#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
BSN	8927	broad.mit.edu	37	3	49662573	49662574	+	In_Frame_Ins	INS	-	-	GTA			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr3:49662573_49662574insGTA	ENST00000296452.4	+	2	504_505	c.390_391insGTA	c.(391-393)gta>GTAgta	p.131_131V>VV		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	131					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GGACGCTGCAGGTAGACAGCAG	0.653																																						ENST00000296452.4	0.830000	4.300000e-01	0.730000	0.510000	0.610000	0.628175	0.610000	0.610000																										0				106						c.(391-393)gta>GTAgta		bassoon presynaptic cytomatrix protein																																				SO:0001652	inframe_insertion	8927	0	0					g.chr3:49662573_49662574insGTA	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.391_393dupGTA	chr3.hg19:g.49662574_49662576dupGTA	ENSP00000296452:p.Val131dup	1						p.131_131V>VV	NM_003458.3	NP_003449.2	0	1	1	1.767646	Q9UPA5	BSN_HUMAN		2	504_505	+			O43161|Q7LGH3	In_Frame_Ins	INS	ENST00000296452.4	0	1	hg19	c.390_391insGTA	CCDS2800.1	0																																																																																								0.256641		TCGA-FB-AAQ1-01A-12D-A40W-08	0.653	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	1	0	1		2			0		0	0	46		46	44	1	1.750000	-20.000000	1	0.390000	NM_003458			29	34		167	162	0		1	0	0	0	0	0	0		1.000000	0	0	0	0	0	0	29	167
MMP13	4322	broad.mit.edu	37	11	102826101	102826101	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr11:102826101C>T	ENST00000260302.3	-	2	270	c.242G>A	c.(241-243)gGc>gAc	p.G81D	MMP13_ENST00000340273.4_Missense_Mutation_p.G81D	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	81					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GTCAAGTTTGCCAGTCACCTC	0.473																																						ENST00000260302.3	1.000000	0	0.070000	0.020000	0.040000	0.108378	0.040000	0.040000																										0				27						c.(241-243)gGc>gAc		matrix metallopeptidase 13 (collagenase 3)	Marimastat(DB00786)						155.0	150.0	152.0					11																	102826101		2202	4299	6501	SO:0001583	missense	4322	0	0					g.chr11:102826101C>T	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.242G>A	chr11.hg19:g.102826101C>T	ENSP00000260302:p.Gly81Asp	0					MMP13_ENST00000340273.4_Missense_Mutation_p.G81D	p.G81D	NM_002427.3	NP_002418.1	1	2	3	2.160636	P45452	MMP13_HUMAN		2	270	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	0	1	hg19	c.242G>A	CCDS8324.1	0	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846161	0.91277	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	D;D	0.90197	-2.63;-2.63	5.77	5.77	0.91146	5.77	5.77	0.91146	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97111	0.9056	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97478	1.0045	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	81	P45452	MMP13_HUMAN	D	81	ENSP00000260302:G81D;ENSP00000339672:G81D	ENSP00000260302:G81D	G	-	2	0	0	MMP13	102331311	102331311	1.000000	0.71417	0.995000	0.50966	0.870000	0.49936	7.776000	0.85560	2.885000	0.99019	0.655000	0.94253	GGC	0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.473	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	0	0	1		2	2	2	0		0	0	136		136	135	1	1.750000	-1.926053	0	0.390000	NM_002427			6	6		763	756	0		1			0	0	136	0		0.964051	0	0	0	0	0	0	6	763
CD81	975	broad.mit.edu	37	11	2411735	2411735	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr11:2411735G>A	ENST00000263645.5	+	2	416	c.160G>A	c.(160-162)Gcg>Acg	p.A54T	CD81_ENST00000492627.1_5'UTR|CD81_ENST00000526072.1_5'UTR|CD81_ENST00000524805.1_3'UTR|CD81_ENST00000381036.3_Missense_Mutation_p.A92T	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	54					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		AGACAAGCCCGCGCCCAACAC	0.617																																						ENST00000263645.5	1.000000	8.300000e-01	1.000000	0.920000	0.990000	0.975150	0.990000	1.000000																										0				5						c.(160-162)Gcg>Acg		CD81 molecule							86.0	78.0	81.0					11																	2411735		2202	4298	6500	SO:0001583	missense	975	0	0					g.chr11:2411735G>A		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.160G>A	chr11.hg19:g.2411735G>A	ENSP00000263645:p.Ala54Thr	0					CD81_ENST00000526072.1_5'UTR|CD81_ENST00000381036.3_Missense_Mutation_p.A92T|CD81_ENST00000492627.1_5'UTR|CD81_ENST00000524805.1_3'UTR	p.A54T	NM_004356.3	NP_004347.1	1	2	3	2.160636	P60033	CD81_HUMAN		2	416	+		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)	P18582|Q5U0J6	Missense_Mutation	SNP	ENST00000263645.5	1	1	hg19	c.160G>A	CCDS7734.1	1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341437	0.60963	.	.	ENSG00000110651	ENST00000263645;ENST00000533417;ENST00000527343;ENST00000493525;ENST00000381036;ENST00000492252	T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	4.54	2.4	0.29515	4.54	2.4	0.29515	.	0.596358	0.15996	N	0.234543	D	0.83248	0.5213	M	0.64997	1.995	0.39692	D	0.97106	D;D	0.71674	0.996;0.998	P;P	0.61275	0.774;0.886	D	0.84064	0.0376	10	0.62326	D	0.03	.	11.7463	0.51821	0.0:0.0:0.6812:0.3188	.	92;54	A6NMH8;P60033	.;CD81_HUMAN	T	54;49;43;46;92;47	ENSP00000263645:A54T;ENSP00000435633:A49T;ENSP00000433767:A43T;ENSP00000432497:A46T;ENSP00000370424:A92T;ENSP00000432249:A47T	ENSP00000263645:A54T	A	+	1	0	0	CD81	2368311	2368311	1.000000	0.71417	0.020000	0.16555	0.589000	0.36550	4.156000	0.58138	0.988000	0.38734	0.462000	0.41574	GCG	0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.617	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027357.4	1	0	1		2	2	2	0		0	0	51		51	50	1	1.750000	-20.000000	1	0.390000	NM_004356			73	71		295	285	1		1	1		0	0	51	0		1.000000	1	0	17	0	1284	0	73	295
TPCN2	219931	broad.mit.edu	37	11	68853221	68853221	+	Splice_Site	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr11:68853221G>A	ENST00000294309.3	+	21	2021		c.e21+1		TPCN2_ENST00000442692.2_Splice_Site|TPCN2_ENST00000542467.1_Intron|MIR3164_ENST00000581178.1_RNA	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TGACTTTGCGGTGAGCCCTGC	0.687																																						ENST00000294309.3	1.000000	3.000000e-02	0.150000	0.050000	0.090000	0.157410	0.090000	0.080000																										0				32						c.e21+1		two pore segment channel 2							87.0	90.0	89.0					11																	68853221		2200	4294	6494	SO:0001630	splice_region_variant	219931	0	0					g.chr11:68853221G>A	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.1920+1G>A	chr11.hg19:g.68853221G>A		0					TPCN2_ENST00000442692.2_Splice_Site|MIR3164_ENST00000581178.1_RNA|TPCN2_ENST00000542467.1_Intron		NM_139075.3	NP_620714.2	1	2	3	2.160636	Q8NHX9	TPC2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)	21	2021	+			Q9NT82	Splice_Site	SNP	ENST00000294309.3	0	1	hg19		CCDS8189.1	0	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563865	0.45694	.	.	ENSG00000162341	ENST00000294309	.	.	.	3.54	3.54	0.40534	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4082	0.60926	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	TPCN2	68609797	68609797	1.000000	0.71417	0.830000	0.32933	0.498000	0.33706	6.125000	0.71627	1.998000	0.58463	0.561000	0.74099	.	0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.687	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	0	0	1		2	2	2	0		0	0	59		59	58	1	1.750000	-6.059544	1	0.390000	NM_139075	Intron		6	6		357	349	0		1			0	0	59	0		0.962813	0	0	0	0	0	0	6	357
PRDM10	56980	broad.mit.edu	37	11	129800938	129800938	+	Silent	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr11:129800938G>A	ENST00000360871.3	-	11	1734	c.1503C>T	c.(1501-1503)gaC>gaT	p.D501D	PRDM10_ENST00000304538.6_Silent_p.D415D|PRDM10_ENST00000423662.2_Silent_p.D415D|PRDM10_ENST00000526082.1_Silent_p.D415D|PRDM10_ENST00000528746.1_Silent_p.D475D|PRDM10_ENST00000358825.5_Silent_p.D501D	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TGCGCATGTCGTCGGCTGTCA	0.622																																						ENST00000360871.3	1.000000	7.400000e-01	1.000000	0.840000	0.960000	0.936461	0.960000	1.000000																										0				48						c.(1501-1503)gaC>gaT		PR domain containing 10							129.0	119.0	122.0					11																	129800938		2201	4297	6498	SO:0001819	synonymous_variant	56980	0	0					g.chr11:129800938G>A	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1503C>T	chr11.hg19:g.129800938G>A		0					PRDM10_ENST00000304538.6_Silent_p.D415D|PRDM10_ENST00000358825.5_Silent_p.D501D|PRDM10_ENST00000526082.1_Silent_p.D415D|PRDM10_ENST00000528746.1_Silent_p.D475D|PRDM10_ENST00000423662.2_Silent_p.D415D	p.D501D	NM_199437.1	NP_955469.1	1	2	3	2.160636	Q9NQV6	PRD10_HUMAN		11	1734	-	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	1	1	hg19	c.1503C>T	CCDS8484.1	1																																																																																								0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.622	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	1	0	1		2	2	2	0		0	0	40		40	40	1	1.750000	-20.000000	1	0.390000	NM_199437			59	57		263	255	1		1			0	0	40	0		1.000000	0	0	0	0	0	0	59	263
FGF6	2251	broad.mit.edu	37	12	4554550	4554550	+	Missense_Mutation	SNP	C	C	T	rs148657794	byFrequency	TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr12:4554550C>T	ENST00000228837.2	-	1	230	c.187G>A	c.(187-189)Gcc>Acc	p.A63T		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	63			A -> V (in dbSNP:rs17183529). {ECO:0000269|Ref.2}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			GCTAGCCCGGCGCGAGACCTG	0.647													C|||	5	0.000998403	0.0	0.0	5008	,	,		17406	0.0		0.005	False		,,,				2504	0.0					ENST00000228837.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				20						c.(187-189)Gcc>Acc		fibroblast growth factor 6		C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	88.0	82.0	84.0		187	1.0	0.0	12	dbSNP_134	84	3,8597	3.0+/-9.4	0,3,4297	yes	missense	FGF6	NM_020996.1	58	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	benign	63/209	4554550	4,13002	2203	4300	6503	SO:0001583	missense	2251	319	121412	57				g.chr12:4554550C>T	X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.187G>A	chr12.hg19:g.4554550C>T	ENSP00000228837:p.Ala63Thr	1						p.A63T	NM_020996.1	NP_066276.2	1	2	3	2.506778	P10767	FGF6_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	1	230	-			Q0VAE1	Missense_Mutation	SNP	ENST00000228837.2	1	0	hg19	c.187G>A	CCDS8527.1	1	5	0.0022893772893772895	0	0.0	0	0.0	0	0.0	5	0.006596306068601583	C	6.607	0.480375	0.12581	2.27E-4	3.49E-4	ENSG00000111241	ENST00000228837	T	0.25749	1.78	5.0	1.03	0.20045	5.0	1.03	0.20045	.	0.553031	0.20578	N	0.089588	T	0.09598	0.0236	L	0.28400	0.85	0.09310	N	1	B	0.22146	0.065	B	0.18561	0.022	T	0.24225	-1.0166	10	0.20046	T	0.44	.	4.459	0.11657	0.2636:0.5167:0.0:0.2197	.	63	P10767	FGF6_HUMAN	T	63	ENSP00000228837:A63T	ENSP00000228837:A63T	A	-	1	0	0	FGF6	4424811	4424811	0.488000	0.25996	0.000000	0.03702	0.202000	0.24057	1.105000	0.31086	-0.013000	0.14199	-0.254000	0.11334	GCC	0.489540		TCGA-FB-AAQ1-01A-12D-A40W-08	0.647	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	1	0	1		2	2	2	0		0	0	95		95	92	1	1.750000	-2.716734	1	0.390000	NM_020996			188	183		466	458	1		1			0	0	95	0		1.000000	0	0	0	0	0	0	188	466
GRIN2B	2904	broad.mit.edu	37	12	13717533	13717533	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr12:13717533C>T	ENST00000609686.1	-	13	2848	c.2639G>A	c.(2638-2640)cGc>cAc	p.R880H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	880					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R880P(1)|p.R880H(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TACAGACTGGCGCTCCTCGAT	0.537																																						ENST00000609686.1	1.000000	7.000000e-01	0.930000	0.770000	0.840000	0.854501	0.840000	0.850000																										2	Substitution - Missense(2)	p.R880P(1)|p.R880H(1)	lung(2)	143						c.(2638-2640)cGc>cAc		glutamate receptor, ionotropic, N-methyl D-aspartate 2B	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)						110.0	99.0	103.0					12																	13717533		2203	4298	6501	SO:0001583	missense	2904	0	0					g.chr12:13717533C>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2639G>A	chr12.hg19:g.13717533C>T	ENSP00000477455:p.Arg880His	0						p.R880H	NM_000834.3	NP_000825.2	1	2	3	2.103429	Q13224	NMDE2_HUMAN		13	2848	-			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	1	1	hg19	c.2639G>A	CCDS8662.1	0	.	.	.	.	.	.	.	.	.	.	C	14.90	2.672612	0.47781	.	.	ENSG00000150086	ENST00000279593	T	0.12465	2.68	5.3	4.41	0.53225	5.3	4.41	0.53225	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.277359	0.39687	N	0.001290	T	0.22244	0.0536	L	0.29908	0.895	0.52501	D	0.999953	D	0.58970	0.984	P	0.60236	0.871	T	0.01259	-1.1403	10	0.59425	D	0.04	.	13.8298	0.63373	0.0:0.9257:0.0:0.0743	.	880	Q13224	NMDE2_HUMAN	H	880	ENSP00000279593:R880H	ENSP00000279593:R880H	R	-	2	0	0	GRIN2B	13608800	13608800	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	3.986000	0.56937	1.238000	0.43771	0.563000	0.77884	CGC	0.391187		TCGA-FB-AAQ1-01A-12D-A40W-08	0.537	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2	1	0	1		2	2	2	0		0	0	93		93	92	1	1.750000	-20.000000	1	0.390000				104	103		523	517	1		1			0	0	93	0		1.000000	0	0	0	0	0	0	104	523
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	7.700000e-01	1.000000	0.900000	0.990000	0.964208	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.103429	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.391187		TCGA-FB-AAQ1-01A-12D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	57		57	57	1	1.750000	-20.000000	1	0.390000	NM_033360			40	39		157	156	1		1	0	1	0	0	57	235		1.000000	4.382169e-01	1	1	50	6	304	40	157
TMTC1	83857	broad.mit.edu	37	12	29659861	29659861	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr12:29659861C>T	ENST00000539277.1	-	18	2625	c.2567G>A	c.(2566-2568)aGc>aAc	p.S856N	TMTC1_ENST00000552618.1_Missense_Mutation_p.S880N|TMTC1_ENST00000551659.1_Missense_Mutation_p.S918N|TMTC1_ENST00000256062.5_Missense_Mutation_p.S748N|TMTC1_ENST00000319685.8_5'UTR	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	856						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					CAGCAGTTTGCTGTCTGGAAC	0.443																																						ENST00000539277.1	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.057794	0.050000	0.050000																										0				75						c.(2566-2568)aGc>aAc		transmembrane and tetratricopeptide repeat containing 1							212.0	211.0	211.0					12																	29659861		2203	4300	6503	SO:0001583	missense	83857	0	0					g.chr12:29659861C>T		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2567G>A	chr12.hg19:g.29659861C>T	ENSP00000442046:p.Ser856Asn	0					TMTC1_ENST00000256062.5_Missense_Mutation_p.S748N|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000552618.1_Missense_Mutation_p.S880N|TMTC1_ENST00000551659.1_Missense_Mutation_p.S918N	p.S856N	NM_001193451.1	NP_001180380.1	1	2	3	2.103429	Q8IUR5	TMTC1_HUMAN		18	2625	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	0	1	hg19	c.2567G>A	CCDS53772.1	0	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334993	0.81801	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277	T;T;T;T	0.64618	0.83;0.83;0.83;-0.11	5.28	4.38	0.52667	5.28	4.38	0.52667	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.093694	0.85682	D	0.000000	T	0.63861	0.2547	L	0.35288	1.05	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.91;0.997;0.998	T	0.58457	-0.7633	10	0.02654	T	1	-24.6549	13.0775	0.59095	0.0:0.9199:0.0:0.0801	.	856;918;201	Q8IUR5;F8VTQ9;Q8IUR5-4	TMTC1_HUMAN;.;.	N	619;748;918;880;856	ENSP00000256062:S748N;ENSP00000448112:S918N;ENSP00000449043:S880N;ENSP00000442046:S856N	ENSP00000256062:S748N	S	-	2	0	0	TMTC1	29551128	29551128	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.779000	0.55379	2.463000	0.83235	0.650000	0.86243	AGC	0.391187		TCGA-FB-AAQ1-01A-12D-A40W-08	0.443	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	0	0	1		2	2	2	0		0	0	101		101	101	1	1.750000	-2.141482	0	0.390000	NM_031920			6	6		613	605	0		1	0		0	0	101	0		0.963673	1.445139e-04	0	0	0	2	0	6	613
FAM19A2	338811	broad.mit.edu	37	12	62148670	62148670	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr12:62148670G>T	ENST00000416284.3	-	3	1826	c.242C>A	c.(241-243)gCt>gAt	p.A81D	FAM19A2_ENST00000551449.1_Intron|FAM19A2_ENST00000550003.1_5'UTR|FAM19A2_ENST00000551619.1_Missense_Mutation_p.A81D	NM_178539.4	NP_848634.1	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A2	81						cytoplasm (GO:0005737)				endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	15			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		ACATGATGGAGCAGCTCGCGT	0.498																																						ENST00000416284.3	1.000000	8.700000e-01	1.000000	0.990000	0.990000	0.989530	0.990000	1.000000																										0				15						c.(241-243)gCt>gAt		family with sequence similarity 19 (chemokine (C-C motif)-like), member A2							166.0	114.0	132.0					12																	62148670		2203	4300	6503	SO:0001583	missense	338811	0	0					g.chr12:62148670G>T	AY325115	CCDS8962.1	12q14.1	2012-10-03			ENSG00000198673	ENSG00000198673			21589	protein-coding gene	gene with protein product						15028294	Standard	NM_178539		Approved	TAFA-2	uc001sqw.3	Q8N3H0	OTTHUMG00000170207	ENST00000416284.3:c.242C>A	chr12.hg19:g.62148670G>T	ENSP00000393987:p.Ala81Asp	0					FAM19A2_ENST00000551619.1_Missense_Mutation_p.A81D|FAM19A2_ENST00000550003.1_5'UTR|FAM19A2_ENST00000551449.1_Intron	p.A81D	NM_178539.4	NP_848634.1	1	2	3	2.103429	Q8N3H0	F19A2_HUMAN	GBM - Glioblastoma multiforme(1;0.00484)	3	1826	-			B3KVV4|Q4G0R9|Q68DK0|Q6GTX6	Missense_Mutation	SNP	ENST00000416284.3	1	1	hg19	c.242C>A	CCDS8962.1	1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.519733	0.44866	.	.	ENSG00000198673	ENST00000416284;ENST00000551619;ENST00000552075;ENST00000549958;ENST00000548780	.	.	.	5.21	5.21	0.72293	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.57286	0.2043	L	0.36672	1.1	0.80722	D	1	B	0.32010	0.351	B	0.36534	0.227	T	0.53099	-0.8486	8	.	.	.	.	18.8508	0.92227	0.0:0.0:1.0:0.0	.	81	Q8N3H0	F19A2_HUMAN	D	81;81;82;88;82	.	.	A	-	2	0	0	FAM19A2	60434937	60434937	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	5.381000	0.66208	2.455000	0.83008	0.558000	0.71614	GCT	0.391187		TCGA-FB-AAQ1-01A-12D-A40W-08	0.498	FAM19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407967.2	1	0	1		2	2	2	0		0	0	46		46	46	1	1.750000	-20.000000	1	0.390000	NM_178539			47	46		164	159	1		1			0	0	46	0		1.000000	0	0	0	0	0	0	47	164
DNAH10	196385	broad.mit.edu	37	12	124397822	124397822	+	Missense_Mutation	SNP	G	G	A	rs373522460		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr12:124397822G>A	ENST00000409039.3	+	59	9983	c.9958G>A	c.(9958-9960)Gca>Aca	p.A3320T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3320					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCTGATTGCCGCAGACAAACT	0.537																																						ENST00000409039.3	1.000000	6.400000e-01	0.970000	0.780000	0.890000	0.881761	0.890000	0.990000																										0				52						c.(9958-9960)Gca>Aca		dynein, axonemal, heavy chain 10		G	THR/ALA	0,3840		0,0,1920	32.0	35.0	34.0		9958	5.4	0.1	12		34	1,8241		0,1,4120	no	missense	DNAH10	NM_207437.3	58	0,1,6040	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging	3320/4472	124397822	1,12081	1920	4121	6041	SO:0001583	missense	196385	3	120604	32				g.chr12:124397822G>A	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9958G>A	chr12.hg19:g.124397822G>A	ENSP00000386770:p.Ala3320Thr	1						p.A3320T	NM_207437.3	NP_997320.2	0	1	1	1.697700	Q8IVF4	DYH10_HUMAN		59	9983	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	1	1	hg19	c.9958G>A	CCDS9255.2	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119935	0.77323	0.0	1.21E-4	ENSG00000197653	ENST00000409039	T	0.80214	-1.35	5.43	5.43	0.79202	5.43	5.43	0.79202	Dynein heavy chain, coiled coil stalk (1);	0.116409	0.64402	D	0.000019	D	0.94026	0.8086	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96078	0.9051	10	0.87932	D	0	.	19.2307	0.93839	0.0:0.0:1.0:0.0	.	3320	Q8IVF4	DYH10_HUMAN	T	3320	ENSP00000386770:A3320T	ENSP00000386770:A3320T	A	+	1	0	0	DNAH10	122963775	122963775	1.000000	0.71417	0.096000	0.21009	0.031000	0.12232	9.869000	0.99810	2.534000	0.85438	0.655000	0.94253	GCA	0.242236		TCGA-FB-AAQ1-01A-12D-A40W-08	0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3	1	0	1		2	2	2	0		0	0	13		13	13	1	1.750000	-20.000000	1	0.390000				18	18		46	45	1		1	0		0	0	13	0		0.999993	0	0	0	0	1	0	18	46
SLC7A7	9056	broad.mit.edu	37	14	23244654	23244654	+	Splice_Site	SNP	T	T	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr14:23244654T>A	ENST00000397532.3	-	7	1619	c.1094A>T	c.(1093-1095)aAt>aTt	p.N365I	SLC7A7_ENST00000555702.1_Splice_Site_p.N365I|SLC7A7_ENST00000285850.7_Splice_Site_p.N365I|SLC7A7_ENST00000397529.2_Splice_Site_p.N365I|SLC7A7_ENST00000554061.1_5'UTR|SLC7A7_ENST00000397528.4_Splice_Site_p.N365I|SLC7A7_ENST00000554517.1_Splice_Site_p.N99I			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	365			N -> Y (in LPI). {ECO:0000269|PubMed:17764084}.		amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TTCACTTACATTGAAGAGCAG	0.473																																						ENST00000397532.3	0.730000	4.300000e-01	0.660000	0.490000	0.570000	0.583453	0.570000	0.570000																										0				20						c.(1093-1095)aAt>aTt		solute carrier family 7 (amino acid transporter light chain, y+L system), member 7							112.0	108.0	110.0					14																	23244654		2203	4300	6503	SO:0001630	splice_region_variant	9056	0	0					g.chr14:23244654T>A	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.1095+1A>T	chr14.hg19:g.23244654T>A		0					SLC7A7_ENST00000555702.1_Splice_Site_p.N365I|SLC7A7_ENST00000397529.2_Splice_Site_p.N365I|SLC7A7_ENST00000285850.7_Splice_Site_p.N365I|SLC7A7_ENST00000397528.4_Splice_Site_p.N365I|SLC7A7_ENST00000554517.1_Splice_Site_p.N99I|SLC7A7_ENST00000554061.1_5'UTR	p.N365I			0	1	1	1.930017	Q9UM01	YLAT1_HUMAN		7	1619	-	all_cancers(95;8.44e-05)		B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Splice_Site	SNP	ENST00000397532.3	1	0	hg19	c.1094A>T	CCDS9574.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.9|20.9	4.059783|4.059783	0.76074|0.76074	.|.	.|.	ENSG00000155465|ENSG00000155465	ENST00000556350|ENST00000285850;ENST00000555702;ENST00000397532;ENST00000404278;ENST00000397529;ENST00000397528;ENST00000554517	.|D;D;D;D;D;D	.|0.89050	.|-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.73|5.73	5.73|5.73	0.89815|0.89815	5.73|5.73	5.73|5.73	0.89815|0.89815	.|Amino acid permease domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93861|0.93861	0.8036|0.8036	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.77004	.|0.989	D|D	0.92497|0.92497	0.6005|0.6005	5|10	.|0.22706	.|T	.|0.39	.|.	14.9941|14.9941	0.71415|0.71415	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|365	.|Q9UM01	.|YLAT1_HUMAN	F|I	80|365;365;365;338;365;365;99	.|ENSP00000285850:N365I;ENSP00000451881:N365I;ENSP00000380666:N365I;ENSP00000380663:N365I;ENSP00000380662:N365I;ENSP00000452083:N99I	.|ENSP00000285850:N365I	I|N	-|-	1|2	0|0	0|0	SLC7A7|SLC7A7	22314494|22314494	22314494|22314494	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.474000|0.474000	0.32979|0.32979	7.658000|7.658000	0.83755|0.83755	2.187000|2.187000	0.69744|0.69744	0.460000|0.460000	0.39030|0.39030	ATC|AAT	0.329891		TCGA-FB-AAQ1-01A-12D-A40W-08	0.473	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3	1	0	1		2	2	2	0		0	0	68		68	67	1	1.750000	-20.000000	1	0.390000		Missense_Mutation		47	47		333	331	1		1	1		0	0	68	0		1.000000	9.999963e-01	0	16	0	117	0	47	333
FBXO33	254170	broad.mit.edu	37	14	39868915	39868915	+	Silent	SNP	G	G	A	rs200556309		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr14:39868915G>A	ENST00000298097.7	-	4	1810	c.1473C>T	c.(1471-1473)acC>acT	p.T491T	FBXO33_ENST00000554190.1_3'UTR	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	491					protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		TGCTTTCTTCGGTGACTTCAA	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		19501	0.001		0.0	False		,,,				2504	0.0					ENST00000298097.7	0.890000	3.600000e-01	0.750000	0.470000	0.600000	0.619172	0.600000	0.590000																										0				9						c.(1471-1473)acC>acT		F-box protein 33							94.0	76.0	82.0					14																	39868915		2203	4300	6503	SO:0001819	synonymous_variant	254170	3	121412	34				g.chr14:39868915G>A	BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.1473C>T	chr14.hg19:g.39868915G>A		0					FBXO33_ENST00000554190.1_3'UTR	p.T491T	NM_203301.3	NP_976046.1	0	1	1	1.930017	Q7Z6M2	FBX33_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	4	1810	-	Hepatocellular(127;0.213)		Q6PIR2|Q86TR2|Q86YE0	Silent	SNP	ENST00000298097.7	1	1	hg19	c.1473C>T	CCDS9677.1	0																																																																																								0.329891		TCGA-FB-AAQ1-01A-12D-A40W-08	0.478	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276769.2	1	0	1		2	2	2	0		0	0	41		41	41	1	1.750000	-2.652772	1	0.390000				16	16		108	107	1		1	1		0	0	41	0		0.999951	7.000951e-01	0	2	0	16	0	16	108
DNAH3	55567	broad.mit.edu	37	16	20975272	20975272	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr16:20975272C>T	ENST00000261383.3	-	53	9933	c.9934G>A	c.(9934-9936)Gcc>Acc	p.A3312T	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3312					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCGATGTTGGCCAGGTCCGAG	0.507																																						ENST00000261383.3	1.000000	1.100000e-01	0.280000	0.150000	0.200000	0.280266	0.200000	0.200000																										0				202						c.(9934-9936)Gcc>Acc		dynein, axonemal, heavy chain 3							111.0	104.0	107.0					16																	20975272		2201	4300	6501	SO:0001583	missense	55567	0	0					g.chr16:20975272C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9934G>A	chr16.hg19:g.20975272C>T	ENSP00000261383:p.Ala3312Thr	0					DNAH3_ENST00000415178.1_3'UTR	p.A3312T	NM_017539.1	NP_060009.1	2	2	4	2.197270	Q8TD57	DYH3_HUMAN		53	9933	-			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	1	1	hg19	c.9934G>A	CCDS10594.1	0	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411746	0.62399	.	.	ENSG00000158486	ENST00000261383	T	0.54479	0.57	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.72993	0.3530	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.68353	0.957	T	0.72181	-0.4368	10	0.54805	T	0.06	.	20.3363	0.98740	0.0:1.0:0.0:0.0	.	3312	Q8TD57	DYH3_HUMAN	T	3312	ENSP00000261383:A3312T	ENSP00000261383:A3312T	A	-	1	0	0	DNAH3	20882773	20882773	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	3.964000	0.56780	2.814000	0.96858	0.563000	0.77884	GCC	0.417272		TCGA-FB-AAQ1-01A-12D-A40W-08	0.507	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	0	0	1		18	2	2	1		1	1	90		90	90	1	1.750000	-3.657397	1	0.390000	NM_017539			17	17		455	448	0		0			1	0	90	0		0.479357	0	0	0	0	0	0	17	455
SMCHD1	23347	broad.mit.edu	37	18	2666912	2666912	+	Silent	SNP	G	G	A	rs7229488	byFrequency	TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr18:2666912G>A	ENST00000320876.6	+	3	644	c.306G>A	c.(304-306)tcG>tcA	p.S102S	SMCHD1_ENST00000261598.8_Silent_p.S102S	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	102					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TGCTACAGTCGGTCAATCAGT	0.388													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19701	0.0		0.0	False		,,,				2504	0.0					ENST00000320876.6	1.000000	7.300000e-01	1.000000	0.860000	0.990000	0.952232	0.990000	1.000000																										0				45						c.(304-306)tcG>tcA		structural maintenance of chromosomes flexible hinge domain containing 1		G		6,3808		0,6,1901	108.0	95.0	99.0		306	0.2	1.0	18	dbSNP_116	99	0,8266		0,0,4133	no	coding-synonymous	SMCHD1	NM_015295.2		0,6,6034	AA,AG,GG		0.0,0.1573,0.0497		102/2006	2666912	6,12074	1907	4133	6040	SO:0001819	synonymous_variant	23347	25	120840	44				g.chr18:2666912G>A	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.306G>A	chr18.hg19:g.2666912G>A		0					SMCHD1_ENST00000261598.8_Silent_p.S102S	p.S102S	NM_015295.2	NP_056110.2	1	2	3	2.158149	A6NHR9	SMHD1_HUMAN		3	644	+			O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	ENST00000320876.6	1	1	hg19	c.306G>A	CCDS45822.1	1																																																																																								0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.388	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2	1	0	1		2	2	2	0		0	0	25		25	25	1	1.750000	-2.965284	1	0.390000				32	31		132	129	1		1			0	0	25	0		1.000000	0	0	0	0	0	0	32	132
C18orf8	29919	broad.mit.edu	37	18	21099089	21099089	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr18:21099089C>T	ENST00000269221.3	+	9	910	c.800C>T	c.(799-801)gCc>gTc	p.A267V	C18orf8_ENST00000590868.1_Missense_Mutation_p.A219V	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	267						lysosomal membrane (GO:0005765)				endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGAAAGTTTGCCCTGAACGTG	0.428																																						ENST00000269221.3	1.000000	3.000000e-02	0.160000	0.060000	0.090000	0.160831	0.090000	0.090000																										0				21						c.(799-801)gCc>gTc		chromosome 18 open reading frame 8							148.0	133.0	138.0					18																	21099089		2203	4300	6503	SO:0001583	missense	29919	0	0					g.chr18:21099089C>T	AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.800C>T	chr18.hg19:g.21099089C>T	ENSP00000269221:p.Ala267Val	0					C18orf8_ENST00000590868.1_Missense_Mutation_p.A219V	p.A267V	NM_013326.3	NP_037458.3	1	2	3	2.158149	Q96DM3	MIC1_HUMAN		9	910	+	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)		Q9BU17|Q9Y5M0	Missense_Mutation	SNP	ENST00000269221.3	0	1	hg19	c.800C>T	CCDS32803.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.469800	0.96274	.	.	ENSG00000141452	ENST00000269221;ENST00000544799;ENST00000540942;ENST00000542734	.	.	.	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.84379	0.5459	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.85396	0.1128	9	0.52906	T	0.07	-16.5741	19.4282	0.94754	0.0:1.0:0.0:0.0	.	267;219	Q96DM3;F5H2W0	MIC1_HUMAN;.	V	267;110;219;110	.	ENSP00000269221:A267V	A	+	2	0	0	C18orf8	19353087	19353087	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.421000	0.80204	2.599000	0.87857	0.491000	0.48974	GCC	0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.428	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445386.1	0	0	1		2	2	2	0		0	0	53		53	53	1	1.750000	-2.631405	1	0.390000	NM_013326			6	6		344	337	0		1	0		0	0	53	0		0.963069	7.496300e-02	0	0	0	22	0	6	344
PIAS2	9063	broad.mit.edu	37	18	44470558	44470558	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr18:44470558T>C	ENST00000585916.1	-	2	483	c.484A>G	c.(484-486)Aag>Gag	p.K162E	PIAS2_ENST00000545673.1_Intron|PIAS2_ENST00000324794.7_Missense_Mutation_p.K162E	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	162	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						CTCGTGGGCTTGATGAGAACA	0.398																																						ENST00000585916.1	1.000000	4.000000e-02	0.240000	0.080000	0.140000	0.205562	0.140000	0.120000																										0				22						c.(484-486)Aag>Gag		protein inhibitor of activated STAT, 2							67.0	60.0	62.0					18																	44470558		2203	4300	6503	SO:0001583	missense	9063	0	0					g.chr18:44470558T>C	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.484A>G	chr18.hg19:g.44470558T>C	ENSP00000465676:p.Lys162Glu	0					PIAS2_ENST00000324794.7_Missense_Mutation_p.K162E|PIAS2_ENST00000545673.1_Intron	p.K162E	NM_004671.3	NP_004662.2	1	2	3	2.158149	O75928	PIAS2_HUMAN		2	483	-			O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	ENST00000585916.1	0	1	hg19	c.484A>G	CCDS32824.1	0	.	.	.	.	.	.	.	.	.	.	T	16.75	3.208609	0.58343	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000398651;ENST00000324794	T	0.44482	0.92	6.16	6.16	0.99307	6.16	6.16	0.99307	PINIT domain (1);	0.000000	0.85682	D	0.000000	T	0.61949	0.2388	M	0.66297	2.02	0.80722	D	1	D;B;B;B	0.64830	0.994;0.098;0.037;0.357	P;B;B;P	0.62560	0.904;0.364;0.085;0.6	T	0.64550	-0.6381	10	0.87932	D	0	-12.525	16.8061	0.85666	0.0:0.0:0.0:1.0	.	166;162;162;162	O75928-3;Q2TA77;O75928-2;O75928	.;.;.;PIAS2_HUMAN	E	162;162;158;162	ENSP00000317163:K162E	ENSP00000262161:K162E	K	-	1	0	0	PIAS2	42724556	42724556	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	8.013000	0.88655	2.367000	0.80283	0.528000	0.53228	AAG	0.399370		TCGA-FB-AAQ1-01A-12D-A40W-08	0.398	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	0	0	1		2	2	2	0		0	0	19		19	19	1	1.750000	-3.458168	1	0.390000	NM_004671			4	4		165	160	0		1	0		0	0	19	0		0.884143	9.402564e-03	0	0	0	5	0	4	165
CILP2	148113	broad.mit.edu	37	19	19655586	19655586	+	Silent	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:19655586C>T	ENST00000291495.5	+	8	2317	c.2232C>T	c.(2230-2232)taC>taT	p.Y744Y	CILP2_ENST00000586018.1_Silent_p.Y750Y	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	744						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGCGCGCCTACGCCAACGACA	0.682																																						ENST00000291495.5	0.830000	3.500000e-01	0.710000	0.450000	0.570000	0.587051	0.570000	0.570000																										0				32						c.(2230-2232)taC>taT		cartilage intermediate layer protein 2							17.0	19.0	18.0					19																	19655586		2193	4284	6477	SO:0001819	synonymous_variant	148113	0	0					g.chr19:19655586C>T	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2232C>T	chr19.hg19:g.19655586C>T		0					CILP2_ENST00000586018.1_Silent_p.Y750Y	p.Y744Y	NM_153221.2	NP_694953.2	0	1	1	1.929368	Q8IUL8	CILP2_HUMAN		8	2317	+			Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	1	1	hg19	c.2232C>T	CCDS12405.1	0																																																																																								0.334170		TCGA-FB-AAQ1-01A-12D-A40W-08	0.682	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	1	0	1		2	2	2	0		0	0	31		31	30	1	1.750000	-20.000000	1	0.390000	NM_153221			18	18		130	124	1		1	0		0	0	31	0		0.999982	0	0	0	0	1	0	18	130
LRFN1	57622	broad.mit.edu	37	19	39804696	39804696	+	Silent	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:39804696C>T	ENST00000248668.4	-	1	1280	c.1281G>A	c.(1279-1281)cgG>cgA	p.R427R	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	427	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CTGCCACGAGCCGACGCTCAG	0.677																																						ENST00000248668.4	0.280000	4.000000e-02	0.210000	0.070000	0.130000	0.147713	0.130000	0.120000																										0				18						c.(1279-1281)cgG>cgA		leucine rich repeat and fibronectin type III domain containing 1							17.0	24.0	21.0					19																	39804696		2030	4146	6176	SO:0001819	synonymous_variant	57622	0	0					g.chr19:39804696C>T	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1281G>A	chr19.hg19:g.39804696C>T		0					CTC-246B18.8_ENST00000601911.1_RNA	p.R427R	NM_020862.1	NP_065913.1	0	1	1	1.929368	Q9P244	LRFN1_HUMAN	Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)	1	1280	-	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Q8TBS9	Silent	SNP	ENST00000248668.4	0	1	hg19	c.1281G>A	CCDS46071.1	0																																																																																								0.334170		TCGA-FB-AAQ1-01A-12D-A40W-08	0.677	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	0	0	1		2	2	2	0		0	0	36		36	27	1	1.750000	-6.661661	1	0.390000	NM_020862			4	4		151	134	0		1	0		0	0	36	0		0.861800	6.838349e-03	0	0	0	4	0	4	151
GYS1	2997	broad.mit.edu	37	19	49485993	49485993	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:49485993G>A	ENST00000323798.3	-	6	1121	c.925C>T	c.(925-927)Cgg>Tgg	p.R309W	GYS1_ENST00000263276.6_Missense_Mutation_p.R245W|GYS1_ENST00000544287.1_Intron|GYS1_ENST00000541188.1_Missense_Mutation_p.R229W|GYS1_ENST00000540532.1_Intron	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	309					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		AAATGGCCCCGCACAAACTCC	0.542																																						ENST00000323798.3	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.061650	0.050000	0.050000																										0				22						c.(925-927)Cgg>Tgg		glycogen synthase 1 (muscle)							99.0	105.0	103.0					19																	49485993		2203	4300	6503	SO:0001583	missense	2997	1	121412	36				g.chr19:49485993G>A		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.925C>T	chr19.hg19:g.49485993G>A	ENSP00000317904:p.Arg309Trp	0					GYS1_ENST00000540532.1_Intron|GYS1_ENST00000263276.6_Missense_Mutation_p.R245W|GYS1_ENST00000544287.1_Intron|GYS1_ENST00000541188.1_Missense_Mutation_p.R229W	p.R309W	NM_002103.4	NP_002094.2	0	1	1	1.939901	P13807	GYS1_HUMAN		6	1121	-		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	0	1	hg19	c.925C>T	CCDS12747.1	0	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728447	0.69074	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188	T;T;T	0.73363	-0.74;-0.74;-0.74	4.98	3.88	0.44766	4.98	3.88	0.44766	.	0.000000	0.85682	D	0.000000	D	0.87346	0.6154	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.77557	0.99;0.95;0.967	D	0.89154	0.3525	10	0.87932	D	0	-25.235	11.3306	0.49473	0.0:0.0:0.7259:0.2741	.	229;245;309	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	W	309;245;229	ENSP00000317904:R309W;ENSP00000263276:R245W;ENSP00000437922:R229W	ENSP00000263276:R245W	R	-	1	2	2	GYS1	54177805	54177805	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.141000	0.58038	2.491000	0.84063	0.561000	0.74099	CGG	0.338395		TCGA-FB-AAQ1-01A-12D-A40W-08	0.542	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	0	0	1		2	2	2	0		0	0	91		91	91	1	1.750000	-1.981527	0	0.390000	NM_002103			6	6		527	520	0		1	0		0	0	91	0		0.963693	1.482832e-01	0	0	0	51	0	6	527
HAS1	3036	broad.mit.edu	37	19	52217079	52217079	+	Silent	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:52217079C>T	ENST00000222115.1	-	5	1372	c.1338G>A	c.(1336-1338)gcG>gcA	p.A446A	HAS1_ENST00000540069.2_Silent_p.A445A|HAS1_ENST00000601714.1_Silent_p.A453A	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	446					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CCGCGAAGGCCGCCTTGGCCA	0.697																																					NSCLC(132;636 2450 45807 47979)	ENST00000222115.1	1.000000	4.100000e-01	0.930000	0.550000	0.720000	0.738741	0.720000	1.000000																										0				40						c.(1336-1338)gcG>gcA		hyaluronan synthase 1							18.0	18.0	18.0					19																	52217079		2185	4273	6458	SO:0001819	synonymous_variant	3036	1	120190	28				g.chr19:52217079C>T	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1338G>A	chr19.hg19:g.52217079C>T		0					HAS1_ENST00000601714.1_Silent_p.A453A|HAS1_ENST00000540069.2_Silent_p.A445A	p.A446A	NM_001523.2	NP_001514.2	0	1	1	1.939901	Q92839	HYAS1_HUMAN		5	1372	-		all_neural(266;0.0189)|Medulloblastoma(540;0.146)	Q14470|Q9NS49	Silent	SNP	ENST00000222115.1	0	1	hg19	c.1338G>A	CCDS12838.1	0																																																																																								0.338395		TCGA-FB-AAQ1-01A-12D-A40W-08	0.697	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	1	0	1		2	2	2	0		0	0	22		22	22	1	1.750000	-19.976910	1	0.390000	NM_001523			12	10		66	65	1		1			0	0	22	0		0.999131	0	0	0	0	0	0	12	66
PRAM1	84106	broad.mit.edu	37	19	8564207	8564207	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:8564207G>A	ENST00000423345.4	-	2	1005	c.485C>T	c.(484-486)gCg>gTg	p.A162V	PRAM1_ENST00000255612.3_Missense_Mutation_p.A162V			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	210	8 X 12 AA repeats of K-P-P-[PQ]-P-[EQ]- [VAF]-T-D-L-P-K.|Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						CCGGGCCGGCGCACCAGGCTC	0.672																																						ENST00000423345.4	0.810000	2.800000e-01	0.670000	0.390000	0.510000	0.535414	0.510000	0.500000																										0				19						c.(484-486)gCg>gTg		PML-RARA regulated adaptor molecule 1							12.0	14.0	14.0					19																	8564207		1894	4029	5923	SO:0001583	missense	84106	0	0					g.chr19:8564207G>A	BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.485C>T	chr19.hg19:g.8564207G>A	ENSP00000408342:p.Ala162Val	0					PRAM1_ENST00000255612.3_Missense_Mutation_p.A162V	p.A162V			0	1	1	1.929368	Q96QH2	PRAM_HUMAN		2	1005	-			Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	0	1	hg19	c.485C>T	CCDS45954.2	0	.	.	.	.	.	.	.	.	.	.	G	9.207	1.029946	0.19512	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.16324	2.35;2.35	3.36	-2.6	0.06190	3.36	-2.6	0.06190	.	3.218910	0.00964	N	0.003140	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	P;P	0.39022	0.516;0.655	B;B	0.28709	0.026;0.093	T	0.13361	-1.0512	10	0.17832	T	0.49	.	1.8153	0.03099	0.1117:0.1719:0.3659:0.3506	.	162;210	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	V	162	ENSP00000255612:A162V;ENSP00000408342:A162V	ENSP00000255612:A162V	A	-	2	0	0	PRAM1	8470207	8470207	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.630000	0.05502	-0.457000	0.07033	0.591000	0.81541	GCG	0.334170		TCGA-FB-AAQ1-01A-12D-A40W-08	0.672	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	1	0	1		2	2	2	0		0	0	14		14	14	1	1.750000	-18.992210	1	0.390000	NM_032152			12	12		98	94	0		1	0		0	0	14	0		0.999116	4.086636e-01	0	0	0	12	0	12	98
ZNF560	147741	broad.mit.edu	37	19	9577789	9577789	+	Missense_Mutation	SNP	G	G	A	rs145243922		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:9577789G>A	ENST00000301480.4	-	10	2047	c.1834C>T	c.(1834-1836)Cgc>Tgc	p.R612C		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R612C(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						AGATCTGAGCGTTCTGTGAAG	0.418																																						ENST00000301480.4	0.590000	3.500000e-01	0.530000	0.400000	0.460000	0.470673	0.460000	0.460000																										1	Substitution - Missense(1)	p.R612C(1)	large_intestine(1)	65						c.(1834-1836)Cgc>Tgc		zinc finger protein 560		G	CYS/ARG	0,4406		0,0,2203	162.0	144.0	150.0		1834	0.9	0.0	19	dbSNP_134	150	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ZNF560	NM_152476.2	180	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	612/791	9577789	3,13003	2203	4300	6503	SO:0001583	missense	147741	15	121408	47				g.chr19:9577789G>A	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1834C>T	chr19.hg19:g.9577789G>A	ENSP00000301480:p.Arg612Cys	0						p.R612C	NM_152476.2	NP_689689.2	0	1	1	1.929368	Q96MR9	ZN560_HUMAN		10	2047	-			Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	1	1	hg19	c.1834C>T	CCDS12214.1	0	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241694	0.58995	0.0	3.49E-4	ENSG00000198028	ENST00000301480	T	0.16073	2.37	1.89	0.846	0.18955	1.89	0.846	0.18955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21550	0.0519	L	0.49455	1.56	0.09310	N	1	D	0.76494	0.999	P	0.53954	0.738	T	0.11348	-1.0591	9	0.38643	T	0.18	.	4.7062	0.12851	0.8013:0.0:0.1987:0.0	.	612	Q96MR9	ZN560_HUMAN	C	612	ENSP00000301480:R612C	ENSP00000301480:R612C	R	-	1	0	0	ZNF560	9438789	9438789	0.000000	0.05858	0.000000	0.03702	0.905000	0.53344	-0.740000	0.04861	0.199000	0.20427	0.313000	0.20887	CGC	0.334170		TCGA-FB-AAQ1-01A-12D-A40W-08	0.418	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	1	0	1		2	2	2	0		0	0	125		125	124	1	1.750000	-16.614390	1	0.390000	NM_152476			54	54		491	482	1		1			0	0	125	0		1.000000	0	0	0	0	0	0	54	491
ZSCAN18	65982	broad.mit.edu	37	19	58600197	58600197	+	Silent	SNP	C	C	A	rs369976525		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr19:58600197C>A	ENST00000240727.6	-	3	810	c.411G>T	c.(409-411)ctG>ctT	p.L137L	ZSCAN18_ENST00000421612.2_Silent_p.L2L|ZSCAN18_ENST00000601144.1_Silent_p.L137L|ZSCAN18_ENST00000600404.1_Silent_p.L193L	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	137					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGGAGCCCAGCAGCATCCCTG	0.602																																						ENST00000240727.6	0.830000	4.600000e-01	0.740000	0.540000	0.630000	0.647717	0.630000	0.640000																										0				19						c.(409-411)ctG>ctT		zinc finger and SCAN domain containing 18		C	,,,	1,4405	2.1+/-5.4	0,1,2202	56.0	59.0	58.0		579,411,6,411	-1.1	0.0	19		58	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZSCAN18	NM_001145542.1,NM_001145543.1,NM_001145544.1,NM_023926.4	,,,	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	,,,	193/567,137/511,2/375,137/511	58600197	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	65982	1	121408	31				g.chr19:58600197C>A	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.411G>T	chr19.hg19:g.58600197C>A		0					ZSCAN18_ENST00000600404.1_Silent_p.L193L|ZSCAN18_ENST00000601144.1_Silent_p.L137L|ZSCAN18_ENST00000421612.2_Silent_p.L2L	p.L137L	NM_023926.4	NP_076415.3	0	1	1	1.940535	Q8TBC5	ZSC18_HUMAN		3	810	-		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Silent	SNP	ENST00000240727.6	1	1	hg19	c.411G>T	CCDS12971.1	0																																																																																								0.346685		TCGA-FB-AAQ1-01A-12D-A40W-08	0.602	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	1	0	1		2	2	2	0		0	0	49		49	49	1	1.750000	-20.000000	1	0.390000	NM_023926			37	37		240	237	1		1	0		0	0	49	0		1.000000	8.880776e-01	0	0	0	27	0	37	240
FLG	2312	broad.mit.edu	37	1	152282228	152282228	+	Nonsense_Mutation	SNP	G	G	A	rs188394023		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr1:152282228G>A	ENST00000368799.1	-	3	5169	c.5134C>T	c.(5134-5136)Cga>Tga	p.R1712*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1712	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGACCCTCGGTTTCCACTG	0.587									Ichthyosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		20119	0.001		0.0	False		,,,				2504	0.0					ENST00000368799.1	1.000000	8.300000e-01	1.000000	0.880000	0.930000	0.939160	0.930000	1.000000																										0				424						c.(5134-5136)Cga>Tga		filaggrin							224.0	228.0	227.0					1																	152282228		2203	4300	6503	SO:0001587	stop_gained	2312	1	121412	45	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152282228G>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5134C>T	chr1.hg19:g.152282228G>A	ENSP00000357789:p.Arg1712*	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.R1712*	NM_002016.1	NP_002007.1	0	0	0	2.081284	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	5169	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	0	1	hg19	c.5134C>T	CCDS30860.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	41	8.752868	0.98941	.	.	ENSG00000143631	ENST00000368799	.	.	.	3.51	-1.23	0.09465	3.51	-1.23	0.09465	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	1.6399	0.02750	0.1149:0.1803:0.3369:0.3679	.	.	.	.	X	1712	.	ENSP00000357789:R1712X	R	-	1	2	2	FLG	150548852	150548852	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.579000	0.00907	-0.196000	0.10366	-0.840000	0.03056	CGA	0.385205		TCGA-FB-AAQ1-01A-12D-A40W-08	0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	1	0	1		2	2	2	0		0	0	298		298	296	1	1.750000	-2.882255	1	0.390000	NM_002016			250	249		1100	1080	0		1	0		0	0	298	0		1.000000	0	0	0	0	1	0	250	1100
OXCT2	64064	broad.mit.edu	37	1	40236249	40236249	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr1:40236249C>T	ENST00000327582.5	-	1	771	c.679G>A	c.(679-681)Gcc>Acc	p.A227T	BMP8B_ENST00000397360.2_Intron|BMP8B_ENST00000372827.3_Intron	NM_022120.1	NP_071403.1	Q9BYC2	SCOT2_HUMAN	3-oxoacid CoA transferase 2	227					ketone body catabolic process (GO:0046952)	mitochondrion (GO:0005739)|motile cilium (GO:0031514)	3-oxoacid CoA-transferase activity (GO:0008260)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|pancreas(1)|upper_aerodigestive_tract(1)	6	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		Succinic acid(DB00139)	AAATTGCGGGCGCTTCTCCTG	0.622											OREG0013400	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000327582.5	0.690000	3.800000e-01	0.610000	0.440000	0.520000	0.535746	0.520000	0.520000																										0				6						c.(679-681)Gcc>Acc		3-oxoacid CoA transferase 2	Succinic acid(DB00139)						35.0	41.0	39.0					1																	40236249		2193	4292	6485	SO:0001583	missense	64064	0	0					g.chr1:40236249C>T	AB050193	CCDS445.1	1p34	2008-02-05			ENSG00000198754	ENSG00000198754			18606	protein-coding gene	gene with protein product		610289				11214971, 11756565	Standard	NM_022120		Approved	FKSG25, FLJ00030, SCOT-T	uc001ceb.1	Q9BYC2	OTTHUMG00000009249	ENST00000327582.5:c.679G>A	chr1.hg19:g.40236249C>T	ENSP00000361914:p.Ala227Thr	0		OREG0013400	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	891	BMP8B_ENST00000397360.2_Intron|BMP8B_ENST00000372827.3_Intron	p.A227T	NM_022120.1	NP_071403.1	0	1	1	2.100853	Q9BYC2	SCOT2_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)	1	771	-	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	B2RBB4|Q5QPK4|Q8NHR1|Q9H1I4	Missense_Mutation	SNP	ENST00000327582.5	0	1	hg19	c.679G>A	CCDS445.1	0	.	.	.	.	.	.	.	.	.	.	c	18.39	3.614569	0.66672	.	.	ENSG00000198754	ENST00000327582;ENST00000542949	D	0.88201	-2.35	2.58	1.63	0.23807	2.58	1.63	0.23807	.	0.055777	0.64402	U	0.000001	D	0.90628	0.7061	.	.	.	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	P;P	0.58660	0.843;0.843	D	0.88046	0.2784	9	0.41790	T	0.15	.	8.6338	0.33935	0.23:0.7699:0.0:0.0	.	227;227	B3KS89;Q9BYC2	.;SCOT2_HUMAN	T	227	ENSP00000361914:A227T	ENSP00000361914:A227T	A	-	1	0	0	OXCT2	40008836	40008836	1.000000	0.71417	0.145000	0.22337	0.003000	0.03518	3.115000	0.50391	0.610000	0.30035	0.604000	0.83254	GCC	0.388808		TCGA-FB-AAQ1-01A-12D-A40W-08	0.622	OXCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025656.1	1	0	1		2	2	2	0		0	0	61		61	74	1	1.750000	-20.000000	1	0.390000	NM_022120			38	36		331	299	0		1			0	0	61	0		1.000000	0	0	0	0	0	0	38	331
TMEM59	9528	broad.mit.edu	37	1	54518728	54518728	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr1:54518728G>A	ENST00000234831.5	-	1	383	c.134C>T	c.(133-135)aCg>aTg	p.T45M	TCEANC2_ENST00000371331.1_5'Flank|TCEANC2_ENST00000234827.1_5'Flank|TMEM59_ENST00000371341.1_Intron|MIR4781_ENST00000585250.1_RNA|TMEM59_ENST00000371337.3_Missense_Mutation_p.T45M	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59	45					autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						GCAAGACGCCGTATCACCCAA	0.657																																						ENST00000234831.5	0.210000	4.000000e-02	0.160000	0.070000	0.100000	0.120396	0.100000	0.100000																										0				7						c.(133-135)aCg>aTg		transmembrane protein 59							72.0	79.0	76.0					1																	54518728		2203	4300	6503	SO:0001583	missense	9528	0	0					g.chr1:54518728G>A	AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.134C>T	chr1.hg19:g.54518728G>A	ENSP00000234831:p.Thr45Met	0					TCEANC2_ENST00000234827.1_5'Flank|TCEANC2_ENST00000371331.1_5'Flank|MIR4781_ENST00000585250.1_RNA|TMEM59_ENST00000371341.1_Intron|TMEM59_ENST00000371337.3_Missense_Mutation_p.T45M	p.T45M	NM_004872.3	NP_004863.2	0	1	1	2.100853	Q9BXS4	TMM59_HUMAN		1	383	-			B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	Missense_Mutation	SNP	ENST00000234831.5	0	1	hg19	c.134C>T	CCDS586.1	0	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296523	0.60086	.	.	ENSG00000116209	ENST00000234831;ENST00000371338;ENST00000452421;ENST00000371337	T;T;T	0.53423	0.63;0.63;0.62	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.049713	0.85682	D	0.000000	T	0.61640	0.2363	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.68621	0.925;0.959;0.931;0.953	T	0.63287	-0.6671	10	0.72032	D	0.01	-9.1589	14.3713	0.66840	0.0:0.1476:0.8524:0.0	.	45;45;45;45	E9PGZ9;Q5T704;D3DQ48;Q9BXS4	.;.;.;TMM59_HUMAN	M	45	ENSP00000234831:T45M;ENSP00000397772:T45M;ENSP00000360388:T45M	ENSP00000234831:T45M	T	-	2	0	0	TMEM59	54291316	54291316	1.000000	0.71417	0.989000	0.46669	0.173000	0.22820	7.028000	0.76470	2.653000	0.90120	0.655000	0.94253	ACG	0.388808		TCGA-FB-AAQ1-01A-12D-A40W-08	0.657	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023254.2	0	0	1		2	2	2	0		0	0	51		51	50	1	1.750000	-3.041771	1	0.390000	NM_004872			6	5		288	282	0		1	0		0	0	51	0		0.962718	9.990584e-01	0	0	0	728	0	6	288
ATP8B2	57198	broad.mit.edu	37	1	154316375	154316375	+	Missense_Mutation	SNP	G	G	A	rs141457358		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr1:154316375G>A	ENST00000368489.3	+	18	1864	c.1864G>A	c.(1864-1866)Gca>Aca	p.A622T		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	608					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCAGGAGTACGCAGGGGAAGG	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20116	0.0		0.0	False		,,,				2504	0.0					ENST00000368489.3	1.000000	6.900000e-01	1.000000	0.800000	0.920000	0.908201	0.920000	1.000000																									IL6R/ATP8B2(2)	0				51						c.(1864-1866)Gca>Aca		ATPase, aminophospholipid transporter, class I, type 8B, member 2		G	THR/ALA	0,4406		0,0,2203	43.0	42.0	42.0		1864	5.6	0.3	1	dbSNP_134	42	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATP8B2	NM_020452.3	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	622/1224	154316375	1,13005	2203	4300	6503	SO:0001583	missense	57198	2	121410	35				g.chr1:154316375G>A	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1864G>A	chr1.hg19:g.154316375G>A	ENSP00000357475:p.Ala622Thr	0						p.A622T	NM_020452.3	NP_065185.1	0	0	0	2.081284	P98198	AT8B2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)	18	1864	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	1	1	hg19	c.1864G>A	CCDS1066.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.57	3.852315	0.71719	0.0	1.16E-4	ENSG00000143515	ENST00000368489	D	0.86297	-2.1	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.059984	0.64402	D	0.000004	D	0.95865	0.8654	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.96491	0.9364	10	0.87932	D	0	.	18.4499	0.90700	0.0:0.0:1.0:0.0	.	622	P98198-3	.	T	622	ENSP00000357475:A622T	ENSP00000357475:A622T	A	+	1	0	0	ATP8B2	152582999	152582999	1.000000	0.71417	0.288000	0.24862	0.015000	0.08874	9.657000	0.98554	2.937000	0.99478	0.650000	0.86243	GCA	0.385205		TCGA-FB-AAQ1-01A-12D-A40W-08	0.592	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	1	0	1		2	2	2	0		0	0	29		29	29	1	1.750000	-3.448627	1	0.390000	NM_020452			44	44		198	196	1		1	0		0	0	29	0		1.000000	5.710564e-01	0	0	0	10	0	44	198
AVP	551	broad.mit.edu	37	20	3065237	3065237	+	Silent	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr20:3065237G>A	ENST00000380293.3	-	1	133	c.84C>T	c.(82-84)ggC>ggT	p.G28G		NM_000490.4	NP_000481.2	P01185	NEU2_HUMAN	arginine vasopressin	28					cell-cell signaling (GO:0007267)|ERK1 and ERK2 cascade (GO:0070371)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|hyperosmotic salinity response (GO:0042538)|locomotory behavior (GO:0007626)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of female receptivity (GO:0007621)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of renal sodium excretion (GO:0035813)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to testosterone (GO:0033574)|signal transduction (GO:0007165)|social behavior (GO:0035176)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)|water transport (GO:0006833)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|neuropeptide hormone activity (GO:0005184)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|signal transducer activity (GO:0004871)|V1A vasopressin receptor binding (GO:0031894)			central_nervous_system(1)|prostate(1)|skin(1)	3				COAD - Colon adenocarcinoma(99;0.00643)		CCCTCTTGCCGCCCCTCGGGC	0.647																																						ENST00000380293.3	0.660000	4.400000e-01	0.610000	0.490000	0.540000	0.555838	0.540000	0.550000																										0				3						c.(82-84)ggC>ggT		arginine vasopressin							118.0	110.0	112.0					20																	3065237		2203	4300	6503	SO:0001819	synonymous_variant	551	2	121412	39				g.chr20:3065237G>A	M25647	CCDS13045.1	20p13	2014-09-17	2008-07-31		ENSG00000101200	ENSG00000101200		"""Endogenous ligands"""	894	protein-coding gene	gene with protein product	"""antidiuretic hormone"", ""neurophysin II"", ""diabetes insipidus"", ""neurohypophyseal"", ""prepro-AVP-NP II"", ""prepro-arginine-vasopressin-neurophysin II"""	192340		ARVP		1840604	Standard	NM_000490		Approved	ADH	uc002whu.3	P01185	OTTHUMG00000031733	ENST00000380293.3:c.84C>T	chr20.hg19:g.3065237G>A		0						p.G28G	NM_000490.4	NP_000481.2	0	1	1	1.939743	P01185	NEU2_HUMAN		1	133	-			A0AV35|O14935	Silent	SNP	ENST00000380293.3	1	1	hg19	c.84C>T	CCDS13045.1	0																																																																																								0.335584		TCGA-FB-AAQ1-01A-12D-A40W-08	0.647	AVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077713.2	1	0	1		2	2	2	0		0	0	109		109	109	1	1.750000	-20.000000	1	0.390000	NM_000490			84	83		632	612	1		1			0	0	109	0		1.000000	0	0	0	0	0	0	84	632
PTPN1	5770	broad.mit.edu	37	20	49195731	49195731	+	Silent	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr20:49195731C>T	ENST00000371621.3	+	7	903	c.729C>T	c.(727-729)tcC>tcT	p.S243S	RP4-530I15.9_ENST00000431019.1_RNA|PTPN1_ENST00000541713.1_Silent_p.S170S	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	243	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)	p.S243S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	ACCCTTCTTCCGTTGATATCA	0.483																																						ENST00000371621.3	0.750000	5.000000e-01	0.690000	0.560000	0.620000	0.628335	0.620000	0.620000																										1	Substitution - coding silent(1)	p.S243S(1)	lung(1)	16						c.(727-729)tcC>tcT		protein tyrosine phosphatase, non-receptor type 1	Tiludronate(DB01133)						141.0	141.0	141.0					20																	49195731		2203	4300	6503	SO:0001819	synonymous_variant	5770	0	0					g.chr20:49195731C>T		CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.729C>T	chr20.hg19:g.49195731C>T		0					RP4-530I15.9_ENST00000431019.1_RNA|PTPN1_ENST00000541713.1_Silent_p.S170S	p.S243S	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	0	1	1	2.022946	P18031	PTN1_HUMAN		7	903	+		Lung NSC(126;0.163)	Q5TGD8|Q9BQV9|Q9NQQ4	Silent	SNP	ENST00000371621.3	1	1	hg19	c.729C>T	CCDS13430.1	0																																																																																								0.357421		TCGA-FB-AAQ1-01A-12D-A40W-08	0.483	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079694.2	1	0	1		2	2	2	0		0	0	125		125	125	1	1.750000	-2.578431	1	0.390000				87	85		591	584	1		1	1		0	0	125	0		1.000000	9.782649e-01	0	6	0	37	0	87	591
SGSM1	129049	broad.mit.edu	37	22	25294312	25294312	+	Missense_Mutation	SNP	C	C	T	rs376575281		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr22:25294312C>T	ENST00000400359.4	+	20	2568	c.2561C>T	c.(2560-2562)aCg>aTg	p.T854M	SGSM1_ENST00000400358.4_Missense_Mutation_p.T799M|SNORD56_ENST00000362913.1_RNA	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	854	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						ATGTCCATCACGGGCAGCCTG	0.612																																						ENST00000400359.4	1.000000	7.300000e-01	0.990000	0.820000	0.910000	0.909661	0.910000	1.000000																										0				41						c.(2560-2562)aCg>aTg		small G protein signaling modulator 1		C	MET/THR,MET/THR,MET/THR,MET/THR	0,4338		0,0,2169	57.0	64.0	61.0		2561,2396,2213,2378	4.2	0.4	22		61	1,8525		0,1,4262	no	missense,missense,missense,missense	SGSM1	NM_001039948.2,NM_001098497.1,NM_001098498.1,NM_133454.2	81,81,81,81	0,1,6431	TT,TC,CC		0.0117,0.0,0.0078	benign,benign,benign,benign	854/1149,799/1094,738/1033,793/1088	25294312	1,12863	2169	4263	6432	SO:0001583	missense	129049	3	121242	38				g.chr22:25294312C>T	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2561C>T	chr22.hg19:g.25294312C>T	ENSP00000383212:p.Thr854Met	1					SGSM1_ENST00000400358.4_Missense_Mutation_p.T799M|SNORD56_ENST00000362913.1_RNA	p.T854M	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	0	1	1	1.777601	Q2NKQ1	SGSM1_HUMAN		20	2568	+			A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	1	1	hg19	c.2561C>T	CCDS46674.1	1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330557	0.24167	0.0	1.17E-4	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.07114	3.22;3.23	5.24	4.21	0.49690	5.24	4.21	0.49690	Rab-GAP/TBC domain (2);	0.677319	0.14164	U	0.337193	T	0.10121	0.0248	L	0.34521	1.04	0.09310	N	1	P;P;D;P	0.59767	0.851;0.54;0.986;0.923	B;B;P;B	0.47206	0.204;0.023;0.541;0.266	T	0.17440	-1.0369	10	0.42905	T	0.14	-0.2681	11.6566	0.51322	0.1388:0.7275:0.1338:0.0	.	799;854;871;854	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	M	854;799;854	ENSP00000383211:T799M;ENSP00000383212:T854M	ENSP00000383211:T799M	T	+	2	0	0	SGSM1	23624312	23624312	0.004000	0.15560	0.388000	0.26195	0.808000	0.45660	1.049000	0.30392	1.327000	0.45338	0.591000	0.81541	ACG	0.245889		TCGA-FB-AAQ1-01A-12D-A40W-08	0.612	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	1	0	1		2	2	2	0		0	0	42		42	39	1	1.750000	-20.000000	1	0.390000	XM_059318			54	54		176	173	1		1	0		0	0	42	0		1.000000	2.394316e-01	0	0	0	4	0	54	176
SAMM50	25813	broad.mit.edu	37	22	44384997	44384997	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr22:44384997A>G	ENST00000350028.4	+	13	1239	c.1082A>G	c.(1081-1083)tAc>tGc	p.Y361C	SAMM50_ENST00000396202.3_Missense_Mutation_p.Y151C	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	361					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TTAGGAGACTACCTAGGTGGA	0.517																																						ENST00000350028.4	1.000000	8.700000e-01	1.000000	0.930000	0.980000	0.975070	0.980000	1.000000																										0				22						c.(1081-1083)tAc>tGc		SAMM50 sorting and assembly machinery component							154.0	147.0	149.0					22																	44384997		2203	4300	6503	SO:0001583	missense	25813	0	0					g.chr22:44384997A>G	AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.1082A>G	chr22.hg19:g.44384997A>G	ENSP00000345445:p.Tyr361Cys	1					SAMM50_ENST00000396202.3_Missense_Mutation_p.Y151C	p.Y361C	NM_015380.4	NP_056195.3	0	1	1	1.776780	Q9Y512	SAM50_HUMAN		13	1239	+		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	ENST00000350028.4	1	1	hg19	c.1082A>G	CCDS14055.1	1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.988993	0.53934	.	.	ENSG00000100347	ENST00000350028;ENST00000396202	T;T	0.42131	0.98;0.98	4.21	4.21	0.49690	4.21	4.21	0.49690	Bacterial surface antigen (D15) (1);	0.063355	0.64402	D	0.000004	T	0.50888	0.1642	L	0.40543	1.245	0.80722	D	1	B;D	0.55385	0.022;0.971	B;P	0.62649	0.021;0.905	T	0.48305	-0.9047	10	0.41790	T	0.15	-20.455	12.8072	0.57619	1.0:0.0:0.0:0.0	.	166;361	B3KUE6;Q9Y512	.;SAM50_HUMAN	C	361;151	ENSP00000345445:Y361C;ENSP00000379505:Y151C	ENSP00000345445:Y361C	Y	+	2	0	0	SAMM50	42716330	42716330	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.497000	0.66924	1.682000	0.51000	0.528000	0.53228	TAC	0.249508		TCGA-FB-AAQ1-01A-12D-A40W-08	0.517	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318898.2	1	0	1		2	2	2	0		0	0	98		98	98	1	1.750000	-20.000000	1	0.390000	NM_015380			130	127		383	375	1		1	1		0	0	98	0		1.000000	1	0	39	0	45	0	130	383
HECW2	57520	broad.mit.edu	37	2	197187274	197187274	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr2:197187274C>T	ENST00000260983.3	-	7	994	c.812G>A	c.(811-813)cGt>cAt	p.R271H	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	271	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GATGATGGGACGGCTCTTGGC	0.423																																						ENST00000260983.3	0.630000	4.000000e-01	0.580000	0.450000	0.510000	0.518889	0.510000	0.510000																										0				113						c.(811-813)cGt>cAt		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2							131.0	137.0	135.0					2																	197187274		2203	4300	6503	SO:0001583	missense	57520	0	0					g.chr2:197187274C>T	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.812G>A	chr2.hg19:g.197187274C>T	ENSP00000260983:p.Arg271His	0					HECW2_ENST00000409111.1_5'UTR	p.R271H	NM_020760.1	NP_065811.1	0	1	1	1.946150	Q9P2P5	HECW2_HUMAN		7	994	-			B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	1	1	hg19	c.812G>A	CCDS33354.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.137069	0.94517	.	.	ENSG00000138411	ENST00000260983	T	0.46451	0.87	5.49	4.6	0.57074	5.49	4.6	0.57074	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.191653	0.47455	D	0.000223	T	0.44973	0.1319	M	0.75447	2.3	0.58432	D	0.999998	B	0.29627	0.252	B	0.26614	0.071	T	0.51741	-0.8667	10	0.87932	D	0	.	14.9482	0.71050	0.0:0.9304:0.0:0.0696	.	271	Q9P2P5	HECW2_HUMAN	H	271	ENSP00000260983:R271H	ENSP00000260983:R271H	R	-	2	0	0	HECW2	196895519	196895519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.912000	0.69948	2.878000	0.98634	0.650000	0.86243	CGT	0.331324		TCGA-FB-AAQ1-01A-12D-A40W-08	0.423	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	1	0	1		2	2	2	0		0	0	128		128	128	1	1.750000	-19.960200	1	0.390000	NM_020760			64	63		518	511	1		1			0	0	128	0		1.000000	0	0	0	0	0	0	64	518
FZD7	8324	broad.mit.edu	37	2	202900003	202900003	+	Silent	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr2:202900003C>T	ENST00000286201.1	+	1	694	c.633C>T	c.(631-633)ccC>ccT	p.P211P	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	211					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						TCTCATGCCCCCGTCAGCTCA	0.711											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000286201.1	0.470000	1.100000e-01	0.360000	0.170000	0.250000	0.275058	0.250000	0.240000																										0				31						c.(631-633)ccC>ccT		frizzled class receptor 7							12.0	14.0	14.0					2																	202900003		2143	4222	6365	SO:0001819	synonymous_variant	8324	0	0					g.chr2:202900003C>T	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.633C>T	chr2.hg19:g.202900003C>T		0		OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2133	RP11-107N15.1_ENST00000608741.1_lincRNA	p.P211P	NM_003507.1	NP_003498.1	0	1	1	1.946150	O75084	FZD7_HUMAN		1	694	+			O94816|Q53S59|Q96B74	Silent	SNP	ENST00000286201.1	0	1	hg19	c.633C>T	CCDS2351.1	0																																																																																								0.331324		TCGA-FB-AAQ1-01A-12D-A40W-08	0.711	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	1	0	1		2	2	2	0		0	0	22		22	21	1	1.750000	-10.654640	1	0.390000	NM_003507			7	7		125	124	0		1	0		0	0	22	0		0.981019	2.160986e-02	0	1	0	3	0	7	125
SPEG	10290	broad.mit.edu	37	2	220356970	220356970	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr2:220356970C>A	ENST00000312358.7	+	40	9731	c.9599C>A	c.(9598-9600)tCt>tAt	p.S3200Y	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	3200	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AAGGTTCTCTCTGTACATCCC	0.612																																						ENST00000312358.7	0.170000	2.000000e-02	0.130000	0.050000	0.080000	0.094499	0.080000	0.080000																										0				100						c.(9598-9600)tCt>tAt		SPEG complex locus							83.0	88.0	86.0					2																	220356970		2045	4187	6232	SO:0001583	missense	10290	0	0					g.chr2:220356970C>A	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.9599C>A	chr2.hg19:g.220356970C>A	ENSP00000311684:p.Ser3200Tyr	0					SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	p.S3200Y	NM_005876.4	NP_005867.3	0	1	1	1.946150	Q15772	SPEG_HUMAN		40	9731	+		Renal(207;0.0183)	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	0	1	hg19	c.9599C>A	CCDS42824.1	0	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218399	0.58560	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.66099	-0.19	4.29	4.29	0.51040	4.29	4.29	0.51040	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.31450	U	0.007628	T	0.70675	0.3251	L	0.48362	1.52	0.80722	D	1	D	0.71674	0.998	D	0.66196	0.942	T	0.73235	-0.4047	10	0.62326	D	0.03	.	13.2469	0.60028	0.0:0.8395:0.1605:0.0	.	3200	Q15772	SPEG_HUMAN	Y	3200	ENSP00000311684:S3200Y	ENSP00000265327:S3200Y	S	+	2	0	0	SPEG	220065214	220065214	0.998000	0.40836	1.000000	0.80357	0.935000	0.57460	3.968000	0.56809	2.229000	0.72834	0.467000	0.42956	TCT	0.331324		TCGA-FB-AAQ1-01A-12D-A40W-08	0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	0	0	0		2	2	2	0		0	0	48		48	48	1	1.750000	-4.040233	1	0.390000	NM_005876			5	4		288	283	0		1	0		0	0	48	0		0.934616	4.809895e-04	0	0	0	2	0	5	288
THADA	63892	broad.mit.edu	37	2	43787408	43787408	+	Silent	SNP	G	G	A	rs78531159		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr2:43787408G>A	ENST00000405006.4	-	16	2779	c.2428C>T	c.(2428-2430)Ctg>Ttg	p.L810L	THADA_ENST00000402360.2_Silent_p.L810L|THADA_ENST00000415080.2_Silent_p.L520L|THADA_ENST00000330266.7_Silent_p.L520L|THADA_ENST00000405975.2_Silent_p.L810L|THADA_ENST00000404790.1_Silent_p.L810L	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	810										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AACTTCATCAGAAGATCAAAT	0.338																																						ENST00000405006.4	1.000000	6.700000e-01	0.980000	0.790000	0.900000	0.895144	0.900000	1.000000																										0				66						c.(2428-2430)Ctg>Ttg		thyroid adenoma associated							66.0	66.0	66.0					2																	43787408		1820	4071	5891	SO:0001819	synonymous_variant	63892	0	0					g.chr2:43787408G>A	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2428C>T	chr2.hg19:g.43787408G>A		1					THADA_ENST00000405975.2_Silent_p.L810L|THADA_ENST00000415080.2_Silent_p.L520L|THADA_ENST00000404790.1_Silent_p.L810L|THADA_ENST00000402360.2_Silent_p.L810L|THADA_ENST00000330266.7_Silent_p.L520L	p.L810L	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	0	1	1	1.733625	Q6YHU6	THADA_HUMAN		16	2779	-		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Silent	SNP	ENST00000405006.4	1	1	hg19	c.2428C>T	CCDS46268.1	1																																																																																								0.244067		TCGA-FB-AAQ1-01A-12D-A40W-08	0.338	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	1	0	1		2	2	2	0		0	0	19		19	19	1	1.750000	-18.967400	1	0.390000	NM_022065			24	24		67	66	1		1	0		0	0	19	0		1.000000	6.675736e-01	0	0	0	8	0	24	67
UBE2F	140739	broad.mit.edu	37	2	238940869	238940869	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr2:238940869G>A	ENST00000272930.4	+	8	612	c.418G>A	c.(418-420)Gtt>Att	p.V140I	UBE2F_ENST00000414443.1_Missense_Mutation_p.V108I|UBE2F_ENST00000409332.1_Missense_Mutation_p.V118I|UBE2F-SCLY_ENST00000449191.1_Intron|UBE2F_ENST00000409953.1_Missense_Mutation_p.V116I|UBE2F_ENST00000409633.1_Missense_Mutation_p.V140I	NM_001278305.1|NM_080678.2	NP_001265234.1|NP_542409.1	Q969M7	UBE2F_HUMAN	ubiquitin-conjugating enzyme E2F (putative)	140					protein neddylation (GO:0045116)		ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)			endometrium(1)|large_intestine(1)	2		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;6.7e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|Kidney(56;3.53e-09)|KIRC - Kidney renal clear cell carcinoma(57;9.79e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000136)|Lung(119;0.0126)|LUSC - Lung squamous cell carcinoma(224;0.0301)		TCAGGATGTCGTTTGGGGATT	0.338																																						ENST00000272930.4	0.440000	1.200000e-01	0.350000	0.180000	0.250000	0.273491	0.250000	0.250000																										0				2						c.(418-420)Gtt>Att		ubiquitin-conjugating enzyme E2F (putative)							125.0	115.0	118.0					2																	238940869		2203	4299	6502	SO:0001583	missense	140739	2	121406	32				g.chr2:238940869G>A	BC010549	CCDS2523.1, CCDS63175.1, CCDS63176.1, CCDS63177.1	2q37.3	2008-02-05	2005-12-15		ENSG00000184182	ENSG00000184182		"""Ubiquitin-conjugating enzymes E2"""	12480	protein-coding gene	gene with protein product	"""NEDD8 conjugating enzyme"""					12477932	Standard	NM_080678		Approved	NCE2	uc031rrz.1	Q969M7	OTTHUMG00000133341	ENST00000272930.4:c.418G>A	chr2.hg19:g.238940869G>A	ENSP00000272930:p.Val140Ile	0					UBE2F_ENST00000414443.1_Missense_Mutation_p.V108I|UBE2F-SCLY_ENST00000449191.1_Intron|UBE2F_ENST00000409332.1_Missense_Mutation_p.V118I|UBE2F_ENST00000409953.1_Missense_Mutation_p.V116I|UBE2F_ENST00000409633.1_Missense_Mutation_p.V140I	p.V140I	NM_001278305.1|NM_080678.2	NP_001265234.1|NP_542409.1	0	1	1	1.946150	Q969M7	UBE2F_HUMAN		8	612	+		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)	A8K1Z8|B4DDT9|B4DFI1|B4DMK3|B4DZU2|B8ZZG2|C9J212|H9KVB9	Missense_Mutation	SNP	ENST00000272930.4	1	1	hg19	c.418G>A	CCDS2523.1	0	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260616	0.23051	.	.	ENSG00000184182	ENST00000272930;ENST00000416292;ENST00000409633;ENST00000414443;ENST00000409953;ENST00000409332;ENST00000434655;ENST00000434137	T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	4.87	4.87	0.63330	4.87	4.87	0.63330	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.063698	0.64402	N	0.000007	T	0.50514	0.1620	N	0.05554	-0.025	0.44719	D	0.997713	B;B	0.17852	0.024;0.0	B;B	0.16289	0.015;0.004	T	0.47156	-0.9139	10	0.30854	T	0.27	-20.783	13.8838	0.63696	0.0:0.0:1.0:0.0	.	108;140	Q969M7-3;Q969M7	.;UBE2F_HUMAN	I	140;108;140;108;116;118;140;130	ENSP00000272930:V140I;ENSP00000390813:V108I;ENSP00000387299:V140I;ENSP00000399183:V108I;ENSP00000386680:V116I;ENSP00000387060:V118I;ENSP00000406113:V140I;ENSP00000414619:V130I	ENSP00000272930:V140I	V	+	1	0	0	UBE2F	238605608	238605608	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.227000	0.78070	2.419000	0.82065	0.655000	0.94253	GTT	0.331324		TCGA-FB-AAQ1-01A-12D-A40W-08	0.338	UBE2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257171.2	1	0	1		2	2	2	0		0	0	45		45	44	1	1.750000	-4.826430	1	0.390000	NM_080678			9	9		158	157	0		1	1		0	0	45	0		0.994465	9.863845e-01	0	23	0	112	0	9	158
DCLK3	85443	broad.mit.edu	37	3	36759634	36759634	+	Silent	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr3:36759634G>A	ENST00000416516.2	-	4	2110	c.1620C>T	c.(1618-1620)ggC>ggT	p.G540G	DCLK3_ENST00000498047.1_5'UTR	NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	540	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G540G(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AGAGGATCACGCCAGCAGCCC	0.547																																						ENST00000416516.2	1.000000	7.500000e-01	0.960000	0.810000	0.880000	0.890505	0.880000	1.000000																										1	Substitution - coding silent(1)	p.G540G(1)	large_intestine(1)	48						c.(1618-1620)ggC>ggT		doublecortin-like kinase 3							143.0	157.0	152.0					3																	36759634		2141	4281	6422	SO:0001819	synonymous_variant	85443	2	121190	36				g.chr3:36759634G>A	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1620C>T	chr3.hg19:g.36759634G>A		0					DCLK3_ENST00000498047.1_5'UTR	p.G540G	NM_033403.1	NP_208382.1	0	1	1	2.004812	Q9C098	DCLK3_HUMAN		4	2110	-				Silent	SNP	ENST00000416516.2	1	1	hg19	c.1620C>T	CCDS43064.1	1																																																																																								0.358739		TCGA-FB-AAQ1-01A-12D-A40W-08	0.547	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	1	0	1		19	2	2	0		0	1	132		132	129	1	1.750000	-20.000000	1	0.390000	XM_047355			132	129		591	579	1		1	0		0	0	132	0		1.000000	0	0	0	0	1	0	132	591
BCHE	590	broad.mit.edu	37	3	165547794	165547794	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr3:165547794G>T	ENST00000264381.3	-	2	1194	c.1028C>A	c.(1027-1029)aCc>aAc	p.T343N	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	343					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CAAAATCTGGGTTTTTTTAAA	0.383																																						ENST00000264381.3	1.000000	3.000000e-01	0.620000	0.390000	0.490000	0.516470	0.490000	0.480000																										0				55	GRCh37	CI951904	BCHE	I		c.(1027-1029)aCc>aAc		butyrylcholinesterase	Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)						26.0	27.0	27.0					3																	165547794		2196	4281	6477	SO:0001583	missense	590	0	0					g.chr3:165547794G>T	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1028C>A	chr3.hg19:g.165547794G>T	ENSP00000264381:p.Thr343Asn	0					BCHE_ENST00000540653.1_Intron	p.T343N	NM_000055.2	NP_000046.1	1	2	3	2.125667	P06276	CHLE_HUMAN		2	1194	-			A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	1	1	hg19	c.1028C>A	CCDS3198.1	0	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913768	0.33815	.	.	ENSG00000114200	ENST00000264381	D	0.95342	-3.68	5.62	5.62	0.85841	5.62	5.62	0.85841	Carboxylesterase, type B (1);	0.151216	0.64402	D	0.000015	D	0.97315	0.9122	M	0.86028	2.79	0.80722	D	1	P	0.48834	0.916	P	0.61477	0.889	D	0.97737	1.0206	10	0.87932	D	0	.	18.6354	0.91376	0.0:0.0:1.0:0.0	.	343	P06276	CHLE_HUMAN	N	343	ENSP00000264381:T343N	ENSP00000264381:T343N	T	-	2	0	0	BCHE	167030488	167030488	1.000000	0.71417	0.999000	0.59377	0.272000	0.26649	3.334000	0.52097	2.652000	0.90054	0.655000	0.94253	ACC	0.394721		TCGA-FB-AAQ1-01A-12D-A40W-08	0.383	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1	1	0	1		2	2	2	0		0	0	43		43	43	1	1.750000	-8.236143	1	0.390000				18	18		174	174	0		1	0		0	0	43	0		0.999986	1.127062e-01	0	0	0	6	0	18	174
AP1AR	55435	broad.mit.edu	37	4	113181980	113181980	+	Missense_Mutation	SNP	G	G	A	rs201026911		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr4:113181980G>A	ENST00000274000.5	+	5	599	c.244G>A	c.(244-246)Gaa>Aaa	p.E82K	AP1AR_ENST00000309703.6_Missense_Mutation_p.E82K	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein	82	Interaction with AP1G1.				cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						TTCCATTGCCGAAAAACAAAA	0.299																																						ENST00000274000.5	1.000000	4.000000e-02	0.250000	0.090000	0.150000	0.200183	0.150000	0.140000																										0				9						c.(244-246)Gaa>Aaa		adaptor-related protein complex 1 associated regulatory protein		G	LYS/GLU,LYS/GLU	0,4404		0,0,2202	32.0	33.0	33.0		244,244	5.5	1.0	4		33	1,8585	1.2+/-3.3	0,1,4292	no	missense,missense	AP1AR	NM_001128426.1,NM_018569.4	56,56	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	82/270,82/303	113181980	1,12989	2202	4293	6495	SO:0001583	missense	55435	14	121350	36				g.chr4:113181980G>A	AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.244G>A	chr4.hg19:g.113181980G>A	ENSP00000274000:p.Glu82Lys	0					AP1AR_ENST00000309703.6_Missense_Mutation_p.E82K	p.E82K	NM_018569.4	NP_061039.3	1	2	3	2.141371	Q63HQ0	AP1AR_HUMAN		5	599	+			B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Missense_Mutation	SNP	ENST00000274000.5	0	1	hg19	c.244G>A	CCDS3696.1	0	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991977	0.74703	0.0	1.16E-4	ENSG00000138660	ENST00000274000;ENST00000309703	T;T	0.52526	0.71;0.66	5.51	5.51	0.81932	5.51	5.51	0.81932	.	0.052746	0.85682	D	0.000000	T	0.44685	0.1305	L	0.50333	1.59	0.45607	D	0.998545	P;P;P	0.47034	0.889;0.889;0.889	B;B;B	0.36922	0.236;0.236;0.236	T	0.52764	-0.8532	10	0.66056	D	0.02	-10.341	19.3993	0.94621	0.0:0.0:1.0:0.0	.	82;82;82	B2RCV7;Q63HQ0-2;Q63HQ0	.;.;AP1AR_HUMAN	K	82	ENSP00000274000:E82K;ENSP00000309023:E82K	ENSP00000274000:E82K	E	+	1	0	0	AP1AR	113401429	113401429	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.042000	0.70996	2.579000	0.87056	0.585000	0.79938	GAA	0.395890		TCGA-FB-AAQ1-01A-12D-A40W-08	0.299	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256323.2	0	0	1		2	2	2	0		0	0	37		37	37	1	1.750000	-3.049653	1	0.390000	NM_018569			4	5		146	145	0		1	0		0	0	37	0		0.891422	1.688819e-01	0	0	0	22	0	4	146
BEND4	389206	broad.mit.edu	37	4	42127607	42127607	+	Missense_Mutation	SNP	G	G	A	rs374001079		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr4:42127607G>A	ENST00000502486.1	-	4	1718	c.1139C>T	c.(1138-1140)cCg>cTg	p.P380L	BEND4_ENST00000504360.1_Missense_Mutation_p.P376L	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	380										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						TACCTCTGTCGGCTGGTCAGC	0.458																																						ENST00000502486.1	1.000000	7.900000e-01	0.990000	0.870000	0.940000	0.936901	0.940000	0.990000																										0				26						c.(1138-1140)cCg>cTg		BEN domain containing 4		G	LEU/PRO,LEU/PRO	2,3864		0,2,1931	105.0	110.0	108.0		1139,1139	5.7	1.0	4		108	0,8260		0,0,4130	no	missense,missense	BEND4	NM_207406.3,NM_001159547.1	98,98	0,2,6061	AA,AG,GG		0.0,0.0517,0.0165	benign,benign	380/535,380/442	42127607	2,12124	1933	4130	6063	SO:0001583	missense	389206	8	120870	40				g.chr4:42127607G>A	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.1139C>T	chr4.hg19:g.42127607G>A	ENSP00000421169:p.Pro380Leu	1					BEND4_ENST00000504360.1_Missense_Mutation_p.P376L	p.P380L	NM_207406.3	NP_997289.2	0	1	1	1.734875	Q6ZU67	BEND4_HUMAN		4	1718	-			A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	1	1	hg19	c.1139C>T	CCDS47048.1	1	.	.	.	.	.	.	.	.	.	.	G	5.183	0.219366	0.09863	5.17E-4	0.0	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.061993	0.64402	D	0.000003	T	0.28962	0.0719	N	0.08118	0	0.80722	D	1	P;B;P	0.39862	0.692;0.233;0.692	B;B;B	0.28465	0.09;0.024;0.09	T	0.24799	-1.0150	9	0.09590	T	0.72	-9.3894	19.773	0.96379	0.0:0.0:1.0:0.0	.	302;380;380	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	L	251;380;376	.	ENSP00000412495:P251L	P	-	2	0	0	BEND4	41822364	41822364	1.000000	0.71417	0.961000	0.40146	0.018000	0.09664	7.109000	0.77062	2.677000	0.91161	0.655000	0.94253	CCG	0.242236		TCGA-FB-AAQ1-01A-12D-A40W-08	0.458	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	1	0	1		2	2	2	0		0	0	35		35	33	1	1.750000	-5.080024	1	0.390000	NM_207406			52	51		139	134	1		1			0	0	35	0		1.000000	0	0	0	0	0	0	52	139
TIGD2	166815	broad.mit.edu	37	4	90034245	90034245	+	Silent	SNP	C	C	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr4:90034245C>A	ENST00000317005.2	+	1	278	c.120C>A	c.(118-120)tcC>tcA	p.S40S	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	40	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		TTGGTGAATCCACAGTTCGTG	0.363																																						ENST00000317005.2	0.690000	4.000000e-01	0.620000	0.460000	0.530000	0.546113	0.530000	0.540000																										0				14						c.(118-120)tcC>tcA		tigger transposable element derived 2							99.0	100.0	100.0					4																	90034245		2203	4300	6503	SO:0001819	synonymous_variant	166815	0	0					g.chr4:90034245C>A	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.120C>A	chr4.hg19:g.90034245C>A		1					RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	p.S40S	NM_145715.2	NP_663761.1	0	1	1	1.734875	Q4W5G0	TIGD2_HUMAN		1	278	+		Hepatocellular(203;0.114)		Silent	SNP	ENST00000317005.2	1	1	hg19	c.120C>A	CCDS3633.1	0																																																																																								0.242236		TCGA-FB-AAQ1-01A-12D-A40W-08	0.363	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	1	0	1		2	2	2	0		0	0	74		74	74	1	1.750000	-2.620085	1	0.390000	NM_145715			44	43		291	286	1		1	0		0	0	74	0		1.000000	1.364690e-01	0	0	0	5	0	44	291
STOX2	56977	broad.mit.edu	37	4	184930914	184930914	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr4:184930914G>A	ENST00000308497.4	+	3	2358	c.923G>A	c.(922-924)cGg>cAg	p.R308Q	STOX2_ENST00000438269.1_Missense_Mutation_p.R308Q	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	308					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		ACGATCCCTCGGGAAGTAGAG	0.502																																						ENST00000308497.4	1.000000	7.800000e-01	1.000000	0.950000	0.990000	0.978107	0.990000	1.000000																										0				14						c.(922-924)cGg>cAg		storkhead box 2							25.0	25.0	25.0					4																	184930914		1942	4145	6087	SO:0001583	missense	56977	1	120888	23				g.chr4:184930914G>A	AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.923G>A	chr4.hg19:g.184930914G>A	ENSP00000311257:p.Arg308Gln	0					STOX2_ENST00000438269.1_Missense_Mutation_p.R308Q	p.R308Q	NM_020225.1	NP_064610.1	1	2	3	2.141371	Q9P2F5	STOX2_HUMAN		3	2358	+		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)	A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	1	1	hg19	c.923G>A	CCDS47167.1	1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854494	0.71719	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;D	0.85629	-1.07;-2.01	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	M	0.75615	2.305	0.80722	D	1	D	0.71674	0.998	D	0.66602	0.945	D	0.91940	0.5562	10	0.72032	D	0.01	-18.9454	20.6634	0.99662	0.0:0.0:1.0:0.0	.	308	Q9P2F5	STOX2_HUMAN	Q	308	ENSP00000311257:R308Q;ENSP00000390127:R308Q	ENSP00000311257:R308Q	R	+	2	0	0	STOX2	185167908	185167908	1.000000	0.71417	0.986000	0.45419	0.053000	0.15095	9.869000	0.99810	2.894000	0.99253	0.655000	0.94253	CGG	0.395890		TCGA-FB-AAQ1-01A-12D-A40W-08	0.502	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	1	0	1		2	2	2	0		0	0	16		16	16	1	1.750000	-3.913069	1	0.390000	NM_020225			24	25		84	79	1		1	0		0	0	16	0		1.000000	5.323505e-02	0	0	0	2	0	24	84
NIPBL	25836	broad.mit.edu	37	5	36985035	36985035	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr5:36985035A>G	ENST00000282516.8	+	10	2252	c.1753A>G	c.(1753-1755)Att>Gtt	p.I585V	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.I585V	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	585					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCAGGAAGATATTGTTGGAAG	0.373																																						ENST00000282516.8	1.000000	2.400000e-01	0.460000	0.300000	0.370000	0.407007	0.370000	0.370000																										0				128						c.(1753-1755)Att>Gtt		Nipped-B homolog (Drosophila)							79.0	79.0	79.0					5																	36985035		2203	4299	6502	SO:0001583	missense	25836	0	0					g.chr5:36985035A>G	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1753A>G	chr5.hg19:g.36985035A>G	ENSP00000282516:p.Ile585Val	0					NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.I585V	p.I585V	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	1	2	3	2.144092	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)	10	2252	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	1	1	hg19	c.1753A>G	CCDS3920.1	0	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.275777	0.00254	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.92752	-3.1;-3.1	5.98	-0.428	0.12306	5.98	-0.428	0.12306	.	0.570820	0.19739	N	0.107161	T	0.80813	0.4695	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.66658	-0.5868	10	0.27785	T	0.31	.	7.573	0.27920	0.6467:0.1081:0.2451:0.0	.	585;585	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	V	585	ENSP00000282516:I585V;ENSP00000406266:I585V	ENSP00000282516:I585V	I	+	1	0	0	NIPBL	37020792	37020792	0.008000	0.16893	0.990000	0.47175	0.789000	0.44602	-0.310000	0.08135	-0.064000	0.13043	-1.140000	0.01884	ATT	0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.373	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	1	0	1		2	2	2	0		0	0	72		72	72	1	1.750000	-20.000000	1	0.390000	NM_015384			27	27		354	349	0		1	0		0	0	72	0		1.000000	1.570288e-02	0	0	0	3	0	27	354
IL31RA	133396	broad.mit.edu	37	5	55203287	55203287	+	Splice_Site	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr5:55203287C>T	ENST00000447346.2	+	10	1418	c.1353C>T	c.(1351-1353)ggC>ggT	p.G451G	IL31RA_ENST00000396834.1_Splice_Site_p.G432G|IL31RA_ENST00000354961.4_Splice_Site_p.G432G|IL31RA_ENST00000297015.3_Splice_Site_p.G309G|IL31RA_ENST00000359040.5_Splice_Site_p.G451G|IL31RA_ENST00000490985.1_Splice_Site_p.G309G|IL31RA_ENST00000396836.2_Splice_Site_p.G451G	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	419	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CCAAAGAAGGCGGTATGAATG	0.463																																						ENST00000447346.2	1.000000	5.900000e-01	0.940000	0.680000	0.790000	0.808078	0.790000	1.000000																										0				21						c.(1351-1353)ggC>ggT		interleukin 31 receptor A							99.0	87.0	91.0					5																	55203287		2203	4300	6503	SO:0001630	splice_region_variant	133396	4	121410	37				g.chr5:55203287C>T	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1354+1C>T	chr5.hg19:g.55203287C>T		0					IL31RA_ENST00000396834.1_Splice_Site_p.G432G|IL31RA_ENST00000490985.1_Splice_Site_p.G309G|IL31RA_ENST00000359040.5_Splice_Site_p.G451G|IL31RA_ENST00000297015.3_Splice_Site_p.G309G|IL31RA_ENST00000396836.2_Splice_Site_p.G451G|IL31RA_ENST00000354961.4_Splice_Site_p.G432G	p.G451G	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	1	2	3	2.144092	Q8NI17	IL31R_HUMAN		10	1418	+		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Splice_Site	SNP	ENST00000447346.2	1	0	hg19	c.1353C>T	CCDS3970.2	0																																																																																								0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.463	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	1	0	1		2	2	2	0		0	0	65		65	62	1	1.750000	-3.086833	1	0.390000	NM_139017	Silent		42	36		233	210	1		1	0		0	0	65	0		1.000000	6.578289e-02	0	0	0	3	0	42	233
DEPDC1B	55789	broad.mit.edu	37	5	59941390	59941390	+	Silent	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr5:59941390G>A	ENST00000265036.5	-	4	574	c.507C>T	c.(505-507)tgC>tgT	p.C169C	DEPDC1B_ENST00000453022.2_Silent_p.C169C|DEPDC1B_ENST00000545085.1_Silent_p.C142C	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	169					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				GGACAAGACGGCAAGCTGGCA	0.438																																						ENST00000265036.5	1.000000	3.000000e-02	0.160000	0.050000	0.090000	0.147351	0.090000	0.090000																										0				17						c.(505-507)tgC>tgT		DEP domain containing 1B							80.0	80.0	80.0					5																	59941390		2203	4300	6503	SO:0001819	synonymous_variant	55789	0	0					g.chr5:59941390G>A	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.507C>T	chr5.hg19:g.59941390G>A		0					DEPDC1B_ENST00000453022.2_Silent_p.C169C|DEPDC1B_ENST00000545085.1_Silent_p.C142C	p.C169C	NM_018369.2	NP_060839.2	1	2	3	2.144092	Q8WUY9	DEP1B_HUMAN		4	574	-		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Silent	SNP	ENST00000265036.5	0	1	hg19	c.507C>T	CCDS3977.1	0																																																																																								0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.438	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	0	0	1		2	2	2	0		0	0	50		50	48	1	1.750000	-2.897948	1	0.390000	NM_018369			5	5		287	286	0		1	0		0	0	50	0		0.937504	6.149756e-02	0	0	0	19	0	5	287
SPINK5	11005	broad.mit.edu	37	5	147510862	147510862	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr5:147510862T>C	ENST00000256084.7	+	31	3047	c.3005T>C	c.(3004-3006)aTa>aCa	p.I1002T	SPINK5_ENST00000359874.3_Missense_Mutation_p.I1032T	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	1002	Kazal-like 15. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGCCCAGGATAGGTTATCTT	0.428																																						ENST00000256084.7	1.000000	7.900000e-01	1.000000	0.850000	0.920000	0.926478	0.920000	1.000000																										0				64						c.(3004-3006)aTa>aCa		serine peptidase inhibitor, Kazal type 5							257.0	241.0	246.0					5																	147510862		1921	4133	6054	SO:0001583	missense	11005	0	0					g.chr5:147510862T>C	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.3005T>C	chr5.hg19:g.147510862T>C	ENSP00000256084:p.Ile1002Thr	0					SPINK5_ENST00000359874.3_Missense_Mutation_p.I1032T	p.I1002T	NM_006846.3	NP_006837.2	1	2	3	2.144092	Q9NQ38	ISK5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	31	3047	+			A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	1	1	hg19	c.3005T>C	CCDS43382.1	1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.742273	0.30865	.	.	ENSG00000133710	ENST00000359874;ENST00000256084	T;T	0.74421	-0.84;-0.84	4.69	4.69	0.59074	4.69	4.69	0.59074	Proteinase inhibitor I1, Kazal (2);	0.845660	0.10791	N	0.633739	T	0.61223	0.2330	N	0.16478	0.41	0.28781	N	0.899811	P;B	0.35139	0.486;0.254	B;B	0.39465	0.199;0.3	T	0.51764	-0.8664	10	0.14252	T	0.57	-0.0909	11.1055	0.48201	0.0:0.0:0.0:1.0	.	1032;1002	Q9NQ38-3;Q9NQ38	.;ISK5_HUMAN	T	1032;1002	ENSP00000352936:I1032T;ENSP00000256084:I1002T	ENSP00000256084:I1002T	I	+	2	0	0	SPINK5	147491055	147491055	1.000000	0.71417	0.907000	0.35723	0.764000	0.43329	2.219000	0.42899	2.034000	0.60081	0.533000	0.62120	ATA	0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.428	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	1	0	1		2	2	2	0		0	0	161		161	161	1	1.750000	-20.000000	1	0.390000	NM_001127698			145	145		667	660	1		1	1		0	0	161	0		1.000000	4.968879e-01	0	8	0	1	0	145	667
OR10C1	442194	broad.mit.edu	37	6	29408444	29408444	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr6:29408444G>A	ENST00000444197.2	+	1	1362	c.652G>A	c.(652-654)Ggg>Agg	p.G218R	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GGGCTCCTACGGGCGTATCCT	0.582																																						ENST00000444197.2	1.000000	8.100000e-01	1.000000	0.880000	0.940000	0.943820	0.940000	1.000000																										0				27						c.(652-654)Ggg>Agg		olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)							199.0	213.0	208.0					6																	29408444		1511	2708	4219	SO:0001583	missense	442194	0	0					g.chr6:29408444G>A		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.652G>A	chr6.hg19:g.29408444G>A	ENSP00000419119:p.Gly218Arg	0					OR11A1_ENST00000377149.1_Intron	p.G218R	NM_013941.3	NP_039229.3	0	1	1	1.938908	Q96KK4	O10C1_HUMAN		1	1362	+			Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	1	1	hg19	c.652G>A	CCDS34364.1	1	.	.	.	.	.	.	.	.	.	.	G	8.744	0.919636	0.17982	.	.	ENSG00000206474	ENST00000444197	T	0.00115	8.71	3.49	2.61	0.31194	3.49	2.61	0.31194	GPCR, rhodopsin-like superfamily (1);	0.205323	0.24373	N	0.039086	T	0.00178	0.0005	M	0.81614	2.55	0.09310	N	1	D	0.71674	0.998	D	0.67548	0.952	T	0.27571	-1.0070	10	0.41790	T	0.15	.	7.9844	0.30202	0.0:0.176:0.6423:0.1818	.	218	Q96KK4	O10C1_HUMAN	R	218	ENSP00000419119:G218R	ENSP00000419119:G218R	G	+	1	0	0	OR10C1	29516423	29516423	0.000000	0.05858	0.117000	0.21633	0.024000	0.10985	-0.907000	0.04067	0.667000	0.31107	-0.234000	0.12200	GGG	0.329891		TCGA-FB-AAQ1-01A-12D-A40W-08	0.582	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2	1	0	1		2	2	2	0		0	0	134		134	132	1	1.750000	-2.585951	1	0.390000				156	155		608	600	1		1			0	0	134	0		1.000000	0	0	0	0	0	0	156	608
VARS	7407	broad.mit.edu	37	6	31748522	31748522	+	Silent	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr6:31748522G>A	ENST00000375663.3	-	24	3197	c.2757C>T	c.(2755-2757)acC>acT	p.T919T	VARS_ENST00000482996.1_5'UTR|Y_RNA_ENST00000364685.1_RNA	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	919					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	GGAGAGCATCGGTGCCACATT	0.612																																						ENST00000375663.3	1.000000	7.000000e-01	0.990000	0.790000	0.880000	0.887020	0.880000	1.000000																										0				30						c.(2755-2757)acC>acT		valyl-tRNA synthetase	L-Valine(DB00161)						87.0	80.0	83.0					6																	31748522		2203	4300	6503	SO:0001819	synonymous_variant	7407	2	121412	33				g.chr6:31748522G>A	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.2757C>T	chr6.hg19:g.31748522G>A		0					VARS_ENST00000482996.1_5'UTR|Y_RNA_ENST00000364685.1_RNA	p.T919T	NM_006295.2	NP_006286.1	0	1	1	1.943868	P26640	SYVC_HUMAN		24	3197	-			B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Silent	SNP	ENST00000375663.3	1	1	hg19	c.2757C>T	CCDS34412.1	1	.	.	.	.	.	.	.	.	.	.	G	8.703	0.910187	0.17833	.	.	ENSG00000204394	ENST00000428445	.	.	.	5.09	-10.2	0.00374	5.09	-10.2	0.00374	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999988	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.4231	9.2143	0.37337	0.7013:0.0811:0.1308:0.0867	.	.	.	.	X	237	.	.	R	-	1	2	2	VARS	31856501	31856501	0.000000	0.05858	0.237000	0.24090	0.967000	0.64934	-3.317000	0.00514	-2.299000	0.00659	-0.742000	0.03525	CGA	0.345318		TCGA-FB-AAQ1-01A-12D-A40W-08	0.612	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	1	0	1		2	2	2	0		0	0	52		52	52	1	1.750000	-2.986860	1	0.390000	NM_006295			64	64		279	272	1		1	1		0	0	52	0		1.000000	1	0	56	0	114	0	64	279
IP6K3	117283	broad.mit.edu	37	6	33690903	33690903	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr6:33690903G>T	ENST00000293756.4	-	6	1153	c.827C>A	c.(826-828)tCa>tAa	p.S276*	IP6K3_ENST00000451316.1_Nonsense_Mutation_p.S276*	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	276					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						CCCCTCCACTGAGAGTTTTCT	0.453																																						ENST00000293756.4	0.610000	2.700000e-01	0.520000	0.340000	0.420000	0.439100	0.420000	0.430000																										0				1						c.(826-828)tCa>tAa		inositol hexakisphosphate kinase 3							41.0	46.0	44.0					6																	33690903		2203	4300	6503	SO:0001587	stop_gained	117283	0	0					g.chr6:33690903G>T	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.827C>A	chr6.hg19:g.33690903G>T	ENSP00000293756:p.Ser276*	0					IP6K3_ENST00000451316.1_Nonsense_Mutation_p.S276*	p.S276*	NM_054111.4	NP_473452.2	0	1	1	1.954277	Q96PC2	IP6K3_HUMAN		6	1153	-			Q96MQ9	Nonsense_Mutation	SNP	ENST00000293756.4	0	1	hg19	c.827C>A	CCDS34435.1	0	.	.	.	.	.	.	.	.	.	.	G	40	8.349889	0.98772	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	.	.	.	5.74	4.87	0.63330	5.74	4.87	0.63330	.	0.121990	0.37715	N	0.001964	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.2462	11.4635	0.50223	0.0:0.136:0.7227:0.1413	.	.	.	.	X	276	.	ENSP00000293756:S276X	S	-	2	0	0	IP6K3	33798881	33798881	1.000000	0.71417	0.613000	0.29037	0.989000	0.77384	6.643000	0.74334	1.398000	0.46701	0.655000	0.94253	TCA	0.331324		TCGA-FB-AAQ1-01A-12D-A40W-08	0.453	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	1	0	1		2	2	2	0		0	0	56		56	55	1	1.750000	-3.318795	1	0.390000	NM_054111			22	22		219	214	1		1			0	0	56	0		0.999999	0	0	0	0	0	0	22	219
SLC22A16	85413	broad.mit.edu	37	6	110763856	110763856	+	Silent	SNP	A	A	G			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr6:110763856A>G	ENST00000368919.3	-	4	840	c.774T>C	c.(772-774)gcT>gcC	p.A258A	RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000439654.1_Silent_p.A258A|SLC22A16_ENST00000330550.4_Silent_p.A224A	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	258					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	ATCCTGTCAAAGCCACCAGCA	0.507																																						ENST00000368919.3	1.000000	7.500000e-01	0.990000	0.840000	0.920000	0.917137	0.920000	1.000000																										0				34						c.(772-774)gcT>gcC		solute carrier family 22 (organic cation/carnitine transporter), member 16	Doxorubicin(DB00997)|L-Carnitine(DB00583)						95.0	93.0	94.0					6																	110763856		2203	4300	6503	SO:0001819	synonymous_variant	85413	0	0					g.chr6:110763856A>G		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.774T>C	chr6.hg19:g.110763856A>G		1					SLC22A16_ENST00000330550.4_Silent_p.A224A|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000439654.1_Silent_p.A258A|SLC22A16_ENST00000456137.2_3'UTR	p.A258A	NM_033125.3	NP_149116.2	0	1	1	1.730651	Q86VW1	S22AG_HUMAN		4	840	-		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Silent	SNP	ENST00000368919.3	1	1	hg19	c.774T>C	CCDS5084.1	1																																																																																								0.244067		TCGA-FB-AAQ1-01A-12D-A40W-08	0.507	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	1	0	1		2	2	2	0		0	0	35		35	35	1	1.750000	-20.000000	1	0.390000	NM_033125			63	63		201	199	1		1	0		0	0	35	0		1.000000	1.468706e-01	0	0	0	3	0	63	201
RELN	5649	broad.mit.edu	37	7	103180720	103180720	+	Missense_Mutation	SNP	C	C	T	rs116394157		TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr7:103180720C>T	ENST00000428762.1	-	44	7013	c.6854G>A	c.(6853-6855)cGt>cAt	p.R2285H	RELN_ENST00000424685.2_Missense_Mutation_p.R2285H|RELN_ENST00000343529.5_Missense_Mutation_p.R2285H	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2285					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGAACCAGAACGGGCTTTCAA	0.527																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999182	0.990000	1.000000																										0				227						c.(6853-6855)cGt>cAt		reelin							96.0	89.0	91.0					7																	103180720		2203	4300	6503	SO:0001583	missense	5649	1	121412	40				g.chr7:103180720C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6854G>A	chr7.hg19:g.103180720C>T	ENSP00000392423:p.Arg2285His	1					RELN_ENST00000343529.5_Missense_Mutation_p.R2285H|RELN_ENST00000424685.2_Missense_Mutation_p.R2285H	p.R2285H	NM_005045.3	NP_005036.2	1	2	3	2.346895	P78509	RELN_HUMAN		44	7013	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	1	1	hg19	c.6854G>A	CCDS47680.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793262	0.90453	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.25085	2.01;2.01;1.82	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.52338	0.1728	M	0.68593	2.085	0.80722	D	1	D;P	0.89917	1.0;0.857	D;B	0.83275	0.996;0.173	T	0.50355	-0.8838	10	0.59425	D	0.04	.	19.6264	0.95679	0.0:1.0:0.0:0.0	.	2285;2285	P78509-2;P78509	.;RELN_HUMAN	H	2285	ENSP00000392423:R2285H;ENSP00000345694:R2285H;ENSP00000388446:R2285H	ENSP00000345694:R2285H	R	-	2	0	0	RELN	102967956	102967956	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	4.462000	0.60121	2.717000	0.92951	0.655000	0.94253	CGT	0.442209		TCGA-FB-AAQ1-01A-12D-A40W-08	0.527	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	1	0	1		2	2	2	0		0	0	73		73	70	1	1.750000	-20.000000	1	0.390000	NM_005045			94	90		346	342	1		1	0		0	0	73	0		1.000000	2.047787e-01	0	0	0	4	0	94	346
RBM28	55131	broad.mit.edu	37	7	127975996	127975996	+	Silent	SNP	A	A	G			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr7:127975996A>G	ENST00000223073.2	-	7	828	c.714T>C	c.(712-714)gaT>gaC	p.D238D	RBM28_ENST00000415472.2_Silent_p.D97D	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	238	Asp/Glu-rich (acidic).				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						catcatcatcatcgtcatcat	0.398																																						ENST00000223073.2	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999244	0.990000	1.000000																										0				21						c.(712-714)gaT>gaC		RNA binding motif protein 28							330.0	243.0	273.0					7																	127975996		2203	4300	6503	SO:0001819	synonymous_variant	55131	0	0					g.chr7:127975996A>G	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.714T>C	chr7.hg19:g.127975996A>G		1					RBM28_ENST00000415472.2_Silent_p.D97D	p.D238D	NM_018077.2	NP_060547.2	1	2	3	2.346895	Q9NW13	RBM28_HUMAN		7	828	-			A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	ENST00000223073.2	1	1	hg19	c.714T>C	CCDS5801.1	1																																																																																								0.442209		TCGA-FB-AAQ1-01A-12D-A40W-08	0.398	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	1	0	1		2	2	2	0		0	0	57		57	57	1	1.750000	-3.037456	1	0.390000	NM_018077			69	65		241	240	1		1	1		0	0	57	0		1.000000	9.306191e-01	0	8	0	10	0	69	241
NRF1	4899	broad.mit.edu	37	7	129349051	129349051	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr7:129349051G>A	ENST00000393232.1	+	6	860	c.743G>A	c.(742-744)cGc>cAc	p.R248H	NRF1_ENST00000393230.2_Missense_Mutation_p.R248H|NRF1_ENST00000539636.1_Missense_Mutation_p.R87H|NRF1_ENST00000223190.4_Missense_Mutation_p.R248H|NRF1_ENST00000311967.2_Missense_Mutation_p.R248H|NRF1_ENST00000353868.4_Missense_Mutation_p.R248H|NRF1_ENST00000393231.3_Missense_Mutation_p.R248H	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	248					cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R248L(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						AGTGATGTCCGCACAGAAGAG	0.493																																						ENST00000393232.1	1.000000	2.000000e-02	1.000000	0.040000	0.070000	0.297890	0.070000	0.070000																										1	Substitution - Missense(1)	p.R248L(1)	prostate(1)	24						c.(742-744)cGc>cAc		nuclear respiratory factor 1							122.0	124.0	124.0					7																	129349051		2203	4300	6503	SO:0001583	missense	4899	0	0					g.chr7:129349051G>A	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.743G>A	chr7.hg19:g.129349051G>A	ENSP00000376924:p.Arg248His	1					NRF1_ENST00000393230.2_Missense_Mutation_p.R248H|NRF1_ENST00000353868.4_Missense_Mutation_p.R248H|NRF1_ENST00000393231.3_Missense_Mutation_p.R248H|NRF1_ENST00000311967.2_Missense_Mutation_p.R248H|NRF1_ENST00000223190.4_Missense_Mutation_p.R248H|NRF1_ENST00000539636.1_Missense_Mutation_p.R87H	p.R248H	NM_005011.3	NP_005002.3	1	2	3	2.346895	Q16656	NRF1_HUMAN		6	860	+			A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	ENST00000393232.1	0	1	hg19	c.743G>A	CCDS5813.2	0	.	.	.	.	.	.	.	.	.	.	G	35	5.582880	0.96578	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000539636;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	D;D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57;-2.57	5.85	5.85	0.93711	5.85	5.85	0.93711	Nuclear respiratory factor 1, NLS/DNA-binding, dimerisation domain (1);	0.000000	0.85682	D	0.000000	D	0.94804	0.8322	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94125	0.7383	9	.	.	.	-9.5325	19.1648	0.93551	0.0:0.0:1.0:0.0	.	248;248	Q96AN2;Q16656	.;NRF1_HUMAN	H	248;248;87;248;248;248;248	ENSP00000376924:R248H;ENSP00000440455:R87H;ENSP00000223190:R248H;ENSP00000309826:R248H;ENSP00000376922:R248H;ENSP00000376923:R248H	.	R	+	2	0	0	NRF1	129136287	129136287	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.499000	0.97975	2.772000	0.95346	0.655000	0.94253	CGC	0.442209		TCGA-FB-AAQ1-01A-12D-A40W-08	0.493	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	0	0	1		2	2	2	0		0	0	105		105	104	1	1.750000	-1.827695	0	0.390000	NM_001040110			9	8		750	734	0		1	0		0	0	105	0		0.993619	1.968350e-02	0	0	0	16	0	9	750
EBF2	64641	broad.mit.edu	37	8	25890660	25890660	+	Silent	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr8:25890660G>A	ENST00000520164.1	-	6	1029	c.492C>T	c.(490-492)tgC>tgT	p.C164C	EBF2_ENST00000408929.3_Silent_p.C16C	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	164					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTTTCTTTTCGCAGCATCGAC	0.393																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	ENST00000520164.1	1.000000	8.100000e-01	1.000000	0.910000	0.990000	0.968836	0.990000	1.000000																										0				39						c.(490-492)tgC>tgT		early B-cell factor 2							129.0	127.0	128.0					8																	25890660		1941	4181	6122	SO:0001819	synonymous_variant	64641	0	0					g.chr8:25890660G>A	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.492C>T	chr8.hg19:g.25890660G>A		0					EBF2_ENST00000408929.3_Silent_p.C16C	p.C164C	NM_022659.3	NP_073150.2	1	2	3	2.142374	Q9HAK2	COE2_HUMAN		6	1029	-		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Silent	SNP	ENST00000520164.1	1	1	hg19	c.492C>T	CCDS43726.1	1																																																																																								0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.393	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	1	0	1		2	2	2	0		0	0	79		79	79	1	1.750000	-20.000000	1	0.390000	NM_022659			77	75		317	311	0		1			0	0	79	0		1.000000	0	0	0	0	0	0	77	317
INTS9	55756	broad.mit.edu	37	8	28669965	28669965	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr8:28669965G>A	ENST00000521022.1	-	8	704	c.623C>T	c.(622-624)gCg>gTg	p.A208V	INTS9_ENST00000521777.1_Missense_Mutation_p.A184V|INTS9_ENST00000416984.2_Missense_Mutation_p.A187V|INTS9_ENST00000397363.4_Missense_Mutation_p.A102V	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	208					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		CACCTGGACCGCACCAAAAAG	0.463																																						ENST00000521022.1	1.000000	4.000000e-02	0.200000	0.070000	0.120000	0.177349	0.120000	0.120000																										0				19						c.(622-624)gCg>gTg		integrator complex subunit 9							62.0	57.0	59.0					8																	28669965		2203	4300	6503	SO:0001583	missense	55756	4	121408	34				g.chr8:28669965G>A	BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.623C>T	chr8.hg19:g.28669965G>A	ENSP00000429065:p.Ala208Val	0					INTS9_ENST00000397363.4_Missense_Mutation_p.A102V|INTS9_ENST00000416984.2_Missense_Mutation_p.A187V|INTS9_ENST00000521777.1_Missense_Mutation_p.A184V	p.A208V	NM_018250.3	NP_060720.2	1	2	3	2.142374	Q9NV88	INT9_HUMAN		8	704	-		Ovarian(32;0.0439)	B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	ENST00000521022.1	0	1	hg19	c.623C>T	CCDS34873.1	0	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978086	0.74360	.	.	ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000541706;ENST00000521777;ENST00000397363	T;T;T;T	0.46063	0.9;0.88;0.9;0.91	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	L	0.52266	1.64	0.80722	D	1	B;B;B	0.22541	0.071;0.005;0.003	B;B;B	0.14578	0.011;0.005;0.006	T	0.11767	-1.0574	10	0.35671	T	0.21	-19.2771	20.2738	0.98482	0.0:0.0:1.0:0.0	.	187;208;208	B7Z6M5;G3XAN1;Q9NV88	.;.;INT9_HUMAN	V	208;187;52;184;102	ENSP00000429065:A208V;ENSP00000398208:A187V;ENSP00000430943:A184V;ENSP00000380520:A102V	ENSP00000380520:A102V	A	-	2	0	0	INTS9	28725884	28725884	1.000000	0.71417	0.973000	0.42090	0.795000	0.44927	7.883000	0.87264	2.894000	0.99253	0.655000	0.94253	GCG	0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.463	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1	0	0	1		2	2	2	0		0	0	27		27	27	1	1.750000	-3.192940	1	0.390000	NM_018250			5	5		219	218	0		1	0		0	0	27	0		0.937507	1.476449e-01	0	0	0	25	0	5	219
WRN	7486	broad.mit.edu	37	8	31004955	31004955	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr8:31004955G>A	ENST00000298139.5	+	30	3784	c.3535G>A	c.(3535-3537)Gca>Aca	p.A1179T		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1179	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AGCTATTCTGGCAACAAACAA	0.338			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	ENST00000298139.5	1.000000	2.000000e-02	0.130000	0.040000	0.070000	0.128349	0.070000	0.070000			yes	Rec		Werner Syndrome	yes	Rec		Werner Syndrome	8	8p12-p11.2	8p12-p11.2	7486	Mis, N, F, S	Werner syndrome (RECQL2)				"""L, E, M, O"""	L, E, M, O		osteosarcoma, meningioma, others			0				60						c.(3535-3537)Gca>Aca	Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome, RecQ helicase-like							97.0	98.0	98.0					8																	31004955		2203	4300	6503	SO:0001583	missense	7486	0	0		Werner syndrome	Familial Cancer Database	WS, Adult Progeria	g.chr8:31004955G>A		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3535G>A	chr8.hg19:g.31004955G>A	ENSP00000298139:p.Ala1179Thr	0						p.A1179T	NM_000553.4	NP_000544.2	1	2	3	2.142374	Q14191	WRN_HUMAN		30	3784	+		Breast(100;0.195)	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	0	1	hg19	c.3535G>A	CCDS6082.1	0	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767242	0.90020	.	.	ENSG00000165392	ENST00000298139	T	0.51574	0.7	4.97	4.97	0.65823	4.97	4.97	0.65823	HRDC-like (1);Helicase/RNase D C-terminal, HRDC domain (3);	0.000000	0.85682	D	0.000000	T	0.70666	0.3250	M	0.77820	2.39	0.50039	D	0.999849	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.74697	-0.3578	10	0.66056	D	0.02	-18.4415	18.1847	0.89789	0.0:0.0:1.0:0.0	.	589;1179	Q59F09;Q14191	.;WRN_HUMAN	T	1179	ENSP00000298139:A1179T	ENSP00000298139:A1179T	A	+	1	0	0	WRN	31124497	31124497	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.519000	0.81809	2.459000	0.83118	0.655000	0.94253	GCA	0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.338	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1	0	0	1		16	3	2	1		1	1	75		75	75	1	1.750000	-2.588732	1	0.390000				5	6		356	353	0		0	0		1	0	75	0		0.011643	5.049849e-03	0	0	0	19	0	5	356
KCNB2	9312	broad.mit.edu	37	8	73848256	73848256	+	Silent	SNP	C	C	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr8:73848256C>T	ENST00000523207.1	+	3	1254	c.666C>T	c.(664-666)gaC>gaT	p.D222D		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	222					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AGGAAACGGACGAATTTGGAC	0.473																																						ENST00000523207.1	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.994715	0.990000	1.000000																										0				85						c.(664-666)gaC>gaT		potassium voltage-gated channel, Shab-related subfamily, member 2	Dalfampridine(DB06637)						195.0	174.0	181.0					8																	73848256		2203	4300	6503	SO:0001819	synonymous_variant	9312	0	0					g.chr8:73848256C>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.666C>T	chr8.hg19:g.73848256C>T		0						p.D222D	NM_004770.2	NP_004761.2	1	2	3	2.142374	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)	3	1254	+	Breast(64;0.137)		Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	1	1	hg19	c.666C>T	CCDS6209.1	1																																																																																								0.397054		TCGA-FB-AAQ1-01A-12D-A40W-08	0.473	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	1	0	1		2	2	2	0		0	0	85		85	85	1	1.750000	-20.000000	1	0.390000	NM_004770			97	94		355	349	1		1			0	0	85	0		1.000000	0	0	0	0	0	0	97	355
TOR2A	27433	broad.mit.edu	37	9	130496760	130496760	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr9:130496760G>A	ENST00000373284.5	-	2	281	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W	TOR2A_ENST00000373281.5_Missense_Mutation_p.R79W|TOR2A_ENST00000458505.3_Intron|TOR2A_ENST00000336067.6_Missense_Mutation_p.R79W|TOR2A_ENST00000472723.1_5'UTR	NM_001085347.2	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A	79					chaperone mediated protein folding requiring cofactor (GO:0051085)|protein homooligomerization (GO:0051260)	endoplasmic reticulum lumen (GO:0005788)	ATP binding (GO:0005524)			NS(1)|endometrium(2)	3						GCTGGGTCCCGCACAAAGGCC	0.662											OREG0019509	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000373284.5	0.350000	5.000000e-02	0.250000	0.090000	0.160000	0.181039	0.160000	0.150000																										0				3						c.(235-237)Cgg>Tgg		torsin family 2, member A							23.0	25.0	25.0					9																	130496760		2202	4297	6499	SO:0001583	missense	27433	7	121098	37				g.chr9:130496760G>A	AA873275	CCDS6876.1, CCDS43879.1, CCDS48024.1	9q34.11	2010-08-20			ENSG00000160404	ENSG00000160404			11996	protein-coding gene	gene with protein product		608052				10644435	Standard	NM_001085347		Approved	FLJ14771, TORP1	uc004brs.4	Q5JU69	OTTHUMG00000020706	ENST00000373284.5:c.235C>T	chr9.hg19:g.130496760G>A	ENSP00000362381:p.Arg79Trp	1		OREG0019509	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1580	TOR2A_ENST00000373281.5_Missense_Mutation_p.R79W|TOR2A_ENST00000336067.6_Missense_Mutation_p.R79W|TOR2A_ENST00000472723.1_5'UTR|TOR2A_ENST00000458505.3_Intron	p.R79W	NM_001085347.2	NP_001078816	0	1	1	1.749242	Q5JU69	TOR2A_HUMAN		2	281	-			A4FU12|A4FU13|Q3ZCN9|Q3ZCP0|Q5JU68|Q66K87|Q6UXW6|Q8NAN5|Q96SL7	Missense_Mutation	SNP	ENST00000373284.5	0	1	hg19	c.235C>T	CCDS43879.1	0	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172678	0.38413	.	.	ENSG00000160404	ENST00000336067;ENST00000373284;ENST00000373281	T;T;T	0.44482	0.92;0.92;0.92	5.23	-2.19	0.07015	5.23	-2.19	0.07015	.	0.571731	0.18845	N	0.129561	T	0.33614	0.0869	L	0.29908	0.895	0.09310	N	0.999998	B;D;D	0.71674	0.001;0.998;0.983	B;P;P	0.54174	0.0;0.744;0.545	T	0.20739	-1.0266	10	0.62326	D	0.03	-4.2007	3.9649	0.09426	0.0755:0.3385:0.3078:0.2782	.	79;79;79	Q5JU69-2;Q8N2E6;Q5JU69	.;TOR2X_HUMAN;TOR2A_HUMAN	W	79	ENSP00000338317:R79W;ENSP00000362381:R79W;ENSP00000362378:R79W	ENSP00000338317:R79W	R	-	1	2	2	TOR2A	129536581	129536581	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-0.227000	0.09126	-0.084000	0.12595	-0.448000	0.05591	CGG	0.249508		TCGA-FB-AAQ1-01A-12D-A40W-08	0.662	TOR2A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054205.1	0	0	1		2	2	2	0		0	0	18		18	17	1	1.750000	-6.690661	1	0.390000	NM_130459			4	4		106	102	0		1	0		0	0	18	0		0.882815	1.499329e-01	0	0	0	15	0	4	106
ODF2	4957	broad.mit.edu	37	9	131256879	131256879	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAQ1-01A-12D-A40W-08	TCGA-FB-AAQ1-11A-11D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	e8f0e3bc-8015-4853-bd15-5c71403806f7	89c6ffd7-52a4-4066-b5bb-e826b90217af	g.chr9:131256879G>T	ENST00000434106.3	+	17	2206	c.1843G>T	c.(1843-1845)Gac>Tac	p.D615Y	ODF2_ENST00000393533.2_Missense_Mutation_p.D615Y|ODF2_ENST00000393527.3_Missense_Mutation_p.D591Y|ODF2_ENST00000372807.5_Missense_Mutation_p.D610Y|ODF2_ENST00000351030.3_Missense_Mutation_p.D610Y|ODF2_ENST00000372791.3_Missense_Mutation_p.D596Y|ODF2_ENST00000448249.3_Missense_Mutation_p.D534Y|ODF2_ENST00000546203.1_Missense_Mutation_p.D596Y|ODF2_ENST00000444119.2_Missense_Mutation_p.D591Y|ODF2_ENST00000604420.1_Missense_Mutation_p.D615Y|ODF2_ENST00000372814.3_Missense_Mutation_p.D659Y	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	615					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						TGAGTGCCAAGACCAACTGCA	0.582																																						ENST00000434106.3	1.000000	7.700000e-01	1.000000	0.860000	0.950000	0.938029	0.950000	1.000000																										0				37						c.(1843-1845)Gac>Tac		outer dense fiber of sperm tails 2							77.0	67.0	70.0					9																	131256879		2203	4300	6503	SO:0001583	missense	4957	0	0					g.chr9:131256879G>T	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1843G>T	chr9.hg19:g.131256879G>T	ENSP00000403453:p.Asp615Tyr	1					ODF2_ENST00000351030.3_Missense_Mutation_p.D610Y|ODF2_ENST00000546203.1_Missense_Mutation_p.D596Y|ODF2_ENST00000444119.2_Missense_Mutation_p.D591Y|ODF2_ENST00000393527.3_Missense_Mutation_p.D591Y|ODF2_ENST00000604420.1_Missense_Mutation_p.D615Y|ODF2_ENST00000448249.3_Missense_Mutation_p.D534Y|ODF2_ENST00000372791.3_Missense_Mutation_p.D596Y|ODF2_ENST00000372807.5_Missense_Mutation_p.D610Y|ODF2_ENST00000393533.2_Missense_Mutation_p.D615Y|ODF2_ENST00000372814.3_Missense_Mutation_p.D659Y	p.D615Y	NM_153433.1	NP_702911.1	0	1	1	1.749242	Q5BJF6	ODFP2_HUMAN		17	2206	+			B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	1	1	hg19	c.1843G>T	CCDS56588.1	1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315892	0.60524	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;D;T;T;T;D;T;T	0.84070	1.27;-1.8;-0.05;-0.05;-0.05;-1.8;1.29;1.3	5.4	3.55	0.40652	5.4	3.55	0.40652	.	0.293958	0.38326	N	0.001723	D	0.84361	0.5455	L	0.38175	1.15	0.80722	D	1	D;D;D;D;D;D;D	0.71674	0.998;0.997;0.998;0.998;0.998;0.998;0.998	P;D;P;D;P;D;D	0.68192	0.904;0.916;0.904;0.956;0.904;0.953;0.916	D	0.83375	0.0009	10	0.72032	D	0.01	-20.1786	8.5962	0.33716	0.0774:0.2919:0.6307:0.0	.	596;610;534;615;596;615;591	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;B4DX73;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;ODFP2_HUMAN;.	Y	615;659;610;615;591;534;596;596	ENSP00000377166:D615Y;ENSP00000361901:D659Y;ENSP00000342581:D610Y;ENSP00000361882:D615Y;ENSP00000307781:D591Y;ENSP00000396687:D534Y;ENSP00000437579:D596Y;ENSP00000361877:D596Y	ENSP00000307781:D591Y	D	+	1	0	0	ODF2	130296700	130296700	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	3.221000	0.51215	0.643000	0.30638	-0.305000	0.09177	GAC	0.249508		TCGA-FB-AAQ1-01A-12D-A40W-08	0.582	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3	1	0	1		2	2	2	0		0	0	46		46	46	1	1.750000	-20.000000	1	0.390000				57	56		175	173	1		1	1		0	0	46	0		1.000000	9.997177e-01	0	14	0	27	0	57	175
