#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
IL4R	3566	broad.mit.edu	37	16	27367137	27367166	+	In_Frame_Del	DEL	GAGCCCTTCGAGCAGCACCTCCTGCTGGGC	GAGCCCTTCGAGCAGCACCTCCTGCTGGGC	-	rs529668380		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr16:27367137_27367166delGAGCCCTTCGAGCAGCACCTCCTGCTGGGC	ENST00000395762.2	+	8	938_967	c.679_708delGAGCCCTTCGAGCAGCACCTCCTGCTGGGC	c.(679-708)gagcccttcgagcagcacctcctgctgggcdel	p.EPFEQHLLLG227del	IL4R_ENST00000543915.2_In_Frame_Del_p.EPFEQHLLLG227del|IL4R_ENST00000380922.3_In_Frame_Del_p.EPFEQHLLLG212del|IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000170630.2_In_Frame_Del_p.EPFEQHLLLG227del	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	227					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						AGCCTACAGGGAGCCCTTCGAGCAGCACCTCCTGCTGGGCGTCAGCGTTT	0.622																																						ENST00000395762.2	1.000000	1.400000e-01	3.100000e-01	1.800000e-01	0.230000	0.283417	0.230000	0.230000																										0				33						c.(679-708)gagcccttcgagcagcacctcctgctgggcdel		interleukin 4 receptor																																				SO:0001651	inframe_deletion	3566	0	0					g.chr16:27367137_27367166delGAGCCCTTCGAGCAGCACCTCCTGCTGGGC	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.679_708delGAGCCCTTCGAGCAGCACCTCCTGCTGGGC	chr16.hg19:g.27367137_27367166delGAGCCCTTCGAGCAGCACCTCCTGCTGGGC	ENSP00000379111:p.Glu227_Gly236del	0					IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000543915.2_In_Frame_Del_p.EPFEQHLLLG227del|IL4R_ENST00000380922.3_In_Frame_Del_p.EPFEQHLLLG212del|IL4R_ENST00000170630.2_In_Frame_Del_p.EPFEQHLLLG227del	p.EPFEQHLLLG227del	NM_000418.3	NP_000409.1	1	2	3	2.079698	P24394	IL4RA_HUMAN		8	938_967	+			B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	In_Frame_Del	DEL	ENST00000395762.2	0	1	hg19	c.679_708delGAGCCCTTCGAGCAGCACCTCCTGCTGGGC	CCDS10629.1	0																																																																																								0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.622	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4	1	0	1		2	2		0		0	0	49		49	49	1	1.950000	-19.581470	1	0.460000				18	38		327	350	0		1	0	0	0	0	49	0		0.999995	7.365866e-01	0	0	0	49	0	18	327
GATA3	2625	broad.mit.edu	37	10	8100325	8100325	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr10:8100325G>A	ENST00000346208.3	+	3	754	c.299G>A	c.(298-300)gGc>gAc	p.G100D	GATA3_ENST00000379328.3_Missense_Mutation_p.G100D			P23771	GATA3_HUMAN	GATA binding protein 3	100					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CTGGACGGCGGCAAAGCCCTG	0.677			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															ENST00000346208.3	0.090000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.050350	0.040000	0.040000				Rec	yes			Rec	yes		10	10p15	10p15	2625	F, N, S	GATA binding protein 3	yes	yes	HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)	E	E			breast		0				87						c.(298-300)gGc>gAc		GATA binding protein 3							53.0	65.0	61.0					10																	8100325		2203	4299	6502	SO:0001583	missense	2625	0	0					g.chr10:8100325G>A	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.299G>A	chr10.hg19:g.8100325G>A	ENSP00000341619:p.Gly100Asp	1					GATA3_ENST00000379328.3_Missense_Mutation_p.G100D	p.G100D			0	1	1	1.846396	P23771	GATA3_HUMAN		3	754	+			Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	0	1	hg19	c.299G>A	CCDS7083.1	0	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231371	0.39399	.	.	ENSG00000107485	ENST00000379328;ENST00000544011;ENST00000346208	D;D	0.96365	-3.99;-3.98	5.31	5.31	0.75309	5.31	5.31	0.75309	.	0.194098	0.53938	D	0.000041	D	0.95242	0.8457	L	0.50333	1.59	0.45205	D	0.998212	B;B	0.29136	0.191;0.234	B;B	0.33750	0.062;0.169	D	0.93958	0.7238	10	0.59425	D	0.04	-24.0814	18.9617	0.92679	0.0:0.0:1.0:0.0	.	100;100	P23771;P23771-2	GATA3_HUMAN;.	D	100	ENSP00000368632:G100D;ENSP00000341619:G100D	ENSP00000341619:G100D	G	+	2	0	0	GATA3	8140331	8140331	1.000000	0.71417	0.935000	0.37517	0.204000	0.24138	7.816000	0.86201	2.469000	0.83416	0.561000	0.74099	GGC	0.399199		TCGA-FB-AAQ2-01A-31D-A40W-08	0.677	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	0	0	1		2	2	2	0		0	0	79		79	75	1	1.950000	-2.451450	0	0.460000	NM_001002295			5	5		457	425	0		1	0		0	0	79	0		0.925253	2.749956e-02	0	0	0	19	0	5	457
PSTK	118672	broad.mit.edu	37	10	124746879	124746879	+	Missense_Mutation	SNP	T	T	C			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr10:124746879T>C	ENST00000368887.3	+	6	1347	c.907T>C	c.(907-909)Ttt>Ctt	p.F303L	PSTK_ENST00000405485.1_3'UTR|PSTK_ENST00000497219.1_3'UTR	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	303					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		agagatgacatttaagcaaag	0.423																																						ENST00000368887.3	0.260000	3.000000e-02	1.900000e-01	7.000000e-02	0.120000	0.136130	0.120000	0.110000																										0				13						c.(907-909)Ttt>Ctt		phosphoseryl-tRNA kinase							98.0	91.0	93.0					10																	124746879		2203	4300	6503	SO:0001583	missense	118672	0	0					g.chr10:124746879T>C	AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.907T>C	chr10.hg19:g.124746879T>C	ENSP00000357882:p.Phe303Leu	1					PSTK_ENST00000497219.1_3'UTR|PSTK_ENST00000405485.1_3'UTR	p.F303L	NM_153336.2	NP_699167.2	0	1	1	1.846396	Q8IV42	PSTK_HUMAN		6	1347	+		all_neural(114;0.169)|Glioma(114;0.222)	Q6ZSS9	Missense_Mutation	SNP	ENST00000368887.3	0	1	hg19	c.907T>C	CCDS7633.1	0	.	.	.	.	.	.	.	.	.	.	T	5.062	0.197044	0.09599	.	.	ENSG00000179988	ENST00000368887	T	0.49432	0.78	2.11	2.11	0.27256	2.11	2.11	0.27256	.	0.974060	0.08343	N	0.960511	T	0.11879	0.0289	N	0.00179	-1.91	0.20638	N	0.999873	B	0.06786	0.001	B	0.10450	0.005	T	0.32375	-0.9909	10	0.07030	T	0.85	.	6.2226	0.20689	0.0:0.0:0.0:1.0	.	303	Q8IV42	PSTK_HUMAN	L	303	ENSP00000357882:F303L	ENSP00000357882:F303L	F	+	1	0	0	PSTK	124736869	124736869	0.000000	0.05858	0.087000	0.20705	0.903000	0.53119	0.284000	0.18864	1.227000	0.43598	0.533000	0.62120	TTT	0.399199		TCGA-FB-AAQ2-01A-31D-A40W-08	0.423	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050811.1	0	0	1		2	2	2	0		0	0	27		27	27	1	1.950000	-7.313595	1	0.460000	NM_153336			4	4		136	133	0		1	0		0	0	27	0		0.886361	3.367398e-02	0	0	0	8	0	4	136
ZC3H12C	85463	broad.mit.edu	37	11	110007605	110007605	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr11:110007605C>T	ENST00000278590.3	+	2	290	c.239C>T	c.(238-240)gCg>gTg	p.A80V	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.A81V|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.A49V	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	80							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.A80V(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GAAAAAGAGGCGTCTGAAGAG	0.448																																						ENST00000278590.3	1.000000	5.900000e-01	1	7.100000e-01	0.850000	0.852095	0.850000	1.000000																										1	Substitution - Missense(1)	p.A80V(1)	large_intestine(1)	37						c.(238-240)gCg>gTg		zinc finger CCCH-type containing 12C							61.0	58.0	59.0					11																	110007605		1946	4152	6098	SO:0001583	missense	85463	3	120826	32				g.chr11:110007605C>T		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.239C>T	chr11.hg19:g.110007605C>T	ENSP00000278590:p.Ala80Val	0					ZC3H12C_ENST00000453089.2_Missense_Mutation_p.A49V|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.A81V	p.A80V	NM_033390.1	NP_203748.1	1	2	3	2.040000	Q9C0D7	ZC12C_HUMAN		2	290	+		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	1	1	hg19	c.239C>T	CCDS44727.1	1	.	.	.	.	.	.	.	.	.	.	t	8.666	0.901758	0.17760	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.30981	1.51;1.51;1.51	5.62	5.62	0.85841	5.62	5.62	0.85841	.	.	.	.	.	T	0.07234	0.0183	N	0.00289	-1.7	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31530	-0.9940	9	0.11182	T	0.66	-1.0609	6.3914	0.21589	0.0:0.2884:0.0:0.7116	.	81;80;80	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	V	80;81;49	ENSP00000278590:A80V;ENSP00000431821:A81V;ENSP00000413094:A49V	ENSP00000278590:A80V	A	+	2	0	0	ZC3H12C	109512815	109512815	0.021000	0.18746	1.000000	0.80357	0.098000	0.18820	0.260000	0.18424	0.966000	0.38159	-0.269000	0.10298	GCG	0.462473		TCGA-FB-AAQ2-01A-31D-A40W-08	0.448	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	1	0	1		2	2	2	0		0	0	29		29	28	1	1.950000	-20.000000	1	0.460000	NM_033390			27	27		111	109	1		1	1		0	0	29	0		1.000000	2.641232e-01	0	4	0	1	0	27	111
OR8B2	26595	broad.mit.edu	37	11	124253123	124253123	+	Missense_Mutation	SNP	C	C	T	rs202110730	byFrequency	TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr11:124253123C>T	ENST00000375013.2	-	1	135	c.117G>A	c.(115-117)atG>atA	p.M39I		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GGTTGCCTACCATGGTGACAA	0.418																																						ENST00000375013.2	0.280000	1.300000e-01	2.300000e-01	1.600000e-01	0.190000	0.208490	0.190000	0.200000																										0				23						c.(115-117)atG>atA		olfactory receptor, family 8, subfamily B, member 2		C	ILE/MET	0,4402		0,0,2201	216.0	188.0	198.0		117	1.2	0.0	11		198	3,8595	3.0+/-9.4	0,3,4296	no	missense	OR8B2	NM_001005468.1	10	0,3,6497	TT,TC,CC		0.0349,0.0,0.0231	benign	39/314	124253123	3,12997	2201	4299	6500	SO:0001583	missense	26595	10	121412	49				g.chr11:124253123C>T	AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.117G>A	chr11.hg19:g.124253123C>T	ENSP00000364152:p.Met39Ile	0						p.M39I	NM_001005468.1	NP_001005468.1	1	2	3	2.040000	Q96RD0	OR8B2_HUMAN		1	135	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	Q8NGH2	Missense_Mutation	SNP	ENST00000375013.2	1	1	hg19	c.117G>A	CCDS31708.1	0	.	.	.	.	.	.	.	.	.	.	c	11.01	1.512128	0.27036	0.0	3.49E-4	ENSG00000204293	ENST00000375013	T	0.00524	6.82	4.2	1.17	0.20885	4.2	1.17	0.20885	.	0.871881	0.10283	N	0.693231	T	0.00210	0.0006	N	0.01405	-0.89	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42965	-0.9420	10	0.54805	T	0.06	.	1.6651	0.02800	0.1587:0.3523:0.3088:0.1803	.	39	Q96RD0	OR8B2_HUMAN	I	39	ENSP00000364152:M39I	ENSP00000364152:M39I	M	-	3	0	0	OR8B2	123758333	123758333	0.000000	0.05858	0.002000	0.10522	0.262000	0.26303	-0.293000	0.08320	0.151000	0.19162	0.400000	0.26472	ATG	0.462473		TCGA-FB-AAQ2-01A-31D-A40W-08	0.418	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387290.1	0	0	1		15	2	2	1		1	1	190		190	201	1	1.950000	-2.456333	0	0.460000	NM_001005468			37	35		787	762	0		1			1	0	190	0		0.999230	0	0	0	0	0	0	37	787
LEPREL2	10536	broad.mit.edu	37	12	6939687	6939687	+	RNA	SNP	G	G	A	rs536565960		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr12:6939687G>A	ENST00000538102.1	+	0	40				LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA			Q8IVL6	P3H3_HUMAN	leprecan-like 2						extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)	endoplasmic reticulum lumen (GO:0005788)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			breast(1)|cervix(1)|endometrium(2)|lung(6)	10					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ATGGGGCTGCGAGCCAGGGGG	0.642																																						ENST00000538102.1	1.000000	2.800000e-01	9.900000e-01	4.500000e-01	0.680000	0.691933	0.680000	1.000000																										0				10								leprecan-like 2	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)						11.0	12.0	12.0					12																	6939687		1960	4121	6081			10536	10	120502	32				g.chr12:6939687G>A	U47926	CCDS61027.1	12p13.31	2014-03-25			ENSG00000110811	ENSG00000110811			19318	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 3"""	610342				15063763	Standard	NM_014262		Approved	GRCB, HSU47926, P3H3		Q8IVL6	OTTHUMG00000168516		chr12.hg19:g.6939687G>A		1					LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA				1	3	4	2.984419	Q8IVL6	P3H3_HUMAN		0	40	+			Q13512|Q15740|Q66K32|Q6NX61|Q7L2T1	RNA	SNP	ENST00000538102.1	0	1	hg19			0																																																																																								0.624217		TCGA-FB-AAQ2-01A-31D-A40W-08	0.642	LEPREL2-006	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000399998.1	0	0	1		2	2	2	0		0	0	13		13	13	1	1.950000	-12.220260	1	0.460000	NM_014262			6	5		54	54	0		1	0		0	0	13	0		0.965862	5.580892e-01	0	0	0	17	0	6	54
C1RL	51279	broad.mit.edu	37	12	7249506	7249506	+	Silent	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr12:7249506C>T	ENST00000266542.4	-	6	1037	c.945G>A	c.(943-945)ggG>ggA	p.G315G	C1RL_ENST00000504702.2_Intron|C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_3'UTR	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	315	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CAGGGTGGTTCCCCAGTTTCA	0.552																																						ENST00000266542.4	1.000000	5.000000e-02	1.800000e-01	8.000000e-02	0.120000	0.164091	0.120000	0.120000																										0				16						c.(943-945)ggG>ggA		complement component 1, r subcomponent-like							219.0	164.0	182.0					12																	7249506		2203	4300	6503	SO:0001819	synonymous_variant	51279	0	0					g.chr12:7249506C>T	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.945G>A	chr12.hg19:g.7249506C>T		1					C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_3'UTR|C1RL_ENST00000504702.2_Intron	p.G315G	NM_016546.2	NP_057630.2	1	3	4	2.984419	Q9NZP8	C1RL_HUMAN		6	1037	-			Q53GX9	Silent	SNP	ENST00000266542.4	0	1	hg19	c.945G>A	CCDS8573.1	0	.	.	.	.	.	.	.	.	.	.	C	3.389	-0.124736	0.06795	.	.	ENSG00000139178	ENST00000534950	.	.	.	4.98	-9.95	0.00446	4.98	-9.95	0.00446	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.46185	D	0.998912	.	.	.	.	.	.	T	0.49835	-0.8897	4	.	.	.	.	5.2161	0.15344	0.0767:0.1221:0.3579:0.4432	.	.	.	.	K	148	.	.	E	-	1	0	0	C1RL	7140648	7140648	0.000000	0.05858	0.000000	0.03702	0.641000	0.38312	-2.582000	0.00905	-2.698000	0.00400	-0.350000	0.07774	GAA	0.624217		TCGA-FB-AAQ2-01A-31D-A40W-08	0.552	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	0	0	1		2	2	2	0		0	0	72		72	70	1	1.950000	-2.673493	1	0.460000	NM_016546			9	9		465	451	0		1	1		0	0	72	0		0.993475	5.661677e-01	0	7	0	87	0	9	465
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	2	4	6	2.453125	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.557667		TCGA-FB-AAQ2-01A-31D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	60		60	59	1	1.950000	-20.000000	1	0.460000	NM_033360			63	62		145	142	1		1	1	1	0	0	60	513		1.000000	9.791257e-01	1	11	140	6	467	63	145
ACSS3	79611	broad.mit.edu	37	12	81647110	81647110	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr12:81647110G>A	ENST00000548058.1	+	14	2654	c.1744G>A	c.(1744-1746)Gca>Aca	p.A582T	ACSS3_ENST00000548324.1_Missense_Mutation_p.A264T|ACSS3_ENST00000261206.3_Missense_Mutation_p.A581T			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	582						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TGGTACCGTGGCAGACTGTGC	0.373																																						ENST00000548058.1	0.810000	6.000000e-01	7.600000e-01	6.500000e-01	0.700000	0.710950	0.700000	0.710000																										0				51						c.(1744-1746)Gca>Aca		acyl-CoA synthetase short-chain family member 3							232.0	225.0	227.0					12																	81647110		2203	4300	6503	SO:0001583	missense	79611	0	0					g.chr12:81647110G>A		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1744G>A	chr12.hg19:g.81647110G>A	ENSP00000449535:p.Ala582Thr	1					ACSS3_ENST00000548324.1_Missense_Mutation_p.A264T|ACSS3_ENST00000261206.3_Missense_Mutation_p.A581T	p.A582T			0	1	1	1.701434	Q9H6R3	ACSS3_HUMAN		14	2654	+			Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	1	1	hg19	c.1744G>A	CCDS9022.1	0	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395361	0.62066	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.62105	0.05;0.05;0.05	6.0	4.17	0.49024	6.0	4.17	0.49024	AMP-dependent synthetase/ligase (1);	0.383935	0.28809	N	0.014067	T	0.63522	0.2518	M	0.81179	2.53	0.37366	D	0.911421	B;B	0.32526	0.374;0.0	B;B	0.29267	0.1;0.003	T	0.69614	-0.5098	10	0.72032	D	0.01	-0.5583	13.4013	0.60885	0.1288:0.0:0.8712:0.0	.	264;582	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	T	582;581;264	ENSP00000449535:A582T;ENSP00000261206:A581T;ENSP00000448965:A264T	ENSP00000261206:A581T	A	+	1	0	0	ACSS3	80171241	80171241	1.000000	0.71417	0.279000	0.24732	0.981000	0.71138	5.191000	0.65110	0.869000	0.35703	-0.261000	0.10672	GCA	0.315068		TCGA-FB-AAQ2-01A-31D-A40W-08	0.373	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	1	0	1		2	2	2	0		0	0	159		159	158	1	1.950000	-20.000000	1	0.460000	NM_024560			138	138		528	520	1		1	0		0	0	159	0		1.000000	4.354520e-02	0	0	0	2	0	138	528
SPERT	220082	broad.mit.edu	37	13	46287859	46287859	+	Silent	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr13:46287859C>T	ENST00000310521.1	+	3	779	c.699C>T	c.(697-699)caC>caT	p.H233H	SPERT_ENST00000378966.3_Silent_p.H197H	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	233						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		AGAAGGACCACGTCGCCCTGC	0.682																																						ENST00000310521.1	1.000000	6.200000e-01	1	7.500000e-01	0.890000	0.881291	0.890000	1.000000																										0				15						c.(697-699)caC>caT		spermatid associated							38.0	35.0	36.0					13																	46287859		2202	4298	6500	SO:0001819	synonymous_variant	220082	1	121378	27				g.chr13:46287859C>T	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.699C>T	chr13.hg19:g.46287859C>T		1					SPERT_ENST00000378966.3_Silent_p.H197H	p.H233H	NM_152719.1	NP_689932.1	1	2	3	2.521774	Q8NA61	SPERT_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	3	779	+		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	A8K8I5|Q8NHV2	Silent	SNP	ENST00000310521.1	1	1	hg19	c.699C>T	CCDS9399.1	1																																																																																								0.560976		TCGA-FB-AAQ2-01A-31D-A40W-08	0.682	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	1	0	1		2	2	2	0		0	0	23		23	23	1	1.950000	-20.000000	1	0.460000	NM_152719			29	29		145	141	1		1			0	0	23	0		1.000000	0	0	0	0	0	0	29	145
IPO5	3843	broad.mit.edu	37	13	98658520	98658520	+	Missense_Mutation	SNP	C	C	T	rs566255473		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr13:98658520C>T	ENST00000490680.1	+	14	1699	c.1634C>T	c.(1633-1635)gCg>gTg	p.A545V	IPO5_ENST00000261574.5_Missense_Mutation_p.A563V|IPO5_ENST00000493492.2_3'UTR|IPO5_ENST00000539640.1_Missense_Mutation_p.A420V			O00410	IPO5_HUMAN	importin 5	545					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GTTGAGAATGCGGTTCAAAAA	0.378													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16537	0.0		0.0	False		,,,				2504	0.0					ENST00000490680.1	0.110000	0	8.000000e-02	2.000000e-02	0.050000	0.058057	0.050000	0.060000																										0				27						c.(1633-1635)gCg>gTg		importin 5							95.0	92.0	93.0					13																	98658520		2203	4300	6503	SO:0001583	missense	3843	1	121412	26				g.chr13:98658520C>T	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1634C>T	chr13.hg19:g.98658520C>T	ENSP00000418393:p.Ala545Val	1					IPO5_ENST00000539640.1_Missense_Mutation_p.A420V|IPO5_ENST00000261574.5_Missense_Mutation_p.A563V|IPO5_ENST00000493492.2_3'UTR	p.A545V			1	2	3	2.521774	O00410	IPO5_HUMAN		14	1699	+			B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	0	1	hg19	c.1634C>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.423620|5.423620	0.96111|0.96111	.|.	.|.	ENSG00000065150|ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640|ENST00000469360	T;T;T;T|.	0.24350|.	1.86;1.86;1.86;1.86|.	5.1|5.1	5.1|5.1	0.69264|0.69264	5.1|5.1	5.1|5.1	0.69264|0.69264	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76644|0.76644	0.4016|0.4016	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	P;D;D|.	0.69078|.	0.947;0.995;0.997|.	P;P;P|.	0.54664|.	0.59;0.578;0.758|.	T|T	0.76512|0.76512	-0.2932|-0.2932	10|5	0.72032|.	D|.	0.01|.	-10.5253|-10.5253	18.8688|18.8688	0.92305|0.92305	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	420;545;563|.	B4E0R6;O00410;O00410-3|.	.;IPO5_HUMAN;.|.	V|W	563;545;545;420|547	ENSP00000261574:A563V;ENSP00000350219:A545V;ENSP00000418393:A545V;ENSP00000445126:A420V|.	ENSP00000261574:A563V|.	A|R	+|+	2|1	0|2	0|2	IPO5|IPO5	97456521|97456521	97456521|97456521	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.928000|5.928000	0.70088|0.70088	2.525000|2.525000	0.85131|0.85131	0.460000|0.460000	0.39030|0.39030	GCG|CGG	0.560976		TCGA-FB-AAQ2-01A-31D-A40W-08	0.378	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	0	0	1		2	2	2	0		0	0	89		89	86	1	1.950000	-1.999313	0	0.460000	NM_002271			5	5		538	533	0		1	0		0	0	89	0		0.936276	7.946496e-01	0	0	0	315	0	5	538
ZFYVE26	23503	broad.mit.edu	37	14	68233050	68233050	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr14:68233050C>T	ENST00000347230.4	-	32	6043	c.5905G>A	c.(5905-5907)Gag>Aag	p.E1969K	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.E1969K	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1969					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCATCCACCTCTGGGTTGGTG	0.577																																						ENST00000347230.4	1.000000	8.400000e-01	1	9.200000e-01	0.990000	0.973325	0.990000	1.000000																										0				94						c.(5905-5907)Gag>Aag		zinc finger, FYVE domain containing 26							77.0	78.0	77.0					14																	68233050		2203	4300	6503	SO:0001583	missense	23503	0	0					g.chr14:68233050C>T	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.5905G>A	chr14.hg19:g.68233050C>T	ENSP00000251119:p.Glu1969Lys	0					ZFYVE26_ENST00000555452.1_Missense_Mutation_p.E1969K	p.E1969K	NM_015346.3	NP_056161.2	1	2	3	2.067251	Q68DK2	ZFY26_HUMAN		32	6043	-			B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	1	1	hg19	c.5905G>A	CCDS9788.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.573986	0.96553	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.34667	1.5;1.35	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.64583	0.2611	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.66654	-0.5869	10	0.72032	D	0.01	-18.437	19.8574	0.96764	0.0:1.0:0.0:0.0	.	1969;1969	G3V2D8;Q68DK2	.;ZFY26_HUMAN	K	1969;1948;1969	ENSP00000251119:E1969K;ENSP00000450603:E1969K	ENSP00000251119:E1969K	E	-	1	0	0	ZFYVE26	67302803	67302803	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.771000	0.85420	2.704000	0.92352	0.555000	0.69702	GAG	0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.577	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	1	0	1		2	2	2	0		0	0	65		65	63	1	1.950000	-4.227237	1	0.460000	NM_015346			114	112		383	375	1		1	1		0	0	65	0		1.000000	9.602587e-01	0	5	0	15	0	114	383
PLA2G4D	283748	broad.mit.edu	37	15	42362977	42362977	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr15:42362977G>A	ENST00000290472.3	-	18	2075	c.1981C>T	c.(1981-1983)Cgg>Tgg	p.R661W		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	661	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CGGCCTGGCCGGAACATGGAG	0.657																																						ENST00000290472.3	1.000000	8.200000e-01	1	9.900000e-01	0.990000	0.987303	0.990000	1.000000																										0				27						c.(1981-1983)Cgg>Tgg		phospholipase A2, group IVD (cytosolic)							72.0	66.0	68.0					15																	42362977		2201	4298	6499	SO:0001583	missense	283748	2	121196	17				g.chr15:42362977G>A	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.1981C>T	chr15.hg19:g.42362977G>A	ENSP00000290472:p.Arg661Trp	1						p.R661W	NM_178034.3	NP_828848.3	0	1	1	1.895790	Q86XP0	PA24D_HUMAN		18	2075	-		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)	Q8N176	Missense_Mutation	SNP	ENST00000290472.3	0	1	hg19	c.1981C>T	CCDS32203.1	1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711719	0.48517	.	.	ENSG00000159337	ENST00000290472	T	0.16073	2.37	4.46	3.54	0.40534	4.46	3.54	0.40534	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.216636	0.29884	N	0.010944	T	0.25680	0.0625	M	0.89715	3.055	0.42428	D	0.992664	B	0.17268	0.021	B	0.06405	0.002	T	0.14008	-1.0488	10	0.66056	D	0.02	-11.7079	7.7234	0.28746	0.0883:0.0:0.7119:0.1998	.	661	Q86XP0	PA24D_HUMAN	W	661	ENSP00000290472:R661W	ENSP00000290472:R661W	R	-	1	2	2	PLA2G4D	40150269	40150269	0.961000	0.32948	0.990000	0.47175	0.986000	0.74619	0.984000	0.29565	1.224000	0.43551	0.573000	0.79308	CGG	0.417098		TCGA-FB-AAQ2-01A-31D-A40W-08	0.657	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	1	0	1		2	2	2	0		0	0	9		9	9	1	1.950000	-20.000000	1	0.460000	NM_178034			15	15		30	28	0		1			0	0	9	0		0.999941	0	0	0	0	0	0	15	30
UBL7	84993	broad.mit.edu	37	15	74743165	74743165	+	Missense_Mutation	SNP	C	C	A	rs199841006		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr15:74743165C>A	ENST00000567435.1	-	6	971	c.508G>T	c.(508-510)Gct>Tct	p.A170S	UBL7_ENST00000361351.4_Missense_Mutation_p.A170S|UBL7_ENST00000395081.2_Missense_Mutation_p.A170S|UBL7_ENST00000565335.1_Missense_Mutation_p.A170S|UBL7_ENST00000564488.1_Missense_Mutation_p.A170S			Q96S82	UBL7_HUMAN	ubiquitin-like 7	170										endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						TTGGGATCAGCGAAGACAGAG	0.502																																						ENST00000567435.1	0.250000	8.000000e-02	2.100000e-01	1.100000e-01	0.150000	0.165343	0.150000	0.150000																										0				9						c.(508-510)Gct>Tct		ubiquitin-like 7							130.0	110.0	117.0					15																	74743165		2197	4296	6493	SO:0001583	missense	84993	0	0					g.chr15:74743165C>A	BC007913	CCDS10263.1	15q23	2014-03-06	2014-03-06		ENSG00000138629	ENSG00000138629			28221	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived ubiquitin-like"", "" ubiquitin-like protein SB132"""	609748	"""ubiquitin-like 7 (bone marrow stromal cell-derived)"""			12644319	Standard	NM_201265		Approved	BMSC-UbP, MGC14421	uc002axy.1	Q96S82	OTTHUMG00000139001	ENST00000567435.1:c.508G>T	chr15.hg19:g.74743165C>A	ENSP00000457703:p.Ala170Ser	1					UBL7_ENST00000564488.1_Missense_Mutation_p.A170S|UBL7_ENST00000565335.1_Missense_Mutation_p.A170S|UBL7_ENST00000361351.4_Missense_Mutation_p.A170S|UBL7_ENST00000395081.2_Missense_Mutation_p.A170S	p.A170S			0	1	1	1.895790	Q96S82	UBL7_HUMAN		6	971	-			D3DW57|Q96I03	Missense_Mutation	SNP	ENST00000567435.1	1	1	hg19	c.508G>T	CCDS10263.1	0	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864125	0.51482	.	.	ENSG00000138629	ENST00000361351;ENST00000395081	T;T	0.43294	0.95;0.95	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.169066	0.53938	D	0.000049	T	0.25754	0.0627	L	0.29908	0.895	0.42144	D	0.991528	P;P	0.44429	0.835;0.495	B;B	0.34824	0.19;0.145	T	0.07328	-1.0778	10	0.12103	T	0.63	-23.3972	12.6718	0.56872	0.0:0.9246:0.0:0.0754	.	210;170	D3DW56;Q96S82	.;UBL7_HUMAN	S	170	ENSP00000354883:A170S;ENSP00000378518:A170S	ENSP00000354883:A170S	A	-	1	0	0	UBL7	72530218	72530218	0.998000	0.40836	0.958000	0.39756	0.987000	0.75469	3.364000	0.52328	2.568000	0.86640	0.655000	0.94253	GCT	0.417098		TCGA-FB-AAQ2-01A-31D-A40W-08	0.502	UBL7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419627.1	0	0	1		13	8	2	1		1	1	103		103	101	1	1.950000	-3.837178	1	0.460000	NM_032907, NM_201265			14	14		348	344	0		1	0		1	0	103	0		0.638465	3.730031e-01	0	4	0	161	0	14	348
RASGRF1	5923	broad.mit.edu	37	15	79350772	79350772	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr15:79350772G>T	ENST00000419573.3	-	3	709	c.435C>A	c.(433-435)caC>caA	p.H145Q	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.H145Q	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	145					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TCTGCAGCAGGTGCAGGTATT	0.562																																						ENST00000419573.3	0.670000	3.700000e-01	6.000000e-01	4.400000e-01	0.510000	0.524651	0.510000	0.520000																										0				71						c.(433-435)caC>caA		Ras protein-specific guanine nucleotide-releasing factor 1							133.0	108.0	116.0					15																	79350772		2196	4293	6489	SO:0001583	missense	5923	0	0					g.chr15:79350772G>T	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.435C>A	chr15.hg19:g.79350772G>T	ENSP00000405963:p.His145Gln	1					RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.H145Q	p.H145Q	NM_002891.4	NP_002882.3	0	1	1	1.895790	Q13972	RGRF1_HUMAN		3	709	-			F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	1	1	hg19	c.435C>A	CCDS10309.1	0	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578942	0.65878	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.40756	1.02	4.59	3.65	0.41850	4.59	3.65	0.41850	.	0.060814	0.64402	D	0.000003	T	0.56514	0.1990	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.73708	0.958;0.958;0.958;0.981	T	0.58907	-0.7553	10	0.87932	D	0	.	7.329	0.26571	0.1963:0.0:0.8037:0.0	.	145;145;145;145	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	Q	145	ENSP00000405963:H145Q	ENSP00000378224:H145Q	H	-	3	2	2	RASGRF1	77137827	77137827	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.502000	0.53332	2.366000	0.80165	0.542000	0.68232	CAC	0.417098		TCGA-FB-AAQ2-01A-31D-A40W-08	0.562	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	1	0	1		2	2	2	0		0	0	41		41	41	1	1.950000	-17.033330	1	0.460000	NM_002891			38	38		258	249	0		1	0		0	0	41	0		1.000000	8.690766e-02	0	0	0	4	0	38	258
FAM169B	283777	broad.mit.edu	37	15	98995216	98995216	+	Missense_Mutation	SNP	C	C	T	rs557283476	byFrequency	TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr15:98995216C>T	ENST00000558256.1	-	5	457	c.208G>A	c.(208-210)Ggt>Agt	p.G70S	FAM169B_ENST00000332908.4_Missense_Mutation_p.G70S	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	70										large_intestine(3)|lung(3)|urinary_tract(1)	7						TAGCATGCACCGGTGCCATCA	0.592													C|||	9	0.00179712	0.0	0.0	5008	,	,		20208	0.0		0.0	False		,,,				2504	0.0092					ENST00000558256.1	1.000000	7.200000e-01	1	8.300000e-01	0.960000	0.934561	0.960000	1.000000																										0				7						c.(208-210)Ggt>Agt		family with sequence similarity 169, member B							68.0	76.0	73.0					15																	98995216		2100	4230	6330	SO:0001583	missense	283777	56	121048	44				g.chr15:98995216C>T		CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.208G>A	chr15.hg19:g.98995216C>T	ENSP00000453554:p.Gly70Ser	1					FAM169B_ENST00000332908.4_Missense_Mutation_p.G70S	p.G70S	NM_182562.2	NP_872368.2	0	1	1	1.895790	Q8N8A8	F169B_HUMAN		5	457	-			B5MDL8	Missense_Mutation	SNP	ENST00000558256.1	1	1	hg19	c.208G>A	CCDS45360.1	1	.	.	.	.	.	.	.	.	.	.	C	2.568	-0.300196	0.05532	.	.	ENSG00000185087	ENST00000332908	T	0.12039	2.72	4.53	1.29	0.21616	4.53	1.29	0.21616	.	0.284924	0.33980	N	0.004373	T	0.05456	0.0144	L	0.27053	0.805	0.09310	N	1	P	0.40638	0.725	B	0.31290	0.127	T	0.33497	-0.9866	10	0.12766	T	0.61	-2.8104	4.1212	0.10106	0.1846:0.5603:0.0:0.2552	.	70	Q8N8A8	F169B_HUMAN	S	70	ENSP00000332615:G70S	ENSP00000332615:G70S	G	-	1	0	0	FAM169B	96812739	96812739	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	0.072000	0.14617	0.515000	0.28320	0.650000	0.86243	GGT	0.417098		TCGA-FB-AAQ2-01A-31D-A40W-08	0.592	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415488.1	1	0	1		2	2	2	0		0	0	22		22	21	1	1.950000	-4.201373	1	0.460000	NM_182562			38	38		119	116	0		1			0	0	22	0		1.000000	0	0	0	0	0	0	38	119
WDR90	197335	broad.mit.edu	37	16	701015	701015	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr16:701015G>A	ENST00000293879.4	+	6	580	c.580G>A	c.(580-582)Gca>Aca	p.A194T	WDR90_ENST00000549091.1_Missense_Mutation_p.A194T|AL022341.3_ENST00000455294.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	194										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GGCCCAGTGGGCAAAGCTGCC	0.607																																						ENST00000293879.4	1.000000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.114274	0.050000	0.060000																										0				37						c.(580-582)Gca>Aca		WD repeat domain 90							80.0	88.0	85.0					16																	701015		2163	4274	6437	SO:0001583	missense	197335	0	0					g.chr16:701015G>A	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.580G>A	chr16.hg19:g.701015G>A	ENSP00000293879:p.Ala194Thr	0					AL022341.3_ENST00000455294.1_RNA|WDR90_ENST00000549091.1_Missense_Mutation_p.A194T	p.A194T			1	2	3	2.079698	Q96KV7	WDR90_HUMAN		6	580	+		Hepatocellular(780;0.0218)	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	0	1	hg19	c.580G>A	CCDS42092.1	0	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708198	0.30322	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.29917	1.59;1.55	4.95	0.105	0.14535	4.95	0.105	0.14535	.	0.781301	0.10905	U	0.621191	T	0.20820	0.0501	L	0.41415	1.275	0.09310	N	1	B;B;B	0.23377	0.018;0.001;0.084	B;B;B	0.18561	0.008;0.007;0.022	T	0.24225	-1.0166	10	0.51188	T	0.08	.	3.5213	0.07743	0.163:0.1287:0.5759:0.1324	.	194;194;194	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	T	194	ENSP00000448122:A194T;ENSP00000293879:A194T	ENSP00000293879:A194T	A	+	1	0	0	WDR90	641016	641016	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.073000	0.14640	-0.197000	0.10350	-1.020000	0.02445	GCA	0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.607	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	0	0	1		2	2	2	0		0	0	95		95	91	1	1.950000	-2.689949	1	0.460000	NM_145294			6	6		490	485	0		1	0		0	0	95	0		0.964060	3.153814e-02	0	0	0	19	0	6	490
IRX6	79190	broad.mit.edu	37	16	55362807	55362807	+	Missense_Mutation	SNP	G	G	A	rs377555554		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr16:55362807G>A	ENST00000290552.7	+	5	2249	c.917G>A	c.(916-918)cGc>cAc	p.R306H	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	306					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						CGATTGGAGCGCAGGGAGTGC	0.662																																						ENST00000290552.7	1.000000	7.800000e-01	1	8.700000e-01	0.970000	0.947423	0.970000	1.000000																										0				33						c.(916-918)cGc>cAc		iroquois homeobox 6							46.0	50.0	48.0					16																	55362807		2196	4297	6493	SO:0001583	missense	79190	1	121374	38				g.chr16:55362807G>A	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.917G>A	chr16.hg19:g.55362807G>A	ENSP00000290552:p.Arg306His	0					RP11-26L20.3_ENST00000558730.2_RNA	p.R306H	NM_024335.2	NP_077311.2	1	2	3	2.080562	P78412	IRX6_HUMAN		5	2249	+			B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	1	1	hg19	c.917G>A	CCDS32449.1	1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704584	0.68615	.	.	ENSG00000159387	ENST00000290552	D	0.89939	-2.59	5.27	4.11	0.48088	5.27	4.11	0.48088	.	0.618078	0.16748	N	0.201144	T	0.80407	0.4617	N	0.24115	0.695	0.09310	N	0.999997	D	0.56287	0.975	B	0.42062	0.374	T	0.72600	-0.4244	10	0.40728	T	0.16	-15.6593	9.6842	0.40089	0.111:0.0:0.889:0.0	.	306	P78412	IRX6_HUMAN	H	306	ENSP00000290552:R306H	ENSP00000290552:R306H	R	+	2	0	0	IRX6	53920308	53920308	0.000000	0.05858	1.000000	0.80357	0.893000	0.52053	0.202000	0.17295	2.463000	0.83235	0.462000	0.41574	CGC	0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.662	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	1	0	1		2	2	2	0		0	0	76		76	75	1	1.950000	-20.000000	1	0.460000	NM_024335			77	73		275	267	1		1			0	0	76	0		1.000000	0	0	0	0	0	0	77	275
TP53	7157	broad.mit.edu	37	17	7577106	7577106	+	Missense_Mutation	SNP	G	G	A	rs17849781		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr17:7577106G>A	ENST00000269305.4	-	8	1021	c.832C>T	c.(832-834)Cct>Tct	p.P278S	TP53_ENST00000420246.2_Missense_Mutation_p.P278S|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.P278S|TP53_ENST00000445888.2_Missense_Mutation_p.P278S|TP53_ENST00000455263.2_Missense_Mutation_p.P278S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278S(55)|p.P278A(24)|p.P278T(23)|p.0?(8)|p.P278F(3)|p.P278fs*67(3)|p.?(2)|p.P278fs*28(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.C275fs*67(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C277_P278insXXXXXXX(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCTCCCAGGACAGGCACAA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.100000e-01	1	8.900000e-01	0.960000	0.951672	0.960000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		131	Substitution - Missense(105)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Insertion - Frameshift(2)|Unknown(2)|Insertion - In frame(1)	p.P278S(55)|p.P278A(24)|p.P278T(23)|p.0?(8)|p.P278F(3)|p.P278fs*67(3)|p.?(2)|p.P278fs*28(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.C275fs*67(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C277_P278insXXXXXXX(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)	upper_aerodigestive_tract(19)|breast(18)|skin(16)|large_intestine(14)|oesophagus(11)|lung(11)|central_nervous_system(7)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(4)|bone(4)|kidney(3)|endometrium(3)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|eye(1)|biliary_tract(1)|liver(1)|prostate(1)	24185	GRCh37	CM011015|CM052927	TP53	M	rs17849781	c.(832-834)Cct>Tct	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						72.0	62.0	65.0					17																	7577106		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577106G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.832C>T	chr17.hg19:g.7577106G>A	ENSP00000269305:p.Pro278Ser	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.P278S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P278S|TP53_ENST00000420246.2_Missense_Mutation_p.P278S|TP53_ENST00000359597.4_Missense_Mutation_p.P278S|TP53_ENST00000413465.2_Intron	p.P278S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.628294	P04637	P53_HUMAN		8	1021	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.832C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.064500	0.93898	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99881	-7.47;-7.47;-7.47;-7.47;-7.47;-7.47	5.13	5.13	0.70059	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.988;1.0;0.987;0.975	D	0.96190	0.9137	10	0.87932	D	0	-13.7877	16.1198	0.81342	0.0:0.0:1.0:0.0	.	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	S	278;278;278;278;278;267;146	ENSP00000352610:P278S;ENSP00000269305:P278S;ENSP00000398846:P278S;ENSP00000391127:P278S;ENSP00000391478:P278S;ENSP00000425104:P146S	ENSP00000269305:P278S	P	-	1	0	0	TP53	7517831	7517831	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.573000	0.98181	2.667000	0.90743	0.462000	0.41574	CCT	0.300790		TCGA-FB-AAQ2-01A-31D-A40W-08	0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	30		30	29	1	1.950000	-20.000000	1	0.460000	NM_000546			43	39		75	72	1		1	1	1	0	0	30	1203		1.000000	1	1	95	348	15	944	43	75
CCDC40	55036	broad.mit.edu	37	17	78039368	78039368	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr17:78039368C>T	ENST00000397545.4	+	10	1552	c.1525C>T	c.(1525-1527)Cgc>Tgc	p.R509C	CCDC40_ENST00000269318.5_Missense_Mutation_p.R509C|CCDC40_ENST00000374877.3_Missense_Mutation_p.R509C|CCDC40_ENST00000374876.4_Intron	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	509					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.R509G(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CATGAAGCACCGCGACGAGGC	0.692																																						ENST00000397545.4	0.430000	1.800000e-01	3.500000e-01	2.300000e-01	0.280000	0.298000	0.280000	0.280000																										2	Substitution - Missense(2)	p.R509G(2)	kidney(2)	38						c.(1525-1527)Cgc>Tgc		coiled-coil domain containing 40							45.0	53.0	50.0					17																	78039368		2128	4238	6366	SO:0001583	missense	55036	4	121050	38				g.chr17:78039368C>T	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1525C>T	chr17.hg19:g.78039368C>T	ENSP00000380679:p.Arg509Cys	0					CCDC40_ENST00000374877.3_Missense_Mutation_p.R509C|CCDC40_ENST00000269318.5_Missense_Mutation_p.R509C|CCDC40_ENST00000374876.4_Intron	p.R509C	NM_017950.3	NP_060420.2	1	2	3	2.041021	Q4G0X9	CCD40_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)	10	1552	+	all_neural(118;0.167)		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	1	1	hg19	c.1525C>T	CCDS42395.1	0	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560125	0.45590	.	.	ENSG00000141519	ENST00000374877;ENST00000269318;ENST00000397545	T;D;T	0.85171	0.02;-1.95;0.17	5.14	5.14	0.70334	5.14	5.14	0.70334	.	.	.	.	.	D	0.92639	0.7661	M	0.84846	2.72	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93632	0.6957	9	0.87932	D	0	-17.7899	14.2557	0.66051	0.1497:0.8503:0.0:0.0	.	509;292	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	C	509	ENSP00000364011:R509C;ENSP00000269318:R509C;ENSP00000380679:R509C	ENSP00000269318:R509C	R	+	1	0	0	CCDC40	75653963	75653963	0.993000	0.37304	0.038000	0.18304	0.025000	0.11179	3.700000	0.54786	2.390000	0.81377	0.655000	0.94253	CGC	0.462473		TCGA-FB-AAQ2-01A-31D-A40W-08	0.692	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	1	0	1		2	2	2	0		0	0	81		81	79	1	1.950000	-2.578481	1	0.460000	XM_371082			24	24		348	343	0		1	0		0	0	81	0		1.000000	2.509171e-02	0	0	0	4	0	24	348
RNF152	220441	broad.mit.edu	37	18	59483165	59483165	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr18:59483165C>T	ENST00000312828.3	-	2	1631	c.532G>A	c.(532-534)Gtc>Atc	p.V178I		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	178					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				AAGACCAAGACGCAAGCCACC	0.592																																						ENST00000312828.3	1.000000	7.200000e-01	9.600000e-01	8.000000e-01	0.870000	0.881595	0.870000	1.000000																										0				17						c.(532-534)Gtc>Atc		ring finger protein 152							133.0	120.0	125.0					18																	59483165		2203	4300	6503	SO:0001583	missense	220441	3	121412	36				g.chr18:59483165C>T	AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.532G>A	chr18.hg19:g.59483165C>T	ENSP00000316628:p.Val178Ile	1						p.V178I	NM_173557.2	NP_775828.1	0	1	1	1.634360	Q8N8N0	RN152_HUMAN		2	1631	-		Colorectal(73;0.186)	B3KV99|Q52LA4	Missense_Mutation	SNP	ENST00000312828.3	1	1	hg19	c.532G>A	CCDS11978.1	1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338338	0.41398	.	.	ENSG00000176641	ENST00000312828	D	0.84146	-1.81	4.69	4.69	0.59074	4.69	4.69	0.59074	.	0.069218	0.56097	D	0.000024	T	0.75817	0.3901	N	0.17082	0.46	0.47862	D	0.999534	B	0.20550	0.046	B	0.14023	0.01	T	0.70733	-0.4791	10	0.32370	T	0.25	-0.1111	17.8094	0.88611	0.0:1.0:0.0:0.0	.	178	Q8N8N0	RN152_HUMAN	I	178	ENSP00000316628:V178I	ENSP00000316628:V178I	V	-	1	0	0	RNF152	57634145	57634145	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.036000	0.64164	2.461000	0.83175	0.563000	0.77884	GTC	0.306982		TCGA-FB-AAQ2-01A-31D-A40W-08	0.592	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	1	0	1		2	2	2	0		0	0	73		73	73	1	1.950000	-20.000000	1	0.460000	NM_173557			87	86		244	240	1		1	1		0	0	73	0		1.000000	2.865318e-01	0	3	0	1	0	87	244
ZNF536	9745	broad.mit.edu	37	19	30935540	30935540	+	Silent	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:30935540G>A	ENST00000355537.3	+	2	1218	c.1071G>A	c.(1069-1071)gcG>gcA	p.A357A		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	357					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCAGCCAGGCGTGGTTCCTCA	0.652																																						ENST00000355537.3	1.000000	8.100000e-01	1	8.700000e-01	0.930000	0.935802	0.930000	1.000000																										0				182						c.(1069-1071)gcG>gcA		zinc finger protein 536							104.0	112.0	110.0					19																	30935540		2203	4300	6503	SO:0001819	synonymous_variant	9745	14	121410	44				g.chr19:30935540G>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1071G>A	chr19.hg19:g.30935540G>A		0						p.A357A	NM_014717.1	NP_055532.1	1	2	3	2.057369	O15090	ZN536_HUMAN		2	1218	+	Esophageal squamous(110;0.0834)		A2RU18	Silent	SNP	ENST00000355537.3	1	1	hg19	c.1071G>A	CCDS32984.1	1																																																																																								0.464923		TCGA-FB-AAQ2-01A-31D-A40W-08	0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	1	0	1		2	2	2	0		0	0	131		131	128	1	1.950000	-20.000000	1	0.460000	NM_014717			166	165		610	607	1		1			0	0	131	0		1.000000	0	0	0	0	0	0	166	610
RYR1	6261	broad.mit.edu	37	19	39016037	39016037	+	Silent	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:39016037G>A	ENST00000359596.3	+	71	10521	c.10521G>A	c.(10519-10521)acG>acA	p.T3507T	AC067969.1_ENST00000597015.1_RNA|RYR1_ENST00000360985.3_Silent_p.T3507T|RYR1_ENST00000355481.4_Silent_p.T3502T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3507					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGTGCAGACGTCACTGATCG	0.627																																						ENST00000359596.3	1.000000	8.800000e-01	1	9.700000e-01	0.990000	0.989177	0.990000	1.000000																										0				285						c.(10519-10521)acG>acA		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						120.0	116.0	117.0					19																	39016037		2203	4300	6503	SO:0001819	synonymous_variant	6261	5	121412	41				g.chr19:39016037G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10521G>A	chr19.hg19:g.39016037G>A		0					RYR1_ENST00000360985.3_Silent_p.T3507T|AC067969.1_ENST00000597015.1_RNA|RYR1_ENST00000355481.4_Silent_p.T3502T	p.T3507T			1	2	3	2.057369	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	71	10521	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	1	1	hg19	c.10521G>A	CCDS33011.1	1																																																																																								0.464923		TCGA-FB-AAQ2-01A-31D-A40W-08	0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	1	0	1		2	2	2	0		0	0	46		46	45	1	1.950000	-20.000000	1	0.460000				88	86		270	263	1		1			0	0	46	0		1.000000	0	0	0	0	0	0	88	270
CEACAM4	1089	broad.mit.edu	37	19	42132119	42132119	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:42132119C>T	ENST00000221954.2	-	2	390	c.280G>A	c.(280-282)Gca>Aca	p.A94T	CEACAM4_ENST00000600925.1_Missense_Mutation_p.A94T	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	94	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.A94T(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						CCACTGTATGCGGCCCCTGGG	0.488																																						ENST00000221954.2	1.000000	0	7.000000e-02	1.000000e-02	0.030000	0.111762	0.030000	0.040000																										1	Substitution - Missense(1)	p.A94T(1)	lung(1)	16						c.(280-282)Gca>Aca		carcinoembryonic antigen-related cell adhesion molecule 4							166.0	157.0	160.0					19																	42132119		2203	4300	6503	SO:0001583	missense	1089	4	121412	41				g.chr19:42132119C>T	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.280G>A	chr19.hg19:g.42132119C>T	ENSP00000221954:p.Ala94Thr	0					CEACAM4_ENST00000600925.1_Missense_Mutation_p.A94T	p.A94T	NM_001817.2	NP_001808.2	1	2	3	2.105113	O75871	CEAM4_HUMAN		2	390	-			Q03715|Q7LDZ7	Missense_Mutation	SNP	ENST00000221954.2	0	1	hg19	c.280G>A	CCDS33033.1	0	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639939	0.47153	.	.	ENSG00000105352	ENST00000221954	T	0.66280	-0.2	1.76	1.76	0.24704	1.76	1.76	0.24704	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76278	0.3965	M	0.84219	2.685	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.73380	0.921;0.98	T	0.61207	-0.7109	9	0.66056	D	0.02	.	6.9535	0.24558	0.0:1.0:0.0:0.0	.	94;94	E7EMX3;O75871	.;CEAM4_HUMAN	T	94	ENSP00000221954:A94T	ENSP00000221954:A94T	A	-	1	0	0	CEACAM4	46823959	46823959	0.000000	0.05858	0.009000	0.14445	0.015000	0.08874	0.618000	0.24373	1.281000	0.44480	0.205000	0.17691	GCA	0.470951		TCGA-FB-AAQ2-01A-31D-A40W-08	0.488	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321148.1	0	0	1		2	2	2	1		1	0	186		186	183	1	1.950000	-1.550370	0	0.460000	NM_001817			6	6		723	714	0		1	0		1	0	186	0		0.963695	0	0	0	0	1	0	6	723
TEX101	83639	broad.mit.edu	37	19	43922079	43922079	+	Silent	SNP	G	G	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:43922079G>T	ENST00000598265.1	+	5	607	c.441G>T	c.(439-441)ggG>ggT	p.G147G	TEX101_ENST00000253435.7_Silent_p.G165G|TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000602198.1_Silent_p.G165G	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	147	UPAR/Ly6.					acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.G165G(1)		large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				TGGCTTTGGGGACCTGTTTCA	0.493																																						ENST00000598265.1	1.000000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.127564	0.050000	0.060000																										1	Substitution - coding silent(1)	p.G165G(1)	lung(1)	15						c.(439-441)ggG>ggT		testis expressed 101							327.0	268.0	288.0					19																	43922079		2203	4300	6503	SO:0001819	synonymous_variant	83639	0	0					g.chr19:43922079G>T	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.441G>T	chr19.hg19:g.43922079G>T		0					TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000602198.1_Silent_p.G165G|TEX101_ENST00000253435.7_Silent_p.G165G	p.G147G	NM_001130011.1	NP_001123483.1	1	2	3	2.105113	Q9BY14	TX101_HUMAN		5	607	+		Prostate(69;0.0199)	Q7L5R2|Q9BPY7	Silent	SNP	ENST00000598265.1	0	1	hg19	c.441G>T	CCDS59393.1	0																																																																																								0.470951		TCGA-FB-AAQ2-01A-31D-A40W-08	0.493	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	0	0	1		2	2	2	0		0	0	145		145	143	1	1.950000	-2.319452	0	0.460000	NM_031451			8	7		665	652	0		1			0	0	145	0		0.988474	0	0	0	0	0	0	8	665
PRKD2	25865	broad.mit.edu	37	19	47193872	47193872	+	Silent	SNP	T	T	C			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:47193872T>C	ENST00000291281.4	-	13	2019	c.1794A>G	c.(1792-1794)gaA>gaG	p.E598E	PRKD2_ENST00000600194.1_Silent_p.E441E|PRKD2_ENST00000601806.1_Silent_p.E441E|PRKD2_ENST00000433867.1_Silent_p.E598E|RN7SL364P_ENST00000473668.2_RNA|PRKD2_ENST00000595515.1_Silent_p.E598E			Q9BZL6	KPCD2_HUMAN	protein kinase D2	598	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GAATGGCCACTTCATTCCGGA	0.577																																						ENST00000291281.4	1.000000	5.900000e-01	8.700000e-01	6.700000e-01	0.760000	0.776535	0.760000	0.750000																										0				41						c.(1792-1794)gaA>gaG		protein kinase D2							115.0	102.0	106.0					19																	47193872		2203	4300	6503	SO:0001819	synonymous_variant	25865	0	0					g.chr19:47193872T>C	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1794A>G	chr19.hg19:g.47193872T>C		0					PRKD2_ENST00000595515.1_Silent_p.E598E|RN7SL364P_ENST00000473668.2_RNA|PRKD2_ENST00000433867.1_Silent_p.E598E|PRKD2_ENST00000601806.1_Silent_p.E441E|PRKD2_ENST00000600194.1_Silent_p.E441E	p.E598E			1	2	3	2.105113	Q9BZL6	KPCD2_HUMAN		13	2019	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	1	1	hg19	c.1794A>G	CCDS12689.1	0																																																																																								0.470951		TCGA-FB-AAQ2-01A-31D-A40W-08	0.577	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	1	0	1		2	2	2	0		0	0	107		107	106	1	1.950000	-20.000000	1	0.460000	NM_016457			63	63		308	306	1		1	1		0	0	107	0		1.000000	9.999987e-01	0	34	0	65	0	63	308
SULT2B1	6820	broad.mit.edu	37	19	49079301	49079301	+	Missense_Mutation	SNP	C	C	T	rs371112055		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:49079301C>T	ENST00000201586.2	+	2	353	c.175C>T	c.(175-177)Cgg>Tgg	p.R59W	SULT2B1_ENST00000323090.4_Missense_Mutation_p.R44W	NM_177973.1	NP_814444.1	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	59					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	alcohol sulfotransferase activity (GO:0004027)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	11		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		CCAAGATGTGCGGGACGACGA	0.632																																						ENST00000201586.2	1.000000	8.800000e-01	1	9.600000e-01	0.990000	0.985575	0.990000	1.000000																										0				11						c.(175-177)Cgg>Tgg		sulfotransferase family, cytosolic, 2B, member 1		C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	125.0	105.0	112.0		130,175	1.2	1.0	19		112	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SULT2B1	NM_004605.2,NM_177973.1	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	44/351,59/366	49079301	1,13005	2203	4300	6503	SO:0001583	missense	6820	0	0					g.chr19:49079301C>T	U92314	CCDS12723.1, CCDS12724.1	19q13.3	2008-02-05				ENSG00000088002		"""Sulfotransferases, cytosolic"""	11459	protein-coding gene	gene with protein product		604125				9799594	Standard	NM_177973		Approved	HSST2	uc002pjl.3	O00204		ENST00000201586.2:c.175C>T	chr19.hg19:g.49079301C>T	ENSP00000201586:p.Arg59Trp	0					SULT2B1_ENST00000323090.4_Missense_Mutation_p.R44W	p.R59W	NM_177973.1	NP_814444.1	1	2	3	2.105113	O00204	ST2B1_HUMAN		2	353	+		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	O00205|O75814	Missense_Mutation	SNP	ENST00000201586.2	1	1	hg19	c.175C>T	CCDS12723.1	1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413766	0.25465	0.0	1.16E-4	ENSG00000088002	ENST00000201586;ENST00000323090	T;T	0.02421	4.3;4.3	4.61	1.17	0.20885	4.61	1.17	0.20885	.	0.895653	0.09103	N	0.848233	T	0.01387	0.0045	N	0.14661	0.345	0.25224	N	0.989883	B;P	0.41008	0.412;0.735	B;B	0.20955	0.026;0.032	T	0.46541	-0.9184	10	0.87932	D	0	.	3.1284	0.06415	0.2122:0.5639:0.0:0.2239	.	44;59	O00204-2;O00204	.;ST2B1_HUMAN	W	59;44	ENSP00000201586:R59W;ENSP00000312880:R44W	ENSP00000201586:R59W	R	+	1	2	2	SULT2B1	53771113	53771113	0.078000	0.21339	0.973000	0.42090	0.141000	0.21300	-0.040000	0.12104	1.061000	0.40601	0.561000	0.74099	CGG	0.470951		TCGA-FB-AAQ2-01A-31D-A40W-08	0.632	SULT2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466140.1	1	0	0		2	2	2	0		0	0	80		80	77	1	1.950000	-4.668788	1	0.460000	NM_004605			117	112		381	369	1		1	1		0	0	80	0		1.000000	1	0	37	0	46	0	117	381
NUP62	23636	broad.mit.edu	37	19	50412073	50412073	+	Missense_Mutation	SNP	G	G	A	rs377108835		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr19:50412073G>A	ENST00000596217.1	-	2	2879	c.992C>T	c.(991-993)gCg>gTg	p.A331V	NUP62_ENST00000413454.1_Missense_Mutation_p.A331V|NUP62_ENST00000422090.2_Missense_Mutation_p.A331V|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000352066.3_Missense_Mutation_p.A331V|NUP62_ENST00000597723.1_Intron|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000597029.1_Missense_Mutation_p.A331V|IL4I1_ENST00000595948.1_Intron			P37198	NUP62_HUMAN	nucleoporin 62kDa	331	Ala-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CTCCAGCTGCGCGTAGGTCAT	0.682																																						ENST00000596217.1	1.000000	6.800000e-01	9.400000e-01	7.600000e-01	0.840000	0.850589	0.840000	0.840000																										0				19						c.(991-993)gCg>gTg		nucleoporin 62kDa		G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,	0,4400		0,0,2200	46.0	52.0	50.0		992,992,992,992,992,	4.1	0.5	19		50	1,8595		0,1,4297	no	missense,missense,missense,missense,missense,intron	NUP62,IL4I1	NM_001193357.1,NM_012346.4,NM_016553.4,NM_153718.3,NM_153719.3,NM_172374.1	64,64,64,64,64,	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,	331/523,331/523,331/523,331/523,331/523,	50412073	1,12995	2200	4298	6498	SO:0001583	missense	23636	1	121378	31				g.chr19:50412073G>A	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.992C>T	chr19.hg19:g.50412073G>A	ENSP00000471191:p.Ala331Val	0					NUP62_ENST00000597723.1_Intron|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000413454.1_Missense_Mutation_p.A331V|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_Missense_Mutation_p.A331V|NUP62_ENST00000597029.1_Missense_Mutation_p.A331V|NUP62_ENST00000422090.2_Missense_Mutation_p.A331V	p.A331V			1	2	3	2.105113	P37198	NUP62_HUMAN		2	2879	-		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	ENST00000596217.1	1	1	hg19	c.992C>T	CCDS12788.1	0	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373391	0.42105	0.0	1.16E-4	ENSG00000213024	ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.76709	-1.04;-1.04;-1.04	5.2	4.14	0.48551	5.2	4.14	0.48551	Nucleoporin, NSP1-like, C-terminal (2);	0.075566	0.51477	U	0.000094	T	0.74596	0.3737	L	0.55481	1.735	0.49213	D	0.99976	P	0.42584	0.784	B	0.42495	0.389	T	0.74368	-0.3688	9	.	.	.	-9.4439	13.7291	0.62776	0.0:0.1556:0.8444:0.0	.	331	P37198	NUP62_HUMAN	V	331	ENSP00000305503:A331V;ENSP00000407331:A331V;ENSP00000387991:A331V	.	A	-	2	0	0	NUP62	55103885	55103885	1.000000	0.71417	0.491000	0.27477	0.408000	0.30992	5.070000	0.64376	1.530000	0.49136	0.655000	0.94253	GCG	0.470951		TCGA-FB-AAQ2-01A-31D-A40W-08	0.682	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	1	0	1		2	2	2	0		0	0	97		97	94	1	1.950000	-20.000000	1	0.460000	NM_153719			94	90		405	398	1		1	1		0	0	97	0		1.000000	9.999438e-01	0	24	0	39	0	94	405
GSTM5	2949	broad.mit.edu	37	1	110256173	110256173	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:110256173G>A	ENST00000256593.3	+	4	303	c.245G>A	c.(244-246)cGc>cAc	p.R82H	GSTM5_ENST00000369812.5_Missense_Mutation_p.R101H|GSTM5_ENST00000369813.1_Missense_Mutation_p.R41H|GSTM5_ENST00000492718.1_3'UTR	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	82	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	TACATTGCCCGCAAGCACAAC	0.557																																						ENST00000256593.3	1.000000	0	7.000000e-02	2.000000e-02	0.030000	0.119151	0.030000	0.040000																										0				21						c.(244-246)cGc>cAc		glutathione S-transferase mu 5	Glutathione(DB00143)						419.0	300.0	340.0					1																	110256173		2203	4300	6503	SO:0001583	missense	2949	1	121412	44				g.chr1:110256173G>A	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.245G>A	chr1.hg19:g.110256173G>A	ENSP00000256593:p.Arg82His	0					GSTM5_ENST00000369812.5_Missense_Mutation_p.R101H|GSTM5_ENST00000369813.1_Missense_Mutation_p.R41H|GSTM5_ENST00000492718.1_3'UTR	p.R82H	NM_000851.3	NP_000842.2	1	2	3	2.109455	P46439	GSTM5_HUMAN		4	303	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	A8K0V8|Q6PD78	Missense_Mutation	SNP	ENST00000256593.3	0	1	hg19	c.245G>A	CCDS811.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140693	0.77775	.	.	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	T;T;T	0.08634	3.07;3.07;3.07	4.42	3.51	0.40186	4.42	3.51	0.40186	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (1);	0.000000	0.64402	U	0.000001	T	0.20170	0.0485	M	0.90252	3.1	0.45261	D	0.998267	D;D	0.69078	0.997;0.995	D;P	0.65010	0.931;0.866	T	0.02925	-1.1093	10	0.66056	D	0.02	.	9.8076	0.40803	0.0983:0.0:0.9017:0.0	.	41;82	Q5T8Q9;P46439	.;GSTM5_HUMAN	H	82;41;101	ENSP00000256593:R82H;ENSP00000358828:R41H;ENSP00000358827:R101H	ENSP00000256593:R82H	R	+	2	0	0	GSTM5	110057696	110057696	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	4.262000	0.58847	1.211000	0.43351	0.597000	0.82753	CGC	0.472141		TCGA-FB-AAQ2-01A-31D-A40W-08	0.557	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	0	0	1		18	2	2	0		0	1	167		167	166	1	1.950000	-1.827667	0	0.460000	NM_000851			7	7		841	831	0		0	0		0	0	167	0		0.019291	1.446995e-03	0	0	0	6	0	7	841
OR6K3	391114	broad.mit.edu	37	1	158686997	158686997	+	Silent	SNP	C	C	G			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:158686997C>G	ENST00000368146.1	-	1	956	c.957G>C	c.(955-957)ctG>ctC	p.L319L	OR6K3_ENST00000368145.1_Silent_p.L303L			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GAAGACAGAACAGTTTTTTAA	0.388																																						ENST00000368146.1	1.000000	0	8.000000e-02	2.000000e-02	0.040000	0.125653	0.040000	0.040000																										0				41						c.(955-957)ctG>ctC		olfactory receptor, family 6, subfamily K, member 3							125.0	128.0	127.0					1																	158686997		2203	4300	6503	SO:0001819	synonymous_variant	391114	0	0					g.chr1:158686997C>G	AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.957G>C	chr1.hg19:g.158686997C>G		0					OR6K3_ENST00000368145.1_Silent_p.L303L	p.L319L			1	2	3	2.109430	Q8NGY3	OR6K3_HUMAN		1	956	-	all_hematologic(112;0.0378)		Q5VUV0|Q6IFR5	Silent	SNP	ENST00000368146.1	0	1	hg19	c.957G>C		0																																																																																								0.472141		TCGA-FB-AAQ2-01A-31D-A40W-08	0.388	OR6K3-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	107		107	106	1	1.950000	-2.800664	1	0.460000				6	6		629	621	0		1			0	0	107	0		0.963703	0	0	0	0	0	0	6	629
ATP1A2	477	broad.mit.edu	37	1	160098496	160098496	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:160098496A>G	ENST00000361216.3	+	9	1161	c.1072A>G	c.(1072-1074)Aac>Gac	p.N358D	ATP1A2_ENST00000392233.3_Missense_Mutation_p.N358D	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	358					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCTGGTGAAGAACCTGGAGGC	0.587																																						ENST00000361216.3	1.000000	7.000000e-02	2.100000e-01	1.000000e-01	0.140000	0.220792	0.140000	0.140000																										0				69						c.(1072-1074)Aac>Gac		ATPase, Na+/K+ transporting, alpha 2 polypeptide							108.0	96.0	100.0					1																	160098496		2203	4300	6503	SO:0001583	missense	477	0	0					g.chr1:160098496A>G	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1072A>G	chr1.hg19:g.160098496A>G	ENSP00000354490:p.Asn358Asp	0					ATP1A2_ENST00000392233.3_Missense_Mutation_p.N358D	p.N358D	NM_000702.3	NP_000693.1	1	2	3	2.109430	P50993	AT1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)	9	1161	+	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	0	1	hg19	c.1072A>G	CCDS1196.1	0	.	.	.	.	.	.	.	.	.	.	A	29.3	4.994443	0.93167	.	.	ENSG00000018625	ENST00000538123;ENST00000361216;ENST00000392233;ENST00000435866	D;D	0.88896	-2.44;-2.44	4.77	4.77	0.60923	4.77	4.77	0.60923	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	M	0.70903	2.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.93459	0.6809	10	0.87932	D	0	.	13.5914	0.61961	1.0:0.0:0.0:0.0	.	203;358;258;358	B4DHD7;B1AKY9;F5GXJ7;P50993	.;.;.;AT1A2_HUMAN	D	203;358;358;61	ENSP00000354490:N358D;ENSP00000376066:N358D	ENSP00000354490:N358D	N	+	1	0	0	ATP1A2	158365120	158365120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.264000	0.95635	1.912000	0.55364	0.459000	0.35465	AAC	0.472141		TCGA-FB-AAQ2-01A-31D-A40W-08	0.587	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	0	0	1		2	2	2	0		0	0	83		83	82	1	1.950000	-3.611855	1	0.460000	NM_000702			13	13		393	391	0		1			0	0	83	0		0.999535	0	0	0	0	0	0	13	393
ATP1A4	480	broad.mit.edu	37	1	160151577	160151577	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:160151577G>A	ENST00000368081.4	+	19	3311	c.2840G>A	c.(2839-2841)cGc>cAc	p.R947H	ATP1A4_ENST00000418334.1_3'UTR|ATP1A4_ENST00000470705.1_Missense_Mutation_p.R83H	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	947					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAGACTCGCCGCAACTCACTT	0.527																																						ENST00000368081.4	1.000000	3.000000e-02	1.300000e-01	5.000000e-02	0.080000	0.160002	0.080000	0.080000																										0				75						c.(2839-2841)cGc>cAc		ATPase, Na+/K+ transporting, alpha 4 polypeptide							140.0	143.0	142.0					1																	160151577		2203	4300	6503	SO:0001583	missense	480	2	121412	32				g.chr1:160151577G>A	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2840G>A	chr1.hg19:g.160151577G>A	ENSP00000357060:p.Arg947His	0					ATP1A4_ENST00000418334.1_3'UTR|ATP1A4_ENST00000470705.1_Missense_Mutation_p.R83H	p.R947H	NM_144699.3	NP_653300.2	1	2	3	2.109430	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)	19	3311	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	0	1	hg19	c.2840G>A	CCDS1197.1	0	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273977	0.59649	.	.	ENSG00000132681	ENST00000368081;ENST00000470705	D;D	0.89050	-2.46;-2.46	4.16	4.16	0.48862	4.16	4.16	0.48862	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94978	0.8375	M	0.93898	3.47	0.53688	D	0.999979	D	0.89917	1.0	D	0.69824	0.966	D	0.95874	0.8893	10	0.87932	D	0	.	14.3343	0.66578	0.0:0.0:1.0:0.0	.	947	Q13733	AT1A4_HUMAN	H	947;83	ENSP00000357060:R947H;ENSP00000433094:R83H	ENSP00000357060:R947H	R	+	2	0	0	ATP1A4	158418201	158418201	0.992000	0.36948	0.712000	0.30502	0.048000	0.14542	5.550000	0.67268	2.315000	0.78130	0.455000	0.32223	CGC	0.472141		TCGA-FB-AAQ2-01A-31D-A40W-08	0.527	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	0	0	1		2	2	2	0		0	0	74		74	72	1	1.950000	-2.023284	0	0.460000	NM_144699			8	9		454	442	0		1			0	0	74	0		0.988514	0	0	0	0	0	0	8	454
SLC25A33	84275	broad.mit.edu	37	1	9642431	9642431	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:9642431C>T	ENST00000302692.6	+	7	1048	c.838C>T	c.(838-840)Cgg>Tgg	p.R280W		NM_032315.2	NP_115691.1	Q9BSK2	S2533_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier), member 33	280					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|lung(4)|prostate(1)|skin(1)	9	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		CCTGGTGTTCCGGGAAGAAGG	0.488																																						ENST00000302692.6	1.000000	2.000000e-02	1.700000e-01	5.000000e-02	0.090000	0.189462	0.090000	0.070000																										0				9						c.(838-840)Cgg>Tgg		solute carrier family 25 (pyrimidine nucleotide carrier), member 33							80.0	77.0	78.0					1																	9642431		2203	4300	6503	SO:0001583	missense	84275	5	121412	36				g.chr1:9642431C>T	AF495714	CCDS103.1	1p36.22	2013-05-22	2012-03-29		ENSG00000171612	ENSG00000171612		"""Solute carriers"""	29681	protein-coding gene	gene with protein product		610816	"""solute carrier family 25, member 33"""			14715278, 16949250	Standard	XM_005263503		Approved	MGC4399, BMSC-MCP, PNC1	uc001apw.3	Q9BSK2	OTTHUMG00000001322	ENST00000302692.6:c.838C>T	chr1.hg19:g.9642431C>T	ENSP00000306328:p.Arg280Trp	0						p.R280W	NM_032315.2	NP_115691.1	2	2	4	2.140883	Q9BSK2	S2533_HUMAN		7	1048	+	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		Missense_Mutation	SNP	ENST00000302692.6	0	1	hg19	c.838C>T	CCDS103.1	0	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307851	0.60305	.	.	ENSG00000171612	ENST00000302692	T	0.80738	-1.41	5.98	5.98	0.97165	5.98	5.98	0.97165	Mitochondrial carrier domain (2);	0.329961	0.32852	N	0.005573	D	0.86896	0.6043	H	0.95950	3.745	0.47949	D	0.999552	B	0.33413	0.411	B	0.33254	0.16	D	0.88291	0.2943	10	0.87932	D	0	-12.7821	14.3012	0.66355	0.1483:0.8517:0.0:0.0	.	280	Q9BSK2	S2533_HUMAN	W	280	ENSP00000306328:R280W	ENSP00000306328:R280W	R	+	1	2	2	SLC25A33	9565018	9565018	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.812000	0.55628	2.835000	0.97688	0.650000	0.86243	CGG	0.490470		TCGA-FB-AAQ2-01A-31D-A40W-08	0.488	SLC25A33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003851.2	0	0	1		2	2	2	0		0	0	41		41	41	1	1.950000	-2.986550	1	0.460000	NM_032315			4	4		235	230	0		1	0		0	0	41	0		0.886092	3.577612e-01	0	0	0	62	0	4	235
RCC2	55920	broad.mit.edu	37	1	17740096	17740096	+	Missense_Mutation	SNP	G	G	C			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:17740096G>C	ENST00000375436.4	-	9	1331	c.1144C>G	c.(1144-1146)Cct>Gct	p.P382A	AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Missense_Mutation_p.P382A	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	382					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)			breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		CCACGCCCAGGGAAGTCAAAC	0.582																																						ENST00000375436.4	1.000000	1.000000e-02	1.100000e-01	3.000000e-02	0.050000	0.167612	0.050000	0.050000																										0				17						c.(1144-1146)Cct>Gct		regulator of chromosome condensation 2							77.0	80.0	79.0					1																	17740096		2203	4300	6503	SO:0001583	missense	55920	0	0					g.chr1:17740096G>C		CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.1144C>G	chr1.hg19:g.17740096G>C	ENSP00000364585:p.Pro382Ala	1					AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Missense_Mutation_p.P382A	p.P382A	NM_018715.3	NP_061185.1	2	2	4	2.152078	Q9P258	RCC2_HUMAN		9	1331	-		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)	Q8IVL9|Q9BSN6|Q9NPV8	Missense_Mutation	SNP	ENST00000375436.4	0	1	hg19	c.1144C>G	CCDS181.1	0	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877573	0.91664	.	.	ENSG00000179051	ENST00000375436;ENST00000375433	T;T	0.79749	-1.3;-1.3	5.4	5.4	0.78164	5.4	5.4	0.78164	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.83124	0.5186	L	0.35341	1.055	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76342	-0.2994	10	0.07482	T	0.82	-25.2313	18.1015	0.89507	0.0:0.0:1.0:0.0	.	382	Q9P258	RCC2_HUMAN	A	382	ENSP00000364585:P382A;ENSP00000364582:P382A	ENSP00000364582:P382A	P	-	1	0	0	RCC2	17612683	17612683	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	9.831000	0.99420	2.687000	0.91594	0.655000	0.94253	CCT	0.492672		TCGA-FB-AAQ2-01A-31D-A40W-08	0.582	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	0	0	1		21	11	2	1		1	1	79		79	79	1	1.950000	-2.877995	1	0.460000	NM_018715			6	6		505	497	0		0	0		1	0	79	0		0.002262	3.271760e-03	0	0	0	224	0	6	505
SSBP3	23648	broad.mit.edu	37	1	54708959	54708959	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:54708959C>T	ENST00000371320.3	-	10	1075	c.665G>A	c.(664-666)gGc>gAc	p.G222D	SSBP3_ENST00000357475.4_Missense_Mutation_p.G202D|SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000371319.3_Missense_Mutation_p.G195D|SSBP3_ENST00000417664.2_Missense_Mutation_p.G112D	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	222	Gly-rich.|Pro-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						TGGTCTCATGCCGCTGCCGTA	0.562																																						ENST00000371320.3			0	0																														0				11						c.(664-666)gGc>gAc		single stranded DNA binding protein 3							145.0	153.0	150.0					1																	54708959		2203	4300	6503	SO:0001583	missense	23648	0	0					g.chr1:54708959C>T		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.665G>A	chr1.hg19:g.54708959C>T	ENSP00000360371:p.Gly222Asp						SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000357475.4_Missense_Mutation_p.G202D|SSBP3_ENST00000371319.3_Missense_Mutation_p.G195D|SSBP3_ENST00000417664.2_Missense_Mutation_p.G112D	p.G222D	NM_145716.2	NP_663768.1					Q9BWW4	SSBP3_HUMAN		10	1075	-			A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	0	1	hg19	c.665G>A	CCDS591.1		.	.	.	.	.	.	.	.	.	.	c	25.8	4.676502	0.88445	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475;ENST00000444533;ENST00000525990	.	.	.	3.94	3.94	0.45596	3.94	3.94	0.45596	.	0.000000	0.85682	U	0.000000	T	0.78717	0.4327	M	0.75085	2.285	0.80722	D	1	D;P;P	0.89917	1.0;0.951;0.866	D;P;P	0.97110	1.0;0.743;0.686	T	0.81534	-0.0889	9	0.59425	D	0.04	-1.6526	17.3039	0.87189	0.0:1.0:0.0:0.0	.	195;202;222	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	D	112;222;195;202;53;85	.	ENSP00000350067:G202D	G	-	2	0	0	SSBP3	54481547	54481547	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.969000	0.76092	2.493000	0.84123	0.479000	0.44913	GGC			TCGA-FB-AAQ2-01A-31D-A40W-08	0.562	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	0	0	1		2	2	2	0		0	0	154		154	150	1	1.950000	-1.724745	0	0.460000	NM_018070			7	5		1099	1064	0		1	0		0	0	154	0		0.978091	2.299315e-01	0	0	0	125	0	7	1099
LRRIQ3	127255	broad.mit.edu	37	1	74507071	74507071	+	Missense_Mutation	SNP	C	C	T	rs534493116	byFrequency	TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:74507071C>T	ENST00000395089.1	-	6	1543	c.1544G>A	c.(1543-1545)cGt>cAt	p.R515H	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.R515H			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	515								p.R515H(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						AACTAATAAACGCTCTGAAGC	0.363													C|||	2	0.000399361	0.0	0.0029	5008	,	,		15266	0.0		0.0	False		,,,				2504	0.0					ENST00000395089.1	1.000000	6.700000e-01	9.100000e-01	7.300000e-01	0.810000	0.825143	0.810000	0.800000																										1	Substitution - Missense(1)	p.R515H(1)	large_intestine(1)	73						c.(1543-1545)cGt>cAt		leucine-rich repeats and IQ motif containing 3							102.0	100.0	101.0					1																	74507071		1797	4070	5867	SO:0001583	missense	127255	32	120766	47				g.chr1:74507071C>T	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1544G>A	chr1.hg19:g.74507071C>T	ENSP00000378524:p.Arg515His	0					LRRIQ3_ENST00000354431.4_Missense_Mutation_p.R515H	p.R515H			1	2	3	2.109455	A6PVS8	LRIQ3_HUMAN		6	1543	-			A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	1	1	hg19	c.1544G>A	CCDS41350.1	0	.	.	.	.	.	.	.	.	.	.	C	6.084	0.383714	0.11524	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.10382	2.88;2.88	5.86	2.52	0.30459	5.86	2.52	0.30459	.	.	.	.	.	T	0.02047	0.0064	L	0.29908	0.895	0.09310	N	1	B	0.34255	0.445	B	0.20184	0.028	T	0.44452	-0.9327	9	0.35671	T	0.21	.	8.4238	0.32716	0.0:0.7631:0.0:0.2369	.	515	A6PVS8	LRIQ3_HUMAN	H	515	ENSP00000378524:R515H;ENSP00000346414:R515H	ENSP00000346414:R515H	R	-	2	0	0	LRRIQ3	74279659	74279659	0.273000	0.24181	0.016000	0.15963	0.029000	0.11900	0.609000	0.24238	0.295000	0.22570	0.650000	0.86243	CGT	0.472141		TCGA-FB-AAQ2-01A-31D-A40W-08	0.363	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	1	0	1		2	2	2	0		0	0	119		119	118	1	1.950000	-20.000000	1	0.460000	NM_145258			109	108		492	486	1		1			0	0	119	0		1.000000	0	0	0	0	0	0	109	492
ASTN1	460	broad.mit.edu	37	1	176845741	176845741	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr1:176845741C>T	ENST00000367654.3	-	21	3630	c.3419G>A	c.(3418-3420)cGg>cAg	p.R1140Q	ASTN1_ENST00000424564.2_Missense_Mutation_p.R1132Q|ASTN1_ENST00000361833.2_Missense_Mutation_p.R1132Q|ASTN1_ENST00000367657.3_Missense_Mutation_p.R1132Q	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1140	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R1132L(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCTGGAGCGCCGTCCTGTGTT	0.572																																						ENST00000367654.3	1.000000	7.700000e-01	1	8.900000e-01	0.990000	0.960936	0.990000	1.000000																										1	Substitution - Missense(1)	p.R1132L(1)	lung(1)	153						c.(3418-3420)cGg>cAg		astrotactin 1							118.0	89.0	99.0					1																	176845741		2203	4300	6503	SO:0001583	missense	460	1	121412	32				g.chr1:176845741C>T	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3419G>A	chr1.hg19:g.176845741C>T	ENSP00000356626:p.Arg1140Gln	0					ASTN1_ENST00000367657.3_Missense_Mutation_p.R1132Q|ASTN1_ENST00000361833.2_Missense_Mutation_p.R1132Q|ASTN1_ENST00000424564.2_Missense_Mutation_p.R1132Q	p.R1140Q	NM_004319.1	NP_004310.1	1	2	3	2.109430	O14525	ASTN1_HUMAN		21	3630	-			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	1	1	hg19	c.3419G>A		1	.	.	.	.	.	.	.	.	.	.	C	36	5.786407	0.96937	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.16196	2.36;2.78;2.78;2.36	5.19	5.19	0.71726	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	L	0.53249	1.67	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.986	T	0.16041	-1.0416	10	0.72032	D	0.01	-17.3769	18.3051	0.90177	0.0:1.0:0.0:0.0	.	1132;1132	O14525-2;B1AJS1	.;.	Q	1132;1132;1140;1132;1132	ENSP00000356629:R1132Q;ENSP00000354536:R1132Q;ENSP00000356626:R1140Q;ENSP00000395041:R1132Q	ENSP00000354536:R1132Q	R	-	2	0	0	ASTN1	175112364	175112364	1.000000	0.71417	0.994000	0.49952	0.962000	0.63368	7.390000	0.79816	2.400000	0.81607	0.655000	0.94253	CGG	0.472141		TCGA-FB-AAQ2-01A-31D-A40W-08	0.572	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	39		39	39	1	1.950000	-3.665143	1	0.460000	NM_004319			43	42		145	142	1		1	0		0	0	39	0		1.000000	5.456048e-02	0	0	0	2	0	43	145
ZNF831	128611	broad.mit.edu	37	20	57769239	57769239	+	Silent	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr20:57769239G>A	ENST00000371030.2	+	1	3165	c.3165G>A	c.(3163-3165)ccG>ccA	p.P1055P		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1055							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCTCCTCCCCGCCCACTCCAA	0.647																																						ENST00000371030.2	1.000000	1.700000e-01	5.300000e-01	2.500000e-01	0.370000	0.409922	0.370000	0.350000																										0				125						c.(3163-3165)ccG>ccA		zinc finger protein 831							24.0	29.0	27.0					20																	57769239		2073	4218	6291	SO:0001819	synonymous_variant	128611	1	120994	26				g.chr20:57769239G>A	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3165G>A	chr20.hg19:g.57769239G>A		0						p.P1055P	NM_178457.1	NP_848552.1	1	2	3	2.073867	Q5JPB2	ZN831_HUMAN		1	3165	+	all_lung(29;0.0085)		Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	0	1	hg19	c.3165G>A	CCDS42894.1	0																																																																																								0.467351		TCGA-FB-AAQ2-01A-31D-A40W-08	0.647	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	1	0	1		2	2	2	0		0	0	19		19	17	1	1.950000	-3.144579	1	0.460000	NM_178457			8	8		93	87	0		1			0	0	19	0		0.987580	0	0	0	0	0	0	8	93
TPO	7173	broad.mit.edu	37	2	1426896	1426896	+	Missense_Mutation	SNP	G	G	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr2:1426896G>T	ENST00000345913.4	+	3	265	c.174G>T	c.(172-174)atG>atT	p.M58I	TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.M58I|TPO_ENST00000382269.3_Missense_Mutation_p.M58I|TPO_ENST00000539820.1_Missense_Mutation_p.M58I|TPO_ENST00000382201.3_Missense_Mutation_p.M58I|TPO_ENST00000337415.3_Missense_Mutation_p.M58I|TPO_ENST00000382198.1_Missense_Mutation_p.M58I|TPO_ENST00000329066.4_Missense_Mutation_p.M58I|TPO_ENST00000349624.3_Missense_Mutation_p.M58I	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	58					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACGCCACGATGCAGAGGTGAG	0.597																																						ENST00000345913.4	1.000000	6.500000e-01	1	7.700000e-01	0.910000	0.898491	0.910000	1.000000																										0				95						c.(172-174)atG>atT		thyroid peroxidase	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)						69.0	60.0	63.0					2																	1426896		2203	4300	6503	SO:0001583	missense	7173	0	0					g.chr2:1426896G>T		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.174G>T	chr2.hg19:g.1426896G>T	ENSP00000318820:p.Met58Ile	0					TPO_ENST00000382201.3_Missense_Mutation_p.M58I|TPO_ENST00000382269.3_Missense_Mutation_p.M58I|TPO_ENST00000539820.1_Missense_Mutation_p.M58I|TPO_ENST00000382198.1_Missense_Mutation_p.M58I|TPO_ENST00000337415.3_Missense_Mutation_p.M58I|TPO_ENST00000329066.4_Missense_Mutation_p.M58I|TPO_ENST00000349624.3_Missense_Mutation_p.M58I|TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.M58I	p.M58I	NM_000547.5	NP_000538.3	1	2	3	2.077827	P07202	PERT_HUMAN		3	265	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	1	1	hg19	c.174G>T	CCDS1643.1	1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.377425	0.24944	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198	T;T;T;T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44	3.72	3.72	0.42706	3.72	3.72	0.42706	.	0.282519	0.34652	N	0.003786	T	0.40909	0.1136	L	0.50919	1.6	0.09310	N	1	B;B;B;B;B	0.33807	0.008;0.426;0.264;0.008;0.006	B;B;B;B;B	0.25405	0.007;0.06;0.033;0.007;0.004	T	0.30563	-0.9974	10	0.29301	T	0.29	-29.3298	11.2868	0.49226	0.0:0.0:1.0:0.0	.	58;58;58;58;58	P07202-4;P07202-5;E9PFM6;P07202-2;P07202	.;.;.;.;PERT_HUMAN	I	58	ENSP00000371704:M58I;ENSP00000337263:M58I;ENSP00000318820:M58I;ENSP00000263886:M58I;ENSP00000332044:M58I;ENSP00000444840:M58I;ENSP00000329869:M58I;ENSP00000371636:M58I;ENSP00000390994:M58I;ENSP00000371633:M58I	ENSP00000329869:M58I	M	+	3	0	0	TPO	1405903	1405903	0.251000	0.23961	0.039000	0.18376	0.038000	0.13279	1.497000	0.35649	2.347000	0.79759	0.467000	0.42956	ATG	0.467351		TCGA-FB-AAQ2-01A-31D-A40W-08	0.597	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	1	0	1		2	2	2	0		0	0	24		24	24	1	1.950000	-20.000000	1	0.460000	NM_000547			31	31		119	118	1		1	0		0	0	24	0		1.000000	0	0	0	0	1	0	31	119
NPHP1	4867	broad.mit.edu	37	2	110922260	110922260	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr2:110922260C>T	ENST00000393272.3	-	8	873	c.776G>A	c.(775-777)gGc>gAc	p.G259D	NPHP1_ENST00000316534.4_Missense_Mutation_p.G259D|NPHP1_ENST00000445609.2_Intron|NPHP1_ENST00000355301.4_Intron|NPHP1_ENST00000417665.1_Intron	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	259					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						ACAGAAGATGCCCGCCTCTGA	0.458																																						ENST00000393272.3	1.000000	0	6.000000e-02	1.000000e-02	0.030000	0.085496	0.030000	0.040000																										0				24						c.(775-777)gGc>gAc		nephronophthisis 1 (juvenile)							124.0	133.0	130.0					2																	110922260		2203	4300	6503	SO:0001583	missense	4867	0	0					g.chr2:110922260C>T	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.776G>A	chr2.hg19:g.110922260C>T	ENSP00000376953:p.Gly259Asp	0					NPHP1_ENST00000445609.2_Intron|NPHP1_ENST00000355301.4_Intron|NPHP1_ENST00000417665.1_Intron|NPHP1_ENST00000316534.4_Missense_Mutation_p.G259D	p.G259D	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	1	2	3	2.077827	O15259	NPHP1_HUMAN		8	873	-			O14837	Missense_Mutation	SNP	ENST00000393272.3	0	1	hg19	c.776G>A	CCDS46385.1	0	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102886	0.20632	.	.	ENSG00000144061	ENST00000316534;ENST00000393272	T;T	0.64438	-0.1;-0.06	4.59	3.72	0.42706	4.59	3.72	0.42706	.	0.678739	0.14107	N	0.341008	T	0.49321	0.1550	N	0.22421	0.69	0.19300	N	0.99997	P;P	0.44946	0.761;0.846	B;B	0.43194	0.234;0.411	T	0.39333	-0.9619	10	0.66056	D	0.02	-3.7449	8.7413	0.34558	0.0:0.8968:0.0:0.1032	.	259;259	O15259;O15259-4	NPHP1_HUMAN;.	D	259	ENSP00000313169:G259D;ENSP00000376953:G259D	ENSP00000313169:G259D	G	-	2	0	0	NPHP1	110279549	110279549	0.009000	0.17119	0.004000	0.12327	0.017000	0.09413	1.848000	0.39309	1.180000	0.42898	-0.219000	0.12488	GGC	0.467351		TCGA-FB-AAQ2-01A-31D-A40W-08	0.458	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	0	0	1		2	2	2	0		0	0	139		139	124	1	1.950000	-1.801325	0	0.460000	NM_000272			6	6		747	669	0		1	0		0	0	139	0		0.951448	0	0	0	0	1	0	6	747
LTBP1	4052	broad.mit.edu	37	2	33572565	33572565	+	Missense_Mutation	SNP	C	C	T	rs144093447		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr2:33572565C>T	ENST00000404816.2	+	26	4341	c.3988C>T	c.(3988-3990)Cgg>Tgg	p.R1330W	LTBP1_ENST00000354476.3_Missense_Mutation_p.R1331W|LTBP1_ENST00000390003.4_Missense_Mutation_p.R1005W|LTBP1_ENST00000402934.1_Missense_Mutation_p.R951W|LTBP1_ENST00000272273.5_Missense_Mutation_p.R228W|LTBP1_ENST00000418533.2_Missense_Mutation_p.R962W|LTBP1_ENST00000404525.1_Missense_Mutation_p.R951W|LTBP1_ENST00000407925.1_Missense_Mutation_p.R1004W			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1330					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.R1331R(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GTGCCGCTCCCGGACCTCCAC	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		21170	0.0		0.0	False		,,,				2504	0.001					ENST00000404816.2	1.000000	3.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.144900	0.090000	0.090000																										1	Substitution - coding silent(1)	p.R1331R(1)	lung(1)	108						c.(3988-3990)Cgg>Tgg		latent transforming growth factor beta binding protein 1		C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1,4405		0,1,2202	168.0	158.0	161.0		3010,2884,2851,2725,3988	5.2	0.5	2	dbSNP_134	161	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	LTBP1	NM_000627.3,NM_001166264.1,NM_001166265.1,NM_001166266.1,NM_206943.2	101,101,101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1004/1396,962/1354,951/1343,909/1301,1330/1722	33572565	1,13005	2203	4300	6503	SO:0001583	missense	4052	8	121412	43				g.chr2:33572565C>T		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3988C>T	chr2.hg19:g.33572565C>T	ENSP00000386043:p.Arg1330Trp	0					LTBP1_ENST00000272273.5_Missense_Mutation_p.R228W|LTBP1_ENST00000407925.1_Missense_Mutation_p.R1004W|LTBP1_ENST00000390003.4_Missense_Mutation_p.R1005W|LTBP1_ENST00000404525.1_Missense_Mutation_p.R951W|LTBP1_ENST00000402934.1_Missense_Mutation_p.R951W|LTBP1_ENST00000354476.3_Missense_Mutation_p.R1331W|LTBP1_ENST00000418533.2_Missense_Mutation_p.R962W	p.R1330W			1	2	3	2.077827	Q14766	LTBP1_HUMAN		26	4341	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	0	1	hg19	c.3988C>T	CCDS33177.2	0	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788854	0.90367	2.27E-4	0.0	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273;ENST00000422669	D;D;T;T;T;T;T;D;D	0.85339	-1.53;-1.52;-1.46;-1.41;-1.45;-1.42;-1.42;-1.97;-1.61	5.19	5.19	0.71726	5.19	5.19	0.71726	.	.	.	.	.	D	0.90896	0.7139	L	0.55213	1.73	0.53005	D	0.999965	D;D;D;D;D;D;D	0.89917	0.998;0.998;1.0;0.972;0.971;0.987;0.999	P;P;D;P;P;P;P	0.75484	0.895;0.794;0.986;0.742;0.685;0.768;0.899	D	0.91362	0.5112	9	0.66056	D	0.02	.	19.0846	0.93198	0.0:1.0:0.0:0.0	.	228;1330;962;951;1004;1005;1331	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	.;LTBP1_HUMAN;.;.;.;.;.	W	1330;1331;1005;962;951;951;1004;228;166	ENSP00000386043:R1330W;ENSP00000346467:R1331W;ENSP00000374653:R1005W;ENSP00000393057:R962W;ENSP00000384373:R951W;ENSP00000385359:R951W;ENSP00000384091:R1004W;ENSP00000272273:R228W;ENSP00000395211:R166W	ENSP00000272273:R228W	R	+	1	2	2	LTBP1	33426069	33426069	0.493000	0.26035	0.536000	0.28039	0.799000	0.45148	2.319000	0.43788	2.594000	0.87642	0.561000	0.74099	CGG	0.467351		TCGA-FB-AAQ2-01A-31D-A40W-08	0.557	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	0	0	1		23	7	2	1		1	1	44		44	42	1	1.950000	-2.360295	0	0.460000	NM_206943			7	7		333	328	0		0	0		1	0	44	0		0.001795	4.187404e-03	0	1	0	70	0	7	333
ZNF385B	151126	broad.mit.edu	37	2	180308122	180308122	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr2:180308122G>A	ENST00000410066.1	-	10	1874	c.1271C>T	c.(1270-1272)gCg>gTg	p.A424V	ZNF385B_ENST00000336917.5_Missense_Mutation_p.A322V|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409343.1_Missense_Mutation_p.A348V|ZNF385B_ENST00000409692.1_Missense_Mutation_p.A322V	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	424	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CACGGCTGCCGCCGCTGCGAG	0.607																																					Colon(155;204 2491 32774 51842)	ENST00000410066.1	1.000000	5.800000e-01	1	7.400000e-01	0.920000	0.888388	0.920000	1.000000																										0				26						c.(1270-1272)gCg>gTg		zinc finger protein 385B							23.0	32.0	29.0					2																	180308122		2202	4300	6502	SO:0001583	missense	151126	0	0					g.chr2:180308122G>A	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1271C>T	chr2.hg19:g.180308122G>A	ENSP00000386845:p.Ala424Val	0					ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409692.1_Missense_Mutation_p.A322V|ZNF385B_ENST00000409343.1_Missense_Mutation_p.A348V|ZNF385B_ENST00000336917.5_Missense_Mutation_p.A322V	p.A424V	NM_152520.4	NP_689733.3	1	2	3	2.077827	Q569K4	Z385B_HUMAN	Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)	10	1874	-			Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	ENST00000410066.1	1	1	hg19	c.1271C>T	CCDS33339.1	1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998461	0.54147	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692	T;T;T;T	0.35973	1.28;1.3;1.28;1.3	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.257134	0.40728	N	0.001021	T	0.47248	0.1435	L	0.39147	1.195	0.58432	D	0.999999	D;D	0.65815	0.995;0.976	P;P	0.54815	0.761;0.488	T	0.43442	-0.9391	10	0.62326	D	0.03	-20.3691	19.3766	0.94512	0.0:0.0:1.0:0.0	.	424;348	Q569K4;Q569K4-2	Z385B_HUMAN;.	V	424;322;348;322	ENSP00000386845:A424V;ENSP00000338225:A322V;ENSP00000386379:A348V;ENSP00000386507:A322V	ENSP00000338225:A322V	A	-	2	0	0	ZNF385B	180016367	180016367	1.000000	0.71417	0.160000	0.22671	0.013000	0.08279	7.203000	0.77864	2.565000	0.86533	0.561000	0.74099	GCG	0.467351		TCGA-FB-AAQ2-01A-31D-A40W-08	0.607	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	1	0	1		2	2	2	0		0	0	21		21	20	1	1.950000	-20.000000	1	0.460000	NM_152520			18	18		69	67	1		1	0		0	0	21	0		0.999990	0	0	0	0	1	0	18	69
KALRN	8997	broad.mit.edu	37	3	123813705	123813705	+	Missense_Mutation	SNP	C	C	G			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr3:123813705C>G	ENST00000240874.3	+	1	178	c.21C>G	c.(19-21)gaC>gaG	p.D7E	KALRN_ENST00000360013.3_Missense_Mutation_p.D7E|KALRN_ENST00000460856.1_Missense_Mutation_p.D7E|KALRN_ENST00000477496.1_3'UTR	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	7					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GCTTCTGGGACCAGTGGTATC	0.557																																						ENST00000240874.3	1.000000	7.200000e-01	1	8.300000e-01	0.960000	0.933336	0.960000	1.000000																										0				83						c.(19-21)gaC>gaG		kalirin, RhoGEF kinase							188.0	135.0	153.0					3																	123813705		2203	4300	6503	SO:0001583	missense	8997	0	0					g.chr3:123813705C>G	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.21C>G	chr3.hg19:g.123813705C>G	ENSP00000240874:p.Asp7Glu	0					KALRN_ENST00000460856.1_Missense_Mutation_p.D7E|KALRN_ENST00000477496.1_3'UTR|KALRN_ENST00000360013.3_Missense_Mutation_p.D7E	p.D7E	NM_003947.4	NP_003938.1	1	2	3	2.068481	O60229	KALRN_HUMAN		1	178	+			A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	1	1	hg19	c.21C>G	CCDS3027.1	1	.	.	.	.	.	.	.	.	.	.	c	14.72	2.619680	0.46736	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.59772	0.78;0.71;0.24	3.7	2.81	0.32909	3.7	2.81	0.32909	.	0.724489	0.11133	U	0.596093	T	0.40767	0.1130	N	0.08118	0	0.80722	D	1	P;P;P	0.41597	0.643;0.643;0.756	B;B;P	0.49752	0.417;0.417;0.621	T	0.31558	-0.9939	10	0.02654	T	1	.	8.5829	0.33640	0.2295:0.7705:0.0:0.0	.	7;7;7	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	E	7	ENSP00000418611:D7E;ENSP00000240874:D7E;ENSP00000353109:D7E	ENSP00000240874:D7E	D	+	3	2	2	KALRN	125296395	125296395	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.530000	0.23036	1.118000	0.41863	0.486000	0.48141	GAC	0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.557	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	0	0	1		18	2	2	1		1	1	36		36	36	1	1.950000	-20.000000	1	0.460000	NM_003947			46	45		165	164	1		1		1	1	0	36	332		0.999958	0	1	0	89	0	339	46	165
SETD5	55209	broad.mit.edu	37	3	9506122	9506122	+	Silent	SNP	A	A	G			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr3:9506122A>G	ENST00000406341.1	+	17	2680	c.2490A>G	c.(2488-2490)ccA>ccG	p.P830P	SETD5_ENST00000402466.1_Silent_p.P732P|SETD5_ENST00000402198.1_Silent_p.P830P|SETD5_ENST00000302463.6_Silent_p.P732P|SETD5_ENST00000488236.1_3'UTR|SETD5_ENST00000407969.1_Silent_p.P849P			Q9C0A6	SETD5_HUMAN	SET domain containing 5	830										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TGTTGAGCCCATTAAAGAAAT	0.428																																						ENST00000406341.1	1.000000	9.100000e-01	1	9.700000e-01	0.990000	0.990642	0.990000	1.000000																										0				47						c.(2488-2490)ccA>ccG		SET domain containing 5							158.0	152.0	154.0					3																	9506122		1908	4129	6037	SO:0001819	synonymous_variant	55209	0	0					g.chr3:9506122A>G	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2490A>G	chr3.hg19:g.9506122A>G		0					SETD5_ENST00000402466.1_Silent_p.P732P|SETD5_ENST00000402198.1_Silent_p.P830P|SETD5_ENST00000302463.6_Silent_p.P732P|SETD5_ENST00000488236.1_3'UTR|SETD5_ENST00000407969.1_Silent_p.P849P	p.P830P			1	2	3	2.063797	Q9C0A6	SETD5_HUMAN		17	2680	+	Medulloblastoma(99;0.227)		Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	1	1	hg19	c.2490A>G	CCDS46741.1	1	.	.	.	.	.	.	.	.	.	.	A	10.07	1.249061	0.22880	.	.	ENSG00000168137	ENST00000399686;ENST00000421188	.	.	.	5.78	3.28	0.37604	5.78	3.28	0.37604	.	.	.	.	.	T	0.54464	0.1860	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45381	-0.9265	4	.	.	.	-10.4749	5.9389	0.19181	0.4756:0.1792:0.0:0.3452	.	.	.	.	V	498;142	.	.	I	+	1	0	0	SETD5	9481122	9481122	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.507000	0.22675	0.386000	0.24997	0.533000	0.62120	ATT	0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.428	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	1	0	1		2	2	2	0		0	0	146		146	144	1	1.950000	-20.000000	1	0.460000	XM_371614			198	196		638	629	1		1	1		0	0	146	0		1.000000	9.999202e-01	0	20	0	26	0	198	638
RASA2	5922	broad.mit.edu	37	3	141292025	141292025	+	Missense_Mutation	SNP	A	A	G			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr3:141292025A>G	ENST00000452898.1	+	13	1356	c.1321A>G	c.(1321-1323)Att>Gtt	p.I441V	RASA2_ENST00000286364.3_Missense_Mutation_p.I441V	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	441	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						AATCGATCCTATTAAATTGAA	0.264																																						ENST00000452898.1	1.000000	6.900000e-01	1	7.800000e-01	0.890000	0.892065	0.890000	1.000000																										0				34						c.(1321-1323)Att>Gtt		RAS p21 protein activator 2							26.0	30.0	29.0					3																	141292025		2182	4275	6457	SO:0001583	missense	5922	0	0					g.chr3:141292025A>G	AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.1321A>G	chr3.hg19:g.141292025A>G	ENSP00000391677:p.Ile441Val	0					RASA2_ENST00000286364.3_Missense_Mutation_p.I441V	p.I441V	NM_006506.2	NP_006497.2	1	2	3	2.068481	Q15283	RASA2_HUMAN		13	1356	+			A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Missense_Mutation	SNP	ENST00000452898.1	1	1	hg19	c.1321A>G		1	.	.	.	.	.	.	.	.	.	.	A	1.433	-0.569702	0.03910	.	.	ENSG00000155903	ENST00000286364;ENST00000452898;ENST00000423660	T;T	0.79141	-1.24;-1.24	5.48	2.98	0.34508	5.48	2.98	0.34508	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.209202	0.42682	N	0.000671	T	0.51398	0.1672	N	0.03194	-0.395	0.29030	N	0.885756	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.15484	0.013;0.006;0.003;0.006	T	0.42716	-0.9435	10	0.25106	T	0.35	.	7.8427	0.29408	0.692:0.2346:0.0734:0.0	.	33;441;441;441	E7EU60;A8K7K1;G3V0F9;Q15283	.;.;.;RASA2_HUMAN	V	441;441;33	ENSP00000286364:I441V;ENSP00000391677:I441V	ENSP00000286364:I441V	I	+	1	0	0	RASA2	142774715	142774715	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.229000	0.42990	1.041000	0.40125	0.533000	0.62120	ATT	0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.264	RASA2-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	79		79	79	1	1.950000	-20.000000	1	0.460000	NM_006506			54	54		212	210	1		1	1		0	0	79	0		1.000000	9.420178e-01	0	9	0	12	0	54	212
PROL1	58503	broad.mit.edu	37	4	71275677	71275677	+	Missense_Mutation	SNP	G	G	A	rs369329579		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr4:71275677G>A	ENST00000399575.2	+	3	806	c.632G>A	c.(631-633)cGt>cAt	p.R211H		NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	211	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				CTCGCCAACCGTCCTCACACA	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		18744	0.0		0.0	False		,,,				2504	0.001					ENST00000399575.2	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.066713	0.050000	0.060000																										0				15						c.(631-633)cGt>cAt		proline rich, lacrimal 1		C	HIS/ARG	0,4052		0,0,2026	115.0	119.0	118.0		632	1.3	0.0	4		118	2,8366		0,2,4182	no	missense	PROL1	NM_021225.4	29	0,2,6208	AA,AG,GG		0.0239,0.0,0.0161	benign	211/249	71275677	2,12418	2026	4184	6210	SO:0001583	missense	58503	17	121002	45				g.chr4:71275677G>A	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.632G>A	chr4.hg19:g.71275677G>A	ENSP00000382485:p.Arg211His	1						p.R211H	NM_021225.4	NP_067048.4	0	1	1	1.895516	Q99935	PROL1_HUMAN		3	806	+		all_hematologic(202;0.196)	A8MZ07|P85047	Missense_Mutation	SNP	ENST00000399575.2	0	1	hg19	c.632G>A	CCDS43235.1	0	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361243	0.41801	0.0	2.39E-4	ENSG00000171199	ENST00000399575	T	0.42131	0.98	3.08	1.33	0.21861	3.08	1.33	0.21861	.	.	.	.	.	T	0.18718	0.0449	N	0.08118	0	0.09310	N	1	B	0.24368	0.102	B	0.08055	0.003	T	0.15206	-1.0445	9	0.44086	T	0.13	.	3.3539	0.07162	0.0:0.5226:0.2206:0.2569	.	211	Q99935	PROL1_HUMAN	H	211	ENSP00000382485:R211H	ENSP00000382485:R211H	R	+	2	0	0	PROL1	71310266	71310266	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	-0.417000	0.07088	0.045000	0.15804	-0.187000	0.12897	CGT	0.409772		TCGA-FB-AAQ2-01A-31D-A40W-08	0.448	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	0	0	1		2	2	2	0		0	0	64		64	62	1	1.950000	-2.486083	0	0.460000	NM_021225			6	6		408	402	0		1			0	0	64	0		0.963628	0	0	0	0	0	0	6	408
DSPP	1834	broad.mit.edu	37	4	88534264	88534264	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr4:88534264G>A	ENST00000282478.7	+	3	959	c.926G>A	c.(925-927)gGc>gAc	p.G309D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.G309D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	309					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GACCCTGAAGGCAAAGAAGAT	0.438																																						ENST00000282478.7	0.270000	4.000000e-02	2.000000e-01	7.000000e-02	0.120000	0.142610	0.120000	0.120000																										0				47						c.(925-927)gGc>gAc		dentin sialophosphoprotein							65.0	67.0	67.0					4																	88534264		1896	4111	6007	SO:0001583	missense	1834	0	0					g.chr4:88534264G>A	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.926G>A	chr4.hg19:g.88534264G>A	ENSP00000282478:p.Gly309Asp	1					DSPP_ENST00000399271.1_Missense_Mutation_p.G309D|RP11-742B18.1_ENST00000506480.1_RNA	p.G309D			0	1	1	1.895516	Q9NZW4	DSPP_HUMAN		3	959	+		Hepatocellular(203;0.114)|all_hematologic(202;0.236)	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	0	1	hg19	c.926G>A	CCDS43248.1	0	.	.	.	.	.	.	.	.	.	.	G	5.743	0.321511	0.10845	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87809	-2.3;-2.3	4.54	-3.71	0.04424	4.54	-3.71	0.04424	.	.	.	.	.	T	0.74898	0.3777	L	0.34521	1.04	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.59721	-0.7401	9	0.05959	T	0.93	1.6285	10.5668	0.45177	0.2505:0.1385:0.6109:0.0	.	309	Q9NZW4	DSPP_HUMAN	D	309	ENSP00000382213:G309D;ENSP00000282478:G309D	ENSP00000282478:G309D	G	+	2	0	0	DSPP	88753288	88753288	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-0.014000	0.12656	-0.930000	0.03752	-0.484000	0.04775	GGC	0.409772		TCGA-FB-AAQ2-01A-31D-A40W-08	0.438	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	0	0	1		2	2	2	0		0	0	18		18	18	1	1.950000	-3.535246	1	0.460000	NM_014208			4	4		132	132	0		1			0	0	18	0		0.891506	0	0	0	0	0	0	4	132
TET2	54790	broad.mit.edu	37	4	106155430	106155430	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr4:106155430A>T	ENST00000540549.1	+	3	1191	c.331A>T	c.(331-333)Aaa>Taa	p.K111*	TET2_ENST00000545826.1_Nonsense_Mutation_p.K111*|TET2_ENST00000394764.1_Nonsense_Mutation_p.K111*|TET2_ENST00000380013.4_Nonsense_Mutation_p.K111*|TET2_ENST00000513237.1_Nonsense_Mutation_p.K132*|TET2_ENST00000413648.2_Nonsense_Mutation_p.K111*|TET2_ENST00000305737.2_Nonsense_Mutation_p.K111*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	111					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.L107fs*8(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCAGATCAAGAAATTGAAACA	0.413			"""Mis N, F"""		MDS																																	ENST00000540549.1	0.200000	3.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.109863	0.090000	0.100000				Rec	yes			Rec	yes		4	4q24	4q24	54790	Mis N, F	tet oncogene family member 2				L	L			MDS		1	Deletion - Frameshift(1)	p.L107fs*8(1)	haematopoietic_and_lymphoid_tissue(1)	1314						c.(331-333)Aaa>Taa		tet methylcytosine dioxygenase 2							61.0	59.0	60.0					4																	106155430		2203	4300	6503	SO:0001587	stop_gained	54790	0	0					g.chr4:106155430A>T	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.331A>T	chr4.hg19:g.106155430A>T	ENSP00000442788:p.Lys111*	1					TET2_ENST00000380013.4_Nonsense_Mutation_p.K111*|TET2_ENST00000413648.2_Nonsense_Mutation_p.K111*|TET2_ENST00000305737.2_Nonsense_Mutation_p.K111*|TET2_ENST00000513237.1_Nonsense_Mutation_p.K132*|TET2_ENST00000394764.1_Nonsense_Mutation_p.K111*|TET2_ENST00000545826.1_Nonsense_Mutation_p.K111*	p.K111*			0	1	1	1.895516	Q6N021	TET2_HUMAN		3	1191	+		Myeloproliferative disorder(5;0.0393)	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	ENST00000540549.1	0	1	hg19	c.331A>T	CCDS47120.1	0	.	.	.	.	.	.	.	.	.	.	A	35	5.499172	0.96355	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	.	.	.	5.51	5.51	0.81932	5.51	5.51	0.81932	.	0.464604	0.16713	N	0.202570	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6604	0.77182	1.0:0.0:0.0:0.0	.	.	.	.	X	111;111;111;132;111;111;111;111	.	ENSP00000265149:K111X	K	+	1	0	0	TET2	106374879	106374879	1.000000	0.71417	0.891000	0.34965	0.970000	0.65996	6.405000	0.73272	2.095000	0.63458	0.528000	0.53228	AAA	0.409772		TCGA-FB-AAQ2-01A-31D-A40W-08	0.413	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	0	0	1		15	2	2	1		1	1	58		58	58	1	1.950000	-7.841932	1	0.460000	NM_017628			6	6		244	240	0		0	0		1	0	58	0		0.032484	1.639057e-02	0	0	0	7	0	6	244
DNAH5	1767	broad.mit.edu	37	5	13900472	13900472	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr5:13900472G>A	ENST00000265104.4	-	15	2206	c.2102C>T	c.(2101-2103)cCa>cTa	p.P701L	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	701	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CCCTGTGCCTGGAGCCTTCAC	0.413									Kartagener syndrome																													ENST00000265104.4	1.000000	7.900000e-01	1	8.800000e-01	0.990000	0.957588	0.990000	1.000000																										0				378						c.(2101-2103)cCa>cTa		dynein, axonemal, heavy chain 5							72.0	74.0	73.0					5																	13900472		2203	4300	6503	SO:0001583	missense	1767	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr5:13900472G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2102C>T	chr5.hg19:g.13900472G>A	ENSP00000265104:p.Pro701Leu	0					CTB-51A17.1_ENST00000503244.1_RNA	p.P701L	NM_001369.2	NP_001360.1	1	2	3	2.084407	Q8TE73	DYH5_HUMAN		15	2206	-	Lung NSC(4;0.00476)		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	1	1	hg19	c.2102C>T	CCDS3882.1	1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365928	0.61513	.	.	ENSG00000039139	ENST00000265104	T	0.55413	0.52	5.5	5.5	0.81552	5.5	5.5	0.81552	Dynein heavy chain, domain-1 (1);	0.108809	0.64402	D	0.000006	T	0.67363	0.2885	M	0.85542	2.76	0.80722	D	1	B	0.31655	0.334	B	0.41174	0.349	T	0.67998	-0.5525	10	0.44086	T	0.13	.	19.3805	0.94530	0.0:0.0:1.0:0.0	.	701	Q8TE73	DYH5_HUMAN	L	701	ENSP00000265104:P701L	ENSP00000265104:P701L	P	-	2	0	0	DNAH5	13953472	13953472	1.000000	0.71417	0.900000	0.35374	0.939000	0.58152	7.508000	0.81686	2.583000	0.87209	0.650000	0.86243	CCA	0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	1	0	1		2	2	2	0		0	0	58		58	56	1	1.950000	-4.084364	1	0.460000	NM_001369			69	69		239	236	1		1			0	0	58	0		1.000000	0	0	0	0	0	0	69	239
ADAMTS16	170690	broad.mit.edu	37	5	5239387	5239387	+	Splice_Site	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr5:5239387C>T	ENST00000274181.7	+	15	2416	c.2278C>T	c.(2278-2280)Cag>Tag	p.Q760*		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	760	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CCACACCAACCGTGAGTACTT	0.512																																						ENST00000274181.7	1.000000	8.300000e-01	1	9.100000e-01	0.990000	0.969545	0.990000	1.000000																										0				107						c.(2278-2280)Cag>Tag		ADAM metallopeptidase with thrombospondin type 1 motif, 16							136.0	135.0	135.0					5																	5239387		2044	4196	6240	SO:0001630	splice_region_variant	170690	3	120848	38				g.chr5:5239387C>T	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2278+1C>T	chr5.hg19:g.5239387C>T		0						p.Q760*	NM_139056.2	NP_620687.2	1	2	3	2.084407	Q8TE57	ATS16_HUMAN		15	2416	+			C6G490|Q8IVE2	Splice_Site	SNP	ENST00000274181.7	0	1	hg19	c.2278C>T	CCDS43299.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.165790	0.98686	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	.	.	.	5.85	4.96	0.65561	5.85	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.5469	0.76108	0.0:0.8611:0.1389:0.0	.	.	.	.	X	760	.	ENSP00000274181:Q760X	Q	+	1	0	0	ADAMTS16	5292387	5292387	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.676000	0.46883	1.410000	0.46936	0.655000	0.94253	CAG	0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.512	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	0	0	1		2	2	2	0		0	0	86		86	86	1	1.950000	-3.481176	1	0.460000	NM_139056	Nonsense_Mutation		101	100		344	332	0		1			0	0	86	0		1.000000	0	0	0	0	0	0	101	344
TTC37	9652	broad.mit.edu	37	5	94803623	94803623	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr5:94803623G>A	ENST00000358746.2	-	42	4865	c.4567C>T	c.(4567-4569)Cgt>Tgt	p.R1523C		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1523						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						AGGTACCAACGTGCAGTTGAT	0.358																																						ENST00000358746.2	1.000000	1.600000e-01	4.000000e-01	2.200000e-01	0.290000	0.342592	0.290000	0.290000																										0				47						c.(4567-4569)Cgt>Tgt		tetratricopeptide repeat domain 37							119.0	110.0	113.0					5																	94803623		2203	4300	6503	SO:0001583	missense	9652	2	121408	32				g.chr5:94803623G>A	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.4567C>T	chr5.hg19:g.94803623G>A	ENSP00000351596:p.Arg1523Cys	0						p.R1523C	NM_014639.3	NP_055454.1	1	2	3	2.084407	Q6PGP7	TTC37_HUMAN		42	4865	-			O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	1	1	hg19	c.4567C>T	CCDS4072.1	0	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737379	0.89482	.	.	ENSG00000198677	ENST00000358746	D	0.81659	-1.52	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.073499	0.64402	D	0.000001	D	0.88540	0.6464	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.89541	0.3792	10	0.87932	D	0	.	18.4885	0.90838	0.0:0.0:1.0:0.0	.	1523	Q6PGP7	TTC37_HUMAN	C	1523	ENSP00000351596:R1523C	ENSP00000351596:R1523C	R	-	1	0	0	TTC37	94829379	94829379	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	4.660000	0.61511	2.471000	0.83476	0.561000	0.74099	CGT	0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.358	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	1	0	1		2	2	2	0		0	0	53		53	52	1	1.950000	-5.689277	1	0.460000	NM_014639			14	14		201	201	0		1	1		0	0	53	0		0.999785	9.992495e-01	0	7	0	172	0	14	201
GABRA6	2559	broad.mit.edu	37	5	161128572	161128572	+	Silent	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr5:161128572C>T	ENST00000274545.5	+	9	1588	c.1155C>T	c.(1153-1155)tcC>tcT	p.S385S	GABRA6_ENST00000523217.1_Silent_p.S375S			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	385					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.S385S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TTTCATCTTCCGAGGCCAATA	0.453										TCGA Ovarian(5;0.080)																												ENST00000274545.5	1.000000	8.300000e-01	1	9.200000e-01	0.990000	0.971615	0.990000	1.000000																										1	Substitution - coding silent(1)	p.S385S(1)	large_intestine(1)	57						c.(1153-1155)tcC>tcT		gamma-aminobutyric acid (GABA) A receptor, alpha 6	Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)						104.0	104.0	104.0					5																	161128572		2203	4300	6503	SO:0001819	synonymous_variant	2559	0	0					g.chr5:161128572C>T		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1155C>T	chr5.hg19:g.161128572C>T		0	TCGA Ovarian(5;0.080)				GABRA6_ENST00000523217.1_Silent_p.S375S	p.S385S			1	2	3	2.084407	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	9	1588	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	A8K096|Q4VAV2	Silent	SNP	ENST00000274545.5	1	1	hg19	c.1155C>T	CCDS4356.1	1																																																																																								0.468556		TCGA-FB-AAQ2-01A-31D-A40W-08	0.453	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2	1	0	1		2	2	2	0		0	0	91		91	88	1	1.950000	-3.714679	1	0.460000				94	92		317	315	1		1			0	0	91	0		1.000000	0	0	0	0	0	0	94	317
WNT2	7472	broad.mit.edu	37	7	116960785	116960785	+	Missense_Mutation	SNP	C	C	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr7:116960785C>A	ENST00000265441.3	-	2	445	c.146G>T	c.(145-147)aGc>aTc	p.S49I	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	49					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CCGCTGGCTGCTCACCAGGCC	0.592																																						ENST00000265441.3	1.000000	5.500000e-01	1	6.900000e-01	0.870000	0.855480	0.870000	1.000000																										0				31						c.(145-147)aGc>aTc		wingless-type MMTV integration site family member 2							54.0	45.0	48.0					7																	116960785		2203	4300	6503	SO:0001583	missense	7472	0	0					g.chr7:116960785C>A	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.146G>T	chr7.hg19:g.116960785C>A	ENSP00000265441:p.Ser49Ile	0					AC002465.2_ENST00000436097.1_RNA	p.S49I	NM_003391.2	NP_003382.1	1	2	3	2.066335	P09544	WNT2_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)	2	445	-	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	1	1	hg19	c.146G>T	CCDS5771.1	1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831442	0.71258	.	.	ENSG00000105989	ENST00000265441;ENST00000491214	T;T	0.76578	-1.03;-1.03	5.42	5.42	0.78866	5.42	5.42	0.78866	.	0.040486	0.85682	D	0.000000	T	0.77691	0.4168	M	0.72894	2.215	0.44123	D	0.996904	P	0.44776	0.843	B	0.41917	0.37	T	0.79743	-0.1675	10	0.49607	T	0.09	.	14.2281	0.65873	0.0:0.851:0.149:0.0	.	49	P09544	WNT2_HUMAN	I	49	ENSP00000265441:S49I;ENSP00000419466:S49I	ENSP00000265441:S49I	S	-	2	0	0	WNT2	116748021	116748021	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.573000	0.23699	2.691000	0.91804	0.655000	0.94253	AGC	0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.592	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	1	0	1		2	2	2	0		0	0	13		13	13	1	1.950000	-20.000000	1	0.460000	NM_003391			18	17		74	71	1		1	0		0	0	13	0		0.999987	0	0	0	0	1	0	18	74
ABCB4	5244	broad.mit.edu	37	7	87069091	87069091	+	Silent	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr7:87069091G>A	ENST00000265723.4	-	14	1734	c.1623C>T	c.(1621-1623)atC>atT	p.I541I	ABCB4_ENST00000453593.1_Silent_p.I541I|ABCB4_ENST00000359206.3_Silent_p.I541I|ABCB4_ENST00000358400.3_Silent_p.I541I|ABCB4_ENST00000545634.1_Silent_p.I541I	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	541	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		I -> F (in PFIC3). {ECO:0000269|PubMed:11313315}.		cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	GTGCAATGGCGATCCTCTGCT	0.532																																						ENST00000265723.4	1.000000	2.000000e-02	1.100000e-01	4.000000e-02	0.060000	0.109845	0.060000	0.060000																										0				77						c.(1621-1623)atC>atT		ATP-binding cassette, sub-family B (MDR/TAP), member 4	Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)						130.0	116.0	121.0					7																	87069091		2203	4300	6503	SO:0001819	synonymous_variant	5244	2	121412	38				g.chr7:87069091G>A	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1623C>T	chr7.hg19:g.87069091G>A		0					ABCB4_ENST00000358400.3_Silent_p.I541I|ABCB4_ENST00000453593.1_Silent_p.I541I|ABCB4_ENST00000545634.1_Silent_p.I541I|ABCB4_ENST00000359206.3_Silent_p.I541I	p.I541I	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	1	2	3	2.066335	P21439	MDR3_HUMAN		14	1734	-	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Silent	SNP	ENST00000265723.4	0	1	hg19	c.1623C>T	CCDS5606.1	0																																																																																								0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.532	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	0	0	1		2	2	2	0		0	0	82		82	81	1	1.950000	-2.888738	1	0.460000	NM_000443			6	6		403	390	0		1			0	0	82	0		0.961597	0	0	0	0	0	0	6	403
CUL1	8454	broad.mit.edu	37	7	148427298	148427298	+	Silent	SNP	C	C	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr7:148427298C>A	ENST00000325222.4	+	2	363	c.84C>A	c.(82-84)atC>atA	p.I28I	CUL1_ENST00000409469.1_Silent_p.I28I|CUL1_ENST00000602748.1_Silent_p.I28I|AC005229.1_ENST00000578165.1_RNA	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	28					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GAGCCGGCATCCAGCAGGTGT	0.547																																						ENST00000325222.4	1.000000	1.500000e-01	3.100000e-01	1.900000e-01	0.240000	0.280549	0.240000	0.240000																										0				40						c.(82-84)atC>atA		cullin 1							103.0	90.0	94.0					7																	148427298		2203	4300	6503	SO:0001819	synonymous_variant	8454	0	0					g.chr7:148427298C>A	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.84C>A	chr7.hg19:g.148427298C>A		0					CUL1_ENST00000602748.1_Silent_p.I28I|CUL1_ENST00000409469.1_Silent_p.I28I|AC005229.1_ENST00000578165.1_RNA	p.I28I	NM_003592.2	NP_003583.2	1	2	3	2.066335	Q13616	CUL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	2	363	+	Melanoma(164;0.15)		D3DWG3|O60719|Q08AL6|Q8IYW1	Silent	SNP	ENST00000325222.4	1	1	hg19	c.84C>A	CCDS34772.1	0																																																																																								0.466139		TCGA-FB-AAQ2-01A-31D-A40W-08	0.547	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	1	0	1		2	2	2	0		0	0	55		55	53	1	1.950000	-19.999900	1	0.460000	NM_003592			22	21		376	372	0		1	1		0	0	55	0		0.999999	9.101935e-01	0	5	0	68	0	22	376
ARHGEF10	9639	broad.mit.edu	37	8	1857468	1857468	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr8:1857468C>T	ENST00000398564.1	+	18	2050	c.2050C>T	c.(2050-2052)Cat>Tat	p.H684Y	ARHGEF10_ENST00000262112.6_Missense_Mutation_p.H684Y|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.H659Y|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.H683Y|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.H621Y			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	684					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CAGCCCCTCTCATGACAGCCG	0.502																																						ENST00000398564.1	1.000000	8.200000e-01	9.700000e-01	8.700000e-01	0.920000	0.925250	0.920000	0.940000																										0				35						c.(2050-2052)Cat>Tat		Rho guanine nucleotide exchange factor (GEF) 10							196.0	187.0	190.0					8																	1857468		2203	4300	6503	SO:0001583	missense	9639	1	121412	33				g.chr8:1857468C>T	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.2050C>T	chr8.hg19:g.1857468C>T	ENSP00000381571:p.His684Tyr	1					ARHGEF10_ENST00000520359.1_Missense_Mutation_p.H621Y|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.H683Y|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.H659Y|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.H684Y	p.H684Y			0	1	1	1.598183	O15013	ARHGA_HUMAN		18	2050	+		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	1	1	hg19	c.2050C>T		1	.	.	.	.	.	.	.	.	.	.	C	9.289	1.050147	0.19827	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25	4.83	4.83	0.62350	4.83	4.83	0.62350	.	1.318090	0.04904	N	0.451894	T	0.19127	0.0459	L	0.41961	1.31	0.58432	D	0.999998	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.10450	0.002;0.002;0.005	T	0.08166	-1.0735	10	0.30854	T	0.27	-11.2687	10.5542	0.45107	0.0:0.9011:0.0:0.0989	.	684;621;659	O15013;O15013-7;O15013-5	ARHGA_HUMAN;.;.	Y	659;621;683;684;684;332	ENSP00000340297:H659Y;ENSP00000427909:H621Y;ENSP00000431012:H683Y;ENSP00000381571:H684Y;ENSP00000262112:H684Y;ENSP00000427768:H332Y	ENSP00000262112:H684Y	H	+	1	0	0	ARHGEF10	1844875	1844875	0.530000	0.26330	0.020000	0.16555	0.010000	0.07245	1.655000	0.37345	2.382000	0.81193	0.644000	0.83932	CAT	0.298701		TCGA-FB-AAQ2-01A-31D-A40W-08	0.502	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding		1	0	0		2	2	2	0		0	0	175		175	175	1	1.950000	-10.026950	1	0.460000				189	187		483	477	1		1	1		0	0	175	0		1.000000	8.905151e-01	0	9	0	3	0	189	483
KCNQ3	3786	broad.mit.edu	37	8	133150166	133150166	+	Missense_Mutation	SNP	C	C	T			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr8:133150166C>T	ENST00000388996.4	-	12	2086	c.1666G>A	c.(1666-1668)Gac>Aac	p.D556N	KCNQ3_ENST00000521134.1_Missense_Mutation_p.D436N|KCNQ3_ENST00000519445.1_Missense_Mutation_p.D556N	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	556					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAAGCATGTCGAGATGCCCG	0.453																																						ENST00000388996.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				70						c.(1666-1668)Gac>Aac		potassium voltage-gated channel, KQT-like subfamily, member 3	Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)						141.0	129.0	133.0					8																	133150166		2203	4300	6503	SO:0001583	missense	3786	1	121412	31				g.chr8:133150166C>T	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1666G>A	chr8.hg19:g.133150166C>T	ENSP00000373648:p.Asp556Asn	1					KCNQ3_ENST00000521134.1_Missense_Mutation_p.D436N|KCNQ3_ENST00000519445.1_Missense_Mutation_p.D556N	p.D556N	NM_004519.3	NP_004510.1	3	4	7	2.788746	O43525	KCNQ3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)	12	2086	-	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	1	1	hg19	c.1666G>A	CCDS34943.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.507800	0.96386	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99758	-6.65;-6.65;-6.65	5.46	5.46	0.80206	5.46	5.46	0.80206	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99527	0.9831	L	0.33093	0.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98336	1.0536	10	0.87932	D	0	-28.2666	18.6955	0.91599	0.0:1.0:0.0:0.0	.	556;556	E7ET42;O43525	.;KCNQ3_HUMAN	N	556;436;556;545;435	ENSP00000373648:D556N;ENSP00000429799:D436N;ENSP00000428790:D556N	ENSP00000373648:D556N	D	-	1	0	0	KCNQ3	133219348	133219348	1.000000	0.71417	0.964000	0.40570	0.962000	0.63368	7.818000	0.86416	2.733000	0.93635	0.655000	0.94253	GAC	0.608554		TCGA-FB-AAQ2-01A-31D-A40W-08	0.453	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	1	0	1		2	2	2	0		0	0	134		134	132	1	1.950000	-20.000000	1	0.460000	NM_004519			189	183		589	584	1		1			0	0	134	0		1.000000	0	0	0	0	0	0	189	589
ALDOB	229	broad.mit.edu	37	9	104187759	104187759	+	Missense_Mutation	SNP	G	G	A	rs201424676		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr9:104187759G>A	ENST00000374855.4	-	7	899	c.775C>T	c.(775-777)Cgt>Tgt	p.R259C	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	259					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				GGAACAGTACGGTGGAGAGCT	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		21426	0.0		0.0	False		,,,				2504	0.001					ENST00000374855.4	1.000000	8.000000e-01	1	8.900000e-01	0.990000	0.963023	0.990000	1.000000																										0				24						c.(775-777)Cgt>Tgt		aldolase B, fructose-bisphosphate							239.0	187.0	204.0					9																	104187759		2203	4300	6503	SO:0001583	missense	229	2	121412	37				g.chr9:104187759G>A	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.775C>T	chr9.hg19:g.104187759G>A	ENSP00000363988:p.Arg259Cys	0					ALDOB_ENST00000468981.3_5'Flank	p.R259C	NM_000035.3	NP_000026.2	1	2	3	2.088270	P05062	ALDOB_HUMAN		7	899	-		Acute lymphoblastic leukemia(62;0.0559)	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	1	1	hg19	c.775C>T	CCDS6756.1	1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543298	0.65198	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.89875	-2.58	6.06	4.2	0.49525	6.06	4.2	0.49525	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.95510	0.8541	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.95203	0.8318	10	0.87932	D	0	-5.352	10.3726	0.44064	0.0695:0.0:0.792:0.1385	.	259	P05062	ALDOB_HUMAN	C	259;186;259	ENSP00000363988:R259C	ENSP00000363986:R186C	R	-	1	0	0	ALDOB	103227580	103227580	1.000000	0.71417	0.880000	0.34516	0.291000	0.27294	6.636000	0.74299	0.854000	0.35336	0.650000	0.86243	CGT	0.469756		TCGA-FB-AAQ2-01A-31D-A40W-08	0.507	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2	1	0	1		2	2	2	0		0	0	54		54	54	1	1.950000	-3.432400	1	0.460000				72	72		247	244	1		1	0		0	0	54	0		1.000000	9.199893e-01	0	0	0	17	0	72	247
ANXA1	301	broad.mit.edu	37	9	75775747	75775747	+	Missense_Mutation	SNP	T	T	G			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr9:75775747T>G	ENST00000376911.1	+	5	1295	c.413T>G	c.(412-414)aTt>aGt	p.I138S	ANXA1_ENST00000257497.6_Missense_Mutation_p.I138S			P04083	ANXA1_HUMAN	annexin A1	138					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	GATACTCTAATTGAGATTTTG	0.358																																						ENST00000376911.1	1.000000	8.800000e-01	1	9.400000e-01	0.990000	0.980873	0.990000	1.000000																										0				8						c.(412-414)aTt>aGt		annexin A1	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)						153.0	162.0	159.0					9																	75775747		2203	4299	6502	SO:0001583	missense	301	0	0					g.chr9:75775747T>G	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.413T>G	chr9.hg19:g.75775747T>G	ENSP00000366109:p.Ile138Ser	0					ANXA1_ENST00000257497.6_Missense_Mutation_p.I138S	p.I138S			1	2	3	2.088270	P04083	ANXA1_HUMAN		5	1295	+		all_epithelial(88;2.54e-11)		Missense_Mutation	SNP	ENST00000376911.1	1	1	hg19	c.413T>G	CCDS6645.1	1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.754013	0.49362	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000376911	T;T;T	0.06933	3.24;3.24;3.24	5.86	2.23	0.28157	5.86	2.23	0.28157	Annexin repeat, conserved site (1);	0.189835	0.56097	D	0.000034	T	0.16342	0.0393	M	0.91459	3.21	0.58432	D	0.999997	B	0.22276	0.067	B	0.24006	0.05	T	0.01604	-1.1314	10	0.87932	D	0	.	8.3775	0.32451	0.1446:0.0724:0.0:0.7829	.	138	P04083	ANXA1_HUMAN	S	138;149;138	ENSP00000257497:I138S;ENSP00000412489:I149S;ENSP00000366109:I138S	ENSP00000257497:I138S	I	+	2	0	0	ANXA1	74965567	74965567	1.000000	0.71417	0.987000	0.45799	0.948000	0.59901	3.066000	0.50002	0.130000	0.18549	0.533000	0.62120	ATT	0.469756		TCGA-FB-AAQ2-01A-31D-A40W-08	0.358	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	1	0	1		2	2	2	0		0	0	192		192	192	1	1.950000	-20.000000	1	0.460000	NM_000700			186	184		629	625	1		1	1		0	0	192	0		1.000000	1	0	1715	0	2408	0	186	629
OMD	4958	broad.mit.edu	37	9	95179346	95179346	+	Missense_Mutation	SNP	T	T	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr9:95179346T>A	ENST00000375550.4	-	2	770	c.495A>T	c.(493-495)gaA>gaT	p.E165D	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	165					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						GAAGGAGTCTTTCCAGAGATT	0.353			T	USP6	aneurysmal bone cysts																																	ENST00000375550.4	1.000000	8.100000e-01	1	9.000000e-01	0.990000	0.964831	0.990000	1.000000				Dom	yes			Dom	yes		9	9q22.31	9q22.31	4958	T	osteomodulin				M	M	USP6		aneurysmal bone cysts		0				16						c.(493-495)gaA>gaT		osteomodulin							95.0	96.0	96.0					9																	95179346		2203	4300	6503	SO:0001583	missense	4958	0	0					g.chr9:95179346T>A	AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.495A>T	chr9.hg19:g.95179346T>A	ENSP00000364700:p.Glu165Asp	0					CENPP_ENST00000375587.3_Intron	p.E165D	NM_005014.2	NP_005005.1	1	2	3	2.088270	Q99983	OMD_HUMAN		2	770	-			Q5TBF4	Missense_Mutation	SNP	ENST00000375550.4	1	1	hg19	c.495A>T	CCDS6696.1	1	.	.	.	.	.	.	.	.	.	.	t	16.29	3.081856	0.55861	.	.	ENSG00000127083	ENST00000375550	T	0.05258	3.47	5.41	4.27	0.50696	5.41	4.27	0.50696	.	0.071747	0.53938	D	0.000044	T	0.06462	0.0166	L	0.60067	1.865	0.31296	N	0.688889	P	0.42692	0.787	B	0.33121	0.158	T	0.13255	-1.0516	10	0.56958	D	0.05	-20.6279	7.6328	0.28249	0.0:0.2438:0.0:0.7562	.	165	Q99983	OMD_HUMAN	D	165	ENSP00000364700:E165D	ENSP00000364700:E165D	E	-	3	2	2	OMD	94219167	94219167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.745000	0.26259	1.001000	0.39076	0.477000	0.44152	GAA	0.469756		TCGA-FB-AAQ2-01A-31D-A40W-08	0.353	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	1	0	1		18	2	2	0		0	1	72		72	72	1	1.950000	-20.000000	1	0.460000	NM_005014			86	86		296	294	1		1	0		0	0	72	0		1.000000	0	0	0	0	1	0	86	296
ST6GALNAC6	30815	broad.mit.edu	37	9	130649855	130649855	+	Silent	SNP	C	C	T	rs368787289		TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chr9:130649855C>T	ENST00000373146.1	-	6	899	c.720G>A	c.(718-720)tcG>tcA	p.S240S	RP11-203J24.9_ENST00000476274.2_RNA|ST6GALNAC6_ENST00000373141.1_Silent_p.S206S|ST6GALNAC6_ENST00000373142.1_Silent_p.S240S|ST6GALNAC6_ENST00000542456.1_Silent_p.S40S|ST6GALNAC6_ENST00000373144.3_Silent_p.S206S|ST6GALNAC6_ENST00000485320.1_5'UTR|ST6GALNAC6_ENST00000291839.5_Silent_p.S240S			Q969X2	SIA7F_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6	240					cell-cell recognition (GO:0009988)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TGCTCAACCACGAATGAGACT	0.597																																						ENST00000373146.1	1.000000	7.400000e-01	1	8.800000e-01	0.990000	0.960402	0.990000	1.000000																										0				14						c.(718-720)tcG>tcA		ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6		C		0,4404		0,0,2202	167.0	93.0	118.0		720	-7.8	0.5	9		118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ST6GALNAC6	NM_013443.3		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		240/334	130649855	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	30815	0	0					g.chr9:130649855C>T	BC006564	CCDS6882.1, CCDS69668.1, CCDS69669.1, CCDS75908.1	9q34.13	2013-03-01		2005-02-07	ENSG00000160408	ENSG00000160408		"""Sialyltransferases"""	23364	protein-coding gene	gene with protein product		610135	"""sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F"""	SIAT7F		12668675	Standard	XM_005251952		Approved	ST6GALNACVI	uc004bso.1	Q969X2	OTTHUMG00000020718	ENST00000373146.1:c.720G>A	chr9.hg19:g.130649855C>T		0					ST6GALNAC6_ENST00000485320.1_5'UTR|RP11-203J24.9_ENST00000476274.2_RNA|ST6GALNAC6_ENST00000291839.5_Silent_p.S240S|ST6GALNAC6_ENST00000542456.1_Silent_p.S40S|ST6GALNAC6_ENST00000373141.1_Silent_p.S206S|ST6GALNAC6_ENST00000373144.3_Silent_p.S206S|ST6GALNAC6_ENST00000373142.1_Silent_p.S240S	p.S240S			1	2	3	2.088270	Q969X2	SIA7F_HUMAN		6	899	-			B3KQ01|Q5T9C4|Q5T9C5|Q9H8A2|Q9ULB8	Silent	SNP	ENST00000373146.1	1	1	hg19	c.720G>A	CCDS6882.1	1																																																																																								0.469756		TCGA-FB-AAQ2-01A-31D-A40W-08	0.597	ST6GALNAC6-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054278.1	1	0	1		2	2	2	0		0	0	31		31	30	1	1.950000	-20.000000	1	0.460000	NM_013443			31	31		101	99	1		1	1		0	0	31	0		1.000000	1	0	29	0	87	0	31	101
BMX	660	broad.mit.edu	37	X	15554529	15554529	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chrX:15554529G>A	ENST00000357607.2	+	13	1389	c.1201G>A	c.(1201-1203)Gac>Aac	p.D401N	BMX_ENST00000342014.6_Missense_Mutation_p.D401N|BMX_ENST00000348343.6_Missense_Mutation_p.D401N			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	401					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					CAAGGTCCCCGACTCTGTGTC	0.408																																						ENST00000357607.2	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999938	0.990000	1.000000																										0				30						c.(1201-1203)Gac>Aac		BMX non-receptor tyrosine kinase							151.0	123.0	132.0					X																	15554529		2203	4300	6503	SO:0001583	missense	660	0	0					g.chrX:15554529G>A	AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.1201G>A	chrX.hg19:g.15554529G>A	ENSP00000350224:p.Asp401Asn						BMX_ENST00000342014.6_Missense_Mutation_p.D401N|BMX_ENST00000348343.6_Missense_Mutation_p.D401N	p.D401N			0	1	1		P51813	BMX_HUMAN		13	1389	+	Hepatocellular(33;0.183)		A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	1	1	hg19	c.1201G>A	CCDS14168.1	1	.	.	.	.	.	.	.	.	.	.	g	5.048	0.194624	0.09599	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	D;D;D	0.88975	-2.45;-2.45;-2.45	4.94	-0.125	0.13519	4.94	-0.125	0.13519	Protein kinase-like domain (1);	1.355510	0.04879	N	0.447326	T	0.73497	0.3594	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.01281	0.0	T	0.60250	-0.7300	10	0.21014	T	0.42	.	1.3363	0.02145	0.2017:0.1429:0.4229:0.2324	.	401	P51813	BMX_HUMAN	N	401	ENSP00000350224:D401N;ENSP00000308774:D401N;ENSP00000340082:D401N	ENSP00000340082:D401N	D	+	1	0	0	BMX	15464450	15464450	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.656000	0.05342	0.242000	0.21303	0.519000	0.50382	GAC	0.460000		TCGA-FB-AAQ2-01A-31D-A40W-08	0.408	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	1	0	1		2	2	2	0		0	0	88		88	81	1	1.950000	-20.000000	1	0.460000	NM_001721			128	124		317	309	1		1	0		0	0	88	0		1.000000	4.478229e-01	0	0	0	5	0	128	317
AFF2	2334	broad.mit.edu	37	X	148055040	148055040	+	Missense_Mutation	SNP	G	G	A			TCGA-FB-AAQ2-01A-31D-A40W-08	TCGA-FB-AAQ2-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b4231a8-75a7-4fe6-bd09-a75f97bee933	880b3248-8493-4948-bc90-14cae9e8761b	g.chrX:148055040G>A	ENST00000370460.2	+	16	3786	c.3307G>A	c.(3307-3309)Gcc>Acc	p.A1103T	AFF2_ENST00000370457.5_Missense_Mutation_p.A1068T|AFF2_ENST00000342251.3_Missense_Mutation_p.A1070T|AFF2_ENST00000286437.5_Missense_Mutation_p.A744T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1103					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.A1103T(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGCTGATGCCGCCCTCTCCTT	0.468																																						ENST00000370460.2	1.000000	9.500000e-01	1	9.900000e-01	0.990000	0.997233	0.990000	1.000000																										1	Substitution - Missense(1)	p.A1103T(1)	kidney(1)	109						c.(3307-3309)Gcc>Acc		AF4/FMR2 family, member 2							185.0	148.0	161.0					X																	148055040		2203	4300	6503	SO:0001583	missense	2334	0	0					g.chrX:148055040G>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3307G>A	chrX.hg19:g.148055040G>A	ENSP00000359489:p.Ala1103Thr						AFF2_ENST00000370457.5_Missense_Mutation_p.A1068T|AFF2_ENST00000342251.3_Missense_Mutation_p.A1070T|AFF2_ENST00000286437.5_Missense_Mutation_p.A744T	p.A1103T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	0	1	1		P51816	AFF2_HUMAN		16	3786	+	Acute lymphoblastic leukemia(192;6.56e-05)		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	1	1	hg19	c.3307G>A	CCDS14684.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.215490	0.95104	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.83211	0.5205	M	0.80616	2.505	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	0.996;0.998;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.75020	0.955;0.889;0.985;0.939;0.939;0.964	D	0.85022	0.0912	10	0.66056	D	0.02	.	18.8728	0.92322	0.0:0.0:1.0:0.0	.	744;1068;1068;1064;1093;1103	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	T	1103;1068;1070;744	ENSP00000359489:A1103T;ENSP00000359486:A1068T;ENSP00000345459:A1070T;ENSP00000286437:A744T	ENSP00000286437:A744T	A	+	1	0	0	AFF2	147862729	147862729	1.000000	0.71417	0.964000	0.40570	0.734000	0.41952	9.827000	0.99397	2.404000	0.81709	0.600000	0.82982	GCC	0.460000		TCGA-FB-AAQ2-01A-31D-A40W-08	0.468	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	1	0	1		2	2	2	0		0	0	108		108	106	1	1.950000	-5.860837	1	0.460000	NM_002025			106	105		300	296	1		1			0	0	108	0		1.000000	0	0	0	0	0	0	106	300
