#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PUS3	83480	broad.mit.edu	37	11	125763815	125763816	+	Frame_Shift_Ins	INS	-	-	TCAA			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			-	TCAA	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr11:125763815_125763816insTCAA	ENST00000530811.1	-	3	1355_1356	c.1310_1311insTTGA	c.(1309-1311)gagfs	p.E437fs	HYLS1_ENST00000425380.2_Intron|PUS3_ENST00000227474.3_Frame_Shift_Ins_p.E437fs|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000356438.3_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	437					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		AATGTGGGTGCTCAATTCGTCC	0.465																																						ENST00000530811.1	1.000000	5.500000e-01	6.800000e-01	5.800000e-01	0.620000	0.661175	0.620000	0.620000																										0				10						c.(1309-1311)gagfs		pseudouridylate synthase 3																																				SO:0001589	frameshift_variant	83480	0	0					g.chr11:125763815_125763816insTCAA	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.1307_1310dupTTGA	chr11.hg19:g.125763816_125763819dupTCAA	ENSP00000432386:p.Glu437fs	0					HYLS1_ENST00000356438.3_Intron|PUS3_ENST00000227474.3_Frame_Shift_Ins_p.E437fs|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000425380.2_Intron	p.E437fs			1	2	3	2.189883	Q9BZE2	PUS3_HUMAN		3	1355_1356	-	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)	B2RAM0|Q96D17|Q96J23|Q96NB4	Frame_Shift_Ins	INS	ENST00000530811.1	0	1	hg19	c.1310_1311insTTGA	CCDS8466.1	0																																																																																								0.682753		TCGA-FB-AAQ0-01A-31D-A40W-08	0.465	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	1	0	1		2	2		0		0	0	190		190	185	1	1.880000	-20.000000	1	0.670000	NM_031307			240	275		955	961	0		1	0	0	0	0	190	0		1.000000	9.999863e-01	0	0	0	64	0	240	955
ZNF485	220992	broad.mit.edu	37	10	44104721	44104721	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr10:44104721C>A	ENST00000361807.3	+	4	364	c.170C>A	c.(169-171)cCa>cAa	p.P57Q	ZNF485_ENST00000374435.3_Missense_Mutation_p.P57Q|ZNF485_ENST00000374437.2_Intron	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	57	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						TCTTCCAAACCAAAACTAATT	0.468																																						ENST00000361807.3	1.000000	1.000000e-02	1	4.000000e-02	0.070000	0.232270	0.070000	0.060000																										0				16						c.(169-171)cCa>cAa		zinc finger protein 485							48.0	46.0	47.0					10																	44104721		2203	4300	6503	SO:0001583	missense	220992	0	0					g.chr10:44104721C>A	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.170C>A	chr10.hg19:g.44104721C>A	ENSP00000354694:p.Pro57Gln	1					ZNF485_ENST00000374435.3_Missense_Mutation_p.P57Q|ZNF485_ENST00000374437.2_Intron	p.P57Q	NM_145312.3	NP_660355.2	0	2	2	2.035076	Q8NCK3	ZN485_HUMAN		4	364	+			B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	0	1	hg19	c.170C>A	CCDS7205.2	0	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980972	0.34942	.	.	ENSG00000198298	ENST00000361807;ENST00000430885;ENST00000374435	T;T;T	0.00986	5.47;5.47;5.47	3.04	2.11	0.27256	3.040000	2.110000	0.272560	Krueppel-associated box (3);	.	.	.	.	T	0.01695	0.0054	M	0.76328	2.33	0.80722	D	1	B	0.31548	0.328	B	0.34138	0.176	T	0.53732	-0.8397	9	0.52906	T	0.07	.	7.8094	0.29221	0.0:0.8675:0.0:0.1325	.	57	Q8NCK3	ZN485_HUMAN	Q	57	ENSP00000354694:P57Q;ENSP00000393570:P57Q;ENSP00000363558:P57Q	ENSP00000354694:P57Q	P	+	2	0	0	ZNF485	43424727	43424727	0.395000	0.25254	0.629000	0.29254	0.510000	0.34073	0.455000	0.21843	0.599000	0.29845	0.455000	0.32223	CCA	0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.468	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	0	0	1		2	2	2	0		0	0	32		32	32	1	1.880000	-5.859047	1	0.670000	NM_145312			4	4		189	185	0		1	0		0	0	32	0		0.886262	7.849294e-04	0	0	0	2	0	4	189
PPP1R3C	5507	broad.mit.edu	37	10	93389939	93389939	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr10:93389939C>G	ENST00000238994.5	-	2	783	c.699G>C	c.(697-699)gaG>gaC	p.E233D		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C											breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				AAATGCAGAACTCAATTTTCT	0.408																																						ENST00000238994.5	1.000000	2.000000e-02	1	3.000000e-02	0.050000	0.228820	0.050000	0.060000																										0				12						c.(697-699)gaG>gaC		protein phosphatase 1, regulatory subunit 3C							98.0	91.0	93.0					10																	93389939		2203	4300	6503	SO:0001583	missense	5507	0	0					g.chr10:93389939C>G	Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.699G>C	chr10.hg19:g.93389939C>G	ENSP00000238994:p.Glu233Asp	1						p.E233D	NM_005398.5	NP_005389.1	0	2	2	2.060687				2	783	-		Colorectal(252;0.235)		Missense_Mutation	SNP	ENST00000238994.5	0	1	hg19	c.699G>C	CCDS7416.1	0	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493100	0.64186	.	.	ENSG00000119938	ENST00000238994;ENST00000438999;ENST00000500094	T	0.65916	-0.18	5.73	4.82	0.62117	5.730000	4.820000	0.621170	Putative phosphatase regulatory subunit (2);	0.054846	0.64402	D	0.000001	T	0.78641	0.4315	M	0.87097	2.86	0.58432	D	0.999993	D	0.71674	0.998	D	0.87578	0.998	T	0.79315	-0.1854	10	0.48119	T	0.1	-33.3203	8.699	0.34314	0.0:0.7879:0.0:0.2121	.	233	Q9UQK1	PPR3C_HUMAN	D	233;213;115	ENSP00000238994:E233D	ENSP00000238994:E233D	E	-	3	2	2	PPP1R3C	93379919	93379919	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.666000	0.25097	2.699000	0.92147	0.655000	0.94253	GAG	0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.408	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049372.1	0	0	1		2	2	2	0		0	0	112		112	112	1	1.880000	-7.984646	1	0.670000	NM_005398			9	9		484	480	0		1	0		0	0	112	0		0.994086	2.602478e-03	0	0	0	4	0	9	484
DYNC2H1	79659	broad.mit.edu	37	11	103057008	103057008	+	Missense_Mutation	SNP	A	A	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr11:103057008A>T	ENST00000375735.2	+	42	6815	c.6671A>T	c.(6670-6672)cAc>cTc	p.H2224L	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.H2224L|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2224					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCAGACTTTCACAAACCTATG	0.393																																						ENST00000375735.2	1.000000	2.000000e-02	1.600000e-01	5.000000e-02	0.090000	0.182955	0.090000	0.080000																										0				33						c.(6670-6672)cAc>cTc		dynein, cytoplasmic 2, heavy chain 1							75.0	66.0	69.0					11																	103057008		1827	4087	5914	SO:0001583	missense	79659	1	120756	28				g.chr11:103057008A>T	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.6671A>T	chr11.hg19:g.103057008A>T	ENSP00000364887:p.His2224Leu	0					DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.H2224L	p.H2224L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	1	2	3	2.189883	Q8NCM8	DYHC2_HUMAN		42	6815	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	0	1	hg19	c.6671A>T	CCDS53701.1	0	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821861	0.32237	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.26660	1.72;1.72	5.61	5.61	0.85477	5.610000	5.610000	0.854770	.	.	.	.	.	T	0.21921	0.0528	L	0.44542	1.39	0.30300	N	0.789519	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.08351	-1.0726	9	0.41790	T	0.15	.	7.9822	0.30190	0.8427:0.0:0.1573:0.0	.	2224;2224	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	2224	ENSP00000364887:H2224L;ENSP00000381167:H2224L	ENSP00000364887:H2224L	H	+	2	0	0	DYNC2H1	102562218	102562218	0.999000	0.42202	0.999000	0.59377	0.965000	0.64279	3.816000	0.55658	2.127000	0.65507	0.454000	0.30748	CAC	0.682753		TCGA-FB-AAQ0-01A-31D-A40W-08	0.393	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	0	0	1		2	2	2	0		0	0	40		40	39	1	1.880000	-6.582075	1	0.670000	XM_370652			4	4		156	155	0		1	0		0	0	40	0		0.889897	2.070018e-02	0	0	0	7	0	4	156
DCDC1	341019	broad.mit.edu	37	11	30926703	30926703	+	Missense_Mutation	SNP	C	C	A	rs553034789		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr11:30926703C>A	ENST00000597505.1	-	29	4112	c.4113G>T	c.(4111-4113)ttG>ttT	p.L1371F	DCDC1_ENST00000339794.5_Missense_Mutation_p.L450F|DCDC1_ENST00000406071.2_Missense_Mutation_p.L106F			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TGTCACACGACAAATCAACCt	0.363																																						ENST00000597505.1	1.000000	7.200000e-01	1	8.800000e-01	0.990000	0.960066	0.990000	1.000000																										0				31						c.(4111-4113)ttG>ttT		doublecortin domain containing 1							64.0	60.0	61.0					11																	30926703		2199	4298	6497	SO:0001583	missense	341019	0	0					g.chr11:30926703C>A	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4113G>T	chr11.hg19:g.30926703C>A	ENSP00000472625:p.Leu1371Phe	0					DCDC1_ENST00000406071.2_Missense_Mutation_p.L106F|DCDC1_ENST00000339794.5_Missense_Mutation_p.L450F	p.L1371F			1	2	3	2.184340	P59894	DCDC1_HUMAN		29	4112	-	Lung SC(675;0.225)		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	0	1	hg19	c.4113G>T		1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016517	0.35606	.	.	ENSG00000170959	ENST00000406071;ENST00000339794	.	.	.	5.31	4.12	0.48240	5.310000	4.120000	0.482400	.	0.000000	0.43110	D	0.000601	T	0.63733	0.2536	M	0.71581	2.175	0.26273	N	0.978396	D	0.89917	1.0	D	0.83275	0.996	T	0.56171	-0.8023	8	.	.	.	-8.0964	8.7935	0.34866	0.0:0.0887:0.0:0.9113	.	450	Q6ZRR9	DCDC5_HUMAN	F	106;450	.	.	L	-	3	2	2	DCDC5	30883279	30883279	1.000000	0.71417	0.996000	0.52242	0.026000	0.11368	1.008000	0.29872	0.844000	0.35094	-0.290000	0.09829	TTG	0.679658		TCGA-FB-AAQ0-01A-31D-A40W-08	0.363	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	0	0	1		2	2	2	0		0	0	9		9	9	1	1.880000	-20.000000	1	0.670000	NM_181807			22	20		42	41	0		1			0	0	9	0		1.000000	0	0	0	0	0	0	22	42
PPP2R1B	5519	broad.mit.edu	37	11	111626165	111626165	+	Missense_Mutation	SNP	G	G	A	rs376765814	byFrequency	TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr11:111626165G>A	ENST00000527614.1	-	6	762	c.697C>T	c.(697-699)Cgc>Tgc	p.R233C	PPP2R1B_ENST00000426998.2_Missense_Mutation_p.R169C|PPP2R1B_ENST00000427203.2_Missense_Mutation_p.R72C|PPP2R1B_ENST00000393055.2_Missense_Mutation_p.R106C|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.R233C|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.R233C	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	233					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GCAAGGAGGCGCACTGAATCC	0.448													G|||	2	0.000399361	0.0	0.0	5008	,	,		16535	0.002		0.0	False		,,,				2504	0.0					ENST00000527614.1	1.000000	3.100000e-01	5.500000e-01	3.700000e-01	0.440000	0.496621	0.440000	0.430000																										0				22						c.(697-699)Cgc>Tgc		protein phosphatase 2, regulatory subunit A, beta		G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	2,4400	4.2+/-10.8	0,2,2199	87.0	68.0	74.0		697,316,697,697,505	5.5	1.0	11		74	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense,missense,missense,missense	PPP2R1B	NM_001177562.1,NM_001177563.1,NM_002716.4,NM_181699.2,NM_181700.1	180,180,180,180,180	0,3,6495	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	233/557,106/475,233/602,233/668,169/604	111626165	3,12993	2201	4297	6498	SO:0001583	missense	5519	7	121410	40				g.chr11:111626165G>A	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.697C>T	chr11.hg19:g.111626165G>A	ENSP00000437193:p.Arg233Cys	0					PPP2R1B_ENST00000393055.2_Missense_Mutation_p.R106C|PPP2R1B_ENST00000427203.2_Missense_Mutation_p.R72C|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.R169C|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.R233C|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.R233C	p.R233C	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	1	2	3	2.189883	P30154	2AAB_HUMAN		6	762	-		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	ENST00000527614.1	1	1	hg19	c.697C>T	CCDS8349.1	0	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665575	0.88251	4.54E-4	1.16E-4	ENSG00000137713	ENST00000311129;ENST00000412902;ENST00000426998;ENST00000527614;ENST00000427203;ENST00000341980;ENST00000393055	T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51	5.5	5.5	0.81552	5.500000	5.500000	0.815520	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82171	0.4979	H	0.97077	3.935	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.994;1.0;1.0;0.998;1.0	D	0.88083	0.2808	10	0.87932	D	0	-6.6676	16.8722	0.86043	0.0:0.0:1.0:0.0	.	106;233;72;169;233;233	A8MY67;F8W8G1;B7Z1G3;B4DWW5;P30154;P30154-2	.;.;.;.;2AAB_HUMAN;.	C	233;106;169;233;72;233;106	ENSP00000311344:R233C;ENSP00000410671:R169C;ENSP00000437193:R233C;ENSP00000415759:R72C;ENSP00000343317:R233C;ENSP00000376775:R106C	ENSP00000311344:R233C	R	-	1	0	0	PPP2R1B	111131375	111131375	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.360000	0.79487	2.585000	0.87301	0.655000	0.94253	CGC	0.682753		TCGA-FB-AAQ0-01A-31D-A40W-08	0.448	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	1	0	1		2	2	2	0		0	0	67		67	63	1	1.880000	-20.000000	1	0.670000	NM_002716			35	36		215	212	1		1	1		0	0	67	0		1.000000	7.403206e-01	0	2	0	16	0	35	215
P2RX7	5027	broad.mit.edu	37	12	121622380	121622380	+	Silent	SNP	C	C	T	rs2230913	byFrequency	TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr12:121622380C>T	ENST00000546057.1	+	13	1706	c.1563C>T	c.(1561-1563)caC>caT	p.H521H	P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000328963.5_Silent_p.H351H|RP11-340F14.5_ENST00000569999.1_RNA|P2RX7_ENST00000535250.1_Silent_p.H431H|P2RX7_ENST00000541446.1_Silent_p.H232H	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	521			H -> Q (in dbSNP:rs2230913).		apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGTCCAGACACGTCCTGCAGT	0.627																																						ENST00000546057.1	0.870000	4.800000e-01	7.700000e-01	5.600000e-01	0.660000	0.675424	0.660000	0.670000																										0				19						c.(1561-1563)caC>caT		purinergic receptor P2X, ligand-gated ion channel, 7							35.0	31.0	32.0					12																	121622380		2203	4300	6503	SO:0001819	synonymous_variant	5027	1552	121412	60				g.chr12:121622380C>T	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.1563C>T	chr12.hg19:g.121622380C>T		1					P2RX7_ENST00000443520.3_3'UTR|RP11-340F14.5_ENST00000569999.1_RNA|P2RX7_ENST00000541446.1_Silent_p.H232H|P2RX7_ENST00000535250.1_Silent_p.H431H|P2RX7_ENST00000328963.5_Silent_p.H351H	p.H521H	NM_002562.5	NP_002553	0	1	1	2.017093	Q99572	P2RX7_HUMAN		13	1706	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Silent	SNP	ENST00000546057.1	1	0	hg19	c.1563C>T	CCDS9213.1	0																																																																																								0.647568		TCGA-FB-AAQ0-01A-31D-A40W-08	0.627	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	1	0	1		2	2	2	0		0	0	25		25	24	1	1.880000	-1.709817	0	0.670000	NM_002562			32	31		102	99	1		1	0		0	0	25	0		1.000000	0	0	0	0	1	0	32	102
DNAH10	196385	broad.mit.edu	37	12	124323215	124323215	+	Silent	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr12:124323215C>T	ENST00000409039.3	+	28	4786	c.4761C>T	c.(4759-4761)tgC>tgT	p.C1587C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1587	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACCCACTCTGCGTCCAGGAGC	0.537																																						ENST00000409039.3	0.190000	7.000000e-02	1.600000e-01	9.000000e-02	0.120000	0.130865	0.120000	0.130000																										0				52						c.(4759-4761)tgC>tgT		dynein, axonemal, heavy chain 10							97.0	99.0	98.0					12																	124323215		1992	4169	6161	SO:0001819	synonymous_variant	196385	6	120908	38				g.chr12:124323215C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.4761C>T	chr12.hg19:g.124323215C>T		1						p.C1587C	NM_207437.3	NP_997320.2	0	1	1	2.017093	Q8IVF4	DYH10_HUMAN		28	4786	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	1	1	hg19	c.4761C>T	CCDS9255.2	0																																																																																								0.647568		TCGA-FB-AAQ0-01A-31D-A40W-08	0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3	1	0	1		2	2	2	0		0	0	88		88	86	1	1.880000	-4.430493	1	0.670000				20	20		426	421	0		1			0	0	88	0		0.999995	0	0	0	0	0	0	20	426
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.920000	5.800000e-01	8.400000e-01	6.600000e-01	0.740000	0.757835	0.740000	0.750000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	0	1	1	2.030175	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.648824		TCGA-FB-AAQ0-01A-31D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	62		62	60	1	1.880000	-20.000000	1	0.670000	NM_033360			54	53		147	147	1		1	1	1	0	0	62	204		1.000000	9.691807e-01	1	10	103	8	226	54	147
RIMBP2	23504	broad.mit.edu	37	12	130926715	130926715	+	Silent	SNP	C	C	T	rs138793493	byFrequency	TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr12:130926715C>T	ENST00000261655.4	-	8	1294	c.1131G>A	c.(1129-1131)tcG>tcA	p.S377S	RIMBP2_ENST00000536002.1_Silent_p.S285S|RIMBP2_ENST00000535703.1_Silent_p.S285S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	377	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCAGCTCATCCGAGCTGCCCC	0.637													C|||	14	0.00279553	0.0	0.0072	5008	,	,		20127	0.0		0.0089	False		,,,				2504	0.0					ENST00000261655.4	0.680000	3.900000e-01	6.100000e-01	4.500000e-01	0.520000	0.538681	0.520000	0.530000																										0				96						c.(1129-1131)tcG>tcA		RIMS binding protein 2				2,4404	4.2+/-10.8	0,2,2201	114.0	105.0	108.0		1131	-0.0	1.0	12	dbSNP_134	108	32,8568	21.6+/-65.8	0,32,4268	no	coding-synonymous	RIMBP2	NM_015347.4		0,34,6469	TT,TC,CC		0.3721,0.0454,0.2614		377/1053	130926715	34,12972	2203	4300	6503	SO:0001819	synonymous_variant	23504	253	121412	55				g.chr12:130926715C>T	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1131G>A	chr12.hg19:g.130926715C>T		1					RIMBP2_ENST00000536002.1_Silent_p.S285S|RIMBP2_ENST00000535703.1_Silent_p.S285S	p.S377S	NM_015347.4	NP_056162.4	0	1	1	2.017093	O15034	RIMB2_HUMAN		8	1294	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	Q96ID2	Silent	SNP	ENST00000261655.4	1	0	hg19	c.1131G>A	CCDS31925.1	0																																																																																								0.647568		TCGA-FB-AAQ0-01A-31D-A40W-08	0.637	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	0	0	1		2	2	2	0		0	0	37		37	36	1	1.880000	-2.838707	1	0.670000	NM_015347			39	39		166	163	1		1			0	0	37	0		1.000000	0	0	0	0	0	0	39	166
MCF2L	23263	broad.mit.edu	37	13	113678964	113678964	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr13:113678964G>A	ENST00000375608.3	+	4	318	c.260G>A	c.(259-261)cGg>cAg	p.R87Q	MCF2L_ENST00000434480.2_Missense_Mutation_p.R63Q|MCF2L_ENST00000535094.2_Missense_Mutation_p.R57Q|MCF2L_ENST00000397030.1_Missense_Mutation_p.R90Q|MCF2L_ENST00000375604.2_Missense_Mutation_p.R114Q|MCF2L_ENST00000442652.2_Missense_Mutation_p.R87Q|MCF2L_ENST00000423482.2_Missense_Mutation_p.R55Q|MCF2L_ENST00000375597.4_Missense_Mutation_p.R55Q|MCF2L_ENST00000397024.1_Missense_Mutation_p.R55Q|MCF2L_ENST00000375601.3_Missense_Mutation_p.R61Q|MCF2L_ENST00000421756.1_Missense_Mutation_p.R61Q			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	87	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CCAGGTGGGCGGGGGCAGGAC	0.612																																						ENST00000375608.3	1.000000	1.300000e-01	1	1.700000e-01	0.210000	0.392427	0.210000	0.200000																										0				8						c.(259-261)cGg>cAg		MCF.2 cell line derived transforming sequence-like							55.0	56.0	56.0					13																	113678964		2203	4300	6503	SO:0001583	missense	23263	4	121412	31				g.chr13:113678964G>A	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.260G>A	chr13.hg19:g.113678964G>A	ENSP00000364758:p.Arg87Gln	1					MCF2L_ENST00000375597.4_Missense_Mutation_p.R55Q|MCF2L_ENST00000375601.3_Missense_Mutation_p.R61Q|MCF2L_ENST00000397030.1_Missense_Mutation_p.R90Q|MCF2L_ENST00000434480.2_Missense_Mutation_p.R63Q|MCF2L_ENST00000397024.1_Missense_Mutation_p.R55Q|MCF2L_ENST00000535094.2_Missense_Mutation_p.R57Q|MCF2L_ENST00000375604.2_Missense_Mutation_p.R114Q|MCF2L_ENST00000442652.2_Missense_Mutation_p.R87Q|MCF2L_ENST00000421756.1_Missense_Mutation_p.R61Q|MCF2L_ENST00000423482.2_Missense_Mutation_p.R55Q	p.R87Q			1	2	3	2.375185	O15068	MCF2L_HUMAN		4	318	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	1	1	hg19	c.260G>A		0	.	.	.	.	.	.	.	.	.	.	G	32	5.122466	0.94429	.	.	ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000430480;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000433807;ENST00000434480;ENST00000409954;ENST00000423482;ENST00000375597;ENST00000397024	T;T;T;T;T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	4.16	4.16	0.48862	4.160000	4.160000	0.488620	Cellular retinaldehyde-binding/triple function, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.80259	0.4590	M	0.83774	2.66	0.46981	D	0.999278	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.84359	0.0537	10	0.87932	D	0	.	15.586	0.76482	0.0:0.0:1.0:0.0	.	55;57;114;55;87	E9PDN8;O15068-9;G5E9A1;O15068-4;O15068	.;.;.;.;MCF2L_HUMAN	Q	87;87;114;90;57;57;61;61;63;63;28;55;55;55	ENSP00000364758:R87Q;ENSP00000401422:R87Q;ENSP00000364754:R114Q;ENSP00000380225:R90Q;ENSP00000440374:R57Q;ENSP00000397285:R61Q;ENSP00000364751:R61Q;ENSP00000407722:R63Q;ENSP00000386551:R28Q;ENSP00000405639:R55Q;ENSP00000364747:R55Q	ENSP00000364747:R55Q	R	+	2	0	0	MCF2L	112726965	112726965	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.629000	0.67798	2.037000	0.60232	0.462000	0.41574	CGG	0.708995		TCGA-FB-AAQ0-01A-31D-A40W-08	0.612	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4	1	0	1		2	2	2	0		0	0	84		84	82	1	1.880000	-2.642100	1	0.670000				26	26		410	398	0		1	0		0	0	84	0		1.000000	1.127690e-02	0	0	0	3	0	26	410
HECTD1	25831	broad.mit.edu	37	14	31575880	31575880	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr14:31575880C>T	ENST00000399332.1	-	38	7686	c.7198G>A	c.(7198-7200)Ggg>Agg	p.G2400R	HECTD1_ENST00000553700.1_Missense_Mutation_p.G2400R	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2400	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AGTGGAGGCCCAGAACCTGAT	0.378																																						ENST00000399332.1	0.130000	2.000000e-02	1.000000e-01	4.000000e-02	0.060000	0.075800	0.060000	0.070000																										0				70						c.(7198-7200)Ggg>Agg		HECT domain containing E3 ubiquitin protein ligase 1							90.0	84.0	86.0					14																	31575880		1869	4111	5980	SO:0001583	missense	25831	0	0					g.chr14:31575880C>T	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.7198G>A	chr14.hg19:g.31575880C>T	ENSP00000382269:p.Gly2400Arg	0					HECTD1_ENST00000553700.1_Missense_Mutation_p.G2400R	p.G2400R	NM_015382.2	NP_056197.2	0	0	0	2.042792	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	38	7686	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	0	1	hg19	c.7198G>A	CCDS41939.1	0	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519115	0.85495	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332	T;T	0.41758	0.99;0.99	5.81	5.81	0.92471	5.810000	5.810000	0.924710	HECT (4);	0.000000	0.64402	U	0.000001	T	0.64560	0.2609	M	0.77103	2.36	0.80722	D	1	D	0.58620	0.983	P	0.58266	0.836	T	0.66638	-0.5873	10	0.66056	D	0.02	-8.2215	20.0695	0.97716	0.0:1.0:0.0:0.0	.	2400	Q9ULT8	HECD1_HUMAN	R	2400;2402;2400	ENSP00000450697:G2400R;ENSP00000382269:G2400R	ENSP00000261312:G2402R	G	-	1	0	0	HECTD1	30645631	30645631	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.484000	0.81180	2.738000	0.93877	0.655000	0.94253	GGG	0.665518		TCGA-FB-AAQ0-01A-31D-A40W-08	0.378	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1	0	0	1		2	2	2	0		0	0	86		86	85	1	1.880000	-2.741956	1	0.670000				9	9		377	375	0		1	0		0	0	86	0		0.994212	9.251385e-01	0	1	0	191	0	9	377
CGRRF1	10668	broad.mit.edu	37	14	55004518	55004518	+	Missense_Mutation	SNP	T	T	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr14:55004518T>G	ENST00000216420.7	+	5	781	c.649T>G	c.(649-651)Ttg>Gtg	p.L217V	CGRRF1_ENST00000557512.1_3'UTR	NM_006568.2	NP_006559.1	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	217					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|lung(5)|ovary(2)|stomach(1)	13						ATATTTACTCTTGGCTCAAGG	0.338																																						ENST00000216420.7	0.960000	6.900000e-01	9.000000e-01	7.500000e-01	0.820000	0.831958	0.820000	0.830000																										0				13						c.(649-651)Ttg>Gtg		cell growth regulator with ring finger domain 1							83.0	80.0	81.0					14																	55004518		2203	4295	6498	SO:0001583	missense	10668	0	0					g.chr14:55004518T>G	BC015063	CCDS9719.1	14q22.2	2013-09-20			ENSG00000100532	ENSG00000100532		"""RING-type (C3HC4) zinc fingers"""	15528	protein-coding gene	gene with protein product		606138				8968090	Standard	NM_006568		Approved	CGR19, RNF197	uc001xay.3	Q99675	OTTHUMG00000140308	ENST00000216420.7:c.649T>G	chr14.hg19:g.55004518T>G	ENSP00000216420:p.Leu217Val	0					CGRRF1_ENST00000557512.1_3'UTR	p.L217V	NM_006568.2	NP_006559.1	0	0	0	2.042792	Q99675	CGRF1_HUMAN		5	781	+			Q96BX2	Missense_Mutation	SNP	ENST00000216420.7	1	1	hg19	c.649T>G	CCDS9719.1	0	.	.	.	.	.	.	.	.	.	.	T	10.82	1.458727	0.26248	.	.	ENSG00000100532	ENST00000216420	T	0.26810	1.71	5.97	3.04	0.35103	5.970000	3.040000	0.351030	.	0.203895	0.42053	D	0.000762	T	0.17789	0.0427	L	0.60455	1.87	0.27023	N	0.964424	B;B	0.31383	0.018;0.321	B;B	0.20577	0.015;0.03	T	0.21415	-1.0246	10	0.15499	T	0.54	-2.8113	5.1776	0.15143	0.1238:0.6109:0.0:0.2653	.	217;217	B2RCX4;Q99675	.;CGRF1_HUMAN	V	217	ENSP00000216420:L217V	ENSP00000216420:L217V	L	+	1	2	2	CGRRF1	54074268	54074268	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.293000	0.43558	0.336000	0.23639	0.477000	0.44152	TTG	0.665518		TCGA-FB-AAQ0-01A-31D-A40W-08	0.338	CGRRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276905.2	1	0	1		2	2	2	0		0	0	85		85	85	1	1.880000	-20.000000	1	0.670000	NM_006568			102	102		260	260	1		1	1		0	0	85	0		1.000000	9.988906e-01	0	8	0	21	0	102	260
DICER1	23405	broad.mit.edu	37	14	95572489	95572489	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr14:95572489T>A	ENST00000526495.1	-	20	3167	c.2876A>T	c.(2875-2877)aAa>aTa	p.K959I	DICER1_ENST00000527414.1_Missense_Mutation_p.K959I|DICER1_ENST00000343455.3_Missense_Mutation_p.K959I|DICER1_ENST00000393063.1_Missense_Mutation_p.K959I|DICER1_ENST00000556045.1_5'Flank|DICER1_ENST00000541352.1_Missense_Mutation_p.K959I			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	959	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GGAAGGAAATTTACTGAGTGG	0.373			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													ENST00000526495.1	0.210000	9.000000e-02	1.800000e-01	1.100000e-01	0.140000	0.152911	0.140000	0.150000			yes	Rec	yes	Familial Pleuropulmonary Blastoma	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	14q32.13	23405	Mis F, N	"""dicer 1, ribonuclease type III """				"""E, M, O"""	E, M, O		pleuropulmonary blastoma	sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma		0				75						c.(2875-2877)aAa>aTa		dicer 1, ribonuclease type III							107.0	116.0	113.0					14																	95572489		2203	4300	6503	SO:0001583	missense	23405	0	0		Familial Multinodular Goiter ;DICER 1 syndrome	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	g.chr14:95572489T>A	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2876A>T	chr14.hg19:g.95572489T>A	ENSP00000437256:p.Lys959Ile	0					DICER1_ENST00000556045.1_5'Flank|DICER1_ENST00000343455.3_Missense_Mutation_p.K959I|DICER1_ENST00000541352.1_Missense_Mutation_p.K959I|DICER1_ENST00000527414.1_Missense_Mutation_p.K959I|DICER1_ENST00000393063.1_Missense_Mutation_p.K959I	p.K959I			0	0	0	2.042792	Q9UPY3	DICER_HUMAN		20	3167	-		all_cancers(154;0.0621)|all_epithelial(191;0.223)	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	1	1	hg19	c.2876A>T	CCDS9931.1	0	.	.	.	.	.	.	.	.	.	.	T	23.5	4.418738	0.83559	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42	5.69	4.52	0.55395	5.690000	4.520000	0.553950	Argonaute/Dicer protein, PAZ (4);	0.043854	0.85682	D	0.000000	T	0.22399	0.0540	L	0.31371	0.925	0.80722	D	1	P	0.41748	0.761	P	0.51487	0.671	T	0.01205	-1.1419	10	0.48119	T	0.1	-20.6741	12.8648	0.57934	0.0:0.0:0.1361:0.8639	.	959	Q9UPY3	DICER_HUMAN	I	959	ENSP00000343745:K959I;ENSP00000437256:K959I;ENSP00000376783:K959I;ENSP00000435681:K959I;ENSP00000444719:K959I	ENSP00000343745:K959I	K	-	2	0	0	DICER1	94642242	94642242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.241000	0.72369	0.952000	0.37798	0.533000	0.62120	AAA	0.665518		TCGA-FB-AAQ0-01A-31D-A40W-08	0.373	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1	1	0	1		2	2	2	0		0	0	84		84	84	1	1.880000	-19.999990	1	0.670000				24	24		455	451	0		1	0		0	0	84	0		1.000000	7.748827e-02	0	0	0	9	0	24	455
MKRN3	7681	broad.mit.edu	37	15	23811532	23811532	+	Silent	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr15:23811532G>A	ENST00000314520.3	+	1	1079	c.603G>A	c.(601-603)gcG>gcA	p.A201A	MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	201					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AAAGCTGGGCGGATGCCATTG	0.592																																						ENST00000314520.3			0	0																														0				61						c.(601-603)gcG>gcA		makorin ring finger protein 3							39.0	45.0	43.0					15																	23811532		2202	4300	6502	SO:0001819	synonymous_variant	7681	0	0					g.chr15:23811532G>A	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.603G>A	chr15.hg19:g.23811532G>A							RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568252.1_Intron	p.A201A	NM_005664.3	NP_005655.1					Q13064	MKRN3_HUMAN		1	1079	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		Silent	SNP	ENST00000314520.3	1	1	hg19	c.603G>A	CCDS10013.1																																																																																											TCGA-FB-AAQ0-01A-31D-A40W-08	0.592	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	1	0	1		2	2	2	0		0	0	26		26	26	1	1.880000	-20.000000	1	0.670000	NM_005664			54	52		87	85	1		1			0	0	26	0		1.000000	0	0	0	0	0	0	54	87
RASGRF1	5923	broad.mit.edu	37	15	79323771	79323771	+	Silent	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr15:79323771G>A	ENST00000419573.3	-	8	1507	c.1233C>T	c.(1231-1233)taC>taT	p.Y411Y	RASGRF1_ENST00000558480.2_Silent_p.Y411Y|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	411	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGGACTTGGCGTAGTCCAGGC	0.637																																						ENST00000419573.3	0.540000	1.400000e-01	4.200000e-01	2.100000e-01	0.300000	0.323665	0.300000	0.290000																										0				71						c.(1231-1233)taC>taT		Ras protein-specific guanine nucleotide-releasing factor 1							92.0	71.0	78.0					15																	79323771		2196	4293	6489	SO:0001819	synonymous_variant	5923	5	121406	34				g.chr15:79323771G>A	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1233C>T	chr15.hg19:g.79323771G>A		1					RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.Y411Y	p.Y411Y	NM_002891.4	NP_002882.3	0	1	1	1.815200	Q13972	RGRF1_HUMAN		8	1507	-			F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	0	1	hg19	c.1233C>T	CCDS10309.1	0																																																																																								0.605192		TCGA-FB-AAQ0-01A-31D-A40W-08	0.637	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	0	0	1		13	2	2	1		1	1	14		14	13	1	1.880000	-13.224300	1	0.670000	NM_002891			7	7		52	51	1		0			1	0	14	0		0.094764	0	0	0	0	0	0	7	52
IGF1R	3480	broad.mit.edu	37	15	99482481	99482481	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr15:99482481G>A	ENST00000268035.6	+	18	3960	c.3349G>A	c.(3349-3351)Gga>Aga	p.G1117R	IGF1R_ENST00000558762.1_Missense_Mutation_p.G1116R	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	1117	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCAGATGGCCGGAGAGATTGC	0.438																																						ENST00000268035.6	0.090000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.050857	0.040000	0.050000																										0				63						c.(3349-3351)Gga>Aga		insulin-like growth factor 1 receptor	"""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"						132.0	125.0	127.0					15																	99482481		2197	4297	6494	SO:0001583	missense	3480	2	121412	32				g.chr15:99482481G>A	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.3349G>A	chr15.hg19:g.99482481G>A	ENSP00000268035:p.Gly1117Arg	1					IGF1R_ENST00000558762.1_Missense_Mutation_p.G1116R	p.G1117R	NM_000875.3	NP_000866.1	0	1	1	1.815200	P08069	IGF1R_HUMAN	Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)	18	3960	+	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	0	1	hg19	c.3349G>A	CCDS10378.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.261478	0.95368	.	.	ENSG00000140443	ENST00000268035	D	0.88201	-2.35	5.9	5.9	0.94986	5.900000	5.900000	0.949860	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000027	D	0.85146	0.5630	N	0.00742	-1.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.99	D	0.91434	0.5168	10	0.59425	D	0.04	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	1116;1117	C9J5X1;P08069	.;IGF1R_HUMAN	R	1117	ENSP00000268035:G1117R	ENSP00000268035:G1117R	G	+	1	0	0	IGF1R	97300004	97300004	1.000000	0.71417	0.240000	0.24138	0.986000	0.74619	9.869000	0.99810	2.806000	0.96561	0.655000	0.94253	GGA	0.605192		TCGA-FB-AAQ0-01A-31D-A40W-08	0.438	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	0	0	1		2	2	2	0		0	0	91		91	91	1	1.880000	-2.271178	0	0.670000	NM_000875			8	9		431	428	0		1	0		0	0	91	0		0.989107	4.881664e-02	0	0	0	17	0	8	431
MYH11	4629	broad.mit.edu	37	16	15841926	15841926	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr16:15841926C>T	ENST00000300036.5	-	17	2267	c.2158G>A	c.(2158-2160)Gtc>Atc	p.V720I	MYH11_ENST00000576790.2_Missense_Mutation_p.V720I|MYH11_ENST00000452625.2_Missense_Mutation_p.V727I|MYH11_ENST00000396324.3_Missense_Mutation_p.V727I	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	720	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TCCTGGAAGACGATCCGGTTG	0.647			T	CBFB	AML																																	ENST00000300036.5	1.000000	4.300000e-01	6.900000e-01	4.800000e-01	0.550000	0.617380	0.550000	0.550000				Dom	yes			Dom	yes		16	16p13.13-p13.12	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""				L	L	CBFB		AML		0				123						c.(2158-2160)Gtc>Atc		myosin, heavy chain 11, smooth muscle							74.0	61.0	65.0					16																	15841926		2197	4300	6497	SO:0001583	missense	4629	1	121412	34				g.chr16:15841926C>T	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2158G>A	chr16.hg19:g.15841926C>T	ENSP00000300036:p.Val720Ile	1					MYH11_ENST00000576790.2_Missense_Mutation_p.V720I|MYH11_ENST00000452625.2_Missense_Mutation_p.V727I|MYH11_ENST00000396324.3_Missense_Mutation_p.V727I	p.V720I	NM_002474.2	NP_002465.1	1	2	3	2.188268	P35749	MYH11_HUMAN		17	2267	-			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	1	1	hg19	c.2158G>A	CCDS10565.1	0	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410585	0.42715	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	4.82	4.82	0.62117	4.820000	4.820000	0.621170	Myosin head, motor domain (2);	0.147580	0.44902	D	0.000402	T	0.61110	0.2321	N	0.26162	0.8	0.80722	D	1	B;B;B;B;B	0.13594	0.008;0.008;0.001;0.008;0.001	B;B;B;B;B	0.17098	0.017;0.01;0.017;0.01;0.01	T	0.59532	-0.7437	10	0.54805	T	0.06	.	16.918	0.86156	0.0:1.0:0.0:0.0	.	727;720;727;720;727	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	I	720;720;727;727;727	ENSP00000300036:V720I;ENSP00000345136:V720I;ENSP00000379616:V727I;ENSP00000407821:V727I	ENSP00000300036:V720I	V	-	1	0	0	MYH11	15749427	15749427	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	4.955000	0.63638	2.224000	0.72417	0.561000	0.74099	GTC	0.689748		TCGA-FB-AAQ0-01A-31D-A40W-08	0.647	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	1	0	1		2	2	2	0		0	0	61		61	59	1	1.880000	-3.365605	1	0.670000	NM_001040113			61	60		293	288	1		1	0		0	0	61	0		1.000000	9.794834e-01	0	0	0	32	0	61	293
IL4R	3566	broad.mit.edu	37	16	27356274	27356274	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr16:27356274C>A	ENST00000395762.2	+	5	553	c.294C>A	c.(292-294)aaC>aaA	p.N98K	IL4R_ENST00000380922.3_Missense_Mutation_p.N83K|IL4R_ENST00000449195.1_Missense_Mutation_p.N98K|IL4R_ENST00000170630.2_Missense_Mutation_p.N98K|IL4R_ENST00000543915.2_Missense_Mutation_p.N98K	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	98					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GTGCGGATAACTATACACTGG	0.642																																						ENST00000395762.2	1.000000	6.700000e-01	9.400000e-01	7.300000e-01	0.800000	0.829195	0.800000	0.790000																										0				33						c.(292-294)aaC>aaA		interleukin 4 receptor							107.0	91.0	97.0					16																	27356274		2197	4300	6497	SO:0001583	missense	3566	0	0					g.chr16:27356274C>A	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.294C>A	chr16.hg19:g.27356274C>A	ENSP00000379111:p.Asn98Lys	1					IL4R_ENST00000449195.1_Missense_Mutation_p.N98K|IL4R_ENST00000543915.2_Missense_Mutation_p.N98K|IL4R_ENST00000380922.3_Missense_Mutation_p.N83K|IL4R_ENST00000170630.2_Missense_Mutation_p.N98K	p.N98K	NM_000418.3	NP_000409.1	1	2	3	2.188268	P24394	IL4RA_HUMAN		5	553	+			B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	1	1	hg19	c.294C>A	CCDS10629.1	0	.	.	.	.	.	.	.	.	.	.	c	9.462	1.093474	0.20471	.	.	ENSG00000077238	ENST00000380925;ENST00000449195;ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	3.4	-1.07	0.09968	3.400000	-1.070000	0.099680	Interleukin-4 receptor alpha chain, N-terminal (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	2.766520	0.01326	N	0.011099	T	0.09024	0.0223	N	0.22421	0.69	0.09310	N	1	B;P;B	0.40578	0.346;0.722;0.298	B;B;B	0.30316	0.05;0.114;0.029	T	0.15752	-1.0426	10	0.06494	T	0.89	.	2.2459	0.04031	0.1909:0.3504:0.3448:0.1138	.	83;98;98	B4E076;P24394;P24394-2	.;IL4RA_HUMAN;.	K	98;98;98;98;83;98	ENSP00000410322:N98K;ENSP00000379111:N98K;ENSP00000441667:N98K;ENSP00000370309:N83K;ENSP00000170630:N98K	ENSP00000170630:N98K	N	+	3	2	2	IL4R	27263775	27263775	0.006000	0.16342	0.000000	0.03702	0.021000	0.10359	0.000000	0.12993	-0.159000	0.11021	-0.642000	0.03964	AAC	0.689748		TCGA-FB-AAQ0-01A-31D-A40W-08	0.642	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4	1	0	1		2	2	2	0		0	0	87		87	84	1	1.880000	-20.000000	1	0.670000				110	109		328	325	1		1	1		0	0	87	0		1.000000	9.952377e-01	0	13	0	14	0	110	328
AMFR	267	broad.mit.edu	37	16	56423115	56423115	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr16:56423115G>C	ENST00000290649.5	-	9	1468	c.1258C>G	c.(1258-1260)Cac>Gac	p.H420D		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	420					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						TGGAAGAAGTGATTGTGTTGG	0.423																																					Pancreas(2;144 323 39528)	ENST00000290649.5	1.000000	5.000000e-02	1.600000e-01	8.000000e-02	0.110000	0.199308	0.110000	0.110000																										0				17						c.(1258-1260)Cac>Gac		autocrine motility factor receptor, E3 ubiquitin protein ligase							155.0	145.0	148.0					16																	56423115		2198	4300	6498	SO:0001583	missense	267	0	0					g.chr16:56423115G>C	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1258C>G	chr16.hg19:g.56423115G>C	ENSP00000290649:p.His420Asp	1						p.H420D	NM_001144.5	NP_001135.3	2	2	4	2.251783	Q9UKV5	AMFR_HUMAN		9	1468	-			P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	1	1	hg19	c.1258C>G	CCDS10758.1	0	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738582	0.89573	.	.	ENSG00000159461	ENST00000290649	T	0.16897	2.31	5.92	5.92	0.95590	5.920000	5.920000	0.955900	.	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	M	0.77103	2.36	0.80722	D	1	D	0.59767	0.986	P	0.59487	0.858	T	0.21109	-1.0255	10	0.59425	D	0.04	-30.074	20.33	0.98713	0.0:0.0:1.0:0.0	.	420	Q9UKV5	AMFR2_HUMAN	D	420	ENSP00000290649:H420D	ENSP00000290649:H420D	H	-	1	0	0	AMFR	54980616	54980616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	2.810000	0.96702	0.585000	0.79938	CAC	0.694558		TCGA-FB-AAQ0-01A-31D-A40W-08	0.423	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2	0	0	0		2	2	2	0		0	0	82		82	80	1	1.880000	-3.695287	1	0.670000				16	16		464	457	0		1	1		0	0	82	0		0.999927	7.803655e-01	0	3	0	82	0	16	464
USP10	9100	broad.mit.edu	37	16	84806216	84806216	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr16:84806216G>A	ENST00000219473.7	+	12	2181	c.2068G>A	c.(2068-2070)Gtt>Att	p.V690I	USP10_ENST00000570191.1_Missense_Mutation_p.V694I	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	690	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						GAAACGATTCGTTTATGAGAA	0.443																																						ENST00000219473.7	1.000000	7.600000e-01	1	8.200000e-01	0.880000	0.897134	0.880000	0.880000																										0				17						c.(2068-2070)Gtt>Att		ubiquitin specific peptidase 10							164.0	157.0	159.0					16																	84806216		1919	4142	6061	SO:0001583	missense	9100	2	120858	33				g.chr16:84806216G>A	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.2068G>A	chr16.hg19:g.84806216G>A	ENSP00000219473:p.Val690Ile	1					USP10_ENST00000570191.1_Missense_Mutation_p.V694I	p.V690I	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	1	2	3	2.201369	Q14694	UBP10_HUMAN		12	2181	+			B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	1	1	hg19	c.2068G>A	CCDS45537.1	1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353656	0.24512	.	.	ENSG00000103194	ENST00000219473	T	0.30448	1.53	4.38	4.38	0.52667	4.380000	4.380000	0.526670	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.32406	0.0828	L	0.33293	1	0.80722	D	1	D;P	0.57571	0.98;0.914	P;P	0.49683	0.572;0.619	T	0.03807	-1.1002	10	0.30854	T	0.27	-17.0169	16.2965	0.82776	0.0:0.0:1.0:0.0	.	694;690	Q14694-3;Q14694	.;UBP10_HUMAN	I	690	ENSP00000219473:V690I	ENSP00000219473:V690I	V	+	1	0	0	USP10	83363717	83363717	1.000000	0.71417	0.796000	0.32109	0.335000	0.28730	9.178000	0.94855	2.157000	0.67596	0.563000	0.77884	GTT	0.689748		TCGA-FB-AAQ0-01A-31D-A40W-08	0.443	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1	0	0	1		2	4	2	1		1	0	130		130	129	1	1.880000	-20.000000	1	0.670000				166	162		434	426	1		1	1		1	0	130	0		1.000000	9.999676e-01	0	19	0	38	0	166	434
ASPA	443	broad.mit.edu	37	17	3397713	3397713	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr17:3397713A>G	ENST00000263080.2	+	5	862	c.704A>G	c.(703-705)gAa>gGa	p.E235G	SPATA22_ENST00000541913.1_Intron|ASPA_ENST00000456349.2_Missense_Mutation_p.E235G	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	235					aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	CCCCGGGATGAAAATGGAGAA	0.343																																						ENST00000263080.2	0.050000	0	4.000000e-02	1.000000e-02	0.020000	0.029465	0.020000	0.030000																										0				17						c.(703-705)gAa>gGa		aspartoacylase	L-Aspartic Acid(DB00128)						172.0	191.0	185.0					17																	3397713		2203	4300	6503	SO:0001583	missense	443	0	0					g.chr17:3397713A>G	S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.704A>G	chr17.hg19:g.3397713A>G	ENSP00000263080:p.Glu235Gly	1					ASPA_ENST00000456349.2_Missense_Mutation_p.E235G|SPATA22_ENST00000541913.1_Intron	p.E235G	NM_000049.2	NP_000040.1	0	1	1	1.593930	P45381	ACY2_HUMAN		5	862	+				Missense_Mutation	SNP	ENST00000263080.2	0	1	hg19	c.704A>G	CCDS11028.1	0	.	.	.	.	.	.	.	.	.	.	a	13.26	2.183230	0.38511	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	D;D	0.97850	-4.57;-4.57	5.72	3.44	0.39384	5.720000	3.440000	0.393840	.	0.570209	0.20924	N	0.083222	D	0.94434	0.8209	L	0.43646	1.37	0.80722	D	1	B	0.17465	0.022	B	0.15484	0.013	D	0.89317	0.3637	10	0.38643	T	0.18	-6.3778	6.8856	0.24197	0.7727:0.1508:0.0765:0.0	.	235	P45381	ACY2_HUMAN	G	235	ENSP00000409976:E235G;ENSP00000263080:E235G	ENSP00000263080:E235G	E	+	2	0	0	ASPA	3344463	3344463	1.000000	0.71417	0.998000	0.56505	0.729000	0.41735	1.983000	0.40648	0.493000	0.27837	0.528000	0.53228	GAA	0.515952		TCGA-FB-AAQ0-01A-31D-A40W-08	0.343	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207315.1	0	0	1		2	2	2	0		0	0	240		240	235	1	1.880000	-3.319207	1	0.670000	NM_000049			12	11		882	871	0		1	0		0	0	240	0		0.999036	0	0	0	0	1	0	12	882
TP53	7157	broad.mit.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr17:7578235T>G	ENST00000269305.4	-	6	803	c.614A>C	c.(613-615)tAt>tCt	p.Y205S	TP53_ENST00000445888.2_Missense_Mutation_p.Y205S|TP53_ENST00000455263.2_Missense_Mutation_p.Y205S|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.Y205S|TP53_ENST00000413465.2_Missense_Mutation_p.Y205S|TP53_ENST00000420246.2_Missense_Mutation_p.Y205S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	7.700000e-01	9.800000e-01	8.400000e-01	0.920000	0.917715	0.920000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)	24185						c.(613-615)tAt>tCt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						136.0	121.0	126.0					17																	7578235		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578235T>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>C	chr17.hg19:g.7578235T>G	ENSP00000269305:p.Tyr205Ser	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.Y205S|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.Y205S|TP53_ENST00000420246.2_Missense_Mutation_p.Y205S|TP53_ENST00000359597.4_Missense_Mutation_p.Y205S|TP53_ENST00000413465.2_Missense_Mutation_p.Y205S	p.Y205S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.580041	P04637	P53_HUMAN		6	803	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.614A>C	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.897640	0.72639	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.41	4.33	0.51752	5.410000	4.330000	0.517520	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92738	3.34	0.58432	D	0.999999	P;D;P;P;D;P;P	0.58268	0.766;0.982;0.89;0.954;0.974;0.853;0.943	P;P;P;P;P;P;P	0.61940	0.714;0.829;0.681;0.781;0.896;0.781;0.623	D	0.97292	0.9925	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205S;ENSP00000352610:Y205S;ENSP00000269305:Y205S;ENSP00000398846:Y205S;ENSP00000391127:Y205S;ENSP00000391478:Y205S;ENSP00000425104:Y73S;ENSP00000423862:Y112S	ENSP00000269305:Y205S	Y	-	2	0	0	TP53	7518960	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT	0.508709		TCGA-FB-AAQ0-01A-31D-A40W-08	0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	38		38	38	1	1.880000	-20.000000	1	0.670000	NM_000546			74	74		83	83	1		1	1	1	0	0	38	1031		1.000000	9.999997e-01	1	23	438	9	521	74	83
ACLY	47	broad.mit.edu	37	17	40030190	40030190	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr17:40030190G>A	ENST00000352035.2	-	23	2646	c.2516C>T	c.(2515-2517)tCg>tTg	p.S839L	ACLY_ENST00000393896.2_Missense_Mutation_p.S829L|ACLY_ENST00000590151.1_Missense_Mutation_p.S839L|ACLY_ENST00000353196.1_Missense_Mutation_p.S829L|ACLY_ENST00000537919.1_Missense_Mutation_p.S568L	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	839					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				GGTCATGAACGAGGCAGGTTT	0.587																																					Colon(64;807 1396 15971 30971)	ENST00000352035.2	1.000000	9.600000e-01	1	9.900000e-01	0.990000	0.998178	0.990000	1.000000																									NTN1/ACLY(2)	0				28						c.(2515-2517)tCg>tTg		ATP citrate lyase							50.0	45.0	47.0					17																	40030190		2203	4300	6503	SO:0001583	missense	47	1	121412	27				g.chr17:40030190G>A	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.2516C>T	chr17.hg19:g.40030190G>A	ENSP00000253792:p.Ser839Leu	1					ACLY_ENST00000590151.1_Missense_Mutation_p.S839L|ACLY_ENST00000393896.2_Missense_Mutation_p.S829L|ACLY_ENST00000353196.1_Missense_Mutation_p.S829L|ACLY_ENST00000537919.1_Missense_Mutation_p.S568L	p.S839L	NM_001096.2	NP_001087.2	0	3	3	2.191771	P53396	ACLY_HUMAN		23	2646	-		Breast(137;0.000143)	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	1	1	hg19	c.2516C>T	CCDS11412.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.265036	0.95399	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.76	5.76	0.90799	5.760000	5.760000	0.907990	Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	T	0.48114	0.1482	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.80764	0.978;0.959;0.994;0.994;0.978	T	0.19321	-1.0309	10	0.35671	T	0.21	.	19.9738	0.97296	0.0:0.0:1.0:0.0	.	568;883;893;829;839	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	L	839;893;829;568;829	ENSP00000253792:S839L;ENSP00000345398:S829L;ENSP00000445349:S568L;ENSP00000377474:S829L	ENSP00000253792:S839L	S	-	2	0	0	ACLY	37283716	37283716	1.000000	0.71417	0.999000	0.59377	0.930000	0.56654	9.720000	0.98763	2.732000	0.93576	0.655000	0.94253	TCG	0.682753		TCGA-FB-AAQ0-01A-31D-A40W-08	0.587	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	0	0	1		2	2	2	0		0	0	43		43	42	1	1.880000	-20.000000	1	0.670000	NM_001096			82	82		137	134	1		1	1		0	0	43	0		1.000000	1	0	65	0	56	0	82	137
GNAL	2774	broad.mit.edu	37	18	11752449	11752449	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr18:11752449G>A	ENST00000423027.3	+	1	338	c.17G>A	c.(16-18)gGc>gAc	p.G6D	GNAL_ENST00000334049.6_Intron|GNAL_ENST00000269162.5_Missense_Mutation_p.G6D|GNAL_ENST00000535121.1_Missense_Mutation_p.G6D			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	6					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						TGTTTGGGCGGCAACAGCAAG	0.557																																						ENST00000423027.3			0	0																														0				12						c.(16-18)gGc>gAc		guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type							96.0	97.0	97.0					18																	11752449		2203	4300	6503	SO:0001583	missense	2774	0	0					g.chr18:11752449G>A	AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.17G>A	chr18.hg19:g.11752449G>A	ENSP00000408489:p.Gly6Asp						GNAL_ENST00000334049.6_Intron|GNAL_ENST00000269162.5_Missense_Mutation_p.G6D|GNAL_ENST00000535121.1_Missense_Mutation_p.G6D	p.G6D							P38405	GNAL_HUMAN		1	338	+			B7ZA26|Q86XU3	Missense_Mutation	SNP	ENST00000423027.3	0	1	hg19	c.17G>A	CCDS11852.1		.	.	.	.	.	.	.	.	.	.	G	25.1	4.599844	0.87055	.	.	ENSG00000141404	ENST00000535121;ENST00000269162;ENST00000423027	D;D;D	0.88975	-2.45;-2.45;-2.45	4.04	4.04	0.47022	4.040000	4.040000	0.470220	.	.	.	.	.	D	0.90783	0.7106	L	0.34521	1.04	0.34358	D	0.690637	D	0.57257	0.979	D	0.69654	0.965	D	0.93188	0.6580	9	0.59425	D	0.04	.	15.6287	0.76885	0.0:0.0:1.0:0.0	.	6	P38405	GNAL_HUMAN	D	6	ENSP00000439023:G6D;ENSP00000269162:G6D;ENSP00000408489:G6D	ENSP00000269162:G6D	G	+	2	0	0	GNAL	11742449	11742449	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.928000	0.92853	2.542000	0.85734	0.491000	0.48974	GGC			TCGA-FB-AAQ0-01A-31D-A40W-08	0.557	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254561.2	0	0	1		2	2	2	1		1	0	82		82	81	1	1.880000	-1.947449	0	0.670000	NM_182978, NM_002071			8	8		763	752	0		1		0	1	0	82	23		0.988760	0	9.350291e-02	0	0	0	43	8	763
NOL4	8715	broad.mit.edu	37	18	31538269	31538269	+	Silent	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr18:31538269G>A	ENST00000261592.5	-	7	1467	c.1170C>T	c.(1168-1170)gaC>gaT	p.D390D	NOL4_ENST00000269185.4_Silent_p.D276D|NOL4_ENST00000538587.1_Silent_p.D316D|NOL4_ENST00000589544.1_Silent_p.D390D|NOL4_ENST00000535384.1_Silent_p.D105D|NOL4_ENST00000535475.1_Silent_p.D235D	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	390						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						AATCGTCATGGTCCTCGTGGT	0.493																																						ENST00000261592.5	0.130000	5.000000e-02	1.100000e-01	7.000000e-02	0.080000	0.095867	0.080000	0.090000																										0				51						c.(1168-1170)gaC>gaT		nucleolar protein 4							275.0	234.0	248.0					18																	31538269		2203	4300	6503	SO:0001819	synonymous_variant	8715	0	0					g.chr18:31538269G>A	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1170C>T	chr18.hg19:g.31538269G>A		1					NOL4_ENST00000535384.1_Silent_p.D105D|NOL4_ENST00000269185.4_Silent_p.D276D|NOL4_ENST00000589544.1_Silent_p.D390D|NOL4_ENST00000538587.1_Silent_p.D316D|NOL4_ENST00000535475.1_Silent_p.D235D	p.D390D	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	0	1	1	1.480870	O94818	NOL4_HUMAN		7	1467	-			B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Silent	SNP	ENST00000261592.5	1	1	hg19	c.1170C>T	CCDS11907.2	0																																																																																								0.508709		TCGA-FB-AAQ0-01A-31D-A40W-08	0.493	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	0	0	1		2	2	2	0		0	0	161		161	154	1	1.880000	-4.413135	1	0.670000	NM_003787			23	23		476	467	0		1			0	0	161	0		0.999999	0	0	0	0	0	0	23	476
TSHZ3	57616	broad.mit.edu	37	19	31769290	31769290	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:31769290A>C	ENST00000240587.4	-	2	1736	c.1409T>G	c.(1408-1410)gTc>gGc	p.V470G		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	470					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTCCTTCTTGACCTCCACATT	0.532																																						ENST00000240587.4	0.520000	3.800000e-01	4.900000e-01	4.100000e-01	0.440000	0.455412	0.440000	0.450000																										0				123						c.(1408-1410)gTc>gGc		teashirt zinc finger homeobox 3							154.0	155.0	155.0					19																	31769290		2203	4300	6503	SO:0001583	missense	57616	0	0					g.chr19:31769290A>C	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1409T>G	chr19.hg19:g.31769290A>C	ENSP00000240587:p.Val470Gly	0						p.V470G	NM_020856.2	NP_065907.2	0	1	1	2.069605	Q63HK5	TSH3_HUMAN		2	1736	-	Esophageal squamous(110;0.226)		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	1	1	hg19	c.1409T>G	CCDS12421.2	0	.	.	.	.	.	.	.	.	.	.	A	10.78	1.445905	0.25987	.	.	ENSG00000121297	ENST00000240587	T	0.38560	1.13	5.55	5.55	0.83447	5.550000	5.550000	0.834470	.	0.238434	0.37669	N	0.001998	T	0.24005	0.0581	N	0.08118	0	0.58432	D	0.999998	P	0.36733	0.567	B	0.33521	0.165	T	0.10268	-1.0637	10	0.23891	T	0.37	-29.7855	15.7178	0.77681	1.0:0.0:0.0:0.0	.	470	Q63HK5	TSH3_HUMAN	G	470	ENSP00000240587:V470G	ENSP00000240587:V470G	V	-	2	0	0	TSHZ3	36461130	36461130	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	8.930000	0.92872	2.099000	0.63709	0.533000	0.62120	GTC	0.667774		TCGA-FB-AAQ0-01A-31D-A40W-08	0.532	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	0	0	1		2	2	2	0		0	0	220		220	213	1	1.880000	-20.000000	1	0.670000	NM_020856			139	139		770	761	1		1	0		0	0	220	0		1.000000	1.713684e-01	0	0	0	5	0	139	770
TSHZ3	57616	broad.mit.edu	37	19	31770055	31770055	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:31770055C>T	ENST00000240587.4	-	2	971	c.644G>A	c.(643-645)cGc>cAc	p.R215H		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	215					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTCCTTACAGCGGAACTTGCT	0.612																																						ENST00000240587.4	0.190000	8.000000e-02	1.700000e-01	1.000000e-01	0.130000	0.138423	0.130000	0.140000																										0				123						c.(643-645)cGc>cAc		teashirt zinc finger homeobox 3							108.0	99.0	102.0					19																	31770055		2203	4300	6503	SO:0001583	missense	57616	3	121412	38				g.chr19:31770055C>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.644G>A	chr19.hg19:g.31770055C>T	ENSP00000240587:p.Arg215His	0						p.R215H	NM_020856.2	NP_065907.2	0	1	1	2.069605	Q63HK5	TSH3_HUMAN		2	971	-	Esophageal squamous(110;0.226)		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	1	1	hg19	c.644G>A	CCDS12421.2	0	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245903	0.80024	.	.	ENSG00000121297	ENST00000240587	T	0.15139	2.45	5.42	5.42	0.78866	5.420000	5.420000	0.788660	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.34221	0.0890	L	0.37561	1.115	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.01858	-1.1259	10	0.42905	T	0.14	-25.4075	19.2151	0.93774	0.0:1.0:0.0:0.0	.	215	Q63HK5	TSH3_HUMAN	H	215	ENSP00000240587:R215H	ENSP00000240587:R215H	R	-	2	0	0	TSHZ3	36461895	36461895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.484000	0.81180	2.509000	0.84616	0.655000	0.94253	CGC	0.667774		TCGA-FB-AAQ0-01A-31D-A40W-08	0.612	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	0	0	1		2	2	2	0		0	0	118		118	116	1	1.880000	-4.487250	1	0.670000	NM_020856			24	24		509	502	0		1			0	0	118	0		1.000000	0	0	0	0	0	0	24	509
HAUS5	23354	broad.mit.edu	37	19	36104957	36104957	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:36104957C>G	ENST00000203166.5	+	4	240	c.215C>G	c.(214-216)cCa>cGa	p.P72R	AC002115.9_ENST00000589603.1_lincRNA|HAUS5_ENST00000379045.2_Missense_Mutation_p.P72R	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	72					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.P72L(1)		NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						CAGGACAGTCCACAGGTGAGA	0.537																																						ENST00000203166.5	0.310000	1.300000e-01	2.600000e-01	1.700000e-01	0.210000	0.222272	0.210000	0.220000																										1	Substitution - Missense(1)	p.P72L(1)	large_intestine(1)	16						c.(214-216)cCa>cGa		HAUS augmin-like complex, subunit 5							57.0	60.0	59.0					19																	36104957		2201	4300	6501	SO:0001583	missense	23354	0	0					g.chr19:36104957C>G	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.215C>G	chr19.hg19:g.36104957C>G	ENSP00000439056:p.Pro72Arg	0					HAUS5_ENST00000379045.2_Missense_Mutation_p.P72R|AC002115.9_ENST00000589603.1_lincRNA	p.P72R	NM_015302.1	NP_056117.1	0	1	1	2.069605	O94927	HAUS5_HUMAN		4	240	+			B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	ENST00000203166.5	1	1	hg19	c.215C>G	CCDS42550.1	0	.	.	.	.	.	.	.	.	.	.	C	19.76	3.886990	0.72410	.	.	ENSG00000249115	ENST00000203166;ENST00000379045	T;T	0.29917	1.55;1.55	4.98	4.98	0.66077	4.980000	4.980000	0.660770	.	0.281001	0.35407	N	0.003229	T	0.32406	0.0828	N	0.08118	0	0.35460	D	0.796479	D	0.67145	0.996	D	0.67382	0.951	T	0.43893	-0.9363	10	0.39692	T	0.17	-11.1042	13.633	0.62206	0.0:1.0:0.0:0.0	.	72	O94927	HAUS5_HUMAN	R	72	ENSP00000439056:P72R;ENSP00000444373:P72R	ENSP00000439056:P72R	P	+	2	0	0	HAUS5	40796797	40796797	0.955000	0.32602	1.000000	0.80357	0.807000	0.45602	1.249000	0.32839	2.581000	0.87130	0.655000	0.94253	CCA	0.667774		TCGA-FB-AAQ0-01A-31D-A40W-08	0.537	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459055.2	1	0	1		2	3	2	1		1	0	67		67	63	1	1.880000	-3.017767	1	0.670000				24	25		307	302	0		1	0		1	0	67	0		1.000000	2.099803e-01	0	0	0	21	0	24	307
ZNF420	147923	broad.mit.edu	37	19	37618172	37618172	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:37618172A>C	ENST00000337995.3	+	5	494	c.279A>C	c.(277-279)aaA>aaC	p.K93N	ZNF420_ENST00000304239.7_Missense_Mutation_p.K93N|CTC-454I21.4_ENST00000587645.1_RNA|ZNF585A_ENST00000588723.1_Intron	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGGAAGCCAAAGGCAAGATGG	0.368																																						ENST00000337995.3	0.170000	4.000000e-02	1.300000e-01	6.000000e-02	0.090000	0.102419	0.090000	0.100000																										0				27						c.(277-279)aaA>aaC		zinc finger protein 420							90.0	90.0	90.0					19																	37618172		2203	4300	6503	SO:0001583	missense	147923	0	0					g.chr19:37618172A>C	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.279A>C	chr19.hg19:g.37618172A>C	ENSP00000338770:p.Lys93Asn	0					ZNF420_ENST00000304239.7_Missense_Mutation_p.K93N|CTC-454I21.4_ENST00000587645.1_RNA|ZNF585A_ENST00000588723.1_Intron	p.K93N	NM_144689.3	NP_653290.2	0	1	1	2.069605	Q8TAQ5	ZN420_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	494	+			B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	1	1	hg19	c.279A>C	CCDS12498.1	0	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.743139	0.00675	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.07327	3.2;3.36	2.82	-0.616	0.11583	2.820000	-0.616000	0.115830	.	.	.	.	.	T	0.03390	0.0098	N	0.11313	0.125	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43637	-0.9379	9	0.33940	T	0.23	.	0.4456	0.00493	0.4223:0.2249:0.1343:0.2184	.	93	Q8TAQ5	ZN420_HUMAN	N	93	ENSP00000306102:K93N;ENSP00000338770:K93N	ENSP00000306102:K93N	K	+	3	2	2	ZNF420	42310012	42310012	.	.	0.002000	0.10522	0.012000	0.07955	.	.	-0.232000	0.09811	-0.496000	0.04628	AAA	0.667774		TCGA-FB-AAQ0-01A-31D-A40W-08	0.368	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	0	0	1		2	2	2	0		0	0	56		56	54	1	1.880000	-3.514007	1	0.670000	NM_144689			9	9		278	276	0		1	0		0	0	56	0		0.994236	3.829231e-03	0	0	0	3	0	9	278
EMP3	2014	broad.mit.edu	37	19	48833591	48833591	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:48833591C>G	ENST00000270221.6	+	5	657	c.356C>G	c.(355-357)gCc>gGc	p.A119G	EMP3_ENST00000597279.1_Missense_Mutation_p.A119G|EMP3_ENST00000596315.1_Missense_Mutation_p.A50G	NM_001425.2	NP_001416.1	P54852	EMP3_HUMAN	epithelial membrane protein 3	119					cell growth (GO:0016049)|negative regulation of cell proliferation (GO:0008285)	integral component of membrane (GO:0016021)				lung(1)	1		all_epithelial(76;6.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.00989)|Prostate(7;0.0143)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		TTGATCTATGCCATTCACGCC	0.607																																						ENST00000270221.6	1.000000	8.300000e-01	1	8.900000e-01	0.960000	0.953970	0.960000	1.000000																										0				1						c.(355-357)gCc>gGc		epithelial membrane protein 3							91.0	88.0	89.0					19																	48833591		2203	4300	6503	SO:0001583	missense	2014	0	0					g.chr19:48833591C>G	U52101	CCDS12715.1	19q13.3	2008-07-16				ENSG00000142227			3335	protein-coding gene	gene with protein product		602335				8996089, 10331954	Standard	NM_001425		Approved	YMP	uc002piv.2	P54852		ENST00000270221.6:c.356C>G	chr19.hg19:g.48833591C>G	ENSP00000270221:p.Ala119Gly	0					EMP3_ENST00000596315.1_Missense_Mutation_p.A50G|EMP3_ENST00000597279.1_Missense_Mutation_p.A119G	p.A119G	NM_001425.2	NP_001416.1	0	2	2	2.091684	P54852	EMP3_HUMAN		5	657	+		all_epithelial(76;6.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.00989)|Prostate(7;0.0143)|Ovarian(192;0.0261)|Breast(70;0.203)	Q6FH01	Missense_Mutation	SNP	ENST00000270221.6	1	1	hg19	c.356C>G	CCDS12715.1	1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898759	0.72639	.	.	ENSG00000142227	ENST00000270221	D	0.89123	-2.47	4.35	3.31	0.37934	4.350000	3.310000	0.379340	.	0.115317	0.64402	D	0.000015	T	0.82010	0.4944	N	0.22421	0.69	0.38944	D	0.958205	B	0.30542	0.284	B	0.33568	0.166	T	0.82218	-0.0566	10	0.87932	D	0	.	11.387	0.49791	0.0:0.9088:0.0:0.0912	.	119	P54852	EMP3_HUMAN	G	119	ENSP00000270221:A119G	ENSP00000270221:A119G	A	+	2	0	0	EMP3	53525403	53525403	0.987000	0.35691	0.993000	0.49108	0.837000	0.47467	4.846000	0.62860	1.168000	0.42723	0.561000	0.74099	GCC	0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.607	EMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465613.1	0	0	1		2	2	2	0		0	0	93		93	91	1	1.880000	-20.000000	1	0.670000	NM_001425			170	168		359	354	1		1	1		0	0	93	0		1.000000	1	0	161	0	231	0	170	359
SLC17A7	57030	broad.mit.edu	37	19	49935855	49935855	+	Silent	SNP	G	G	T	rs564881392		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:49935855G>T	ENST00000221485.3	-	9	1242	c.1071C>A	c.(1069-1071)atC>atA	p.I357I	SLC17A7_ENST00000543531.1_Silent_p.I345I|SLC17A7_ENST00000600601.1_Silent_p.I290I	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	357					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		TCTGGCCGCCGATGGGCACGA	0.672																																						ENST00000221485.3	1.000000	5.000000e-02	2.400000e-01	9.000000e-02	0.140000	0.210681	0.140000	0.140000																										0				26						c.(1069-1071)atC>atA		solute carrier family 17 (vesicular glutamate transporter), member 7							24.0	25.0	25.0					19																	49935855		2203	4299	6502	SO:0001819	synonymous_variant	57030	0	0					g.chr19:49935855G>T	AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1071C>A	chr19.hg19:g.49935855G>T		0					SLC17A7_ENST00000600601.1_Silent_p.I290I|SLC17A7_ENST00000543531.1_Silent_p.I345I	p.I357I	NM_020309.3	NP_064705.1	0	2	2	2.091684	Q9P2U7	VGLU1_HUMAN		9	1242	-		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)	B4DFR9|B4DG46|Q6PCD0	Silent	SNP	ENST00000221485.3	0	1	hg19	c.1071C>A	CCDS12764.1	0																																																																																								0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.672	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2	0	0	1		2	2	2	0		0	0	25		25	25	1	1.880000	-8.225748	1	0.670000				5	5		107	102	0		1			0	0	25	0		0.931254	0	0	0	0	0	0	5	107
LILRA3	11026	broad.mit.edu	37	19	54803682	54803682	+	Silent	SNP	T	T	G			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:54803682T>G	ENST00000251390.3	-	3	233	c.142A>C	c.(142-144)Agg>Cgg	p.R48R	LILRA3_ENST00000391744.3_Silent_p.R48R|LILRA3_ENST00000391745.1_Silent_p.R65R	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	48	Ig-like C2-type 1.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCCTGACACCTGAGGGTCACA	0.547																																						ENST00000251390.3	1.000000	9.300000e-01	1	9.900000e-01	0.990000	0.995599	0.990000	1.000000																										0				28						c.(142-144)Agg>Cgg		leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3							89.0	79.0	82.0					19																	54803682		2194	4157	6351	SO:0001819	synonymous_variant	11026	0	0					g.chr19:54803682T>G	U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.142A>C	chr19.hg19:g.54803682T>G		0					LILRA3_ENST00000391744.3_Silent_p.R48R|LILRA3_ENST00000391745.1_Silent_p.R65R	p.R48R	NM_006865.3	NP_006856.3	0	2	2	2.091684	Q8N6C8	LIRA3_HUMAN		3	233	-	Ovarian(34;0.19)		J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Silent	SNP	ENST00000251390.3	1	1	hg19	c.142A>C	CCDS12887.1	1																																																																																								0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.547	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1	1	0	1		2	2	2	0		0	0	60		60	58	1	1.880000	-20.000000	1	0.670000				137	136		241	238	1		1			0	0	60	0		1.000000	0	0	0	0	0	0	137	241
NLRP9	338321	broad.mit.edu	37	19	56244180	56244180	+	Silent	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:56244180C>T	ENST00000332836.2	-	2	1044	c.1017G>A	c.(1015-1017)acG>acA	p.T339T		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	339	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CCAACCAGCACGTAAAGGGAT	0.413																																						ENST00000332836.2	0.620000	4.200000e-01	5.700000e-01	4.700000e-01	0.510000	0.523165	0.510000	0.520000																										0				74						c.(1015-1017)acG>acA		NLR family, pyrin domain containing 9							104.0	99.0	101.0					19																	56244180		2203	4300	6503	SO:0001819	synonymous_variant	338321	0	0					g.chr19:56244180C>T	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1017G>A	chr19.hg19:g.56244180C>T		0						p.T339T	NM_176820.2	NP_789790.2	1	2	3	2.089785	Q7RTR0	NALP9_HUMAN		2	1044	-		Colorectal(82;0.000133)|Ovarian(87;0.133)	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	1	1	hg19	c.1017G>A	CCDS12934.1	0																																																																																								0.671102		TCGA-FB-AAQ0-01A-31D-A40W-08	0.413	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	1	0	1		2	2	2	0		0	0	137		137	133	1	1.880000	-20.000000	1	0.670000	NM_176820			99	99		471	469	1		1			0	0	137	0		1.000000	0	0	0	0	0	0	99	471
PEG3	5178	broad.mit.edu	37	19	57327998	57327998	+	Silent	SNP	G	G	A	rs143113379	byFrequency	TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr19:57327998G>A	ENST00000326441.9	-	10	2175	c.1812C>T	c.(1810-1812)cgC>cgT	p.R604R	ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.R604R|PEG3_ENST00000598410.1_Silent_p.R480R|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Silent_p.R478R	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	604					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGGTTTCCCCGCGCtcacgtt	0.463																																						ENST00000326441.9	0.220000	4.000000e-02	1.700000e-01	7.000000e-02	0.110000	0.124476	0.110000	0.110000																										0				170						c.(1810-1812)cgC>cgT		paternally expressed 3		A	,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	89.0	74.0	79.0		1812,1434,1812,1440,,,1812,	-3.9	0.0	19	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,intron,coding-synonymous,intron	PEG3,ZIM2	NM_001146184.1,NM_001146185.1,NM_001146186.1,NM_001146187.1,NM_001146326.1,NM_001146327.1,NM_006210.2,NM_015363.4	,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,	604/1589,478/1463,604/1589,480/1465,,,604/1589,	57327998	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5178	4	121410	38				g.chr19:57327998G>A	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1812C>T	chr19.hg19:g.57327998G>A		0					PEG3_ENST00000598410.1_Silent_p.R480R|PEG3_ENST00000423103.2_Silent_p.R604R|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Silent_p.R478R|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron	p.R604R	NM_006210.2	NP_006201.1	1	2	3	2.089785	Q9GZU2	PEG3_HUMAN		10	2175	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	0	1	hg19	c.1812C>T	CCDS12948.1	0																																																																																								0.671102		TCGA-FB-AAQ0-01A-31D-A40W-08	0.463	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2	0	0	1		2	2	2	0		0	0	36		36	35	1	1.880000	-3.106865	1	0.670000				7	7		183	178	0		1			0	0	36	0		0.979315	0	0	0	0	0	0	7	183
TNFRSF1B	7133	broad.mit.edu	37	1	12251922	12251922	+	Silent	SNP	G	G	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:12251922G>T	ENST00000376259.3	+	4	488	c.399G>T	c.(397-399)ggG>ggT	p.G133G	TNFRSF1B_ENST00000536782.1_Silent_p.G133G|TNFRSF1B_ENST00000492361.1_3'UTR|MIR4632_ENST00000584158.1_RNA	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	133					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	AGCAGGAGGGGTGCCGGCTGT	0.692																																						ENST00000376259.3	0.790000	4.200000e-01	7.000000e-01	5.000000e-01	0.590000	0.608832	0.590000	0.590000																										0				10						c.(397-399)ggG>ggT		tumor necrosis factor receptor superfamily, member 1B	Etanercept(DB00005)						24.0	25.0	25.0					1																	12251922		2202	4299	6501	SO:0001819	synonymous_variant	7133	0	0					g.chr1:12251922G>T	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.399G>T	chr1.hg19:g.12251922G>T		1					TNFRSF1B_ENST00000492361.1_3'UTR|TNFRSF1B_ENST00000536782.1_Silent_p.G133G|MIR4632_ENST00000584158.1_RNA	p.G133G	NM_001066.2	NP_001057.1	0	1	1	1.903103	P20333	TNR1B_HUMAN		4	488	+	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Silent	SNP	ENST00000376259.3	1	1	hg19	c.399G>T	CCDS145.1	0																																																																																								0.618938		TCGA-FB-AAQ0-01A-31D-A40W-08	0.692	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	1	0	1		2	2	2	0		0	0	22		22	22	1	1.880000	-20.000000	1	0.670000	NM_001066			30	30		99	97	1		1	0		0	0	22	0		1.000000	4.324413e-01	0	1	0	5	0	30	99
ADAMTSL4	54507	broad.mit.edu	37	1	150527952	150527952	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:150527952C>T	ENST00000369038.2	+	6	1483	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C	ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R451C|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R428C|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R428C			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	428					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCGTGGCTTCCGCTTCTATGT	0.607																																						ENST00000369038.2	1.000000	6.000000e-02	1	1.000000e-01	0.160000	0.356559	0.160000	0.140000																										0				32						c.(1282-1284)Cgc>Tgc		ADAMTS-like 4							86.0	76.0	79.0					1																	150527952		2203	4300	6503	SO:0001583	missense	54507	0	0					g.chr1:150527952C>T	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1282C>T	chr1.hg19:g.150527952C>T	ENSP00000358034:p.Arg428Cys	1					ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R451C|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R428C|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R428C	p.R428C			1	2	3	2.497402	Q6UY14	ATL4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)	6	1483	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	0	1	hg19	c.1282C>T	CCDS955.1	0	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291565	0.80914	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.68765	3.82;3.82;-0.35;3.82	4.69	4.69	0.59074	4.690000	4.690000	0.590740	.	.	.	.	.	T	0.77631	0.4159	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.997;0.999	T	0.80717	-0.1258	9	0.87932	D	0	.	15.1631	0.72801	0.0:1.0:0.0:0.0	.	451;451;428;428	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	C	428;428;451;428	ENSP00000358037:R428C;ENSP00000271643:R428C;ENSP00000358035:R451C;ENSP00000358034:R428C	ENSP00000271643:R428C	R	+	1	0	0	ADAMTSL4	148794576	148794576	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.720000	0.54933	2.426000	0.82243	0.561000	0.74099	CGC	0.723688		TCGA-FB-AAQ0-01A-31D-A40W-08	0.607	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	1	0	1		2	2	2	0		0	0	26		26	26	1	1.880000	-3.392392	1	0.670000	NM_019032			8	8		193	190	0		1	1		0	0	26	0		0.989152	4.631670e-01	0	4	0	32	0	8	193
MEF2D	4209	broad.mit.edu	37	1	156437921	156437921	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:156437921G>A	ENST00000348159.4	-	11	1898	c.1418C>T	c.(1417-1419)cCa>cTa	p.P473L	MEF2D_ENST00000360595.3_Missense_Mutation_p.P466L|MEF2D_ENST00000368240.2_Missense_Mutation_p.P466L|MEF2D_ENST00000340875.5_Missense_Mutation_p.P472L|MEF2D_ENST00000353795.3_Missense_Mutation_p.P427L|MEF2D_ENST00000464356.2_Missense_Mutation_p.P465L	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	473					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCCCCGGCTGGGCTGCTGAG	0.706																																						ENST00000348159.4	1.000000	9.000000e-02	1	1.200000e-01	0.170000	0.363063	0.170000	0.160000																										0				15						c.(1417-1419)cCa>cTa		myocyte enhancer factor 2D							33.0	38.0	37.0					1																	156437921		2201	4296	6497	SO:0001583	missense	4209	0	0					g.chr1:156437921G>A	BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.1418C>T	chr1.hg19:g.156437921G>A	ENSP00000271555:p.Pro473Leu	1					MEF2D_ENST00000340875.5_Missense_Mutation_p.P472L|MEF2D_ENST00000368240.2_Missense_Mutation_p.P466L|MEF2D_ENST00000353795.3_Missense_Mutation_p.P427L|MEF2D_ENST00000360595.3_Missense_Mutation_p.P466L|MEF2D_ENST00000464356.2_Missense_Mutation_p.P465L	p.P473L	NM_005920.2	NP_005911.1	1	2	3	2.497402	Q14814	MEF2D_HUMAN		11	1898	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	ENST00000348159.4	1	1	hg19	c.1418C>T	CCDS1143.1	0	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075854	0.55646	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000454816	T;T;T;T;T;T	0.58652	0.32;0.33;0.33;0.72;0.33;0.32	3.83	3.83	0.44106	3.830000	3.830000	0.441060	.	0.187490	0.42420	D	0.000707	T	0.27559	0.0677	N	0.08118	0	0.36720	D	0.881122	P;P;P	0.48911	0.917;0.791;0.867	B;B;P	0.47346	0.401;0.342;0.544	T	0.33240	-0.9876	10	0.66056	D	0.02	-9.2416	8.8543	0.35219	0.0:0.0:0.6507:0.3493	.	478;473;466	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	L	473;472;466;427;466;465	ENSP00000271555:P473L;ENSP00000343159:P472L;ENSP00000357223:P466L;ENSP00000344705:P427L;ENSP00000353803:P466L;ENSP00000388505:P465L	ENSP00000343159:P472L	P	-	2	0	0	MEF2D	154704545	154704545	0.999000	0.42202	0.899000	0.35326	0.845000	0.48019	2.975000	0.49281	1.979000	0.57680	0.313000	0.20887	CCA	0.723688		TCGA-FB-AAQ0-01A-31D-A40W-08	0.706	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080562.2	1	0	1		2	2	2	0		0	0	60		60	60	1	1.880000	-3.225353	1	0.670000	NM_005920			18	17		387	376	0		1	1		0	0	60	0		0.999978	7.052322e-01	0	4	0	50	0	18	387
LHX9	56956	broad.mit.edu	37	1	197889248	197889248	+	Silent	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:197889248C>T	ENST00000367387.4	+	2	746	c.321C>T	c.(319-321)tcC>tcT	p.S107S	LHX9_ENST00000367391.1_Silent_p.S98S|LHX9_ENST00000367390.3_Silent_p.S98S|LHX9_ENST00000561173.1_Silent_p.S113S|LHX9_ENST00000337020.2_Silent_p.S107S	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	107	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.S107S(1)|p.S98S(1)		endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						CCCTCGAGTCCGAGCTCACCT	0.557																																						ENST00000367387.4	1.000000	0	1	1.000000e-02	0.030000	0.259257	0.030000	0.030000																										2	Substitution - coding silent(2)	p.S107S(1)|p.S98S(1)	lung(2)	35						c.(319-321)tcC>tcT		LIM homeobox 9							217.0	205.0	209.0					1																	197889248		2203	4300	6503	SO:0001819	synonymous_variant	56956	0	0					g.chr1:197889248C>T	AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.321C>T	chr1.hg19:g.197889248C>T		1					LHX9_ENST00000367390.3_Silent_p.S98S|LHX9_ENST00000561173.1_Silent_p.S113S|LHX9_ENST00000337020.2_Silent_p.S107S|LHX9_ENST00000367391.1_Silent_p.S98S	p.S107S	NM_020204.2	NP_064589.2	1	2	3	2.531334	Q9NQ69	LHX9_HUMAN		2	746	+			Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Silent	SNP	ENST00000367387.4	0	1	hg19	c.321C>T	CCDS1393.1	0																																																																																								0.725993		TCGA-FB-AAQ0-01A-31D-A40W-08	0.557	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	0	0	1		2	2	2	0		0	0	264		264	260	1	1.880000	-1.845314	0	0.670000	NM_020204			14	13		1358	1338	0		1			0	0	264	0		0.999719	0	0	0	0	0	0	14	1358
WNT3A	89780	broad.mit.edu	37	1	228238515	228238515	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:228238515G>A	ENST00000284523.1	+	3	550	c.472G>A	c.(472-474)Gac>Aac	p.D158N	WNT3A_ENST00000366753.2_Missense_Mutation_p.D158N	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	158					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				CTGTAGCGAGGACATCGAGTT	0.657																																						ENST00000284523.1	1.000000	1.300000e-01	1	1.700000e-01	0.230000	0.402447	0.230000	0.210000																										0				12						c.(472-474)Gac>Aac		wingless-type MMTV integration site family, member 3A							114.0	109.0	110.0					1																	228238515		2203	4300	6503	SO:0001583	missense	89780	0	0					g.chr1:228238515G>A	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.472G>A	chr1.hg19:g.228238515G>A	ENSP00000284523:p.Asp158Asn	1					WNT3A_ENST00000366753.2_Missense_Mutation_p.D158N	p.D158N	NM_033131.3	NP_149122.1	1	2	3	2.531334	P56704	WNT3A_HUMAN		3	550	+		Prostate(94;0.0405)	Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	1	1	hg19	c.472G>A	CCDS1564.1	0	.	.	.	.	.	.	.	.	.	.	G	10.01	1.233798	0.22626	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.73469	-0.75;-0.75	4.78	3.85	0.44370	4.780000	3.850000	0.443700	.	0.056503	0.64402	D	0.000002	T	0.60261	0.2255	N	0.12853	0.265	0.80722	D	1	B;B	0.21309	0.054;0.034	B;B	0.37833	0.259;0.084	T	0.51779	-0.8662	10	0.02654	T	1	.	14.9341	0.70938	0.0:0.144:0.856:0.0	.	158;158	P56704;Q3SY79	WNT3A_HUMAN;.	N	158	ENSP00000284523:D158N;ENSP00000355715:D158N	ENSP00000284523:D158N	D	+	1	0	0	WNT3A	226305138	226305138	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.927000	0.87577	1.010000	0.39314	0.591000	0.81541	GAC	0.725993		TCGA-FB-AAQ0-01A-31D-A40W-08	0.657	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	1	0	1		2	2	2	0		0	0	50		50	45	1	1.880000	-19.925030	1	0.670000	NM_033131			18	18		285	282	0		1			0	0	50	0		0.999983	0	0	0	0	0	0	18	285
HIST3H3	8290	broad.mit.edu	37	1	228612733	228612733	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:228612733C>A	ENST00000366696.1	-	1	293	c.294G>T	c.(292-294)gaG>gaT	p.E98D		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	98					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				CCAGGTAAGACTCGCACGCCT	0.602																																						ENST00000366696.1	1.000000	1.300000e-01	1	1.600000e-01	0.210000	0.387778	0.210000	0.200000																										0				6						c.(292-294)gaG>gaT		histone cluster 3, H3							96.0	87.0	90.0					1																	228612733		2203	4300	6503	SO:0001583	missense	8290	0	0					g.chr1:228612733C>A	Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.294G>T	chr1.hg19:g.228612733C>A	ENSP00000355657:p.Glu98Asp	1						p.E98D	NM_003493.2	NP_003484.1	1	2	3	2.531334	Q16695	H31T_HUMAN		1	293	-		Prostate(94;0.0724)	B2R5K3|Q6FGU4	Missense_Mutation	SNP	ENST00000366696.1	1	1	hg19	c.294G>T	CCDS1572.1	0	.	.	.	.	.	.	.	.	.	.	c	11.28	1.592525	0.28357	.	.	ENSG00000168148	ENST00000366696	T	0.78595	-1.19	3.89	2.98	0.34508	3.890000	2.980000	0.345080	Histone-fold (2);Histone core (1);	0.000000	0.40064	N	0.001184	D	0.91808	0.7408	H	0.99972	5.13	0.34984	D	0.754365	P	0.48911	0.917	P	0.53988	0.739	D	0.94532	0.7737	10	0.87932	D	0	.	10.0089	0.41975	0.0:0.8982:0.0:0.1017	.	98	Q16695	H31T_HUMAN	D	98	ENSP00000355657:E98D	ENSP00000355657:E98D	E	-	3	2	2	HIST3H3	226679356	226679356	1.000000	0.71417	0.975000	0.42487	0.005000	0.04900	2.261000	0.43276	1.202000	0.43218	-0.162000	0.13425	GAG	0.725993		TCGA-FB-AAQ0-01A-31D-A40W-08	0.602	HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096595.2	1	0	1		2	2	2	0		0	0	67		67	64	1	1.880000	-20.000000	1	0.670000	NM_003493			26	26		446	439	0		1	0		0	0	67	0		1.000000	9.624394e-03	0	1	0	2	0	26	446
INADL	10207	broad.mit.edu	37	1	62455974	62455974	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:62455974A>C	ENST00000371158.2	+	28	3919	c.3805A>C	c.(3805-3807)Att>Ctt	p.I1269L	INADL_ENST00000316485.6_Missense_Mutation_p.I1269L|INADL_ENST00000545929.1_5'UTR|INADL_ENST00000543708.1_Missense_Mutation_p.I53L	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1269	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TGTGGTGGGAATTAACCCGGA	0.428																																						ENST00000371158.2	0.210000	7.000000e-02	1.800000e-01	1.000000e-01	0.130000	0.143688	0.130000	0.140000																										0				103						c.(3805-3807)Att>Ctt		InaD-like (Drosophila)							100.0	94.0	96.0					1																	62455974		2203	4300	6503	SO:0001583	missense	10207	0	0					g.chr1:62455974A>C	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3805A>C	chr1.hg19:g.62455974A>C	ENSP00000360200:p.Ile1269Leu	1					INADL_ENST00000316485.6_Missense_Mutation_p.I1269L|INADL_ENST00000545929.1_5'UTR|INADL_ENST00000543708.1_Missense_Mutation_p.I53L	p.I1269L	NM_176877.2	NP_795352	0	1	1	1.853324	Q8NI35	INADL_HUMAN		28	3919	+			O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	1	1	hg19	c.3805A>C	CCDS617.2	0	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175730	0.78564	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000307297;ENST00000543708	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.84	5.84	0.93424	5.840000	5.840000	0.934240	PDZ/DHR/GLGF (4);	0.078603	0.51477	D	0.000096	T	0.61664	0.2365	L	0.56396	1.775	0.80722	D	1	B;P;D;D;D	0.57571	0.028;0.911;0.966;0.973;0.98	P;D;D;D;D	0.81914	0.592;0.986;0.991;0.995;0.995	T	0.61028	-0.7145	10	0.48119	T	0.1	.	16.2302	0.82332	1.0:0.0:0.0:0.0	.	53;728;1269;1269;1269	B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;INADL_HUMAN;.	L	1269;1269;1269;1269;53;53	ENSP00000360200:I1269L;ENSP00000326199:I1269L;ENSP00000307496:I53L;ENSP00000445790:I53L	ENSP00000307496:I53L	I	+	1	0	0	INADL	62228562	62228562	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.256000	0.72473	2.228000	0.72767	0.533000	0.62120	ATT	0.615966		TCGA-FB-AAQ0-01A-31D-A40W-08	0.428	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	1	0	1		2	2	2	0		0	0	76		76	74	1	1.880000	-17.526150	1	0.670000	NM_170605			15	15		268	266	0		1	1		0	0	76	0		0.999877	5.467428e-01	0	2	0	31	0	15	268
CLCA1	1179	broad.mit.edu	37	1	86961301	86961301	+	Missense_Mutation	SNP	C	C	T	rs373476030		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:86961301C>T	ENST00000234701.3	+	13	2407	c.2056C>T	c.(2056-2058)Cgg>Tgg	p.R686W	CLCA1_ENST00000394711.1_Missense_Mutation_p.R686W			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	686					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CGCAGCCAGACGGAGAGTGAT	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		20857	0.0		0.001	False		,,,				2504	0.0					ENST00000234701.3	0.770000	4.700000e-01	7.000000e-01	5.400000e-01	0.610000	0.626173	0.610000	0.620000																										0				38						c.(2056-2058)Cgg>Tgg		chloride channel accessory 1		C	TRP/ARG	0,4406		0,0,2203	92.0	89.0	90.0		2056	3.8	0.0	1		90	2,8598	2.2+/-6.3	0,2,4298	no	missense	CLCA1	NM_001285.3	101	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	686/915	86961301	2,13004	2203	4300	6503	SO:0001583	missense	1179	11	121412	38				g.chr1:86961301C>T		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.2056C>T	chr1.hg19:g.86961301C>T	ENSP00000234701:p.Arg686Trp	1					CLCA1_ENST00000394711.1_Missense_Mutation_p.R686W	p.R686W			0	1	1	1.853324	A8K7I4	CLCA1_HUMAN		13	2407	+		Lung NSC(277;0.239)	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	1	1	hg19	c.2056C>T	CCDS709.1	0	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959770	0.34565	0.0	2.33E-4	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.03152	4.03;4.03	5.69	3.76	0.43208	5.690000	3.760000	0.432080	.	0.549745	0.17770	N	0.162617	T	0.01523	0.0049	L	0.31926	0.97	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.43360	-0.9396	10	0.44086	T	0.13	-0.0463	16.1222	0.81365	0.0:0.747:0.253:0.0	.	686	A8K7I4	CLCA1_HUMAN	W	686	ENSP00000234701:R686W;ENSP00000378200:R686W	ENSP00000234701:R686W	R	+	1	2	2	CLCA1	86733889	86733889	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.487000	0.22356	0.816000	0.34421	-0.175000	0.13238	CGG	0.615966		TCGA-FB-AAQ0-01A-31D-A40W-08	0.453	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	1	0	1		2	2	2	0		0	0	43		43	42	1	1.880000	-20.000000	1	0.670000	NM_001285			47	46		147	147	1		1	0		0	0	43	0		1.000000	8.236657e-01	0	0	0	12	0	47	147
PLD5	200150	broad.mit.edu	37	1	242271086	242271086	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr1:242271086C>T	ENST00000536534.2	-	8	1367	c.1126G>A	c.(1126-1128)Gtt>Att	p.V376I	PLD5_ENST00000442594.2_Missense_Mutation_p.V284I|PLD5_ENST00000427495.1_Missense_Mutation_p.V314I			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	376						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CGAACTCTAACGCTTCGTAAA	0.358																																						ENST00000536534.2	1.000000	7.600000e-01	1	8.300000e-01	0.900000	0.913425	0.900000	0.880000																										0				55						c.(1126-1128)Gtt>Att		phospholipase D family, member 5							98.0	101.0	100.0					1																	242271086		2203	4300	6503	SO:0001583	missense	200150	1	121410	36				g.chr1:242271086C>T	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1126G>A	chr1.hg19:g.242271086C>T	ENSP00000440896:p.Val376Ile	1					PLD5_ENST00000427495.1_Missense_Mutation_p.V314I|PLD5_ENST00000442594.2_Missense_Mutation_p.V284I	p.V376I			1	2	3	2.444263	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)	8	1367	-	Melanoma(84;0.242)		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	1	1	hg19	c.1126G>A	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.329054	0.41197	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.38240	1.15;1.15;1.15	5.38	5.38	0.77491	5.380000	5.380000	0.774910	Phospholipase D/viral envelope (1);	0.067526	0.64402	D	0.000014	T	0.24851	0.0603	L	0.33245	0.995	0.47659	D	0.999489	B;B;B	0.29115	0.108;0.233;0.108	B;B;B	0.20384	0.014;0.029;0.009	T	0.06552	-1.0820	10	0.42905	T	0.14	-16.1879	8.703	0.34338	0.0:0.8646:0.0:0.1354	.	284;376;314	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	I	314;284;376	ENSP00000401285:V314I;ENSP00000414188:V284I;ENSP00000440896:V376I	ENSP00000401285:V314I	V	-	1	0	0	PLD5	240337709	240337709	0.962000	0.33011	0.995000	0.50966	0.992000	0.81027	2.078000	0.41567	2.497000	0.84241	0.643000	0.83706	GTT	0.717345		TCGA-FB-AAQ0-01A-31D-A40W-08	0.358	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	1	0	1		2	2	2	0		0	0	106		106	103	1	1.880000	-20.000000	1	0.670000	NM_152666			151	148		444	442	1		1	0		0	0	106	0		1.000000	0	0	0	0	1	0	151	444
GART	2618	broad.mit.edu	37	21	34878358	34878358	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr21:34878358G>A	ENST00000381831.3	-	19	2769	c.2506C>T	c.(2506-2508)Caa>Taa	p.Q836*	GART_ENST00000381839.3_Nonsense_Mutation_p.Q836*|GART_ENST00000543717.1_Nonsense_Mutation_p.Q388*|GART_ENST00000381815.4_Nonsense_Mutation_p.Q836*	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	836	GART.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	ATATCAATTTGTGCAGAGCTA	0.418																																						ENST00000381831.3	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.045276	0.030000	0.040000																										0				31						c.(2506-2508)Caa>Taa		phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	Pemetrexed(DB00642)						129.0	117.0	121.0					21																	34878358		2203	4300	6503	SO:0001587	stop_gained	2618	0	0					g.chr21:34878358G>A	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2506C>T	chr21.hg19:g.34878358G>A	ENSP00000371253:p.Gln836*	1					GART_ENST00000381815.4_Nonsense_Mutation_p.Q836*|GART_ENST00000543717.1_Nonsense_Mutation_p.Q388*|GART_ENST00000381839.3_Nonsense_Mutation_p.Q836*	p.Q836*	NM_001136005.1	NP_001129477.1	0	1	1	1.809860	P22102	PUR2_HUMAN		19	2769	-			A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Nonsense_Mutation	SNP	ENST00000381831.3	0	1	hg19	c.2506C>T	CCDS13627.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.492713	0.96339	.	.	ENSG00000159131	ENST00000414353;ENST00000381815;ENST00000381831;ENST00000381839;ENST00000543717	.	.	.	6.17	1.05	0.20165	6.170000	1.050000	0.201650	.	0.719210	0.14613	N	0.308899	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-0.0033	11.6304	0.51171	0.1168:0.5242:0.359:0.0	.	.	.	.	X	100;836;836;836;388	.	ENSP00000371236:Q836X	Q	-	1	0	0	GART	33800228	33800228	0.634000	0.27190	0.002000	0.10522	0.413000	0.31143	1.309000	0.33539	-0.070000	0.12908	-0.150000	0.13652	CAA	0.615966		TCGA-FB-AAQ0-01A-31D-A40W-08	0.418	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	0	0	1		13	4	2	1		1	1	120		120	120	1	1.880000	-4.627458	1	0.670000	NM_000819			6	6		388	380	0		0	0		1	0	120	0		0.073541	4.296804e-02	0	0	0	67	0	6	388
PCBP3	54039	broad.mit.edu	37	21	47355186	47355186	+	Silent	SNP	G	G	A	rs576585779	byFrequency	TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr21:47355186G>A	ENST00000400314.1	+	14	1214	c.876G>A	c.(874-876)ccG>ccA	p.P292P	PCBP3_ENST00000400309.1_Silent_p.P291P|PCBP3_ENST00000449640.1_Silent_p.P292P|PCBP3_ENST00000400310.1_Silent_p.P272P|PCBP3_ENST00000400308.1_Silent_p.P266P|PCBP3_ENST00000400304.1_Silent_p.P282P|PRED62_ENST00000593412.1_5'Flank			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	292					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CCAGCCCACCGGCCAGCACTC	0.582													G|||	3	0.000599042	0.0	0.0	5008	,	,		17881	0.001		0.0	False		,,,				2504	0.002					ENST00000400314.1	0.670000	3.100000e-01	5.800000e-01	3.800000e-01	0.470000	0.487020	0.470000	0.470000																										0				17						c.(874-876)ccG>ccA		poly(rC) binding protein 3							62.0	70.0	67.0					21																	47355186		2075	4200	6275	SO:0001819	synonymous_variant	54039	10	121004	39				g.chr21:47355186G>A	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.876G>A	chr21.hg19:g.47355186G>A		1					PCBP3_ENST00000400304.1_Silent_p.P282P|PRED62_ENST00000593412.1_5'Flank|PCBP3_ENST00000400309.1_Silent_p.P291P|PCBP3_ENST00000449640.1_Silent_p.P292P|PCBP3_ENST00000400310.1_Silent_p.P272P|PCBP3_ENST00000400308.1_Silent_p.P266P	p.P292P			0	1	1	1.729511	P57721	PCBP3_HUMAN		14	1214	+	all_hematologic(128;0.24)		A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Silent	SNP	ENST00000400314.1	1	1	hg19	c.876G>A	CCDS42974.2	0																																																																																								0.590418		TCGA-FB-AAQ0-01A-31D-A40W-08	0.582	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2	1	0	1		2	2	2	0		0	0	32		32	32	1	1.880000	-3.540453	1	0.670000				20	20		81	79	1		1	0		0	0	32	0		0.999997	4.312920e-02	0	0	0	2	0	20	81
NEB	4703	broad.mit.edu	37	2	152376273	152376273	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr2:152376273G>A	ENST00000172853.10	-	126	17533	c.17386C>T	c.(17386-17388)Cga>Tga	p.R5796*	NEB_ENST00000427231.2_Nonsense_Mutation_p.R7497*|NEB_ENST00000603639.1_Nonsense_Mutation_p.R7497*|NEB_ENST00000409198.1_Nonsense_Mutation_p.R5796*|NEB_ENST00000604864.1_Nonsense_Mutation_p.R7497*|NEB_ENST00000397345.3_Nonsense_Mutation_p.R7497*			P20929	NEBU_HUMAN	nebulin	5796					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAATTTTCTCGGTATTTAACC	0.353																																						ENST00000172853.10	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.063998	0.050000	0.050000																										0				301						c.(17386-17388)Cga>Tga		nebulin							228.0	197.0	206.0					2																	152376273		1822	4074	5896	SO:0001587	stop_gained	4703	1	120772	28				g.chr2:152376273G>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.17386C>T	chr2.hg19:g.152376273G>A	ENSP00000172853:p.Arg5796*	1					NEB_ENST00000603639.1_Nonsense_Mutation_p.R7497*|NEB_ENST00000409198.1_Nonsense_Mutation_p.R5796*|NEB_ENST00000427231.2_Nonsense_Mutation_p.R7497*|NEB_ENST00000604864.1_Nonsense_Mutation_p.R7497*|NEB_ENST00000397345.3_Nonsense_Mutation_p.R7497*	p.R5796*			0	1	1	1.965343	P20929	NEBU_HUMAN		126	17533	-			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	SNP	ENST00000172853.10	0	1	hg19	c.17386C>T		0	.	.	.	.	.	.	.	.	.	.	G	58	30.674372	0.99977	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	.	.	.	6.16	6.16	0.99307	6.160000	6.160000	0.993070	.	0.109561	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	13.6708	0.62424	0.0:0.0:0.7491:0.2509	.	.	.	.	X	5796;7497;7497;1845;2227;5796	.	ENSP00000172853:R5796X	R	-	1	2	2	NEB	152084519	152084519	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.539000	0.53604	2.937000	0.99478	0.650000	0.86243	CGA	0.635842		TCGA-FB-AAQ0-01A-31D-A40W-08	0.353	NEB-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	34		34	34	1	1.880000	-2.581310	1	0.670000	NM_004543			5	5		246	243	0		1			0	0	34	0		0.935505	0	0	0	0	0	0	5	246
TTN	7273	broad.mit.edu	37	2	179436797	179436797	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr2:179436797G>A	ENST00000591111.1	-	276	69363	c.69139C>T	c.(69139-69141)Cgt>Tgt	p.R23047C	TTN_ENST00000342175.6_Missense_Mutation_p.R15815C|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R15748C|TTN_ENST00000460472.2_Missense_Mutation_p.R15623C|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R24688C|TTN_ENST00000342992.6_Missense_Mutation_p.R22120C|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23047	Fibronectin type-III 67. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTGAAACACGGAAAGAGTAT	0.478																																						ENST00000591111.1	0.820000	4.900000e-01	7.400000e-01	5.600000e-01	0.650000	0.659121	0.650000	0.650000																										0				1448						c.(69139-69141)Cgt>Tgt		titin							76.0	70.0	72.0					2																	179436797		1970	4161	6131	SO:0001583	missense	7273	1	120856	23				g.chr2:179436797G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.69139C>T	chr2.hg19:g.179436797G>A	ENSP00000465570:p.Arg23047Cys	1					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R22120C|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R15623C|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R24688C|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R15815C|TTN_ENST00000359218.5_Missense_Mutation_p.R15748C|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.R23047C			0	1	1	1.965343	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	69363	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.69139C>T		0	.	.	.	.	.	.	.	.	.	.	G	11.78	1.740484	0.30865	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	6.07	5.18	0.71444	6.070000	5.180000	0.714440	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82986	0.5156	H	0.94306	3.52	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88470	0.3061	9	0.87932	D	0	.	16.9885	0.86347	0.0:0.0:0.8717:0.1283	.	15623;15748;15815;23047	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	22120;15623;15815;15748;15621	ENSP00000343764:R22120C;ENSP00000434586:R15623C;ENSP00000340554:R15815C;ENSP00000352154:R15748C	ENSP00000340554:R15815C	R	-	1	0	0	TTN	179145043	179145043	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.586000	0.67503	1.556000	0.49512	0.650000	0.86243	CGT	0.635842		TCGA-FB-AAQ0-01A-31D-A40W-08	0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0		0	0	39		39	38	1	1.880000	-3.917015	1	0.670000	NM_133378			43	43		135	135	1		1			0	0	39	0		1.000000	0	0	0	0	0	0	43	135
KDM3A	55818	broad.mit.edu	37	2	86693827	86693827	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr2:86693827C>T	ENST00000409556.1	+	11	1705	c.1340C>T	c.(1339-1341)tCg>tTg	p.S447L	KDM3A_ENST00000409064.1_Missense_Mutation_p.S447L|KDM3A_ENST00000312912.5_Missense_Mutation_p.S447L|KDM3A_ENST00000485171.1_3'UTR|KDM3A_ENST00000542128.1_Missense_Mutation_p.S395L			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	447			S -> P (in dbSNP:rs34605051). {ECO:0000269|PubMed:17974005}.		androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						CCTTCCCCATCGGATGTTTCA	0.448																																					NSCLC(96;1150 1523 6936 46253 49736)	ENST00000409556.1	0.210000	9.000000e-02	1.800000e-01	1.100000e-01	0.140000	0.153282	0.140000	0.150000																										0				47						c.(1339-1341)tCg>tTg		lysine (K)-specific demethylase 3A							110.0	108.0	109.0					2																	86693827		2203	4300	6503	SO:0001583	missense	55818	7	121410	39				g.chr2:86693827C>T	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1340C>T	chr2.hg19:g.86693827C>T	ENSP00000386660:p.Ser447Leu	0					KDM3A_ENST00000542128.1_Missense_Mutation_p.S395L|KDM3A_ENST00000485171.1_3'UTR|KDM3A_ENST00000312912.5_Missense_Mutation_p.S447L|KDM3A_ENST00000409064.1_Missense_Mutation_p.S447L	p.S447L			0	1	1	1.960098	Q9Y4C1	KDM3A_HUMAN		11	1705	+			D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	1	1	hg19	c.1340C>T	CCDS1990.1	0	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073442	0.36566	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.60548	0.18;0.18;0.18;0.18	5.65	5.65	0.86999	5.650000	5.650000	0.869990	.	0.170906	0.41712	D	0.000825	T	0.42698	0.1214	L	0.27053	0.805	0.09310	N	0.999999	P;P	0.39696	0.683;0.555	B;B	0.29716	0.106;0.049	T	0.45323	-0.9269	10	0.41790	T	0.15	.	16.8834	0.86069	0.0:1.0:0.0:0.0	.	395;447	F5H070;Q9Y4C1	.;KDM3A_HUMAN	L	447;447;447;447;395	ENSP00000386660:S447L;ENSP00000323659:S447L;ENSP00000386516:S447L;ENSP00000438324:S395L	ENSP00000323659:S447L	S	+	2	0	0	KDM3A	86547338	86547338	0.450000	0.25697	0.025000	0.17156	0.248000	0.25809	3.021000	0.49651	2.663000	0.90544	0.563000	0.77884	TCG	0.638515		TCGA-FB-AAQ0-01A-31D-A40W-08	0.448	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	1	0	1		2	2	2	0		0	0	141		141	137	1	1.880000	-3.073959	1	0.670000	NM_018433			28	28		485	480	0		1	1		0	0	141	0		1.000000	6.147601e-01	0	2	0	35	0	28	485
ABCA12	26154	broad.mit.edu	37	2	215891634	215891634	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr2:215891634C>T	ENST00000272895.7	-	10	1309	c.1090G>A	c.(1090-1092)Gcc>Acc	p.A364T	ABCA12_ENST00000389661.4_Missense_Mutation_p.A46T|AC072062.3_ENST00000437897.3_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	364					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTTAAGAGGGCATCTTCAAAG	0.353																																					Ovarian(66;664 1488 5121 34295)	ENST00000272895.7	0.640000	4.700000e-01	6.100000e-01	5.100000e-01	0.550000	0.564331	0.550000	0.560000																										0				139						c.(1090-1092)Gcc>Acc		ATP-binding cassette, sub-family A (ABC1), member 12							108.0	118.0	115.0					2																	215891634		2203	4300	6503	SO:0001583	missense	26154	0	0					g.chr2:215891634C>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1090G>A	chr2.hg19:g.215891634C>T	ENSP00000272895:p.Ala364Thr	1					ABCA12_ENST00000389661.4_Missense_Mutation_p.A46T|AC072062.3_ENST00000437897.3_RNA	p.A364T	NM_173076.2	NP_775099.2	0	1	1	1.993592	Q86UK0	ABCAC_HUMAN		10	1309	-		Renal(323;0.127)	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	1	1	hg19	c.1090G>A	CCDS33372.1	0	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673387	0.29693	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.47528	0.84;0.84	5.78	2.97	0.34412	5.780000	2.970000	0.344120	.	0.691400	0.13955	N	0.351234	T	0.22898	0.0553	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.05886	-1.0858	10	0.19590	T	0.45	.	5.212	0.15322	0.1525:0.6287:0.0:0.2188	.	364;46	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	T	364;46	ENSP00000272895:A364T;ENSP00000374312:A46T	ENSP00000272895:A364T	A	-	1	0	0	ABCA12	215599879	215599879	0.993000	0.37304	0.962000	0.40283	0.878000	0.50629	0.882000	0.28186	0.766000	0.33244	0.655000	0.94253	GCC	0.637183		TCGA-FB-AAQ0-01A-31D-A40W-08	0.353	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	0	0	1		15	2	2	1		1	1	163		163	158	1	1.880000	-20.000000	1	0.670000	NM_173076			139	138		532	526	1		1			1	0	163	0		1.000000	0	0	0	0	0	0	139	532
MORC1	27136	broad.mit.edu	37	3	108746697	108746697	+	Silent	SNP	G	G	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:108746697G>T	ENST00000483760.1	-	17	1648	c.1605C>A	c.(1603-1605)ggC>ggA	p.G535G	MORC1_ENST00000232603.5_Silent_p.G535G					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TGCTCATGGTGCCCAGTGGGA	0.398																																						ENST00000483760.1	0.210000	6.000000e-02	1.700000e-01	9.000000e-02	0.120000	0.133220	0.120000	0.130000																										0				105						c.(1603-1605)ggC>ggA		MORC family CW-type zinc finger 1							158.0	147.0	151.0					3																	108746697		2203	4300	6503	SO:0001819	synonymous_variant	27136	2	121408	33				g.chr3:108746697G>T	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1605C>A	chr3.hg19:g.108746697G>T		0					MORC1_ENST00000232603.5_Silent_p.G535G	p.G535G			0	0	0	2.020690				17	1648	-				Silent	SNP	ENST00000483760.1	1	1	hg19	c.1605C>A		0																																																																																								0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.398	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1	1	0	1		2	2	2	0		0	0	43		43	42	1	1.880000	-3.966566	1	0.670000				12	12		267	264	0		1			0	0	43	0		0.999115	0	0	0	0	0	0	12	267
CAND2	23066	broad.mit.edu	37	3	12869094	12869094	+	Silent	SNP	C	C	T	rs367749511		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:12869094C>T	ENST00000456430.2	+	13	3407	c.3366C>T	c.(3364-3366)taC>taT	p.Y1122Y	CAND2_ENST00000295989.5_Silent_p.Y1005Y	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	1122					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AGGACCACTACGACATCCGGG	0.562																																					GBM(43;676 868 1633 6395 37496)	ENST00000456430.2	0.780000	5.200000e-01	7.200000e-01	5.800000e-01	0.640000	0.655444	0.640000	0.650000																										0				37						c.(3364-3366)taC>taT		cullin-associated and neddylation-dissociated 2 (putative)		C	,	1,4065		0,1,2032	108.0	108.0	108.0		3366,3015	-6.0	0.9	3		108	0,8350		0,0,4175	no	coding-synonymous,coding-synonymous	CAND2	NM_001162499.1,NM_012298.2	,	0,1,6207	TT,TC,CC		0.0,0.0246,0.0081	,	1122/1237,1005/1120	12869094	1,12415	2033	4175	6208	SO:0001819	synonymous_variant	23066	2	120938	35				g.chr3:12869094C>T		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.3366C>T	chr3.hg19:g.12869094C>T		0					CAND2_ENST00000295989.5_Silent_p.Y1005Y	p.Y1122Y	NM_001162499.1	NP_001155971.1	0	0	0	2.020690	O75155	CAND2_HUMAN		13	3407	+			B9EGM9|E9KL24	Silent	SNP	ENST00000456430.2	1	1	hg19	c.3366C>T	CCDS54554.1	0																																																																																								0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.562	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	1	0	1		2	2	2	0		0	0	52		52	52	1	1.880000	-20.000000	1	0.670000	XM_371617			70	68		240	235	1		1		0	0	0	52	0		1.000000	0	0	0	1	0	0	70	240
RPL32	6161	broad.mit.edu	37	3	12877678	12877678	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:12877678C>T	ENST00000429711.2	-	4	422	c.323G>A	c.(322-324)cGc>cAc	p.R108H	RPL32_ENST00000396953.2_Missense_Mutation_p.R108H|RPL32_ENST00000435983.1_Missense_Mutation_p.R108H|RPL32_ENST00000396957.1_Missense_Mutation_p.R108H|RPL32_ENST00000273223.6_Missense_Mutation_p.R126H	NM_000994.3	NP_000985.1	P62910	RL32_HUMAN	ribosomal protein L32	108					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						GATGGCTTTGCGGTTCTTGGA	0.507																																						ENST00000429711.2	0.100000	0	7.000000e-02	2.000000e-02	0.040000	0.050897	0.040000	0.040000																										0				6						c.(322-324)cGc>cAc		ribosomal protein L32							74.0	66.0	68.0					3																	12877678		2203	4298	6501	SO:0001583	missense	6161	0	0					g.chr3:12877678C>T	CA436299, CF124158, CR608027	CCDS2614.1	3q13.3-q21	2011-04-06			ENSG00000144713	ENSG00000144713		"""L ribosomal proteins"""	10336	protein-coding gene	gene with protein product						9284913	Standard	NM_001007073		Approved	L32	uc003bxl.3	P62910	OTTHUMG00000129804	ENST00000429711.2:c.323G>A	chr3.hg19:g.12877678C>T	ENSP00000416429:p.Arg108His	0					RPL32_ENST00000396953.2_Missense_Mutation_p.R108H|RPL32_ENST00000396957.1_Missense_Mutation_p.R108H|RPL32_ENST00000435983.1_Missense_Mutation_p.R108H|RPL32_ENST00000273223.6_Missense_Mutation_p.R126H	p.R108H	NM_000994.3	NP_000985.1	0	0	0	2.020690	P62910	RL32_HUMAN		4	422	-			B2R4Q3|P02433	Missense_Mutation	SNP	ENST00000429711.2	0	1	hg19	c.323G>A	CCDS2614.1	0	.	.	.	.	.	.	.	.	.	.	C	22.7	4.323886	0.81580	.	.	ENSG00000144713	ENST00000429711;ENST00000396957;ENST00000273223;ENST00000435983;ENST00000396953;ENST00000457131	.	.	.	5.41	5.41	0.78517	5.410000	5.410000	0.785170	.	0.000000	0.85682	D	0.000000	T	0.65647	0.2711	L	0.58969	1.84	0.80722	D	1	B	0.19817	0.039	B	0.22386	0.039	T	0.62553	-0.6830	9	0.48119	T	0.1	0.0875	17.0408	0.86489	0.0:1.0:0.0:0.0	.	108	P62910	RL32_HUMAN	H	108;108;126;108;108;108	.	ENSP00000339064:R126H	R	-	2	0	0	RPL32	12852678	12852678	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.916000	0.69981	2.684000	0.91462	0.655000	0.94253	CGC	0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.507	RPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252032.2	0	0	1		2	2	2	0		0	0	75		75	73	1	1.880000	-2.435056	0	0.670000	NM_000994			5	5		332	325	0		1	1		0	0	75	0		0.934489	1	0	9	0	7668	0	5	332
ALG1L	200810	broad.mit.edu	37	3	125649457	125649457	+	Silent	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:125649457C>T	ENST00000340333.3	-	5	454	c.291G>A	c.(289-291)gtG>gtA	p.V97V	FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	97							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CTTCATGTTTCACCAGCTCAT	0.597																																						ENST00000340333.3	0.300000	1.000000e-01	2.500000e-01	1.400000e-01	0.190000	0.202676	0.190000	0.190000																										0				4						c.(289-291)gtG>gtA		ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like							51.0	55.0	53.0					3																	125649457		1368	2309	3677	SO:0001819	synonymous_variant	200810	0	0					g.chr3:125649457C>T	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.291G>A	chr3.hg19:g.125649457C>T		0					FAM86JP_ENST00000485843.1_RNA	p.V97V	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	0	0	0	2.020690	Q6GMV1	ALG1L_HUMAN		5	454	-			D3DNA5	Silent	SNP	ENST00000340333.3	0	1	hg19	c.291G>A	CCDS33840.1	0																																																																																								0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.597	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356347.1	1	0	1		2	2	2	0		0	0	59		59	71	1	1.880000	-17.744980	1	0.670000	NM_001015050			14	13		197	184	0		1	0		0	0	59	0		0.999652	6.381540e-02	0	0	0	6	0	14	197
CNBP	7555	broad.mit.edu	37	3	128889325	128889325	+	Missense_Mutation	SNP	G	G	A	rs190320743		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:128889325G>A	ENST00000422453.2	-	5	665	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W	CNBP_ENST00000446936.2_Missense_Mutation_p.R164W|CNBP_ENST00000441626.2_Missense_Mutation_p.R171W|CNBP_ENST00000504813.1_Missense_Mutation_p.R159W|CNBP_ENST00000502976.1_Missense_Mutation_p.R162W|CNBP_ENST00000451728.2_Missense_Mutation_p.R170W|CNBP_ENST00000500450.2_Missense_Mutation_p.R152W	NM_001127192.1|NM_001127193.1|NM_003418.4	NP_001120664.1|NP_001120665.1|NP_003409.1	P62633	CNBP_HUMAN	CCHC-type zinc finger, nucleic acid binding protein	169					cholesterol biosynthetic process (GO:0006695)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			biliary_tract(1)|endometrium(1)|kidney(1)|lung(2)	5						GTGCATTCCCGTGCAAGGTGC	0.448																																						ENST00000422453.2	0.050000	0	4.000000e-02	0	0.010000	0.025180	0.010000	0.020000																										0				5						c.(505-507)Cgg>Tgg		CCHC-type zinc finger, nucleic acid binding protein							177.0	165.0	169.0					3																	128889325		2203	4300	6503	SO:0001583	missense	7555	0	0					g.chr3:128889325G>A	U19765	CCDS3056.1, CCDS46906.1, CCDS46907.1, CCDS46908.1, CCDS54637.1	3q21	2013-01-09	2006-06-29	2006-06-29				"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCHC domain containing"""	13164	protein-coding gene	gene with protein product		116955	"""zinc finger protein 9 (a cellular retroviral nucleic acid binding protein)"", ""zinc finger protein 9"""	DM2, ZNF9		2249857, 11486088	Standard	NM_003418		Approved	RNF163, ZCCHC22, CNBP1	uc021xdw.1	P62633		ENST00000422453.2:c.505C>T	chr3.hg19:g.128889325G>A	ENSP00000410619:p.Arg169Trp	0					CNBP_ENST00000446936.2_Missense_Mutation_p.R164W|CNBP_ENST00000451728.2_Missense_Mutation_p.R170W|CNBP_ENST00000504813.1_Missense_Mutation_p.R159W|CNBP_ENST00000500450.2_Missense_Mutation_p.R152W|CNBP_ENST00000441626.2_Missense_Mutation_p.R171W|CNBP_ENST00000502976.1_Missense_Mutation_p.R162W	p.R169W	NM_001127192.1|NM_001127193.1|NM_003418.4	NP_001120664.1|NP_001120665.1|NP_003409.1	0	0	0	2.020690	P62633	CNBP_HUMAN		5	665	-			A8K7V4|B2RAV9|B4DP17|D3DNB9|D3DNC0|D3DNC1|E9PDR7|P20694|Q4JGY0|Q4JGY1|Q5QJR0|Q5U0E9|Q6PJI7|Q96NV3	Missense_Mutation	SNP	ENST00000422453.2	0	1	hg19	c.505C>T	CCDS3056.1	0	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570676	0.65765	.	.	ENSG00000169714	ENST00000502976;ENST00000422453;ENST00000451728;ENST00000446936;ENST00000500450;ENST00000504813;ENST00000441626	.	.	.	6.08	6.08	0.98989	6.080000	6.080000	0.989890	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (3);	0.128051	0.52532	D	0.000070	D	0.83589	0.5287	M	0.82823	2.61	0.58432	D	0.999993	D;D;D	0.76494	0.994;0.993;0.999	P;P;D	0.72338	0.837;0.821;0.977	D	0.84859	0.0818	9	0.87932	D	0	-16.7435	18.1659	0.89727	0.0:0.0:1.0:0.0	.	152;162;169	B4DP17;P62633-2;P62633	.;.;CNBP_HUMAN	W	162;169;170;164;152;159;171	.	ENSP00000410619:R169W	R	-	1	2	2	CNBP	130372015	130372015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.578000	0.74032	2.894000	0.99253	0.591000	0.81541	CGG	0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.448	CNBP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358419.1	0	0	1		2	2	2	0		0	0	152		152	148	1	1.880000	-2.347363	0	0.670000	NM_003418			6	6		760	757	0		1	1		0	0	152	0		0.964629	9.533215e-01	0	4	0	693	0	6	760
TRIM42	287015	broad.mit.edu	37	3	140406735	140406735	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:140406735C>T	ENST00000286349.3	+	3	1402	c.1211C>T	c.(1210-1212)tCc>tTc	p.S404F		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	404						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CTAGAAGTGTCCAGGCAGAAG	0.433																																						ENST00000286349.3	0.970000	6.800000e-01	9.000000e-01	7.500000e-01	0.820000	0.830478	0.820000	0.830000																										0				69						c.(1210-1212)tCc>tTc		tripartite motif containing 42							100.0	98.0	99.0					3																	140406735		2203	4300	6503	SO:0001583	missense	287015	0	0					g.chr3:140406735C>T	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1211C>T	chr3.hg19:g.140406735C>T	ENSP00000286349:p.Ser404Phe	0						p.S404F	NM_152616.4	NP_689829.3	0	0	0	2.020690	Q8IWZ5	TRI42_HUMAN		3	1402	+			A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	1	1	hg19	c.1211C>T	CCDS3113.1	0	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134764	0.37728	.	.	ENSG00000155890	ENST00000286349	T	0.39229	1.09	5.33	3.43	0.39272	5.330000	3.430000	0.392720	.	0.666605	0.14463	N	0.318026	T	0.19525	0.0469	N	0.08118	0	0.28555	N	0.911407	B	0.33379	0.41	B	0.28916	0.096	T	0.03784	-1.1004	10	0.56958	D	0.05	-11.2766	5.5628	0.17154	0.1968:0.7047:0.0:0.0985	.	404	Q8IWZ5	TRI42_HUMAN	F	404	ENSP00000286349:S404F	ENSP00000286349:S404F	S	+	2	0	0	TRIM42	141889425	141889425	0.985000	0.35326	1.000000	0.80357	0.991000	0.79684	1.214000	0.32419	2.676000	0.91093	0.555000	0.69702	TCC	0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.433	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	1	0	1		2	2	2	0		0	0	67		67	66	1	1.880000	-7.121661	1	0.670000	NM_152616			89	89		221	219	1		1		1	0	0	67	326		1.000000	0	1	0	165	0	357	89	221
DHX36	170506	broad.mit.edu	37	3	154018452	154018452	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr3:154018452C>T	ENST00000496811.1	-	11	1472	c.1392G>A	c.(1390-1392)atG>atA	p.M464I	DHX36_ENST00000329463.5_Missense_Mutation_p.M464I|DHX36_ENST00000544526.1_Missense_Mutation_p.M464I|DHX36_ENST00000308361.6_Missense_Mutation_p.M464I	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	464					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CATCCTCCATCATTTCTATAA	0.313																																						ENST00000496811.1	0.310000	1.400000e-01	2.700000e-01	1.800000e-01	0.220000	0.228059	0.220000	0.220000																										0				35						c.(1390-1392)atG>atA		DEAH (Asp-Glu-Ala-His) box polypeptide 36							121.0	116.0	118.0					3																	154018452		2203	4298	6501	SO:0001583	missense	170506	0	0					g.chr3:154018452C>T	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1392G>A	chr3.hg19:g.154018452C>T	ENSP00000417078:p.Met464Ile	0					DHX36_ENST00000308361.6_Missense_Mutation_p.M464I|DHX36_ENST00000329463.5_Missense_Mutation_p.M464I|DHX36_ENST00000544526.1_Missense_Mutation_p.M464I	p.M464I	NM_020865.2	NP_065916.2	0	0	0	2.020690	Q9H2U1	DHX36_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)	11	1472	-			B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	1	1	hg19	c.1392G>A	CCDS3171.1	0	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785057	0.31593	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.02158	4.42;4.42;4.42;4.42;4.42	5.75	5.75	0.90469	5.750000	5.750000	0.904690	.	0.149837	0.85682	D	0.000000	T	0.02533	0.0077	L	0.31526	0.94	0.40269	D	0.978263	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.12837	0.008;0.008;0.004	T	0.58364	-0.7649	10	0.21014	T	0.42	.	15.0769	0.72084	0.1418:0.8582:0.0:0.0	.	464;464;464	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	I	464;464;464;464;378	ENSP00000417078:M464I;ENSP00000309296:M464I;ENSP00000444247:M464I;ENSP00000330113:M464I;ENSP00000419862:M378I	ENSP00000309296:M464I	M	-	3	0	0	DHX36	155501146	155501146	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.423000	0.52756	2.866000	0.98385	0.650000	0.86243	ATG	0.658562		TCGA-FB-AAQ0-01A-31D-A40W-08	0.313	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	1	0	1		2	2	2	0		0	0	95		95	92	1	1.880000	-3.318794	1	0.670000	NM_020865			29	28		348	345	0		1	0		0	0	95	0		1.000000	3.323271e-01	0	1	0	14	0	29	348
GBA3	57733	broad.mit.edu	37	4	22737642	22737642	+	RNA	SNP	G	G	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr4:22737642G>T	ENST00000503442.1	+	0	188				GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TTGTGTCTGGGACACATTTAC	0.448																																						ENST00000503442.1	1.000000	7.700000e-01	1	8.500000e-01	0.940000	0.935231	0.940000	1.000000																										0				33								glucosidase, beta, acid 3 (gene/pseudogene)							112.0	115.0	114.0					4																	22737642		1931	4143	6074			57733	0	0					g.chr4:22737642G>T	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		chr4.hg19:g.22737642G>T		1					GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA		NM_001128432.2	NP_001121904.1	0	1	1	1.844112	Q9H227	GBA3_HUMAN		0	188	+			Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	RNA	SNP	ENST00000503442.1	0	1	hg19			1																																																																																								0.631758		TCGA-FB-AAQ0-01A-31D-A40W-08	0.448	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2	0	0	1		2	2	2	0		0	0	41		41	40	1	1.880000	-20.000000	1	0.670000				76	74		138	135	0		1			0	0	41	0		1.000000	0	0	0	0	0	0	76	138
GRID2	2895	broad.mit.edu	37	4	94376883	94376883	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr4:94376883G>A	ENST00000282020.4	+	11	1874	c.1616G>A	c.(1615-1617)cGt>cAt	p.R539H	GRID2_ENST00000510992.1_Missense_Mutation_p.R444H	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	539					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TTTACGACACGTTACATGGAC	0.443																																						ENST00000282020.4	0.110000	2.000000e-02	9.000000e-02	4.000000e-02	0.050000	0.066697	0.050000	0.060000																										0				100						c.(1615-1617)cGt>cAt		glutamate receptor, ionotropic, delta 2							160.0	144.0	149.0					4																	94376883		2203	4300	6503	SO:0001583	missense	2895	2	121412	32				g.chr4:94376883G>A	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1616G>A	chr4.hg19:g.94376883G>A	ENSP00000282020:p.Arg539His	1					GRID2_ENST00000510992.1_Missense_Mutation_p.R444H	p.R539H	NM_001510.2	NP_001501.2	0	1	1	1.921047	O43424	GRID2_HUMAN		11	1874	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	0	1	hg19	c.1616G>A	CCDS3637.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.086141	0.94100	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.27402	1.67;1.67	5.97	5.97	0.96955	5.970000	5.970000	0.969550	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.59851	0.2224	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.59198	-0.7499	10	0.66056	D	0.02	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	444;539	E9PH24;O43424	.;GRID2_HUMAN	H	539;444	ENSP00000282020:R539H;ENSP00000421257:R444H	ENSP00000282020:R539H	R	+	2	0	0	GRID2	94595906	94595906	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.869000	0.99810	2.836000	0.97738	0.655000	0.94253	CGT	0.630376		TCGA-FB-AAQ0-01A-31D-A40W-08	0.443	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2	0	0	1		2	2	2	0		0	0	70		70	69	1	1.880000	-3.042159	1	0.670000				9	10		388	387	0		1			0	0	70	0		0.994343	0	0	0	0	0	0	9	388
TBC1D9	23158	broad.mit.edu	37	4	141543578	141543578	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr4:141543578C>T	ENST00000442267.2	-	21	3646	c.3572G>A	c.(3571-3573)cGg>cAg	p.R1191Q		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1191							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CTGGCCGCTCCGCACCAGGAC	0.662																																						ENST00000442267.2	1.000000	1.400000e-01	1	2.000000e-01	0.280000	0.409961	0.280000	0.260000																										0				31						c.(3571-3573)cGg>cAg		TBC1 domain family, member 9 (with GRAM domain)							30.0	36.0	34.0					4																	141543578		2097	4196	6293	SO:0001583	missense	23158	1	121040	27				g.chr4:141543578C>T	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3572G>A	chr4.hg19:g.141543578C>T	ENSP00000411197:p.Arg1191Gln	1						p.R1191Q	NM_015130.2	NP_055945.2	0	2	2	2.050351	Q6ZT07	TBCD9_HUMAN		21	3646	-	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	0	1	hg19	c.3572G>A	CCDS47136.1	0	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101168	0.56183	.	.	ENSG00000109436	ENST00000442267	T	0.07908	3.15	5.01	4.17	0.49024	5.010000	4.170000	0.490240	.	0.055070	0.85682	D	0.000000	T	0.03959	0.0111	N	0.12182	0.205	0.58432	D	0.999999	D	0.57257	0.979	B	0.36378	0.223	T	0.53380	-0.8447	10	0.13108	T	0.6	.	13.3474	0.60582	0.0:0.9239:0.0:0.0761	.	1191	Q6ZT07	TBCD9_HUMAN	Q	1191	ENSP00000411197:R1191Q	ENSP00000411197:R1191Q	R	-	2	0	0	TBC1D9	141763028	141763028	1.000000	0.71417	0.971000	0.41717	0.956000	0.61745	5.760000	0.68793	1.109000	0.41680	0.655000	0.94253	CGG	0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.662	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	0	0	1		2	2	2	0		0	0	24		24	24	1	1.880000	-16.622210	1	0.670000	NM_015130			11	11		118	116	0		1	1		0	0	24	0		0.998441	4.619758e-02	0	2	0	2	0	11	118
PCDHB13	56123	broad.mit.edu	37	5	140594777	140594777	+	Missense_Mutation	SNP	C	C	T	rs148992616		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr5:140594777C>T	ENST00000341948.4	+	1	1269	c.1082C>T	c.(1081-1083)gCg>gTg	p.A361V		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	361	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A361V(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGAGAACGCGCCTGAAACT	0.448																																						ENST00000341948.4	1.000000	4.000000e-02	1.000000e-01	6.000000e-02	0.070000	0.126166	0.070000	0.080000																										1	Substitution - Missense(1)	p.A361V(1)	haematopoietic_and_lymphoid_tissue(1)	66						c.(1081-1083)gCg>gTg		protocadherin beta 13							195.0	183.0	187.0					5																	140594777		2203	4300	6503	SO:0001583	missense	56123	0	0					g.chr5:140594777C>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1082C>T	chr5.hg19:g.140594777C>T	ENSP00000345491:p.Ala361Val	0						p.A361V	NM_018933.2	NP_061756.1	1	2	3	2.163442	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1269	+			A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	1	1	hg19	c.1082C>T	CCDS4255.1	0	.	.	.	.	.	.	.	.	.	.	c	16.74	3.206586	0.58343	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.03663	3.85	3.5	2.59	0.31030	3.500000	2.590000	0.310300	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.08447	0.0210	M	0.66506	2.035	0.09310	N	1	P	0.48911	0.917	P	0.49252	0.604	T	0.15752	-1.0426	9	0.66056	D	0.02	.	8.1381	0.31067	0.0:0.7799:0.0:0.2201	.	361	Q9Y5F0	PCDBD_HUMAN	V	361	ENSP00000345491:A361V	ENSP00000345491:A361V	A	+	2	0	0	PCDHB13	140574961	140574961	0.000000	0.05858	0.000000	0.03702	0.835000	0.47333	1.135000	0.31454	0.550000	0.28991	0.298000	0.19748	GCG	0.676502		TCGA-FB-AAQ0-01A-31D-A40W-08	0.448	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	0	0	1		2	2	2	0		0	0	243		243	240	1	1.880000	-2.683679	1	0.670000	NM_018933			28	27		1032	1020	0		1	0		0	0	243	0		1.000000	2.421628e-02	0	0	0	9	0	28	1032
UTRN	7402	broad.mit.edu	37	6	144759999	144759999	+	Missense_Mutation	SNP	A	A	C			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr6:144759999A>C	ENST00000367545.3	+	11	1360	c.1360A>C	c.(1360-1362)Aaa>Caa	p.K454Q		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	454	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGATGATGTAAAATCTCTACA	0.433																																						ENST00000367545.3	0.970000	6.400000e-01	8.900000e-01	7.200000e-01	0.800000	0.811570	0.800000	0.810000																										0				148						c.(1360-1362)Aaa>Caa		utrophin							89.0	87.0	88.0					6																	144759999		2203	4300	6503	SO:0001583	missense	7402	0	0					g.chr6:144759999A>C	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.1360A>C	chr6.hg19:g.144759999A>C	ENSP00000356515:p.Lys454Gln	1						p.K454Q	NM_007124.2	NP_009055.2	0	0	0	1.833958	P46939	UTRO_HUMAN		11	1360	+		Ovarian(120;0.218)	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	1	1	hg19	c.1360A>C	CCDS34547.1	0	.	.	.	.	.	.	.	.	.	.	A	3.826	-0.036673	0.07497	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.47869	0.83	5.41	-8.38	0.00973	5.410000	-8.380000	0.009730	.	1.903270	0.02816	N	0.124960	T	0.07143	0.0181	N	0.00926	-1.1	0.09310	N	0.999998	B	0.02656	0.0	B	0.11329	0.006	T	0.09487	-1.0672	10	0.26408	T	0.33	.	16.917	0.86154	0.1863:0.6844:0.1293:0.0	.	454	P46939	UTRO_HUMAN	Q	454	ENSP00000356515:K454Q	ENSP00000356499:K454Q	K	+	1	0	0	UTRN	144801692	144801692	0.904000	0.30761	0.000000	0.03702	0.000000	0.00434	0.546000	0.23284	-1.159000	0.02807	-1.164000	0.01763	AAA	0.624744		TCGA-FB-AAQ0-01A-31D-A40W-08	0.433	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1	1	0	1		2	2	2	0		0	0	54		54	53	1	1.880000	-20.000000	1	0.670000				66	65		148	146	1		1	0		0	0	54	0		1.000000	9.720089e-02	0	0	0	2	0	66	148
IYD	389434	broad.mit.edu	37	6	150715311	150715311	+	Missense_Mutation	SNP	G	G	A	rs377381152		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr6:150715311G>A	ENST00000344419.3	+	4	747	c.607G>A	c.(607-609)Gca>Aca	p.A203T	IYD_ENST00000425615.3_Missense_Mutation_p.A148T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	203					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TGGTTTCGCCGCAAATGGCAA	0.433																																						ENST00000344419.3	0.070000	0	6.000000e-02	1.000000e-02	0.030000	0.040920	0.030000	0.040000																										0				15						c.(607-609)Gca>Aca		iodotyrosine deiodinase		A	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	122.0	109.0	113.0		607,607,607	2.1	0.0	6		113	0,8600		0,0,4300	no	missense,missense,missense	IYD	NM_001164694.1,NM_001164695.1,NM_203395.2	58,58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	203/294,203/248,203/290	150715311	1,13005	2203	4300	6503	SO:0001583	missense	389434	3	121412	38				g.chr6:150715311G>A	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.607G>A	chr6.hg19:g.150715311G>A	ENSP00000343763:p.Ala203Thr	1					IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T|IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T	p.A203T	NM_203395.2	NP_981932.1	0	0	0	1.833958	Q6PHW0	IYD1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.215)	4	747	+		Ovarian(120;0.028)	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	0	1	hg19	c.607G>A	CCDS5227.1	0	.	.	.	.	.	.	.	.	.	.	g	5.689	0.311597	0.10789	2.27E-4	0.0	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320;ENST00000425615	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	6.17	2.1	0.27182	6.170000	2.100000	0.271820	Nitroreductase-like (3);	0.509560	0.22264	N	0.062376	T	0.43055	0.1230	L	0.46885	1.475	0.09310	N	1	B;B;B;B	0.20261	0.004;0.043;0.001;0.002	B;B;B;B	0.18561	0.003;0.022;0.001;0.005	T	0.24548	-1.0157	10	0.27785	T	0.31	-23.7178	1.2452	0.01971	0.2372:0.2256:0.3896:0.1475	.	121;203;203;203	Q2VPV9;C9JFW2;Q6PHW0-3;Q6PHW0	.;.;.;IYD1_HUMAN	T	203;203;203;203;203;148	ENSP00000229447:A203T;ENSP00000343763:A203T;ENSP00000376085:A203T;ENSP00000376084:A203T;ENSP00000441276:A203T;ENSP00000390081:A148T	ENSP00000229447:A203T	A	+	1	0	0	IYD	150757004	150757004	0.019000	0.18553	0.001000	0.08648	0.174000	0.22865	0.255000	0.18333	0.496000	0.27904	-0.119000	0.15052	GCA	0.624744		TCGA-FB-AAQ0-01A-31D-A40W-08	0.433	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	0	0	1		2	2	2	0		0	0	126		126	125	1	1.880000	-1.972326	0	0.670000	NM_203395			6	6		440	434	0		1	0		0	0	126	0		0.963719	2.662797e-03	0	0	0	5	0	6	440
TIAM2	26230	broad.mit.edu	37	6	155575617	155575617	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr6:155575617C>T	ENST00000461783.3	+	28	5651	c.4378C>T	c.(4378-4380)Cgt>Tgt	p.R1460C	TIAM2_ENST00000456877.2_Missense_Mutation_p.R772C|TIAM2_ENST00000367174.2_Missense_Mutation_p.R836C|TIAM2_ENST00000275246.7_Missense_Mutation_p.R385C|TIAM2_ENST00000528391.2_Missense_Mutation_p.R796C|TIAM2_ENST00000318981.5_Missense_Mutation_p.R1460C|TIAM2_ENST00000360366.4_Missense_Mutation_p.R1484C|TIAM2_ENST00000529824.2_Missense_Mutation_p.R1489C|TIAM2_ENST00000456144.1_Missense_Mutation_p.R1489C|RP11-477D19.2_ENST00000435295.1_RNA			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1460	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GAACTTCAGGCGTCACATAAA	0.458																																						ENST00000461783.3	0.820000	5.600000e-01	7.600000e-01	6.200000e-01	0.680000	0.695263	0.680000	0.690000																										0				65						c.(4378-4380)Cgt>Tgt		T-cell lymphoma invasion and metastasis 2							150.0	132.0	138.0					6																	155575617		2203	4300	6503	SO:0001583	missense	26230	4	121412	38				g.chr6:155575617C>T		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.4378C>T	chr6.hg19:g.155575617C>T	ENSP00000437188:p.Arg1460Cys	1					TIAM2_ENST00000360366.4_Missense_Mutation_p.R1484C|RP11-477D19.2_ENST00000435295.1_RNA|TIAM2_ENST00000275246.7_Missense_Mutation_p.R385C|TIAM2_ENST00000367174.2_Missense_Mutation_p.R836C|TIAM2_ENST00000318981.5_Missense_Mutation_p.R1460C|TIAM2_ENST00000528391.2_Missense_Mutation_p.R796C|TIAM2_ENST00000456144.1_Missense_Mutation_p.R1489C|TIAM2_ENST00000456877.2_Missense_Mutation_p.R772C|TIAM2_ENST00000529824.2_Missense_Mutation_p.R1489C	p.R1460C			0	0	0	1.833958	Q8IVF5	TIAM2_HUMAN		28	5651	+		Ovarian(120;0.196)	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	1	1	hg19	c.4378C>T	CCDS34558.1	0	.	.	.	.	.	.	.	.	.	.	C	23.3	4.400918	0.83120	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391;ENST00000275246	T;T;T;T;T;T;T;T;T	0.13778	3.1;2.94;3.1;2.91;3.04;2.94;2.92;2.69;2.56	5.66	4.77	0.60923	5.660000	4.770000	0.609230	.	0.051437	0.85682	D	0.000000	T	0.25382	0.0617	M	0.66939	2.045	0.54753	D	0.999982	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.997;0.994	T	0.03077	-1.1075	10	0.72032	D	0.01	.	14.0455	0.64702	0.151:0.849:0.0:0.0	.	796;1489;1484;1460	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	C	1460;1706;1489;1460;836;1484;1489;772;796;385	ENSP00000437188:R1460C;ENSP00000407746:R1489C;ENSP00000327315:R1460C;ENSP00000356142:R836C;ENSP00000353528:R1484C;ENSP00000433348:R1489C;ENSP00000407183:R772C;ENSP00000435335:R796C;ENSP00000275246:R385C	ENSP00000275246:R385C	R	+	1	0	0	TIAM2	155617309	155617309	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	4.413000	0.59795	1.342000	0.45619	0.650000	0.86243	CGT	0.624744		TCGA-FB-AAQ0-01A-31D-A40W-08	0.458	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	1	0	1		2	2	2	0		0	0	76		76	76	1	1.880000	-5.666547	1	0.670000	NM_012454			81	80		226	226	0		1	0		0	0	76	0		1.000000	1.747724e-01	0	0	0	3	0	81	226
TAP1	6890	broad.mit.edu	37	6	32820990	32820990	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr6:32820990C>T	ENST00000354258.4	-	1	765	c.604G>A	c.(604-606)Gtc>Atc	p.V202I	TAP1_ENST00000425148.2_5'Flank|PSMB9_ENST00000453265.2_5'Flank|PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000395330.1_Intron	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	202					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GCATAACTGACAACGAAGGCG	0.657																																						ENST00000354258.4	0.550000	1.400000e-01	4.300000e-01	2.100000e-01	0.310000	0.327435	0.310000	0.290000																										0				21						c.(604-606)Gtc>Atc		transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	Lapatinib(DB01259)						25.0	22.0	23.0					6																	32820990		1509	2708	4217	SO:0001583	missense	6890	0	0					g.chr6:32820990C>T		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.604G>A	chr6.hg19:g.32820990C>T	ENSP00000346206:p.Val202Ile	0					PSMB9_ENST00000395330.1_Intron|PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000453265.2_5'Flank|TAP1_ENST00000425148.2_5'Flank	p.V202I	NM_000593.5	NP_000584.2	0	0	0	1.907416	Q03518	TAP1_HUMAN		1	765	-			Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	0	1	hg19	c.604G>A	CCDS4758.1	0	.	.	.	.	.	.	.	.	.	.	C	10.41	1.341922	0.24339	.	.	ENSG00000168394	ENST00000354258	D	0.86865	-2.18	4.34	0.387	0.16259	4.340000	0.387000	0.162590	.	2.688260	0.01391	N	0.013250	T	0.55513	0.1925	N	0.14661	0.345	0.50632	D	0.999887	B	0.12013	0.005	B	0.04013	0.001	T	0.54344	-0.8308	10	0.15499	T	0.54	.	3.2607	0.06848	0.097:0.3375:0.4054:0.1601	.	202	Q03518	TAP1_HUMAN	I	202	ENSP00000346206:V202I	ENSP00000346206:V202I	V	-	1	0	0	TAP1	32928968	32928968	0.868000	0.29978	0.048000	0.18961	0.012000	0.07955	0.734000	0.26101	-0.139000	0.11414	-0.185000	0.12909	GTC	0.638515		TCGA-FB-AAQ0-01A-31D-A40W-08	0.657	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	1	0	1		2	2	2	0		0	0	21		21	21	1	1.880000	-13.124120	1	0.670000	NM_000593			7	6		57	56	1		1	1		0	0	21	0		0.980538	9.826765e-01	0	14	0	50	0	7	57
SLC35B2	347734	broad.mit.edu	37	6	44223304	44223304	+	Silent	SNP	A	A	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr6:44223304A>T	ENST00000393812.3	-	4	581	c.438T>A	c.(436-438)ggT>ggA	p.G146G	SLC35B2_ENST00000538577.1_Silent_p.G53G|SLC35B2_ENST00000537814.1_Silent_p.G13G|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000393810.1_Nonstop_Mutation_p.*95R|MIR4647_ENST00000583964.1_RNA	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	146					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TAAAGCGCTCACCCGGTGATG	0.572																																						ENST00000393812.3	1.000000	7.500000e-01	9.600000e-01	8.100000e-01	0.880000	0.890164	0.880000	1.000000																										0				15						c.(436-438)ggT>ggA		solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2							88.0	86.0	86.0					6																	44223304		2203	4300	6503	SO:0001819	synonymous_variant	347734	0	0					g.chr6:44223304A>T	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.438T>A	chr6.hg19:g.44223304A>T		1					SLC35B2_ENST00000393810.1_Nonstop_Mutation_p.*95R|SLC35B2_ENST00000538577.1_Silent_p.G53G|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000537814.1_Silent_p.G13G|SLC35B2_ENST00000495706.1_5'UTR	p.G146G	NM_178148.2	NP_835361.1	0	0	0	1.864756	Q8TB61	S35B2_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)	4	581	-	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Silent	SNP	ENST00000393812.3	0	1	hg19	c.438T>A	CCDS34462.1	1	.	.	.	.	.	.	.	.	.	.	A	0.730	-0.780181	0.02929	.	.	ENSG00000157593	ENST00000393810	.	.	.	5.79	-11.6	0.00059	5.790000	-11.600000	0.000590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.7141	1.3736	0.02215	0.1841:0.2603:0.2932:0.2624	.	.	.	.	R	95	.	.	X	-	1	0	0	SLC35B2	44331282	44331282	0.000000	0.05858	0.182000	0.23118	0.791000	0.44710	-3.600000	0.00418	-2.176000	0.00770	-0.379000	0.06801	TGA	0.630376		TCGA-FB-AAQ0-01A-31D-A40W-08	0.572	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2	0	0	1		2	7	2	1		1	0	55		55	52	1	1.880000	-20.000000	1	0.670000				104	101		207	204	0		1	1		1	0	55	0		1.000000	9.999999e-01	0	47	0	39	0	104	207
IGF2R	3482	broad.mit.edu	37	6	160517606	160517606	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr6:160517606C>T	ENST00000356956.1	+	45	6939	c.6791C>T	c.(6790-6792)gCc>gTc	p.A2264V	IGF2R_ENST00000475584.1_3'UTR|RP11-288H12.3_ENST00000569097.1_RNA	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	2264					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CACGAGACTGCCGACTGCCAG	0.537																																						ENST00000356956.1	0.080000	0	6.000000e-02	1.000000e-02	0.030000	0.040067	0.030000	0.030000																										0				95						c.(6790-6792)gCc>gTc		insulin-like growth factor 2 receptor	Mecasermin(DB01277)						169.0	140.0	150.0					6																	160517606		2203	4300	6503	SO:0001583	missense	3482	0	0					g.chr6:160517606C>T	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.6791C>T	chr6.hg19:g.160517606C>T	ENSP00000349437:p.Ala2264Val	1					RP11-288H12.3_ENST00000569097.1_RNA|IGF2R_ENST00000475584.1_3'UTR	p.A2264V	NM_000876.2	NP_000867	0	0	0	1.833958	P11717	MPRI_HUMAN		45	6939	+		Breast(66;0.000777)|Ovarian(120;0.0305)	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	0	1	hg19	c.6791C>T	CCDS5273.1	0	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481500	0.63849	.	.	ENSG00000197081	ENST00000356956	T	0.02103	4.45	5.69	4.82	0.62117	5.690000	4.820000	0.621170	Mannose-6-phosphate receptor, binding (1);	0.169864	0.51477	D	0.000085	T	0.02571	0.0078	M	0.83692	2.655	0.35229	D	0.776725	P	0.43231	0.801	B	0.41036	0.346	T	0.48896	-0.8994	10	0.30078	T	0.28	-15.7351	16.1287	0.81412	0.1347:0.8653:0.0:0.0	.	2264	P11717	MPRI_HUMAN	V	2264	ENSP00000349437:A2264V	ENSP00000349437:A2264V	A	+	2	0	0	IGF2R	160437596	160437596	1.000000	0.71417	0.963000	0.40424	0.347000	0.29111	5.962000	0.70364	1.389000	0.46526	-0.169000	0.13324	GCC	0.624744		TCGA-FB-AAQ0-01A-31D-A40W-08	0.537	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	0	0	1		2	7	2	1		1	0	69		69	66	1	1.880000	-2.560631	1	0.670000	NM_000876			5	5		384	375	0		1	0		1	0	69	0		0.934008	3.922370e-03	0	0	0	99	0	5	384
LRRC17	10234	broad.mit.edu	37	7	102585031	102585031	+	Missense_Mutation	SNP	G	G	A	rs117261467	byFrequency	TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr7:102585031G>A	ENST00000339431.4	+	4	1598	c.1303G>A	c.(1303-1305)Gta>Ata	p.V435I	LRRC17_ENST00000249377.4_3'UTR|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000313221.4_Intron|FBXL13_ENST00000455112.2_Intron|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000393772.2_Intron|FBXL13_ENST00000379308.3_Intron|LRRC17_ENST00000485478.1_3'UTR	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	435					bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						GAAGCAAAGCGTAATAATTAC	0.318													G|||	2	0.000399361	0.0	0.0	5008	,	,		19988	0.0		0.001	False		,,,				2504	0.001					ENST00000339431.4	1.000000	5.800000e-01	8.100000e-01	6.500000e-01	0.720000	0.738149	0.720000	0.730000																										0				17						c.(1303-1305)Gta>Ata		leucine rich repeat containing 17		G	ILE/VAL,,,	0,4406		0,0,2203	63.0	64.0	64.0		1303,,,	6.0	1.0	7	dbSNP_133	64	14,8586	10.5+/-38.8	0,14,4286	yes	missense,intron,utr-3,intron	LRRC17,FBXL13	NM_001031692.2,NM_001111038.1,NM_005824.2,NM_145032.3	29,,,	0,14,6489	AA,AG,GG		0.1628,0.0,0.1076	possibly-damaging,,,	435/442,,,	102585031	14,12992	2203	4300	6503	SO:0001583	missense	10234	178	121404	53				g.chr7:102585031G>A	U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.1303G>A	chr7.hg19:g.102585031G>A	ENSP00000344242:p.Val435Ile	0					FBXL13_ENST00000455112.2_Intron|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000393772.2_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000313221.4_Intron|FBXL13_ENST00000379308.3_Intron|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379306.3_Intron|LRRC17_ENST00000485478.1_3'UTR|LRRC17_ENST00000249377.4_3'UTR	p.V435I	NM_001031692.2	NP_001026862.1	1	2	3	2.139247	Q8N6Y2	LRC17_HUMAN		4	1598	+			Q13288|Q6UWA7|Q75MG5	Missense_Mutation	SNP	ENST00000339431.4	1	1	hg19	c.1303G>A	CCDS34721.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	22.8	4.337605	0.81911	0.0	0.001628	ENSG00000128606	ENST00000339431	T	0.59638	0.25	6.03	6.03	0.97812	6.030000	6.030000	0.978120	.	0.000000	0.52532	D	0.000068	T	0.58061	0.2096	M	0.62723	1.935	0.80722	D	1	D	0.58268	0.982	B	0.41374	0.355	T	0.57183	-0.7855	10	0.27785	T	0.31	-22.2805	20.5568	0.99304	0.0:0.0:1.0:0.0	.	435	Q8N6Y2	LRC17_HUMAN	I	435	ENSP00000344242:V435I	ENSP00000344242:V435I	V	+	1	0	0	LRRC17	102372267	102372267	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.860000	0.55995	2.861000	0.98227	0.655000	0.94253	GTA	0.674364		TCGA-FB-AAQ0-01A-31D-A40W-08	0.318	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347930.1	1	0	1		2	2	2	0		0	0	61		61	59	1	1.880000	-2.858997	1	0.670000	NM_005824			73	71		231	228	1		1	0		0	0	61	0		1.000000	2.474385e-01	0	0	0	4	0	73	231
OR9A4	130075	broad.mit.edu	37	7	141618819	141618819	+	Silent	SNP	C	C	T			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr7:141618819C>T	ENST00000548136.1	+	1	203	c.144C>T	c.(142-144)gtC>gtT	p.V48V	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					TCATGATTGTCTGTGTGGATA	0.453																																						ENST00000548136.1	1.000000	4.000000e-02	1.100000e-01	6.000000e-02	0.080000	0.115251	0.080000	0.080000																										0				22						c.(142-144)gtC>gtT		olfactory receptor, family 9, subfamily A, member 4							186.0	192.0	190.0					7																	141618819		2203	4300	6503	SO:0001819	synonymous_variant	130075	0	0					g.chr7:141618819C>T		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.144C>T	chr7.hg19:g.141618819C>T		0					MGAM_ENST00000497554.1_Intron	p.V48V	NM_001001656.1	NP_001001656.1	1	2	3	2.139247	Q8NGU2	OR9A4_HUMAN		1	203	+	Melanoma(164;0.0171)		B9EGV6|Q6IFI4	Silent	SNP	ENST00000548136.1	1	1	hg19	c.144C>T	CCDS43661.1	0																																																																																								0.674364		TCGA-FB-AAQ0-01A-31D-A40W-08	0.453	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	0	0	1		2	2	2	0		0	0	118		118	117	1	1.880000	-3.268250	1	0.670000	NM_001001656			20	20		691	686	0		1			0	0	118	0		0.999995	0	0	0	0	0	0	20	691
XKR4	114786	broad.mit.edu	37	8	56015735	56015735	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr8:56015735C>A	ENST00000327381.6	+	1	787	c.687C>A	c.(685-687)agC>agA	p.S229R		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	229						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			CGGCCAACAGCGGCAGCAACA	0.647																																						ENST00000327381.6	1.000000	6.600000e-01	9.300000e-01	7.400000e-01	0.830000	0.838494	0.830000	0.830000																										0				34						c.(685-687)agC>agA		XK, Kell blood group complex subunit-related family, member 4							40.0	43.0	42.0					8																	56015735		2202	4297	6499	SO:0001583	missense	114786	0	0					g.chr8:56015735C>A	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.687C>A	chr8.hg19:g.56015735C>A	ENSP00000328326:p.Ser229Arg	0						p.S229R	NM_052898.1	NP_443130.1	1	2	3	2.130070	Q5GH76	XKR4_HUMAN	Epithelial(17;0.000117)|all cancers(17;0.000836)	1	787	+			Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	1	1	hg19	c.687C>A	CCDS34893.1	0	.	.	.	.	.	.	.	.	.	.	C	9.671	1.146600	0.21288	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.82984	-1.67	4.54	1.58	0.23477	4.540000	1.580000	0.234770	.	0.630387	0.15645	N	0.251674	T	0.69522	0.3120	N	0.22421	0.69	0.26813	N	0.968955	B	0.27286	0.174	B	0.31751	0.135	T	0.53753	-0.8394	10	0.12103	T	0.63	-2.5041	9.169	0.37069	0.0:0.8629:0.0:0.1371	.	229	Q5GH76	XKR4_HUMAN	R	229	ENSP00000328326:S229R	ENSP00000328326:S229R	S	+	3	2	2	XKR4	56178289	56178289	0.971000	0.33674	0.997000	0.53966	0.916000	0.54674	0.523000	0.22925	0.117000	0.18138	0.555000	0.69702	AGC	0.674364		TCGA-FB-AAQ0-01A-31D-A40W-08	0.647	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	1	0	1		2	2	2	0		0	0	53		53	53	1	1.880000	-20.000000	1	0.670000	NM_052898			64	63		169	165	1		1			0	0	53	0		1.000000	0	0	0	0	0	0	64	169
CYP7A1	1581	broad.mit.edu	37	8	59404241	59404241	+	Silent	SNP	G	G	C			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr8:59404241G>C	ENST00000301645.3	-	6	1445	c.1308C>G	c.(1306-1308)ccC>ccG	p.P436P		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	436					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CCGATCCAAAGGGCATGTAGT	0.353									Neonatal Giant Cell Hepatitis																													ENST00000301645.3	1.000000	8.800000e-01	1	9.300000e-01	0.990000	0.977004	0.990000	1.000000																										0				34						c.(1306-1308)ccC>ccG		cytochrome P450, family 7, subfamily A, polypeptide 1							116.0	125.0	122.0					8																	59404241		2203	4300	6503	SO:0001819	synonymous_variant	1581	0	0		Neonatal Giant Cell Hepatitis	Familial Cancer Database	Neonatal Hemochromatosis	g.chr8:59404241G>C	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1308C>G	chr8.hg19:g.59404241G>C		0						p.P436P	NM_000780.3	NP_000771.2	1	2	3	2.130070	P22680	CP7A1_HUMAN		6	1445	-		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)	P78454|Q3MIL8|Q7KZ19	Silent	SNP	ENST00000301645.3	1	1	hg19	c.1308C>G	CCDS6171.1	1																																																																																								0.674364		TCGA-FB-AAQ0-01A-31D-A40W-08	0.353	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	1	0	1		2	2	2	0		0	0	168		168	164	1	1.880000	-17.452620	1	0.670000	NM_000780			219	219		446	442	1		1			0	0	168	0		1.000000	0	0	0	0	0	0	219	446
PREX2	80243	broad.mit.edu	37	8	69033248	69033248	+	Missense_Mutation	SNP	C	C	T	rs143386950		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr8:69033248C>T	ENST00000288368.4	+	30	3965	c.3688C>T	c.(3688-3690)Cgg>Tgg	p.R1230W		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1230					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CAGCAGCGTCCGGACTCTTGC	0.383																																						ENST00000288368.4	1.000000	8.500000e-01	1	9.200000e-01	0.990000	0.971483	0.990000	1.000000																										0				178						c.(3688-3690)Cgg>Tgg		phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	75.0	73.0	74.0		3688	5.8	1.0	8	dbSNP_134	74	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PREX2	NM_024870.2	101	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	possibly-damaging	1230/1607	69033248	3,13003	2203	4300	6503	SO:0001583	missense	80243	10	121412	40				g.chr8:69033248C>T	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3688C>T	chr8.hg19:g.69033248C>T	ENSP00000288368:p.Arg1230Trp	0						p.R1230W	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	1	2	3	2.096078	Q70Z35	PREX2_HUMAN		30	3965	+			B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	1	1	hg19	c.3688C>T	CCDS6201.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.154857	0.94686	2.27E-4	2.33E-4	ENSG00000046889	ENST00000288368	T	0.37752	1.18	5.82	5.82	0.92795	5.820000	5.820000	0.927950	.	0.203092	0.44483	D	0.000444	T	0.34279	0.0892	N	0.22421	0.69	0.52501	D	0.99995	P	0.48694	0.914	P	0.44561	0.453	T	0.14448	-1.0472	10	0.72032	D	0.01	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	1230	Q70Z35	PREX2_HUMAN	W	1230	ENSP00000288368:R1230W	ENSP00000288368:R1230W	R	+	1	2	2	PREX2	69195802	69195802	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.666000	0.61554	2.752000	0.94435	0.655000	0.94253	CGG	0.671102		TCGA-FB-AAQ0-01A-31D-A40W-08	0.383	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	1	0	1		2	2	2	0		0	0	81		81	79	1	1.880000	-11.606190	1	0.670000	NM_025170			120	118		239	237	1		1	0		0	0	81	0		1.000000	6.506496e-01	0	0	0	6	0	120	239
ZFHX4	79776	broad.mit.edu	37	8	77765105	77765105	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr8:77765105G>A	ENST00000521891.2	+	10	6396	c.5948G>A	c.(5947-5949)cGt>cAt	p.R1983H	ZFHX4_ENST00000050961.6_Missense_Mutation_p.R1938H|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R1957H|ZFHX4_ENST00000455469.2_Missense_Mutation_p.R1938H	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1938	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R1983H(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAATTTGCTCGTCAATACAGG	0.458										HNSCC(33;0.089)																												ENST00000521891.2	1.000000	6.800000e-01	9.900000e-01	7.700000e-01	0.880000	0.881237	0.880000	1.000000																										2	Substitution - Missense(2)	p.R1983H(2)	lung(1)|pancreas(1)	432						c.(5947-5949)cGt>cAt		zinc finger homeobox 4							53.0	53.0	53.0					8																	77765105		1889	4117	6006	SO:0001583	missense	79776	7	120850	42				g.chr8:77765105G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5948G>A	chr8.hg19:g.77765105G>A	ENSP00000430497:p.Arg1983His	0	HNSCC(33;0.089)				ZFHX4_ENST00000518282.1_Missense_Mutation_p.R1957H|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R1938H|ZFHX4_ENST00000455469.2_Missense_Mutation_p.R1938H	p.R1983H	NM_024721.4	NP_078997.4	0	0	0	2.047479	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)	10	6396	+			G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	1	1	hg19	c.5948G>A	CCDS47878.2	1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423068	0.43020	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50813	0.73;0.78;0.74;0.74	4.2	4.2	0.49525	4.200000	4.200000	0.495250	.	0.000000	0.44483	U	0.000460	T	0.49966	0.1588	M	0.62723	1.935	0.43271	D	0.995226	P;P;P	0.46020	0.796;0.871;0.871	B;B;B	0.42361	0.215;0.385;0.385	T	0.60747	-0.7202	10	0.66056	D	0.02	.	17.142	0.86756	0.0:0.0:1.0:0.0	.	1938;1938;1983	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	H	1983;1983;1938;1938;1957	ENSP00000430497:R1983H;ENSP00000399605:R1938H;ENSP00000050961:R1938H;ENSP00000430848:R1957H	ENSP00000050961:R1938H	R	+	2	0	0	ZFHX4	77927660	77927660	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.860000	0.69546	2.365000	0.80145	0.539000	0.68188	CGT	0.665518		TCGA-FB-AAQ0-01A-31D-A40W-08	0.458	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	1	0	1		2	2	2	0		0	0	30		30	29	1	1.880000	-20.000000	1	0.670000	NM_024721			49	48		114	113	1		1	0		0	0	30	0		1.000000	0	0	0	0	1	0	49	114
C9orf139	401563	broad.mit.edu	37	9	139929195	139929195	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chr9:139929195T>A	ENST00000314330.2	+	3	1776	c.262T>A	c.(262-264)Tgt>Agt	p.C88S	RP11-229P13.20_ENST00000457302.2_lincRNA|FUT7_ENST00000314412.6_5'Flank	NM_207511.1	NP_997394.1	Q6ZV77	CI139_HUMAN	chromosome 9 open reading frame 139	88										cervix(1)|lung(2)	3	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		CCTTCCTGTTTGTGCTGCCAG	0.677																																						ENST00000314330.2	1.000000	8.700000e-01	1	9.200000e-01	0.960000	0.964882	0.960000	1.000000																										0				3						c.(262-264)Tgt>Agt		chromosome 9 open reading frame 139							49.0	54.0	52.0					9																	139929195		2200	4294	6494	SO:0001583	missense	401563	0	0					g.chr9:139929195T>A		CCDS7023.1	9q34.3	2008-02-05			ENSG00000180539	ENSG00000180539			31426	protein-coding gene	gene with protein product							Standard	NM_207511		Approved	FLJ36268, FLJ42909	uc004ckp.1	Q6ZV77	OTTHUMG00000020959	ENST00000314330.2:c.262T>A	chr9.hg19:g.139929195T>A	ENSP00000318119:p.Cys88Ser	1					FUT7_ENST00000314412.6_5'Flank|RP11-229P13.20_ENST00000457302.2_lincRNA	p.C88S	NM_207511.1	NP_997394.1	0	1	1	1.489689	Q6ZV77	CI139_HUMAN	STAD - Stomach adenocarcinoma(284;0.123)	3	1776	+	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	A2RUA3|B9EGW2|Q5SPY0|Q8N224	Missense_Mutation	SNP	ENST00000314330.2	1	1	hg19	c.262T>A	CCDS7023.1	1	.	.	.	.	.	.	.	.	.	.	t	9.954	1.221083	0.22457	.	.	ENSG00000180539	ENST00000314330	T	0.55052	0.54	2.95	2.95	0.34219	2.950000	2.950000	0.342190	.	.	.	.	.	T	0.41834	0.1176	N	0.08118	0	0.24195	N	0.995533	P	0.50272	0.933	P	0.52909	0.713	T	0.19257	-1.0311	9	0.87932	D	0	.	7.6935	0.28581	0.0:0.0:0.0:1.0	.	88	Q6ZV77	CI139_HUMAN	S	88	ENSP00000318119:C88S	ENSP00000318119:C88S	C	+	1	0	0	C9orf139	139049016	139049016	0.991000	0.36638	0.956000	0.39512	0.072000	0.16883	2.380000	0.44327	1.588000	0.49971	0.241000	0.17934	TGT	0.508709		TCGA-FB-AAQ0-01A-31D-A40W-08	0.677	C9orf139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055213.2	1	0	1		2	2	2	0		0	0	90		90	86	1	1.880000	-20.000000	1	0.670000	NM_207511			176	174		179	175	0		1			0	0	90	0		1.000000	0	0	0	0	0	0	176	179
DMD	1756	broad.mit.edu	37	X	32486730	32486730	+	Missense_Mutation	SNP	C	C	T	rs139772014		TCGA-FB-AAQ0-01A-31D-A40W-08	TCGA-FB-AAQ0-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	77589c29-e28c-4585-ab6e-05ab8e3c965c	0eb76165-29c0-4220-b6dd-094907cb9510	g.chrX:32486730C>T	ENST00000357033.4	-	23	3253	c.3047G>A	c.(3046-3048)cGg>cAg	p.R1016Q	DMD_ENST00000378677.2_Missense_Mutation_p.R1012Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1016					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGATATTTCCGGCTAATTTC	0.433																																						ENST00000357033.4	0.250000	9.000000e-02	2.100000e-01	1.200000e-01	0.160000	0.169716	0.160000	0.160000																										0				77						c.(3046-3048)cGg>cAg		dystrophin		C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3833		0,0,0,1631,571	79.0	71.0	74.0		3023,3047,2678,3035,2678	-5.4	0.0	X	dbSNP_134	74	2,6726		0,1,1,2427,1871	no	missense,missense,missense,missense,missense	DMD	NM_000109.3,NM_004006.2,NM_004007.2,NM_004009.3,NM_004010.3	43,43,43,43,43	0,1,1,4058,2442	TT,TC,T,CC,C		0.0297,0.0,0.0189	benign,benign,benign,benign,benign	1008/3678,1016/3686,893/3563,1012/3682,893/3563	32486730	2,10559	2202	4300	6502	SO:0001583	missense	1756	10	121374	38				g.chrX:32486730C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3047G>A	chrX.hg19:g.32486730C>T	ENSP00000354923:p.Arg1016Gln						DMD_ENST00000378677.2_Missense_Mutation_p.R1012Q	p.R1016Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	0	1	1		P11532	DMD_HUMAN		23	3253	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	1	1	hg19	c.3047G>A	CCDS14233.1	0	.	.	.	.	.	.	.	.	.	.	C	2.255	-0.370542	0.05069	0.0	2.97E-4	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.48201	0.82;0.82	5.12	-5.38	0.02673	5.120000	-5.380000	0.026730	.	0.767750	0.10141	N	0.710788	T	0.21022	0.0506	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.0	T	0.31420	-0.9944	10	0.14252	T	0.57	.	17.6406	0.88135	0.0:0.1026:0.0:0.8974	.	1008;1016;1012	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	Q	1008;1012;1016;1016;893	ENSP00000367948:R1012Q;ENSP00000354923:R1016Q	ENSP00000354923:R1016Q	R	-	2	0	0	DMD	32396651	32396651	0.282000	0.24268	0.000000	0.03702	0.004000	0.04260	0.582000	0.23834	-1.546000	0.01717	-0.276000	0.10085	CGG	0.670000		TCGA-FB-AAQ0-01A-31D-A40W-08	0.433	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	1	0	1		2	2	2	0		0	0	42		42	40	1	1.880000	-3.076678	1	0.670000	NM_004006			16	16		131	130	1		1	0		0	0	42	0		0.999947	1.369128e-02	0	0	0	2	0	16	131
