#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
HTRA1	5654	broad.mit.edu	37	10	124266340	124266340	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr10:124266340G>A	ENST00000368984.3	+	4	1039	c.911G>A	c.(910-912)gGc>gAc	p.G304D		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	304	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CAGCGAGGCGGCAAAGAGCTG	0.617																																						ENST00000368984.3	1.000000	3.000000e-02	1	5.000000e-02	1.000000e-01	0.309835	1.000000e-01	0.090000																										0				17						c.(910-912)gGc>gAc		HtrA serine peptidase 1							81.0	65.0	70.0					10																	124266340		2203	4300	6503	SO:0001583	missense	5654	0	0					g.chr10:124266340G>A	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.911G>A	chr10.hg19:g.124266340G>A	ENSP00000357980:p.Gly304Asp	1						p.G304D	NM_002775.4	NP_002766.1	1	3	4	2.062720	Q92743	HTRA1_HUMAN		4	1039	+		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	0	1	hg19	c.911G>A	CCDS7630.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.241471	0.95272	.	.	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	D;D	0.88201	-2.35;-2.34	5.24	5.24	0.73138	5.24	5.24	0.73138	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.000000	0.85682	D	0.000000	D	0.91556	0.7333	L	0.31065	0.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92821	0.6272	10	0.87932	D	0	-14.1768	18.8615	0.92273	0.0:0.0:1.0:0.0	.	304	Q92743	HTRA1_HUMAN	D	304;271;45	ENSP00000357980:G304D;ENSP00000412676:G45D	ENSP00000357980:G304D	G	+	2	0	0	HTRA1	124256330	124256330	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	9.613000	0.98350	2.456000	0.83038	0.655000	0.94253	GGC	0.770511		TCGA-FB-AAPZ-01A-11D-A40W-08	0.617	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	0	0	1		2	2	2	0		0	0	65		65	65	1	3.130000	-2.823622	1	0.680000	NM_002775			6	6		289	286	0		1	0		0	0	65	0		9.642824e-01	8.951188e-01	0	0	0	197	0	6	289
MKI67	4288	broad.mit.edu	37	10	129906577	129906577	+	Missense_Mutation	SNP	G	G	A	rs117795868		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr10:129906577G>A	ENST00000368654.3	-	13	3902	c.3527C>T	c.(3526-3528)aCg>aTg	p.T1176M	MKI67_ENST00000368653.3_Missense_Mutation_p.T816M	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1176	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGGTTTGGGCGTAAGCATGGC	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		21842	0.001		0.0	False		,,,				2504	0.0					ENST00000368654.3	1.000000	0	1	1.000000e-02	3.000000e-02	0.261777	3.000000e-02	0.030000																										0				159						c.(3526-3528)aCg>aTg		marker of proliferation Ki-67							292.0	278.0	283.0					10																	129906577		2203	4300	6503	SO:0001583	missense	4288	29	121412	52				g.chr10:129906577G>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3527C>T	chr10.hg19:g.129906577G>A	ENSP00000357643:p.Thr1176Met	1					MKI67_ENST00000368653.3_Missense_Mutation_p.T816M	p.T1176M	NM_002417.4	NP_002408.3	1	3	4	2.079943	P46013	KI67_HUMAN		13	3902	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	0	1	hg19	c.3527C>T	CCDS7659.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.05	1.822665	0.32237	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03301	3.98;3.98	2.74	1.83	0.25207	2.74	1.83	0.25207	.	1.848640	0.03443	N	0.209516	T	0.15998	0.0385	M	0.72118	2.19	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.96;0.991;0.989	T	0.06058	-1.0848	10	0.52906	T	0.07	.	5.4955	0.16799	0.1565:0.0:0.8435:0.0	.	1175;816;1176	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	M	1176;816;1175	ENSP00000357643:T1176M;ENSP00000357642:T816M	ENSP00000357642:T816M	T	-	2	0	0	MKI67	129796567	129796567	0.005000	0.15991	0.002000	0.10522	0.005000	0.04900	0.110000	0.15437	0.740000	0.32651	0.462000	0.41574	ACG	0.769386		TCGA-FB-AAPZ-01A-11D-A40W-08	0.463	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	0	0	1		18	2	2	1		1	1	233		233	229	1	3.130000	-2.031104	0	0.680000	NM_002417			7	7		1189	1173	0		0	0		1	0	233	0		1.935142e-02	5.012524e-05	0	0	0	2	0	7	1189
GLYAT	10249	broad.mit.edu	37	11	58477299	58477299	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr11:58477299G>T	ENST00000344743.3	-	6	972	c.831C>A	c.(829-831)taC>taA	p.Y277*	GLYAT_ENST00000529732.1_Nonsense_Mutation_p.Y277*	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	277					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	GTTGCAGTGTGTAACTCATTT	0.463																																						ENST00000344743.3	0.130000	1.000000e-02	1.000000e-01	3.000000e-02	6.000000e-02	0.069868	6.000000e-02	0.060000																										0				16						c.(829-831)taC>taA		glycine-N-acyltransferase	Glycine(DB00145)						125.0	118.0	120.0					11																	58477299		2201	4295	6496	SO:0001587	stop_gained	10249	0	0					g.chr11:58477299G>T	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.831C>A	chr11.hg19:g.58477299G>T	ENSP00000340200:p.Tyr277*	1					GLYAT_ENST00000529732.1_Nonsense_Mutation_p.Y277*	p.Y277*	NM_201648.2	NP_964011.2	0	2	2	1.488230	Q6IB77	GLYAT_HUMAN		6	972	-		Breast(21;0.0044)|all_epithelial(135;0.0157)	O14833|Q96QK7	Nonsense_Mutation	SNP	ENST00000344743.3	0	1	hg19	c.831C>A	CCDS7970.1	0	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064053	0.36373	.	.	ENSG00000149124	ENST00000344743;ENST00000529732	.	.	.	6.06	-0.557	0.11800	6.06	-0.557	0.11800	.	2.072040	0.02028	N	0.048337	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.6363	1.6509	0.02771	0.2466:0.3236:0.3044:0.1255	.	.	.	.	X	277	.	ENSP00000340200:Y277X	Y	-	3	2	2	GLYAT	58233875	58233875	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.083000	0.11286	-0.048000	0.13401	-0.912000	0.02778	TAC	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.463	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1	0	0	1		15	2	2	1		1	1	60		60	59	1	3.130000	-3.336917	1	0.680000				5	5		245	242	0		0			1	0	60	0		1.710635e-02	0	0	0	0	0	0	5	245
ANO1	55107	broad.mit.edu	37	11	69978186	69978186	+	Splice_Site	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr11:69978186G>A	ENST00000355303.5	+	11	1563		c.e11+1		ANO1_ENST00000538023.1_Splice_Site|RP11-805J14.3_ENST00000530525.1_RNA|ANO1_ENST00000530676.1_Splice_Site|ANO1_ENST00000398543.2_Splice_Site|ANO1_ENST00000316296.5_Splice_Site|ANO1_ENST00000531349.1_Splice_Site	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	GCCCTCTGGGGTAAGCAGGGC	0.597																																						ENST00000355303.5	1.000000	7.700000e-01	1	9.800000e-01	9.900000e-01	0.980110	9.900000e-01	1.000000																										0				29						c.e11+1		anoctamin 1, calcium activated chloride channel	Crofelemer(DB04941)						20.0	24.0	23.0					11																	69978186		2043	4190	6233	SO:0001630	splice_region_variant	55107	0	0					g.chr11:69978186G>A	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1258+1G>A	chr11.hg19:g.69978186G>A		1					ANO1_ENST00000316296.5_Splice_Site|ANO1_ENST00000398543.2_Splice_Site|ANO1_ENST00000530676.1_Splice_Site|RP11-805J14.3_ENST00000530525.1_RNA|ANO1_ENST00000531349.1_Splice_Site|ANO1_ENST00000538023.1_Splice_Site		NM_018043.5	NP_060513.5	2	3	5	2.180428	Q5XXA6	ANO1_HUMAN		11	1563	+			A8KAM3|Q8IYY8|Q8N7V3	Splice_Site	SNP	ENST00000355303.5	1	1	hg19		CCDS44663.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981281	0.74474	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349	.	.	.	4.77	3.85	0.44370	4.77	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3645	0.66795	0.0:0.0:0.8509:0.1491	.	.	.	.	.	-1	.	.	.	+	.	.	.	ANO1	69655834	69655834	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.683000	0.84093	0.995000	0.38917	0.555000	0.69702	.	0.789501		TCGA-FB-AAPZ-01A-11D-A40W-08	0.597	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	1	0	1		2	2	2	0		0	0	15		15	15	1	3.130000	-20.000000	1	0.680000	NM_018043	Intron		19	18		55	52	1		1			0	0	15	0		9.999944e-01	0	0	0	0	0	0	19	55
CLEC1B	51266	broad.mit.edu	37	12	10147796	10147796	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr12:10147796C>A	ENST00000298527.6	-	5	667	c.488G>T	c.(487-489)cGc>cTc	p.R163L	CLEC1B_ENST00000428126.2_Missense_Mutation_p.R130L|CLEC1B_ENST00000348658.4_Missense_Mutation_p.R130L	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	163	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						CGACTTCTGGCGAGATAATCC	0.433																																						ENST00000298527.6	1.000000	1.500000e-01	2.500000e-01	1.700000e-01	2.000000e-01	0.280063	2.000000e-01	0.220000																										0				19						c.(487-489)cGc>cTc		C-type lectin domain family 1, member B							275.0	267.0	270.0					12																	10147796		1871	4091	5962	SO:0001583	missense	51266	0	0					g.chr12:10147796C>A	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.488G>T	chr12.hg19:g.10147796C>A	ENSP00000298527:p.Arg163Leu	1					CLEC1B_ENST00000348658.4_Missense_Mutation_p.R130L|CLEC1B_ENST00000428126.2_Missense_Mutation_p.R130L	p.R163L	NM_016509.3	NP_057593.3	2	2	4	2.317841	Q9P126	CLC1B_HUMAN		5	667	-			Q6UWX7|Q8NHR6	Missense_Mutation	SNP	ENST00000298527.6	1	1	hg19	c.488G>T	CCDS41752.1	0	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236215	0.58886	.	.	ENSG00000165682	ENST00000398937;ENST00000428126;ENST00000298527;ENST00000348658;ENST00000398939	T;T;T;T	0.19532	2.14;2.14;2.14;2.14	3.83	3.83	0.44106	3.83	3.83	0.44106	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.49305	D	0.000156	T	0.42539	0.1207	M	0.80332	2.49	0.44268	D	0.997128	D;D	0.89917	0.999;1.0	D;D	0.85130	0.99;0.997	T	0.39583	-0.9607	10	0.13853	T	0.58	.	11.1397	0.48396	0.0:1.0:0.0:0.0	.	130;163	Q9P126-2;Q9P126	.;CLC1B_HUMAN	L	70;130;163;130;70	ENSP00000381910:R70L;ENSP00000406338:R130L;ENSP00000298527:R163L;ENSP00000327169:R130L	ENSP00000298527:R163L	R	-	2	0	0	CLEC1B	10039063	10039063	0.991000	0.36638	0.902000	0.35471	0.685000	0.39939	2.087000	0.41653	1.954000	0.56735	0.298000	0.19748	CGC	0.800648		TCGA-FB-AAPZ-01A-11D-A40W-08	0.433	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	1	0	1		20	2	2	0		0	1	355		355	347	1	3.130000	-6.101907	1	0.680000	NM_016509			92	92		1996	1968	0		1			0	0	355	0		1	0	0	0	0	0	0	92	1996
NTF3	4908	broad.mit.edu	37	12	5603793	5603793	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr12:5603793G>A	ENST00000331010.6	+	1	496	c.413G>A	c.(412-414)cGg>cAg	p.R138Q	NTF3_ENST00000423158.3_Missense_Mutation_p.R151Q|NTF3_ENST00000535299.1_Intron	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	138					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)	p.R138Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						CGGCGGAAACGGTACGCGGAG	0.602																																					GBM(194;1104 2182 8339 9578 18493)	ENST00000331010.6	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										1	Substitution - Missense(1)	p.R138Q(1)	lung(1)	22						c.(412-414)cGg>cAg		neurotrophin 3							90.0	85.0	87.0					12																	5603793		2203	4300	6503	SO:0001583	missense	4908	0	0					g.chr12:5603793G>A		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.413G>A	chr12.hg19:g.5603793G>A	ENSP00000328738:p.Arg138Gln	1					NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.R151Q	p.R138Q	NM_002527.4	NP_002518.1	2	2	4	2.317841	P20783	NTF3_HUMAN		1	496	+			B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	1	1	hg19	c.413G>A	CCDS8538.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265075	0.80358	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.70516	-0.49;-0.49	5.52	3.71	0.42584	5.52	3.71	0.42584	.	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	M	0.89601	3.045	0.47214	D	0.999355	P;D	0.54601	0.892;0.967	B;B	0.35859	0.212;0.212	T	0.76143	-0.3067	10	0.87932	D	0	-11.5385	11.2247	0.48877	0.1475:0.0:0.8525:0.0	.	138;151	P20783;B7Z1T5	NTF3_HUMAN;.	Q	151;138	ENSP00000397297:R151Q;ENSP00000328738:R138Q	ENSP00000328738:R138Q	R	+	2	0	0	NTF3	5474054	5474054	1.000000	0.71417	0.997000	0.53966	0.953000	0.61014	9.869000	0.99810	0.724000	0.32296	0.591000	0.81541	CGG	0.800648		TCGA-FB-AAPZ-01A-11D-A40W-08	0.602	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1	1	0	1		25	2	2	1		1	1	64		64	61	1	3.130000	-20.000000	1	0.680000				225	221		286	285	1		1	0		1	0	64	0		1	0	0	0	0	1	0	225	286
VWF	7450	broad.mit.edu	37	12	6105363	6105363	+	Silent	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr12:6105363C>T	ENST00000261405.5	-	35	6122	c.5868G>A	c.(5866-5868)cgG>cgA	p.R1956R		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1956	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TCACGATGTGCCGAGTGGAGC	0.522																																						ENST00000261405.5	1.000000	3.000000e-02	2.400000e-01	7.000000e-02	1.300000e-01	0.216619	1.300000e-01	0.110000																										0				129						c.(5866-5868)cgG>cgA		von Willebrand factor	Antihemophilic Factor(DB00025)						44.0	40.0	41.0					12																	6105363		2203	4300	6503	SO:0001819	synonymous_variant	7450	0	0					g.chr12:6105363C>T		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5868G>A	chr12.hg19:g.6105363C>T		1						p.R1956R	NM_000552.3	NP_000543	2	2	4	2.317841	P04275	VWF_HUMAN		35	6122	-			Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	0	1	hg19	c.5868G>A	CCDS8539.1	0																																																																																								0.800648		TCGA-FB-AAPZ-01A-11D-A40W-08	0.522	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	0	0	1		2	2	2	0		0	0	41		41	41	1	3.130000	-5.942028	1	0.680000	NM_000552			4	4		162	159	0		1	0		0	0	41	0		8.870172e-01	6.840568e-01	0	0	0	90	0	4	162
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	2	2	4	2.372814	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.805589		TCGA-FB-AAPZ-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	76		76	73	1	3.130000	-20.000000	1	0.680000	NM_033360			79	80		154	151	1		1	1	1	0	0	76	283		1	9.803785e-01	1	3	112	12	196	79	154
SKA3	221150	broad.mit.edu	37	13	21742393	21742393	+	Silent	SNP	T	T	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr13:21742393T>A	ENST00000314759.5	-	4	601	c.477A>T	c.(475-477)tcA>tcT	p.S159S	SKA3_ENST00000400018.3_Silent_p.S159S	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	159					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GTCCAAAATCTGAAAGTTGTG	0.438																																						ENST00000314759.5	1.000000	0	1	1.000000e-02	4.000000e-02	0.247000	4.000000e-02	0.030000																										0				19						c.(475-477)tcA>tcT		spindle and kinetochore associated complex subunit 3							126.0	130.0	128.0					13																	21742393		2203	4300	6503	SO:0001819	synonymous_variant	221150	0	0					g.chr13:21742393T>A	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.477A>T	chr13.hg19:g.21742393T>A		1					SKA3_ENST00000400018.3_Silent_p.S159S	p.S159S	NM_145061.5	NP_659498.4	2	4	6	2.072044	Q8IX90	SKA3_HUMAN		4	601	-			A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Silent	SNP	ENST00000314759.5	0	1	hg19	c.477A>T	CCDS31946.1	0																																																																																								0.779128		TCGA-FB-AAPZ-01A-11D-A40W-08	0.438	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	0	0	0		2	2	2	0		0	0	100		100	99	1	3.130000	-4.628092	1	0.680000	NM_145061			5	1		576	569	0		0	0		0	0	100	0		9.345952e-01	2.475119e-03	0	0	0	7	0	5	576
OR4Q3	441669	broad.mit.edu	37	14	20215715	20215715	+	Silent	SNP	C	C	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr14:20215715C>A	ENST00000331723.1	+	1	129	c.129C>A	c.(127-129)ctC>ctA	p.L43L		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGGGAAACCTCTTGATAGTGG	0.408																																						ENST00000331723.1			0	0																														0				47						c.(127-129)ctC>ctA		olfactory receptor, family 4, subfamily Q, member 3							200.0	204.0	203.0					14																	20215715		2203	4300	6503	SO:0001819	synonymous_variant	441669	0	0					g.chr14:20215715C>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.129C>A	chr14.hg19:g.20215715C>A								p.L43L	NM_172194.1	NP_751944.1					Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	1	129	+	all_cancers(95;0.00108)		Q6IEX4	Silent	SNP	ENST00000331723.1	1	1	hg19	c.129C>A	CCDS32020.1																																																																																											TCGA-FB-AAPZ-01A-11D-A40W-08	0.408	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2	1	0	1		18	2	2	1		1	1	169		169	167	1	3.130000	-20.000000	1	0.680000				438	426		436	427	0		1			1	0	169	0		1	0	0	0	0	0	0	438	436
SYNE2	23224	broad.mit.edu	37	14	64681074	64681074	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr14:64681074G>A	ENST00000344113.4	+	106	19431	c.19219G>A	c.(19219-19221)Gag>Aag	p.E6407K	SYNE2_ENST00000441438.2_5'Flank|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.E2792K|SYNE2_ENST00000394768.2_Missense_Mutation_p.E2792K|SYNE2_ENST00000554584.1_Missense_Mutation_p.E6349K|SYNE2_ENST00000458046.2_Missense_Mutation_p.E41K|SYNE2_ENST00000555002.1_Missense_Mutation_p.E3041K|SYNE2_ENST00000358025.3_Missense_Mutation_p.E6407K|SYNE2_ENST00000554805.1_Missense_Mutation_p.E190K|SYNE2_ENST00000555022.1_Missense_Mutation_p.E285K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6407					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GTCTGGCTGCGAGACCCCTGT	0.632																																						ENST00000344113.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				224						c.(19219-19221)Gag>Aag		spectrin repeat containing, nuclear envelope 2							90.0	87.0	88.0					14																	64681074		2203	4300	6503	SO:0001583	missense	23224	0	0					g.chr14:64681074G>A	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.19219G>A	chr14.hg19:g.64681074G>A	ENSP00000341781:p.Glu6407Lys	1					SYNE2_ENST00000357395.3_Missense_Mutation_p.E2792K|SYNE2_ENST00000358025.3_Missense_Mutation_p.E6407K|SYNE2_ENST00000555002.1_Missense_Mutation_p.E3041K|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555022.1_Missense_Mutation_p.E285K|SYNE2_ENST00000554584.1_Missense_Mutation_p.E6349K|SYNE2_ENST00000441438.2_5'Flank|SYNE2_ENST00000394768.2_Missense_Mutation_p.E2792K|SYNE2_ENST00000458046.2_Missense_Mutation_p.E41K|SYNE2_ENST00000554805.1_Missense_Mutation_p.E190K	p.E6407K	NM_015180.4	NP_055995.4	2	6	8	2.304479	Q8WXH0	SYNE2_HUMAN		106	19431	+			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	1	1	hg19	c.19219G>A	CCDS41963.1	1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923682	0.73213	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000555022;ENST00000554805;ENST00000458046	T;T;T;T;T;T;T;T;T	0.65549	0.24;3.64;0.23;-0.16;3.64;3.64;3.47;2.98;2.5	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.000000	0.50627	D	0.000114	T	0.78220	0.4249	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.991;0.999;0.973;0.989;0.975;0.997	T	0.79374	-0.1830	10	0.72032	D	0.01	.	19.0978	0.93260	0.0:0.0:1.0:0.0	.	41;2792;41;795;6349;6407;6407	B4DND7;Q8WXH0-7;Q8WXH0-5;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;.;.;SYNE2_HUMAN;.	K	6407;2792;6407;6349;6355;3041;2792;285;190;41	ENSP00000350719:E6407K;ENSP00000349969:E2792K;ENSP00000341781:E6407K;ENSP00000452570:E6349K;ENSP00000450831:E3041K;ENSP00000378249:E2792K;ENSP00000451009:E285K;ENSP00000450605:E190K;ENSP00000391937:E41K	ENSP00000261678:E6355K	E	+	1	0	0	SYNE2	63750827	63750827	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	9.411000	0.97342	2.735000	0.93741	0.655000	0.94253	GAG	0.798944		TCGA-FB-AAPZ-01A-11D-A40W-08	0.632	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	1	0	1		2	2	2	0		0	0	81		81	79	1	3.130000	-20.000000	1	0.680000	NM_182914			216	215		230	225	1		1	1		0	0	81	0		1	1	0	31	0	57	0	216	230
NRXN3	9369	broad.mit.edu	37	14	79175640	79175640	+	Silent	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr14:79175640C>T	ENST00000554719.1	+	4	674	c.183C>T	c.(181-183)ggC>ggT	p.G61G	NRXN3_ENST00000335750.5_Silent_p.G61G|RP11-232C2.2_ENST00000555680.1_RNA	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.G61G(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AAATCTATGGCGAAGTTGTGT	0.468																																						ENST00000554719.1	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										2	Substitution - coding silent(2)	p.G61G(2)	large_intestine(1)|lung(1)	104						c.(181-183)ggC>ggT		neurexin 3							102.0	99.0	100.0					14																	79175640		2203	4300	6503	SO:0001819	synonymous_variant	9369	2	121410	33				g.chr14:79175640C>T	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.183C>T	chr14.hg19:g.79175640C>T		1					NRXN3_ENST00000335750.5_Silent_p.G61G|RP11-232C2.2_ENST00000555680.1_RNA	p.G61G	NM_004796.4	NP_004787.2	2	6	8	2.304479	Q9HDB5	NRX3B_HUMAN		4	674	+		Renal(4;0.00876)	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000554719.1	1	1	hg19	c.183C>T	CCDS9870.1	1																																																																																								0.798944		TCGA-FB-AAPZ-01A-11D-A40W-08	0.468	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	1	0	1		2	2	2	0		0	0	71		71	69	1	3.130000	-20.000000	1	0.680000	NM_001105250			209	206		201	199	1		1			0	0	71	0		1	0	0	0	0	0	0	209	201
BEGAIN	57596	broad.mit.edu	37	14	101004539	101004539	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr14:101004539C>T	ENST00000355173.2	-	7	1620	c.1549G>A	c.(1549-1551)Gag>Aag	p.E517K	CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000556751.1_Missense_Mutation_p.E453K|BEGAIN_ENST00000443071.2_Missense_Mutation_p.E517K	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	517						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				TCCCCCCCCTCGCTGGGTGCA	0.731																																					NSCLC(159;1889 2010 9965 27479 40101)	ENST00000355173.2	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	0.999999	9.900000e-01	1.000000																										0				14						c.(1549-1551)Gag>Aag		brain-enriched guanylate kinase-associated							5.0	6.0	5.0					14																	101004539		2064	4066	6130	SO:0001583	missense	57596	0	0					g.chr14:101004539C>T	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.1549G>A	chr14.hg19:g.101004539C>T	ENSP00000347301:p.Glu517Lys	1					BEGAIN_ENST00000443071.2_Missense_Mutation_p.E517K|BEGAIN_ENST00000556751.1_Missense_Mutation_p.E453K|CTD-2062F14.3_ENST00000553301.1_lincRNA	p.E517K	NM_020836.3	NP_065887.1	2	6	8	2.304479	Q9BUH8	BEGIN_HUMAN		7	1620	-		Melanoma(154;0.212)	Q9NPU3|Q9P282	Missense_Mutation	SNP	ENST00000355173.2	0	1	hg19	c.1549G>A	CCDS9962.1	1	.	.	.	.	.	.	.	.	.	.	c	12.23	1.875165	0.33162	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071	.	.	.	4.72	3.83	0.44106	4.72	3.83	0.44106	.	0.564050	0.18819	N	0.130300	T	0.56031	0.1958	L	0.54323	1.7	0.42735	D	0.993725	B	0.28971	0.229	B	0.24269	0.052	T	0.52238	-0.8602	9	0.28530	T	0.3	.	14.6592	0.68858	0.0:0.8449:0.1551:0.0	.	517	Q9BUH8	BEGIN_HUMAN	K	517;453;517	.	ENSP00000347301:E517K	E	-	1	0	0	BEGAIN	100074292	100074292	1.000000	0.71417	0.893000	0.35052	0.164000	0.22412	3.288000	0.51739	0.948000	0.37687	0.450000	0.29827	GAG	0.798944		TCGA-FB-AAPZ-01A-11D-A40W-08	0.731	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	1	0	1		2	2	2	0		0	0	14		14	12	1	3.130000	-20.000000	1	0.680000	NM_020836			21	18		21	17	0		1	1		0	0	14	0		9.999989e-01	8.753438e-01	0	5	0	1	0	21	21
ATP10A	57194	broad.mit.edu	37	15	25924552	25924552	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr15:25924552C>T	ENST00000356865.6	-	21	4547	c.4436G>A	c.(4435-4437)cGa>cAa	p.R1479Q		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1479					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		AAGTCCTGATCGGCCTGAGTG	0.512																																						ENST00000356865.6	0.290000	1.100000e-01	2.400000e-01	1.500000e-01	1.900000e-01	0.200423	1.900000e-01	0.190000																										0				103						c.(4435-4437)cGa>cAa		ATPase, class V, type 10A							55.0	60.0	58.0					15																	25924552		2203	4300	6503	SO:0001583	missense	57194	0	0					g.chr15:25924552C>T	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4436G>A	chr15.hg19:g.25924552C>T	ENSP00000349325:p.Arg1479Gln	1						p.R1479Q	NM_024490.3	NP_077816.1	0	2	2	1.519396	O60312	AT10A_HUMAN		21	4547	-		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	1	1	hg19	c.4436G>A	CCDS32178.1	0	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318296	0.23994	.	.	ENSG00000206190	ENST00000356865	T	0.10382	2.88	5.12	3.19	0.36642	5.12	3.19	0.36642	.	6.590700	0.00166	N	0.000007	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	P	0.44006	0.824	B	0.28011	0.085	T	0.32955	-0.9887	10	0.25751	T	0.34	11.1915	6.8241	0.23872	0.0:0.7845:0.0:0.2155	.	1479	O60312	AT10A_HUMAN	Q	1479	ENSP00000349325:R1479Q	ENSP00000349325:R1479Q	R	-	2	0	0	ATP10A	23475645	23475645	0.021000	0.18746	0.001000	0.08648	0.005000	0.04900	0.520000	0.22878	0.688000	0.31529	0.655000	0.94253	CGA	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.512	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	1	0	1		2	2	2	0		0	0	71		71	68	1	3.130000	-3.017663	1	0.680000	NM_024490			19	19		272	268	0		1	0		0	0	71	0		9.999909e-01	3.239395e-01	0	0	0	17	0	19	272
FEM1B	10116	broad.mit.edu	37	15	68570843	68570843	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr15:68570843A>G	ENST00000306917.4	+	1	703	c.88A>G	c.(88-90)Agc>Ggc	p.S30G	RP11-315D16.4_ENST00000563057.1_lincRNA	NM_015322.4	NP_056137.1	Q9UK73	FEM1B_HUMAN	fem-1 homolog b (C. elegans)	30					apoptotic process (GO:0006915)|branching involved in prostate gland morphogenesis (GO:0060442)|epithelial cell maturation involved in prostate gland development (GO:0060743)|regulation of DNA damage checkpoint (GO:2000001)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death receptor binding (GO:0005123)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						CCGGTCTGAAAGCGACATCCG	0.632																																						ENST00000306917.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				9						c.(88-90)Agc>Ggc		fem-1 homolog b (C. elegans)							67.0	62.0	64.0					15																	68570843		2200	4298	6498	SO:0001583	missense	10116	0	0					g.chr15:68570843A>G		CCDS10228.1	15q22	2013-02-19	2001-11-28		ENSG00000169018	ENSG00000169018		"""Ankyrin repeat domain containing"""	3649	protein-coding gene	gene with protein product		613539	"""FEM-1 (C. elegans) homolog b"""			10623617	Standard	NM_015322		Approved		uc002arg.3	Q9UK73	OTTHUMG00000133285	ENST00000306917.4:c.88A>G	chr15.hg19:g.68570843A>G	ENSP00000307298:p.Ser30Gly	1					RP11-315D16.4_ENST00000563057.1_lincRNA	p.S30G	NM_015322.4	NP_056137.1	0	2	2	1.519396	Q9UK73	FEM1B_HUMAN		1	703	+			O43146	Missense_Mutation	SNP	ENST00000306917.4	1	1	hg19	c.88A>G	CCDS10228.1	1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.041286	0.35989	.	.	ENSG00000169018	ENST00000306917	T	0.53640	0.61	4.29	4.29	0.51040	4.29	4.29	0.51040	Ankyrin repeat-containing domain (1);	0.316936	0.33854	N	0.004490	T	0.24736	0.0600	N	0.08118	0	0.27961	N	0.936787	B	0.15473	0.013	B	0.14023	0.01	T	0.11203	-1.0597	10	0.23302	T	0.38	-27.3124	8.8849	0.35398	0.8112:0.1887:0.0:0.0	.	30	Q9UK73	FEM1B_HUMAN	G	30	ENSP00000307298:S30G	ENSP00000307298:S30G	S	+	1	0	0	FEM1B	66357897	66357897	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	3.542000	0.53625	1.812000	0.52913	0.454000	0.30748	AGC	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.632	FEM1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257065.1	1	0	1		2	2	2	0		0	0	52		52	50	1	3.130000	-20.000000	1	0.680000				127	125		62	61	0		1	0		0	0	52	0		1	9.995515e-01	0	1	0	9	0	127	62
ACSM3	6296	broad.mit.edu	37	16	20781387	20781387	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr16:20781387C>T	ENST00000289416.5	+	2	506	c.31C>T	c.(31-33)Cgt>Tgt	p.R11C	ACSM3_ENST00000440284.2_Missense_Mutation_p.R11C|ACSM3_ENST00000450120.2_5'Flank	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	11					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						GAAGATGCTACGTCATGCCAA	0.438																																						ENST00000289416.5	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				21						c.(31-33)Cgt>Tgt		acyl-CoA synthetase medium-chain family member 3							152.0	126.0	135.0					16																	20781387		2201	4300	6501	SO:0001583	missense	6296	0	0					g.chr16:20781387C>T	D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.31C>T	chr16.hg19:g.20781387C>T	ENSP00000289416:p.Arg11Cys	1					ACSM3_ENST00000450120.2_5'Flank|ACSM3_ENST00000440284.2_Missense_Mutation_p.R11C	p.R11C	NM_005622.3	NP_005613.2	0	2	2	1.473083	Q53FZ2	ACSM3_HUMAN		2	506	+			O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	ENST00000289416.5	1	1	hg19	c.31C>T	CCDS10589.1	1	.	.	.	.	.	.	.	.	.	.	C	5.071	0.198692	0.09652	.	.	ENSG00000005187	ENST00000289416;ENST00000440284	T;T	0.44083	0.93;1.68	5.91	0.758	0.18432	5.91	0.758	0.18432	.	0.674484	0.14670	N	0.305411	T	0.23014	0.0556	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16335	-1.0406	10	0.37606	T	0.19	-2.0692	8.0878	0.30782	0.0:0.5219:0.0:0.4781	.	11;11	Q53FZ2;Q53FZ2-2	ACSM3_HUMAN;.	C	11	ENSP00000289416:R11C;ENSP00000394565:R11C	ENSP00000289416:R11C	R	+	1	0	0	ACSM3	20688888	20688888	0.003000	0.15002	0.002000	0.10522	0.003000	0.03518	0.634000	0.24614	0.132000	0.18615	-0.137000	0.14449	CGT	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.438	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254414.2	1	0	1		2	2	2	0		0	0	81		81	79	1	3.130000	-20.000000	1	0.680000	NM_005622			174	169		112	106	1		1	0		0	0	81	0		1	9.168836e-01	0	1	0	4	0	174	112
CDIPT	10423	broad.mit.edu	37	16	29872467	29872467	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr16:29872467T>C	ENST00000219789.6	-	3	1170	c.292A>G	c.(292-294)Atg>Gtg	p.M98V	CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000566113.1_Missense_Mutation_p.M53V|CDIPT_ENST00000563415.1_Missense_Mutation_p.M98V|CDIPT_ENST00000561555.1_Missense_Mutation_p.M122V|CDIPT_ENST00000567459.1_5'Flank|CDIPT_ENST00000570016.1_Missense_Mutation_p.M98V|CDIPT_ENST00000569956.1_Missense_Mutation_p.M98V|CDIPT-AS1_ENST00000565014.1_RNA	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	98					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						TCCAAACTCATGCTGATTTGG	0.607																																						ENST00000219789.6	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				4						c.(292-294)Atg>Gtg		CDP-diacylglycerol--inositol 3-phosphatidyltransferase							83.0	67.0	73.0					16																	29872467		2197	4300	6497	SO:0001583	missense	10423	0	0					g.chr16:29872467T>C	AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.292A>G	chr16.hg19:g.29872467T>C	ENSP00000219789:p.Met98Val	1					CDIPT_ENST00000569956.1_Missense_Mutation_p.M98V|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT_ENST00000567459.1_5'Flank|CDIPT_ENST00000566113.1_Missense_Mutation_p.M53V|CDIPT_ENST00000570016.1_Missense_Mutation_p.M98V|CDIPT_ENST00000563415.1_Missense_Mutation_p.M98V|CDIPT_ENST00000561555.1_Missense_Mutation_p.M122V	p.M98V	NM_006319.3	NP_006310.1	3	4	7	2.188718	O14735	CDIPT_HUMAN		3	1170	-			B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Missense_Mutation	SNP	ENST00000219789.6	1	1	hg19	c.292A>G	CCDS10657.1	1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.156835	0.38119	.	.	ENSG00000103502	ENST00000219789;ENST00000403894	T	0.39056	1.1	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.33352	0.0860	N	0.21142	0.635	0.58432	D	0.999994	B;B;P	0.50943	0.104;0.048;0.94	B;B;P	0.44946	0.051;0.086;0.465	T	0.05989	-1.0852	10	0.24483	T	0.36	-15.9386	14.0659	0.64828	0.0:0.0:0.0:1.0	.	53;98;122	B4DUV0;O14735;B3KY94	.;CDIPT_HUMAN;.	V	98;151	ENSP00000219789:M98V	ENSP00000219789:M98V	M	-	1	0	0	CDIPT	29779968	29779968	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.797000	0.75150	2.220000	0.72140	0.533000	0.62120	ATG	0.788079		TCGA-FB-AAPZ-01A-11D-A40W-08	0.607	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255147.3	1	0	1		2	2	2	0		0	0	28		28	28	1	3.130000	-20.000000	1	0.680000	NM_006319			81	76		99	99	1		1	1		0	0	28	0		1	1	0	4	0	80	0	81	99
ZNF48	197407	broad.mit.edu	37	16	30410328	30410328	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr16:30410328G>A	ENST00000320159.2	+	2	2133	c.1757G>A	c.(1756-1758)cGc>cAc	p.R586H		NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						AGTTCTGCCCGCATCAAGCAC	0.592																																						ENST00000320159.2	1.000000	0	1	2.000000e-02	5.000000e-02	0.243486	5.000000e-02	0.040000																										0				21						c.(1756-1758)cGc>cAc		zinc finger protein 48							105.0	108.0	107.0					16																	30410328		2197	4300	6497	SO:0001583	missense	197407	0	0					g.chr16:30410328G>A	M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.1757G>A	chr16.hg19:g.30410328G>A	ENSP00000324056:p.Arg586His	1						p.R586H	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	3	4	7	2.188718	Q96MX3	ZNF48_HUMAN		2	2133	+			Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	0	1	hg19	c.1757G>A	CCDS10679.1	0	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709960	0.30322	.	.	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.28454	1.61	4.6	4.6	0.57074	4.6	4.6	0.57074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34507	N	0.003901	T	0.19765	0.0475	N	0.24115	0.695	0.27017	N	0.964547	B	0.26363	0.147	B	0.13407	0.009	T	0.14896	-1.0456	10	0.87932	D	0	-16.7957	10.3576	0.43974	0.0:0.0:0.8042:0.1958	.	586	Q96MX3	ZNF48_HUMAN	H	711;586	ENSP00000324056:R586H	ENSP00000324056:R586H	R	+	2	0	0	ZNF48	30317829	30317829	0.193000	0.23313	0.954000	0.39281	0.780000	0.44128	1.880000	0.39628	2.556000	0.86216	0.557000	0.71058	CGC	0.788079		TCGA-FB-AAPZ-01A-11D-A40W-08	0.592	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	0	0	1		2	2	2	0		0	0	87		87	86	1	3.130000	-1.813077	0	0.680000	NM_152652			6	6		570	564	0		1	0		0	0	87	0		9.639753e-01	1.740175e-02	0	0	0	16	0	6	570
ADAMTS18	170692	broad.mit.edu	37	16	77327045	77327045	+	Silent	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr16:77327045C>T	ENST00000282849.5	-	20	3535	c.3117G>A	c.(3115-3117)ctG>ctA	p.L1039L	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1039	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AGCCCTCCTGCAGCTCAGGTC	0.607																																						ENST00000282849.5	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				118						c.(3115-3117)ctG>ctA		ADAM metallopeptidase with thrombospondin type 1 motif, 18							85.0	81.0	82.0					16																	77327045		2198	4300	6498	SO:0001819	synonymous_variant	170692	0	0					g.chr16:77327045C>T	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3117G>A	chr16.hg19:g.77327045C>T		1					RP11-538I12.3_ENST00000561672.1_RNA	p.L1039L	NM_199355.2	NP_955387.1	2	2	4	2.341113	Q8TE60	ATS18_HUMAN		20	3535	-			Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	1	1	hg19	c.3117G>A	CCDS10926.1	1																																																																																								0.803150		TCGA-FB-AAPZ-01A-11D-A40W-08	0.607	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1	1	0	1		2	2	2	0		0	0	82		82	80	1	3.130000	-20.000000	1	0.680000				154	152		288	285	1		1			0	0	82	0		1	0	0	0	0	0	0	154	288
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	24185	GRCh37	CM951226	TP53	M		c.(637-639)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	7157	1	121412	30	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578212G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	chr17.hg19:g.7578212G>A	ENSP00000269305:p.Arg213*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*	p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	3	3	1.690177	P04637	P53_HUMAN		6	826	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.637C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	2	TP53	7518937	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	0.748428		TCGA-FB-AAPZ-01A-11D-A40W-08	0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	7	0		0	0	30		30	29	1	3.130000	-20.000000	1	0.680000	NM_000546			117	116		54	52	0		1	1	1	0	2	30	1068		1	1	1	3	641	22	287	117	54
ROCK1	6093	broad.mit.edu	37	18	18625398	18625398	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr18:18625398G>A	ENST00000399799.2	-	5	1385	c.445C>T	c.(445-447)Ctc>Ttc	p.L149F		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	149	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					ACCATGTAGAGATAACGATCA	0.328																																						ENST00000399799.2	0.880000	3.800000e-01	7.300000e-01	4.800000e-01	5.900000e-01	0.609078	5.900000e-01	0.590000																										0				16						c.(445-447)Ctc>Ttc		Rho-associated, coiled-coil containing protein kinase 1							95.0	85.0	88.0					18																	18625398		2203	4300	6503	SO:0001583	missense	6093	0	0					g.chr18:18625398G>A		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.445C>T	chr18.hg19:g.18625398G>A	ENSP00000382697:p.Leu149Phe	1						p.L149F	NM_005406.2	NP_005397.1	1	4	5	2.954331	Q13464	ROCK1_HUMAN		5	1385	-	Melanoma(1;0.165)		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	1	1	hg19	c.445C>T	CCDS11870.2	0	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699139	0.88830	.	.	ENSG00000067900	ENST00000399799	T	0.69175	-0.38	5.36	4.49	0.54785	5.36	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78413	0.4279	L	0.58969	1.84	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80892	-0.1179	10	0.87932	D	0	.	14.1018	0.65062	0.0719:0.0:0.9281:0.0	.	149	Q13464	ROCK1_HUMAN	F	149	ENSP00000382697:L149F	ENSP00000382697:L149F	L	-	1	0	0	ROCK1	16879396	16879396	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.561000	0.60809	1.485000	0.48380	0.655000	0.94253	CTC	0.839968		TCGA-FB-AAPZ-01A-11D-A40W-08	0.328	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	1	0	1		2	2	2	0		0	0	32		32	32	1	3.130000	-20.000000	1	0.680000	NM_005406			23	23		208	208	1		1	1		0	0	32	0		9.999995e-01	6.644365e-01	0	2	0	20	0	23	208
RNF165	494470	broad.mit.edu	37	18	44030346	44030346	+	Missense_Mutation	SNP	G	G	A	rs373942142		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr18:44030346G>A	ENST00000269439.7	+	5	754	c.703G>A	c.(703-705)Gta>Ata	p.V235I	RNF165_ENST00000543885.1_Missense_Mutation_p.V43I	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	235							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CACCTCCGCCGTACGGGAGAG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		21674	0.0		0.0	False		,,,				2504	0.001					ENST00000269439.7	1.000000	8.600000e-01	1	9.200000e-01	9.700000e-01	0.967699	9.700000e-01	1.000000																										0				11						c.(703-705)Gta>Ata		ring finger protein 165		G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	85.0	76.0	79.0		703	5.3	0.7	18		79	0,8600		0,0,4300	no	missense	RNF165	NM_152470.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	235/347	44030346	1,13005	2203	4300	6503	SO:0001583	missense	494470	10	121412	39				g.chr18:44030346G>A	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.703G>A	chr18.hg19:g.44030346G>A	ENSP00000269439:p.Val235Ile	1					RNF165_ENST00000543885.1_Missense_Mutation_p.V43I	p.V235I	NM_152470.2	NP_689683.2	0	1	1	1.033301	Q6ZSG1	RN165_HUMAN		5	754	+			B3KVD1	Missense_Mutation	SNP	ENST00000269439.7	1	1	hg19	c.703G>A	CCDS32823.1	1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653556	0.67472	2.27E-4	0.0	ENSG00000141622	ENST00000269439;ENST00000543885	T;T	0.22945	2.18;1.93	5.28	5.28	0.74379	5.28	5.28	0.74379	.	0.067191	0.64402	D	0.000015	T	0.35913	0.0948	L	0.60455	1.87	0.58432	D	0.999999	D	0.61080	0.989	P	0.49421	0.61	T	0.03852	-1.0998	10	0.20519	T	0.43	.	19.277	0.94036	0.0:0.0:1.0:0.0	.	235	Q6ZSG1	RN165_HUMAN	I	235;43	ENSP00000269439:V235I;ENSP00000444285:V43I	ENSP00000269439:V235I	V	+	1	0	0	RNF165	42284344	42284344	1.000000	0.71417	0.746000	0.31095	0.873000	0.50193	9.420000	0.97426	2.647000	0.89833	0.467000	0.42956	GTA	0.517636		TCGA-FB-AAPZ-01A-11D-A40W-08	0.522	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	1	0	1		2	2	2	0		0	0	47		47	47	1	3.130000	-20.000000	1	0.680000	NM_152470			76	76		59	56	1		1			0	0	47	0		1	0	0	0	0	0	0	76	59
ZNF546	339327	broad.mit.edu	37	19	40520572	40520572	+	Silent	SNP	T	T	C			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr19:40520572T>C	ENST00000347077.4	+	7	1611	c.1395T>C	c.(1393-1395)ggT>ggC	p.G465G	ZNF546_ENST00000600094.1_Silent_p.G439G|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTCATACTGGTGAGAAACCCT	0.403																																						ENST00000347077.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				34						c.(1393-1395)ggT>ggC		zinc finger protein 546							73.0	75.0	75.0					19																	40520572		2203	4300	6503	SO:0001819	synonymous_variant	339327	0	0					g.chr19:40520572T>C	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1395T>C	chr19.hg19:g.40520572T>C		1					ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Silent_p.G439G	p.G465G	NM_178544.3	NP_848639.2	2	2	4	2.327377	Q86UE3	ZN546_HUMAN		7	1611	+	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		A8K913	Silent	SNP	ENST00000347077.4	1	1	hg19	c.1395T>C	CCDS12548.1	1																																																																																								0.801489		TCGA-FB-AAPZ-01A-11D-A40W-08	0.403	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	1	0	1		2	2	2	0		0	0	83		83	78	1	3.130000	-20.000000	1	0.680000	NM_178544			206	205		312	311	1		1	0		0	0	83	0		1	0	0	0	0	1	0	206	312
PSG8	440533	broad.mit.edu	37	19	43259170	43259170	+	Missense_Mutation	SNP	G	G	A	rs200167716		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr19:43259170G>A	ENST00000306511.4	-	4	1055	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	PSG8_ENST00000404209.4_Missense_Mutation_p.R320C|PSG8_ENST00000600709.1_Intron|PSG8_ENST00000401467.2_Missense_Mutation_p.R227C|PSG8_ENST00000406636.3_Missense_Mutation_p.R198C	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	320	Ig-like C2-type 2.					extracellular region (GO:0005576)		p.R320C(2)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GGGTAACTGCGGATGCCACCA	0.483																																						ENST00000306511.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										2	Substitution - Missense(2)	p.R320C(2)	large_intestine(2)	40						c.(958-960)Cgc>Tgc		pregnancy specific beta-1-glycoprotein 8		G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	185.0	185.0	185.0		958,592,958	-2.0	0.0	19		185	1,8597		0,1,4298	no	missense,missense,missense	PSG8	NM_001130167.1,NM_001130168.1,NM_182707.2	180,180,180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	320/420,198/298,320/427	43259170	1,13003	2203	4299	6502	SO:0001583	missense	440533	12	121404	44				g.chr19:43259170G>A	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.958C>T	chr19.hg19:g.43259170G>A	ENSP00000305005:p.Arg320Cys	1					PSG8_ENST00000600709.1_Intron|PSG8_ENST00000404209.4_Missense_Mutation_p.R320C|PSG8_ENST00000406636.3_Missense_Mutation_p.R198C|PSG8_ENST00000401467.2_Missense_Mutation_p.R227C	p.R320C	NM_182707.2	NP_874366.1	2	2	4	2.327377	Q9UQ74	PSG8_HUMAN		4	1055	-		Prostate(69;0.00899)	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	1	1	hg19	c.958C>T	CCDS33037.1	1	.	.	.	.	.	.	.	.	.	.	N	4.888	0.164951	0.09287	0.0	1.16E-4	ENSG00000124467	ENST00000404209;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	1.38	-1.99	0.07457	1.38	-1.99	0.07457	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.25494	0.0620	M	0.78285	2.405	0.09310	N	1	D;P;B;B;B;B	0.69078	0.997;0.594;0.02;0.005;0.005;0.006	P;B;B;B;B;B	0.61397	0.888;0.284;0.009;0.07;0.005;0.009	T	0.13737	-1.0498	9	0.51188	T	0.08	.	2.0334	0.03534	0.2288:0.0:0.475:0.2962	.	198;227;320;227;320;320	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	C	320;198;227;132;227;320	ENSP00000385869:R320C;ENSP00000385081:R198C;ENSP00000386090:R227C;ENSP00000305005:R320C	ENSP00000305005:R320C	R	-	1	0	0	PSG8	47951010	47951010	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.436000	0.02421	-0.117000	0.11872	-1.261000	0.01458	CGC	0.801489		TCGA-FB-AAPZ-01A-11D-A40W-08	0.483	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1	1	0	1		2	2	2	0		0	0	121		121	134	1	3.130000	-20.000000	1	0.680000				303	296		475	465	1		1			0	0	121	0		1	0	0	0	0	0	0	303	475
PSG11	5680	broad.mit.edu	37	19	43523094	43523094	+	Silent	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr19:43523094C>T	ENST00000401740.1	-	3	640	c.537G>A	c.(535-537)ctG>ctA	p.L179L	PSG11_ENST00000306322.7_Silent_p.L57L|PSG11_ENST00000595312.1_5'UTR|PSG11_ENST00000403486.1_Silent_p.L57L|PSG11_ENST00000320078.7_Silent_p.L179L			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	179	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				TCATCCACCACAGGTAGCTTG	0.512																																						ENST00000401740.1	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				26						c.(535-537)ctG>ctA		pregnancy specific beta-1-glycoprotein 11							259.0	265.0	263.0					19																	43523094		2200	4297	6497	SO:0001819	synonymous_variant	5680	0	0					g.chr19:43523094C>T	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.537G>A	chr19.hg19:g.43523094C>T		1					PSG11_ENST00000595312.1_5'UTR|PSG11_ENST00000320078.7_Silent_p.L179L|PSG11_ENST00000403486.1_Silent_p.L57L|PSG11_ENST00000306322.7_Silent_p.L57L	p.L179L			2	2	4	2.327377	Q00887	PSG9_HUMAN		3	640	-		Prostate(69;0.00682)	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Silent	SNP	ENST00000401740.1	1	1	hg19	c.537G>A	CCDS12614.2	1																																																																																								0.801489		TCGA-FB-AAPZ-01A-11D-A40W-08	0.512	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	1	0	1		2	2	2	0		0	0	320		320	308	1	3.130000	-20.000000	1	0.680000	NM_002785			768	759		1165	1147	1		1			0	0	320	0		1	0	0	0	0	0	0	768	1165
TNNI3	7137	broad.mit.edu	37	19	55665406	55665406	+	Missense_Mutation	SNP	T	T	G			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr19:55665406T>G	ENST00000344887.5	-	7	683	c.541A>C	c.(541-543)Acc>Ccc	p.T181P	TNNI3_ENST00000590463.1_5'Flank|TNNI3_ENST00000588882.1_Missense_Mutation_p.T156P	NM_000363.4	NP_000354.4	P19429	TNNI3_HUMAN	troponin I type 3 (cardiac)	181					cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|heart contraction (GO:0060047)|heart development (GO:0007507)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|regulation of smooth muscle contraction (GO:0006940)|regulation of systemic arterial blood pressure by ischemic conditions (GO:0001980)|vasculogenesis (GO:0001570)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|troponin complex (GO:0005861)	actin binding (GO:0003779)|calcium channel inhibitor activity (GO:0019855)|calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|troponin C binding (GO:0030172)|troponin T binding (GO:0031014)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		ACCTTCTCGGTGTCCTCCTTC	0.627																																						ENST00000344887.5	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				12						c.(541-543)Acc>Ccc		troponin I type 3 (cardiac)							65.0	69.0	67.0					19																	55665406		2053	4215	6268	SO:0001583	missense	7137	0	0					g.chr19:55665406T>G	M64247	CCDS42628.1	19q13.4	2014-09-17	2005-09-12			ENSG00000129991			11947	protein-coding gene	gene with protein product		191044	"""troponin I, cardiac"", ""cardiomyopathy, dilated 2A (autosomal recessive)"""	CMD2A		9605869, 9241277, 10806205	Standard	NM_000363		Approved	TNNC1, CMH7	uc002qjg.4	P19429		ENST00000344887.5:c.541A>C	chr19.hg19:g.55665406T>G	ENSP00000341838:p.Thr181Pro	1					TNNI3_ENST00000588882.1_Missense_Mutation_p.T156P|TNNI3_ENST00000590463.1_5'Flank	p.T181P	NM_000363.4	NP_000354.4	2	2	4	2.455654	P19429	TNNI3_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	7	683	-				Missense_Mutation	SNP	ENST00000344887.5	1	1	hg19	c.541A>C	CCDS42628.1	1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.337852	0.41398	.	.	ENSG00000129991	ENST00000344887	D	0.94723	-3.5	4.72	2.5	0.30297	4.72	2.5	0.30297	.	0.581099	0.16498	N	0.211800	D	0.90079	0.6901	L	0.52573	1.65	0.35660	D	0.81242	B	0.02656	0.0	B	0.01281	0.0	D	0.86432	0.1761	10	0.54805	T	0.06	-21.4095	4.2672	0.10769	0.0:0.1778:0.1798:0.6424	.	181	P19429	TNNI3_HUMAN	P	181	ENSP00000341838:T181P	ENSP00000341838:T181P	T	-	1	0	0	TNNI3	60357218	60357218	1.000000	0.71417	0.968000	0.41197	0.989000	0.77384	3.726000	0.54977	0.714000	0.32081	0.477000	0.44152	ACC	0.809524		TCGA-FB-AAPZ-01A-11D-A40W-08	0.627	TNNI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452098.1	0	0	1		2	2	2	0		0	0	96		96	91	1	3.130000	-20.000000	1	0.680000				254	247		382	373	1		1	0		0	0	96	0		1	3.508749e-01	0	1	0	2	0	254	382
ZNF132	7691	broad.mit.edu	37	19	58944797	58944797	+	Missense_Mutation	SNP	G	G	A	rs202158029		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr19:58944797G>A	ENST00000254166.3	-	3	2414	c.2014C>T	c.(2014-2016)Cgg>Tgg	p.R672W	CTD-2619J13.17_ENST00000594816.1_lincRNA	NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	672					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		TTCTGGTGCCGAACAAGTGTA	0.448																																						ENST00000254166.3	0.150000	1.000000e-02	1.100000e-01	3.000000e-02	7.000000e-02	0.079554	7.000000e-02	0.080000																										0				19						c.(2014-2016)Cgg>Tgg		zinc finger protein 132							110.0	100.0	104.0					19																	58944797		2203	4300	6503	SO:0001583	missense	7691	7	121412	39				g.chr19:58944797G>A	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.2014C>T	chr19.hg19:g.58944797G>A	ENSP00000254166:p.Arg672Trp	1					CTD-2619J13.17_ENST00000594816.1_lincRNA	p.R672W	NM_003433.3	NP_003424.3	2	2	4	2.455654	P52740	ZN132_HUMAN		3	2414	-		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	Q32MI9	Missense_Mutation	SNP	ENST00000254166.3	0	1	hg19	c.2014C>T	CCDS12980.1	0	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412314	0.42817	.	.	ENSG00000131849	ENST00000254166;ENST00000391695	T	0.26660	1.72	3.05	1.76	0.24704	3.05	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44519	0.1297	M	0.75884	2.315	0.09310	N	1	D	0.76494	0.999	D	0.65773	0.938	T	0.11991	-1.0565	9	0.62326	D	0.03	.	7.4495	0.27229	0.0:0.0:0.4465:0.5535	.	672	P52740	ZN132_HUMAN	W	672;387	ENSP00000254166:R672W	ENSP00000254166:R672W	R	-	1	2	2	ZNF132	63636609	63636609	0.000000	0.05858	0.998000	0.56505	0.965000	0.64279	-4.163000	0.00282	1.419000	0.47118	0.650000	0.86243	CGG	0.809524		TCGA-FB-AAPZ-01A-11D-A40W-08	0.448	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	0	0	1		2	2	2	0		0	0	67		67	65	1	3.130000	-2.579007	1	0.680000	NM_003433			6	6		423	419	0		1	0		0	0	67	0		9.641985e-01	3.007648e-04	0	0	0	2	0	6	423
TAS1R2	80834	broad.mit.edu	37	1	19183978	19183978	+	Silent	SNP	C	C	T	rs370454471	byFrequency	TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr1:19183978C>T	ENST00000375371.3	-	2	351	c.330G>A	c.(328-330)ccG>ccA	p.P110P	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	110					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AGTAGAGCACCGGCTGGACAT	0.542													-|||	2	0.000399361	0.0	0.0	5008	,	,		22483	0.0		0.0	False		,,,				2504	0.002					ENST00000375371.3	1.000000	1.900000e-01	1	2.400000e-01	3.000000e-01	0.457632	3.000000e-01	0.290000																										0				45						c.(328-330)ccG>ccA		taste receptor, type 1, member 2	Aspartame(DB00168)			1,4405		0,1,2202	195.0	146.0	163.0		330	-7.6	0.9	1		163	0,8600		0,0,4300	no	coding-synonymous	TAS1R2	NM_152232.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		110/840	19183978	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80834	3	121412	38				g.chr1:19183978C>T		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.330G>A	chr1.hg19:g.19183978C>T		1					RP13-279N23.2_ENST00000494072.3_3'UTR	p.P110P	NM_152232.2	NP_689418.2	2	3	5	2.022724	Q8TE23	TS1R2_HUMAN		2	351	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	Q5TZ19	Silent	SNP	ENST00000375371.3	1	1	hg19	c.330G>A	CCDS187.1	0																																																																																								0.772727		TCGA-FB-AAPZ-01A-11D-A40W-08	0.542	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1	1	0	1		2	2	2	0		0	0	78		78	78	1	3.130000	-2.473695	0	0.680000				28	27		379	376	0		1			0	0	78	0		1	0	0	0	0	0	0	28	379
EPHA8	2046	broad.mit.edu	37	1	22924191	22924191	+	Silent	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr1:22924191C>T	ENST00000166244.3	+	11	2025	c.1953C>T	c.(1951-1953)taC>taT	p.Y651Y		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	651	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AAGTCTGCTACGGGAGGCTGC	0.692																																						ENST00000166244.3	1.000000	8.400000e-01	1	9.600000e-01	9.900000e-01	0.983414	9.900000e-01	1.000000																										0				61						c.(1951-1953)taC>taT		EPH receptor A8							31.0	38.0	35.0					1																	22924191		2202	4299	6501	SO:0001819	synonymous_variant	2046	0	0					g.chr1:22924191C>T	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1953C>T	chr1.hg19:g.22924191C>T		1						p.Y651Y	NM_020526.3	NP_065387.1	2	3	5	2.022724	P29322	EPHA8_HUMAN		11	2025	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	1	1	hg19	c.1953C>T	CCDS225.1	1																																																																																								0.772727		TCGA-FB-AAPZ-01A-11D-A40W-08	0.692	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	1	0	1		2	2	2	0		0	0	31		31	31	1	3.130000	-20.000000	1	0.680000	NM_020526			51	50		147	146	1		1			0	0	31	0		1	0	0	0	0	0	0	51	147
THRAP3	9967	broad.mit.edu	37	1	36752394	36752394	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr1:36752394G>A	ENST00000354618.5	+	4	787	c.563G>A	c.(562-564)cGg>cAg	p.R188Q	THRAP3_ENST00000469141.2_Missense_Mutation_p.R188Q	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	188	Required for mRNA splicing activation.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAGGATAGCCGGCCATCTCAG	0.527			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)	ENST00000354618.5	1.000000	0	1	1.000000e-02	3.000000e-02	0.262045	3.000000e-02	0.030000				Dom	yes			Dom	yes		1	1p34.3	1p34.3	9967	T	thyroid hormone receptor associated protein 3 (TRAP150)				M	M	USP6		aneurysmal bone cysts		0				37						c.(562-564)cGg>cAg		thyroid hormone receptor associated protein 3							108.0	117.0	114.0					1																	36752394		2203	4300	6503	SO:0001583	missense	9967	0	0					g.chr1:36752394G>A	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.563G>A	chr1.hg19:g.36752394G>A	ENSP00000346634:p.Arg188Gln	1					THRAP3_ENST00000469141.2_Missense_Mutation_p.R188Q	p.R188Q	NM_005119.3	NP_005110.2	2	3	5	2.042750	Q9Y2W1	TR150_HUMAN		4	787	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	0	1	hg19	c.563G>A	CCDS405.1	0	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245450	0.59103	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.13089	2.62;2.62	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000004	T	0.18173	0.0436	L	0.41236	1.265	0.51233	D	0.999918	D	0.63046	0.992	P	0.45753	0.492	T	0.00273	-1.1858	10	0.54805	T	0.06	-2.4011	18.8828	0.92364	0.0:0.0:1.0:0.0	.	188	Q9Y2W1	TR150_HUMAN	Q	188	ENSP00000346634:R188Q;ENSP00000433825:R188Q	ENSP00000346634:R188Q	R	+	2	0	0	THRAP3	36524981	36524981	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	6.476000	0.73587	2.711000	0.92665	0.655000	0.94253	CGG	0.774362		TCGA-FB-AAPZ-01A-11D-A40W-08	0.527	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	0	0	1		2	2	2	0		0	0	164		164	161	1	3.130000	-2.129839	0	0.680000	NM_005119			6	7		789	780	0		1	0		0	0	164	0		9.639347e-01	1.084992e-01	0	0	0	62	0	6	789
GBA	2629	broad.mit.edu	37	1	155209725	155209725	+	Missense_Mutation	SNP	G	G	A	rs1141814		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr1:155209725G>A	ENST00000327247.5	-	4	491	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	GBA_ENST00000427500.3_Missense_Mutation_p.R87W|GBA_ENST00000493842.1_5'UTR|GBA_ENST00000536770.1_Intron|GBA_ENST00000428024.3_De_novo_Start_OutOfFrame|GBA_ENST00000368373.3_Missense_Mutation_p.R87W	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	87			R -> Q (in GD; 20% of normal activity).|R -> W (in GD; mild; dbSNP:rs1141814). {ECO:0000269|PubMed:10796875, ECO:0000269|PubMed:9153297, ECO:0000269|PubMed:9217217}.		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	AGCTCCATCCGTCGCCCACTG	0.592									Gaucher disease type I																													ENST00000327247.5	1.000000	2.100000e-01	1	3.000000e-01	4.100000e-01	0.521899	4.100000e-01	0.360000																										0				26	GRCh37	CM950561	GBA	M	rs1141814	c.(259-261)Cgg>Tgg		glucosidase, beta, acid	Velaglucerase alfa(DB06720)						55.0	45.0	48.0					1																	155209725		2203	4300	6503	SO:0001583	missense	2629	2	121412	32	Gaucher disease type I	Familial Cancer Database	glucocerebrosidase insufficiency	g.chr1:155209725G>A	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.259C>T	chr1.hg19:g.155209725G>A	ENSP00000314508:p.Arg87Trp	0					GBA_ENST00000536770.1_Intron|GBA_ENST00000427500.3_Missense_Mutation_p.R87W|GBA_ENST00000493842.1_5'UTR|GBA_ENST00000428024.3_De_novo_Start_OutOfFrame|GBA_ENST00000368373.3_Missense_Mutation_p.R87W	p.R87W	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	2	3	5	1.933017	P04062	GLCM_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)	4	491	-	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Missense_Mutation	SNP	ENST00000327247.5	1	0	hg19	c.259C>T	CCDS1102.1	0	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906424	0.33628	.	.	ENSG00000177628	ENST00000427500;ENST00000368373;ENST00000327247;ENST00000536555;ENST00000402928	D;D;D	0.99652	-4.04;-6.3;-6.3	3.46	1.33	0.21861	3.46	1.33	0.21861	.	0.081577	0.45867	N	0.000328	D	0.99278	0.9748	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.973	D	0.99107	1.0845	10	0.87932	D	0	.	3.8119	0.08801	0.1327:0.0:0.6312:0.2361	rs1141814;rs3205618;rs17401365	87;87	B7Z5G2;P04062	.;GLCM_HUMAN	W	87;87;87;44;87	ENSP00000402577:R87W;ENSP00000357357:R87W;ENSP00000314508:R87W	ENSP00000314508:R87W	R	-	1	2	2	GBA	153476349	153476349	1.000000	0.71417	0.240000	0.24138	0.020000	0.10135	2.947000	0.49058	0.802000	0.34089	-0.356000	0.07607	CGG	0.762400		TCGA-FB-AAPZ-01A-11D-A40W-08	0.592	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	1	0	1		2	2	2	0		0	0	26		26	26	1	3.130000	-18.808840	1	0.680000	NM_000157			13	13		127	126	0		1	1		0	0	26	0		9.995996e-01	9.005170e-01	0	2	0	40	0	13	127
PHACTR3	116154	broad.mit.edu	37	20	58381152	58381152	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr20:58381152C>T	ENST00000371015.1	+	8	1698	c.1231C>T	c.(1231-1233)Cca>Tca	p.P411S	PHACTR3_ENST00000395639.4_Missense_Mutation_p.P300S|PHACTR3_ENST00000361300.4_Missense_Mutation_p.P300S|PHACTR3_ENST00000359926.3_Missense_Mutation_p.P408S|PHACTR3_ENST00000395636.2_Missense_Mutation_p.P370S|PHACTR3_ENST00000355648.4_Missense_Mutation_p.P370S|PHACTR3_ENST00000541461.1_Missense_Mutation_p.P370S	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	411						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AAGGAACCGGCCAAGCAAACA	0.512																																						ENST00000371015.1	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				59						c.(1231-1233)Cca>Tca		phosphatase and actin regulator 3							142.0	153.0	149.0					20																	58381152		2203	4300	6503	SO:0001583	missense	116154	0	0					g.chr20:58381152C>T	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1231C>T	chr20.hg19:g.58381152C>T	ENSP00000360054:p.Pro411Ser	1					PHACTR3_ENST00000395639.4_Missense_Mutation_p.P300S|PHACTR3_ENST00000355648.4_Missense_Mutation_p.P370S|PHACTR3_ENST00000361300.4_Missense_Mutation_p.P300S|PHACTR3_ENST00000359926.3_Missense_Mutation_p.P408S|PHACTR3_ENST00000541461.1_Missense_Mutation_p.P370S|PHACTR3_ENST00000395636.2_Missense_Mutation_p.P370S	p.P411S	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	2	2	4	2.294843	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)	8	1698	+	all_lung(29;0.00344)		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	1	1	hg19	c.1231C>T	CCDS13480.1	1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.446091	0.84101	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.43688	1.21;1.25;0.94;1.25;1.25;1.25;0.94	5.25	5.25	0.73442	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.68686	0.3028	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.73467	-0.3973	10	0.66056	D	0.02	-16.2549	17.8596	0.88777	0.0:1.0:0.0:0.0	.	300;411;408	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	S	408;411;300;370;370;370;300	ENSP00000353002:P408S;ENSP00000360054:P411S;ENSP00000379001:P300S;ENSP00000442483:P370S;ENSP00000347866:P370S;ENSP00000378998:P370S;ENSP00000354555:P300S	ENSP00000347866:P370S	P	+	1	0	0	PHACTR3	57814547	57814547	1.000000	0.71417	0.999000	0.59377	0.625000	0.37756	7.818000	0.86416	2.460000	0.83146	0.650000	0.86243	CCA	0.798944		TCGA-FB-AAPZ-01A-11D-A40W-08	0.512	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	0	0	1		24	2	2	1		1	1	143		143	139	1	3.130000	-20.000000	1	0.680000	NM_080672			459	457		598	589	1		1			1	0	143	0		1	0	0	0	0	0	0	459	598
DSCAM	1826	broad.mit.edu	37	21	42080519	42080519	+	Silent	SNP	G	G	A	rs371757548		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr21:42080519G>A	ENST00000400454.1	-	2	699	c.222C>T	c.(220-222)caC>caT	p.H74H		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	74	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGGGGTGGACGTGGCGGATCC	0.542																																					Melanoma(134;970 1778 1785 21664 32388)	ENST00000400454.1	1.000000	3.900000e-01	1	4.500000e-01	5.300000e-01	0.612745	5.300000e-01	0.510000																										0				142						c.(220-222)caC>caT		Down syndrome cell adhesion molecule		G		1,3929		0,1,1964	92.0	96.0	94.0		222	5.1	1.0	21		94	0,8308		0,0,4154	no	coding-synonymous	DSCAM	NM_001389.3		0,1,6118	AA,AG,GG		0.0,0.0254,0.0082		74/2013	42080519	1,12237	1965	4154	6119	SO:0001819	synonymous_variant	1826	1	120894	31				g.chr21:42080519G>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.222C>T	chr21.hg19:g.42080519G>A		1						p.H74H	NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	2	4	6	2.030803	O60469	DSCAM_HUMAN		2	699	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	O60468	Silent	SNP	ENST00000400454.1	1	1	hg19	c.222C>T	CCDS42929.1	0																																																																																								0.770511		TCGA-FB-AAPZ-01A-11D-A40W-08	0.542	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	1	0	1		18	2	2	0		0	1	80		80	77	1	3.130000	-19.895370	1	0.680000	NM_001389			52	52		366	360	1		1			0	0	80	0		9.999942e-01	0	0	0	0	0	0	52	366
MX2	4600	broad.mit.edu	37	21	42749046	42749046	+	Missense_Mutation	SNP	G	G	T	rs142593261		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr21:42749046G>T	ENST00000330714.3	+	2	397	c.213G>T	c.(211-213)caG>caT	p.Q71H	MX2_ENST00000543692.1_Missense_Mutation_p.Q71H	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	71					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				TGAACAATCAGCCACCACCAG	0.552																																						ENST00000330714.3	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				34						c.(211-213)caG>caT		MX dynamin-like GTPase 2							116.0	127.0	123.0					21																	42749046		2203	4300	6503	SO:0001583	missense	4600	0	0					g.chr21:42749046G>T		CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.213G>T	chr21.hg19:g.42749046G>T	ENSP00000333657:p.Gln71His	1					MX2_ENST00000543692.1_Missense_Mutation_p.Q71H	p.Q71H	NM_002463.1	NP_002454.1	2	4	6	2.030803	P20592	MX2_HUMAN		2	397	+		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)	B7Z5D3|D3DSI7	Missense_Mutation	SNP	ENST00000330714.3	1	1	hg19	c.213G>T	CCDS13672.1	1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923572	0.33908	.	.	ENSG00000183486	ENST00000330714;ENST00000436410;ENST00000435611;ENST00000543692;ENST00000418103	D;D	0.92397	-2.58;-3.03	2.47	1.58	0.23477	2.47	1.58	0.23477	.	4.843280	0.00597	N	0.000371	D	0.90407	0.6997	L	0.50333	1.59	0.09310	N	1	P	0.49961	0.93	P	0.44732	0.459	T	0.78957	-0.1999	10	0.59425	D	0.04	.	5.0852	0.14678	0.1707:0.0:0.8293:0.0	.	71	P20592	MX2_HUMAN	H	71	ENSP00000333657:Q71H;ENSP00000446017:Q71H	ENSP00000333657:Q71H	Q	+	3	2	2	MX2	41670916	41670916	0.005000	0.15991	0.002000	0.10522	0.018000	0.09664	1.088000	0.30877	0.614000	0.30107	0.561000	0.74099	CAG	0.770511		TCGA-FB-AAPZ-01A-11D-A40W-08	0.552	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	0	0	1		21	2	2	1		1	1	113		113	113	1	3.130000	-20.000000	1	0.680000	NM_002463			303	300		416	404	1		1	0		1	0	113	0		1	9.774018e-01	0	0	0	11	0	303	416
RBM45	129831	broad.mit.edu	37	2	178990889	178990889	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr2:178990889C>G	ENST00000286070.5	+	9	1503	c.1411C>G	c.(1411-1413)Caa>Gaa	p.Q471E	RBM45_ENST00000464647.1_3'UTR	NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	473					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TAACAAACGGCAAAGAACTTA	0.348																																						ENST00000286070.5	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	0.999995	9.900000e-01	1.000000																										0				27						c.(1411-1413)Caa>Gaa		RNA binding motif protein 45							76.0	69.0	71.0					2																	178990889		2203	4300	6503	SO:0001583	missense	129831	0	0					g.chr2:178990889C>G	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.1411C>G	chr2.hg19:g.178990889C>G	ENSP00000286070:p.Gln471Glu	0					RBM45_ENST00000464647.1_3'UTR	p.Q471E	NM_152945.2	NP_694453.2	1	2	3	2.002322	Q8IUH3	RBM45_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)	9	1503	+			Q6NYL0|Q8NFC9	Missense_Mutation	SNP	ENST00000286070.5	1	1	hg19	c.1411C>G	CCDS33335.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.03|19.03	3.747532|3.747532	0.69533|0.69533	.|.	.|.	ENSG00000155636|ENSG00000155636	ENST00000424099|ENST00000286070	.|T	.|0.05081	.|3.5	5.78|5.78	5.78|5.78	0.91487|0.91487	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.113073	.|0.64402	.|D	.|0.000007	T|T	0.10252|0.10252	0.0251|0.0251	L|L	0.47716|0.47716	1.5|1.5	0.58432|0.58432	D|D	0.999999|0.999999	.|P	.|0.46859	.|0.885	.|B	.|0.42593	.|0.392	T|T	0.02705|0.02705	-1.1121|-1.1121	5|10	.|0.44086	.|T	.|0.13	-14.8272|-14.8272	18.9873|18.9873	0.92777|0.92777	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|471	.|Q8IUH3-3	.|.	G|E	69|471	.|ENSP00000286070:Q471E	.|ENSP00000286070:Q471E	A|Q	+|+	2|1	0|0	0|0	RBM45|RBM45	178699135|178699135	178699135|178699135	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.796000|5.796000	0.69080|0.69080	2.724000|2.724000	0.93272|0.93272	0.655000|0.655000	0.94253|0.94253	GCA|CAA	0.732710		TCGA-FB-AAPZ-01A-11D-A40W-08	0.348	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	1	0	1		2	2	2	0		0	0	61		61	61	1	3.130000	-20.000000	1	0.680000	NM_152945			112	112		185	182	1		1	1		0	0	61	0		1	9.996035e-01	0	6	0	17	0	112	185
EHBP1	23301	broad.mit.edu	37	2	63223823	63223823	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr2:63223823G>A	ENST00000263991.5	+	21	3720	c.3238G>A	c.(3238-3240)Gca>Aca	p.A1080T	EHBP1_ENST00000405289.1_Missense_Mutation_p.A1045T|EHBP1_ENST00000405015.3_Missense_Mutation_p.A1009T|EHBP1_ENST00000431489.1_Missense_Mutation_p.A1009T|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000354487.3_Missense_Mutation_p.A1045T	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	1080						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AGAATTGGCAGCACTAGAGAA	0.443																																						ENST00000263991.5	1.000000	0	1.100000e-01	2.000000e-02	6.000000e-02	0.132475	6.000000e-02	0.060000																										0				47						c.(3238-3240)Gca>Aca		EH domain binding protein 1							124.0	118.0	120.0					2																	63223823		2203	4300	6503	SO:0001583	missense	23301	0	0					g.chr2:63223823G>A	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3238G>A	chr2.hg19:g.63223823G>A	ENSP00000263991:p.Ala1080Thr	1					EHBP1_ENST00000354487.3_Missense_Mutation_p.A1045T|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000431489.1_Missense_Mutation_p.A1009T|EHBP1_ENST00000405289.1_Missense_Mutation_p.A1045T|EHBP1_ENST00000405015.3_Missense_Mutation_p.A1009T	p.A1080T	NM_015252.3	NP_056067.2	2	2	4	2.335306	Q8NDI1	EHBP1_HUMAN	LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)	21	3720	+	Lung NSC(7;0.0951)|all_lung(7;0.169)		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	0	1	hg19	c.3238G>A	CCDS1872.1	0	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657246	0.88154	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289;ENST00000545092	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.19	5.19	0.71726	5.19	5.19	0.71726	Domain of unknown function DUF3585 (1);	0.000000	0.85682	D	0.000000	T	0.61788	0.2375	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	T	0.57435	-0.7812	10	0.32370	T	0.25	.	18.7221	0.91698	0.0:0.0:1.0:0.0	.	1045;1009;1080	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	T	1009;1009;1080;1045;1045;51	ENSP00000384143:A1009T;ENSP00000403783:A1009T;ENSP00000263991:A1080T;ENSP00000346482:A1045T;ENSP00000385524:A1045T	ENSP00000263991:A1080T	A	+	1	0	0	EHBP1	63077327	63077327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.438000	0.82558	0.650000	0.86243	GCA	0.802323		TCGA-FB-AAPZ-01A-11D-A40W-08	0.443	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	0	0	1		2	2	2	0		0	0	69		69	69	1	3.130000	-2.908839	1	0.680000	NM_015252			5	5		427	423	0		1	0		0	0	69	0		9.363465e-01	8.579740e-02	0	0	0	34	0	5	427
TCF7L1	83439	broad.mit.edu	37	2	85532397	85532397	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr2:85532397G>A	ENST00000282111.3	+	8	1135	c.860G>A	c.(859-861)cGg>cAg	p.R287Q		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	287	Pro-rich.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						GTCTCCAGTCGGTTCTCTCCT	0.627																																						ENST00000282111.3	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	0.999336	9.900000e-01	1.000000																										0				18						c.(859-861)cGg>cAg		transcription factor 7-like 1 (T-cell specific, HMG-box)							118.0	118.0	118.0					2																	85532397		2203	4300	6503	SO:0001583	missense	83439	3	121412	38				g.chr2:85532397G>A	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.860G>A	chr2.hg19:g.85532397G>A	ENSP00000282111:p.Arg287Gln	1						p.R287Q	NM_031283.2	NP_112573.1	2	2	4	2.308637	Q9HCS4	TF7L1_HUMAN		8	1135	+			Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	1	1	hg19	c.860G>A	CCDS1971.1	1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381282	0.82792	.	.	ENSG00000152284	ENST00000282111	D	0.98617	-5.03	5.18	5.18	0.71444	5.18	5.18	0.71444	.	0.057692	0.64402	D	0.000001	D	0.99001	0.9659	M	0.77820	2.39	0.45183	D	0.99819	D	0.76494	0.999	D	0.72625	0.978	D	0.99785	1.1029	10	0.72032	D	0.01	.	16.1893	0.81975	0.0:0.0:1.0:0.0	.	287	Q9HCS4	TF7L1_HUMAN	Q	287	ENSP00000282111:R287Q	ENSP00000282111:R287Q	R	+	2	0	0	TCF7L1	85385908	85385908	1.000000	0.71417	1.000000	0.80357	0.338000	0.28826	9.782000	0.99034	2.401000	0.81631	0.591000	0.81541	CGG	0.799800		TCGA-FB-AAPZ-01A-11D-A40W-08	0.627	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	1	0	1		2	2	2	0		0	0	87		87	85	1	3.130000	-5.416782	1	0.680000	NM_031283			147	146		450	443	1		1	0		0	0	87	0		1	3.601788e-01	0	0	0	5	0	147	450
CD8B	926	broad.mit.edu	37	2	87085431	87085431	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr2:87085431C>T	ENST00000390655.6	-	2	210	c.152G>A	c.(151-153)cGc>cAc	p.R51H	CD8B_ENST00000431506.2_Intron|CD8B_ENST00000349455.3_Missense_Mutation_p.R51H|CD8B_ENST00000393761.2_Missense_Mutation_p.R51H|CD8B_ENST00000393759.2_Missense_Mutation_p.R51H|CD8B_ENST00000331469.2_Missense_Mutation_p.R51H	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	51	Ig-like V-type.				immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						CCAGTAGATGCGCATGTTACT	0.552																																						ENST00000390655.6	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				13						c.(151-153)cGc>cAc		CD8b molecule							132.0	113.0	119.0					2																	87085431		2203	4300	6503	SO:0001583	missense	926	3	121412	37				g.chr2:87085431C>T		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.152G>A	chr2.hg19:g.87085431C>T	ENSP00000375070:p.Arg51His	1					CD8B_ENST00000349455.3_Missense_Mutation_p.R51H|CD8B_ENST00000393761.2_Missense_Mutation_p.R51H|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000393759.2_Missense_Mutation_p.R51H|CD8B_ENST00000331469.2_Missense_Mutation_p.R51H	p.R51H	NM_004931.4	NP_004922.1	2	2	4	2.308637	P10966	CD8B_HUMAN		2	210	-			P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	ENST00000390655.6	1	1	hg19	c.152G>A	CCDS1997.1	1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796172	0.50208	.	.	ENSG00000172116	ENST00000393761;ENST00000393759;ENST00000349455;ENST00000331469;ENST00000390655;ENST00000445248	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	4.49	0.103	0.14526	4.49	0.103	0.14526	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.342240	0.04418	N	0.367173	T	0.63283	0.2498	N	0.08118	0	0.09310	N	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999;1.0	D;D;D;P;D;D	0.68943	0.961;0.961;0.93;0.899;0.91;0.934	T	0.56860	-0.7909	10	0.35671	T	0.21	-3.9365	7.4646	0.27314	0.0:0.3982:0.5015:0.1003	.	51;51;51;51;51;51	Q496E2;Q53QL8;P10966;P10966-3;P10966-2;P10966-6	.;.;CD8B_HUMAN;.;.;.	H	51	ENSP00000377358:R51H;ENSP00000377356:R51H;ENSP00000340592:R51H;ENSP00000331172:R51H;ENSP00000375070:R51H	ENSP00000331172:R51H	R	-	2	0	0	CD8B	86938942	86938942	0.000000	0.05858	0.001000	0.08648	0.111000	0.19643	-0.174000	0.09839	0.009000	0.14813	-0.140000	0.14226	CGC	0.799800		TCGA-FB-AAPZ-01A-11D-A40W-08	0.552	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	1	0	1		2	2	2	0		0	0	65		65	66	1	3.130000	-20.000000	1	0.680000	NM_172099			118	116		228	223	1		1	0		0	0	65	0		1	4.226639e-01	0	0	0	4	0	118	228
DNAH7	56171	broad.mit.edu	37	2	196825327	196825327	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr2:196825327G>A	ENST00000312428.6	-	18	2648	c.2548C>T	c.(2548-2550)Cgc>Tgc	p.R850C		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	850	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.R850C(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGCCTGGGGCGCAAACCAGGA	0.453																																						ENST00000312428.6	1.000000	0	1	2.000000e-02	5.000000e-02	0.251326	5.000000e-02	0.050000																										1	Substitution - Missense(1)	p.R850C(1)	prostate(1)	205						c.(2548-2550)Cgc>Tgc		dynein, axonemal, heavy chain 7							124.0	126.0	125.0					2																	196825327		1935	4131	6066	SO:0001583	missense	56171	4	120856	40				g.chr2:196825327G>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2548C>T	chr2.hg19:g.196825327G>A	ENSP00000311273:p.Arg850Cys	1						p.R850C	NM_018897.2	NP_061720.2	2	4	6	2.804002	Q8WXX0	DYH7_HUMAN		18	2648	-			B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	0	1	hg19	c.2548C>T	CCDS42794.1	0	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952760	0.53293	.	.	ENSG00000118997	ENST00000312428	T	0.63417	-0.04	5.74	5.74	0.90152	5.74	5.74	0.90152	Dynein heavy chain, domain-2 (1);	0.125121	0.53938	D	0.000044	D	0.84392	0.5462	M	0.93375	3.41	0.80722	D	1	D	0.76494	0.999	D	0.64877	0.93	D	0.87323	0.2319	10	0.59425	D	0.04	.	19.9196	0.97082	0.0:0.0:1.0:0.0	.	850	Q8WXX0	DYH7_HUMAN	C	850	ENSP00000311273:R850C	ENSP00000311273:R850C	R	-	1	0	0	DNAH7	196533572	196533572	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.626000	0.61269	2.708000	0.92522	0.650000	0.86243	CGC	0.833749		TCGA-FB-AAPZ-01A-11D-A40W-08	0.453	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	0	0	1		2	2	2	0		0	0	63		63	61	1	3.130000	-1.779367	0	0.680000	NM_018897			6	5		741	731	0		1	0		0	0	63	0		9.634199e-01	0	0	0	0	1	0	6	741
RHOA	387	broad.mit.edu	37	3	49412957	49412957	+	Silent	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr3:49412957G>A	ENST00000418115.1	-	2	450	c.66C>T	c.(64-66)ctC>ctT	p.L22L	RHOA_ENST00000422781.1_Silent_p.L22L|RHOA_ENST00000454011.2_Silent_p.L22L	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	22					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGAAGACTATGAGCAAGCATG	0.473																																						ENST00000418115.1	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	0.999961	9.900000e-01	1.000000																										0				12						c.(64-66)ctC>ctT		ras homolog family member A							148.0	133.0	138.0					3																	49412957		2203	4300	6503	SO:0001819	synonymous_variant	387	0	0					g.chr3:49412957G>A	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.66C>T	chr3.hg19:g.49412957G>A		1					RHOA_ENST00000422781.1_Silent_p.L22L|RHOA_ENST00000454011.2_Silent_p.L22L	p.L22L	NM_001664.2	NP_001655.1	0	3	3	1.696043	P61586	RHOA_HUMAN		2	450	-			P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Silent	SNP	ENST00000418115.1	1	1	hg19	c.66C>T	CCDS2795.1	1																																																																																								0.749765		TCGA-FB-AAPZ-01A-11D-A40W-08	0.473	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	1	0	1		2	2	2	0		0	0	120		120	117	1	3.130000	-13.078020	1	0.680000	NM_001664			142	142		290	288	1		1	1		0	0	120	0		1	1	0	150	0	606	0	142	290
TRAT1	50852	broad.mit.edu	37	3	108572493	108572493	+	Nonsense_Mutation	SNP	C	C	A	rs565838055	byFrequency	TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr3:108572493C>A	ENST00000295756.6	+	6	560	c.330C>A	c.(328-330)taC>taA	p.Y110*	TRAT1_ENST00000426646.1_Nonsense_Mutation_p.Y73*	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1	110					cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						AGATGTGCTACGCCTCACTTG	0.413																																						ENST00000295756.6	1.000000	4.500000e-01	1	5.200000e-01	6.100000e-01	0.687122	6.100000e-01	0.580000																										0				28						c.(328-330)taC>taA		T cell receptor associated transmembrane adaptor 1							124.0	115.0	118.0					3																	108572493		2203	4300	6503	SO:0001587	stop_gained	50852	0	0					g.chr3:108572493C>A	AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.330C>A	chr3.hg19:g.108572493C>A	ENSP00000295756:p.Tyr110*	1					TRAT1_ENST00000426646.1_Nonsense_Mutation_p.Y73*	p.Y110*	NM_016388.2	NP_057472.2	3	4	7	2.348910	Q6PIZ9	TRAT1_HUMAN		6	560	+			Q9NZX5	Nonsense_Mutation	SNP	ENST00000295756.6	0	1	hg19	c.330C>A	CCDS33813.1	0	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740523	0.30865	.	.	ENSG00000163519	ENST00000295756;ENST00000426646	.	.	.	5.63	-9.83	0.00482	5.63	-9.83	0.00482	.	0.110144	0.41001	D	0.000963	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.2088	16.9584	0.86266	0.0:0.7349:0.0:0.2651	.	.	.	.	X	110;73	.	ENSP00000295756:Y110X	Y	+	3	2	2	TRAT1	110055183	110055183	0.373000	0.25073	0.002000	0.10522	0.054000	0.15201	-0.978000	0.03778	-2.084000	0.00866	-0.140000	0.14226	TAC	0.803560		TCGA-FB-AAPZ-01A-11D-A40W-08	0.413	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353794.1	1	0	1		2	2	2	0		0	0	93		93	92	1	3.130000	-19.997640	1	0.680000	NM_016388			58	57		414	409	1		1	0		0	0	93	0		1	4.493298e-01	0	0	0	12	0	58	414
HS3ST1	9957	broad.mit.edu	37	4	11401393	11401393	+	Silent	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr4:11401393G>A	ENST00000002596.5	-	2	1411	c.237C>T	c.(235-237)gaC>gaT	p.D79D		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	79					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)	p.D79D(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						CGGCCGCCACGTCGGGGTGCA	0.662																																						ENST00000002596.5	0.180000	3.000000e-02	1.400000e-01	6.000000e-02	9.000000e-02	0.106745	9.000000e-02	0.090000																										1	Substitution - coding silent(1)	p.D79D(1)	haematopoietic_and_lymphoid_tissue(1)	15						c.(235-237)gaC>gaT		heparan sulfate (glucosamine) 3-O-sulfotransferase 1							59.0	50.0	53.0					4																	11401393		2203	4300	6503	SO:0001819	synonymous_variant	9957	1	121402	30				g.chr4:11401393G>A	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.237C>T	chr4.hg19:g.11401393G>A		1						p.D79D	NM_005114.2	NP_005105.1	1	2	3	1.953323	O14792	HS3S1_HUMAN		2	1411	-			B3KUA6|Q6PEY8	Silent	SNP	ENST00000002596.5	0	1	hg19	c.237C>T	CCDS3408.1	0																																																																																								0.761194		TCGA-FB-AAPZ-01A-11D-A40W-08	0.662	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	0	0	1		2	2	2	0		0	0	74		74	73	1	3.130000	-8.533830	1	0.680000	NM_005114			8	8		322	314	0		1	1		0	0	74	0		9.884920e-01	3.408764e-01	0	4	0	41	0	8	322
PROL1	58503	broad.mit.edu	37	4	71275677	71275677	+	Missense_Mutation	SNP	G	G	A	rs369329579		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr4:71275677G>A	ENST00000399575.2	+	3	806	c.632G>A	c.(631-633)cGt>cAt	p.R211H		NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	211	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				CTCGCCAACCGTCCTCACACA	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		18744	0.0		0.0	False		,,,				2504	0.001					ENST00000399575.2	1.000000	8.400000e-01	1	9.200000e-01	9.900000e-01	0.975066	9.900000e-01	1.000000																										0				15						c.(631-633)cGt>cAt		proline rich, lacrimal 1		C	HIS/ARG	0,4052		0,0,2026	115.0	119.0	118.0		632	1.3	0.0	4		118	2,8366		0,2,4182	no	missense	PROL1	NM_021225.4	29	0,2,6208	AA,AG,GG		0.0239,0.0,0.0161	benign	211/249	71275677	2,12418	2026	4184	6210	SO:0001583	missense	58503	17	121002	45				g.chr4:71275677G>A	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.632G>A	chr4.hg19:g.71275677G>A	ENSP00000382485:p.Arg211His	1						p.R211H	NM_021225.4	NP_067048.4	1	2	3	1.953323	Q99935	PROL1_HUMAN		3	806	+		all_hematologic(202;0.196)	A8MZ07|P85047	Missense_Mutation	SNP	ENST00000399575.2	1	1	hg19	c.632G>A	CCDS43235.1	1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361243	0.41801	0.0	2.39E-4	ENSG00000171199	ENST00000399575	T	0.42131	0.98	3.08	1.33	0.21861	3.08	1.33	0.21861	.	.	.	.	.	T	0.18718	0.0449	N	0.08118	0	0.09310	N	1	B	0.24368	0.102	B	0.08055	0.003	T	0.15206	-1.0445	9	0.44086	T	0.13	.	3.3539	0.07162	0.0:0.5226:0.2206:0.2569	.	211	Q99935	PROL1_HUMAN	H	211	ENSP00000382485:R211H	ENSP00000382485:R211H	R	+	2	0	0	PROL1	71310266	71310266	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	-0.417000	0.07088	0.045000	0.15804	-0.187000	0.12897	CGT	0.761194		TCGA-FB-AAPZ-01A-11D-A40W-08	0.448	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	0	0	1		2	2	2	0		0	0	93		93	92	1	3.130000	-3.222083	1	0.680000	NM_021225			101	99		290	284	1		1	0		0	0	93	0		1	0	0	0	0	1	0	101	290
ADAMTS19	171019	broad.mit.edu	37	5	129039960	129039960	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr5:129039960G>A	ENST00000274487.4	+	21	3315	c.3170G>A	c.(3169-3171)cGt>cAt	p.R1057H	ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1057	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAAGGCATACGTCATCGGACC	0.423																																						ENST00000274487.4	1.000000	2.100000e-01	3.600000e-01	2.500000e-01	3.000000e-01	0.330177	3.000000e-01	0.310000																										0				91						c.(3169-3171)cGt>cAt		ADAM metallopeptidase with thrombospondin type 1 motif, 19							241.0	216.0	225.0					5																	129039960		2203	4300	6503	SO:0001583	missense	171019	8	121412	44				g.chr5:129039960G>A	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3170G>A	chr5.hg19:g.129039960G>A	ENSP00000274487:p.Arg1057His	1					ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	p.R1057H	NM_133638.3	NP_598377.3	2	2	4	2.380632	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	21	3315	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)		Missense_Mutation	SNP	ENST00000274487.4	1	1	hg19	c.3170G>A	CCDS4146.1	0	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401303	0.25291	.	.	ENSG00000145808	ENST00000274487	T	0.57907	0.37	4.45	4.45	0.53987	4.45	4.45	0.53987	.	0.078589	0.51477	D	0.000088	T	0.49864	0.1582	M	0.63169	1.94	0.50813	D	0.99989	B	0.30211	0.273	B	0.23275	0.045	T	0.49428	-0.8941	9	.	.	.	.	18.3946	0.90494	0.0:0.0:1.0:0.0	.	1057	Q8TE59	ATS19_HUMAN	H	1057	ENSP00000274487:R1057H	.	R	+	2	0	0	ADAMTS19	129067859	129067859	0.988000	0.35896	0.419000	0.26584	0.023000	0.10783	3.651000	0.54431	2.758000	0.94735	0.655000	0.94253	CGT	0.806389		TCGA-FB-AAPZ-01A-11D-A40W-08	0.423	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	1	0	1		2	2	2	0		0	0	135		135	128	1	3.130000	-8.494014	1	0.680000	NM_133638			46	46		688	682	0		1			0	0	135	0		1	0	0	0	0	0	0	46	688
C5orf34	375444	broad.mit.edu	37	5	43508741	43508741	+	Nonsense_Mutation	SNP	G	G	A	rs143336043	byFrequency	TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr5:43508741G>A	ENST00000306862.2	-	3	598	c.223C>T	c.(223-225)Cga>Tga	p.R75*	RP11-159F24.3_ENST00000505645.1_RNA|RP11-159F24.6_ENST00000512498.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	75								p.R75*(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					GAAGAGTTTCGAAAATCTAGG	0.289													G|||	2	0.000399361	0.0	0.0	5008	,	,		18001	0.001		0.001	False		,,,				2504	0.0					ENST00000306862.2	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										1	Substitution - Nonsense(1)	p.R75*(1)	large_intestine(1)	21						c.(223-225)Cga>Tga		chromosome 5 open reading frame 34		G	stop/ARG	0,4406		0,0,2203	84.0	99.0	94.0		223	3.3	1.0	5	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	C5orf34	NM_198566.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		75/639	43508741	1,13005	2203	4300	6503	SO:0001587	stop_gained	375444	24	121408	47				g.chr5:43508741G>A	AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.223C>T	chr5.hg19:g.43508741G>A	ENSP00000303490:p.Arg75*	1					RP11-159F24.3_ENST00000505645.1_RNA|RP11-159F24.6_ENST00000512498.1_RNA	p.R75*	NM_198566.2	NP_940968	2	2	4	2.392500	Q96MH7	CE034_HUMAN		3	598	-	Lung NSC(6;2.07e-05)			Nonsense_Mutation	SNP	ENST00000306862.2	0	1	hg19	c.223C>T	CCDS3946.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.582089	0.97680	0.0	1.16E-4	ENSG00000172244	ENST00000306862	.	.	.	5.35	3.27	0.37495	5.35	3.27	0.37495	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7736	13.9037	0.63821	0.0:0.0:0.7113:0.2887	.	.	.	.	X	75	.	ENSP00000303490:R75X	R	-	1	2	2	C5orf34	43544498	43544498	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.350000	0.34010	1.184000	0.42957	0.655000	0.94253	CGA	0.807969		TCGA-FB-AAPZ-01A-11D-A40W-08	0.289	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253843.1	1	0	1		2	2	2	0		0	0	85		85	81	1	3.130000	-20.000000	1	0.680000	NM_198566			179	178		307	306	1		1	1		0	0	85	0		1	4.701862e-01	0	2	0	2	0	179	307
MEF2C	4208	broad.mit.edu	37	5	88027589	88027589	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr5:88027589C>T	ENST00000437473.2	-	7	1184	c.767G>A	c.(766-768)cGa>cAa	p.R256Q	MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000508569.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000514015.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000510942.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000539796.1_Missense_Mutation_p.R208Q|MEF2C_ENST00000340208.5_Missense_Mutation_p.R274Q|MEF2C_ENST00000514028.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000504921.2_Missense_Mutation_p.R256Q|MEF2C_ENST00000424173.2_Missense_Mutation_p.R254Q|MEF2C_ENST00000506554.1_Missense_Mutation_p.R256Q	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	256					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R256L(2)|p.R254L(1)		breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		AATAAGAACTCGGAGATCTGG	0.378										HNSCC(66;0.2)																												ENST00000437473.2	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										3	Substitution - Missense(3)	p.R256L(2)|p.R254L(1)	lung(3)	40						c.(766-768)cGa>cAa		myocyte enhancer factor 2C							112.0	106.0	108.0					5																	88027589		1843	4083	5926	SO:0001583	missense	4208	0	0					g.chr5:88027589C>T	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.767G>A	chr5.hg19:g.88027589C>T	ENSP00000396219:p.Arg256Gln	1	HNSCC(66;0.2)				MEF2C_ENST00000510942.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000504921.2_Missense_Mutation_p.R256Q|MEF2C_ENST00000340208.5_Missense_Mutation_p.R274Q|MEF2C_ENST00000508569.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000514028.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000539796.1_Missense_Mutation_p.R208Q|MEF2C_ENST00000424173.2_Missense_Mutation_p.R254Q|MEF2C_ENST00000514015.1_Missense_Mutation_p.R256Q|MEF2C_ENST00000506554.1_Missense_Mutation_p.R256Q	p.R256Q	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	2	2	4	2.338893	Q06413	MEF2C_HUMAN		7	1184	-		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)	C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	1	1	hg19	c.767G>A	CCDS47245.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.088843	0.97271	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000539796	T;T;T;T;T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.66056	0.2751	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.994;0.998;0.974;0.999	T	0.67465	-0.5664	10	0.87932	D	0	-4.0687	20.5666	0.99351	0.0:1.0:0.0:0.0	.	254;274;256;256	C9JMZ0;F8W7V7;Q06413;Q06413-2	.;.;MEF2C_HUMAN;.	Q	274;254;256;256;256;256;256;256;256;208	ENSP00000340874:R274Q;ENSP00000389610:R254Q;ENSP00000421925:R256Q;ENSP00000426665:R256Q;ENSP00000396219:R256Q;ENSP00000422390:R256Q;ENSP00000425636:R256Q;ENSP00000423597:R256Q;ENSP00000424606:R256Q;ENSP00000441153:R208Q	ENSP00000340874:R274Q	R	-	2	0	0	MEF2C	88063345	88063345	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.854000	0.98071	0.655000	0.94253	CGA	0.802323		TCGA-FB-AAPZ-01A-11D-A40W-08	0.378	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	1	0	1		2	2	2	0		0	0	41		41	41	1	3.130000	-12.800020	1	0.680000	NM_002397			88	85		144	144	1		1	0		0	0	41	0		1	8.102472e-01	0	0	0	7	0	88	144
KCTD16	57528	broad.mit.edu	37	5	143853641	143853641	+	Silent	SNP	T	T	C			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr5:143853641T>C	ENST00000507359.3	+	3	2342	c.1251T>C	c.(1249-1251)ccT>ccC	p.P417P	KCTD16_ENST00000512467.1_Silent_p.P417P	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	417					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GAAAACATCCTTGGCAATCTG	0.378																																						ENST00000507359.3	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				21						c.(1249-1251)ccT>ccC		potassium channel tetramerization domain containing 16							48.0	56.0	54.0					5																	143853641		2191	4296	6487	SO:0001819	synonymous_variant	57528	0	0					g.chr5:143853641T>C	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1251T>C	chr5.hg19:g.143853641T>C		1					KCTD16_ENST00000512467.1_Silent_p.P417P	p.P417P	NM_020768.3	NP_065819.1	3	4	7	2.282443	Q68DU8	KCD16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)	3	2342	+		all_hematologic(541;0.118)	Q9P2M9	Silent	SNP	ENST00000507359.3	1	1	hg19	c.1251T>C	CCDS34260.1	1																																																																																								0.797212		TCGA-FB-AAPZ-01A-11D-A40W-08	0.378	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	1	0	1		2	2	2	0		0	0	75		75	73	1	3.130000	-20.000000	1	0.680000	XM_098368			169	168		331	322	1		1			0	0	75	0		1	0	0	0	0	0	0	169	331
ENPP4	22875	broad.mit.edu	37	6	46108833	46108833	+	Missense_Mutation	SNP	A	A	C	rs201266533		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr6:46108833A>C	ENST00000321037.4	+	3	1101	c.871A>C	c.(871-873)Atg>Ctg	p.M291L		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	291					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						TAGCCCTCATATGAATGTTTA	0.323																																						ENST00000321037.4	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																										0				18						c.(871-873)Atg>Ctg		ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)							61.0	59.0	60.0					6																	46108833		2202	4297	6499	SO:0001583	missense	22875	0	0					g.chr6:46108833A>C	AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.871A>C	chr6.hg19:g.46108833A>C	ENSP00000318066:p.Met291Leu	1						p.M291L	NM_014936.4	NP_055751.1	2	3	5	2.245979	Q9Y6X5	ENPP4_HUMAN		3	1101	+			A8K5G1|Q7L2N1	Missense_Mutation	SNP	ENST00000321037.4	1	1	hg19	c.871A>C	CCDS34468.1	1	.	.	.	.	.	.	.	.	.	.	A	9.051	0.992094	0.18966	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.74002	-0.8	6.16	0.723	0.18231	6.16	0.723	0.18231	Alkaline-phosphatase-like, core domain (1);	0.189676	0.64402	N	0.000004	T	0.28830	0.0715	N	0.16307	0.4	0.49798	D	0.999825	B	0.11235	0.004	B	0.17979	0.02	T	0.38542	-0.9656	10	0.02654	T	1	-10.9395	9.624	0.39739	0.5348:0.3528:0.0:0.1124	.	291	Q9Y6X5	ENPP4_HUMAN	L	291	ENSP00000318066:M291L	ENSP00000318066:M291L	M	+	1	0	0	ENPP4	46216792	46216792	1.000000	0.71417	0.996000	0.52242	0.785000	0.44390	2.205000	0.42770	-0.084000	0.12595	0.528000	0.53228	ATG	0.793655		TCGA-FB-AAPZ-01A-11D-A40W-08	0.323	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040777.2	1	0	1		2	2	2	0		0	0	93		93	92	1	3.130000	-20.000000	1	0.680000				137	134		303	300	1		1	0		0	0	93	0		1	8.995325e-01	0	0	0	11	0	137	303
IYD	389434	broad.mit.edu	37	6	150715311	150715311	+	Missense_Mutation	SNP	G	G	A	rs377381152		TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr6:150715311G>A	ENST00000344419.3	+	4	747	c.607G>A	c.(607-609)Gca>Aca	p.A203T	IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T|IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	203					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TGGTTTCGCCGCAAATGGCAA	0.433																																						ENST00000344419.3	0.100000	1.000000e-02	8.000000e-02	2.000000e-02	4.000000e-02	0.056024	4.000000e-02	0.050000																										0				15						c.(607-609)Gca>Aca		iodotyrosine deiodinase		A	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	122.0	109.0	113.0		607,607,607	2.1	0.0	6		113	0,8600		0,0,4300	no	missense,missense,missense	IYD	NM_001164694.1,NM_001164695.1,NM_203395.2	58,58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	203/294,203/248,203/290	150715311	1,13005	2203	4300	6503	SO:0001583	missense	389434	3	121412	38				g.chr6:150715311G>A	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.607G>A	chr6.hg19:g.150715311G>A	ENSP00000343763:p.Ala203Thr	1					IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T|IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T	p.A203T	NM_203395.2	NP_981932.1	0	2	2	1.519410	Q6PHW0	IYD1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.215)	4	747	+		Ovarian(120;0.028)	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	0	1	hg19	c.607G>A	CCDS5227.1	0	.	.	.	.	.	.	.	.	.	.	g	5.689	0.311597	0.10789	2.27E-4	0.0	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320;ENST00000425615	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	6.17	2.1	0.27182	6.17	2.1	0.27182	Nitroreductase-like (3);	0.509560	0.22264	N	0.062376	T	0.43055	0.1230	L	0.46885	1.475	0.09310	N	1	B;B;B;B	0.20261	0.004;0.043;0.001;0.002	B;B;B;B	0.18561	0.003;0.022;0.001;0.005	T	0.24548	-1.0157	10	0.27785	T	0.31	-23.7178	1.2452	0.01971	0.2372:0.2256:0.3896:0.1475	.	121;203;203;203	Q2VPV9;C9JFW2;Q6PHW0-3;Q6PHW0	.;.;.;IYD1_HUMAN	T	203;203;203;203;203;148	ENSP00000229447:A203T;ENSP00000343763:A203T;ENSP00000376085:A203T;ENSP00000376084:A203T;ENSP00000441276:A203T;ENSP00000390081:A148T	ENSP00000229447:A203T	A	+	1	0	0	IYD	150757004	150757004	0.019000	0.18553	0.001000	0.08648	0.174000	0.22865	0.255000	0.18333	0.496000	0.27904	-0.119000	0.15052	GCA	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.433	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	0	0	1		2	2	2	0		0	0	96		96	95	1	3.130000	-1.992233	0	0.680000	NM_203395			6	6		359	358	0		1	0		0	0	96	0		9.649964e-01	4.146428e-04	0	0	0	2	0	6	359
SEPT7	989	broad.mit.edu	37	7	35923505	35923505	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr7:35923505G>A	ENST00000435235.1	+	8	1001	c.569G>A	c.(568-570)cGt>cAt	p.R190H	SEPT7_ENST00000350320.6_Missense_Mutation_p.R242H|SEPT7_ENST00000494488.2_Missense_Mutation_p.R229H|SEPT7_ENST00000469679.2_Intron|SEPT7_ENST00000399034.2_Missense_Mutation_p.R244H|SEPT7_ENST00000399035.3_Missense_Mutation_p.R242H|SEPT7_ENST00000432293.2_Intron			Q16181	SEPT7_HUMAN	septin 7	243	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						TTATAGGACCGTTTACCTCTT	0.358																																						ENST00000435235.1	1.000000	1.300000e-01	1	1.900000e-01	2.700000e-01	0.425362	2.700000e-01	0.230000																										0				14						c.(568-570)cGt>cAt		septin 7							133.0	121.0	125.0					7																	35923505		1824	4077	5901	SO:0001583	missense	989	0	0					g.chr7:35923505G>A	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.569G>A	chr7.hg19:g.35923505G>A	ENSP00000413507:p.Arg190His	1					SEPT7_ENST00000494488.2_Missense_Mutation_p.R229H|SEPT7_ENST00000350320.6_Missense_Mutation_p.R242H|SEPT7_ENST00000399035.3_Missense_Mutation_p.R242H|SEPT7_ENST00000469679.2_Intron|SEPT7_ENST00000399034.2_Missense_Mutation_p.R244H|SEPT7_ENST00000432293.2_Intron	p.R190H			3	3	6	2.684319	Q16181	SEPT7_HUMAN		8	1001	+			Q52M76|Q6NX50	Missense_Mutation	SNP	ENST00000435235.1	1	1	hg19	c.569G>A		0	.	.	.	.	.	.	.	.	.	.	G	15.05	2.716738	0.48622	.	.	ENSG00000122545	ENST00000435235;ENST00000399034;ENST00000350320;ENST00000399035;ENST00000537785;ENST00000493670;ENST00000494488	T;T;T;T;T	0.79749	-1.3;1.4;1.4;1.4;1.4	4.88	4.88	0.63580	4.88	4.88	0.63580	.	0.243404	0.30890	U	0.008678	T	0.72447	0.3461	L	0.37800	1.135	0.80722	D	1	B;B;B	0.16166	0.01;0.016;0.016	B;B;B	0.19391	0.024;0.025;0.025	T	0.67329	-0.5698	10	0.08599	T	0.76	.	18.4417	0.90669	0.0:0.0:1.0:0.0	.	188;242;243	B4DNE4;E7EPK1;Q16181	.;.;SEPT7_HUMAN	H	190;244;242;242;188;190;229	ENSP00000413507:R190H;ENSP00000381992:R244H;ENSP00000344868:R242H;ENSP00000381993:R242H;ENSP00000438395:R229H	ENSP00000344868:R242H	R	+	2	0	0	SEPT7	35890030	35890030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.596000	0.82721	2.422000	0.82143	0.558000	0.71614	CGT	0.827660		TCGA-FB-AAPZ-01A-11D-A40W-08	0.358	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	1	0	1		2	2	2	0		0	0	41		41	40	1	3.130000	-14.409580	1	0.680000	NM_001788			13	13		281	278	0		1	1		0	0	41	0		9.995338e-01	9.395397e-01	0	2	0	104	0	13	281
PKD1L1	168507	broad.mit.edu	37	7	47933504	47933504	+	Silent	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr7:47933504G>A	ENST00000289672.2	-	15	2474	c.2424C>T	c.(2422-2424)ttC>ttT	p.F808F		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	808	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CGTCAGGGTCGAAGGACTGGG	0.617																																						ENST00000289672.2	1.000000	9.900000e-01	1	9.900000e-01	9.900000e-01	1.000000	9.900000e-01	1.000000																									BBS9/PKD1L1(2)	0				142						c.(2422-2424)ttC>ttT		polycystic kidney disease 1 like 1							60.0	44.0	50.0					7																	47933504		2203	4300	6503	SO:0001819	synonymous_variant	168507	4	121412	34				g.chr7:47933504G>A	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2424C>T	chr7.hg19:g.47933504G>A		1						p.F808F	NM_138295.3	NP_612152.1	3	3	6	2.674979	Q8TDX9	PK1L1_HUMAN		15	2474	-			Q6UWK1	Silent	SNP	ENST00000289672.2	1	1	hg19	c.2424C>T	CCDS34633.1	1																																																																																								0.827660		TCGA-FB-AAPZ-01A-11D-A40W-08	0.617	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	1	0	1		2	2	2	0		0	0	22		22	22	1	3.130000	-20.000000	1	0.680000	NM_138295			57	56		91	89	0		1			0	0	22	0		1	0	0	0	0	0	0	57	91
SUMF2	25870	broad.mit.edu	37	7	56142409	56142409	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr7:56142409C>T	ENST00000413756.1	+	5	538	c.515C>T	c.(514-516)gCc>gTc	p.A172V	SUMF2_ENST00000434526.2_Missense_Mutation_p.A191V|SUMF2_ENST00000275607.9_Missense_Mutation_p.A84V|SUMF2_ENST00000342190.6_Missense_Mutation_p.A191V|SUMF2_ENST00000437307.2_Intron|SUMF2_ENST00000395435.2_Intron|SUMF2_ENST00000395436.2_Missense_Mutation_p.A176V			Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2	172					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	14	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGGGAGTTTGCCGCCCGAGGG	0.567											OREG0018081	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000413756.1	1.000000	0	1	2.000000e-02	5.000000e-02	0.266377	5.000000e-02	0.050000																										0				14						c.(514-516)gCc>gTc		sulfatase modifying factor 2							80.0	82.0	81.0					7																	56142409		2203	4300	6503	SO:0001583	missense	25870	0	0					g.chr7:56142409C>T	AK075477	CCDS5524.2, CCDS43588.2, CCDS43589.2, CCDS47589.1, CCDS55111.1	7q11.1	2004-04-30			ENSG00000129103	ENSG00000129103			20415	protein-coding gene	gene with protein product		607940				12757706	Standard	NM_015411		Approved	DKFZp566I1024	uc003trv.3	Q8NBJ7	OTTHUMG00000129373	ENST00000413756.1:c.515C>T	chr7.hg19:g.56142409C>T	ENSP00000406445:p.Ala172Val	1		OREG0018081	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1013	SUMF2_ENST00000434526.2_Missense_Mutation_p.A191V|SUMF2_ENST00000437307.2_Intron|SUMF2_ENST00000395435.2_Intron|SUMF2_ENST00000395436.2_Missense_Mutation_p.A176V|SUMF2_ENST00000342190.6_Missense_Mutation_p.A191V|SUMF2_ENST00000275607.9_Missense_Mutation_p.A84V	p.A172V			3	3	6	2.674979	Q8NBJ7	SUMF2_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)	5	538	+	Breast(14;0.214)		B4DU41|B4DWQ0|Q14DW5|Q53ZE3|Q96BH2|Q9BRN3|Q9BWI1|Q9Y405	Missense_Mutation	SNP	ENST00000413756.1	0	1	hg19	c.515C>T		0	.	.	.	.	.	.	.	.	.	.	C	36	5.686691	0.96784	.	.	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000275607;ENST00000413952;ENST00000342190;ENST00000413756;ENST00000451338	D;D;D;D;D;D;D	0.98968	-5.28;-5.28;-5.28;-5.28;-5.28;-5.28;-5.28	5.53	5.53	0.82687	5.53	5.53	0.82687	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.000000	0.85682	D	0.000000	D	0.99309	0.9758	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.951	D	0.99226	1.0880	10	0.87932	D	0	-11.665	18.8414	0.92186	0.0:1.0:0.0:0.0	.	176;172;191	A8MXB9;Q8NBJ7;F8WA42	.;SUMF2_HUMAN;.	V	176;191;84;194;191;172;189	ENSP00000378824:A176V;ENSP00000400922:A191V;ENSP00000275607:A84V;ENSP00000414434:A194V;ENSP00000341938:A191V;ENSP00000406445:A172V;ENSP00000410796:A189V	ENSP00000275607:A84V	A	+	2	0	0	SUMF2	56109903	56109903	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.607000	0.82883	2.777000	0.95525	0.591000	0.81541	GCC	0.827660		TCGA-FB-AAPZ-01A-11D-A40W-08	0.567	SUMF2-013	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000341457.2	0	0	1		2	2	2	0		0	0	85		85	0	1	3.130000	-1.901312	0	0.680000	NM_015411			6	0		694	0	0			0		0	0	85	0		0	4.302332e-01	0	0	0	152	0	6	694
ADAM28	10863	broad.mit.edu	37	8	24193065	24193065	+	Missense_Mutation	SNP	A	A	G	rs7001647	byFrequency	TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chr8:24193065A>G	ENST00000265769.4	+	14	1588	c.1478A>G	c.(1477-1479)aAt>aGt	p.N493S	ADAM28_ENST00000540823.1_Missense_Mutation_p.N260S|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.N493S|ADAM28_ENST00000397649.3_Missense_Mutation_p.N240S|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	493	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.		N -> S (in dbSNP:rs7001647).		spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TTCCAAGTCAATGGCTTCCCT	0.532													A|||	80	0.0159744	0.0598	0.0014	5008	,	,		17260	0.0		0.0	False		,,,				2504	0.0				NSCLC(193;488 2149 22258 34798 40734)	ENST00000265769.4	0.830000	3.400000e-01	7.000000e-01	4.400000e-01	5.600000e-01	0.577463	5.600000e-01	0.560000																										0				42						c.(1477-1479)aAt>aGt		ADAM metallopeptidase domain 28		A	SER/ASN,SER/ASN	182,4224	118.0+/-155.7	6,170,2027	122.0	111.0	115.0		1478,1478	5.7	1.0	8	dbSNP_116	115	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ADAM28	NM_014265.4,NM_021777.3	46,46	6,171,6326	GG,GA,AA		0.0116,4.1307,1.407	probably-damaging,probably-damaging	493/776,493/541	24193065	183,12823	2203	4300	6503	SO:0001583	missense	10863	533	121406	58				g.chr8:24193065A>G	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1478A>G	chr8.hg19:g.24193065A>G	ENSP00000265769:p.Asn493Ser	1					RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.N240S|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.N493S|ADAM28_ENST00000540823.1_Missense_Mutation_p.N260S	p.N493S	NM_014265.4	NP_055080.2	0	2	2	1.484975	Q9UKQ2	ADA28_HUMAN		14	1588	+		Prostate(55;0.0959)	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	1	0	hg19	c.1478A>G	CCDS34865.1	0	31	0.014194139194139194	31	0.06300813008130081	0	0.0	0	0.0	0	0.0	A	16.74	3.208031	0.58343	0.041307	1.16E-4	ENSG00000042980	ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	5.69	5.69	0.88448	5.69	5.69	0.88448	ADAM, cysteine-rich (2);Blood coagulation inhibitor, Disintegrin (1);	.	.	.	.	T	0.13713	0.0332	M	0.90650	3.135	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.51317	-0.8721	9	0.87932	D	0	.	13.8927	0.63750	1.0:0.0:0.0:0.0	rs7001647;rs52800840;rs7001647	260;493;493;493	B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2	.;.;ADA28_HUMAN;.	S	493;240;260;493	ENSP00000265769:N493S;ENSP00000380770:N240S;ENSP00000443743:N260S;ENSP00000393699:N493S	ENSP00000265769:N493S	N	+	2	0	0	ADAM28	24249010	24249010	1.000000	0.71417	0.998000	0.56505	0.207000	0.24258	7.932000	0.87634	2.156000	0.67533	0.528000	0.53228	AAT	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.532	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	1	0	1		2	2	2	0		0	0	29		29	29	1	3.130000	-2.298601	0	0.680000	NM_021778			15	15		64	64	1		1	0		0	0	29	0		9.999274e-01	9.526916e-01	0	0	0	25	0	15	64
CYBB	1536	broad.mit.edu	37	X	37653065	37653065	+	Splice_Site	SNP	T	T	C			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chrX:37653065T>C	ENST00000378588.4	+	5	550		c.e5+2		TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Splice_Site|CYBB_ENST00000536160.1_Intron	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	AGAATAAAGGTAAGCCTCTCA	0.373																																						ENST00000378588.4	0.270000	1.300000e-01	2.400000e-01	1.600000e-01	1.900000e-01	0.201063	1.900000e-01	0.200000																										0				32	GRCh37	CS961541	CYBB	S		c.e5+2		cytochrome b-245, beta polypeptide	Dextromethorphan(DB00514)						77.0	68.0	71.0					X																	37653065		2201	4300	6501	SO:0001630	splice_region_variant	1536	0	0					g.chrX:37653065T>C	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.483+2T>C	chrX.hg19:g.37653065T>C							CYBB_ENST00000536160.1_Intron|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Splice_Site		NM_000397.3	NP_000388.2	0	1	1		P04839	CY24B_HUMAN		5	550	+			A8K138|Q2PP16	Splice_Site	SNP	ENST00000378588.4	1	1	hg19		CCDS14242.1	0	.	.	.	.	.	.	.	.	.	.	T	17.31	3.357925	0.61403	.	.	ENSG00000165168	ENST00000378588;ENST00000545017	.	.	.	5.67	5.67	0.87782	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9689	0.71217	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	CYBB	37538005	37538005	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	4.466000	0.60148	1.917000	0.55516	0.483000	0.47432	.	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.373	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1	1	0	1		2	2	2	0		0	0	45		45	42	1	3.130000	-20.000000	1	0.680000		Intron		26	26		169	166	1		1			0	0	45	0		9.999999e-01	0	0	0	0	0	0	26	169
ZIC3	7547	broad.mit.edu	37	X	136651124	136651124	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAPZ-01A-11D-A40W-08	TCGA-FB-AAPZ-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2feaf6e8-f76a-4c02-9536-689e3ad149de	3b27aea6-7bdb-48d4-9fef-c5748fef457d	g.chrX:136651124G>A	ENST00000287538.5	+	2	1674	c.1124G>A	c.(1123-1125)cGt>cAt	p.R375H	ZIC3_ENST00000478471.1_3'UTR|ZIC3_ENST00000370606.3_Missense_Mutation_p.R375H	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	375					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					AGCAGCGACCGTAAGAAGCAC	0.502																																						ENST00000287538.5	0.020000	0	2.000000e-02	0	0	0.011765	0	0.010000																										0				37						c.(1123-1125)cGt>cAt		Zic family member 3							211.0	184.0	193.0					X																	136651124		2203	4300	6503	SO:0001583	missense	7547	0	0					g.chrX:136651124G>A	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.1124G>A	chrX.hg19:g.136651124G>A	ENSP00000287538:p.Arg375His						ZIC3_ENST00000478471.1_3'UTR|ZIC3_ENST00000370606.3_Missense_Mutation_p.R375H	p.R375H	NM_003413.3	NP_003404.1	0	1	1		O60481	ZIC3_HUMAN		2	1674	+	Acute lymphoblastic leukemia(192;0.000127)		B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	0	1	hg19	c.1124G>A	CCDS14663.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.308427	0.95629	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.07567	3.18;3.18	5.74	5.74	0.90152	5.74	5.74	0.90152	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00316	-1.1823	10	0.87932	D	0	.	17.7298	0.88374	0.0:0.0:1.0:0.0	.	375	O60481	ZIC3_HUMAN	H	375	ENSP00000287538:R375H;ENSP00000359638:R375H	ENSP00000287538:R375H	R	+	2	0	0	ZIC3	136478790	136478790	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.796000	0.99103	2.405000	0.81733	0.600000	0.82982	CGT	0.680000		TCGA-FB-AAPZ-01A-11D-A40W-08	0.502	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1	0	0	1		2	2	2	0		0	0	142		142	140	1	3.130000	-2.331330	0	0.680000				6	5		839	836	0		1			0	0	142	0		9.645181e-01	0	0	0	0	0	0	6	839
