	0.563000	0.77884	CTC	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.612	TMEM53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021599.1	0	0	1		2	2	2	0		0	0	58		58	57	1	2	-8.650731	1	0.700000	NM_024587			6	6		157	154	0		1	1		0	0	58	0		0.963820	7.227515e-01	0	5	0	61	0	6	157
ZZZ3	26009	broad.mit.edu	37	1	78031331	78031331	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:78031331G>C	ENST00000370801.3	-	15	3181	c.2706C>G	c.(2704-2706)aaC>aaG	p.N902K	ZZZ3_ENST00000370798.1_Missense_Mutation_p.N408K|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	902					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						CATGTCATCTGTTTGCTGGAA	0.388																																						ENST00000370801.3	1.000000	7.300000e-01	1	8.100000e-01	0.910000	0.908258	0.910000	1.000000																										0				39						c.(2704-2706)aaC>aaG		zinc finger, ZZ-type containing 3							179.0	151.0	161.0					1																	78031331		2203	4300	6503	SO:0001583	missense	26009	0	0					g.chr1:78031331G>C	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2706C>G	chr1.hg19:g.78031331G>C	ENSP00000359837:p.Asn902Lys	0					ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.N408K	p.N902K	NM_015534.4	NP_056349.1	1	2	3	2.031693	Q8IYH5	ZZZ3_HUMAN		15	3181	-			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	1	1	hg19	c.2706C>G	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607382	0.46527	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	.	.	.	5.15	4.23	0.50019	5.15	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.59252	0.2180	L	0.50333	1.59	0.58432	D	0.999999	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.87578	0.991;0.996;0.998	T	0.65067	-0.6258	9	0.87932	D	0	.	9.2332	0.37450	0.2136:0.0:0.7864:0.0	.	408;902;901	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	K	902;408	.	ENSP00000359834:N408K	N	-	3	2	2	ZZZ3	77803919	77803919	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.295000	0.51794	1.500000	0.48636	-0.218000	0.12543	AAC	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.388	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	1	0	1		2	2	2	0		0	0	47		47	47	1	2	-20.000000	1	0.700000	NM_015534			62	62		133	131	1		1	1		0	0	47	0		1.000000	9.999991e-01	0	23	0	27	0	62	133
MCOLN2	255231	broad.mit.edu	37	1	85417986	85417986	+	Silent	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:85417986G>A	ENST00000370608.3	-	6	754	c.687C>T	c.(685-687)ggC>ggT	p.G229G	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Silent_p.G201G	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	229					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		GTAGGTCAATGCCTTTAAGAT	0.328																																						ENST00000370608.3	0.360000	1.100000e-01	2.800000e-01	1.500000e-01	0.210000	0.228433	0.210000	0.200000																										0				18						c.(685-687)ggC>ggT		mucolipin 2							98.0	98.0	98.0					1																	85417986		2203	4300	6503	SO:0001819	synonymous_variant	255231	0	0					g.chr1:85417986G>A	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.687C>T	chr1.hg19:g.85417986G>A		0					MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Silent_p.G201G	p.G229G	NM_153259.2	NP_694991.2	1	2	3	2.031693	Q8IZK6	MCLN2_HUMAN		6	754	-			A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Silent	SNP	ENST00000370608.3	1	1	hg19	c.687C>T	CCDS30762.1	0																																																																																								0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.328	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	1	0	1		2	2	2	0		0	0	44		44	44	1	2	-6.052750	1	0.700000	NM_153259			13	13		167	164	0		1			0	0	44	0		0.999548	0	0	0	0	0	0	13	167
ABCA4	24	broad.mit.edu	37	1	94578575	94578575	+	Silent	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:94578575G>C	ENST00000370225.3	-	2	200	c.114C>G	c.(112-114)gtC>gtG	p.V38V	ABCA4_ENST00000535735.1_Silent_p.V38V	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	38					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		ACCAGATCAAGACCAGAAATA	0.443																																						ENST00000370225.3	0.630000	3.800000e-01	5.600000e-01	4.300000e-01	0.490000	0.505724	0.490000	0.500000																										0				147						c.(112-114)gtC>gtG		ATP-binding cassette, sub-family A (ABC1), member 4							118.0	109.0	112.0					1																	94578575		2203	4300	6503	SO:0001819	synonymous_variant	24	0	0					g.chr1:94578575G>C	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.114C>G	chr1.hg19:g.94578575G>C		0					ABCA4_ENST00000535735.1_Silent_p.V38V	p.V38V	NM_000350.2	NP_000341.2	1	2	3	2.031693	P78363	ABCA4_HUMAN		2	200	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	1	1	hg19	c.114C>G	CCDS747.1	0																																																																																								0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.443	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	1	0	1		2	2	2	0		0	0	101		101	100	1	2	-20.000000	1	0.700000	NM_000350			60	60		288	285	1		1			0	0	101	0		1.000000	0	0	0	0	0	0	60	288
FH	2271	broad.mit.edu	37	1	241671912	241671912	+	Silent	SNP	A	A	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr1:241671912A>G	ENST00000366560.3	-	5	767	c.729T>C	c.(727-729)acT>acC	p.T243T		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	243					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		CCTGCCCAAGAGTAAGTGGAA	0.398			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												Melanoma(148;1573 2486 7381 46575)	ENST00000366560.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000			yes	Rec		hereditary leiomyomatosis and renal cell cancer	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	1q42.1	2271	Mis, N, F	fumarate hydratase				"""E, M"""	E, M		lieomyomatosis, renal			0				26						c.(727-729)acT>acC		fumarate hydratase							123.0	116.0	118.0					1																	241671912		2203	4300	6503	SO:0001819	synonymous_variant	2271	0	0		Hereditary Leiomyomatosis and Renal Cell Cancer	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	g.chr1:241671912A>G	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.729T>C	chr1.hg19:g.241671912A>G		1						p.T243T	NM_000143.3	NP_000134.2	1	2	3	2.592080	P07954	FUMH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	5	767	-	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	B1ANK7	Silent	SNP	ENST00000366560.3	1	1	hg19	c.729T>C	CCDS1617.1	1																																																																																								0.771254		TCGA-FB-AAPU-01A-31D-A40W-08	0.398	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	1	0	1		2	2	2	0		0	0	66		66	66	1	2	-20.000000	1	0.700000	NM_000143			130	130		128	128	1		1	1		0	0	66	0		1.000000	1	0	226	0	138	0	130	128
CASS4	57091	broad.mit.edu	37	20	55033569	55033569	+	Silent	SNP	C	C	T	rs372142142		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr20:55033569C>T	ENST00000360314.3	+	7	2352	c.2127C>T	c.(2125-2127)gtC>gtT	p.V709V	AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000434344.1_Silent_p.V272V|CASS4_ENST00000371336.3_Silent_p.V709V	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	709					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GCAAGCTGGTCATCATGGTGG	0.617																																						ENST00000360314.3	1.000000	8.000000e-01	1	8.800000e-01	0.970000	0.953038	0.970000	1.000000																										0				54						c.(2125-2127)gtC>gtT		Cas scaffolding protein family member 4		C	,,,	1,4405	2.1+/-5.4	0,1,2202	92.0	78.0	83.0		1965,816,2127,2127	4.0	0.9	20		83	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CASS4	NM_001164114.1,NM_001164115.1,NM_001164116.1,NM_020356.3	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	655/733,272/350,709/787,709/787	55033569	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57091	0	0					g.chr20:55033569C>T	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.2127C>T	chr20.hg19:g.55033569C>T		0					AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000371336.3_Silent_p.V709V|CASS4_ENST00000434344.1_Silent_p.V272V	p.V709V	NM_001164116.1	NP_001157588.1	0	0	0	2.006393	Q9NQ75	CASS4_HUMAN		7	2352	+			E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Silent	SNP	ENST00000360314.3	1	1	hg19	c.2127C>T	CCDS33492.1	1																																																																																								0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.617	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	1	0	1		2	2	2	0		0	0	44		44	44	1	2	-20.000000	1	0.700000	NM_020356			79	78		152	150	1		1	0		0	0	44	0		1.000000	0	0	0	0	1	0	79	152
CDH4	1002	broad.mit.edu	37	20	60511862	60511862	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr20:60511862A>G	ENST00000360469.5	+	16	2700	c.2612A>G	c.(2611-2613)gAg>gGg	p.E871G	CDH4_ENST00000543233.1_Missense_Mutation_p.E797G	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	871					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TTCGACTACGAGGGGAGCGGC	0.627																																						ENST00000360469.5	0.540000	2.600000e-01	4.700000e-01	3.200000e-01	0.390000	0.400597	0.390000	0.390000																										0				74						c.(2611-2613)gAg>gGg		cadherin 4, type 1, R-cadherin (retinal)							48.0	46.0	47.0					20																	60511862		2203	4299	6502	SO:0001583	missense	1002	0	0					g.chr20:60511862A>G	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.2612A>G	chr20.hg19:g.60511862A>G	ENSP00000353656:p.Glu871Gly	0					CDH4_ENST00000543233.1_Missense_Mutation_p.E797G	p.E871G	NM_001794.3	NP_001785.2	0	0	0	2.006393	P55283	CADH4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.36e-08)	16	2700	+			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	1	1	hg19	c.2612A>G	CCDS13488.1	0	.	.	.	.	.	.	.	.	.	.	A	23.6	4.433272	0.83776	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	D;D	0.87966	-2.32;-2.32	4.49	4.49	0.54785	4.49	4.49	0.54785	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.94827	0.8329	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95944	0.8949	9	.	.	.	.	13.8037	0.63218	1.0:0.0:0.0:0.0	.	871	P55283	CADH4_HUMAN	G	871;779;797	ENSP00000353656:E871G;ENSP00000443301:E797G	.	E	+	2	0	0	CDH4	59945257	59945257	1.000000	0.71417	0.695000	0.30226	0.635000	0.38103	9.016000	0.93645	1.681000	0.50988	0.383000	0.25322	GAG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.627	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	1	0	1		2	2	2	0		0	0	38		38	38	1	2	-20.000000	1	0.700000	NM_001794			25	25		158	156	1		1			0	0	38	0		1.000000	0	0	0	0	0	0	25	158
LSM14B	149986	broad.mit.edu	37	20	60701454	60701454	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr20:60701454G>A	ENST00000279068.6	+	3	546	c.386G>A	c.(385-387)aGc>aAc	p.S129N	LSM14B_ENST00000370915.1_Missense_Mutation_p.S129N|LSM14B_ENST00000253001.4_Missense_Mutation_p.S129N	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	129					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CTGGCGGCCAGCTCCCTGCTC	0.627																																						ENST00000279068.6	1.000000	7.700000e-01	1	8.900000e-01	0.990000	0.959764	0.990000	1.000000																										0				8						c.(385-387)aGc>aAc		LSM14B, SCD6 homolog B (S. cerevisiae)							35.0	39.0	38.0					20																	60701454		2028	4169	6197	SO:0001583	missense	149986	0	0					g.chr20:60701454G>A	AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.386G>A	chr20.hg19:g.60701454G>A	ENSP00000279068:p.Ser129Asn	0					LSM14B_ENST00000370915.1_Missense_Mutation_p.S129N|LSM14B_ENST00000253001.4_Missense_Mutation_p.S129N	p.S129N	NM_144703.2	NP_653304.2	0	0	0	2.006393	Q9BX40	LS14B_HUMAN	BRCA - Breast invasive adenocarcinoma(19;1.28e-07)	3	546	+	Breast(26;3.97e-09)		Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	1	1	hg19	c.386G>A	CCDS46626.1	1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724866	0.68959	.	.	ENSG00000149657	ENST00000370915;ENST00000279068;ENST00000253001;ENST00000444156;ENST00000400318;ENST00000279069;ENST00000370906;ENST00000361670	T;T;T;T	0.55588	0.88;0.87;0.9;0.51	5.42	5.42	0.78866	5.42	5.42	0.78866	.	0.162938	0.64402	D	0.000002	T	0.56001	0.1956	M	0.75264	2.295	0.40246	D	0.978013	B;P;P;P;B	0.44429	0.134;0.647;0.799;0.835;0.047	B;B;B;B;B	0.41666	0.037;0.146;0.156;0.363;0.031	T	0.63056	-0.6722	10	0.49607	T	0.09	.	14.7797	0.69756	0.0:0.144:0.856:0.0	.	10;10;129;155;129	E9PG81;C9J454;Q9BX40;Q5TBQ0;Q9BX40-2	.;.;LS14B_HUMAN;.;.	N	129;129;129;10;155;129;10;10	ENSP00000279068:S129N;ENSP00000253001:S129N;ENSP00000383172:S155N;ENSP00000355209:S10N	ENSP00000253001:S129N	S	+	2	0	0	LSM14B	60134849	60134849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.436000	0.66538	2.529000	0.85273	0.511000	0.50034	AGC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.627	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4	1	0	1		2	2	2	0		0	0	26		26	26	1	2	-20.000000	1	0.700000	NM_144703			43	43		78	75	1		1	1		0	0	26	0		1.000000	9.999999e-01	0	25	0	28	0	43	78
ADAMTS1	9510	broad.mit.edu	37	21	28214913	28214913	+	Silent	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr21:28214913G>A	ENST00000284984.3	-	2	1276	c.822C>T	c.(820-822)caC>caT	p.H274H		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	274	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		GACCACTGCCGTGGAATTCTG	0.483																																						ENST00000284984.3	0.150000	3.000000e-02	1.100000e-01	5.000000e-02	0.070000	0.084719	0.070000	0.080000																										0				42						c.(820-822)caC>caT		ADAM metallopeptidase with thrombospondin type 1 motif, 1							80.0	71.0	74.0					21																	28214913		2203	4300	6503	SO:0001819	synonymous_variant	9510	0	0					g.chr21:28214913G>A	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.822C>T	chr21.hg19:g.28214913G>A		0						p.H274H	NM_006988.3	NP_008919.3	1	2	3	2.013662	Q9UHI8	ATS1_HUMAN		2	1276	-		Breast(209;0.000962)	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Silent	SNP	ENST00000284984.3	1	1	hg19	c.822C>T	CCDS33524.1	0	.	.	.	.	.	.	.	.	.	.	G	9.460	1.092734	0.20471	.	.	ENSG00000154734	ENST00000451462	.	.	.	5.44	-1.59	0.08453	5.44	-1.59	0.08453	.	.	.	.	.	T	0.58509	0.2127	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56481	-0.7972	4	.	.	.	.	12.2727	0.54716	0.6587:0.0:0.3413:0.0	.	.	.	.	M	56	.	.	T	-	2	0	0	ADAMTS1	27136784	27136784	0.097000	0.21791	0.993000	0.49108	0.987000	0.75469	-0.483000	0.06536	-0.211000	0.10124	-0.768000	0.03414	ACG	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.483	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2	0	0	1		2	2	2	0		0	0	85		85	85	1	2	-3.475365	1	0.700000				9	9		327	317	0		1	0		0	0	85	0		0.993546	1.409441e-01	0	0	0	22	0	9	327
TMPRSS3	64699	broad.mit.edu	37	21	43815480	43815480	+	Missense_Mutation	SNP	C	C	T	rs369418733		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr21:43815480C>T	ENST00000291532.3	-	2	1002	c.47G>A	c.(46-48)cGa>cAa	p.R16Q	TMPRSS3_ENST00000398397.3_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R100Q|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.R16Q	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	16					cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						AAAAAGCGATCGGAATGAGAA	0.517																																						ENST00000291532.3	1.000000	7.500000e-01	1	8.600000e-01	0.970000	0.943428	0.970000	1.000000																										0				13						c.(46-48)cGa>cAa		transmembrane protease, serine 3		C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	102.0	107.0		47,47	4.5	1.0	21		107	0,8600		0,0,4300	no	missense,missense	TMPRSS3	NM_024022.2,NM_032405.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	16/455,16/345	43815480	1,13005	2203	4300	6503	SO:0001583	missense	64699	5	121412	41				g.chr21:43815480C>T	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.47G>A	chr21.hg19:g.43815480C>T	ENSP00000291532:p.Arg16Gln	0					TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R100Q|TMPRSS3_ENST00000398397.3_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.R16Q	p.R16Q	NM_032404.2	NP_115780.1	1	2	3	2.013662	P57727	TMPS3_HUMAN		2	1002	-			D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	1	1	hg19	c.47G>A	CCDS13686.1	1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916630	0.73098	2.27E-4	0.0	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	D;D;D;D;D	0.88354	-2.33;-2.33;-2.33;-2.37;-2.33	5.39	4.5	0.54988	5.39	4.5	0.54988	.	0.132141	0.36628	N	0.002499	T	0.80276	0.4593	N	0.19112	0.55	0.28577	N	0.910325	D;P;P	0.57899	0.981;0.948;0.913	B;B;B	0.43916	0.436;0.237;0.12	T	0.74551	-0.3628	9	.	.	.	.	9.3585	0.38182	0.0:0.904:0.0:0.096	.	16;16;16	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	Q	16;16;16;100;16	ENSP00000291532:R16Q;ENSP00000411013:R16Q;ENSP00000381442:R16Q;ENSP00000369762:R100Q;ENSP00000381434:R16Q	.	R	-	2	0	0	TMPRSS3	42688549	42688549	0.993000	0.37304	0.956000	0.39512	0.959000	0.62525	1.712000	0.37940	2.691000	0.91804	0.655000	0.94253	CGA	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.517	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1	1	0	1		2	2	2	0		0	0	44		44	43	1	2	-7.570966	1	0.700000				47	46		91	87	1		1	1		0	0	44	0		1.000000	9.999965e-01	0	8	0	35	0	47	91
TRMT2A	27037	broad.mit.edu	37	22	20103778	20103778	+	Missense_Mutation	SNP	C	C	T	rs200653246		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:20103778C>T	ENST00000252136.7	-	2	770	c.382G>A	c.(382-384)Gtt>Att	p.V128I	TRMT2A_ENST00000492988.1_5'Flank|RANBP1_ENST00000402752.1_5'Flank|TRMT2A_ENST00000404751.3_Missense_Mutation_p.V128I|RANBP1_ENST00000331821.3_5'Flank|TRMT2A_ENST00000403707.3_Missense_Mutation_p.V128I|TRMT2A_ENST00000439169.2_Missense_Mutation_p.V128I|RANBP1_ENST00000430524.1_5'UTR	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	128	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)			breast(2)|endometrium(2)|lung(5)	9						CCATGCAAAACGCGCAGGGCC	0.647																																						ENST00000252136.7	1.000000	6.600000e-01	9.300000e-01	7.400000e-01	0.830000	0.837693	0.830000	0.830000																										0				9						c.(382-384)Gtt>Att		tRNA methyltransferase 2 homolog A (S. cerevisiae)							47.0	48.0	47.0					22																	20103778		2203	4299	6502	SO:0001583	missense	27037	1	121382	33				g.chr22:20103778C>T	BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.382G>A	chr22.hg19:g.20103778C>T	ENSP00000252136:p.Val128Ile	0					RANBP1_ENST00000331821.3_5'Flank|RANBP1_ENST00000402752.1_5'Flank|TRMT2A_ENST00000403707.3_Missense_Mutation_p.V128I|TRMT2A_ENST00000492988.1_5'Flank|TRMT2A_ENST00000404751.3_Missense_Mutation_p.V128I|TRMT2A_ENST00000439169.2_Missense_Mutation_p.V128I|RANBP1_ENST00000430524.1_5'UTR	p.V128I	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	1	2	3	2.029302	Q8IZ69	TRM2A_HUMAN		2	770	-			D3DX25|Q32P57|Q96ME6|Q9H732	Missense_Mutation	SNP	ENST00000252136.7	0	1	hg19	c.382G>A	CCDS13774.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.87|15.87	2.960083|2.960083	0.53400|0.53400	.|.	.|.	ENSG00000099901|ENSG00000099899	ENST00000432879|ENST00000252136;ENST00000403707;ENST00000404751;ENST00000439169;ENST00000445045	.|T;T;T;T;T	.|0.41758	.|3.17;3.17;3.17;3.17;0.99	5.68|5.68	4.67|4.67	0.58626|0.58626	5.68|5.68	4.67|4.67	0.58626|0.58626	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.|0.189905	.|0.47093	.|D	.|0.000254	T|T	0.33962|0.33962	0.0881|0.0881	L|L	0.31065|0.31065	0.9|0.9	0.80722|0.80722	D|D	1|1	.|P;B;B	.|0.50369	.|0.934;0.003;0.0	.|B;B;B	.|0.43478	.|0.421;0.005;0.003	T|T	0.05402|0.05402	-1.0887|-1.0887	6|10	0.54805|0.27785	T|T	0.06|0.31	-28.7311|-28.7311	14.5387|14.5387	0.67979|0.67979	0.0:0.9287:0.0:0.0713|0.0:0.9287:0.0:0.0713	.|.	.|128;128;128	.|B4E213;F2Z2W7;Q8IZ69	.|.;.;TRM2A_HUMAN	M|I	24|128;128;128;128;116	.|ENSP00000252136:V128I;ENSP00000385807:V128I;ENSP00000384968:V128I;ENSP00000395738:V128I;ENSP00000393911:V116I	ENSP00000404724:T24M|ENSP00000252136:V128I	T|V	+|-	2|1	0|0	0|0	RANBP1|TRMT2A	18483778|18483778	18483778|18483778	0.851000|0.851000	0.29673|0.29673	0.928000|0.928000	0.36995|0.36995	0.657000|0.657000	0.38888|0.38888	2.040000|2.040000	0.41203|0.41203	1.422000|1.422000	0.47177|0.47177	-0.424000|-0.424000	0.05967|0.05967	ACG|GTT	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.647	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318168.3	1	0	1		2	2	2	0		0	0	43		43	43	1	2	-20.000000	1	0.700000	NM_022727			62	62		152	152	1		1	1		0	0	43	0		1.000000	9.999310e-01	0	13	0	26	0	62	152
TOP3B	8940	broad.mit.edu	37	22	22316871	22316871	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:22316871C>T	ENST00000398793.2	-	13	1889	c.1455G>A	c.(1453-1455)gaG>gaA	p.E485E	TOP3B_ENST00000413067.2_Silent_p.E214E|TOP3B_ENST00000357179.5_Silent_p.E485E	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	485					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TCGTCTGCTTCTCCAGCATCT	0.662																																						ENST00000398793.2	0.300000	1.000000e-01	2.400000e-01	1.300000e-01	0.180000	0.196061	0.180000	0.180000																										0				26						c.(1453-1455)gaG>gaA		topoisomerase (DNA) III beta							85.0	72.0	77.0					22																	22316871		2203	4300	6503	SO:0001819	synonymous_variant	8940	0	0					g.chr22:22316871C>T	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1455G>A	chr22.hg19:g.22316871C>T		0					TOP3B_ENST00000357179.5_Silent_p.E485E|TOP3B_ENST00000413067.2_Silent_p.E214E	p.E485E	NM_003935.3	NP_003926.1	1	2	3	2.029302	O95985	TOP3B_HUMAN		13	1889	-	Colorectal(54;0.105)		A0M8Q3|Q9BUP5	Silent	SNP	ENST00000398793.2	1	1	hg19	c.1455G>A	CCDS13797.1	0	.	.	.	.	.	.	.	.	.	.	C	8.858	0.946274	0.18356	.	.	ENSG00000100038	ENST00000457270	.	.	.	5.12	4.1	0.47936	5.12	4.1	0.47936	.	.	.	.	.	T	0.58438	0.2122	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55231	-0.8173	4	.	.	.	.	8.1485	0.31126	0.0:0.7409:0.0:0.2591	.	.	.	.	K	280	.	.	R	-	2	0	0	TOP3B	20646871	20646871	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	3.352000	0.52239	1.141000	0.42275	0.563000	0.77884	AGA	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.662	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	1	0	1		2	2	2	0		0	0	49		49	48	1	2	-17.527500	1	0.700000	NM_003935			14	13		213	209	0		1	1		0	0	49	0		0.999745	5.946364e-01	0	3	0	28	0	14	213
SUSD2	56241	broad.mit.edu	37	22	24579094	24579094	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:24579094C>G	ENST00000358321.3	+	2	407	c.146C>G	c.(145-147)tCt>tGt	p.S49C		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	49	SMB. {ECO:0000255|PROSITE- ProRule:PRU00350}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CCGACGTGCTCTGGCCTTGGC	0.632																																						ENST00000358321.3	0.360000	2.000000e-01	3.100000e-01	2.300000e-01	0.270000	0.283363	0.270000	0.270000																										0				26						c.(145-147)tCt>tGt		sushi domain containing 2							135.0	147.0	143.0					22																	24579094		2203	4300	6503	SO:0001583	missense	56241	0	0					g.chr22:24579094C>G	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.146C>G	chr22.hg19:g.24579094C>G	ENSP00000351075:p.Ser49Cys	0						p.S49C	NM_019601.3	NP_062547.1	1	2	3	2.029302	Q9UGT4	SUSD2_HUMAN		2	407	+			Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	1	1	hg19	c.146C>G	CCDS13824.1	0	.	.	.	.	.	.	.	.	.	.	C	7.214	0.596096	0.13875	.	.	ENSG00000099994	ENST00000358321	T	0.44482	0.92	3.76	1.58	0.23477	3.76	1.58	0.23477	Somatomedin B domain (4);	1.140860	0.06462	N	0.729556	T	0.38931	0.1059	L	0.44542	1.39	0.09310	N	1	P	0.40731	0.728	P	0.44732	0.459	T	0.30679	-0.9970	10	0.51188	T	0.08	-8.1814	3.3614	0.07188	0.1932:0.5932:0.0:0.2136	.	49	Q9UGT4	SUSD2_HUMAN	C	49	ENSP00000351075:S49C	ENSP00000351075:S49C	S	+	2	0	0	SUSD2	22909094	22909094	0.000000	0.05858	0.353000	0.25747	0.062000	0.15995	-3.602000	0.00418	0.371000	0.24564	0.449000	0.29647	TCT	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.632	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	1	0	0		2	2	2	0		0	0	145		145	148	1	2	-16.320620	1	0.700000	NM_019601			58	58		554	536	1		1	0		0	0	145	0		1.000000	2.861161e-01	0	0	0	11	0	58	554
THOC5	8563	broad.mit.edu	37	22	29915009	29915009	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:29915009T>C	ENST00000490103.1	-	15	1597	c.1475A>G	c.(1474-1476)cAg>cGg	p.Q492R	THOC5_ENST00000397872.1_Missense_Mutation_p.Q492R|THOC5_ENST00000397873.2_Missense_Mutation_p.Q492R|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Missense_Mutation_p.Q492R	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	492					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGATGCAAACTGTTTGTGGAG	0.507																																						ENST00000490103.1	0.350000	2.000000e-01	3.000000e-01	2.200000e-01	0.260000	0.275048	0.260000	0.260000																										0				21						c.(1474-1476)cAg>cGg		THO complex 5							231.0	197.0	209.0					22																	29915009		2203	4300	6503	SO:0001583	missense	8563	0	0					g.chr22:29915009T>C	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1475A>G	chr22.hg19:g.29915009T>C	ENSP00000420306:p.Gln492Arg	0					THOC5_ENST00000397873.2_Missense_Mutation_p.Q492R|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Missense_Mutation_p.Q492R|THOC5_ENST00000397872.1_Missense_Mutation_p.Q492R	p.Q492R	NM_003678.4	NP_003669.4	1	2	3	2.029302	Q13769	THOC5_HUMAN		15	1597	-			O60839|Q9UPZ5	Missense_Mutation	SNP	ENST00000490103.1	1	1	hg19	c.1475A>G	CCDS13859.1	0	.	.	.	.	.	.	.	.	.	.	T	27.7	4.858213	0.91433	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.76	5.76	0.90799	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.43743	0.1261	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.29274	-1.0017	10	0.45353	T	0.12	-17.1228	15.0502	0.71862	0.0:0.0:0.0:1.0	.	492	Q13769	THOC5_HUMAN	R	492	ENSP00000420306:Q492R;ENSP00000380970:Q492R;ENSP00000380969:Q492R;ENSP00000380971:Q492R	ENSP00000380969:Q492R	Q	-	2	0	0	THOC5	28245009	28245009	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.779000	0.85648	2.201000	0.70794	0.533000	0.62120	CAG	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.507	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	1	0	1		2	2	2	0		0	0	147		147	145	1	2	-20.000000	1	0.700000	NM_003678			59	59		583	571	1		1	1		0	0	147	0		1.000000	8.901238e-01	0	5	0	35	0	59	583
TMPRSS6	164656	broad.mit.edu	37	22	37466587	37466587	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:37466587C>A	ENST00000346753.3	-	15	1921	c.1805G>T	c.(1804-1806)tGt>tTt	p.C602F	TMPRSS6_ENST00000406725.1_Missense_Mutation_p.C593F|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.C593F|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.C593F	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	602	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GGCCCCCCCACAGATGTGTCG	0.662																																						ENST00000346753.3	0.210000	6.000000e-02	1.700000e-01	9.000000e-02	0.120000	0.140540	0.120000	0.120000																										0				40						c.(1804-1806)tGt>tTt		transmembrane protease, serine 6							53.0	56.0	55.0					22																	37466587		2203	4300	6503	SO:0001583	missense	164656	0	0					g.chr22:37466587C>A	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.1805G>T	chr22.hg19:g.37466587C>A	ENSP00000334962:p.Cys602Phe	0					TMPRSS6_ENST00000406725.1_Missense_Mutation_p.C593F|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.C593F|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.C593F	p.C602F	NM_153609.2	NP_705837.1	1	2	3	2.029302	Q8IU80	TMPS6_HUMAN		15	1921	-			B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	1	1	hg19	c.1805G>T	CCDS13941.1	0	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928706	0.92389	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08	5.44	5.44	0.79542	5.44	5.44	0.79542	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.99579	0.9848	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97650	1.0154	10	0.87932	D	0	.	19.2437	0.93893	0.0:1.0:0.0:0.0	.	593;602	Q8IU80-5;Q8IU80	.;TMPS6_HUMAN	F	593;602;593;593	ENSP00000371211:C593F;ENSP00000334962:C602F;ENSP00000385453:C593F;ENSP00000384964:C593F	ENSP00000334962:C602F	C	-	2	0	0	TMPRSS6	35796533	35796533	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.741000	0.84997	2.540000	0.85666	0.591000	0.81541	TGT	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.662	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	1	0	1		2	2	2	0		0	0	86		86	84	1	2	-16.663560	1	0.700000	NM_153609			16	16		352	344	0		1			0	0	86	0		0.999923	0	0	0	0	0	0	16	352
JOSD1	9929	broad.mit.edu	37	22	39084975	39084975	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:39084975C>A	ENST00000216039.5	-	3	1153	c.474G>T	c.(472-474)aaG>aaT	p.K158N		NM_014876.5	NP_055691.1	Q15040	JOS1_HUMAN	Josephin domain containing 1	158	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	omega peptidase activity (GO:0008242)			large_intestine(1)|lung(1)|ovary(2)|pancreas(1)	5	Melanoma(58;0.04)					ACTCGGGCATCTTGAGTTTGG	0.547																																						ENST00000216039.5	0.190000	6.000000e-02	1.500000e-01	9.000000e-02	0.110000	0.132417	0.110000	0.120000																										0				5						c.(472-474)aaG>aaT		Josephin domain containing 1							127.0	108.0	114.0					22																	39084975		2203	4300	6503	SO:0001583	missense	9929	0	0					g.chr22:39084975C>A		CCDS13976.1	22q13.1	2005-11-10			ENSG00000100221	ENSG00000100221			28953	protein-coding gene	gene with protein product		615323				7584044	Standard	NM_014876		Approved	KIAA0063	uc003awf.3	Q15040	OTTHUMG00000151030	ENST00000216039.5:c.474G>T	chr22.hg19:g.39084975C>A	ENSP00000216039:p.Lys158Asn	0						p.K158N	NM_014876.5	NP_055691.1	1	2	3	2.029302	Q15040	JOS1_HUMAN		3	1153	-	Melanoma(58;0.04)		A8K712	Missense_Mutation	SNP	ENST00000216039.5	1	1	hg19	c.474G>T	CCDS13976.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.42|15.42	2.826872|2.826872	0.50739|0.50739	.|.	.|.	ENSG00000100221|ENSG00000100221	ENST00000545590|ENST00000216039	.|T	.|0.42900	.|0.96	5.64|5.64	5.64|5.64	0.86602|0.86602	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	.|0.046800	.|0.85682	.|D	.|0.000000	T|T	0.33990|0.33990	0.0882|0.0882	L|L	0.38953|0.38953	1.18|1.18	0.58432|0.58432	D|D	0.999998|0.999998	.|B	.|0.14438	.|0.01	.|B	.|0.19666	.|0.026	T|T	0.08006|0.08006	-1.0743|-1.0743	5|10	.|0.27082	.|T	.|0.32	.|.	12.9775|12.9775	0.58546|0.58546	0.0:0.9262:0.0:0.0738|0.0:0.9262:0.0:0.0738	.|.	.|158	.|Q15040	.|JOS1_HUMAN	Y|N	110|158	.|ENSP00000216039:K158N	.|ENSP00000216039:K158N	D|K	-|-	1|3	0|2	0|2	JOSD1|JOSD1	37414921|37414921	37414921|37414921	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.897000|0.897000	0.52465|0.52465	2.113000|2.113000	0.41902|0.41902	2.647000|2.647000	0.89833|0.89833	0.655000|0.655000	0.94253|0.94253	GAT|AAG	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.547	JOSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321047.1	0	0	1		2	2	2	0		0	0	91		91	90	1	2	-4.200902	1	0.700000	NM_014876			18	18		421	413	0		1	1		0	0	91	0		0.999980	9.998689e-01	0	13	0	333	0	18	421
L3MBTL2	83746	broad.mit.edu	37	22	41620150	41620150	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:41620150T>A	ENST00000216237.5	+	9	1227	c.1069T>A	c.(1069-1071)Tac>Aac	p.Y357N		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	357					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACGGCTCCTCTACGAGGATGG	0.612																																						ENST00000216237.5	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999904	0.990000	1.000000																										0				24						c.(1069-1071)Tac>Aac		l(3)mbt-like 2 (Drosophila)							75.0	67.0	70.0					22																	41620150		2203	4300	6503	SO:0001583	missense	83746	0	0					g.chr22:41620150T>A	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1069T>A	chr22.hg19:g.41620150T>A	ENSP00000216237:p.Tyr357Asn	0						p.Y357N	NM_031488.4	NP_113676.2	0	0	0	2.007508	Q969R5	LMBL2_HUMAN		9	1227	+			Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	1	1	hg19	c.1069T>A	CCDS14011.1	1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.987915	0.93106	.	.	ENSG00000100395	ENST00000216237	T	0.35789	1.29	5.26	5.26	0.73747	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.65512	0.2698	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72947	-0.4137	10	0.87932	D	0	.	15.1768	0.72920	0.0:0.0:0.0:1.0	.	357;357	Q969R5-3;Q969R5	.;LMBL2_HUMAN	N	357	ENSP00000216237:Y357N	ENSP00000216237:Y357N	Y	+	1	0	0	L3MBTL2	39950096	39950096	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.305000	0.72805	2.008000	0.58898	0.533000	0.62120	TAC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.612	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	1	0	1		2	2	2	0		0	0	53		53	52	1	2	-20.000000	1	0.700000	NM_031488			125	118		169	166	1		1	1		0	0	53	0		1.000000	1	0	24	0	31	0	125	169
BIK	638	broad.mit.edu	37	22	43524566	43524566	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr22:43524566G>C	ENST00000216115.2	+	4	388	c.325G>C	c.(325-327)Gac>Cac	p.D109H		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	109					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)				breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				AAGTTTCATGGACGGTTTCAC	0.517																																						ENST00000216115.2	1.000000	8.300000e-01	9.800000e-01	8.800000e-01	0.930000	0.934386	0.930000	0.950000																										0				5						c.(325-327)Gac>Cac		BCL2-interacting killer (apoptosis-inducing)							130.0	126.0	128.0					22																	43524566		2203	4300	6503	SO:0001583	missense	638	0	0					g.chr22:43524566G>C	U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	ENST00000216115.2:c.325G>C	chr22.hg19:g.43524566G>C	ENSP00000216115:p.Asp109His	1						p.D109H	NM_001197.4	NP_001188.1	0	1	1	1.359079	Q13323	BIK_HUMAN		4	388	+		Ovarian(80;0.0694)	Q16582|Q6FH93	Missense_Mutation	SNP	ENST00000216115.2	1	1	hg19	c.325G>C	CCDS14044.1	1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929535	0.34096	.	.	ENSG00000100290	ENST00000216115	T	0.25414	1.8	3.65	-1.33	0.09172	3.65	-1.33	0.09172	.	.	.	.	.	T	0.24160	0.0585	N	0.19112	0.55	0.09310	N	1	D	0.61080	0.989	P	0.59948	0.866	T	0.16958	-1.0385	9	0.38643	T	0.18	2.1384	4.952	0.14019	0.2262:0.357:0.4168:0.0	.	109	Q13323	BIK_HUMAN	H	109	ENSP00000216115:D109H	ENSP00000216115:D109H	D	+	1	0	0	BIK	41854510	41854510	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.703000	0.01900	-0.087000	0.12528	0.462000	0.41574	GAC	0.540933		TCGA-FB-AAPU-01A-31D-A40W-08	0.517	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319676.1	1	0	1		2	2	2	0		0	0	122		122	120	1	2	-20.000000	1	0.700000	NM_001197			141	141		136	136	1		1	1		0	0	122	0		1.000000	1	0	120	0	0	0	141	136
STEAP3	55240	broad.mit.edu	37	2	120005698	120005698	+	Silent	SNP	C	C	T	rs145832236		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:120005698C>T	ENST00000354888.5	+	4	1440	c.936C>T	c.(934-936)tgC>tgT	p.C312C	STEAP3_ENST00000393108.2_Silent_p.C312C|STEAP3_ENST00000393110.2_Silent_p.C322C|STEAP3_ENST00000450943.2_Silent_p.C312C|STEAP3_ENST00000425223.2_Silent_p.C312C|STEAP3_ENST00000393106.2_Silent_p.C312C|STEAP3_ENST00000393107.2_Silent_p.C312C|STEAP3_ENST00000409811.1_Silent_p.C312C|STEAP3-AS1_ENST00000454260.1_RNA	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	312	Ferric oxidoreductase.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						GCTTCTTCTGCGCCGCCCTGC	0.677																																						ENST00000354888.5	1.000000	8.300000e-01	9.900000e-01	8.900000e-01	0.950000	0.947925	0.950000	0.990000																										0				17						c.(934-936)tgC>tgT		STEAP family member 3, metalloreductase		C	,,	0,4394		0,0,2197	30.0	27.0	28.0		936,936,966	2.6	1.0	2	dbSNP_134	28	1,8577		0,1,4288	no	coding-synonymous,coding-synonymous,coding-synonymous	STEAP3	NM_001008410.1,NM_018234.2,NM_182915.2	,,	0,1,6485	TT,TC,CC		0.0117,0.0,0.0077	,,	312/489,312/489,322/499	120005698	1,12971	2197	4289	6486	SO:0001819	synonymous_variant	55240	8	121074	38				g.chr2:120005698C>T	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.936C>T	chr2.hg19:g.120005698C>T		1					STEAP3_ENST00000409811.1_Silent_p.C312C|STEAP3_ENST00000393106.2_Silent_p.C312C|STEAP3_ENST00000393107.2_Silent_p.C312C|STEAP3_ENST00000425223.2_Silent_p.C312C|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000450943.2_Silent_p.C312C|STEAP3_ENST00000393110.2_Silent_p.C322C|STEAP3_ENST00000393108.2_Silent_p.C312C	p.C312C	NM_182915.2	NP_878919.2	0	1	1	1.343218	Q658P3	STEA3_HUMAN		4	1440	+			A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	1	1	hg19	c.936C>T	CCDS2125.1	1																																																																																								0.538462		TCGA-FB-AAPU-01A-31D-A40W-08	0.677	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	1	0	1		2	2	2	0		0	0	33		33	33	1	2	-19.992270	1	0.700000	NM_018234			70	68		55	54	1		1	1		0	0	33	0		1.000000	9.999974e-01	0	21	0	1	0	70	55
PXDN	7837	broad.mit.edu	37	2	1653014	1653014	+	Silent	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:1653014G>A	ENST00000252804.4	-	17	2588	c.2538C>T	c.(2536-2538)caC>caT	p.H846H		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	846					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGTTGCTGCAGTGCTGTCCGT	0.647																																						ENST00000252804.4	1.000000	7.900000e-01	1	9.200000e-01	0.990000	0.971952	0.990000	1.000000																										0				112						c.(2536-2538)caC>caT		peroxidasin homolog (Drosophila)							33.0	36.0	35.0					2																	1653014		2189	4284	6473	SO:0001819	synonymous_variant	7837	0	0					g.chr2:1653014G>A	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2538C>T	chr2.hg19:g.1653014G>A		0						p.H846H	NM_012293.1	NP_036425.1	0	0	0	1.996559	Q92626	PXDN_HUMAN		17	2588	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	1	1	hg19	c.2538C>T	CCDS46221.1	1																																																																																								0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.647	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	1	0	1		2	2	2	0		0	0	38		38	36	1	2	-20.000000	1	0.700000	XM_056455			34	32		57	54	1		1	0		0	0	38	0		1.000000	9.638596e-01	0	0	0	12	0	34	57
RND3	390	broad.mit.edu	37	2	151326505	151326505	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:151326505A>G	ENST00000375734.2	-	5	980	c.731T>C	c.(730-732)aTg>aCg	p.M244T	RND3_ENST00000263895.4_Missense_Mutation_p.M244T|RND3_ENST00000409557.1_Missense_Mutation_p.M115T|RND3_ENST00000472416.1_5'Flank	NM_001254738.1	NP_001241667.1	P61587	RND3_HUMAN	Rho family GTPase 3	244					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.106)		AAAGATTCACATCACAGTGCA	0.423																																						ENST00000375734.2	1.000000	8.100000e-01	9.800000e-01	8.800000e-01	0.930000	0.934666	0.930000	0.970000																										0				13						c.(730-732)aTg>aCg		Rho family GTPase 3							98.0	91.0	93.0					2																	151326505		2203	4300	6503	SO:0001583	missense	390	0	0					g.chr2:151326505A>G		CCDS2190.1	2q23.3	2008-02-05	2005-01-24	2005-01-27	ENSG00000115963	ENSG00000115963			671	protein-coding gene	gene with protein product		602924	"""ras homolog gene family, member E"""	ARHE		8649376	Standard	NM_001254738		Approved	RhoE, Rho8	uc002txe.3	P61587	OTTHUMG00000131859	ENST00000375734.2:c.731T>C	chr2.hg19:g.151326505A>G	ENSP00000364886:p.Met244Thr	1					RND3_ENST00000472416.1_5'Flank|RND3_ENST00000409557.1_Missense_Mutation_p.M115T|RND3_ENST00000263895.4_Missense_Mutation_p.M244T	p.M244T	NM_001254738.1	NP_001241667.1	0	1	1	1.350572	P61587	RND3_HUMAN		5	980	-			D3DP95|P52199	Missense_Mutation	SNP	ENST00000375734.2	1	1	hg19	c.731T>C	CCDS2190.1	1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.498553	0.64298	.	.	ENSG00000115963	ENST00000375734;ENST00000263895;ENST00000409557	T;T;T	0.68624	-0.34;-0.34;2.26	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.033764	0.85682	D	0.000000	T	0.75517	0.3860	M	0.64404	1.975	0.80722	D	1	P;D;D	0.55800	0.597;0.973;0.973	P;P;P	0.55345	0.774;0.663;0.663	T	0.78560	-0.2157	10	0.87932	D	0	-26.2874	15.3525	0.74399	1.0:0.0:0.0:0.0	.	107;243;244	B4DSG7;D3DP96;P61587	.;.;RND3_HUMAN	T	244;244;115	ENSP00000364886:M244T;ENSP00000263895:M244T;ENSP00000386576:M115T	ENSP00000263895:M244T	M	-	2	0	0	RND3	151034751	151034751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.335000	0.96500	2.221000	0.72209	0.528000	0.53228	ATG	0.538462		TCGA-FB-AAPU-01A-31D-A40W-08	0.423	RND3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254809.1	1	0	1		2	2	2	0		0	0	98		98	97	1	2	-20.000000	1	0.700000	NM_005168			91	91		82	82	1		1	1		0	0	98	0		1.000000	1	0	35	0	14	0	91	82
SGOL2	151246	broad.mit.edu	37	2	201436126	201436126	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:201436126G>A	ENST00000357799.4	+	7	1155	c.1057G>A	c.(1057-1059)Gac>Aac	p.D353N		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	353					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GGATAATGATGACTTTCAATT	0.373																																						ENST00000357799.4	0.210000	2.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.107035	0.090000	0.090000																										0				46						c.(1057-1059)Gac>Aac		shugoshin-like 2 (S. pombe)							35.0	33.0	34.0					2																	201436126		1882	4108	5990	SO:0001583	missense	151246	0	0					g.chr2:201436126G>A	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.1057G>A	chr2.hg19:g.201436126G>A	ENSP00000350447:p.Asp353Asn	1						p.D353N	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	0	2	2	2.074045	Q562F6	SGOL2_HUMAN		7	1155	+			Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	0	1	hg19	c.1057G>A	CCDS42796.1	0	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057581	0.36277	.	.	ENSG00000163535	ENST00000357799	T	0.12984	2.63	5.45	3.63	0.41609	5.45	3.63	0.41609	.	0.200831	0.35436	N	0.003203	T	0.11324	0.0276	L	0.46157	1.445	0.22457	N	0.999084	P;P;P	0.40332	0.713;0.713;0.713	B;B;B	0.36845	0.234;0.234;0.234	T	0.16247	-1.0409	10	0.25106	T	0.35	-3.3647	9.4882	0.38942	0.1632:0.0:0.8368:0.0	.	353;353;353	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	N	353	ENSP00000350447:D353N	ENSP00000350447:D353N	D	+	1	0	0	SGOL2	201144371	201144371	0.000000	0.05858	0.691000	0.30163	0.196000	0.23810	0.307000	0.19296	0.837000	0.34925	0.585000	0.79938	GAC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.373	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	0	0	1		2	2	2	0		0	0	56		56	56	1	2	-6.807310	1	0.700000	NM_152524			4	4		127	126	0		1	0		0	0	56	0		0.889737	1.516314e-02	0	1	0	4	0	4	127
UGT1A10	54575	broad.mit.edu	37	2	234545236	234545236	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:234545236C>T	ENST00000344644.5	+	1	137	c.68C>T	c.(67-69)gCc>gTc	p.A23V	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Missense_Mutation_p.A23V	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	23				MARAGWTSPVPLCVCLLLTCGFA -> MAPRRVDQPRSFMC VSTADLWLC (in Ref. 1). {ECO:0000305}.	cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	TGTGGCTTTGCCGAGGCAGGG	0.592																																						ENST00000344644.5	0.080000	0	6.000000e-02	1.000000e-02	0.030000	0.042347	0.030000	0.040000																										0				32						c.(67-69)gCc>gTc		UDP glucuronosyltransferase 1 family, polypeptide A10	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)						102.0	95.0	97.0					2																	234545236		2203	4300	6503	SO:0001583	missense	54575	0	0					g.chr2:234545236C>T	U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.68C>T	chr2.hg19:g.234545236C>T	ENSP00000343838:p.Ala23Val	1					UGT1A10_ENST00000373445.1_Missense_Mutation_p.A23V|UGT1A1_ENST00000373450.4_Intron	p.A23V	NM_019075.2	NP_061948.1	0	2	2	2.182243	Q9HAW8	UD110_HUMAN		1	137	+		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)	O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	ENST00000344644.5	0	1	hg19	c.68C>T	CCDS33403.1	0	.	.	.	.	.	.	.	.	.	.	C	9.852	1.194005	0.22037	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.59224	0.28;0.36	3.83	1.94	0.25998	3.83	1.94	0.25998	.	.	.	.	.	T	0.40619	0.1124	L	0.31845	0.965	0.09310	N	1	B;B	0.17268	0.021;0.021	B;B	0.23852	0.02;0.049	T	0.28964	-1.0027	9	0.13470	T	0.59	.	5.5238	0.16947	0.0:0.6325:0.1827:0.1848	.	23;23	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	V	23	ENSP00000343838:A23V;ENSP00000362544:A23V	ENSP00000343838:A23V	A	+	2	0	0	UGT1A10	234209975	234209975	0.000000	0.05858	0.001000	0.08648	0.071000	0.16799	0.183000	0.16919	0.376000	0.24707	0.537000	0.68136	GCC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.592	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130986.1	0	0	1		2	2	2	0		0	0	117		117	115	1	2	-2.244575	0	0.700000	NM_019075			5	5		394	385	0		1	0		0	0	117	0		0.934098	4.871960e-01	0	0	0	115	0	5	394
ITSN2	50618	broad.mit.edu	37	2	24521586	24521586	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:24521586A>G	ENST00000355123.4	-	13	1885	c.1442T>C	c.(1441-1443)aTt>aCt	p.I481T	ITSN2_ENST00000361999.3_Missense_Mutation_p.I481T|ITSN2_ENST00000406921.3_Missense_Mutation_p.I481T	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	481					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAACCTGACAATTTCTTCTTG	0.398																																						ENST00000355123.4	1.000000	7.500000e-01	9.600000e-01	8.100000e-01	0.880000	0.890100	0.880000	1.000000																										0				61						c.(1441-1443)aTt>aCt		intersectin 2							159.0	156.0	157.0					2																	24521586		2203	4300	6503	SO:0001583	missense	50618	0	0					g.chr2:24521586A>G	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1442T>C	chr2.hg19:g.24521586A>G	ENSP00000347244:p.Ile481Thr	0					ITSN2_ENST00000406921.3_Missense_Mutation_p.I481T|ITSN2_ENST00000361999.3_Missense_Mutation_p.I481T	p.I481T	NM_006277.2	NP_006268.2	0	0	0	1.996559	Q9NZM3	ITSN2_HUMAN		13	1885	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	1	1	hg19	c.1442T>C	CCDS1710.2	1	.	.	.	.	.	.	.	.	.	.	A	17.24	3.339931	0.60963	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011	T;T;T;T;T	0.79653	0.08;0.13;0.08;0.56;-1.29	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.000000	0.37577	U	0.002034	D	0.86531	0.5955	L	0.52011	1.625	0.52099	D	0.999941	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.991	D	0.85992	0.1489	10	0.40728	T	0.16	.	15.4385	0.75165	1.0:0.0:0.0:0.0	.	481;481;481;481	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	T	481;481;481;505;481;506	ENSP00000354561:I481T;ENSP00000347244:I481T;ENSP00000370250:I481T;ENSP00000384499:I481T;ENSP00000391224:I506T	ENSP00000347244:I481T	I	-	2	0	0	ITSN2	24375090	24375090	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.614000	0.90917	2.123000	0.65237	0.397000	0.26171	ATT	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.398	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	0	0	0		2	2	2	0		0	0	112		112	110	1	2	-20.000000	1	0.700000	NM_006277			119	117		263	259	1		1	1		0	0	112	0		1.000000	9.998899e-01	0	17	0	16	0	119	263
KCNG3	170850	broad.mit.edu	37	2	42719978	42719978	+	Splice_Site	SNP	C	C	G	rs375643888		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:42719978C>G	ENST00000306078.1	-	1	1259	c.664G>C	c.(664-666)Ggg>Cgg	p.G222R	MTA3_ENST00000405592.1_5'Flank|KCNG3_ENST00000394973.4_Intron	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	222					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						GCGTCCTACCCGGAGGGCTCC	0.711																																						ENST00000306078.1	1.000000	6.800000e-01	1	8.100000e-01	0.960000	0.926902	0.960000	1.000000																										0				6						c.(664-666)Ggg>Cgg		potassium voltage-gated channel, subfamily G, member 3							19.0	15.0	16.0					2																	42719978		2182	4272	6454	SO:0001630	splice_region_variant	170850	1	118912	28				g.chr2:42719978C>G	AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.665+1G>C	chr2.hg19:g.42719978C>G		0					KCNG3_ENST00000394973.4_Intron|MTA3_ENST00000405592.1_5'Flank	p.G222R	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	0	0	0	1.980529	Q8TAE7	KCNG3_HUMAN		1	1259	-			Q53SC1	Splice_Site	SNP	ENST00000306078.1	1	0	hg19	c.664G>C	CCDS1809.1	1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656292	0.47467	.	.	ENSG00000171126	ENST00000306078	D	0.97328	-4.34	4.85	3.97	0.46021	4.85	3.97	0.46021	.	0.983145	0.08331	N	0.962294	D	0.91529	0.7325	N	0.08118	0	0.80722	D	1	P	0.45768	0.866	B	0.35278	0.199	D	0.86409	0.1747	10	0.54805	T	0.06	.	13.3731	0.60723	0.0:0.9238:0.0:0.0762	.	222	Q8TAE7	KCNG3_HUMAN	R	222	ENSP00000304127:G222R	ENSP00000304127:G222R	G	-	1	0	0	KCNG3	42573482	42573482	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.822000	0.69265	1.253000	0.44018	0.563000	0.77884	GGG	0.697885		TCGA-FB-AAPU-01A-31D-A40W-08	0.711	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2	1	0	1		2	2	2	0		0	0	14		14	14	1	2	-6.053581	1	0.700000	NM_172344	Missense_Mutation		26	26		50	48	1		1			0	0	14	0		1.000000	0	0	0	0	0	0	26	50
SPP2	6694	broad.mit.edu	37	2	234959698	234959698	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr2:234959698A>T	ENST00000168148.3	+	2	257	c.169A>T	c.(169-171)Agt>Tgt	p.S57C	SPP2_ENST00000492481.1_3'UTR|SPP2_ENST00000373368.1_Missense_Mutation_p.S57C	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa	57					bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		CCAGTCACTGAGTCCGTATCT	0.468																																						ENST00000168148.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999500	0.990000	1.000000																										0				12						c.(169-171)Agt>Tgt		secreted phosphoprotein 2, 24kDa							115.0	100.0	105.0					2																	234959698		2203	4300	6503	SO:0001583	missense	6694	0	0					g.chr2:234959698A>T		CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.169A>T	chr2.hg19:g.234959698A>T	ENSP00000168148:p.Ser57Cys	1					SPP2_ENST00000373368.1_Missense_Mutation_p.S57C|SPP2_ENST00000492481.1_3'UTR	p.S57C	NM_006944.2	NP_008875.1	0	2	2	2.182243	Q13103	SPP24_HUMAN		2	257	+		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)	A4QMV3|Q3B892|Q546M5	Missense_Mutation	SNP	ENST00000168148.3	1	1	hg19	c.169A>T	CCDS2511.1	1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.077136	0.55753	.	.	ENSG00000072080	ENST00000373368;ENST00000168148	T;T	0.51071	0.72;0.72	5.39	3.07	0.35406	5.39	3.07	0.35406	.	0.136200	0.52532	D	0.000071	T	0.60392	0.2265	M	0.65975	2.015	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.49341	-0.8950	10	0.62326	D	0.03	-31.8015	6.1693	0.20408	0.8066:0.0:0.1934:0.0	.	57	Q13103	SPP24_HUMAN	C	57	ENSP00000362466:S57C;ENSP00000168148:S57C	ENSP00000168148:S57C	S	+	1	0	0	SPP2	234624437	234624437	0.997000	0.39634	0.772000	0.31596	0.826000	0.46750	1.596000	0.36718	0.903000	0.36546	0.533000	0.62120	AGT	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.468	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131313.3	1	0	1		2	2	2	0		0	0	69		69	69	1	2	-20.000000	1	0.700000	NM_006944			94	93		130	125	1		1			0	0	69	0		1.000000	0	0	0	0	0	0	94	130
CCDC58	131076	broad.mit.edu	37	3	122081856	122081856	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr3:122081856C>T	ENST00000291458.5	-	4	349	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K	CCDC58_ENST00000497726.1_Missense_Mutation_p.E24K|CCDC58_ENST00000466854.1_5'UTR|CCDC58_ENST00000479899.1_Missense_Mutation_p.E101K	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	115						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		ACATTCAGTTCTGACTGCATC	0.313																																						ENST00000291458.5	1.000000	7.100000e-01	9.900000e-01	7.900000e-01	0.890000	0.892324	0.890000	1.000000																										0				2						c.(343-345)Gaa>Aaa		coiled-coil domain containing 58							88.0	84.0	85.0					3																	122081856		2202	4300	6502	SO:0001583	missense	131076	0	0					g.chr3:122081856C>T	AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.343G>A	chr3.hg19:g.122081856C>T	ENSP00000291458:p.Glu115Lys	0					CCDC58_ENST00000497726.1_Missense_Mutation_p.E24K|CCDC58_ENST00000466854.1_5'UTR|CCDC58_ENST00000479899.1_Missense_Mutation_p.E101K	p.E115K	NM_001017928.2	NP_001017928.1	0	0	0	1.997626	Q4VC31	CCD58_HUMAN		4	349	-			Q32LY6	Missense_Mutation	SNP	ENST00000291458.5	1	1	hg19	c.343G>A	CCDS33838.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.3|27.3	4.821041|4.821041	0.90873|0.90873	.|.	.|.	ENSG00000160124|ENSG00000160124	ENST00000291458;ENST00000497726;ENST00000479899|ENST00000479414	.|.	.|.	.|.	5.1|5.1	5.1|5.1	0.69264|0.69264	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83008|0.83008	0.5161|0.5161	M|M	0.89287|0.89287	3.02|3.02	0.58432|0.58432	D|D	0.999994|0.999994	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.85748|0.85748	0.1341|0.1341	9|5	0.87932|.	D|.	0|.	.|.	15.8232|15.8232	0.78676|0.78676	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	115|.	Q4VC31|.	CCD58_HUMAN|.	K|K	115;24;101|111	.|.	ENSP00000291458:E115K|.	E|R	-|-	1|2	0|0	0|0	CCDC58|CCDC58	123564546|123564546	123564546|123564546	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	6.444000|6.444000	0.73452|0.73452	2.650000|2.650000	0.89964|0.89964	0.561000|0.561000	0.74099|0.74099	GAA|AGA	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.313	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355754.1	1	0	1		2	2	2	0		0	0	72		72	72	1	2	-20.000000	1	0.700000	NM_001017928			59	58		129	128	1		1	1		0	0	72	0		1.000000	1	0	58	0	74	0	59	129
MYLK	4638	broad.mit.edu	37	3	123418920	123418920	+	Missense_Mutation	SNP	G	G	A	rs202025561		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr3:123418920G>A	ENST00000475616.1	-	15	3394	c.3395C>T	c.(3394-3396)aCg>aTg	p.T1132M	MYLK_ENST00000510775.1_5'Flank|MYLK_ENST00000360772.3_Missense_Mutation_p.T1132M|MYLK_ENST00000360304.3_Missense_Mutation_p.T1132M|MYLK_ENST00000346322.5_Missense_Mutation_p.T1063M|MYLK_ENST00000359169.1_Missense_Mutation_p.T1132M			Q15746	MYLK_HUMAN	myosin light chain kinase	1132	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Ig-like C2-type 7.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TCCGTTCAGCGTCCAGATGAT	0.567																																						ENST00000475616.1	1.000000	8.200000e-01	1	8.800000e-01	0.940000	0.946234	0.940000	1.000000																										0				113						c.(3394-3396)aCg>aTg		myosin light chain kinase							103.0	98.0	100.0					3																	123418920		2203	4300	6503	SO:0001583	missense	4638	8	121412	39				g.chr3:123418920G>A	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3395C>T	chr3.hg19:g.123418920G>A	ENSP00000418335:p.Thr1132Met	0					MYLK_ENST00000510775.1_5'Flank|MYLK_ENST00000360772.3_Missense_Mutation_p.T1132M|MYLK_ENST00000359169.1_Missense_Mutation_p.T1132M|MYLK_ENST00000346322.5_Missense_Mutation_p.T1063M|MYLK_ENST00000360304.3_Missense_Mutation_p.T1132M	p.T1132M			0	0	0	1.997626	Q15746	MYLK_HUMAN		15	3394	-		Lung NSC(201;0.0496)	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	1	1	hg19	c.3395C>T	CCDS46896.1	1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664962	0.29604	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.76	3.98	0.46160	5.76	3.98	0.46160	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32526	0.0832	L	0.29908	0.895	0.32639	N	0.521	B;B;B;B;B;B	0.33512	0.237;0.157;0.379;0.362;0.415;0.279	B;B;B;B;B;B	0.34138	0.11;0.062;0.105;0.11;0.139;0.176	T	0.38308	-0.9667	9	0.33141	T	0.24	.	12.9494	0.58391	0.1201:0.0:0.8799:0.0	.	1132;210;1063;1132;1063;1132	Q15746-6;Q15746-7;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	M	1132;1132;1132;1063;1132	ENSP00000354004:T1132M;ENSP00000353452:T1132M;ENSP00000352088:T1132M;ENSP00000320622:T1063M;ENSP00000418335:T1132M	ENSP00000320622:T1063M	T	-	2	0	0	MYLK	124901610	124901610	1.000000	0.71417	0.648000	0.29521	0.936000	0.57629	3.938000	0.56583	0.800000	0.34041	0.555000	0.69702	ACG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.567	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	1	0	1		2	2	2	0		0	0	127		127	124	1	2	-20.000000	1	0.700000	NM_053025			148	147		295	290	1		1	0		0	0	127	0		1.000000	9.926479e-01	0	0	0	18	0	148	295
XRN1	54464	broad.mit.edu	37	3	142094760	142094760	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr3:142094760A>C	ENST00000264951.4	-	25	2975	c.2858T>G	c.(2857-2859)gTg>gGg	p.V953G	XRN1_ENST00000392981.2_Missense_Mutation_p.V953G	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	953					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATTTAAACCCACATTTGCTTT	0.403																																						ENST00000264951.4	0.960000	6.300000e-01	8.800000e-01	7.100000e-01	0.790000	0.800110	0.790000	0.800000																										0				61						c.(2857-2859)gTg>gGg		5'-3' exoribonuclease 1							90.0	84.0	86.0					3																	142094760		2203	4299	6502	SO:0001583	missense	54464	0	0					g.chr3:142094760A>C	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2858T>G	chr3.hg19:g.142094760A>C	ENSP00000264951:p.Val953Gly	0					XRN1_ENST00000392981.2_Missense_Mutation_p.V953G	p.V953G	NM_019001.3	NP_061874.3	0	0	0	1.997626	Q8IZH2	XRN1_HUMAN		25	2975	-			Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	1	1	hg19	c.2858T>G	CCDS3123.1	0	.	.	.	.	.	.	.	.	.	.	A	22.9	4.344152	0.82022	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.37752	1.18;1.18	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.062617	0.64402	D	0.000006	T	0.58104	0.2099	M	0.70275	2.135	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.62649	0.905;0.806	T	0.62315	-0.6880	10	0.87932	D	0	-11.1021	16.0952	0.81114	1.0:0.0:0.0:0.0	.	953;953	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	G	953	ENSP00000264951:V953G;ENSP00000376707:V953G	ENSP00000264951:V953G	V	-	2	0	0	XRN1	143577450	143577450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.268000	0.95675	2.209000	0.71365	0.477000	0.44152	GTG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.403	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	1	0	1		2	2	2	0		0	0	96		96	96	1	2	-20.000000	1	0.700000	NM_019001			63	61		163	162	1		1	1		0	0	96	0		1.000000	9.101886e-01	0	6	0	7	0	63	163
CYP8B1	1582	broad.mit.edu	37	3	42917299	42917299	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr3:42917299A>C	ENST00000316161.4	-	1	334	c.10T>G	c.(10-12)Tgg>Ggg	p.W4G	RP11-141M3.5_ENST00000471537.1_RNA|CYP8B1_ENST00000437102.1_Missense_Mutation_p.W4G|KRBOX1_ENST00000426937.1_Intron	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	4					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		ACTGGACCCCAGAGAACCATG	0.592																																						ENST00000316161.4	1.000000	9.500000e-01	1	9.900000e-01	0.990000	0.997571	0.990000	1.000000																										0				23						c.(10-12)Tgg>Ggg		cytochrome P450, family 8, subfamily B, polypeptide 1							30.0	31.0	31.0					3																	42917299		2191	4282	6473	SO:0001583	missense	1582	0	0					g.chr3:42917299A>C	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.10T>G	chr3.hg19:g.42917299A>C	ENSP00000318867:p.Trp4Gly	1					KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Missense_Mutation_p.W4G|RP11-141M3.5_ENST00000471537.1_RNA	p.W4G	NM_004391.2	NP_004382.2	0	2	2	1.795195	Q9UNU6	CP8B1_HUMAN		1	334	-			B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	1	1	hg19	c.10T>G	CCDS2707.1	1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634875	0.47049	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.74947	-0.73;-0.89	4.89	4.89	0.63831	4.89	4.89	0.63831	.	0.287902	0.27513	N	0.019032	T	0.71281	0.3321	N	0.08118	0	0.32807	D	0.500855	D;D	0.76494	0.999;0.988	D;P	0.63488	0.915;0.779	T	0.80111	-0.1519	10	0.87932	D	0	-13.3635	13.6159	0.62108	1.0:0.0:0.0:0.0	.	4;4	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	G	4	ENSP00000404499:W4G;ENSP00000318867:W4G	ENSP00000318867:W4G	W	-	1	0	0	CYP8B1	42892303	42892303	1.000000	0.71417	0.997000	0.53966	0.298000	0.27526	5.950000	0.70265	2.064000	0.61679	0.459000	0.35465	TGG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.592	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	1	0	1		2	2	2	0		0	0	37		37	37	1	2	-20.000000	1	0.700000	NM_004391			58	56		82	82	0		1			0	0	37	0		1.000000	0	0	0	0	0	0	58	82
CCNL1	57018	broad.mit.edu	37	3	156866115	156866115	+	Missense_Mutation	SNP	C	C	T	rs202095674		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr3:156866115C>T	ENST00000295926.3	-	11	1614	c.1496G>A	c.(1495-1497)cGt>cAt	p.R499H	CCNL1_ENST00000479052.1_5'Flank|CCNL1_ENST00000461804.1_Intron	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	499					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			AGATCGTTCACGCCTGTCCCT	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		19074	0.001		0.0	False		,,,				2504	0.0					ENST00000295926.3	1.000000	7.500000e-01	9.500000e-01	8.100000e-01	0.880000	0.886264	0.880000	0.880000																										0				18						c.(1495-1497)cGt>cAt		cyclin L1		C	HIS/ARG	0,4406		0,0,2203	218.0	185.0	196.0		1496	4.3	0.8	3		196	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCNL1	NM_020307.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	499/527	156866115	1,13005	2203	4300	6503	SO:0001583	missense	57018	2	121412	40				g.chr3:156866115C>T	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.1496G>A	chr3.hg19:g.156866115C>T	ENSP00000295926:p.Arg499His	0					CCNL1_ENST00000479052.1_5'Flank|CCNL1_ENST00000461804.1_Intron	p.R499H	NM_020307.2	NP_064703.1	0	0	0	1.997626	Q9UK58	CCNL1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)	11	1614	-			B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Missense_Mutation	SNP	ENST00000295926.3	1	1	hg19	c.1496G>A	CCDS3178.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.15	2.746831	0.49257	0.0	1.16E-4	ENSG00000163660	ENST00000295926	T	0.22945	1.93	5.2	4.32	0.51571	5.2	4.32	0.51571	.	0.110120	0.53938	D	0.000041	T	0.24967	0.0606	L	0.54323	1.7	0.80722	D	1	P	0.42584	0.784	B	0.38616	0.277	T	0.03025	-1.1081	10	0.27785	T	0.31	-1.4904	13.7858	0.63108	0.0:0.9257:0.0:0.0743	.	499	Q9UK58	CCNL1_HUMAN	H	499	ENSP00000295926:R499H	ENSP00000295926:R499H	R	-	2	0	0	CCNL1	158348809	158348809	0.999000	0.42202	0.844000	0.33320	0.808000	0.45660	4.102000	0.57776	1.314000	0.45095	0.557000	0.71058	CGT	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.512	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	1	0	1		2	2	2	0		0	0	134		134	133	1	2	-20.000000	1	0.700000	NM_020307			120	120		267	260	1		1	1		0	0	134	0		1.000000	1	0	149	0	157	0	120	267
LIMCH1	22998	broad.mit.edu	37	4	41605916	41605916	+	Silent	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr4:41605916G>A	ENST00000313860.7	+	5	423	c.369G>A	c.(367-369)ctG>ctA	p.L123L	LIMCH1_ENST00000503057.1_5'UTR|LIMCH1_ENST00000509638.1_5'UTR|LIMCH1_ENST00000511496.1_Intron|LIMCH1_ENST00000512820.1_Silent_p.L123L|LIMCH1_ENST00000512632.1_Silent_p.L123L|LIMCH1_ENST00000513024.1_5'UTR|LIMCH1_ENST00000512946.1_Silent_p.L123L|LIMCH1_ENST00000508501.1_Silent_p.L123L	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	123	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						GTAGGAAGCTGAAAAATGTAA	0.338																																						ENST00000313860.7	1.000000	7.700000e-01	1	8.700000e-01	0.970000	0.948441	0.970000	1.000000																										0				41						c.(367-369)ctG>ctA		LIM and calponin homology domains 1							111.0	111.0	111.0					4																	41605916		2202	4297	6499	SO:0001819	synonymous_variant	22998	0	0					g.chr4:41605916G>A	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.369G>A	chr4.hg19:g.41605916G>A		0					LIMCH1_ENST00000509638.1_5'UTR|LIMCH1_ENST00000508501.1_Silent_p.L123L|LIMCH1_ENST00000512820.1_Silent_p.L123L|LIMCH1_ENST00000512632.1_Silent_p.L123L|LIMCH1_ENST00000512946.1_Silent_p.L123L|LIMCH1_ENST00000513024.1_5'UTR|LIMCH1_ENST00000503057.1_5'UTR|LIMCH1_ENST00000511496.1_Intron	p.L123L	NM_014988.2	NP_055803.2	1	2	3	2.072253	Q9UPQ0	LIMC1_HUMAN		5	423	+			A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Silent	SNP	ENST00000313860.7	1	1	hg19	c.369G>A	CCDS33977.1	1																																																																																								0.705160		TCGA-FB-AAPU-01A-31D-A40W-08	0.338	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	1	0	1		2	2	2	0		0	0	49		49	48	1	2	-20.000000	1	0.700000	NM_014988			58	57		115	115	0		1	1		0	0	49	0		1.000000	8.019111e-01	0	2	0	6	0	58	115
FIP1L1	81608	broad.mit.edu	37	4	54248462	54248462	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr4:54248462G>C	ENST00000337488.6	+	4	382	c.188G>C	c.(187-189)gGa>gCa	p.G63A	FIP1L1_ENST00000358575.5_Missense_Mutation_p.G48A|FIP1L1_ENST00000510668.1_3'UTR|FIP1L1_ENST00000507922.1_Missense_Mutation_p.G48A|FIP1L1_ENST00000306932.6_Missense_Mutation_p.G48A|FIP1L1_ENST00000507166.1_Missense_Mutation_p.G63A	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	63	Necessary for stimulating PAPOLA activity.|Sufficient for interaction with PAPOLA.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CCTCCATCTGGAATTGAAGAT	0.333			T	PDGFRA	idiopathic hypereosinophilic syndrome																																	ENST00000337488.6	1.000000	9.300000e-01	1	9.900000e-01	0.990000	0.995992	0.990000	1.000000				Dom	yes			Dom	yes		4	4q12	4q12	81608	T	FIP1 like 1 (S. cerevisiae)				L	L	PDGFRA		idiopathic hypereosinophilic syndrome		0				6						c.(187-189)gGa>gCa		factor interacting with PAPOLA and CPSF1							155.0	144.0	148.0					4																	54248462		2203	4300	6503	SO:0001583	missense	81608	0	0					g.chr4:54248462G>C	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.188G>C	chr4.hg19:g.54248462G>C	ENSP00000336752:p.Gly63Ala	0					FIP1L1_ENST00000507166.1_Missense_Mutation_p.G63A|FIP1L1_ENST00000510668.1_3'UTR|FIP1L1_ENST00000507922.1_Missense_Mutation_p.G48A|FIP1L1_ENST00000306932.6_Missense_Mutation_p.G48A|FIP1L1_ENST00000358575.5_Missense_Mutation_p.G48A	p.G63A	NM_030917.3	NP_112179.2	1	2	3	2.072253	Q6UN15	FIP1_HUMAN	GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)	4	382	+			B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	ENST00000337488.6	1	1	hg19	c.188G>C	CCDS3491.1	1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844491	0.71488	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000507166	T	0.76578	-1.03	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000003	D	0.82430	0.5035	L	0.36672	1.1	0.54753	D	0.999984	P;D;B;D	0.76494	0.955;0.999;0.217;0.958	P;D;B;P	0.80764	0.756;0.994;0.189;0.671	T	0.78175	-0.2306	10	0.20519	T	0.43	-21.7326	17.912	0.88937	0.0:0.0:1.0:0.0	.	48;48;63;48	G3XAD6;Q6UN15-3;Q6UN15;Q6UN15-4	.;.;FIP1_HUMAN;.	A	63;48;48;48;63	ENSP00000423325:G63A	ENSP00000302993:G48A	G	+	2	0	0	FIP1L1	53943219	53943219	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.540000	0.45727	2.556000	0.86216	0.655000	0.94253	GGA	0.705160		TCGA-FB-AAPU-01A-31D-A40W-08	0.333	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	1	0	1		2	2	2	0		0	0	59		59	59	1	2	-20.000000	1	0.700000	NM_030917			55	54		82	81	1		1	1		0	0	59	0		1.000000	1	0	52	0	43	0	55	82
ADAMTS3	9508	broad.mit.edu	37	4	73205337	73205337	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr4:73205337C>G	ENST00000286657.4	-	5	771	c.735G>C	c.(733-735)atG>atC	p.M245I		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	245					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGCGGCGTCTCATTGTTTCAT	0.488																																					NSCLC(168;1941 2048 2918 13048 43078)	ENST00000286657.4	1.000000	6.000000e-02	1.300000e-01	7.000000e-02	0.090000	0.138766	0.090000	0.100000																										0				76						c.(733-735)atG>atC		ADAM metallopeptidase with thrombospondin type 1 motif, 3							243.0	234.0	237.0					4																	73205337		2203	4300	6503	SO:0001583	missense	9508	0	0					g.chr4:73205337C>G	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.735G>C	chr4.hg19:g.73205337C>G	ENSP00000286657:p.Met245Ile	0						p.M245I	NM_014243.2	NP_055058.2	1	2	3	2.072253	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)	5	771	-			A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	1	1	hg19	c.735G>C	CCDS3553.1	0	.	.	.	.	.	.	.	.	.	.	C	3.124	-0.179799	0.06380	.	.	ENSG00000156140	ENST00000286657	T	0.60171	0.21	5.31	1.65	0.23941	5.31	1.65	0.23941	.	1.075530	0.07192	N	0.855931	T	0.39572	0.1083	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26087	-1.0113	10	0.39692	T	0.17	.	2.8231	0.05477	0.2577:0.4819:0.1247:0.1357	.	245	O15072	ATS3_HUMAN	I	245	ENSP00000286657:M245I	ENSP00000286657:M245I	M	-	3	0	0	ADAMTS3	73424201	73424201	0.001000	0.12720	0.019000	0.16419	0.005000	0.04900	-0.034000	0.12225	0.093000	0.17368	-0.300000	0.09419	ATG	0.705160		TCGA-FB-AAPU-01A-31D-A40W-08	0.488	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2	0	0	1		13	2	2	1		1	1	211		211	209	1	2	-2.942243	1	0.700000				25	25		694	687	0		1			1	0	211	0		0.982958	0	0	0	0	0	0	25	694
ADAMTS3	9508	broad.mit.edu	37	4	73414444	73414444	+	Silent	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr4:73414444C>G	ENST00000286657.4	-	3	291	c.255G>C	c.(253-255)acG>acC	p.T85T	ADAMTS3_ENST00000505193.1_5'UTR	NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	85					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTCCAAATGCCGTGATGTTAA	0.493																																					NSCLC(168;1941 2048 2918 13048 43078)	ENST00000286657.4	1.000000	7.300000e-01	1	8.200000e-01	0.910000	0.909649	0.910000	1.000000																										0				76						c.(253-255)acG>acC		ADAM metallopeptidase with thrombospondin type 1 motif, 3							107.0	101.0	103.0					4																	73414444		2203	4300	6503	SO:0001819	synonymous_variant	9508	0	0					g.chr4:73414444C>G	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.255G>C	chr4.hg19:g.73414444C>G		0					ADAMTS3_ENST00000505193.1_5'UTR	p.T85T	NM_014243.2	NP_055058.2	1	2	3	2.072253	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)	3	291	-			A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	1	1	hg19	c.255G>C	CCDS3553.1	1																																																																																								0.705160		TCGA-FB-AAPU-01A-31D-A40W-08	0.493	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2	1	0	1		2	2	2	0		0	0	63		63	60	1	2	-7.474031	1	0.700000				69	69		151	150	1		1			0	0	63	0		1.000000	0	0	0	0	0	0	69	151
PLK4	10733	broad.mit.edu	37	4	128816239	128816239	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr4:128816239G>C	ENST00000270861.5	+	14	2968	c.2694G>C	c.(2692-2694)tgG>tgC	p.W898C	PLK4_ENST00000513090.1_Missense_Mutation_p.W866C|PLK4_ENST00000514379.1_Missense_Mutation_p.W857C|PLK4_ENST00000507249.1_Missense_Mutation_p.W837C|PLK4_ENST00000515069.1_Missense_Mutation_p.W820C	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	898	POLO box. {ECO:0000255|PROSITE- ProRule:PRU00154}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						ATGTTGGTTGGGCTACACAGG	0.323																																					Colon(135;508 1718 19061 31832 42879)	ENST00000270861.5	1.000000	7.000000e-01	9.600000e-01	7.700000e-01	0.860000	0.867412	0.860000	1.000000																										0				31						c.(2692-2694)tgG>tgC		polo-like kinase 4							111.0	114.0	113.0					4																	128816239		2203	4300	6503	SO:0001583	missense	10733	0	0					g.chr4:128816239G>C	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2694G>C	chr4.hg19:g.128816239G>C	ENSP00000270861:p.Trp898Cys	0					PLK4_ENST00000513090.1_Missense_Mutation_p.W866C|PLK4_ENST00000507249.1_Missense_Mutation_p.W837C|PLK4_ENST00000514379.1_Missense_Mutation_p.W857C|PLK4_ENST00000515069.1_Missense_Mutation_p.W820C	p.W898C	NM_014264.4	NP_055079.3	1	2	3	2.072253	O00444	PLK4_HUMAN		14	2968	+			B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	1	1	hg19	c.2694G>C	CCDS3735.1	1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548975	0.45383	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379;ENST00000508113	T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75	5.25	4.37	0.52481	5.25	4.37	0.52481	POLO box duplicated domain (2);	0.056561	0.85682	D	0.000000	T	0.12475	0.0303	L	0.35723	1.085	0.80722	D	1	B;B	0.33494	0.01;0.414	B;B	0.38378	0.034;0.272	T	0.06232	-1.0838	10	0.52906	T	0.07	-1.8738	15.0412	0.71793	0.0:0.0:0.8575:0.1425	.	866;898	O00444-2;O00444	.;PLK4_HUMAN	C	898;820;866;837;857;144	ENSP00000270861:W898C;ENSP00000421774:W820C;ENSP00000427554:W866C;ENSP00000423412:W837C;ENSP00000423582:W857C;ENSP00000427568:W144C	ENSP00000270861:W898C	W	+	3	0	0	PLK4	129035689	129035689	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.950000	0.70265	2.730000	0.93505	0.479000	0.44913	TGG	0.705160		TCGA-FB-AAPU-01A-31D-A40W-08	0.323	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3	1	0	1		2	2	2	0		0	0	80		80	80	1	2	-6.870145	1	0.700000				77	77		183	181	1		1	1		0	0	80	0		1.000000	9.925636e-01	0	8	0	13	0	77	183
TSSK1B	83942	broad.mit.edu	37	5	112769663	112769663	+	Missense_Mutation	SNP	G	G	A	rs369630791		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:112769663G>A	ENST00000390666.3	-	1	1065	c.874C>T	c.(874-876)Cgg>Tgg	p.R292W	CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000510381.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	292					multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		TCAGTTCCCCGGGAACTCTCC	0.637																																						ENST00000390666.3	1.000000	8.900000e-01	1	9.900000e-01	0.990000	0.992649	0.990000	1.000000																										0				13						c.(874-876)Cgg>Tgg		testis-specific serine kinase 1B		G	,TRP/ARG	1,4339		0,1,2169	35.0	38.0	37.0		,874	1.2	0.0	5		37	0,8574		0,0,4287	no	intron,missense	MCC,TSSK1B	NM_001085377.1,NM_032028.3	,101	0,1,6456	AA,AG,GG		0.0,0.023,0.0077	,possibly-damaging	,292/368	112769663	1,12913	2170	4287	6457	SO:0001583	missense	83942	2	121314	34				g.chr5:112769663G>A	AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.874C>T	chr5.hg19:g.112769663G>A	ENSP00000375081:p.Arg292Trp	0					MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000416046.2_RNA	p.R292W	NM_032028.3	NP_114417.1	1	2	3	2.010798	Q9BXA7	TSSK1_HUMAN		1	1065	-		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)	B2R8D9	Missense_Mutation	SNP	ENST00000390666.3	1	1	hg19	c.874C>T	CCDS4112.1	1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263874	0.23136	2.3E-4	0.0	ENSG00000212122	ENST00000390666	T	0.69806	-0.43	1.24	1.24	0.21308	1.24	1.24	0.21308	Protein kinase-like domain (1);	0.657886	0.11189	U	0.590072	T	0.43211	0.1237	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	B	0.43445	0.42	T	0.26883	-1.0090	10	0.41790	T	0.15	.	5.7504	0.18144	0.0:0.0:1.0:0.0	.	292	Q9BXA7	TSSK1_HUMAN	W	292	ENSP00000375081:R292W	ENSP00000375081:R292W	R	-	1	2	2	TSSK1B	112797562	112797562	0.980000	0.34600	0.001000	0.08648	0.004000	0.04260	4.334000	0.59291	0.653000	0.30826	0.462000	0.41574	CGG	0.723247		TCGA-FB-AAPU-01A-31D-A40W-08	0.637	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250774.2	1	0	1		2	2	2	0		0	0	39		39	39	1	2	-8.080114	1	0.700000	NM_032028			47	46		81	79	1		1			0	0	39	0		1.000000	0	0	0	0	0	0	47	81
ZNF608	57507	broad.mit.edu	37	5	123984759	123984759	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:123984759A>T	ENST00000306315.5	-	4	1753	c.1318T>A	c.(1318-1320)Tct>Act	p.S440T	ZNF608_ENST00000504926.1_Missense_Mutation_p.S13T	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	440							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCAGCAGCAGACCTCGCTCTC	0.597																																						ENST00000306315.5	0.170000	4.000000e-02	1.400000e-01	7.000000e-02	0.100000	0.108677	0.100000	0.100000																										0				46						c.(1318-1320)Tct>Act		zinc finger protein 608							31.0	34.0	33.0					5																	123984759		2202	4296	6498	SO:0001583	missense	57507	0	0					g.chr5:123984759A>T	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.1318T>A	chr5.hg19:g.123984759A>T	ENSP00000307746:p.Ser440Thr	0					ZNF608_ENST00000504926.1_Missense_Mutation_p.S13T	p.S440T	NM_020747.2	NP_065798.2	0	0	0	1.992331	Q9ULD9	ZN608_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	4	1753	-		all_cancers(142;0.186)|Prostate(80;0.081)	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	0	1	hg19	c.1318T>A	CCDS34219.1	0	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027154	0.35797	.	.	ENSG00000168916	ENST00000504926;ENST00000306315;ENST00000509799;ENST00000513986	T;T	0.45276	0.93;0.9	5.26	5.26	0.73747	5.26	5.26	0.73747	.	0.178789	0.50627	D	0.000117	T	0.22166	0.0534	N	0.14661	0.345	0.30518	N	0.768777	B	0.02656	0.0	B	0.06405	0.002	T	0.18304	-1.0341	10	0.08837	T	0.75	-13.6396	9.307	0.37881	0.7225:0.0:0.0:0.2775	.	440	Q9ULD9	ZN608_HUMAN	T	13;440;440;440	ENSP00000427657:S13T;ENSP00000307746:S440T	ENSP00000307746:S440T	S	-	1	0	0	ZNF608	124012658	124012658	0.999000	0.42202	0.853000	0.33588	0.600000	0.36913	1.070000	0.30653	1.989000	0.58080	0.445000	0.29226	TCT	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.597	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	1	0	1		2	2	2	0		0	0	61		61	60	1	2	-12.025330	1	0.700000	XM_114432			11	11		302	299	0		1	1		0	0	61	0		0.998322	1.251874e-01	0	2	0	14	0	11	302
PCDHB15	56121	broad.mit.edu	37	5	140626038	140626038	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:140626038T>A	ENST00000231173.3	+	1	892	c.892T>A	c.(892-894)Tca>Aca	p.S298T		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	298	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGCAGCCTTTCAGGAGAAAT	0.403																																						ENST00000231173.3	1.000000	3.000000e-02	1.500000e-01	5.000000e-02	0.080000	0.200189	0.080000	0.090000																										0				61						c.(892-894)Tca>Aca		protocadherin beta 15							64.0	68.0	67.0					5																	140626038		2203	4300	6503	SO:0001583	missense	56121	0	0					g.chr5:140626038T>A	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.892T>A	chr5.hg19:g.140626038T>A	ENSP00000231173:p.Ser298Thr	1						p.S298T	NM_018935.2	NP_061758.1	1	2	3	2.593277	Q9Y5E8	PCDBF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	892	+			Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	0	1	hg19	c.892T>A	CCDS4257.1	0	.	.	.	.	.	.	.	.	.	.	t	0.004	-2.283625	0.00251	.	.	ENSG00000113248	ENST00000231173	T	0.44482	0.92	5.07	2.17	0.27698	5.07	2.17	0.27698	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.13927	0.0337	N	0.02357	-0.585	0.09310	N	1	B	0.12630	0.006	B	0.21546	0.035	T	0.36187	-0.9758	9	0.02654	T	1	.	4.5546	0.12130	0.4747:0.0948:0.0:0.4306	.	298	Q9Y5E8	PCDBF_HUMAN	T	298	ENSP00000231173:S298T	ENSP00000231173:S298T	S	+	1	0	0	PCDHB15	140606222	140606222	0.004000	0.15560	0.091000	0.20842	0.376000	0.30014	1.902000	0.39848	0.853000	0.35312	-0.669000	0.03829	TCA	0.768786		TCGA-FB-AAPU-01A-31D-A40W-08	0.403	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	0	0	1		2	2	2	0		0	0	98		98	98	1	2	-9.530774	1	0.700000	NM_018935			10	10		429	426	0		1	0		0	0	98	0		0.996845	2.126693e-02	0	0	0	9	0	10	429
PCDHGA10	56106	broad.mit.edu	37	5	140793564	140793564	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:140793564C>T	ENST00000398610.2	+	1	822	c.822C>T	c.(820-822)gaC>gaT	p.D274D	PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	274	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGACAGGGACGAAGGTGCCA	0.458																																						ENST00000398610.2	1.000000	1.200000e-01	4.400000e-01	1.800000e-01	0.270000	0.361153	0.270000	0.260000																										0				43						c.(820-822)gaC>gaT		protocadherin gamma subfamily A, 10							32.0	35.0	34.0					5																	140793564		1980	4176	6156	SO:0001819	synonymous_variant	56106	0	0					g.chr5:140793564C>T		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.822C>T	chr5.hg19:g.140793564C>T		1					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron	p.D274D	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	1	2	3	2.593277	Q9Y5H3	PCDGA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	822	+			Q9Y5E0	Silent	SNP	ENST00000398610.2	0	1	hg19	c.822C>T	CCDS47292.1	0																																																																																								0.768786		TCGA-FB-AAPU-01A-31D-A40W-08	0.458	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	1	0	1		2	2	2	0		0	0	20		20	20	1	2	-12.657840	1	0.700000	NM_018913			8	8		111	110	0		1	0		0	0	20	0		0.989825	0	0	0	0	1	0	8	111
JAKMIP2	9832	broad.mit.edu	37	5	147040819	147040819	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:147040819G>C	ENST00000265272.5	-	3	786	c.319C>G	c.(319-321)Cgt>Ggt	p.R107G	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R107G|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R65G	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	107						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCCATCACGTACCTTCACC	0.557																																						ENST00000265272.5	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				64						c.(319-321)Cgt>Ggt		janus kinase and microtubule interacting protein 2							187.0	176.0	180.0					5																	147040819		2203	4300	6503	SO:0001583	missense	9832	0	0					g.chr5:147040819G>C	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.319C>G	chr5.hg19:g.147040819G>C	ENSP00000265272:p.Arg107Gly	1					JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R107G|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R65G	p.R107G	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	1	2	3	2.593277	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	3	786	-			A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	1	1	hg19	c.319C>G	CCDS4285.1	1	.	.	.	.	.	.	.	.	.	.	G	9.591	1.126056	0.20959	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.35421	1.31;1.31;1.31	4.67	3.71	0.42584	4.67	3.71	0.42584	.	0.059973	0.64402	D	0.000003	T	0.24160	0.0585	N	0.24115	0.695	0.38983	D	0.95898	B;B;B;B	0.32396	0.15;0.369;0.369;0.239	B;B;B;B	0.29176	0.045;0.099;0.099;0.099	T	0.23013	-1.0200	10	0.66056	D	0.02	.	12.4034	0.55426	0.0:0.0:0.6863:0.3137	.	65;107;107;107	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	G	107;107;65;107	ENSP00000421398:R107G;ENSP00000265272:R107G;ENSP00000328989:R65G	ENSP00000265272:R107G	R	-	1	0	0	JAKMIP2	147021012	147021012	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	4.826000	0.62715	2.529000	0.85273	0.563000	0.77884	CGT	0.768786		TCGA-FB-AAPU-01A-31D-A40W-08	0.557	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	1	0	1		2	2	2	0		0	0	198		198	197	1	2	-20.000000	1	0.700000	NM_014790			439	438		435	429	1		1			0	0	198	0		1.000000	0	0	0	0	0	0	439	435
PLK2	10769	broad.mit.edu	37	5	57750426	57750426	+	Nonsense_Mutation	SNP	A	A	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:57750426A>C	ENST00000274289.3	-	14	2342	c.2042T>G	c.(2041-2043)tTa>tGa	p.L681*	PLK2_ENST00000502671.1_Intron	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	681					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		ACATCTTTGTAAGAGCATGTT	0.408																																						ENST00000274289.3	1.000000	4.000000e-02	1.500000e-01	6.000000e-02	0.100000	0.132833	0.100000	0.100000																										0				26						c.(2041-2043)tTa>tGa		polo-like kinase 2							148.0	141.0	143.0					5																	57750426		2203	4300	6503	SO:0001587	stop_gained	10769	0	0					g.chr5:57750426A>C		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.2042T>G	chr5.hg19:g.57750426A>C	ENSP00000274289:p.Leu681*	0					PLK2_ENST00000502671.1_Intron	p.L681*	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	1	2	3	2.047411	Q9NYY3	PLK2_HUMAN		14	2342	-		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)	O60679|Q96CV7|Q9UE61	Nonsense_Mutation	SNP	ENST00000274289.3	0	1	hg19	c.2042T>G	CCDS3974.1	0	.	.	.	.	.	.	.	.	.	.	A	40	8.531226	0.98852	.	.	ENSG00000145632	ENST00000274289	.	.	.	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.54753	D	0.999981	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-9.6175	16.3662	0.83325	1.0:0.0:0.0:0.0	.	.	.	.	X	681	.	ENSP00000274289:L681X	L	-	2	0	0	PLK2	57786183	57786183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.962000	0.76048	2.274000	0.75844	0.533000	0.62120	TTA	0.704142		TCGA-FB-AAPU-01A-31D-A40W-08	0.408	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	0	0	1		2	2	2	0		0	0	82		82	80	1	2	-3.855942	1	0.700000	NM_006622			9	9		259	255	0		1	1		0	0	82	0		0.994040	9.369305e-01	0	7	0	134	0	9	259
F2RL1	2150	broad.mit.edu	37	5	76129526	76129526	+	Missense_Mutation	SNP	G	G	A	rs149001132		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:76129526G>A	ENST00000296677.4	+	2	1300	c.1094G>A	c.(1093-1095)cGc>cAc	p.R365H		NM_005242.4	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	365					blood coagulation (GO:0007596)|chemokine (C-C motif) ligand 2 secretion (GO:0035926)|chemokine secretion (GO:0090195)|defense response to virus (GO:0051607)|establishment of endothelial barrier (GO:0061028)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|interleukin-1 beta secretion (GO:0050702)|interleukin-10 secretion (GO:0072608)|leukocyte migration (GO:0050900)|leukocyte proliferation (GO:0070661)|mature dendritic cell differentiation (GO:0097029)|negative regulation of chemokine secretion (GO:0090198)|negative regulation of JNK cascade (GO:0046329)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neutrophil activation (GO:0042119)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of cell migration (GO:0030335)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of eosinophil degranulation (GO:0043311)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of neutrophil mediated killing of gram-negative bacterium (GO:0070963)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of blood coagulation (GO:0030193)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of JNK cascade (GO:0046328)|T cell activation involved in immune response (GO:0002286)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.R365H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	13		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		CGAAGTGTCCGCACTGTAAAG	0.448																																						ENST00000296677.4	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.026853	0.020000	0.020000																										1	Substitution - Missense(1)	p.R365H(1)	lung(1)	13						c.(1093-1095)cGc>cAc		coagulation factor II (thrombin) receptor-like 1		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	221.0	222.0	222.0		1094	4.4	0.6	5	dbSNP_134	222	0,8600		0,0,4300	no	missense	F2RL1	NM_005242.4	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	365/398	76129526	1,13005	2203	4300	6503	SO:0001583	missense	2150	2	121412	38				g.chr5:76129526G>A	BC018130	CCDS4033.1	5q13	2012-08-08			ENSG00000164251	ENSG00000164251		"""GPCR / Class A : Protease activated receptors"""	3538	protein-coding gene	gene with protein product	"""proteinase-activated receptor-2"""	600933		GPR11		7937743, 7556175	Standard	NM_005242		Approved	PAR2	uc003keo.3	P55085	OTTHUMG00000102118	ENST00000296677.4:c.1094G>A	chr5.hg19:g.76129526G>A	ENSP00000296677:p.Arg365His	1						p.R365H	NM_005242.4	NP_005233	0	1	1	1.320364	P55085	PAR2_HUMAN		2	1300	+		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)	Q13317|Q13346|Q53XJ8	Missense_Mutation	SNP	ENST00000296677.4	0	1	hg19	c.1094G>A	CCDS4033.1	0	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192238	0.58017	2.27E-4	0.0	ENSG00000164251	ENST00000296677	T	0.40225	1.04	5.3	4.43	0.53597	5.3	4.43	0.53597	.	0.111618	0.64402	D	0.000013	T	0.62405	0.2425	M	0.69823	2.125	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.63726	-0.6572	9	.	.	.	-18.6704	13.8882	0.63721	0.0735:0.0:0.9265:0.0	.	365	P55085	PAR2_HUMAN	H	365	ENSP00000296677:R365H	.	R	+	2	0	0	F2RL1	76165282	76165282	1.000000	0.71417	0.640000	0.29408	0.271000	0.26615	9.808000	0.99193	1.236000	0.43740	-0.136000	0.14681	CGC	0.538462		TCGA-FB-AAPU-01A-31D-A40W-08	0.448	F2RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219957.2	0	0	1		2	2	2	0		0	0	229		229	228	1	2	-1.762392	0	0.700000				7	7		544	540	0		1	0		0	0	229	0		0.980211	9.071567e-01	0	0	0	330	0	7	544
ADRB2	154	broad.mit.edu	37	5	148206693	148206693	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr5:148206693C>G	ENST00000305988.4	+	1	538	c.299C>G	c.(298-300)aCt>aGt	p.T100S		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	100					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	AAAATGTGGACTTTTGGCAAC	0.527																																						ENST00000305988.4	1.000000	6.000000e-02	2.400000e-01	1.000000e-01	0.140000	0.251945	0.140000	0.140000																										0				14						c.(298-300)aCt>aGt		adrenoceptor beta 2, surface	Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)						111.0	103.0	106.0					5																	148206693		2203	4300	6503	SO:0001583	missense	154	0	0					g.chr5:148206693C>G	AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.299C>G	chr5.hg19:g.148206693C>G	ENSP00000305372:p.Thr100Ser	1						p.T100S	NM_000024.5	NP_000015	1	2	3	2.593277	P07550	ADRB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	538	+			B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Missense_Mutation	SNP	ENST00000305988.4	0	1	hg19	c.299C>G	CCDS4292.1	0	.	.	.	.	.	.	.	.	.	.	C	0.963	-0.702511	0.03255	.	.	ENSG00000169252	ENST00000305988	T	0.19105	2.17	5.4	0.158	0.14942	5.4	0.158	0.14942	GPCR, rhodopsin-like superfamily (1);	0.415884	0.28459	N	0.015270	T	0.06508	0.0167	N	0.04245	-0.25	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37549	-0.9701	10	0.09590	T	0.72	.	4.9026	0.13782	0.5116:0.2522:0.1675:0.0686	.	100	P07550	ADRB2_HUMAN	S	100	ENSP00000305372:T100S	ENSP00000305372:T100S	T	+	2	0	0	ADRB2	148186886	148186886	0.024000	0.19004	0.917000	0.36280	0.995000	0.86356	0.638000	0.24674	-0.152000	0.11156	0.655000	0.94253	ACT	0.768786		TCGA-FB-AAPU-01A-31D-A40W-08	0.527	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252189.1	0	0	1		2	2	2	0		0	0	50		50	50	1	2	-10.688220	1	0.700000	NM_000024			9	9		234	230	0		1	0		0	0	50	0		0.994030	0	0	0	0	1	0	9	234
HACE1	57531	broad.mit.edu	37	6	105198307	105198307	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr6:105198307C>G	ENST00000262903.4	-	20	2528	c.2252G>C	c.(2251-2253)aGa>aCa	p.R751T	HACE1_ENST00000369125.2_Missense_Mutation_p.R536T|HACE1_ENST00000517995.1_5'UTR	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	751	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CTGAATGGCTCTTGTCATTCG	0.368																																						ENST00000262903.4	0.350000	1.100000e-01	2.700000e-01	1.500000e-01	0.200000	0.221846	0.200000	0.200000																										0				44						c.(2251-2253)aGa>aCa		HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1							112.0	104.0	107.0					6																	105198307		2203	4300	6503	SO:0001583	missense	57531	0	0					g.chr6:105198307C>G	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2252G>C	chr6.hg19:g.105198307C>G	ENSP00000262903:p.Arg751Thr	1					HACE1_ENST00000369125.2_Missense_Mutation_p.R536T|HACE1_ENST00000517995.1_5'UTR	p.R751T	NM_020771.3	NP_065822.2	0	2	2	1.969417	Q8IYU2	HACE1_HUMAN		20	2528	-		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	1	1	hg19	c.2252G>C	CCDS5050.1	0	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872626	0.72180	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.56776	0.44;0.44	5.0	5.0	0.66597	5.0	5.0	0.66597	HECT (4);	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	N	0.25286	0.73	0.34010	D	0.651392	B;P;D;D	0.59357	0.347;0.901;0.985;0.981	B;P;D;D	0.69824	0.387;0.453;0.966;0.943	T	0.36456	-0.9747	10	0.17369	T	0.5	.	18.6385	0.91386	0.0:1.0:0.0:0.0	.	536;240;751;404	E9PGP0;B4DFM6;Q8IYU2;Q8IYU2-3	.;.;HACE1_HUMAN;.	T	751;536	ENSP00000262903:R751T;ENSP00000358121:R536T	ENSP00000262903:R751T	R	-	2	0	0	HACE1	105305000	105305000	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.358000	0.79466	2.473000	0.83533	0.563000	0.77884	AGA	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.368	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	1	0	1		2	2	2	0		0	0	54		54	54	1	2	-3.319756	1	0.700000	XM_045095			12	12		159	158	0		1	0		0	0	54	0		0.999196	9.527409e-02	0	1	0	6	0	12	159
RBM24	221662	broad.mit.edu	37	6	17292038	17292038	+	Silent	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr6:17292038C>G	ENST00000379052.5	+	4	635	c.399C>G	c.(397-399)gtC>gtG	p.V133V	RBM24_ENST00000425446.2_Silent_p.V75V|RBM24_ENST00000508508.1_3'UTR|RBM24_ENST00000318204.5_Silent_p.V88V	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24	133					cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			CGGGAGTGGTCATTCCACACG	0.542																																						ENST00000379052.5	0.100000	2.000000e-02	8.000000e-02	3.000000e-02	0.050000	0.063108	0.050000	0.060000																										0				13						c.(397-399)gtC>gtG		RNA binding motif protein 24							87.0	101.0	96.0					6																	17292038		2176	4286	6462	SO:0001819	synonymous_variant	221662	0	0					g.chr6:17292038C>G	BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.399C>G	chr6.hg19:g.17292038C>G		0					RBM24_ENST00000318204.5_Silent_p.V88V|RBM24_ENST00000425446.2_Silent_p.V75V|RBM24_ENST00000508508.1_3'UTR	p.V133V	NM_001143942.1	NP_001137414.1	0	0	0	1.955452	Q9BX46	RBM24_HUMAN	all cancers(50;0.131)|Epithelial(50;0.15)	4	635	+	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	Silent	SNP	ENST00000379052.5	0	1	hg19	c.399C>G	CCDS47378.1	0	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329137	0.24167	.	.	ENSG00000112183	ENST00000503965	.	.	.	5.71	1.34	0.21922	5.71	1.34	0.21922	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.3684	3.4813	0.07603	0.3218:0.4196:0.1748:0.0839	.	.	.	.	X	98	.	.	S	+	2	0	0	RBM24	17400017	17400017	0.303000	0.24463	0.997000	0.53966	0.998000	0.95712	-0.217000	0.09253	0.020000	0.15106	0.591000	0.81541	TCA	0.695740		TCGA-FB-AAPU-01A-31D-A40W-08	0.542	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039946.2	0	0	1		2	2	2	0		0	0	123		123	120	1	2	-2.801395	1	0.700000	NM_153020			11	11		522	519	0		1	0		0	0	123	0		0.998291	5.419828e-04	0	0	0	2	0	11	522
DAAM2	23500	broad.mit.edu	37	6	39866704	39866704	+	Silent	SNP	G	G	A	rs370996980	byFrequency	TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr6:39866704G>A	ENST00000398904.2	+	22	2852	c.2670G>A	c.(2668-2670)gcG>gcA	p.A890A	RP11-61I13.3_ENST00000430595.1_RNA|RP11-61I13.3_ENST00000606829.1_RNA|DAAM2_ENST00000538976.1_Silent_p.A890A|RP11-61I13.3_ENST00000420293.1_RNA|RP11-61I13.3_ENST00000437947.1_RNA|DAAM2_ENST00000274867.4_Silent_p.A890A			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	890	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GCCTGAGAGCGGTGGAGGTGG	0.577													G|||	3	0.000599042	0.0008	0.0014	5008	,	,		20722	0.0		0.0	False		,,,				2504	0.001					ENST00000398904.2	0.930000	3.300000e-01	7.700000e-01	4.500000e-01	0.600000	0.619950	0.600000	0.590000																										0				49						c.(2668-2670)gcG>gcA		dishevelled associated activator of morphogenesis 2		G	,	1,4139		0,1,2069	87.0	104.0	98.0		2670,2670	-10.7	0.3	6		98	0,8426		0,0,4213	no	coding-synonymous,coding-synonymous	DAAM2	NM_001201427.1,NM_015345.3	,	0,1,6282	AA,AG,GG		0.0,0.0242,0.0080	,	890/1069,890/1068	39866704	1,12565	2070	4213	6283	SO:0001819	synonymous_variant	23500	5	121040	39				g.chr6:39866704G>A	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2670G>A	chr6.hg19:g.39866704G>A		0					RP11-61I13.3_ENST00000606829.1_RNA|DAAM2_ENST00000274867.4_Silent_p.A890A|RP11-61I13.3_ENST00000430595.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|RP11-61I13.3_ENST00000437947.1_RNA|DAAM2_ENST00000538976.1_Silent_p.A890A	p.A890A			0	0	0	1.969283	Q86T65	DAAM2_HUMAN		22	2852	+	Ovarian(28;0.0355)|Colorectal(47;0.196)		G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Silent	SNP	ENST00000398904.2	1	1	hg19	c.2670G>A	CCDS56426.1	0																																																																																								0.695740		TCGA-FB-AAPU-01A-31D-A40W-08	0.577	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1	1	0	1		2	2	2	0		0	0	12		12	12	1	2	-10.489340	1	0.700000				11	11		41	39	1		1	0		0	0	12	0		0.998675	3.106473e-01	0	0	0	5	0	11	41
KLHL32	114792	broad.mit.edu	37	6	97423967	97423967	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr6:97423967A>G	ENST00000369261.4	+	3	481	c.118A>G	c.(118-120)Atc>Gtc	p.I40V	KLHL32_ENST00000539200.1_Missense_Mutation_p.I40V|KLHL32_ENST00000536676.1_Missense_Mutation_p.I40V|KLHL32_ENST00000544166.1_5'UTR	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	40										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GAGTGATGGCATCCTCTGCGA	0.507																																						ENST00000369261.4	0.140000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.074769	0.060000	0.060000																										0				38						c.(118-120)Atc>Gtc		kelch-like family member 32							99.0	77.0	85.0					6																	97423967		2203	4300	6503	SO:0001583	missense	114792	0	0					g.chr6:97423967A>G	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.118A>G	chr6.hg19:g.97423967A>G	ENSP00000358265:p.Ile40Val	1					KLHL32_ENST00000544166.1_5'UTR|KLHL32_ENST00000539200.1_Missense_Mutation_p.I40V|KLHL32_ENST00000536676.1_Missense_Mutation_p.I40V	p.I40V	NM_052904.3	NP_443136.2	0	1	1	1.315272	Q96NJ5	KLH32_HUMAN		3	481	+		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	0	1	hg19	c.118A>G	CCDS5038.1	0	.	.	.	.	.	.	.	.	.	.	A	12.19	1.865093	0.32977	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200;ENST00000369254	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.14	3.98	0.46160	5.14	3.98	0.46160	BTB/POZ (1);BTB/POZ fold (2);	0.319047	0.33834	N	0.004507	T	0.35158	0.0922	N	0.25201	0.72	0.80722	D	1	B;B;B;B	0.15719	0.0;0.0;0.014;0.008	B;B;B;B	0.19666	0.0;0.0;0.015;0.026	T	0.26744	-1.0094	10	0.30854	T	0.27	.	11.1181	0.48273	0.917:0.0:0.083:0.0	.	40;40;40;40	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	V	40	ENSP00000358265:I40V;ENSP00000440382:I40V;ENSP00000441527:I40V;ENSP00000358258:I40V	ENSP00000358258:I40V	I	+	1	0	0	KLHL32	97530688	97530688	0.997000	0.39634	1.000000	0.80357	0.961000	0.63080	2.905000	0.48727	2.159000	0.67721	0.482000	0.46254	ATC	0.540933		TCGA-FB-AAPU-01A-31D-A40W-08	0.507	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	0	0	1		2	2	2	0		0	0	61		61	61	1	2	-7.262399	1	0.700000	NM_052904			4	4		118	116	0		1			0	0	61	0		0.887695	0	0	0	0	0	0	4	118
THBS2	7058	broad.mit.edu	37	6	169639743	169639743	+	Silent	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr6:169639743G>A	ENST00000366787.3	-	8	1329	c.1080C>T	c.(1078-1080)tgC>tgT	p.C360C	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	360	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ATGGACTGGCGCAGGTTGCAG	0.512																																					Esophageal Squamous(91;219 1934 18562 44706)	ENST00000366787.3	1.000000	1.000000e-01	4.000000e-01	1.700000e-01	0.260000	0.303608	0.260000	0.240000																										0				111						c.(1078-1080)tgC>tgT		thrombospondin 2							84.0	62.0	69.0					6																	169639743		2201	4298	6499	SO:0001819	synonymous_variant	7058	1	121146	30				g.chr6:169639743G>A		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1080C>T	chr6.hg19:g.169639743G>A		0					XXyac-YX65C7_A.2_ENST00000444188.1_RNA	p.C360C	NM_003247.2	NP_003238.2	1	2	3	2.051905	P35442	TSP2_HUMAN		8	1329	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	0	1	hg19	c.1080C>T	CCDS34574.1	0																																																																																								0.704142		TCGA-FB-AAPU-01A-31D-A40W-08	0.512	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	0	0	1		2	2	2	0		0	0	12		12	12	1	2	-5.260740	1	0.700000	NM_003247			5	5		54	53	0		1	0		0	0	12	0		0.937599	9.764975e-01	0	0	0	81	0	5	54
GIMAP1	170575	broad.mit.edu	37	7	150417597	150417597	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr7:150417597A>C	ENST00000307194.5	+	3	645	c.505A>C	c.(505-507)Aca>Cca	p.T169P		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	169	AIG1-type G.				B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGTGAGCAACACAGAGAACCG	0.647																																						ENST00000307194.5	1.000000	6.100000e-01	1	6.800000e-01	0.760000	0.797536	0.760000	0.740000																										0				28						c.(505-507)Aca>Cca		GTPase, IMAP family member 1							53.0	56.0	55.0					7																	150417597		2203	4300	6503	SO:0001583	missense	170575	0	0					g.chr7:150417597A>C	AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.505A>C	chr7.hg19:g.150417597A>C	ENSP00000302833:p.Thr169Pro	1						p.T169P	NM_130759.3	NP_570115.1	1	2	3	2.507732	Q8WWP7	GIMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	3	645	+			B2RCI3|Q8NAZ0	Missense_Mutation	SNP	ENST00000307194.5	1	1	hg19	c.505A>C	CCDS5906.1	0	.	.	.	.	.	.	.	.	.	.	A	10.64	1.407461	0.25378	.	.	ENSG00000213203	ENST00000307194	T	0.60672	0.17	4.81	1.04	0.20106	4.81	1.04	0.20106	AIG1 (1);	0.325956	0.28431	U	0.015380	T	0.63307	0.2500	M	0.64170	1.965	0.09310	N	1	P	0.47910	0.902	P	0.61397	0.888	T	0.53493	-0.8431	10	0.56958	D	0.05	.	3.4499	0.07494	0.5502:0.0:0.0968:0.353	.	169	Q8WWP7	GIMA1_HUMAN	P	169	ENSP00000302833:T169P	ENSP00000302833:T169P	T	+	1	0	0	GIMAP1	150048530	150048530	0.000000	0.05858	0.008000	0.14137	0.009000	0.06853	0.636000	0.24644	0.033000	0.15463	-0.309000	0.09137	ACA	0.760383		TCGA-FB-AAPU-01A-31D-A40W-08	0.647	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348951.2	1	0	1		2	2	2	0		0	0	60		60	60	1	2	-20.000000	1	0.700000	NM_130759			87	85		331	325	1		1	0		0	0	60	0		1.000000	1.962864e-01	0	0	0	4	0	87	331
SDK1	221935	broad.mit.edu	37	7	4247761	4247761	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr7:4247761G>A	ENST00000404826.2	+	37	5384	c.5245G>A	c.(5245-5247)Gaa>Aaa	p.E1749K	SDK1_ENST00000389531.3_Missense_Mutation_p.E1729K	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1749	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAGCCAGAACGAAACGGAGAA	0.552																																						ENST00000404826.2	1.000000	9.000000e-02	2.200000e-01	1.200000e-01	0.160000	0.202249	0.160000	0.160000																										0				153						c.(5245-5247)Gaa>Aaa		sidekick cell adhesion molecule 1							79.0	79.0	79.0					7																	4247761		2203	4300	6503	SO:0001583	missense	221935	0	0					g.chr7:4247761G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5245G>A	chr7.hg19:g.4247761G>A	ENSP00000385899:p.Glu1749Lys	0					SDK1_ENST00000389531.3_Missense_Mutation_p.E1729K	p.E1749K	NM_152744.3	NP_689957.3	1	2	3	2.068427	Q7Z5N4	SDK1_HUMAN		37	5384	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	1	1	hg19	c.5245G>A	CCDS34590.1	0	.	.	.	.	.	.	.	.	.	.	G	10.26	1.302508	0.23736	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.53640	0.61;0.61	4.67	3.77	0.43336	4.67	3.77	0.43336	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.667620	0.13455	N	0.386599	T	0.41604	0.1166	M	0.66560	2.04	0.28442	N	0.916768	P;B;B	0.37158	0.585;0.034;0.249	B;B;B	0.29524	0.103;0.015;0.082	T	0.33394	-0.9870	10	0.22706	T	0.39	.	12.5036	0.55970	0.0817:0.0:0.9183:0.0	.	1729;236;1749	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	K	1749;1729	ENSP00000385899:E1749K;ENSP00000374182:E1729K	ENSP00000374182:E1729K	E	+	1	0	0	SDK1	4214287	4214287	1.000000	0.71417	0.571000	0.28486	0.426000	0.31534	4.633000	0.61318	2.302000	0.77476	0.655000	0.94253	GAA	0.705160		TCGA-FB-AAPU-01A-31D-A40W-08	0.552	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	1	0	1		2	2	2	0		0	0	44		44	43	1	2	-18.313940	1	0.700000	NM_152744			16	15		271	270	0		1	0		0	0	44	0		0.999936	0	0	0	0	1	0	16	271
PEG10	23089	broad.mit.edu	37	7	94293789	94293789	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr7:94293789T>A	ENST00000482108.1	+	2	1400	c.921T>A	c.(919-921)aaT>aaA	p.N307K	PEG10_ENST00000488574.1_Missense_Mutation_p.N307K	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	307					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ACGCTGACAATTGTCCTGCCA	0.582																																						ENST00000482108.1	1.000000	5.800000e-01	1	7.900000e-01	0.990000	0.926655	0.990000	1.000000																										0				21						c.(919-921)aaT>aaA		paternally expressed 10							20.0	25.0	24.0					7																	94293789		1953	4145	6098	SO:0001583	missense	23089	0	0					g.chr7:94293789T>A	AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.921T>A	chr7.hg19:g.94293789T>A	ENSP00000417587:p.Asn307Lys	1					PEG10_ENST00000488574.1_Missense_Mutation_p.N307K	p.N307K	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	2	2	4	3.465305	Q86TG7	PEG10_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)	2	1400	+	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		Q96A68|Q9UPV1	Missense_Mutation	SNP	ENST00000482108.1	0	1	hg19	c.921T>A	CCDS55126.1	1	.	.	.	.	.	.	.	.	.	.	T	10.18	1.279380	0.23307	.	.	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.76186	-1.0;-1.0	4.42	1.51	0.23008	4.42	1.51	0.23008	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (2);	.	.	.	.	T	0.54013	0.1832	N	0.19112	0.55	0.22684	N	0.998851	B;B	0.13145	0.007;0.001	B;B	0.12156	0.007;0.002	T	0.36163	-0.9759	9	0.29301	T	0.29	.	4.0781	0.09914	0.0:0.5347:0.1743:0.291	.	383;307	B4DSP0;Q86TG7	.;PEG10_HUMAN	K	307	ENSP00000417587:N307K;ENSP00000418944:N307K	ENSP00000417587:N307K	N	+	3	2	2	PEG10	94131725	94131725	0.214000	0.23563	0.998000	0.56505	0.920000	0.55202	0.218000	0.17622	0.203000	0.20529	-0.262000	0.10625	AAT	0.823529		TCGA-FB-AAPU-01A-31D-A40W-08	0.582	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340751.1	1	0	1		2	2	2	0		0	0	8		8	8	1	2	-20.000000	1	0.700000	NM_015068			11	11		41	41	1		1			0	0	8	0		0.998946	0	0	0	0	0	0	11	41
NOS3	4846	broad.mit.edu	37	7	150699033	150699033	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr7:150699033C>T	ENST00000484524.1	+	12	1627	c.1627C>T	c.(1627-1629)Cgg>Tgg	p.R543W	NOS3_ENST00000461406.1_Missense_Mutation_p.R337W|NOS3_ENST00000297494.3_Missense_Mutation_p.R543W|NOS3_ENST00000467517.1_Missense_Mutation_p.R543W	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGACTCTTCCGGAAGGCTTT	0.632																																						ENST00000484524.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				50						c.(1627-1629)Cgg>Tgg		nitric oxide synthase 3 (endothelial cell)							35.0	39.0	38.0					7																	150699033		2203	4300	6503	SO:0001583	missense	4846	6	121398	36				g.chr7:150699033C>T		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1627C>T	chr7.hg19:g.150699033C>T	ENSP00000420215:p.Arg543Trp	1					NOS3_ENST00000297494.3_Missense_Mutation_p.R543W|NOS3_ENST00000467517.1_Missense_Mutation_p.R543W|NOS3_ENST00000461406.1_Missense_Mutation_p.R337W	p.R543W	NM_001160111.1	NP_001153583.1	1	2	3	2.507732	P60323	NANO3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	12	1627	+	all_neural(206;0.219)		Q495E5	Missense_Mutation	SNP	ENST00000484524.1	1	1	hg19	c.1627C>T	CCDS55182.1	1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660722	0.67700	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	4.8	3.9	0.45041	4.8	3.9	0.45041	Flavodoxin/nitric oxide synthase (2);	0.118708	0.35772	N	0.002998	D	0.86230	0.5883	M	0.88377	2.95	0.33655	D	0.609001	D;D;D;D;D	0.76494	0.999;0.999;0.988;0.997;0.997	D;D;D;D;P	0.70716	0.917;0.97;0.97;0.948;0.892	D	0.90621	0.4559	10	0.72032	D	0.01	-20.3273	10.4856	0.44719	0.3522:0.6478:0.0:0.0	.	543;543;543;337;543	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	W	543;337;543;543	ENSP00000297494:R543W;ENSP00000417143:R337W;ENSP00000420215:R543W;ENSP00000420551:R543W	ENSP00000297494:R543W	R	+	1	2	2	NOS3	150329966	150329966	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.991000	0.29654	1.123000	0.41961	0.655000	0.94253	CGG	0.760383		TCGA-FB-AAPU-01A-31D-A40W-08	0.632	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	1	0	1		2	2	2	0		0	0	64		64	63	1	2	-20.000000	1	0.700000	NM_000603			165	164		212	207	1		1	0		0	0	64	0		1.000000	8.191065e-01	0	0	0	6	0	165	212
ADRA1A	148	broad.mit.edu	37	8	26722090	26722090	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr8:26722090G>A	ENST00000519229.1	-	1	403	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	ADRA1A_ENST00000380572.3_Missense_Mutation_p.R133C|ADRA1A_ENST00000380587.1_Missense_Mutation_p.R133C|ADRA1A_ENST00000380586.1_Missense_Mutation_p.R133C|ADRA1A_ENST00000358857.5_Missense_Mutation_p.R133C|ADRA1A_ENST00000380582.3_Missense_Mutation_p.R133C|ADRA1A_ENST00000354550.4_Missense_Mutation_p.R133C|ADRA1A_ENST00000380573.3_Missense_Mutation_p.R133C|ADRA1A_ENST00000276393.4_Missense_Mutation_p.R133C|ADRA1A_ENST00000380581.2_Missense_Mutation_p.R133C			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	203					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	GTTGGGTAGCGCAGCGGGTAG	0.617																																						ENST00000519229.1	0.800000	4.900000e-01	7.300000e-01	5.600000e-01	0.630000	0.647766	0.630000	0.640000																										0				36						c.(397-399)Cgc>Tgc		adrenoceptor alpha 1A	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)						73.0	73.0	73.0					8																	26722090		2203	4300	6503	SO:0001583	missense	148	0	0					g.chr8:26722090G>A	L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.397C>T	chr8.hg19:g.26722090G>A	ENSP00000430793:p.Arg133Cys	1					ADRA1A_ENST00000380572.3_Missense_Mutation_p.R133C|ADRA1A_ENST00000380581.2_Missense_Mutation_p.R133C|ADRA1A_ENST00000380573.3_Missense_Mutation_p.R133C|ADRA1A_ENST00000380582.3_Missense_Mutation_p.R133C|ADRA1A_ENST00000354550.4_Missense_Mutation_p.R133C|ADRA1A_ENST00000380587.1_Missense_Mutation_p.R133C|ADRA1A_ENST00000380586.1_Missense_Mutation_p.R133C|ADRA1A_ENST00000358857.5_Missense_Mutation_p.R133C|ADRA1A_ENST00000276393.4_Missense_Mutation_p.R133C	p.R133C			0	1	1	1.873826	P25100	ADA1D_HUMAN		1	403	-		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)	Q9NPY0	Missense_Mutation	SNP	ENST00000519229.1	1	1	hg19	c.397C>T		0	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599366	0.66332	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	4.94	4.94	0.65067	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.058843	0.64402	D	0.000001	T	0.67429	0.2892	M	0.89214	3.015	0.54753	D	0.999985	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.75020	0.975;0.975;0.973;0.975;0.95;0.985	T	0.73585	-0.3936	10	0.87932	D	0	.	11.6903	0.51512	0.0:0.0:0.7031:0.2969	.	133;133;133;133;133;133	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	C	133	ENSP00000369960:R133C;ENSP00000369961:R133C;ENSP00000369956:R133C;ENSP00000369955:R133C;ENSP00000430793:R133C;ENSP00000346557:R133C;ENSP00000276393:R133C;ENSP00000369947:R133C;ENSP00000369946:R133C;ENSP00000351725:R133C	ENSP00000276393:R133C	R	-	1	0	0	ADRA1A	26778007	26778007	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.027000	0.64109	2.423000	0.82170	0.563000	0.77884	CGC	0.674973		TCGA-FB-AAPU-01A-31D-A40W-08	0.617	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000376207.1	1	0	1		2	2	2	0		0	0	55		55	53	1	2	-20.000000	1	0.700000	NM_033303			48	47		149	147	1		1			0	0	55	0		1.000000	0	0	0	0	0	0	48	149
EXTL3	2137	broad.mit.edu	37	8	28575489	28575489	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr8:28575489C>A	ENST00000220562.4	+	3	2815	c.1913C>A	c.(1912-1914)cCt>cAt	p.P638H	EXTL3_ENST00000523149.1_Missense_Mutation_p.P254H|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	638					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GGCTTTCGGCCTATTGGTGGT	0.557																																						ENST00000220562.4	0.790000	5.300000e-01	7.300000e-01	5.900000e-01	0.650000	0.665015	0.650000	0.660000																										0				36						c.(1912-1914)cCt>cAt		exostosin-like glycosyltransferase 3							81.0	80.0	80.0					8																	28575489		2203	4300	6503	SO:0001583	missense	2137	0	0					g.chr8:28575489C>A	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1913C>A	chr8.hg19:g.28575489C>A	ENSP00000220562:p.Pro638His	1					EXTL3_ENST00000523149.1_Missense_Mutation_p.P254H|EXTL3_ENST00000519886.1_Intron	p.P638H	NM_001440.2	NP_001431.1	0	1	1	1.873826	O43909	EXTL3_HUMAN		3	2815	+		Ovarian(32;0.069)	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	1	1	hg19	c.1913C>A	CCDS6070.1	0	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896758	0.72639	.	.	ENSG00000012232	ENST00000523149;ENST00000220562	D;D	0.97016	-3.64;-4.21	5.74	5.74	0.90152	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98335	1.0535	10	0.87932	D	0	-20.1467	20.2982	0.98569	0.0:1.0:0.0:0.0	.	638	O43909	EXTL3_HUMAN	H	254;638	ENSP00000428691:P254H;ENSP00000220562:P638H	ENSP00000220562:P638H	P	+	2	0	0	EXTL3	28631408	28631408	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.567000	0.82357	2.873000	0.98535	0.563000	0.77884	CCT	0.674973		TCGA-FB-AAPU-01A-31D-A40W-08	0.557	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	1	0	1		2	2	2	0		0	0	86		86	83	1	2	-20.000000	1	0.700000	NM_001440			72	72		215	212	1		1	1		0	0	86	0		1.000000	9.989941e-01	0	14	0	20	0	72	215
INTS9	55756	broad.mit.edu	37	8	28717081	28717081	+	Splice_Site	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr8:28717081C>A	ENST00000521022.1	-	2	91		c.e2-1		INTS9_ENST00000397363.4_Intron|INTS9_ENST00000521777.1_Splice_Site|INTS9_ENST00000416984.2_Splice_Site	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9						snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		ACAGGCAATACTGAAAAAAAT	0.383																																						ENST00000521022.1	0.830000	4.400000e-01	7.300000e-01	5.200000e-01	0.620000	0.635506	0.620000	0.620000																										0				19						c.e2-1		integrator complex subunit 9							126.0	112.0	116.0					8																	28717081		2203	4300	6503	SO:0001630	splice_region_variant	55756	0	0					g.chr8:28717081C>A	BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.10-1G>T	chr8.hg19:g.28717081C>A		1					INTS9_ENST00000397363.4_Intron|INTS9_ENST00000416984.2_Splice_Site|INTS9_ENST00000521777.1_Splice_Site		NM_018250.3	NP_060720.2	0	1	1	1.873826	Q9NV88	INT9_HUMAN		2	91	-		Ovarian(32;0.0439)	B7Z560|B7Z6M5|O00224|Q8TB16	Splice_Site	SNP	ENST00000521022.1	1	1	hg19		CCDS34873.1	0	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162573	0.57368	.	.	ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000541706;ENST00000523436	.	.	.	4.94	4.94	0.65067	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5649	0.91113	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	INTS9	28773000	28773000	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	7.720000	0.84759	2.456000	0.83038	0.655000	0.94253	.	0.674973		TCGA-FB-AAPU-01A-31D-A40W-08	0.383	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1	1	0	1		2	2	2	0		0	0	29		29	29	1	2	-19.986440	1	0.700000	NM_018250	Intron		29	29		93	93	0		1			0	0	29	0		1.000000	0	0	0	0	0	0	29	93
KCNQ3	3786	broad.mit.edu	37	8	133184899	133184899	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr8:133184899T>A	ENST00000388996.4	-	7	1506	c.1086A>T	c.(1084-1086)caA>caT	p.Q362H	KCNQ3_ENST00000521134.1_Missense_Mutation_p.Q242H|KCNQ3_ENST00000519445.1_Missense_Mutation_p.Q362H	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	362					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCTGACGGTGTTGCTCCTGCA	0.587																																						ENST00000388996.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				70						c.(1084-1086)caA>caT		potassium voltage-gated channel, KQT-like subfamily, member 3	Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)						193.0	146.0	162.0					8																	133184899		2203	4300	6503	SO:0001583	missense	3786	0	0					g.chr8:133184899T>A	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1086A>T	chr8.hg19:g.133184899T>A	ENSP00000373648:p.Gln362His	1					KCNQ3_ENST00000521134.1_Missense_Mutation_p.Q242H|KCNQ3_ENST00000519445.1_Missense_Mutation_p.Q362H	p.Q362H	NM_004519.3	NP_004510.1	1	2	3	2.284464	O43525	KCNQ3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)	7	1506	-	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	1	1	hg19	c.1086A>T	CCDS34943.1	1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.525173	0.64747	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99186	-5.52;-5.44;-5.53	5.0	-2.3	0.06785	5.0	-2.3	0.06785	.	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	L	0.56396	1.775	0.46654	D	0.999145	D;D	0.71674	0.998;0.998	D;D	0.79784	0.993;0.993	D	0.97346	0.9960	10	0.87932	D	0	-21.3538	11.8756	0.52546	0.0:0.3411:0.0:0.6589	.	362;362	E7ET42;O43525	.;KCNQ3_HUMAN	H	362;242;362;351;241	ENSP00000373648:Q362H;ENSP00000429799:Q242H;ENSP00000428790:Q362H	ENSP00000373648:Q362H	Q	-	3	2	2	KCNQ3	133254081	133254081	0.890000	0.30428	0.991000	0.47740	0.984000	0.73092	0.009000	0.13219	-0.300000	0.08895	-0.315000	0.08773	CAA	0.735216		TCGA-FB-AAPU-01A-31D-A40W-08	0.587	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	1	0	1		2	2	2	0		0	0	79		79	79	1	2	-20.000000	1	0.700000	NM_004519			157	151		231	228	1		1	1		0	0	79	0		1.000000	6.687366e-01	0	2	0	3	0	157	231
TEX10	54881	broad.mit.edu	37	9	103090198	103090198	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:103090198G>C	ENST00000374902.4	-	8	1848	c.1672C>G	c.(1672-1674)Caa>Gaa	p.Q558E	TEX10_ENST00000535814.1_Missense_Mutation_p.Q561E	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	558						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TGAGCAAGTTGCAATGGTAAG	0.398																																						ENST00000374902.4	1.000000	8.400000e-01	1	9.300000e-01	0.990000	0.977677	0.990000	1.000000																										0				38						c.(1672-1674)Caa>Gaa		testis expressed 10							97.0	82.0	87.0					9																	103090198		2203	4300	6503	SO:0001583	missense	54881	0	0					g.chr9:103090198G>C	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1672C>G	chr9.hg19:g.103090198G>C	ENSP00000364037:p.Gln558Glu	0					TEX10_ENST00000535814.1_Missense_Mutation_p.Q561E	p.Q558E	NM_017746.3	NP_060216.2	1	2	3	2.013462	Q9NXF1	TEX10_HUMAN		8	1848	-		Acute lymphoblastic leukemia(62;0.0527)	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	1	1	hg19	c.1672C>G	CCDS6748.1	1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593958	0.86953	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730	.	.	.	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.67097	0.2857	L	0.34521	1.04	0.80722	D	1	D;D;D	0.64830	0.994;0.99;0.993	D;D;P	0.72982	0.97;0.979;0.708	T	0.63171	-0.6697	9	0.29301	T	0.29	-6.3079	19.0215	0.92917	0.0:0.0:1.0:0.0	.	561;426;558	B4DYV2;E7ERG2;Q9NXF1	.;.;TEX10_HUMAN	E	561;558;426	.	ENSP00000364037:Q558E	Q	-	1	0	0	TEX10	102130019	102130019	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.932000	0.92897	2.494000	0.84150	0.655000	0.94253	CAA	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.398	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	1	0	1		2	2	2	0		0	0	53		53	52	1	2	-20.000000	1	0.700000	NM_017746			63	62		110	108	1		1	1		0	0	53	0		1.000000	9.999999e-01	0	28	0	20	0	63	110
EPB41L4B	54566	broad.mit.edu	37	9	111970268	111970268	+	Missense_Mutation	SNP	G	G	A	rs201598200		TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:111970268G>A	ENST00000374566.3	-	18	2331	c.1814C>T	c.(1813-1815)gCg>gTg	p.A605V		NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	605					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CACATGATCCGCAACAGGGGA	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		19497	0.0		0.0	False		,,,				2504	0.001					ENST00000374566.3	0.090000	0	7.000000e-02	2.000000e-02	0.040000	0.047127	0.040000	0.040000																										0				39						c.(1813-1815)gCg>gTg		erythrocyte membrane protein band 4.1 like 4B		G	VAL/ALA	0,3688		0,0,1844	130.0	118.0	121.0		1814	5.5	0.1	9		121	4,8220		0,4,4108	yes	missense	EPB41L4B	NM_019114.3	64	0,4,5952	AA,AG,GG		0.0486,0.0,0.0336	benign	605/901	111970268	4,11908	1844	4112	5956	SO:0001583	missense	54566	18	120806	46				g.chr9:111970268G>A	AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1814C>T	chr9.hg19:g.111970268G>A	ENSP00000363694:p.Ala605Val	0						p.A605V	NM_019114.3	NP_061987.3	1	2	3	2.013462	Q9H329	E41LB_HUMAN		18	2331	-			Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	0	1	hg19	c.1814C>T	CCDS43859.1	0	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711206	0.48517	0.0	4.86E-4	ENSG00000095203	ENST00000262536;ENST00000374566	D	0.84516	-1.86	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.39834	N	0.001248	T	0.78130	0.4235	N	0.22421	0.69	0.80722	D	1	B	0.22541	0.071	B	0.12156	0.007	T	0.75255	-0.3382	10	0.87932	D	0	.	16.9032	0.86118	0.0:0.0:1.0:0.0	.	605	Q9H329	E41LB_HUMAN	V	290;605	ENSP00000363694:A605V	ENSP00000262536:A290V	A	-	2	0	0	EPB41L4B	111010089	111010089	0.984000	0.35163	0.130000	0.21974	0.350000	0.29205	4.611000	0.61162	2.583000	0.87209	0.561000	0.74099	GCG	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.423	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	0	0	1		14	2	2	1		1	1	90		90	90	1	2	-1.970880	0	0.700000	NM_018424			5	5		356	347	0		0			1	0	90	0		0.026078	0	0	0	0	0	0	5	356
AMBP	259	broad.mit.edu	37	9	116837247	116837247	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:116837247G>C	ENST00000265132.3	-	3	592	c.330C>G	c.(328-330)caC>caG	p.H110Q		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	110					cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	TACTGGATTTGTGATAGAGAA	0.438																																						ENST00000265132.3	0.980000	6.800000e-01	9.100000e-01	7.500000e-01	0.820000	0.829881	0.820000	0.830000																										0				11						c.(328-330)caC>caG		alpha-1-microglobulin/bikunin precursor	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)						177.0	151.0	160.0					9																	116837247		2203	4300	6503	SO:0001583	missense	259	0	0					g.chr9:116837247G>C	X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.330C>G	chr9.hg19:g.116837247G>C	ENSP00000265132:p.His110Gln	0						p.H110Q	NM_001633.3	NP_001624.1	1	2	3	2.013462	P02760	AMBP_HUMAN		3	592	-			P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Missense_Mutation	SNP	ENST00000265132.3	1	1	hg19	c.330C>G	CCDS6800.1	0	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195027	0.58017	.	.	ENSG00000106927	ENST00000265132;ENST00000540645	T	0.07444	3.19	5.43	2.45	0.29901	5.43	2.45	0.29901	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.579014	0.19553	N	0.111528	T	0.19406	0.0466	M	0.83953	2.67	0.37815	D	0.928163	D;D	0.60575	0.988;0.966	P;P	0.56343	0.796;0.617	T	0.05084	-1.0907	10	0.38643	T	0.18	.	4.7856	0.13223	0.1675:0.0:0.6611:0.1713	.	51;110	B7Z8R6;P02760	.;AMBP_HUMAN	Q	110;51	ENSP00000265132:H110Q	ENSP00000265132:H110Q	H	-	3	2	2	AMBP	115877068	115877068	0.031000	0.19500	0.934000	0.37439	0.845000	0.48019	0.132000	0.15891	0.686000	0.31488	0.561000	0.74099	CAC	0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.438	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053758.2	1	0	1		2	2	2	0		0	0	101		101	100	1	2	-20.000000	1	0.700000	NM_001633			86	85		212	206	1		1	1		0	0	101	0		1.000000	9.404316e-01	0	8	0	6	0	86	212
CCIN	881	broad.mit.edu	37	9	36170825	36170825	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:36170825C>T	ENST00000335119.2	+	1	1437	c.1326C>T	c.(1324-1326)gtC>gtT	p.V442V		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	442					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			TCTCCCGGGTCGGGGTAGTGG	0.552																																						ENST00000335119.2	0.940000	6.500000e-01	8.700000e-01	7.100000e-01	0.790000	0.798856	0.790000	0.800000																										0				21						c.(1324-1326)gtC>gtT		calicin							115.0	96.0	102.0					9																	36170825		2203	4300	6503	SO:0001819	synonymous_variant	881	2	121412	34				g.chr9:36170825C>T	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.1326C>T	chr9.hg19:g.36170825C>T		0						p.V442V	NM_005893.2	NP_005884.2	0	0	0	1.909640	Q13939	CALI_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	1	1437	+			Q9BXG7	Silent	SNP	ENST00000335119.2	1	1	hg19	c.1326C>T	CCDS6599.1	0																																																																																								0.684543		TCGA-FB-AAPU-01A-31D-A40W-08	0.552	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	1	0	1		2	2	2	0		0	0	96		96	95	1	2	-20.000000	1	0.700000	NM_005893			80	79		193	187	1		1			0	0	96	0		1.000000	0	0	0	0	0	0	80	193
RNF38	152006	broad.mit.edu	37	9	36351123	36351123	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:36351123C>G	ENST00000259605.6	-	9	1359	c.1252G>C	c.(1252-1254)Gaa>Caa	p.E418Q	RNF38_ENST00000350199.4_Missense_Mutation_p.E335Q|RNF38_ENST00000357058.3_Missense_Mutation_p.E335Q|RNF38_ENST00000353739.4_Missense_Mutation_p.E368Q|RNF38_ENST00000377885.2_Missense_Mutation_p.E335Q|RNF38_ENST00000377877.4_Missense_Mutation_p.E342Q	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	418					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			TCGTAATTTTCTACTTCTCCA	0.378																																						ENST00000259605.6			0	0																														0				11						c.(1252-1254)Gaa>Caa		ring finger protein 38							86.0	82.0	83.0					9																	36351123		2203	4300	6503	SO:0001583	missense	152006	0	0					g.chr9:36351123C>G		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.1252G>C	chr9.hg19:g.36351123C>G	ENSP00000259605:p.Glu418Gln						RNF38_ENST00000377885.2_Missense_Mutation_p.E335Q|RNF38_ENST00000350199.4_Missense_Mutation_p.E335Q|RNF38_ENST00000353739.4_Missense_Mutation_p.E368Q|RNF38_ENST00000357058.3_Missense_Mutation_p.E335Q|RNF38_ENST00000377877.4_Missense_Mutation_p.E342Q	p.E418Q	NM_022781.4	NP_073618.3					Q9H0F5	RNF38_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	9	1359	-			A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	ENST00000259605.6	1	1	hg19	c.1252G>C	CCDS6603.1		.	.	.	.	.	.	.	.	.	.	C	24.1	4.499260	0.85069	.	.	ENSG00000137075	ENST00000259605;ENST00000353739;ENST00000377885;ENST00000357058;ENST00000350199;ENST00000377876;ENST00000377870;ENST00000377877	T;T;T;T;T;T	0.16073	2.37;2.4;2.41;2.41;2.41;2.42	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.41534	0.1163	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;0.987;0.999	D;D;D	0.87578	0.998;0.958;0.995	T	0.22138	-1.0225	10	0.66056	D	0.02	-6.4143	16.4624	0.84064	0.0:1.0:0.0:0.0	.	342;368;418	B1AM81;Q9H0F5-2;Q9H0F5	.;.;RNF38_HUMAN	Q	418;368;335;335;335;235;342;342	ENSP00000259605:E418Q;ENSP00000335239:E368Q;ENSP00000367117:E335Q;ENSP00000349566:E335Q;ENSP00000343947:E335Q;ENSP00000367109:E342Q	ENSP00000259605:E418Q	E	-	1	0	0	RNF38	36341123	36341123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.103000	0.77014	2.553000	0.86117	0.563000	0.77884	GAA			TCGA-FB-AAPU-01A-31D-A40W-08	0.378	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3	1	0	0		2	2	2	0		0	0	26		26	26	1	2	-20.000000	1	0.700000	NM_022781			20	19		45	44	1		1	1		0	0	26	0		0.999998	9.965730e-01	0	13	0	11	0	20	45
RNF38	152006	broad.mit.edu	37	9	36351150	36351150	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:36351150C>T	ENST00000259605.6	-	9	1332	c.1225G>A	c.(1225-1227)Gaa>Aaa	p.E409K	RNF38_ENST00000350199.4_Missense_Mutation_p.E326K|RNF38_ENST00000357058.3_Missense_Mutation_p.E326K|RNF38_ENST00000353739.4_Missense_Mutation_p.E359K|RNF38_ENST00000377885.2_Missense_Mutation_p.E326K|RNF38_ENST00000377877.4_Missense_Mutation_p.E333K	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	409					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			ACATCTAATTCAAAGCTGAAA	0.358																																						ENST00000259605.6			0	0																														0				11						c.(1225-1227)Gaa>Aaa		ring finger protein 38							82.0	78.0	79.0					9																	36351150		2203	4300	6503	SO:0001583	missense	152006	0	0					g.chr9:36351150C>T		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.1225G>A	chr9.hg19:g.36351150C>T	ENSP00000259605:p.Glu409Lys						RNF38_ENST00000377885.2_Missense_Mutation_p.E326K|RNF38_ENST00000350199.4_Missense_Mutation_p.E326K|RNF38_ENST00000353739.4_Missense_Mutation_p.E359K|RNF38_ENST00000357058.3_Missense_Mutation_p.E326K|RNF38_ENST00000377877.4_Missense_Mutation_p.E333K	p.E409K	NM_022781.4	NP_073618.3					Q9H0F5	RNF38_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	9	1332	-			A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	ENST00000259605.6	1	1	hg19	c.1225G>A	CCDS6603.1		.	.	.	.	.	.	.	.	.	.	C	23.7	4.451466	0.84209	.	.	ENSG00000137075	ENST00000259605;ENST00000353739;ENST00000377885;ENST00000357058;ENST00000350199;ENST00000377876;ENST00000377870;ENST00000377877	T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	L	0.40543	1.245	0.80722	D	1	P;B;P	0.47910	0.82;0.38;0.902	P;B;P	0.46110	0.504;0.291;0.504	T	0.54596	-0.8270	10	0.54805	T	0.06	-6.5436	16.4624	0.84064	0.0:1.0:0.0:0.0	.	333;359;409	B1AM81;Q9H0F5-2;Q9H0F5	.;.;RNF38_HUMAN	K	409;359;326;326;326;226;333;333	ENSP00000259605:E409K;ENSP00000335239:E359K;ENSP00000367117:E326K;ENSP00000349566:E326K;ENSP00000343947:E326K;ENSP00000367109:E333K	ENSP00000259605:E409K	E	-	1	0	0	RNF38	36341150	36341150	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.061000	0.76699	2.553000	0.86117	0.563000	0.77884	GAA			TCGA-FB-AAPU-01A-31D-A40W-08	0.358	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3	1	0	0		2	2	2	0		0	0	28		28	28	1	2	-20.000000	1	0.700000	NM_022781			26	25		53	53	1		1	1		0	0	28	0		1.000000	9.990121e-01	0	16	0	11	0	26	53
PCSK5	5125	broad.mit.edu	37	9	78686787	78686787	+	Silent	SNP	G	G	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:78686787G>A	ENST00000545128.1	+	7	1405	c.867G>A	c.(865-867)cgG>cgA	p.R289R	PCSK5_ENST00000376752.4_Silent_p.R289R|PCSK5_ENST00000376767.3_Silent_p.R289R	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	289	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CCCTCACCCGGCAAGCCTTTG	0.507																																						ENST00000545128.1	0.070000	0	5.000000e-02	1.000000e-02	0.020000	0.034049	0.020000	0.040000																										0				55						c.(865-867)cgG>cgA		proprotein convertase subtilisin/kexin type 5							112.0	117.0	115.0					9																	78686787		2203	4300	6503	SO:0001819	synonymous_variant	5125	0	0					g.chr9:78686787G>A		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.867G>A	chr9.hg19:g.78686787G>A		0					PCSK5_ENST00000376767.3_Silent_p.R289R|PCSK5_ENST00000376752.4_Silent_p.R289R	p.R289R	NM_001190482.1	NP_001177411.1	1	2	3	2.013462	Q92824	PCSK5_HUMAN		7	1405	+			F5H2G7|Q13527|Q96EP4	Silent	SNP	ENST00000545128.1	0	1	hg19	c.867G>A	CCDS55320.1	0																																																																																								0.701046		TCGA-FB-AAPU-01A-31D-A40W-08	0.507	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		15	2	2	1		1	1	166		166	165	1	2	-1.976864	0	0.700000				7	7		651	645	0		0	0		1	0	166	0		0.062121	4.506040e-02	0	0	0	27	0	7	651
ASTN2	23245	broad.mit.edu	37	9	120053699	120053699	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chr9:120053699C>A	ENST00000313400.4	-	2	636	c.536G>T	c.(535-537)aGc>aTc	p.S179I	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.S179I|ASTN2_ENST00000361209.2_Missense_Mutation_p.S179I			O75129	ASTN2_HUMAN	astrotactin 2	179					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CTGCCCGGAGCTGCTCATGGA	0.592																																						ENST00000313400.4	0.500000	2.900000e-01	4.400000e-01	3.300000e-01	0.380000	0.394958	0.380000	0.380000																										0				102						c.(535-537)aGc>aTc		astrotactin 2							65.0	63.0	63.0					9																	120053699		2203	4300	6503	SO:0001583	missense	23245	1	121410	33				g.chr9:120053699C>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.536G>T	chr9.hg19:g.120053699C>A	ENSP00000314038:p.Ser179Ile	0					ASTN2_ENST00000373996.3_Missense_Mutation_p.S179I|ASTN2_ENST00000361209.2_Missense_Mutation_p.S179I|ASTN2_ENST00000361477.3_5'UTR	p.S179I			1	2	3	2.036802	O75129	ASTN2_HUMAN		2	636	-			A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	1	1	hg19	c.536G>T		0	.	.	.	.	.	.	.	.	.	.	C	21.8	4.209137	0.79240	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.11495	2.8;2.8;2.77	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.141111	0.56097	D	0.000032	T	0.15046	0.0363	N	0.19112	0.55	0.38032	D	0.935204	P;P;D	0.61080	0.911;0.855;0.989	P;B;P	0.58820	0.563;0.36;0.846	T	0.08126	-1.0737	9	.	.	.	-29.8448	13.1929	0.59722	0.0:0.9271:0.0:0.0729	.	179;179;179	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	I	179	ENSP00000314038:S179I;ENSP00000363108:S179I;ENSP00000354504:S179I	.	S	-	2	0	0	ASTN2	119093520	119093520	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	3.132000	0.50523	2.782000	0.95742	0.655000	0.94253	AGC	0.702085		TCGA-FB-AAPU-01A-31D-A40W-08	0.592	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	68		68	68	1	2	-20.000000	1	0.700000	NM_014010			53	52		344	335	1		1			0	0	68	0		1.000000	0	0	0	0	0	0	53	344
RNF128	79589	broad.mit.edu	37	X	105970227	105970227	+	Silent	SNP	C	C	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chrX:105970227C>T	ENST00000255499.2	+	1	334	c.84C>T	c.(82-84)gcC>gcT	p.A28A	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	28					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TCCTGCTGGCCCTGAGTCCGC	0.711																																						ENST00000255499.2	1.000000	4.700000e-01	1	6.300000e-01	0.830000	0.819220	0.830000	1.000000																										0				11						c.(82-84)gcC>gcT		ring finger protein 128, E3 ubiquitin protein ligase							12.0	11.0	11.0					X																	105970227		2191	4283	6474	SO:0001819	synonymous_variant	79589	0	0					g.chrX:105970227C>T	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.84C>T	chrX.hg19:g.105970227C>T							RNF128_ENST00000324342.3_Intron	p.A28A	NM_194463.1	NP_919445.1	0	1	1		Q8TEB7	RN128_HUMAN		1	334	+			A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Silent	SNP	ENST00000255499.2	1	1	hg19	c.84C>T	CCDS14521.1	0																																																																																								0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.711	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	1	0	1		2	2	2	0		0	0	13		13	13	1	2	-19.999880	1	0.700000	NM_024539			11	11		27	24	1		1	1		0	0	13	0		0.998614	9.999999e-01	0	127	0	0	0	11	27
ACSL4	2182	broad.mit.edu	37	X	108921610	108921610	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chrX:108921610G>T	ENST00000469796.2	-	7	1209	c.813C>A	c.(811-813)gaC>gaA	p.D271E	ACSL4_ENST00000340800.2_Missense_Mutation_p.D271E|ACSL4_ENST00000348502.6_Missense_Mutation_p.D230E			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	271					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	CAATGGCCATGTCTGAAGGCG	0.378																																					Pancreas(188;358 2127 38547 41466 45492)	ENST00000469796.2	0.510000	3.200000e-01	4.700000e-01	3.600000e-01	0.410000	0.419331	0.410000	0.420000																										0				22						c.(811-813)gaC>gaA		acyl-CoA synthetase long-chain family member 4	Icosapent(DB00159)|Rosiglitazone(DB00412)						131.0	111.0	118.0					X																	108921610		2203	4300	6503	SO:0001583	missense	2182	0	0					g.chrX:108921610G>T	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.813C>A	chrX.hg19:g.108921610G>T	ENSP00000419171:p.Asp271Glu						ACSL4_ENST00000348502.6_Missense_Mutation_p.D230E|ACSL4_ENST00000340800.2_Missense_Mutation_p.D271E	p.D271E			0	1	1		O60488	ACSL4_HUMAN		7	1209	-			D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	1	1	hg19	c.813C>A	CCDS14548.1	0	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875527	0.72180	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.14893	2.47;2.47;2.47	5.57	3.8	0.43715	5.57	3.8	0.43715	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.47637	0.1456	M	0.92412	3.305	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.50734	-0.8793	10	0.87932	D	0	-16.4258	8.8404	0.35137	0.2351:0.0:0.7649:0.0	.	271	O60488	ACSL4_HUMAN	E	230;271;271	ENSP00000262835:D230E;ENSP00000419171:D271E;ENSP00000339787:D271E	ENSP00000339787:D271E	D	-	3	2	2	ACSL4	108808266	108808266	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.011000	0.40922	0.533000	0.28675	0.600000	0.82982	GAC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.378	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	1	0	1		2	2	2	0		0	0	121		121	120	1	2	-20.000000	1	0.700000	NM_004458			61	60		359	354	1		1	1		0	0	121	0		1.000000	9.997582e-01	0	32	0	42	0	61	359
HYPM	25763	broad.mit.edu	37	X	37850202	37850202	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chrX:37850202A>T	ENST00000341016.3	+	1	133	c.110A>T	c.(109-111)cAa>cTa	p.Q37L	TM4SF2_ENST00000465127.1_Intron	NM_012274.1	NP_036406.1	O75409	HYPM_HUMAN		37										central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)	8						CGCGTTGTGCAAGATGAACGA	0.478																																						ENST00000341016.3	1.000000	7.700000e-01	1	8.700000e-01	0.960000	0.946865	0.960000	1.000000																										0				8						c.(109-111)cAa>cTa									87.0	81.0	83.0					X																	37850202		2011	4167	6178	SO:0001583	missense	0	0	0					g.chrX:37850202A>T																												ENST00000341016.3:c.110A>T	chrX.hg19:g.37850202A>T	ENSP00000339511:p.Gln37Leu						TM4SF2_ENST00000465127.1_Intron	p.Q37L	NM_012274.1	NP_036406.1	0	1	1		O75409	HYPM_HUMAN		1	133	+			A1A4D3	Missense_Mutation	SNP	ENST00000341016.3	1	1	hg19	c.110A>T	CCDS43929.1	1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.616948	0.46736	.	.	ENSG00000187516	ENST00000341016	T	0.48836	0.8	3.7	-3.49	0.04724	3.7	-3.49	0.04724	Histone-fold (2);	.	.	.	.	T	0.53238	0.1784	L	0.48642	1.525	0.09310	N	1	D	0.65815	0.995	D	0.63877	0.919	T	0.52305	-0.8593	9	0.59425	D	0.04	.	9.1117	0.36732	0.443:0.0:0.557:0.0	.	37	O75409	HYPM_HUMAN	L	37	ENSP00000339511:Q37L	ENSP00000339511:Q37L	Q	+	2	0	0	CXorf27	37735146	37735146	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.197000	0.17197	-0.845000	0.04179	0.417000	0.27973	CAA	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.478	CXorf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080888.1	1	0	1		2	2	2	0		0	0	53		53	53	1	2	-20.000000	1	0.700000				62	60		120	120	1		1			0	0	53	0		1.000000	0	0	0	0	0	0	62	120
DGKK	139189	broad.mit.edu	37	X	50136189	50136189	+	RNA	SNP	G	G	T			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chrX:50136189G>T	ENST00000376025.2	-	0	1615							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					GAACACTTGAGATGGGTTAAG	0.453																																						ENST00000376025.2	0.400000	1.000000e-01	3.200000e-01	1.500000e-01	0.220000	0.239489	0.220000	0.220000																										0				45								diacylglycerol kinase, kappa							74.0	66.0	69.0					X																	50136189		1990	4141	6131			139189	0	0					g.chrX:50136189G>T	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			chrX.hg19:g.50136189G>T											0	1	1		Q5KSL6	DGKK_HUMAN		0	1615	-	Ovarian(276;0.236)		B2RP91	RNA	SNP	ENST00000376025.2	1	1	hg19			0																																																																																								0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.453	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	0	0	1		2	2	2	0		0	0	23		23	23	1	2	-11.980330	1	0.700000	NM_001013742			7	7		86	83	0		1			0	0	23	0		0.979708	0	0	0	0	0	0	7	86
SHROOM4	57477	broad.mit.edu	37	X	50378166	50378166	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chrX:50378166C>G	ENST00000289292.7	-	4	1190	c.907G>C	c.(907-909)Gtc>Ctc	p.V303L	SHROOM4_ENST00000376020.2_Missense_Mutation_p.V303L|SHROOM4_ENST00000460112.3_Missense_Mutation_p.V187L			Q9ULL8	SHRM4_HUMAN	shroom family member 4	303					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGCAAGGGGACCACAGGCTCA	0.587																																						ENST00000289292.7	1.000000	6.300000e-01	1	7.700000e-01	0.920000	0.898603	0.920000	1.000000																										0				52						c.(907-909)Gtc>Ctc		shroom family member 4							32.0	21.0	25.0					X																	50378166		2203	4300	6503	SO:0001583	missense	57477	0	0					g.chrX:50378166C>G	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.907G>C	chrX.hg19:g.50378166C>G	ENSP00000289292:p.Val303Leu						SHROOM4_ENST00000460112.3_Missense_Mutation_p.V187L|SHROOM4_ENST00000376020.2_Missense_Mutation_p.V303L	p.V303L			0	1	1		Q9ULL8	SHRM4_HUMAN		4	1190	-	Ovarian(276;0.236)		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	1	1	hg19	c.907G>C	CCDS35277.1	1	.	.	.	.	.	.	.	.	.	.	C	1.010	-0.688151	0.03328	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.13538	2.99;2.99;2.58	5.95	5.1	0.69264	5.95	5.1	0.69264	.	1.004360	0.08012	N	0.990475	T	0.08492	0.0211	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.32745	-0.9895	10	0.10636	T	0.68	.	13.1671	0.59577	0.0:0.9205:0.0:0.0795	.	303	Q9ULL8	SHRM4_HUMAN	L	303;303;187	ENSP00000289292:V303L;ENSP00000365188:V303L;ENSP00000421450:V187L	ENSP00000289292:V303L	V	-	1	0	0	SHROOM4	50394906	50394906	0.001000	0.12720	0.006000	0.13384	0.013000	0.08279	1.313000	0.33585	1.279000	0.44446	0.600000	0.82982	GTC	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.587	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	1	0	1		2	2	2	0		0	0	21		21	21	1	2	-20.000000	1	0.700000	NM_020717			23	23		48	48	1		1	0		0	0	21	0		1.000000	1.110700e-01	0	0	0	2	0	23	48
KIAA1210	57481	broad.mit.edu	37	X	118221500	118221500	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPU-01A-31D-A40W-08	TCGA-FB-AAPU-11A-12D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c40787c-0278-4af4-9040-ab073ef2287b	6d31d43e-5e3f-4c55-a7b2-1188f82ab4f8	g.chrX:118221500C>A	ENST00000402510.2	-	11	3692	c.3693G>T	c.(3691-3693)aaG>aaT	p.K1231N		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1231										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TGACTTCAGGCTTTGATAAAG	0.448																																						ENST00000402510.2	0.760000	3.600000e-01	6.600000e-01	4.500000e-01	0.540000	0.560059	0.540000	0.540000																										0				64						c.(3691-3693)aaG>aaT		KIAA1210							39.0	36.0	37.0					X																	118221500		1879	4107	5986	SO:0001583	missense	57481	0	0					g.chrX:118221500C>A	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3693G>T	chrX.hg19:g.118221500C>A	ENSP00000384670:p.Lys1231Asn							p.K1231N	NM_020721.1	NP_065772.1	0	1	1		Q9ULL0	K1210_HUMAN		11	3692	-			B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	1	1	hg19	c.3693G>T	CCDS48156.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.176|8.176	0.792717|0.792717	0.16327|0.16327	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.14516	.|2.5	4.38|4.38	-2.02|-2.02	0.07388|0.07388	4.38|4.38	-2.02|-2.02	0.07388|0.07388	.|.	.|.	.|.	.|.	.|.	T|T	0.07052|0.07052	0.0179|0.0179	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|P	.|0.37573	.|0.6	.|B	.|0.36289	.|0.221	T|T	0.22977|0.22977	-1.0201|-1.0201	5|9	.|0.40728	.|T	.|0.16	.|.	0.6478|0.6478	0.00821|0.00821	0.292:0.2336:0.2834:0.191|0.292:0.2336:0.2834:0.191	.|.	.|1231	.|Q9ULL0	.|K1210_HUMAN	S|N	638|1231	.|ENSP00000384670:K1231N	.|ENSP00000384670:K1231N	A|K	-|-	1|3	0|2	0|2	KIAA1210|RP13-347D8.6	118105528|118105528	118105528|118105528	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.729000|-0.729000	0.04920|0.04920	-0.638000|-0.638000	0.05509|0.05509	-0.192000|-0.192000	0.12808|0.12808	GCC|AAG	0.700000		TCGA-FB-AAPU-01A-31D-A40W-08	0.448	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	1	0	1		2	2	2	0		0	0	36		36	36	1	2	-20.000000	1	0.700000	NM_020721			23	23		97	97	1		1			0	0	36	0		1.000000	0	0	0	0	0	0	23	97
