#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
RAP2B	5912	broad.mit.edu	37	3	152880927	152880962	+	In_Frame_Del	DEL	AACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	AACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	-	rs575789682|rs138892831		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr3:152880927_152880962delAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	ENST00000323534.2	+	1	899_934	c.445_480delAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	c.(445-480)aacaaagcctcggtagacgagctatttgccgagatcdel	p.NKASVDELFAEI149del	RP11-529G21.2_ENST00000487827.1_RNA	NM_002886.2	NP_002877.2	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family	149					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			GTCGGCCAAAAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATCGTGCGGCAGA	0.661																																						ENST00000323534.2	0.540000	1.800000e-01	4.400000e-01	2.500000e-01	0.330000	0.351870	0.330000	0.330000																										0				7						c.(445-480)aacaaagcctcggtagacgagctatttgccgagatcdel		RAP2B, member of RAS oncogene family																																				SO:0001651	inframe_deletion	5912	0	0					g.chr3:152880927_152880962delAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC		CCDS3170.1	3q25.2	2014-05-09			ENSG00000181467	ENSG00000181467			9862	protein-coding gene	gene with protein product	"""Ras-related protein RAP-2B"", ""small GTP binding protein"", ""Ras family small GTP binding protein RAP2B"""	179541				2118648	Standard	NM_002886		Approved		uc003ezr.3	P61225	OTTHUMG00000159655	ENST00000323534.2:c.445_480delAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	chr3.hg19:g.152880927_152880962delAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	ENSP00000319096:p.Asn149_Ile160del	0					RP11-529G21.2_ENST00000487827.1_RNA	p.NKASVDELFAEI149del	NM_002886.2	NP_002877.2	0	0	0	2.171377	P61225	RAP2B_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)	1	899_934	+			P17964|Q96EG5|Q9CXG0	In_Frame_Del	DEL	ENST00000323534.2	0	1	hg19	c.445_480delAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATC	CCDS3170.1	0																																																																																								0.700000		TCGA-H6-8124-01A-11D-2396-08	0.661	RAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356707.1	1	0	1		2	2		0	0	0	0	22	0	22	22	1	1.770000	-18.580870	1	0.700000	NM_002886		0	11	35	0	84	107	0	0	1	0	0	0	0	22	0	0	0.999897	9.777806e-01	0	0	0	53	0	11	84
LRPAP1	4043	broad.mit.edu	37	4	3516576	3516582	+	Frame_Shift_Del	DEL	AGCTTCT	AGCTTCT	-			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			AGCTTCT	-	AGCTTCT	AGCTTCT		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr4:3516576_3516582delAGCTTCT	ENST00000500728.2	-	7	1054_1060	c.908_914delAGAAGCT	c.(907-915)gagaagctgfs	p.EKL303fs	LRPAP1_ENST00000296325.5_5'UTR	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	303	LDL receptor binding. {ECO:0000255}.				extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		TGCGTGCCTCAGCTTCTCGTGCGCAAT	0.614																																						ENST00000500728.2	1.000000	5.200000e-01	6.400000e-01	5.600000e-01	0.590000	0.613255	0.590000	0.600000																										0				14						c.(907-915)gagaagctgfs		low density lipoprotein receptor-related protein associated protein 1																																				SO:0001589	frameshift_variant	4043	0	0					g.chr4:3516576_3516582delAGCTTCT		CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.908_914delAGAAGCT	chr4.hg19:g.3516576_3516582delAGCTTCT	ENSP00000421922:p.Glu303fs	0					LRPAP1_ENST00000296325.5_5'UTR	p.EKL303fs	NM_002337.3	NP_002328.1	1	2	3	2.239288	P30533	AMRP_HUMAN		7	1054_1060	-			D3DVR9|Q2M310|Q53HQ3|Q53HS6	Frame_Shift_Del	DEL	ENST00000500728.2	1	1	hg19	c.908_914delAGAAGCT	CCDS3371.1	0																																																																																								0.704142		TCGA-H6-8124-01A-11D-2396-08	0.614	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206659.4	1	0	1		2	2		0	0	0	0	294	0	294	294	1	1.770000	-3.884088	1	0.700000			0	212	264	0	811	850	0	0	1	1	0	0	0	294	0	0	1.000000	1	0	26	0	487	0	212	811
ADCY1	107	broad.mit.edu	37	7	45614538	45614540	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr7:45614538_45614540delCTT	ENST00000297323.7	+	1	418_420	c.396_398delCTT	c.(394-399)accttc>acc	p.F133del	ADCY1_ENST00000432715.1_5'UTR	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	133					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TCAGCCTCACCTTCGCGCTGCTC	0.719																																						ENST00000297323.7	0.800000	5.500000e-01	7.400000e-01	6.100000e-01	0.670000	0.680578	0.670000	0.680000																										0				71						c.(394-399)accttc>acc		adenylate cyclase 1 (brain)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)																																			SO:0001651	inframe_deletion	107	0	0					g.chr7:45614538_45614540delCTT	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.396_398delCTT	chr7.hg19:g.45614538_45614540delCTT	ENSP00000297323:p.Phe133del	0					ADCY1_ENST00000432715.1_5'UTR	p.F133del	NM_021116.2	NP_066939.1	0	0	0	2.170941	Q08828	ADCY1_HUMAN		1	418_420	+			A4D2L8|Q75MI1	In_Frame_Del	DEL	ENST00000297323.7	1	1	hg19	c.396_398delCTT	CCDS34631.1	0																																																																																								0.700000		TCGA-H6-8124-01A-11D-2396-08	0.719	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	1	0	1		22			0	0	0	2	83	0	83	86	1	1.770000	-20.000000	1	0.700000	NM_021116		0	87	118	0	280	290	0	0	1		0	0	0	83	0	0	1.000000		0	0	0	0	0	87	280
PRTFDC1	56952	broad.mit.edu	37	10	25138811	25138811	+	Missense_Mutation	SNP	C	C	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr10:25138811C>A	ENST00000320152.6	-	9	668	c.640G>T	c.(640-642)Gtc>Ttc	p.V214F	PRTFDC1_ENST00000376378.1_Missense_Mutation_p.R188L	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	214					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						TCATTGATGACGCATATGTGC	0.378																																						ENST00000320152.6	0.980000	7.900000e-01	9.400000e-01	8.400000e-01	0.880000	0.894992	0.880000	0.890000																										0				9						c.(640-642)Gtc>Ttc		phosphoribosyl transferase domain containing 1							204.0	174.0	184.0					10																	25138811		2203	4300	6503	SO:0001583	missense	56952	0	0					g.chr10:25138811C>A	AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.640G>T	chr10.hg19:g.25138811C>A	ENSP00000318602:p.Val214Phe	1					PRTFDC1_ENST00000376378.1_Missense_Mutation_p.R188L	p.V214F	NM_020200.5	NP_064585.1	0	1	1	1.520219	Q9NRG1	PRDC1_HUMAN		9	668	-			B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	ENST00000320152.6	1	1	hg19	c.640G>T	CCDS7145.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.3|21.3	4.124299|4.124299	0.77436|0.77436	.|.	.|.	ENSG00000099256|ENSG00000099256	ENST00000358336;ENST00000376378|ENST00000320152	D|D	0.99841|0.99232	-7.09|-5.6	5.55|5.55	2.64|2.64	0.31445|0.31445	5.55|5.55	2.64|2.64	0.31445|0.31445	.|.	.|0.058217	.|0.64402	.|D	.|0.000002	D|D	0.99524|0.99524	0.9830|0.9830	H|H	0.97983|0.97983	4.12|4.12	0.80722|0.80722	D|D	1|1	B|D	0.13145|0.65815	0.007|0.995	B|D	0.17098|0.67548	0.017|0.952	D|D	0.98786|0.98786	1.0734|1.0734	9|10	0.54805|0.87932	T|D	0.06|0	.|.	7.9935|7.9935	0.30254|0.30254	0.1307:0.7315:0.0:0.1378|0.1307:0.7315:0.0:0.1378	.|.	188|214	Q9NRG1-2|Q9NRG1	.|PRDC1_HUMAN	L|F	188|214	ENSP00000365558:R188L|ENSP00000318602:V214F	ENSP00000351096:R188L|ENSP00000318602:V214F	R|V	-|-	2|1	0|0	0|0	PRTFDC1|PRTFDC1	25178817|25178817	25178817|25178817	0.897000|0.897000	0.30589|0.30589	0.858000|0.858000	0.33744|0.33744	0.984000|0.984000	0.73092|0.73092	1.561000|1.561000	0.36342|0.36342	0.270000|0.270000	0.21984|0.21984	0.563000|0.563000	0.77884|0.77884	CGT|GTC	0.557522		TCGA-H6-8124-01A-11D-2396-08	0.378	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2	1	0	1	2	2	2	2	0	0	0	0	33	33	33	31	1	1.770000	-20.000000	1	0.700000	NM_020200		0	187	182	0	217	216	1		1	1		0	0	33	0	0	1.000000	1	0	52	0	20	0	187	217
ADD3	120	broad.mit.edu	37	10	111876161	111876161	+	Missense_Mutation	SNP	A	A	G			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr10:111876161A>G	ENST00000356080.4	+	4	846	c.479A>G	c.(478-480)tAt>tGt	p.Y160C	ADD3_ENST00000360162.3_Missense_Mutation_p.Y160C|ADD3_ENST00000277900.8_Missense_Mutation_p.Y160C|ADD3_ENST00000497125.1_3'UTR	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	160						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GCAAATACCTATATCTCAGTG	0.403																																						ENST00000356080.4	1.000000	9.000000e-01	1	9.500000e-01	0.990000	0.985790	0.990000	1.000000																										0				29						c.(478-480)tAt>tGt		adducin 3 (gamma)							136.0	124.0	128.0					10																	111876161		2203	4300	6503	SO:0001583	missense	120	1	121412	29				g.chr10:111876161A>G	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.479A>G	chr10.hg19:g.111876161A>G	ENSP00000348381:p.Tyr160Cys	1					ADD3_ENST00000497125.1_3'UTR|ADD3_ENST00000360162.3_Missense_Mutation_p.Y160C|ADD3_ENST00000277900.8_Missense_Mutation_p.Y160C	p.Y160C	NM_016824.3	NP_058432.1	0	1	1	1.526225	Q9UEY8	ADDG_HUMAN		4	846	+		Breast(234;0.052)|Lung NSC(174;0.223)	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	1	1	hg19	c.479A>G	CCDS7561.1	1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.111684	0.56398	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.21734	1.99;1.99;1.99	5.47	5.47	0.80525	5.47	5.47	0.80525	Class II aldolase/adducin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	L	0.35341	1.055	0.80722	D	1	D;B	0.89917	1.0;0.451	D;B	0.91635	0.999;0.363	T	0.05162	-1.0902	10	0.51188	T	0.08	-6.7683	10.76	0.46259	0.8583:0.0:0.0:0.1417	.	160;160	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	C	160	ENSP00000353286:Y160C;ENSP00000348381:Y160C;ENSP00000277900:Y160C	ENSP00000277900:Y160C	Y	+	2	0	0	ADD3	111866151	111866151	1.000000	0.71417	0.712000	0.30502	0.858000	0.48976	7.338000	0.79269	2.083000	0.62718	0.460000	0.39030	TAT	0.550562		TCGA-H6-8124-01A-11D-2396-08	0.403	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	1.770000	-20.000000	1	0.700000	NM_019903		0	122	119	0	98	96	1		1	1		0	0	20	0	0	1.000000	1	0	88	0	37	0	122	98
MAP4K2	5871	broad.mit.edu	37	11	64564293	64564293	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr11:64564293G>A	ENST00000294066.2	-	21	1571	c.1480C>T	c.(1480-1482)Cct>Tct	p.P494S	MAP4K2_ENST00000377350.3_Missense_Mutation_p.P486S	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	494	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						CGAGTAACAGGGTGAATCCAG	0.637																																						ENST00000294066.2	1.000000	7.800000e-01	9.900000e-01	8.400000e-01	0.910000	0.919661	0.910000	1.000000																										0				8						c.(1480-1482)Cct>Tct		mitogen-activated protein kinase kinase kinase kinase 2							36.0	40.0	39.0					11																	64564293		2201	4297	6498	SO:0001583	missense	5871	0	0					g.chr11:64564293G>A	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1480C>T	chr11.hg19:g.64564293G>A	ENSP00000294066:p.Pro494Ser	0					MAP4K2_ENST00000377350.3_Missense_Mutation_p.P486S	p.P494S	NM_004579.3	NP_004570.2	0	0	0	2.145534	Q12851	M4K2_HUMAN		21	1571	-			Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	1	1	hg19	c.1480C>T	CCDS8082.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346951	0.82022	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.05996	3.36;3.36	4.51	4.51	0.55191	4.51	4.51	0.55191	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.21062	0.0507	M	0.64997	1.995	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.00223	-1.1903	10	0.59425	D	0.04	.	13.1403	0.59430	0.0:0.0:1.0:0.0	.	486;494	Q86VU3;Q12851	.;M4K2_HUMAN	S	494;486	ENSP00000294066:P494S;ENSP00000366567:P486S	ENSP00000294066:P494S	P	-	1	0	0	MAP4K2	64320869	64320869	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.359000	0.90093	2.247000	0.74100	0.558000	0.71614	CCT	0.697885		TCGA-H6-8124-01A-11D-2396-08	0.637	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	72	1	1.770000	-10.968850	1	0.700000	NM_004579		0	112	108	0	232	227	1		1	1		0	0	74	0	0	1.000000	9.987351e-01	0	9	0	15	0	112	232
ARHGEF17	9828	broad.mit.edu	37	11	73076866	73076866	+	Missense_Mutation	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr11:73076866C>T	ENST00000263674.3	+	20	6219	c.5869C>T	c.(5869-5871)Cgg>Tgg	p.R1957W		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1957					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CAGCTGCCCACGGGCACCACT	0.652																																						ENST00000263674.3	1.000000	7.500000e-01	9.900000e-01	8.200000e-01	0.900000	0.905737	0.900000	1.000000																										0				32						c.(5869-5871)Cgg>Tgg		Rho guanine nucleotide exchange factor (GEF) 17							61.0	58.0	59.0					11																	73076866		2200	4293	6493	SO:0001583	missense	9828	0	0					g.chr11:73076866C>T	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5869C>T	chr11.hg19:g.73076866C>T	ENSP00000263674:p.Arg1957Trp	0						p.R1957W	NM_014786.3	NP_055601.2	1	2	3	2.215795	Q96PE2	ARHGH_HUMAN		20	6219	+			B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	1	1	hg19	c.5869C>T	CCDS8221.1	1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617632	0.46736	.	.	ENSG00000110237	ENST00000263674	T	0.36340	1.26	5.28	4.36	0.52297	5.28	4.36	0.52297	WD40 repeat-like-containing domain (1);	0.133526	0.50627	D	0.000118	T	0.48874	0.1524	L	0.53249	1.67	0.19300	N	0.999979	D	0.89917	1.0	D	0.64687	0.928	T	0.34976	-0.9807	10	0.52906	T	0.07	-20.421	8.7897	0.34843	0.4108:0.4532:0.1361:0.0	.	1957	Q96PE2	ARHGH_HUMAN	W	1957	ENSP00000263674:R1957W	ENSP00000263674:R1957W	R	+	1	2	2	ARHGEF17	72754514	72754514	0.256000	0.24012	0.269000	0.24586	0.573000	0.36030	1.436000	0.34980	1.442000	0.47568	0.655000	0.94253	CGG	0.702085		TCGA-H6-8124-01A-11D-2396-08	0.652	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	1	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	1.770000	-20.000000	1	0.700000	NM_014786		0	99	98	0	215	213	1		1	1		0	0	92	0	0	1.000000	1	0	11	0	64	0	99	215
MAML2	84441	broad.mit.edu	37	11	95724867	95724867	+	Silent	SNP	G	G	A	rs367763533		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr11:95724867G>A	ENST00000524717.1	-	3	3444	c.2160C>T	c.(2158-2160)ggC>ggT	p.G720G		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	720					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CTGTGTTCTGGCCTACCACAG	0.428			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	ENST00000524717.1	1.000000	8.600000e-01	1	9.200000e-01	0.990000	0.972284	0.990000	1.000000				Dom	yes			Dom	yes		11	11q22-q23	11q22-q23	84441	T	mastermind-like 2 (Drosophila)				E	E	MECT1, CRTC3		salivary gland mucoepidermoid	CRTC3/MAML2(26)|CRTC1/MAML2(516)	0				43						c.(2158-2160)ggC>ggT		mastermind-like 2 (Drosophila)		G		0,3732		0,0,1866	84.0	80.0	81.0		2160	5.6	1.0	11		81	1,8181		0,1,4090	no	coding-synonymous	MAML2	NM_032427.1		0,1,5956	AA,AG,GG		0.0122,0.0,0.0084		720/1157	95724867	1,11913	1866	4091	5957	SO:0001819	synonymous_variant	84441	3	120808	41				g.chr11:95724867G>A	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.2160C>T	chr11.hg19:g.95724867G>A		0						p.G720G	NM_032427.1	NP_115803.1	1	2	3	2.215795	Q8IZL2	MAML2_HUMAN		3	3444	-		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	1	1	hg19	c.2160C>T	CCDS44714.1	1																																																																																								0.702085		TCGA-H6-8124-01A-11D-2396-08	0.428	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1	1	0	1	2	2	2	2	0	0	0	0	45	45	45	46	1	1.770000	-20.000000	1	0.700000			0	136	131	0	256	265	1		1	1		0	0	45	0	0	1.000000	1	0	24	0	40	0	136	256
ARHGDIB	397	broad.mit.edu	37	12	15095522	15095522	+	Silent	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr12:15095522G>A	ENST00000228945.4	-	6	684	c.540C>T	c.(538-540)gaC>gaT	p.D180D	ARHGDIB_ENST00000541644.1_Silent_p.D180D|ARHGDIB_ENST00000539131.1_5'UTR|ARHGDIB_ENST00000541546.1_Silent_p.D180D	NM_001175.4	NP_001166.3	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	180					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell adhesion (GO:0007162)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	15						GCTTGTCATCGTCGGTGAAGA	0.567																																						ENST00000228945.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				15						c.(538-540)gaC>gaT		Rho GDP dissociation inhibitor (GDI) beta							266.0	198.0	221.0					12																	15095522		2203	4300	6503	SO:0001819	synonymous_variant	397	11	121412	47				g.chr12:15095522G>A	L07916	CCDS8671.1	12p12.3	2014-01-30				ENSG00000111348		"""Endogenous ligands"""	679	protein-coding gene	gene with protein product		602843		RAP1GN1, GDIA2, GDID4		8434008, 8356058	Standard	NM_001175		Approved	Ly-GDI, RhoGDI2	uc001rcq.1	P52566		ENST00000228945.4:c.540C>T	chr12.hg19:g.15095522G>A		1					ARHGDIB_ENST00000541546.1_Silent_p.D180D|ARHGDIB_ENST00000539131.1_5'UTR|ARHGDIB_ENST00000541644.1_Silent_p.D180D	p.D180D	NM_001175.4	NP_001166.3	0	2	2	2.354604	P52566	GDIR2_HUMAN		6	684	-			B5BU79	Silent	SNP	ENST00000228945.4	1	1	hg19	c.540C>T	CCDS8671.1	1	.	.	.	.	.	.	.	.	.	.	G	8.275	0.814158	0.16537	.	.	ENSG00000111348	ENST00000536592	.	.	.	4.73	-9.03	0.00737	4.73	-9.03	0.00737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.6554	19.0707	0.93134	0.8544:0.0:0.1456:0.0	.	.	.	.	X	174	.	.	R	-	1	2	2	ARHGDIB	14986789	14986789	0.273000	0.24181	0.064000	0.19789	0.971000	0.66376	-0.294000	0.08309	-2.089000	0.00860	-0.145000	0.13849	CGA	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.567	ARHGDIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400871.1	1	0	1	2	2	2	2	0	0	0	0	159	159	159	156	1	1.770000	-20.000000	1	0.700000	NM_001175		0	556	549	0	213	211	1		1	1		0	0	159	0	0	1.000000	1	0	419	0	194	0	556	213
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	2	2	2.354604	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.770000	-20.000000	1	0.700000	NM_033360		5456	61	61	2557	27	27	1	1	1	1	1	0	0	15	435	1	1.000000	9.999999e-01	1	17	207	3	129	61	27
LRP1	4035	broad.mit.edu	37	12	57573330	57573330	+	Missense_Mutation	SNP	G	G	A	rs199662511	byFrequency	TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr12:57573330G>A	ENST00000243077.3	+	29	5423	c.4957G>A	c.(4957-4959)Gtc>Atc	p.V1653I		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1653					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGAGACAGTCGTCTCTGCAGG	0.632													G|||	2	0.000399361	0.0	0.0	5008	,	,		18270	0.002		0.0	False		,,,				2504	0.0					ENST00000243077.3	1.000000	9.200000e-01	1	9.900000e-01	0.990000	0.994890	0.990000	1.000000																										0				184						c.(4957-4959)Gtc>Atc		low density lipoprotein receptor-related protein 1	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						80.0	59.0	66.0					12																	57573330		2203	4300	6503	SO:0001583	missense	4035	13	121404	40				g.chr12:57573330G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.4957G>A	chr12.hg19:g.57573330G>A	ENSP00000243077:p.Val1653Ile	1						p.V1653I	NM_002332.2	NP_002323.2	1	4	5	3.965701	Q07954	LRP1_HUMAN		29	5423	+			Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	1	1	hg19	c.4957G>A	CCDS8932.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	12.57	1.977557	0.34848	.	.	ENSG00000123384	ENST00000243077	D	0.95554	-3.74	4.8	4.8	0.61643	4.8	4.8	0.61643	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000014	D	0.93579	0.7950	N	0.10664	0.02	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.90619	0.4558	10	0.10111	T	0.7	.	16.7799	0.85560	0.0:0.0:1.0:0.0	.	1653	Q07954	LRP1_HUMAN	I	1653	ENSP00000243077:V1653I	ENSP00000243077:V1653I	V	+	1	0	0	LRP1	55859597	55859597	1.000000	0.71417	0.993000	0.49108	0.657000	0.38888	6.500000	0.73687	2.480000	0.83734	0.655000	0.94253	GTC	0.831176		TCGA-H6-8124-01A-11D-2396-08	0.632	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.770000	-20.000000	1	0.700000	NM_002332		0	72	72	0	251	247	1		1	1		0	0	60	0	0	1.000000	1	0	26	0	159	0	72	251
DUSP6	1848	broad.mit.edu	37	12	89743153	89743153	+	Missense_Mutation	SNP	C	C	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr12:89743153C>A	ENST00000279488.7	-	3	2255	c.1024G>T	c.(1024-1026)Gac>Tac	p.D342Y	DUSP6_ENST00000547291.1_Missense_Mutation_p.D217Y|DUSP6_ENST00000308385.6_Missense_Mutation_p.D196Y|DUSP6_ENST00000547140.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	342	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						CTCTCGAAGTCCAGCAGCTGA	0.478																																					Colon(132;3456 5224)	ENST00000279488.7	1.000000	9.000000e-01	1	9.400000e-01	0.970000	0.971408	0.970000	0.990000																										0				16						c.(1024-1026)Gac>Tac		dual specificity phosphatase 6							165.0	155.0	159.0					12																	89743153		2203	4300	6503	SO:0001583	missense	1848	0	0					g.chr12:89743153C>A	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.1024G>T	chr12.hg19:g.89743153C>A	ENSP00000279488:p.Asp342Tyr	1					DUSP6_ENST00000308385.6_Missense_Mutation_p.D196Y|DUSP6_ENST00000547291.1_Missense_Mutation_p.D217Y|DUSP6_ENST00000547140.1_5'Flank	p.D342Y	NM_001946.2	NP_001937.2	0	1	1	1.563407	Q16828	DUS6_HUMAN		3	2255	-			O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	1	1	hg19	c.1024G>T	CCDS9033.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333073	0.81801	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000547291	D;D;D	0.86030	-2.06;-2.06;-2.06	5.98	5.98	0.97165	5.98	5.98	0.97165	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.93874	0.8040	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.99	D	0.93919	0.7204	10	0.87932	D	0	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	196;342	Q16828-2;Q16828	.;DUS6_HUMAN	Y	342;196;217	ENSP00000279488:D342Y;ENSP00000307835:D196Y;ENSP00000449838:D217Y	ENSP00000279488:D342Y	D	-	1	0	0	DUSP6	88267284	88267284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.745000	0.85046	2.835000	0.97688	0.650000	0.86243	GAC	0.538462		TCGA-H6-8124-01A-11D-2396-08	0.478	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.770000	-20.000000	1	0.700000	NM_001946, NM_022652		0	269	268	0	227	223	1		1	1		0	0	96	0	0	1.000000	1	0	566	0	67	0	269	227
N4BP2L2	10443	broad.mit.edu	37	13	33110585	33110585	+	Missense_Mutation	SNP	T	T	C			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr13:33110585T>C	ENST00000267068.3	-	2	744	c.580A>G	c.(580-582)Aaa>Gaa	p.K194E	N4BP2L2_ENST00000504114.1_Intron|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.K194E|N4BP2L2_ENST00000399396.3_Intron|N4BP2L2_ENST00000357505.6_Intron	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	194					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TCAGATTCTTTACAACTGTTC	0.299																																						ENST00000267068.3	1.000000	9.400000e-01	1	9.900000e-01	0.990000	0.995890	0.990000	1.000000																										0				16						c.(580-582)Aaa>Gaa		NEDD4 binding protein 2-like 2							59.0	61.0	60.0					13																	33110585		2203	4299	6502	SO:0001583	missense	10443	0	0					g.chr13:33110585T>C	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.580A>G	chr13.hg19:g.33110585T>C	ENSP00000267068:p.Lys194Glu	0					N4BP2L2_ENST00000357505.6_Intron|N4BP2L2_ENST00000504114.1_Intron|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.K194E|N4BP2L2_ENST00000399396.3_Intron	p.K194E	NM_014887.2	NP_055702.1	1	2	3	2.261976	Q92802	N42L2_HUMAN		2	744	-		Lung SC(185;0.0262)	A3KME8	Missense_Mutation	SNP	ENST00000267068.3	1	1	hg19	c.580A>G	CCDS9346.1	1	.	.	.	.	.	.	.	.	.	.	T	10.41	1.342658	0.24339	.	.	ENSG00000244754	ENST00000446957;ENST00000505213;ENST00000267068	T;T;T	0.44083	0.93;0.93;0.93	5.58	2.06	0.26882	5.58	2.06	0.26882	.	.	.	.	.	T	0.36358	0.0964	L	0.53249	1.67	0.09310	N	0.999997	B;B	0.21071	0.051;0.024	B;B	0.16722	0.016;0.007	T	0.34675	-0.9819	9	0.72032	D	0.01	-18.8345	7.1289	0.25488	0.0:0.1463:0.2835:0.5702	.	194;194	D6R968;Q92802	.;N42L2_HUMAN	E	194	ENSP00000394239:K194E;ENSP00000423362:K194E;ENSP00000267068:K194E	ENSP00000267068:K194E	K	-	1	0	0	N4BP2L2	32008585	32008585	0.013000	0.17824	0.763000	0.31416	0.398000	0.30690	0.010000	0.13242	0.405000	0.25532	0.460000	0.39030	AAA	0.706170		TCGA-H6-8124-01A-11D-2396-08	0.299	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.770000	-20.000000	1	0.700000	NM_014887		0	147	145	0	250	249	1		1	1		0	0	19	0	0	1.000000	1	0	48	0	44	0	147	250
SOHLH2	54937	broad.mit.edu	37	13	36744857	36744857	+	Silent	SNP	C	C	T	rs375286456		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr13:36744857C>T	ENST00000379881.3	-	10	1156	c.1068G>A	c.(1066-1068)gcG>gcA	p.A356A	SOHLH2_ENST00000554962.1_Silent_p.A433A|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.A433A	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	356					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		TCAGAGACAGCGCTGCACTGG	0.388																																						ENST00000379881.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999664	0.990000	1.000000																										0				26						c.(1066-1068)gcG>gcA		spermatogenesis and oogenesis specific basic helix-loop-helix 2		C	,	0,4406		0,0,2203	146.0	141.0	143.0		1299,1068	-8.1	0.0	13		143	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SOHLH2,CCDC169-SOHLH2	NM_001198910.1,NM_017826.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	433/503,356/426	36744857	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54937	2	121412	40				g.chr13:36744857C>T	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1068G>A	chr13.hg19:g.36744857C>T		0					SOHLH2_ENST00000554962.1_Silent_p.A433A|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.A433A	p.A356A	NM_017826.2	NP_060296.2	1	2	3	2.261976	Q9NX45	SOLH2_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	10	1156	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	ENST00000379881.3	1	1	hg19	c.1068G>A	CCDS9355.1	1																																																																																								0.706170		TCGA-H6-8124-01A-11D-2396-08	0.388	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	1.770000	-20.000000	1	0.700000	NM_017826		0	301	299	0	495	490	1		1			0	0	85	0	0	1.000000	0	0	0	0	0	0	301	495
COX8C	341947	broad.mit.edu	37	14	93813699	93813699	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr14:93813699G>A	ENST00000342144.2	+	1	163	c.85G>A	c.(85-87)Gcc>Acc	p.A29T	UNC79_ENST00000256339.4_Intron	NM_182971.2	NP_892016.1	Q7Z4L0	COX8C_HUMAN	cytochrome c oxidase subunit VIIIC	29						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			large_intestine(1)|lung(1)|prostate(2)|skin(1)	5		all_cancers(154;0.083)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		TCCCCGCTTCGCCCACTCGGG	0.756																																					GBM(134;630 1800 8342 13106 15419)	ENST00000342144.2	0.230000	4.000000e-02	1.700000e-01	7.000000e-02	0.110000	0.127769	0.110000	0.110000																										0				5						c.(85-87)Gcc>Acc		cytochrome c oxidase subunit VIIIC							9.0	10.0	10.0					14																	93813699		2162	4150	6312	SO:0001583	missense	341947	2	116578	32				g.chr14:93813699G>A	AY161004	CCDS9910.1	14q32.13	2011-07-04	2011-05-25			ENSG00000187581		"""Mitochondrial respiratory chain complex / Complex IV"""	24382	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit VIII isoform 3"""		"""cytochrome c oxidase subunit 8C"""			12909344	Standard	NM_182971		Approved	COX8-3	uc001ybt.1	Q7Z4L0		ENST00000342144.2:c.85G>A	chr14.hg19:g.93813699G>A	ENSP00000340568:p.Ala29Thr	0					UNC79_ENST00000256339.4_Intron	p.A29T	NM_182971.2	NP_892016.1	0	0	0	2.150613	Q7Z4L0	COX8C_HUMAN		1	163	+		all_cancers(154;0.083)	Q495K7	Missense_Mutation	SNP	ENST00000342144.2	0	1	hg19	c.85G>A	CCDS9910.1	0	.	.	.	.	.	.	.	.	.	.	G	7.584	0.669319	0.14776	.	.	ENSG00000187581	ENST00000342144	.	.	.	2.6	-2.3	0.06785	2.6	-2.3	0.06785	.	.	.	.	.	T	0.26448	0.0646	.	.	.	0.09310	N	1	B	0.15719	0.014	B	0.16289	0.015	T	0.26430	-1.0103	7	0.62326	D	0.03	.	3.5519	0.07850	0.4705:0.2318:0.2978:0.0	.	29	Q7Z4L0	COX8C_HUMAN	T	29	.	ENSP00000340568:A29T	A	+	1	0	0	COX8C	92883452	92883452	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.535000	0.02210	-0.438000	0.07232	-0.361000	0.07541	GCC	0.697885		TCGA-H6-8124-01A-11D-2396-08	0.756	COX8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412769.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	31	1	1.770000	-9.237671	1	0.700000	NM_182971		0	6	6	0	147	112	0		1			0	0	33	0	0	0.927728	0	0	0	0	0	0	6	147
TP53	7157	broad.mit.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	9.000000e-01	1	9.400000e-01	0.970000	0.976208	0.970000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	24185	GRCh37	CM034930	TP53	M		c.(712-714)tGt>tAt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						132.0	103.0	113.0					17																	7577568		2203	4300	6503	SO:0001583	missense	7157	3	121412	28	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577568C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	chr17.hg19:g.7577568C>T	ENSP00000269305:p.Cys238Tyr	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000413465.2_Missense_Mutation_p.C238Y	p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.314500	P04637	P53_HUMAN		7	902	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.713G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	0	TP53	7518293	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	0.538462		TCGA-H6-8124-01A-11D-2396-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	94	1	1.770000	-20.000000	1	0.700000	NM_000546		0	144	141	0	103	100	1		1	1	1	0	0	96	986	0	1.000000	1	1	54	176	31	175	144	103
MYH13	8735	broad.mit.edu	37	17	10212619	10212619	+	Missense_Mutation	SNP	G	G	A	rs200612449		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr17:10212619G>A	ENST00000418404.3	-	34	5264	c.5101C>T	c.(5101-5103)Cgg>Tgg	p.R1701W	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.R1701W			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1701					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTGCGGGTCCGCTCCGTCTGT	0.657																																						ENST00000418404.3	1.000000	7.700000e-01	1	8.500000e-01	0.940000	0.933538	0.940000	1.000000																										0				108						c.(5101-5103)Cgg>Tgg		myosin, heavy chain 13, skeletal muscle							27.0	29.0	29.0					17																	10212619		2128	4252	6380	SO:0001583	missense	8735	0	0					g.chr17:10212619G>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5101C>T	chr17.hg19:g.10212619G>A	ENSP00000404570:p.Arg1701Trp	0					RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.R1701W	p.R1701W			0	0	0	2.142607	Q9UKX3	MYH13_HUMAN		34	5264	-			O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	1	0	hg19	c.5101C>T	CCDS45613.1	1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504479	0.64410	.	.	ENSG00000006788	ENST00000252172	D	0.85013	-1.93	4.45	-3.48	0.04739	4.45	-3.48	0.04739	Myosin tail (1);	.	.	.	.	D	0.94958	0.8369	H	0.98525	4.255	0.31829	N	0.624973	D	0.89917	1.0	D	0.91635	0.999	D	0.94056	0.7322	9	0.87932	D	0	.	16.6484	0.85182	0.0:0.0:0.3441:0.6559	.	1701	Q9UKX3	MYH13_HUMAN	W	1701	ENSP00000252172:R1701W	ENSP00000252172:R1701W	R	-	1	2	2	MYH13	10153344	10153344	0.078000	0.21339	0.985000	0.45067	0.779000	0.44077	-0.555000	0.05999	-0.297000	0.08934	-0.182000	0.12963	CGG	0.695740		TCGA-H6-8124-01A-11D-2396-08	0.657	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	1	0	1	2	2	2	2	0	0	0	0	67	67	67	66	1	1.770000	-2.239613	0	0.700000	NM_003802		0	74	73	0	146	144	1		1			0	0	67	0	0	1.000000	0	0	0	0	0	0	74	146
SLC1A6	6511	broad.mit.edu	37	19	15083616	15083616	+	Missense_Mutation	SNP	C	C	T	rs372266621		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr19:15083616C>T	ENST00000221742.3	-	1	114	c.107G>A	c.(106-108)cGc>cAc	p.R36H	SLC1A6_ENST00000598504.1_Missense_Mutation_p.R36H|SLC1A6_ENST00000600144.1_Missense_Mutation_p.R36H|SLC1A6_ENST00000544886.2_Missense_Mutation_p.R36H|SLC1A6_ENST00000430939.2_Silent_p.A40A	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	36					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CAGGCGCGTGCGCAGTGCTCT	0.677																																						ENST00000221742.3	0.160000	2.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.083323	0.070000	0.070000																										0				42						c.(106-108)cGc>cAc		solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6		C	HIS/ARG	0,4404		0,0,2202	18.0	20.0	19.0		107	4.5	1.0	19		19	1,8593		0,1,4296	no	missense	SLC1A6	NM_005071.1	29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	36/565	15083616	1,12997	2202	4297	6499	SO:0001583	missense	6511	8	121192	37				g.chr19:15083616C>T		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.107G>A	chr19.hg19:g.15083616C>T	ENSP00000221742:p.Arg36His	1					SLC1A6_ENST00000598504.1_Missense_Mutation_p.R36H|SLC1A6_ENST00000430939.2_Silent_p.A40A|SLC1A6_ENST00000544886.2_Missense_Mutation_p.R36H|SLC1A6_ENST00000600144.1_Missense_Mutation_p.R36H	p.R36H	NM_005071.1	NP_005062.1	0	1	1	1.405512	P48664	EAA4_HUMAN		1	114	-			Q8N753	Missense_Mutation	SNP	ENST00000221742.3	0	1	hg19	c.107G>A	CCDS12321.1	0	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053905	0.55218	0.0	1.16E-4	ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610	T;T	0.56776	0.44;1.18	4.46	4.46	0.54185	4.46	4.46	0.54185	.	0.153858	0.50627	D	0.000114	T	0.53077	0.1774	N	0.24115	0.695	0.43390	D	0.995506	D;D;D	0.76494	0.999;0.999;0.998	P;P;P	0.60236	0.871;0.871;0.769	T	0.53408	-0.8443	10	0.44086	T	0.13	-13.3673	12.4519	0.55681	0.0:1.0:0.0:0.0	.	36;37;36	Q8N753;Q59GB0;P48664	.;.;EAA4_HUMAN	H	36;36;37	ENSP00000221742:R36H;ENSP00000446175:R36H	ENSP00000221742:R36H	R	-	2	0	0	SLC1A6	14944616	14944616	1.000000	0.71417	1.000000	0.80357	0.263000	0.26337	3.133000	0.50531	2.306000	0.77630	0.313000	0.20887	CGC	0.548193		TCGA-H6-8124-01A-11D-2396-08	0.677	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	0	0	1	2	12	2	2	1	1	1	1	34	34	34	34	1	1.770000	-7.628079	1	0.700000	NM_005071		0	4	4	0	107	106	0		0			1	0	34	0	0	0.030501	0	0	0	0	0	0	4	107
MYO9B	4650	broad.mit.edu	37	19	17213029	17213029	+	Missense_Mutation	SNP	C	C	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr19:17213029C>A	ENST00000594824.1	+	2	649	c.502C>A	c.(502-504)Cac>Aac	p.H168N	MYO9B_ENST00000593411.1_3'UTR|MYO9B_ENST00000397274.2_Missense_Mutation_p.H168N|MYO9B_ENST00000595618.1_Missense_Mutation_p.H168N|CTD-2528A14.5_ENST00000597045.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	168	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GAACCTCAAGCACCGCTTCCT	0.572																																						ENST00000594824.1	1.000000	8.700000e-01	9.900000e-01	9.100000e-01	0.940000	0.952117	0.940000	1.000000																										0				39						c.(502-504)Cac>Aac		myosin IXB							132.0	134.0	133.0					19																	17213029		2063	4212	6275	SO:0001583	missense	4650	0	0					g.chr19:17213029C>A		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.502C>A	chr19.hg19:g.17213029C>A	ENSP00000471367:p.His168Asn	1					CTD-2528A14.5_ENST00000597045.1_RNA|MYO9B_ENST00000397274.2_Missense_Mutation_p.H168N|MYO9B_ENST00000593411.1_3'UTR|MYO9B_ENST00000595618.1_Missense_Mutation_p.H168N	p.H168N			0	1	1	1.405512	Q13459	MYO9B_HUMAN		2	649	+			O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	1	1	hg19	c.502C>A		1	.	.	.	.	.	.	.	.	.	.	C	1.069	-0.670350	0.03403	.	.	ENSG00000099331	ENST00000397274	D	0.86956	-2.19	5.62	4.59	0.56863	5.62	4.59	0.56863	Myosin head, motor domain (2);	0.714976	0.12174	N	0.492731	T	0.71634	0.3363	N	0.05467	-0.045	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.001;0.001;0.004	T	0.57183	-0.7855	10	0.14656	T	0.56	.	7.2307	0.26040	0.0:0.7392:0.0:0.2608	.	168;168;174	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	N	168	ENSP00000380444:H168N	ENSP00000380444:H168N	H	+	1	0	0	MYO9B	17074029	17074029	0.006000	0.16342	0.261000	0.24466	0.994000	0.84299	0.110000	0.15437	1.376000	0.46267	0.655000	0.94253	CAC	0.548193		TCGA-H6-8124-01A-11D-2396-08	0.572	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1	1	0	1	2	2	2	2	0	0	0	0	212	212	212	210	1	1.770000	-20.000000	1	0.700000			0	328	323	0	323	316	1		1	1		0	0	212	0	0	1.000000	1	0	13	0	26	0	328	323
ZNF585A	199704	broad.mit.edu	37	19	37644488	37644488	+	Missense_Mutation	SNP	T	T	C			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr19:37644488T>C	ENST00000356958.4	-	5	571	c.313A>G	c.(313-315)Aat>Gat	p.N105D	ZNF585A_ENST00000292841.5_Missense_Mutation_p.N50D|ZNF585A_ENST00000355533.2_Missense_Mutation_p.N50D|ZNF585A_ENST00000392157.2_Missense_Mutation_p.N50D|ZNF585A_ENST00000588723.1_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTACATTGATTATGGTCCCAT	0.323																																						ENST00000356958.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				42						c.(313-315)Aat>Gat		zinc finger protein 585A							119.0	124.0	122.0					19																	37644488		2202	4300	6502	SO:0001583	missense	199704	0	0					g.chr19:37644488T>C	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.313A>G	chr19.hg19:g.37644488T>C	ENSP00000349440:p.Asn105Asp	1					ZNF585A_ENST00000355533.2_Missense_Mutation_p.N50D|ZNF585A_ENST00000292841.5_Missense_Mutation_p.N50D|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.N50D	p.N105D			1	2	3	2.772088	Q6P3V2	Z585A_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	571	-			Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	1	1	hg19	c.313A>G		1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.136367	0.37728	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157;ENST00000355533	T;T;T;T	0.27402	3.3;3.34;3.34;1.67	3.76	2.71	0.32032	3.76	2.71	0.32032	.	1.711460	0.03779	U	0.261004	T	0.24470	0.0593	L	0.31804	0.96	0.09310	N	1	B	0.20164	0.042	B	0.24006	0.05	T	0.22312	-1.0220	10	0.27082	T	0.32	.	5.4867	0.16753	0.0:0.1002:0.1734:0.7264	.	105	Q6P3V2	Z585A_HUMAN	D	105;50;50;50	ENSP00000349440:N105D;ENSP00000292841:N50D;ENSP00000375998:N50D;ENSP00000347724:N50D	ENSP00000292841:N50D	N	-	1	0	0	ZNF585A	42336328	42336328	0.000000	0.05858	0.179000	0.23059	0.102000	0.19082	-0.109000	0.10840	0.567000	0.29293	0.533000	0.62120	AAT	0.766264		TCGA-H6-8124-01A-11D-2396-08	0.323	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	59	1	1.770000	-20.000000	1	0.700000	NM_152655		0	630	624	0	600	600	1		1	1		0	0	61	0	0	1.000000	7.046121e-01	0	3	0	1	0	630	600
FCGBP	8857	broad.mit.edu	37	19	40363276	40363276	+	Missense_Mutation	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr19:40363276C>T	ENST00000221347.6	-	32	14801	c.14794G>A	c.(14794-14796)Gag>Aag	p.E4932K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4932	VWFD 12. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCACAGCCTCGCCGTCCACG	0.652																																						ENST00000221347.6	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				165						c.(14794-14796)Gag>Aag		Fc fragment of IgG binding protein							14.0	18.0	17.0					19																	40363276		2175	4261	6436	SO:0001583	missense	8857	1	120874	30				g.chr19:40363276C>T	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14794G>A	chr19.hg19:g.40363276C>T	ENSP00000221347:p.Glu4932Lys	1						p.E4932K	NM_003890.2	NP_003881.2	1	2	3	2.772088	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)	32	14801	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		O95784	Missense_Mutation	SNP	ENST00000221347.6	1	1	hg19	c.14794G>A	CCDS12546.1	1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591238	0.28357	.	.	ENSG00000090920	ENST00000221347	T	0.58210	0.35	5.05	4.0	0.46444	5.05	4.0	0.46444	von Willebrand factor, type D domain (3);	0.000000	0.64402	U	0.000001	T	0.58595	0.2133	L	0.48642	1.525	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.50482	-0.8823	10	0.06891	T	0.86	.	11.216	0.48827	0.0:0.8151:0.1849:0.0	.	4932	Q9Y6R7	FCGBP_HUMAN	K	4932	ENSP00000221347:E4932K	ENSP00000221347:E4932K	E	-	1	0	0	FCGBP	45055116	45055116	0.037000	0.19845	0.071000	0.20095	0.946000	0.59487	3.060000	0.49955	1.326000	0.45319	0.313000	0.20887	GAG	0.766264		TCGA-H6-8124-01A-11D-2396-08	0.652	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	1.770000	-20.000000	1	0.700000	NM_003890		0	116	116	0	106	103	1		1	1		0	0	36	0	0	1.000000	1	0	11	0	66	0	116	106
IGSF8	93185	broad.mit.edu	37	1	160063798	160063798	+	Missense_Mutation	SNP	A	A	C			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr1:160063798A>C	ENST00000368086.1	-	3	822	c.606T>G	c.(604-606)ttT>ttG	p.F202L	IGSF8_ENST00000460351.1_5'UTR|IGSF8_ENST00000314485.7_Missense_Mutation_p.F202L			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	202	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CAGATCGCCCAAAGGACACTG	0.637																																						ENST00000368086.1	1.000000	7.900000e-01	9.500000e-01	8.400000e-01	0.890000	0.899220	0.890000	0.890000																										0				33						c.(604-606)ttT>ttG		immunoglobulin superfamily, member 8							96.0	89.0	91.0					1																	160063798		2203	4300	6503	SO:0001583	missense	93185	0	0					g.chr1:160063798A>C	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.606T>G	chr1.hg19:g.160063798A>C	ENSP00000357065:p.Phe202Leu	0					IGSF8_ENST00000460351.1_5'UTR|IGSF8_ENST00000314485.7_Missense_Mutation_p.F202L	p.F202L			0	0	0	2.144885	Q969P0	IGSF8_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)	3	822	-	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	1	1	hg19	c.606T>G	CCDS1195.1	1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297471	0.60086	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475;ENST00000448417	T;T;T	0.21932	1.98;1.98;1.98	3.88	-1.42	0.08913	3.88	-1.42	0.08913	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.156351	0.41938	D	0.000796	T	0.14356	0.0347	L	0.29908	0.895	0.48830	D	0.999713	D	0.76494	0.999	D	0.80764	0.994	T	0.14420	-1.0473	10	0.72032	D	0.01	-3.709	5.1525	0.15017	0.4767:0.1584:0.3649:0.0	.	202	Q969P0	IGSF8_HUMAN	L	202	ENSP00000316664:F202L;ENSP00000357065:F202L;ENSP00000397464:F202L	ENSP00000316664:F202L	F	-	3	2	2	IGSF8	158330422	158330422	0.968000	0.33430	0.906000	0.35671	0.836000	0.47400	0.137000	0.15995	-0.375000	0.07955	-0.438000	0.05819	TTT	0.697885		TCGA-H6-8124-01A-11D-2396-08	0.637	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	1	0	1	2	2	2	2	0	0	0	0	163	163	163	161	1	1.770000	-20.000000	1	0.700000	NM_052868		0	192	186	0	414	410	1		1	1		0	0	163	0	0	1.000000	1	0	59	0	67	0	192	414
PANK4	55229	broad.mit.edu	37	1	2444410	2444410	+	Silent	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr1:2444410C>T	ENST00000378466.3	-	13	1656	c.1644G>A	c.(1642-1644)ctG>ctA	p.L548L	PANK4_ENST00000435556.3_Silent_p.L509L	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	548					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CCTCCCAGCCCAGCGCGTCCA	0.677																																						ENST00000378466.3	1.000000	8.800000e-01	1	9.200000e-01	0.970000	0.967722	0.970000	1.000000																										0				23						c.(1642-1644)ctG>ctA		pantothenate kinase 4							78.0	86.0	83.0					1																	2444410		2203	4297	6500	SO:0001819	synonymous_variant	55229	0	0					g.chr1:2444410C>T	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1644G>A	chr1.hg19:g.2444410C>T		0					PANK4_ENST00000435556.3_Silent_p.L509L	p.L548L	NM_018216.1	NP_060686.1	1	2	3	2.188926	Q9NVE7	PANK4_HUMAN		13	1656	-	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Silent	SNP	ENST00000378466.3	1	1	hg19	c.1644G>A	CCDS42.1	1																																																																																								0.701046		TCGA-H6-8124-01A-11D-2396-08	0.677	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1	1	0	1	2	2	2	2	0	0	0	0	294	294	294	289	1	1.770000	-20.000000	1	0.700000			0	330	326	0	640	626	1		1	1		0	0	294	0	0	1.000000	9.999485e-01	0	6	0	25	0	330	640
AJAP1	55966	broad.mit.edu	37	1	4772528	4772528	+	Missense_Mutation	SNP	G	G	A	rs138033447		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr1:4772528G>A	ENST00000378191.4	+	2	979	c.598G>A	c.(598-600)Gtt>Att	p.V200I	AJAP1_ENST00000378190.3_Missense_Mutation_p.V200I	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	200	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ATTTCCGGGCGTTTACGGCCC	0.652																																						ENST00000378191.4	1.000000	8.700000e-01	1	9.800000e-01	0.990000	0.988793	0.990000	1.000000																										0				24						c.(598-600)Gtt>Att		adherens junctions associated protein 1		G	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	37.0	35.0	35.0		598,598	-10.1	0.0	1	dbSNP_134	35	0,8598		0,0,4299	no	missense,missense	AJAP1	NM_001042478.1,NM_018836.3	29,29	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	200/412,200/412	4772528	1,13003	2203	4299	6502	SO:0001583	missense	55966	1	121344	29				g.chr1:4772528G>A	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.598G>A	chr1.hg19:g.4772528G>A	ENSP00000367433:p.Val200Ile	0					AJAP1_ENST00000378190.3_Missense_Mutation_p.V200I	p.V200I	NM_018836.3	NP_061324.1	1	2	3	2.188926	Q9UKB5	AJAP1_HUMAN		2	979	+	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	1	1	hg19	c.598G>A	CCDS54.1	1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.194097	0.00026	2.27E-4	0.0	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.40225	1.04;1.04	5.04	-10.1	0.00402	5.04	-10.1	0.00402	.	1.402030	0.05157	N	0.497146	T	0.11239	0.0274	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09122	-1.0689	10	0.02654	T	1	3.1249	2.9387	0.05823	0.0974:0.3502:0.3527:0.1997	.	200	Q9UKB5	AJAP1_HUMAN	I	200	ENSP00000367432:V200I;ENSP00000367433:V200I	ENSP00000367432:V200I	V	+	1	0	0	AJAP1	4672388	4672388	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	-3.993000	0.00318	-6.103000	0.00006	-0.657000	0.03884	GTT	0.701046		TCGA-H6-8124-01A-11D-2396-08	0.652	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.770000	-20.000000	1	0.700000	NM_018836		0	55	55	0	88	84	1		1	0		0	0	42	0	0	1.000000	0	0	0	0	1	0	55	88
DEPDC1	55635	broad.mit.edu	37	1	68952619	68952619	+	Splice_Site	SNP	C	C	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr1:68952619C>A	ENST00000456315.2	-	6	884		c.e6+1		DEPDC1_ENST00000370966.5_Splice_Site	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1						intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		ATTTAACTTACAATTTGCTAG	0.328																																						ENST00000456315.2	1.000000	7.500000e-01	9.600000e-01	8.100000e-01	0.880000	0.888090	0.880000	0.880000																										0				13						c.e6+1		DEP domain containing 1							52.0	55.0	54.0					1																	68952619		2202	4299	6501	SO:0001630	splice_region_variant	55635	0	0					g.chr1:68952619C>A	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.769+1G>T	chr1.hg19:g.68952619C>A		0					DEPDC1_ENST00000370966.5_Splice_Site		NM_001114120.1	NP_001107592.1	1	2	3	2.225223	Q5TB30	DEP1A_HUMAN		6	884	-			A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Splice_Site	SNP	ENST00000456315.2	1	1	hg19		CCDS44159.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196068	0.78902	.	.	ENSG00000024526	ENST00000456315;ENST00000370966;ENST00000370964	.	.	.	5.38	5.38	0.77491	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1258	0.93384	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	DEPDC1	68725207	68725207	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	6.994000	0.76251	2.534000	0.85438	0.585000	0.79938	.	0.704142		TCGA-H6-8124-01A-11D-2396-08	0.328	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	1	0	1	2	2	2	2	0	0	0	0	39	39	39	27	1	1.770000	-20.000000	1	0.700000	NM_017779	Intron	0	123	116	0	280	263	1		1			0	0	39	0	0	1.000000	0	0	0	0	0	0	123	280
KLHDC8A	55220	broad.mit.edu	37	1	205312365	205312365	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr1:205312365G>A	ENST00000367156.3	-	5	1184	c.368C>T	c.(367-369)aCg>aTg	p.T123M	KLHDC8A_ENST00000539253.1_Missense_Mutation_p.T123M|KLHDC8A_ENST00000537168.1_Intron|KLHDC8A_ENST00000460687.1_Intron|KLHDC8A_ENST00000606529.1_5'Flank|KLHDC8A_ENST00000367155.3_Missense_Mutation_p.T123M	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	123										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GCCTTTGGCCGTGACAGAAAT	0.592																																						ENST00000367156.3	1.000000	8.900000e-01	1	9.400000e-01	0.990000	0.979284	0.990000	1.000000																										0				14						c.(367-369)aCg>aTg		kelch domain containing 8A							66.0	65.0	65.0					1																	205312365		2196	4288	6484	SO:0001583	missense	55220	0	0					g.chr1:205312365G>A		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.368C>T	chr1.hg19:g.205312365G>A	ENSP00000356124:p.Thr123Met	0					KLHDC8A_ENST00000367155.3_Missense_Mutation_p.T123M|KLHDC8A_ENST00000537168.1_Intron|KLHDC8A_ENST00000539253.1_Missense_Mutation_p.T123M|KLHDC8A_ENST00000460687.1_Intron|KLHDC8A_ENST00000606529.1_5'Flank	p.T123M	NM_001271863.1	NP_001258792.1	1	2	3	2.235718	Q8IYD2	KLD8A_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.117)	5	1184	-	Breast(84;0.23)		B3KU70|Q9NVG5	Missense_Mutation	SNP	ENST00000367156.3	1	1	hg19	c.368C>T	CCDS30985.1	1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461883	0.63513	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253	T;T;T	0.67865	-0.29;-0.29;-0.29	5.65	5.65	0.86999	5.65	5.65	0.86999	Kelch-type beta propeller (1);	0.147910	0.64402	D	0.000012	T	0.67813	0.2933	L	0.59436	1.845	0.53688	D	0.999975	D	0.56287	0.975	B	0.43225	0.412	T	0.72931	-0.4142	10	0.66056	D	0.02	-13.9286	19.3222	0.94246	0.0:0.0:1.0:0.0	.	123	Q8IYD2	KLD8A_HUMAN	M	123	ENSP00000356123:T123M;ENSP00000356124:T123M;ENSP00000442229:T123M	ENSP00000356123:T123M	T	-	2	0	0	KLHDC8A	203578988	203578988	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.523000	0.67099	2.646000	0.89796	0.655000	0.94253	ACG	0.704142		TCGA-H6-8124-01A-11D-2396-08	0.592	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	1	0	1	2	15	2	2	1	1	1	1	187	187	187	186	1	1.770000	-20.000000	1	0.700000	NM_018203		0	271	266	0	517	512	1		1	0		1	0	187	0	0	1.000000	5.601188e-01	0	0	0	5	0	271	517
XKR7	343702	broad.mit.edu	37	20	30584387	30584387	+	Silent	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr20:30584387C>T	ENST00000562532.2	+	3	1041	c.867C>T	c.(865-867)gaC>gaT	p.D289D		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	289						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ACTCGCGGGACGACAAGCGGC	0.701																																						ENST00000562532.2	0.910000	6.100000e-01	8.400000e-01	6.800000e-01	0.760000	0.767773	0.760000	0.770000																										0				34						c.(865-867)gaC>gaT		XK, Kell blood group complex subunit-related family, member 7							31.0	32.0	31.0					20																	30584387		2203	4300	6503	SO:0001819	synonymous_variant	343702	0	0					g.chr20:30584387C>T	AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.867C>T	chr20.hg19:g.30584387C>T		0						p.D289D	NM_001011718.1	NP_001011718.1	0	0	0	2.158459	Q5GH72	XKR7_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)	3	1041	+			Q9NUG5	Silent	SNP	ENST00000562532.2	1	1	hg19	c.867C>T	CCDS33459.1	0																																																																																								0.697885		TCGA-H6-8124-01A-11D-2396-08	0.701	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078597.3	1	0	1	2	2	2	2	0	0	0	0	72	72	72	71	1	1.770000	-20.000000	1	0.700000	NM_001011718		0	73	72	0	198	193	0		1			0	0	72	0	0	1.000000	0	0	0	0	0	0	73	198
PXDN	7837	broad.mit.edu	37	2	1670184	1670184	+	Missense_Mutation	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr2:1670184C>T	ENST00000252804.4	-	10	1143	c.1093G>A	c.(1093-1095)Gcc>Acc	p.A365T	PXDN_ENST00000483018.1_5'UTR	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	365	Ig-like C2-type 2.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TGGCCTGTGGCGCTGCACTCC	0.587																																						ENST00000252804.4	0.520000	2.100000e-01	4.400000e-01	2.700000e-01	0.350000	0.363904	0.350000	0.350000																										0				112						c.(1093-1095)Gcc>Acc		peroxidasin homolog (Drosophila)							26.0	29.0	28.0					2																	1670184		2026	4173	6199	SO:0001583	missense	7837	0	0					g.chr2:1670184C>T	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1093G>A	chr2.hg19:g.1670184C>T	ENSP00000252804:p.Ala365Thr	1					PXDN_ENST00000483018.1_5'UTR	p.A365T	NM_012293.1	NP_036425.1	0	1	1	1.893316	Q92626	PXDN_HUMAN		10	1143	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	1	1	hg19	c.1093G>A	CCDS46221.1	0	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587546	0.66105	.	.	ENSG00000130508	ENST00000252804	T	0.68331	-0.32	5.09	4.21	0.49690	5.09	4.21	0.49690	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.176187	0.49916	N	0.000139	T	0.73976	0.3656	M	0.67625	2.065	0.46542	D	0.999097	D;B	0.64830	0.994;0.127	P;B	0.59761	0.863;0.178	T	0.75243	-0.3386	10	0.87932	D	0	-31.0361	7.7167	0.28708	0.1612:0.756:0.0:0.0828	.	365;365	Q92626-2;Q92626	.;PXDN_HUMAN	T	365	ENSP00000252804:A365T	ENSP00000252804:A365T	A	-	1	0	0	PXDN	1649191	1649191	1.000000	0.71417	0.987000	0.45799	0.734000	0.41952	4.819000	0.62664	1.140000	0.42260	0.655000	0.94253	GCC	0.648300		TCGA-H6-8124-01A-11D-2396-08	0.587	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	49	1	1.770000	-20.000000	1	0.700000	XM_056455		0	17	17	0	101	98	1		1	0		0	0	52	0	0	0.999970	9.991124e-01	0	0	0	74	0	17	101
PLCD4	84812	broad.mit.edu	37	2	219500518	219500518	+	Splice_Site	SNP	G	G	C			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr2:219500518G>C	ENST00000450993.2	+	14	2235		c.e14-1		PLCD4_ENST00000432688.1_Splice_Site|PLCD4_ENST00000417849.1_Splice_Site|RP11-548H3.1_ENST00000607946.1_RNA	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4						acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCTGACTACAGGTGATCAGCG	0.532																																						ENST00000450993.2	1.000000	8.900000e-01	1	9.900000e-01	0.990000	0.992078	0.990000	1.000000																										0				23						c.e14-1		phospholipase C, delta 4							40.0	42.0	41.0					2																	219500518		1940	4137	6077	SO:0001630	splice_region_variant	84812	0	0					g.chr2:219500518G>C	AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1897-1G>C	chr2.hg19:g.219500518G>C		1					PLCD4_ENST00000417849.1_Splice_Site|RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000432688.1_Splice_Site		NM_032726.3	NP_116115.1	0	1	1	1.853026	Q9BRC7	PLCD4_HUMAN		14	2235	+		Renal(207;0.0915)	Q53FS8	Splice_Site	SNP	ENST00000450993.2	1	1	hg19		CCDS46516.1	1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774719	0.70107	.	.	ENSG00000115556	ENST00000450993;ENST00000417849;ENST00000432688	.	.	.	4.85	4.85	0.62838	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1177	0.89561	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	PLCD4	219208762	219208762	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	9.601000	0.98297	2.676000	0.91093	0.655000	0.94253	.	0.643917		TCGA-H6-8124-01A-11D-2396-08	0.532	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	1.770000	-20.000000	1	0.700000		Intron	0	48	47	0	54	53	1		1	1		0	0	23	0	0	1.000000	7.685852e-01	0	2	0	3	0	48	54
CELSR3	1951	broad.mit.edu	37	3	48699138	48699138	+	Silent	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr3:48699138C>T	ENST00000164024.4	-	1	1210	c.930G>A	c.(928-930)gcG>gcA	p.A310A	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Silent_p.A310A	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	310					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A310A(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGCCCGGTTCGCCGAGGTTA	0.706																																						ENST00000164024.4	0.560000	3.900000e-01	5.200000e-01	4.300000e-01	0.470000	0.480554	0.470000	0.480000																										1	Substitution - coding silent(1)	p.A310A(1)	large_intestine(1)	83						c.(928-930)gcG>gcA		cadherin, EGF LAG seven-pass G-type receptor 3							37.0	42.0	40.0					3																	48699138		2184	4249	6433	SO:0001819	synonymous_variant	1951	0	0					g.chr3:48699138C>T	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.930G>A	chr3.hg19:g.48699138C>T		0					RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Silent_p.A310A	p.A310A	NM_001407.2	NP_001398.2	0	0	0	2.171377	Q9NYQ7	CELR3_HUMAN		1	1210	-			O75092	Silent	SNP	ENST00000164024.4	1	1	hg19	c.930G>A	CCDS2775.1	0																																																																																								0.700000		TCGA-H6-8124-01A-11D-2396-08	0.706	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	1	0	1	2	13	2	2	1	1	1	1	180	180	180	178	1	1.770000	-3.027413	1	0.700000	NM_001407		0	101	100	0	503	499	1		1	0	1	1	0	180	50	0	1.000000	2.675188e-01	9.999669e-01	0	18	6	57	101	503
TOPBP1	11073	broad.mit.edu	37	3	133327737	133327737	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr3:133327737G>A	ENST00000260810.5	-	26	4374	c.4243C>T	c.(4243-4245)Ctt>Ttt	p.L1415F		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1415	BRCT 8. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						CCTGACTGAAGAAGGCGTTTG	0.368								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	ENST00000260810.5	1.000000	7.600000e-01	1	8.400000e-01	0.920000	0.923053	0.920000	1.000000																										0				40						c.(4243-4245)Ctt>Ttt	Other conserved DNA damage response genes	topoisomerase (DNA) II binding protein 1							71.0	69.0	69.0					3																	133327737		1850	4089	5939	SO:0001583	missense	11073	0	0					g.chr3:133327737G>A	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.4243C>T	chr3.hg19:g.133327737G>A	ENSP00000260810:p.Leu1415Phe	0						p.L1415F	NM_007027.3	NP_008958.2	0	0	0	2.171377	Q92547	TOPB1_HUMAN		26	4374	-			B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	1	1	hg19	c.4243C>T	CCDS46919.1	1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819176	0.90873	.	.	ENSG00000163781	ENST00000260810	T	0.28069	1.63	5.57	5.57	0.84162	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.60741	0.2292	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62358	-0.6871	10	0.52906	T	0.07	.	19.5504	0.95315	0.0:0.0:1.0:0.0	.	1415	Q92547	TOPB1_HUMAN	F	1415	ENSP00000260810:L1415F	ENSP00000260810:L1415F	L	-	1	0	0	TOPBP1	134810427	134810427	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.006000	0.88564	2.612000	0.88384	0.655000	0.94253	CTT	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.368	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	11	1	1.770000	-20.000000	1	0.700000	NM_007027		0	86	87	0	178	176	1		1	1		0	0	12	0	0	1.000000	1	0	29	0	33	0	86	178
ZFYVE28	57732	broad.mit.edu	37	4	2306490	2306490	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr4:2306490G>A	ENST00000290974.2	-	8	1916	c.1577C>T	c.(1576-1578)tCc>tTc	p.S526F	RP11-478C1.7_ENST00000510632.1_RNA|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.S456F|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.S496F	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	526					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						AGAGTCCAGGGAAGTGGGCGA	0.667																																						ENST00000290974.2	1.000000	7.500000e-01	9.300000e-01	8.000000e-01	0.860000	0.871507	0.860000	0.860000																										0				31						c.(1576-1578)tCc>tTc		zinc finger, FYVE domain containing 28							38.0	42.0	41.0					4																	2306490		2200	4282	6482	SO:0001583	missense	57732	0	0					g.chr4:2306490G>A	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1577C>T	chr4.hg19:g.2306490G>A	ENSP00000290974:p.Ser526Phe	0					ZFYVE28_ENST00000515312.1_Missense_Mutation_p.S456F|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.S496F|RP11-478C1.7_ENST00000510632.1_RNA	p.S526F	NM_020972.2	NP_066023.2	1	2	3	2.239288	Q9HCC9	LST2_HUMAN		8	1916	-			B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	1	1	hg19	c.1577C>T	CCDS33942.1	1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420143	0.42918	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.60424	0.21;0.19;0.21	4.21	3.37	0.38596	4.21	3.37	0.38596	.	0.815729	0.11518	N	0.556019	T	0.51601	0.1684	L	0.50333	1.59	0.09310	N	1	B;P	0.45902	0.004;0.868	B;B	0.43052	0.007;0.406	T	0.46359	-0.9197	10	0.72032	D	0.01	.	6.0708	0.19887	0.1057:0.2096:0.6846:0.0	.	496;526	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	F	526;496;456	ENSP00000290974:S526F;ENSP00000425706:S496F;ENSP00000426299:S456F	ENSP00000290974:S526F	S	-	2	0	0	ZFYVE28	2276288	2276288	0.032000	0.19561	0.001000	0.08648	0.011000	0.07611	2.501000	0.45389	0.997000	0.38969	0.306000	0.20318	TCC	0.704142		TCGA-H6-8124-01A-11D-2396-08	0.667	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	1	0	1	2	2	2	2	0	0	0	0	138	138	138	137	1	1.770000	-20.000000	1	0.700000	XM_035371		0	163	161	0	382	378	1		1	1		0	0	138	0	0	1.000000	4.710303e-01	0	2	0	3	0	163	382
GRID2	2895	broad.mit.edu	37	4	94006305	94006305	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr4:94006305G>A	ENST00000282020.4	+	3	662	c.404G>A	c.(403-405)cGg>cAg	p.R135Q	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Intron	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	135					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGACTCACCCGGAGCAACAGG	0.537																																						ENST00000282020.4	1.000000	8.500000e-01	1	9.000000e-01	0.960000	0.958031	0.960000	1.000000																										0				100						c.(403-405)cGg>cAg		glutamate receptor, ionotropic, delta 2							109.0	98.0	102.0					4																	94006305		2203	4300	6503	SO:0001583	missense	2895	0	0					g.chr4:94006305G>A	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.404G>A	chr4.hg19:g.94006305G>A	ENSP00000282020:p.Arg135Gln	0					GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Intron	p.R135Q	NM_001510.2	NP_001501.2	1	2	3	2.239288	O43424	GRID2_HUMAN		3	662	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	1	1	hg19	c.404G>A	CCDS3637.1	1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783512	0.70222	.	.	ENSG00000152208	ENST00000282020	D	0.85955	-2.05	5.23	5.23	0.72850	5.23	5.23	0.72850	Extracellular ligand-binding receptor (1);	0.168825	0.50627	D	0.000117	T	0.75324	0.3834	N	0.14661	0.345	0.80722	D	1	P;P	0.46987	0.888;0.888	B;B	0.40009	0.185;0.316	T	0.75351	-0.3348	10	0.25106	T	0.35	.	19.1731	0.93588	0.0:0.0:1.0:0.0	.	135;76	O43424;B4DYB9	GRID2_HUMAN;.	Q	135	ENSP00000282020:R135Q	ENSP00000282020:R135Q	R	+	2	0	0	GRID2	94225328	94225328	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	3.748000	0.55142	2.613000	0.88420	0.655000	0.94253	CGG	0.704142		TCGA-H6-8124-01A-11D-2396-08	0.537	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2	0	0	1	2	21	2	2	1	1	1	1	100	100	100	100	1	1.770000	-18.194470	1	0.700000			0	222	221	0	445	437	1		1			1	0	100	0	0	1.000000	0	0	0	0	0	0	222	445
IL12B	3593	broad.mit.edu	37	5	158750144	158750144	+	Silent	SNP	G	G	A	rs142017503		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr5:158750144G>A	ENST00000231228.2	-	3	737	c.282C>T	c.(280-282)ggC>ggT	p.G94G		NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	94	Ig-like C2-type.				cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)			cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTAGAACCTCGCCTCCTTTGT	0.478																																						ENST00000231228.2	1.000000	8.400000e-01	1	9.100000e-01	0.980000	0.968476	0.980000	1.000000																										0				11						c.(280-282)ggC>ggT		interleukin 12B		G		0,4406		0,0,2203	92.0	86.0	88.0		282	-3.3	0.0	5	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	IL12B	NM_002187.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		94/329	158750144	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3593	2	121410	37				g.chr5:158750144G>A	M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.282C>T	chr5.hg19:g.158750144G>A		0						p.G94G	NM_002187.2	NP_002178.2	1	2	3	2.204364	P29460	IL12B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	3	737	-	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)		Silent	SNP	ENST00000231228.2	1	1	hg19	c.282C>T	CCDS4346.1	1																																																																																								0.701046		TCGA-H6-8124-01A-11D-2396-08	0.478	IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	1	0	1	2	2	2	2	0	0	0	0	43	43	43	41	1	1.770000	-20.000000	1	0.700000	NM_002187		0	120	119	0	226	223	1		1			0	0	43	0	0	1.000000	0	0	0	0	0	0	120	226
DLL1	28514	broad.mit.edu	37	6	170597430	170597430	+	Silent	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr6:170597430G>A	ENST00000366756.3	-	4	900	c.567C>T	c.(565-567)tcC>tcT	p.S189S	FAM120B_ENST00000540480.1_5'Flank	NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	189	DSL. {ECO:0000255|PROSITE- ProRule:PRU00377}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GGCAGAAAACGGAGCAGCCCT	0.632																																						ENST00000366756.3	0.970000	7.600000e-01	9.200000e-01	8.100000e-01	0.860000	0.871460	0.860000	0.870000																										0				33						c.(565-567)tcC>tcT		delta-like 1 (Drosophila)							87.0	71.0	76.0					6																	170597430		2203	4300	6503	SO:0001819	synonymous_variant	28514	0	0					g.chr6:170597430G>A	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.567C>T	chr6.hg19:g.170597430G>A		1					FAM120B_ENST00000540480.1_5'Flank	p.S189S	NM_005618.3	NP_005609.3	0	1	1	1.509146	O00548	DLL1_HUMAN		4	900	-		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Silent	SNP	ENST00000366756.3	1	1	hg19	c.567C>T	CCDS5313.1	1																																																																																								0.540933		TCGA-H6-8124-01A-11D-2396-08	0.632	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1	1	0	1	2	2	2	2	0	0	0	0	117	117	117	116	1	1.770000	-20.000000	1	0.700000			0	147	145	0	167	166	1		1	1		0	0	117	0	0	1.000000	9.999420e-01	0	7	0	14	0	147	167
POM121L12	285877	broad.mit.edu	37	7	53103972	53103972	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr7:53103972G>A	ENST00000408890.4	+	1	624	c.608G>A	c.(607-609)aGc>aAc	p.S203N		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	203										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GTCTCAGACAGCAAGGGTGGC	0.667																																						ENST00000408890.4	1.000000	8.900000e-01	1	9.400000e-01	0.990000	0.981761	0.990000	1.000000																										0				61						c.(607-609)aGc>aAc		POM121 transmembrane nucleoporin-like 12							50.0	59.0	56.0					7																	53103972		1986	4140	6126	SO:0001583	missense	285877	1	120902	32				g.chr7:53103972G>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.608G>A	chr7.hg19:g.53103972G>A	ENSP00000386133:p.Ser203Asn	0						p.S203N	NM_182595.3	NP_872401.3	0	0	0	2.170941	Q8N7R1	P1L12_HUMAN		1	624	+			Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	1	1	hg19	c.608G>A	CCDS43584.1	1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.253636	0.22965	.	.	ENSG00000221900	ENST00000408890	T	0.11604	2.76	1.68	0.545	0.17190	1.68	0.545	0.17190	.	.	.	.	.	T	0.04770	0.0129	N	0.20986	0.625	0.09310	N	1	P	0.50710	0.938	B	0.37451	0.25	T	0.31475	-0.9942	9	0.11182	T	0.66	.	4.9354	0.13937	0.0:0.0:0.5027:0.4973	.	203	Q8N7R1	P1L12_HUMAN	N	203	ENSP00000386133:S203N	ENSP00000386133:S203N	S	+	2	0	0	POM121L12	53071466	53071466	0.001000	0.12720	0.003000	0.11579	0.080000	0.17528	0.642000	0.24735	0.131000	0.18576	0.561000	0.74099	AGC	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.667	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	1	0	1	2	2	2	2	0	0	0	0	173	173	173	171	1	1.770000	-20.000000	1	0.700000	NM_182595		0	221	217	0	406	397	0		1			0	0	173	0	0	1.000000	0	0	0	0	0	0	221	406
ADAM22	53616	broad.mit.edu	37	7	87564445	87564445	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr7:87564445G>A	ENST00000265727.7	+	2	269	c.190G>A	c.(190-192)Gaa>Aaa	p.E64K	ADAM22_ENST00000398209.3_Missense_Mutation_p.E64K|ADAM22_ENST00000398201.4_Missense_Mutation_p.E64K|ADAM22_ENST00000398204.4_Missense_Mutation_p.E64K|ADAM22_ENST00000315984.7_Missense_Mutation_p.E64K|ADAM22_ENST00000439864.1_Missense_Mutation_p.E64K			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	64					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			CGGCGAAGACGAAAGTCGGCA	0.687																																						ENST00000265727.7			0	0																														0				53						c.(190-192)Gaa>Aaa		ADAM metallopeptidase domain 22							28.0	31.0	30.0					7																	87564445		1957	4123	6080	SO:0001583	missense	53616	0	0					g.chr7:87564445G>A	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.190G>A	chr7.hg19:g.87564445G>A	ENSP00000265727:p.Glu64Lys						ADAM22_ENST00000439864.1_Missense_Mutation_p.E64K|ADAM22_ENST00000398201.4_Missense_Mutation_p.E64K|ADAM22_ENST00000315984.7_Missense_Mutation_p.E64K|ADAM22_ENST00000398209.3_Missense_Mutation_p.E64K|ADAM22_ENST00000398204.4_Missense_Mutation_p.E64K	p.E64K							Q9P0K1	ADA22_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)	2	269	+	Esophageal squamous(14;0.00202)		O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	1	1	hg19	c.190G>A	CCDS47637.1		.	.	.	.	.	.	.	.	.	.	G	21.2	4.114188	0.77210	.	.	ENSG00000008277	ENST00000398204;ENST00000439864;ENST00000412441;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T;T;T	0.17528	4.45;3.6;2.27;4.45;4.45;4.46;4.46;4.44	4.94	1.94	0.25998	4.94	1.94	0.25998	.	0.154004	0.43416	N	0.000575	T	0.30198	0.0757	L	0.55213	1.73	0.24151	N	0.995698	D;D;D;P;P;D	0.76494	0.99;0.979;0.983;0.639;0.94;0.999	P;P;P;B;P;D	0.69142	0.869;0.761;0.846;0.245;0.535;0.962	T	0.02179	-1.1200	10	0.59425	D	0.04	.	8.3943	0.32548	0.0851:0.2937:0.6211:0.0	.	116;64;64;64;64;64	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2;E7EPF1;D6W5P7	.;.;ADA22_HUMAN;.;.;.	K	64;64;64;64;64;64;64;31	ENSP00000381262:E64K;ENSP00000391334:E64K;ENSP00000413899:E64K;ENSP00000381260:E64K;ENSP00000265727:E64K;ENSP00000315900:E64K;ENSP00000381267:E64K;ENSP00000381261:E31K	ENSP00000265727:E64K	E	+	1	0	0	ADAM22	87402381	87402381	1.000000	0.71417	0.909000	0.35828	0.748000	0.42578	1.511000	0.35801	0.779000	0.33543	0.655000	0.94253	GAA			TCGA-H6-8124-01A-11D-2396-08	0.687	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.770000	-20.000000	1	0.700000	NM_021723		0	94	92	0	331	328	0		1	0		0	0	66	0	0	1.000000	6.851146e-01	0	0	0	10	0	94	331
CUX1	1523	broad.mit.edu	37	7	101870648	101870648	+	Splice_Site	SNP	A	A	C			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			A	C	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr7:101870648A>C	ENST00000292535.7	+	21	3170	c.3132A>C	c.(3130-3132)gaA>gaC	p.E1044D	CUX1_ENST00000546411.2_Splice_Site_p.E942D|CUX1_ENST00000550008.2_Splice_Site_p.E988D|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000549414.2_Splice_Site_p.E1022D|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000360264.3_Splice_Site_p.E1055D|CUX1_ENST00000556210.1_Splice_Site_p.E886D|CUX1_ENST00000437600.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1044					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TAATTACAGAAAGCACTCCAA	0.512																																						ENST00000292535.7			0	0																														0				70						c.(3130-3132)gaA>gaC		cut-like homeobox 1							94.0	104.0	100.0					7																	101870648		2203	4298	6501	SO:0001630	splice_region_variant	1523	0	0					g.chr7:101870648A>C	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3131-1A>C	chr7.hg19:g.101870648A>C							CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Splice_Site_p.E942D|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Splice_Site_p.E1055D|CUX1_ENST00000549414.2_Splice_Site_p.E1022D|CUX1_ENST00000550008.2_Splice_Site_p.E988D|CUX1_ENST00000556210.1_Splice_Site_p.E886D	p.E1044D	NM_181552.3	NP_853530.2					P39880	CUX1_HUMAN		21	3170	+			B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Splice_Site	SNP	ENST00000292535.7	1	0	hg19	c.3132A>C	CCDS5721.1		.	.	.	.	.	.	.	.	.	.	A	14.04	2.417793	0.42918	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.60797	0.18;0.17;0.17;0.16;0.17;0.16	5.67	0.0822	0.14428	5.67	0.0822	0.14428	.	0.111571	0.64402	D	0.000015	T	0.37972	0.1023	L	0.43152	1.355	0.53688	D	0.999971	B;B	0.06786	0.001;0.0	B;B	0.09377	0.003;0.004	T	0.07654	-1.0761	10	0.21540	T	0.41	.	2.1663	0.03838	0.5209:0.1682:0.2064:0.1045	.	1044;1055	P39880;P39880-3	CUX1_HUMAN;.	D	1055;1044;1022;988;942;886	ENSP00000353401:E1055D;ENSP00000292535:E1044D;ENSP00000446630:E1022D;ENSP00000447373:E988D;ENSP00000450125:E942D;ENSP00000451558:E886D	ENSP00000292535:E1044D	E	+	3	2	2	CUX1	101657368	101657368	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.791000	0.38744	0.402000	0.25451	0.533000	0.62120	GAA			TCGA-H6-8124-01A-11D-2396-08	0.512	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	1	0	1	2	2	2	2	0	0	0	0	218	218	218	218	1	1.770000	-20.000000	1	0.700000	NM_001913	Missense_Mutation	0	862	856	0	1733	1718	1		1	0		0	0	218	0	0	1.000000	9.997194e-01	0	0	0	27	0	862	1733
HR	55806	broad.mit.edu	37	8	21986391	21986391	+	Missense_Mutation	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr8:21986391C>T	ENST00000381418.4	-	2	1773	c.293G>A	c.(292-294)cGc>cAc	p.R98H	HR_ENST00000518377.1_5'Flank|HR_ENST00000312841.8_Missense_Mutation_p.R98H	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	98					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CTCCTTCCAGCGCAGTCCCTC	0.652																																						ENST00000381418.4	0.400000	1.900000e-01	3.300000e-01	2.300000e-01	0.270000	0.291762	0.270000	0.280000																										0				27						c.(292-294)cGc>cAc		hair growth associated							54.0	52.0	53.0					8																	21986391		2202	4300	6502	SO:0001583	missense	55806	1	121402	27				g.chr8:21986391C>T	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.293G>A	chr8.hg19:g.21986391C>T	ENSP00000370826:p.Arg98His	0					HR_ENST00000312841.8_Missense_Mutation_p.R98H|HR_ENST00000518377.1_5'Flank	p.R98H	NM_005144.4	NP_005135.2	1	2	3	2.208213	O43593	HAIR_HUMAN		2	1773	-		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	1	1	hg19	c.293G>A	CCDS6022.1	0	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344423	0.41498	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.74106	-0.8;-0.81	4.72	2.85	0.33270	4.72	2.85	0.33270	.	0.160475	0.29692	N	0.011458	T	0.59459	0.2195	L	0.34521	1.04	0.27888	N	0.939439	B;B;B	0.18741	0.023;0.03;0.017	B;B;B	0.14578	0.004;0.011;0.005	T	0.52852	-0.8520	10	0.51188	T	0.08	-7.088	6.2548	0.20867	0.0:0.7605:0.0:0.2395	.	98;98;98	A6NCE3;O43593-2;O43593	.;.;HAIR_HUMAN	H	98	ENSP00000370826:R98H;ENSP00000326765:R98H	ENSP00000326765:R98H	R	-	2	0	0	HR	22042336	22042336	0.048000	0.20356	0.996000	0.52242	0.905000	0.53344	-0.070000	0.11523	0.549000	0.28973	-0.258000	0.10820	CGC	0.702085		TCGA-H6-8124-01A-11D-2396-08	0.652	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1	1	0	1	2	2	2	2	0	0	0	0	100	100	100	99	1	1.770000	-20.000000	1	0.700000			0	32	32	0	299	291	1		1	1		0	0	100	0	0	1.000000	2.230885e-01	0	2	0	7	0	32	299
CLU	1191	broad.mit.edu	37	8	27463908	27463908	+	Missense_Mutation	SNP	C	C	T			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr8:27463908C>T	ENST00000316403.10	-	4	785	c.380G>A	c.(379-381)cGc>cAc	p.R127H	CLU_ENST00000546343.1_Missense_Mutation_p.R138H|CLU_ENST00000523500.1_Missense_Mutation_p.R127H|CLU_ENST00000405140.3_Missense_Mutation_p.R127H|CLU_ENST00000560366.1_Missense_Mutation_p.R179H			P10909	CLUS_HUMAN	clusterin	127					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		TCTGCAGACGCGTGCGTAGAA	0.572																																						ENST00000316403.10	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.054634	0.030000	0.040000																										0				21						c.(379-381)cGc>cAc		clusterin							133.0	118.0	123.0					8																	27463908		2203	4300	6503	SO:0001583	missense	1191	6	121412	39				g.chr8:27463908C>T	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.380G>A	chr8.hg19:g.27463908C>T	ENSP00000315130:p.Arg127His	0					CLU_ENST00000546343.1_Missense_Mutation_p.R138H|CLU_ENST00000405140.3_Missense_Mutation_p.R127H|CLU_ENST00000523500.1_Missense_Mutation_p.R127H|CLU_ENST00000560366.1_Missense_Mutation_p.R179H	p.R127H			1	2	3	2.208213	P10909	CLUS_HUMAN		4	785	-		Ovarian(32;2.61e-05)	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	0	1	hg19	c.380G>A	CCDS47832.1	0	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775112	0.70107	.	.	ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000523589;ENST00000520796;ENST00000519742;ENST00000520491;ENST00000522413	T;T;T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67	5.52	2.27	0.28462	5.52	2.27	0.28462	Clusterin, N-terminal (1);	0.111708	0.52532	D	0.000064	T	0.40322	0.1112	M	0.78637	2.42	0.09310	N	1	D;D;D	0.58620	0.979;0.979;0.983	P;P;P	0.51974	0.558;0.558;0.686	T	0.29088	-1.0023	10	0.87932	D	0	-8.8843	5.2716	0.15628	0.0:0.5819:0.1628:0.2554	.	179;138;127	P10909-2;P10909-5;P10909	.;.;CLUS_HUMAN	H	179;138;127;127;127;127;127;127;127	ENSP00000446413:R138H;ENSP00000385419:R127H;ENSP00000429620:R127H;ENSP00000431070:R127H;ENSP00000429336:R127H;ENSP00000431026:R127H;ENSP00000429881:R127H;ENSP00000428779:R127H	ENSP00000315130:R179H	R	-	2	0	0	CLU	27519825	27519825	0.005000	0.15991	0.034000	0.17996	0.973000	0.67179	1.095000	0.30964	0.687000	0.31509	0.655000	0.94253	CGC	0.702085		TCGA-H6-8124-01A-11D-2396-08	0.572	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	0	0	0	2	2	2	2	0	0	0	0	134	134	134	131	1	1.770000	-2.924029	1	0.700000	NM_001831		0	9	9	0	628	621	0		1	1		0	0	134	0	0	0.993969	9.998469e-01	0	6	0	1227	0	9	628
ADCK5	203054	broad.mit.edu	37	8	145616829	145616829	+	Missense_Mutation	SNP	G	G	A	rs201101725		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr8:145616829G>A	ENST00000308860.6	+	8	892	c.848G>A	c.(847-849)cGc>cAc	p.R283H	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'Flank|ADCK5_ENST00000526231.2_3'UTR	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	283	Protein kinase.			R -> G (in Ref. 3; AAH85013). {ECO:0000305}.		integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AATGAGGGCCGCAACGCAGAG	0.677																																						ENST00000308860.6	0.550000	6.000000e-02	3.600000e-01	1.200000e-01	0.220000	0.250019	0.220000	0.200000																										0				8						c.(847-849)cGc>cAc		aarF domain containing kinase 5		G	HIS/ARG	1,4333		0,1,2166	14.0	16.0	16.0		848	3.4	0.5	8		16	0,8542		0,0,4271	yes	missense	ADCK5	NM_174922.3	29	0,1,6437	AA,AG,GG		0.0,0.0231,0.0078	possibly-damaging	283/581	145616829	1,12875	2167	4271	6438	SO:0001583	missense	203054	1	117324	16				g.chr8:145616829G>A	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.848G>A	chr8.hg19:g.145616829G>A	ENSP00000310547:p.Arg283His	0					ADCK5_ENST00000526231.2_3'UTR|MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'Flank	p.R283H	NM_174922.3	NP_777582.4	1	2	3	2.208213	Q3MIX3	ADCK5_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)	8	892	+	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Missense_Mutation	SNP	ENST00000308860.6	0	1	hg19	c.848G>A	CCDS34965.1	0	.	.	.	.	.	.	.	.	.	.	G	9.295	1.051513	0.19827	2.31E-4	0.0	ENSG00000173137	ENST00000308860	T	0.54071	0.59	5.17	3.38	0.38709	5.17	3.38	0.38709	ABC-1 (1);Protein kinase-like domain (1);	0.207878	0.39020	N	0.001489	T	0.42154	0.1190	L	0.41710	1.295	0.80722	D	1	B	0.21688	0.059	B	0.21546	0.035	T	0.25363	-1.0134	10	0.48119	T	0.1	-20.9067	9.5897	0.39539	0.1731:0.0:0.8269:0.0	.	283	Q3MIX3	ADCK5_HUMAN	H	283	ENSP00000310547:R283H	ENSP00000310547:R283H	R	+	2	0	0	ADCK5	145587637	145587637	0.929000	0.31497	0.509000	0.27700	0.016000	0.09150	1.319000	0.33655	0.589000	0.29677	-0.258000	0.10820	CGC	0.702085		TCGA-H6-8124-01A-11D-2396-08	0.677	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382556.2	0	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.770000	-7.795558	1	0.700000	NM_174922		0	3	3	0	42	42	0		1	0		0	0	10	0	0	0.812618	4.349692e-01	0	0	0	17	0	3	42
TGFBR1	7046	broad.mit.edu	37	9	101911535	101911535	+	Missense_Mutation	SNP	G	G	A	rs113605875		TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chr9:101911535G>A	ENST00000374994.4	+	9	1577	c.1460G>A	c.(1459-1461)cGg>cAg	p.R487Q	TGFBR1_ENST00000550253.1_Missense_Mutation_p.R418Q|TGFBR1_ENST00000374990.2_Missense_Mutation_p.R410Q|TGFBR1_ENST00000552516.1_Missense_Mutation_p.R491Q	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	487	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> P (in LDS1). {ECO:0000269|PubMed:15731757, ECO:0000269|PubMed:16928994}.|R -> Q (in LDS1). {ECO:0000269|PubMed:16791849, ECO:0000269|PubMed:16928994, ECO:0000269|PubMed:22113417}.|R -> W (in LDS1). {ECO:0000269|PubMed:16928994}.		activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				ACAGCATTGCGGATTAAGAAA	0.373																																						ENST00000374994.4	0.150000	3.000000e-02	1.200000e-01	5.000000e-02	0.080000	0.089437	0.080000	0.080000																										0				27	GRCh37	CM050757|CM063198	TGFBR1	M	rs113605875	c.(1459-1461)cGg>cAg		transforming growth factor, beta receptor 1							87.0	79.0	82.0					9																	101911535		2203	4300	6503	SO:0001583	missense	7046	0	0					g.chr9:101911535G>A		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1460G>A	chr9.hg19:g.101911535G>A	ENSP00000364133:p.Arg487Gln	1					TGFBR1_ENST00000552516.1_Missense_Mutation_p.R491Q|TGFBR1_ENST00000374990.2_Missense_Mutation_p.R410Q|TGFBR1_ENST00000550253.1_Missense_Mutation_p.R418Q	p.R487Q	NM_004612.2	NP_004603.1	0	1	1	1.411584	P36897	TGFR1_HUMAN		9	1577	+		Acute lymphoblastic leukemia(62;0.0559)	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	0	1	hg19	c.1460G>A	CCDS6738.1	0	.	.	.	.	.	.	.	.	.	.	G	28.3	4.907570	0.92107	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05	5.66	5.66	0.87406	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95201	0.8444	L	0.55103	1.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.916;0.999	D	0.95213	0.8327	10	0.87932	D	0	.	18.8853	0.92375	0.0:0.0:1.0:0.0	.	410;487	P36897-3;P36897	.;TGFR1_HUMAN	Q	487;449;410;491;418	ENSP00000364133:R487Q;ENSP00000364129:R410Q;ENSP00000447297:R491Q;ENSP00000450052:R418Q	ENSP00000364129:R410Q	R	+	2	0	0	TGFBR1	100951356	100951356	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.827000	0.97445	0.655000	0.94253	CGG	0.538462		TCGA-H6-8124-01A-11D-2396-08	0.373	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3	1	0	1	2	2	2	4	0	0	0	0	24	24	24	24	1	1.770000	-2.909994	1	0.700000			0	8	8	0	176	176	0		1	1	1	0	1	24	782	0	0.989853	7.031618e-01	9.957717e-01	2	16	52	341	8	176
ARAF	369	broad.mit.edu	37	X	47426043	47426043	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chrX:47426043G>A	ENST00000377045.4	+	7	757	c.563G>A	c.(562-564)cGc>cAc	p.R188H	ARAF_ENST00000290277.6_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	188					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.R188H(1)		biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	GGCAGCCCCCGCACCCAGCAC	0.622													G|||	1	0.000264901	0.0	0.0	3775	,	,		10037	0.001		0.0	False		,,,				2504	0.0					ENST00000377045.4	1.000000	9.700000e-01	1	9.900000e-01	0.990000	0.998334	0.990000	1.000000																										1	Substitution - Missense(1)	p.R188H(1)	lung(1)	29						c.(562-564)cGc>cAc		A-Raf proto-oncogene, serine/threonine kinase	Adenosine triphosphate(DB00171)						28.0	25.0	26.0					X																	47426043		2202	4299	6501	SO:0001583	missense	369	6	120406	32				g.chrX:47426043G>A	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.563G>A	chrX.hg19:g.47426043G>A	ENSP00000366244:p.Arg188His						ARAF_ENST00000290277.6_Intron	p.R188H	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	0	1	1		P10398	ARAF_HUMAN		7	757	+			P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	1	1	hg19	c.563G>A	CCDS35232.1	1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.341094	0.01277	.	.	ENSG00000078061	ENST00000377045	T	0.74421	-0.84	5.37	2.02	0.26589	5.37	2.02	0.26589	.	1.428110	0.03652	N	0.241251	T	0.59729	0.2215	N	0.22421	0.69	0.09310	N	0.999999	P;B	0.34629	0.46;0.0	B;B	0.26517	0.07;0.001	T	0.47209	-0.9135	10	0.29301	T	0.29	.	8.5422	0.33399	0.1819:0.0:0.6845:0.1336	.	188;54	P10398;B4DV85	ARAF_HUMAN;.	H	188	ENSP00000366244:R188H	ENSP00000366244:R188H	R	+	2	0	0	ARAF	47310987	47310987	0.896000	0.30565	0.181000	0.23098	0.004000	0.04260	2.153000	0.42282	0.100000	0.17581	-1.195000	0.01675	CGC	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.622	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.770000	-20.000000	1	0.700000			0	72	71	0	102	98	1		1	0		0	0	34	0	0	1.000000	1	0	0	0	160	0	72	102
CLCN5	1184	broad.mit.edu	37	X	49854844	49854844	+	Missense_Mutation	SNP	G	G	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chrX:49854844G>A	ENST00000307367.2	+	10	1897	c.1606G>A	c.(1606-1608)Gtg>Atg	p.V536M	CLCN5_ENST00000376108.3_Missense_Mutation_p.V536M|CLCN5_ENST00000376091.3_Missense_Mutation_p.V606M|CLCN5_ENST00000376088.3_Missense_Mutation_p.V606M			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	536					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					AGAATACATCGTGCCTCTGAT	0.502																																						ENST00000307367.2	1.000000	9.200000e-01	1	9.600000e-01	0.990000	0.989902	0.990000	1.000000																										0				30						c.(1606-1608)Gtg>Atg		chloride channel, voltage-sensitive 5							150.0	138.0	142.0					X																	49854844		2203	4300	6503	SO:0001583	missense	1184	4	121410	41				g.chrX:49854844G>A	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1606G>A	chrX.hg19:g.49854844G>A	ENSP00000304257:p.Val536Met						CLCN5_ENST00000376108.3_Missense_Mutation_p.V536M|CLCN5_ENST00000376088.3_Missense_Mutation_p.V606M|CLCN5_ENST00000376091.3_Missense_Mutation_p.V606M	p.V536M			0	1	1		P51795	CLCN5_HUMAN		10	1897	+	Ovarian(276;0.236)		A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	1	1	hg19	c.1606G>A	CCDS14328.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566129	0.86439	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.94793	-3.52;-3.52;-3.52;-3.52	5.79	5.79	0.91817	5.79	5.79	0.91817	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.97692	0.9243	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.83275	0.921;0.996	D	0.98214	1.0474	10	0.62326	D	0.03	-0.1014	17.6718	0.88220	0.0:0.0:1.0:0.0	.	536;606	P51795;P51795-2	CLCN5_HUMAN;.	M	606;438;606;536;536	ENSP00000365256:V606M;ENSP00000365259:V606M;ENSP00000365276:V536M;ENSP00000304257:V536M	ENSP00000304257:V536M	V	+	1	0	0	CLCN5	49741584	49741584	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.705000	0.98719	2.445000	0.82738	0.600000	0.82982	GTG	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.502	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1	1	0	1	2	2	2	2	0	0	0	0	157	157	157	155	1	1.770000	-20.000000	1	0.700000			0	396	394	0	719	708	1		1	0		0	0	157	0	0	1.000000	6.903426e-01	0	0	0	6	0	396	719
FLNA	2316	broad.mit.edu	37	X	153587767	153587767	+	Missense_Mutation	SNP	C	C	A			TCGA-H6-8124-01A-11D-2396-08	TCGA-H6-8124-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	575ab748-dec0-42a8-85a6-1e337f07b129	3952ea3a-0fab-4436-a3ec-3bbd1c7e24a2	g.chrX:153587767C>A	ENST00000369850.3	-	25	4386	c.4150G>T	c.(4150-4152)Ggc>Tgc	p.G1384C	FLNA_ENST00000422373.1_Missense_Mutation_p.G1384C|FLNA_ENST00000344736.4_Missense_Mutation_p.G1384C|FLNA_ENST00000369856.3_5'Flank|FLNA_ENST00000360319.4_Missense_Mutation_p.G1384C	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1384					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGCCCGTGCCAGCTCCCCTG	0.647																																						ENST00000369850.3	1.000000	9.000000e-01	1	9.300000e-01	0.970000	0.970993	0.970000	1.000000																										0				6						c.(4150-4152)Ggc>Tgc		filamin A, alpha							90.0	101.0	97.0					X																	153587767		1965	4125	6090	SO:0001583	missense	2316	0	0					g.chrX:153587767C>A	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.4150G>T	chrX.hg19:g.153587767C>A	ENSP00000358866:p.Gly1384Cys						FLNA_ENST00000369856.3_5'Flank|FLNA_ENST00000422373.1_Missense_Mutation_p.G1384C|FLNA_ENST00000344736.4_Missense_Mutation_p.G1384C|FLNA_ENST00000360319.4_Missense_Mutation_p.G1384C	p.G1384C	NM_001110556.1	NP_001104026.1	0	1	1		P21333	FLNA_HUMAN		25	4386	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	1	1	hg19	c.4150G>T	CCDS48194.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277760	0.80692	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.36	5.36	0.76844	5.36	5.36	0.76844	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98353	0.9453	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99811	1.1041	10	0.87932	D	0	.	18.1702	0.89743	0.0:1.0:0.0:0.0	.	1384;1384	P21333-2;P21333	.;FLNA_HUMAN	C	1384;1357;1384;1384;1384	ENSP00000353467:G1384C;ENSP00000416926:G1384C;ENSP00000358866:G1384C;ENSP00000358863:G1384C	ENSP00000358863:G1384C	G	-	1	0	0	FLNA	153240961	153240961	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.788000	0.85771	2.229000	0.72834	0.600000	0.82982	GGC	0.700000		TCGA-H6-8124-01A-11D-2396-08	0.647	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3	1	0	1	2	2	2	2	0	0	0	0	532	532	532	529	1	1.770000	-20.000000	1	0.700000			0	560	551	0	1080	1061	1		1	1		0	0	532	0	0	1.000000	1	0	2	0	882	0	560	1080
