#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TP53	7157	broad.mit.edu	37	17	7574003	7574003	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			G	-	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr17:7574003delG	ENST00000269305.4	-	10	1213	c.1024delC	c.(1024-1026)cgafs	p.R342fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.R342fs|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.810000	0.510000	0.740000	0.580000	0.650000	0.663410	0.650000	0.660000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	24185	GRCh37	CM004908	TP53	M		c.(1024-1026)cgafs	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						62.0	48.0	53.0					17																	7574003		2203	4300	6503	SO:0001589	frameshift_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7574003delG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024delC	chr17.hg19:g.7574003delG	ENSP00000269305:p.Arg342fs	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Frame_Shift_Del_p.R342fs|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000413465.2_Intron	p.R342fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.490383	P04637	P53_HUMAN		10	1213	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	1	1	hg19	c.1024delC	CCDS11118.1	0																																																																																								0.473068		TCGA-HV-A5A6-01A-11D-A26I-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		22	2	2	0	0	0	2	33	0	33	32	1	1.940000	-5.939592	1	0.640000	NM_000546		0	50	54	0	111	111	0	0	1	1	1	0	0	33	1151	0	0.999968	9.967110e-01	1	5	264	18	699	50	111
WDR11	55717	broad.mit.edu	37	10	122626196	122626196	+	Silent	SNP	A	A	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr10:122626196A>T	ENST00000263461.6	+	8	1356	c.1110A>T	c.(1108-1110)gcA>gcT	p.A370A		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						ATGAGAATGCAGCCGCCCTCG	0.473																																						ENST00000263461.6	1.000000	0.830000	1.000000	0.890000	0.950000	0.950199	0.950000	1.000000																										0				38						c.(1108-1110)gcA>gcT		WD repeat domain 11							195.0	183.0	187.0					10																	122626196		2203	4300	6503	SO:0001819	synonymous_variant	55717	0	0					g.chr10:122626196A>T	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.1110A>T	chr10.hg19:g.122626196A>T		1						p.A370A	NM_018117.11	NP_060587.8	0	1	1	1.818128	Q8WWQ0	PHIP_HUMAN		8	1356	+			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000263461.6	1	1	hg19	c.1110A>T	CCDS7619.1	1																																																																																								0.584104		TCGA-HV-A5A6-01A-11D-A26I-08	0.473	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.940000	-20.000000	1	0.640000			0	168	166	0	306	305	1		1	1		0	0	69	0	0	1.000000	8.827383e-01	0	2	0	7	0	168	306
PTPN5	84867	broad.mit.edu	37	11	18763931	18763931	+	Silent	SNP	G	G	A	rs367543231		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr11:18763931G>A	ENST00000358540.2	-	7	1033	c.603C>T	c.(601-603)atC>atT	p.I201I	PTPN5_ENST00000496201.2_5'UTR|PTPN5_ENST00000396167.2_Silent_p.I169I|PTPN5_ENST00000396168.1_Silent_p.I177I|PTPN5_ENST00000477854.1_Silent_p.I5I|PTPN5_ENST00000396170.1_Silent_p.I169I|PTPN5_ENST00000396171.4_Silent_p.I201I|RP11-1081L13.4_ENST00000527285.1_RNA	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	201					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						AGTCATCCTCGATCTTCTCCT	0.617																																						ENST00000358540.2	1.000000	0.400000	0.610000	0.460000	0.520000	0.553587	0.520000	0.530000																										0				27						c.(601-603)atC>atT		protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)							71.0	75.0	73.0					11																	18763931		2199	4293	6492	SO:0001819	synonymous_variant	84867	23	121412	43				g.chr11:18763931G>A	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.603C>T	chr11.hg19:g.18763931G>A		0					PTPN5_ENST00000396170.1_Silent_p.I169I|PTPN5_ENST00000396167.2_Silent_p.I169I|PTPN5_ENST00000477854.1_Silent_p.I5I|PTPN5_ENST00000396171.4_Silent_p.I201I|PTPN5_ENST00000396168.1_Silent_p.I177I|PTPN5_ENST00000496201.2_5'UTR|RP11-1081L13.4_ENST00000527285.1_RNA	p.I201I	NM_006906.1	NP_008837.1	1	2	3	2.108160	P54829	PTN5_HUMAN		7	1033	-			B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Silent	SNP	ENST00000358540.2	1	1	hg19	c.603C>T	CCDS7845.1	0																																																																																								0.646782		TCGA-HV-A5A6-01A-11D-A26I-08	0.617	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.940000	-20.000000	1	0.640000	NM_001039970		0	52	52	0	263	258	1		1	0		0	0	48	0	0	1.000000	0	0	0	0	1	0	52	263
AHNAK	79026	broad.mit.edu	37	11	62299013	62299013	+	Missense_Mutation	SNP	T	T	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr11:62299013T>G	ENST00000378024.4	-	5	3150	c.2876A>C	c.(2875-2877)aAa>aCa	p.K959T	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	959					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCCCTTTACTTTAGGACCTTT	0.483																																						ENST00000378024.4	0.120000	0.040000	0.100000	0.050000	0.070000	0.080867	0.070000	0.080000																										0				268						c.(2875-2877)aAa>aCa		AHNAK nucleoprotein							145.0	154.0	151.0					11																	62299013		2202	4299	6501	SO:0001583	missense	79026	0	0					g.chr11:62299013T>G	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.2876A>C	chr11.hg19:g.62299013T>G	ENSP00000367263:p.Lys959Thr	0					AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	p.K959T	NM_001620.1	NP_001611.1	1	2	3	2.048049	Q09666	AHNK_HUMAN		5	3150	-		Melanoma(852;0.155)	A1A586	Missense_Mutation	SNP	ENST00000378024.4	1	1	hg19	c.2876A>C	CCDS31584.1	0	.	.	.	.	.	.	.	.	.	.	t	9.875	1.200010	0.22121	.	.	ENSG00000124942	ENST00000378024	T	0.01665	4.7	4.8	3.66	0.41972	4.8	3.66	0.41972	.	0.240370	0.41823	D	0.000807	T	0.09069	0.0224	H	0.95402	3.665	0.26966	N	0.965691	P	0.50528	0.936	P	0.51415	0.669	T	0.16247	-1.0409	10	0.30078	T	0.28	-2.0869	10.1142	0.42581	0.0:0.0808:0.0:0.9192	.	959	Q09666	AHNK_HUMAN	T	959	ENSP00000367263:K959T	ENSP00000367263:K959T	K	-	2	0	0	AHNAK	62055589	62055589	0.273000	0.24181	0.993000	0.49108	0.053000	0.15095	1.372000	0.34261	0.683000	0.31428	0.374000	0.22700	AAA	0.641148		TCGA-HV-A5A6-01A-11D-A26I-08	0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	0	0	1	2	2	2	2	0	0	0	0	130	130	130	130	1	1.940000	-18.755220	1	0.640000	NM_024060		0	26	26	0	1018	1008	0		1	0		0	0	130	0	0	1.000000	6.529177e-03	0	0	0	5	0	26	1018
SF1	7536	broad.mit.edu	37	11	64533556	64533556	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr11:64533556C>T	ENST00000377390.3	-	13	1991	c.1654G>A	c.(1654-1656)Gca>Aca	p.A552T	SF1_ENST00000377387.1_Intron|SF1_ENST00000377394.3_Intron|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000433274.2_Missense_Mutation_p.A526T|SF1_ENST00000422298.2_Intron|SF1_ENST00000334944.5_Missense_Mutation_p.A552T|SF1_ENST00000227503.9_Intron	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	552	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GGAGAAGCTGCGGCAGCCGCC	0.682																																						ENST00000377390.3	1.000000	0.800000	1.000000	0.880000	0.980000	0.956381	0.980000	1.000000																										0				31						c.(1654-1656)Gca>Aca		splicing factor 1							24.0	33.0	30.0					11																	64533556		2147	4266	6413	SO:0001583	missense	7536	1	120562	31				g.chr11:64533556C>T	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1654G>A	chr11.hg19:g.64533556C>T	ENSP00000366607:p.Ala552Thr	0					SF1_ENST00000227503.9_Intron|SF1_ENST00000334944.5_Missense_Mutation_p.A552T|SF1_ENST00000377387.1_Intron|SF1_ENST00000433274.2_Missense_Mutation_p.A526T|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000422298.2_Intron|SF1_ENST00000377394.3_Intron	p.A552T	NM_004630.3	NP_004621.2	0	0	0	2.040351	Q15637	SF01_HUMAN		13	1991	-			B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	1	1	hg19	c.1654G>A	CCDS31599.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.87|11.87	1.767095|1.767095	0.31320|0.31320	.|.	.|.	ENSG00000168066|ENSG00000168066	ENST00000377390;ENST00000334944;ENST00000433274|ENST00000486867	T;T;T|T	0.48836|0.54675	0.8;0.92;0.81|0.56	5.3|5.3	5.3|5.3	0.74995|0.74995	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|.	.|.	.|.	.|.	T|T	0.47637|0.47637	0.1456|0.1456	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	B;B|.	0.31611|.	0.223;0.331|.	B;B|.	0.25614|.	0.028;0.062|.	T|T	0.56092|0.56092	-0.8036|-0.8036	9|7	0.87932|0.87932	D|D	0|0	.|.	16.4457|16.4457	0.83928|0.83928	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	552;552|.	Q15637;Q15637-2|.	SF01_HUMAN;.|.	T|H	552;552;526|271	ENSP00000366607:A552T;ENSP00000334414:A552T;ENSP00000396793:A526T|ENSP00000419062:R271H	ENSP00000334414:A552T|ENSP00000419062:R271H	A|R	-|-	1|2	0|0	0|0	SF1|SF1	64290132|64290132	64290132|64290132	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.087000|4.087000	0.57671|0.57671	2.488000|2.488000	0.83962|0.83962	0.561000|0.561000	0.74099|0.74099	GCA|CGC	0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.682	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	64	1	1.940000	-8.089916	1	0.640000	NM_004630		0	76	76	0	165	163	0		1	1		0	0	65	0	0	1.000000	9.999976e-01	0	16	0	30	0	76	165
ATG2A	23130	broad.mit.edu	37	11	64678283	64678283	+	Missense_Mutation	SNP	G	G	A	rs369749777		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr11:64678283G>A	ENST00000377264.3	-	11	1722	c.1610C>T	c.(1609-1611)aCg>aTg	p.T537M	ATG2A_ENST00000421419.2_Missense_Mutation_p.T537M	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	537					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CCTCACCTCCGTGTACTCAGG	0.677																																						ENST00000377264.3	0.380000	0.060000	0.280000	0.100000	0.180000	0.198841	0.180000	0.160000																										0				55						c.(1609-1611)aCg>aTg		autophagy related 2A		G	MET/THR	1,4397	2.1+/-5.4	0,1,2198	33.0	39.0	37.0		1610	5.1	1.0	11		37	0,8588		0,0,4294	no	missense	ATG2A	NM_015104.2	81	0,1,6492	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	537/1939	64678283	1,12985	2199	4294	6493	SO:0001583	missense	23130	0	0					g.chr11:64678283G>A		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1610C>T	chr11.hg19:g.64678283G>A	ENSP00000366475:p.Thr537Met	0					ATG2A_ENST00000421419.2_Missense_Mutation_p.T537M	p.T537M	NM_015104.2	NP_055919.2	0	0	0	2.040351	Q2TAZ0	ATG2A_HUMAN		11	1722	-			O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	0	1	hg19	c.1610C>T	CCDS31602.1	0	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522125	0.64747	2.27E-4	0.0	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.08984	3.03;3.03	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.190202	0.41097	D	0.000944	T	0.09774	0.0240	L	0.50333	1.59	0.34319	D	0.68634	P	0.48350	0.909	B	0.38327	0.271	T	0.14643	-1.0465	10	0.66056	D	0.02	.	14.4207	0.67180	0.0:0.0:1.0:0.0	.	537	Q2TAZ0	ATG2A_HUMAN	M	537	ENSP00000410522:T537M;ENSP00000366475:T537M	ENSP00000366475:T537M	T	-	2	0	0	ATG2A	64434859	64434859	0.993000	0.37304	0.964000	0.40570	0.697000	0.40408	2.162000	0.42367	2.550000	0.86006	0.462000	0.41574	ACG	0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.677	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	0	0	1	2	2	2	2	0	0	0	0	12	12	12	11	1	1.940000	-7.958007	1	0.640000	NM_015104		0	4	4	0	72	71	0		1	0		0	0	12	0	0	0.889105	1.174952e-01	0	0	0	9	0	4	72
ADRBK1	156	broad.mit.edu	37	11	67048254	67048254	+	Splice_Site	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr11:67048254C>T	ENST00000308595.5	+	7	845	c.555C>T	c.(553-555)caC>caT	p.H185H	ADRBK1_ENST00000526285.1_Splice_Site_p.H185H	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	185	N-terminal.			SDKFTRFCQWKNVELNIH -> RISSHGFASGRMWSSTST (in Ref. 3; AAB60689). {ECO:0000305}.	activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	TCAACATCCACGTGAGTGGGC	0.597																																						ENST00000308595.5	1.000000	0.870000	1.000000	0.910000	0.950000	0.959803	0.950000	1.000000																										0				22						c.(553-555)caC>caT		adrenergic, beta, receptor kinase 1	Adenosine triphosphate(DB00171)						182.0	182.0	182.0					11																	67048254		2200	4295	6495	SO:0001630	splice_region_variant	156	2	121412	41				g.chr11:67048254C>T	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.555+1C>T	chr11.hg19:g.67048254C>T		0					ADRBK1_ENST00000526285.1_Splice_Site_p.H185H	p.H185H	NM_001619.3	NP_001610.2	0	0	0	2.040351	P25098	ARBK1_HUMAN	BRCA - Breast invasive adenocarcinoma(15;2.26e-06)	7	845	+			B0ZBE1|Q13837|Q6GTT3	Splice_Site	SNP	ENST00000308595.5	1	0	hg19	c.555C>T	CCDS8156.1	1																																																																																								0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.597	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	1	0	1	2	2	2	2	0	0	0	0	234	234	234	233	1	1.940000	-20.000000	1	0.640000	NM_001619	Silent	0	316	315	0	707	699	1		1	1		0	0	234	0	0	1.000000	1	0	38	0	79	0	316	707
USP28	57646	broad.mit.edu	37	11	113675589	113675589	+	Splice_Site	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr11:113675589C>T	ENST00000003302.4	-	20	2648		c.e20+1		USP28_ENST00000545540.1_Splice_Site|USP28_ENST00000544967.1_Splice_Site|USP28_ENST00000260188.5_Splice_Site	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28						cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TCTCTTCTCACCTTTCATCAT	0.428																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	ENST00000003302.4	0.970000	0.680000	0.900000	0.750000	0.820000	0.830610	0.820000	0.820000																										0				59						c.e20+1		ubiquitin specific peptidase 28							120.0	110.0	113.0					11																	113675589		2201	4296	6497	SO:0001630	splice_region_variant	57646	0	0					g.chr11:113675589C>T	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2579+1G>A	chr11.hg19:g.113675589C>T		0					USP28_ENST00000260188.5_Splice_Site|USP28_ENST00000545540.1_Splice_Site|USP28_ENST00000544967.1_Splice_Site		NM_020886.2	NP_065937.1	0	0	0	2.040351	Q96RU2	UBP28_HUMAN		20	2648	-		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	B0YJC0|B0YJC1|Q9P213	Splice_Site	SNP	ENST00000003302.4	1	1	hg19		CCDS31680.1	0	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688412	0.88639	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	.	.	.	5.95	5.95	0.96441	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3748	0.98911	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	USP28	113180799	113180799	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.461000	0.80834	2.817000	0.96982	0.563000	0.77884	.	0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.428	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.940000	-6.010339	1	0.640000		Intron	0	97	96	0	269	268	1		1	0		0	0	25	0	0	1.000000	0	0	1	0	0	0	97	269
IFT81	28981	broad.mit.edu	37	12	110655943	110655943	+	Missense_Mutation	SNP	G	G	A	rs150790899		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr12:110655943G>A	ENST00000242591.5	+	19	2449	c.1943G>A	c.(1942-1944)tGt>tAt	p.C648Y	IFT81_ENST00000552912.1_Missense_Mutation_p.C648Y	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	648					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						TTAATGGAATGTAAGAAACAG	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		16776	0.001		0.0	False		,,,				2504	0.0					ENST00000242591.5	0.980000	0.750000	0.930000	0.800000	0.860000	0.869178	0.860000	0.870000																										0				10						c.(1942-1944)tGt>tAt		intraflagellar transport 81							153.0	143.0	147.0					12																	110655943		1878	4108	5986	SO:0001583	missense	28981	1	120846	32				g.chr12:110655943G>A	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.1943G>A	chr12.hg19:g.110655943G>A	ENSP00000242591:p.Cys648Tyr	0					IFT81_ENST00000552912.1_Missense_Mutation_p.C648Y	p.C648Y	NM_014055.3	NP_054774.2	0	0	0	2.008545	Q8WYA0	IFT81_HUMAN		19	2449	+			Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	ENST00000242591.5	1	1	hg19	c.1943G>A	CCDS41831.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	19.76	3.888341	0.72524	.	.	ENSG00000122970	ENST00000552912;ENST00000242591;ENST00000550748	.	.	.	5.22	4.33	0.51752	5.22	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	M	0.78916	2.43	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.80821	-0.1211	9	0.59425	D	0.04	-8.5873	14.297	0.66321	0.0724:0.0:0.9276:0.0	.	648	Q8WYA0	IFT81_HUMAN	Y	648;648;79	.	ENSP00000242591:C648Y	C	+	2	0	0	IFT81	109140326	109140326	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.301000	0.96167	1.338000	0.45544	0.579000	0.79373	TGT	0.635332		TCGA-HV-A5A6-01A-11D-A26I-08	0.388	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	0	0	1	2	26	4	2	1	1	1	1	65	65	65	64	1	1.940000	-20.000000	1	0.640000	NM_014055		0	157	154	0	401	399	1		1	1		1	0	65	0	0	1.000000	9.858339e-01	0	6	0	25	0	157	401
VWF	7450	broad.mit.edu	37	12	6080794	6080794	+	Missense_Mutation	SNP	G	G	A	rs368286307	byFrequency	TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr12:6080794G>A	ENST00000261405.5	-	44	7773	c.7519C>T	c.(7519-7521)Cgg>Tgg	p.R2507W		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2507					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GAGTCCCCCCGCGGTGAGCCA	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		17656	0.0		0.0	False		,,,				2504	0.002					ENST00000261405.5	1.000000	0.970000	1.000000	0.990000	0.990000	0.998464	0.990000	1.000000																										0				129						c.(7519-7521)Cgg>Tgg		von Willebrand factor	Antihemophilic Factor(DB00025)						77.0	75.0	75.0					12																	6080794		2203	4300	6503	SO:0001583	missense	7450	31	121412	47				g.chr12:6080794G>A		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7519C>T	chr12.hg19:g.6080794G>A	ENSP00000261405:p.Arg2507Trp	0						p.R2507W	NM_000552.3	NP_000543	1	2	3	2.049774	P04275	VWF_HUMAN		44	7773	-			Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	1	1	hg19	c.7519C>T	CCDS8539.1	1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968317	0.53614	.	.	ENSG00000110799	ENST00000261405	T	0.37752	1.18	4.79	1.9	0.25705	4.79	1.9	0.25705	.	0.194975	0.25261	N	0.031943	T	0.30947	0.0781	M	0.64404	1.975	0.47994	D	0.999565	B	0.19073	0.033	B	0.12156	0.007	T	0.10965	-1.0607	10	0.62326	D	0.03	.	5.2466	0.15500	0.1761:0.0:0.6614:0.1625	.	2507	P04275	VWF_HUMAN	W	2507	ENSP00000261405:R2507W	ENSP00000261405:R2507W	R	-	1	2	2	VWF	5951055	5951055	0.487000	0.25988	0.082000	0.20525	0.026000	0.11368	0.507000	0.22675	0.204000	0.20548	0.561000	0.74099	CGG	0.641148		TCGA-HV-A5A6-01A-11D-A26I-08	0.612	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.940000	-17.624700	1	0.640000	NM_000552		0	164	161	0	299	290	1		1	0		0	0	87	0	0	1.000000	1	0	0	0	130	0	164	299
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.830000	1.000000	0.970000	0.990000	0.984274	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.008545	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.635332		TCGA-HV-A5A6-01A-11D-A26I-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	1.940000	-20.000000	1	0.640000	NM_033360		2831	33	32	5201	57	57	1	1	1	1	1	0	0	12	453	1	1.000000	9.926599e-01	1	10	140	7	334	33	57
PIWIL1	9271	broad.mit.edu	37	12	130827607	130827607	+	Missense_Mutation	SNP	C	C	T	rs144603967	byFrequency	TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr12:130827607C>T	ENST00000245255.3	+	3	423	c.151C>T	c.(151-153)Cgg>Tgg	p.R51W		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	51					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TGGCCGTGGACGGCAGAGAGG	0.443													C|||	2	0.000399361	0.0	0.0	5008	,	,		14436	0.002		0.0	False		,,,				2504	0.0					ENST00000245255.3	1.000000	0.810000	1.000000	0.900000	0.990000	0.965990	0.990000	1.000000																										0				57						c.(151-153)Cgg>Tgg		piwi-like RNA-mediated gene silencing 1							67.0	59.0	62.0					12																	130827607		2203	4300	6503	SO:0001583	missense	9271	7	121412	38				g.chr12:130827607C>T	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.151C>T	chr12.hg19:g.130827607C>T	ENSP00000245255:p.Arg51Trp	0						p.R51W	NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	0	0	0	2.008545	Q96J94	PIWL1_HUMAN		3	423	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	1	1	hg19	c.151C>T	CCDS9268.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	16.69	3.194066	0.58017	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539400;ENST00000539995;ENST00000535956;ENST00000542723	T;T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93;2.93	5.13	5.13	0.70059	5.13	5.13	0.70059	.	0.197782	0.43579	D	0.000552	T	0.36110	0.0955	M	0.77820	2.39	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.12426	-1.0548	10	0.72032	D	0.01	-12.2295	17.5036	0.87738	0.0:1.0:0.0:0.0	.	51;51	Q96J94;Q96J94-2	PIWL1_HUMAN;.	W	51	ENSP00000245255:R51W;ENSP00000442086:R51W;ENSP00000440677:R51W;ENSP00000439096:R51W;ENSP00000444353:R51W;ENSP00000438582:R51W	ENSP00000245255:R51W	R	+	1	2	2	PIWIL1	129393560	129393560	1.000000	0.71417	0.836000	0.33094	0.417000	0.31264	3.696000	0.54757	2.544000	0.85801	0.467000	0.42956	CGG	0.635332		TCGA-HV-A5A6-01A-11D-A26I-08	0.443	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.940000	-8.296194	1	0.640000			0	64	63	0	131	129	1		1			0	0	19	0	0	1.000000	0	0	0	0	0	0	64	131
EXOC5	10640	broad.mit.edu	37	14	57698417	57698417	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr14:57698417T>A	ENST00000413566.2	-	11	1314	c.955A>T	c.(955-957)Agc>Tgc	p.S319C	EXOC5_ENST00000340918.7_Missense_Mutation_p.S254C	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	319					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						ATCAGCTTGCTGGAAAGATTG	0.303																																						ENST00000413566.2	1.000000	0.740000	1.000000	0.820000	0.910000	0.912202	0.910000	1.000000																										0				22						c.(955-957)Agc>Tgc		exocyst complex component 5							60.0	58.0	58.0					14																	57698417		1814	4072	5886	SO:0001583	missense	10640	0	0					g.chr14:57698417T>A	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.955A>T	chr14.hg19:g.57698417T>A	ENSP00000389934:p.Ser319Cys	1					EXOC5_ENST00000340918.7_Missense_Mutation_p.S254C	p.S319C	NM_006544.3	NP_006535.1	0	1	1	1.795831	O00471	EXOC5_HUMAN		11	1314	-			B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	1	1	hg19	c.955A>T	CCDS45111.1	1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.195041	0.78902	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.47177	0.85;0.85	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.079098	0.85682	D	0.000000	T	0.49983	0.1589	L	0.34521	1.04	0.54753	D	0.999987	P;P	0.51791	0.948;0.927	P;P	0.51582	0.545;0.674	T	0.52434	-0.8576	10	0.62326	D	0.03	-7.6021	16.1251	0.81386	0.0:0.0:0.0:1.0	.	254;319	F8W9B8;O00471	.;EXOC5_HUMAN	C	319;254	ENSP00000389934:S319C;ENSP00000342100:S254C	ENSP00000342100:S254C	S	-	1	0	0	EXOC5	56768170	56768170	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.411000	0.66386	2.267000	0.75376	0.477000	0.44152	AGC	0.581006		TCGA-HV-A5A6-01A-11D-A26I-08	0.303	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.940000	-20.000000	1	0.640000	NM_006544		0	73	72	0	140	140	1		1	1		0	0	31	0	0	1.000000	9.494723e-01	0	3	0	9	0	73	140
AHNAK2	113146	broad.mit.edu	37	14	105420573	105420573	+	Silent	SNP	G	G	A	rs368999034		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr14:105420573G>A	ENST00000333244.5	-	7	1334	c.1215C>T	c.(1213-1215)tgC>tgT	p.C405C	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	405						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGTTCCCTCGCAAAGTCTAG	0.622																																						ENST00000333244.5	0.520000	0.310000	0.470000	0.360000	0.410000	0.420292	0.410000	0.420000																										0				33						c.(1213-1215)tgC>tgT		AHNAK nucleoprotein 2		G		0,4126		0,0,2063	82.0	86.0	85.0		1215	-4.4	0.0	14		85	2,8430		0,2,4214	no	coding-synonymous	AHNAK2	NM_138420.2		0,2,6277	AA,AG,GG		0.0237,0.0,0.0159		405/5796	105420573	2,12556	2063	4216	6279	SO:0001819	synonymous_variant	113146	21	121028	46				g.chr14:105420573G>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1215C>T	chr14.hg19:g.105420573G>A		1					AHNAK2_ENST00000557457.1_5'Flank	p.C405C	NM_138420.2	NP_612429.2	0	1	1	1.747417	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)	7	1334	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	1	1	hg19	c.1215C>T	CCDS45177.1	0																																																																																								0.569790		TCGA-HV-A5A6-01A-11D-A26I-08	0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.940000	-3.142702	1	0.640000	NM_138420		0	52	52	0	275	270	1		1	0		0	0	76	0	0	1.000000	0	0	0	0	1	0	52	275
PGPEP1L	145814	broad.mit.edu	37	15	99512680	99512680	+	Silent	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr15:99512680G>A	ENST00000378919.6	-	4	550	c.345C>T	c.(343-345)gaC>gaT	p.D115D	PGPEP1L_ENST00000535714.1_Silent_p.D61D|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	115							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						AAAAGATCACGTCGACACCCT	0.632																																						ENST00000378919.6	0.500000	0.330000	0.460000	0.360000	0.410000	0.417553	0.410000	0.410000																										0				14						c.(343-345)gaC>gaT		pyroglutamyl-peptidase I-like							118.0	120.0	120.0					15																	99512680		2191	4294	6485	SO:0001819	synonymous_variant	145814	0	0					g.chr15:99512680G>A		CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.345C>T	chr15.hg19:g.99512680G>A		1					PGPEP1L_ENST00000535714.1_Silent_p.D61D|RP11-654A16.3_ENST00000559468.1_RNA	p.D115D	NM_001102612.2	NP_001096082.2	0	1	1	1.798880	A6NFU8	PGPIL_HUMAN		4	550	-			H0YF86	Silent	SNP	ENST00000378919.6	1	1	hg19	c.345C>T	CCDS53977.1	0																																																																																								0.579439		TCGA-HV-A5A6-01A-11D-A26I-08	0.632	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1	1	0	1	2	2	2	2	0	0	0	0	146	146	146	146	1	1.940000	-20.000000	1	0.640000	NM_001102612.2		0	82	82	0	447	442	1		1			0	0	146	0	0	1.000000	0	0	0	0	0	0	82	447
MEFV	4210	broad.mit.edu	37	16	3293394	3293394	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr16:3293394T>C	ENST00000219596.1	-	10	2132	c.2093A>G	c.(2092-2094)gAg>gGg	p.E698G	MEFV_ENST00000536379.1_Missense_Mutation_p.E487G|MEFV_ENST00000339854.4_Missense_Mutation_p.E518G|MEFV_ENST00000541159.1_3'UTR	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	698	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CGCCTGGTACTCATTTTCCTT	0.532																																						ENST00000219596.1	1.000000	0.880000	1.000000	0.930000	0.990000	0.978051	0.990000	1.000000																										0				50						c.(2092-2094)gAg>gGg		Mediterranean fever							125.0	115.0	119.0					16																	3293394		2197	4300	6497	SO:0001583	missense	4210	0	0					g.chr16:3293394T>C	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.2093A>G	chr16.hg19:g.3293394T>C	ENSP00000219596:p.Glu698Gly	0					MEFV_ENST00000339854.4_Missense_Mutation_p.E518G|MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000536379.1_Missense_Mutation_p.E487G	p.E698G	NM_000243.2	NP_000234.1	1	2	3	2.081051	O15553	MEFV_HUMAN		10	2132	-			D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	1	1	hg19	c.2093A>G	CCDS10498.1	1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.217269	0.39201	.	.	ENSG00000103313	ENST00000219596;ENST00000339854;ENST00000536379	T;T;T	0.61040	0.14;0.14;0.14	5.32	4.23	0.50019	5.32	4.23	0.50019	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.135230	0.33691	N	0.004653	T	0.62332	0.2419	L	0.35542	1.07	0.09310	N	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.52616	-0.8552	10	0.41790	T	0.15	-17.3674	9.3257	0.37990	0.0:0.0855:0.0:0.9145	.	698	O15553	MEFV_HUMAN	G	698;518;487	ENSP00000219596:E698G;ENSP00000339639:E518G;ENSP00000445079:E487G	ENSP00000219596:E698G	E	-	2	0	0	MEFV	3233395	3233395	0.118000	0.22208	0.061000	0.19648	0.659000	0.38960	2.161000	0.42358	0.979000	0.38497	0.528000	0.53228	GAG	0.644550		TCGA-HV-A5A6-01A-11D-A26I-08	0.532	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	1	0	1	2	2	2	2	0	0	0	0	86	86	86	86	1	1.940000	-20.000000	1	0.640000	NM_000243		0	198	195	0	428	423	1		1			0	0	86	0	0	1.000000	0	0	0	0	0	0	198	428
SLC6A2	6530	broad.mit.edu	37	16	55733527	55733527	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr16:55733527G>T	ENST00000379906.2	+	11	1806	c.1551G>T	c.(1549-1551)tgG>tgT	p.W517C	SLC6A2_ENST00000219833.8_Missense_Mutation_p.W517C|SLC6A2_ENST00000414754.3_Missense_Mutation_p.W517C|SLC6A2_ENST00000566163.1_Missense_Mutation_p.W472C|SLC6A2_ENST00000567238.1_Missense_Mutation_p.W412C|SLC6A2_ENST00000568943.1_Missense_Mutation_p.W517C|SLC6A2_ENST00000561820.1_Missense_Mutation_p.W517C	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	517					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GTCTATACTGGAGACTGTGCT	0.592																																						ENST00000379906.2	1.000000	0.370000	0.610000	0.440000	0.510000	0.535703	0.510000	0.510000																										0				41						c.(1549-1551)tgG>tgT		solute carrier family 6 (neurotransmitter transporter), member 2	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)						240.0	167.0	192.0					16																	55733527		2198	4300	6498	SO:0001583	missense	6530	0	0					g.chr16:55733527G>T		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1551G>T	chr16.hg19:g.55733527G>T	ENSP00000369237:p.Trp517Cys	0					SLC6A2_ENST00000567238.1_Missense_Mutation_p.W412C|SLC6A2_ENST00000414754.3_Missense_Mutation_p.W517C|SLC6A2_ENST00000219833.8_Missense_Mutation_p.W517C|SLC6A2_ENST00000568943.1_Missense_Mutation_p.W517C|SLC6A2_ENST00000561820.1_Missense_Mutation_p.W517C|SLC6A2_ENST00000566163.1_Missense_Mutation_p.W472C	p.W517C	NM_001043.3	NP_001034.1	1	2	3	2.092122	P23975	SC6A2_HUMAN		11	1806	+			B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	1	1	hg19	c.1551G>T	CCDS10754.1	0	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415365	0.83449	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906;ENST00000219833	T;T;T	0.79033	-1.23;-1.23;-1.23	5.55	5.55	0.83447	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.92227	0.7535	H	0.96142	3.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.998;0.998	D	0.94353	0.7581	10	0.87932	D	0	.	18.2862	0.90114	0.0:0.0:1.0:0.0	.	517;231;412;517	Q96KH8;F5H0T4;B4DX48;P23975	.;.;.;SC6A2_HUMAN	C	517;231;517;517	ENSP00000394956:W517C;ENSP00000369237:W517C;ENSP00000219833:W517C	ENSP00000219833:W517C	W	+	3	0	0	SLC6A2	54291028	54291028	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.315000	0.96313	2.596000	0.87737	0.650000	0.86243	TGG	0.644550		TCGA-HV-A5A6-01A-11D-A26I-08	0.592	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.940000	-20.000000	1	0.640000			0	39	36	0	201	200	1		1			0	0	43	0	0	1.000000	0	0	0	0	0	0	39	201
IL34	146433	broad.mit.edu	37	16	70688501	70688501	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr16:70688501C>T	ENST00000288098.2	+	2	472	c.89C>T	c.(88-90)aCg>aTg	p.T30M	IL34_ENST00000429149.2_Missense_Mutation_p.T30M|IL34_ENST00000569641.1_Intron|IL34_ENST00000566361.1_Missense_Mutation_p.T5M	NM_001172772.1	NP_001166243.1	Q6ZMJ4	IL34_HUMAN	interleukin 34	30					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	extracellular space (GO:0005615)	macrophage colony-stimulating factor receptor binding (GO:0005157)			breast(1)|central_nervous_system(1)|kidney(9)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(2)	17						TGGCCCTTGACGCAGAATGAG	0.572											OREG0023916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000288098.2	1.000000	0.240000	0.390000	0.280000	0.320000	0.370339	0.320000	0.330000																										0				17						c.(88-90)aCg>aTg		interleukin 34							328.0	229.0	263.0					16																	70688501		2198	4300	6498	SO:0001583	missense	146433	1	121410	35				g.chr16:70688501C>T	BC029804	CCDS10895.1	16q22.1	2008-08-01	2008-06-04	2008-06-04	ENSG00000157368	ENSG00000157368		"""Interleukins and interleukin receptors"""	28529	protein-coding gene	gene with protein product		612081	"""chromosome 16 open reading frame 77"""	C16orf77		18467591	Standard	NM_152456		Approved	MGC34647, IL-34	uc002ezh.2	Q6ZMJ4	OTTHUMG00000137581	ENST00000288098.2:c.89C>T	chr16.hg19:g.70688501C>T	ENSP00000288098:p.Thr30Met	0		OREG0023916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1124	IL34_ENST00000569641.1_Intron|IL34_ENST00000429149.2_Missense_Mutation_p.T30M|IL34_ENST00000566361.1_Missense_Mutation_p.T5M	p.T30M	NM_001172772.1	NP_001166243.1	1	2	3	2.120359	Q6ZMJ4	IL34_HUMAN		2	472	+			B2RC28|B2Z4A8|B2ZC70|Q8N6L2	Missense_Mutation	SNP	ENST00000288098.2	1	1	hg19	c.89C>T	CCDS10895.1	0	.	.	.	.	.	.	.	.	.	.	C	11.00	1.509704	0.27036	.	.	ENSG00000157368	ENST00000429149;ENST00000288098	T;T	0.49432	0.78;0.78	4.32	3.32	0.38043	4.32	3.32	0.38043	.	0.568429	0.15866	N	0.240758	T	0.61515	0.2353	M	0.70595	2.14	0.09310	N	1	D;D	0.89917	1.0;1.0	P;P	0.60886	0.88;0.88	T	0.51434	-0.8706	10	0.66056	D	0.02	-11.2702	10.7643	0.46283	0.1886:0.8114:0.0:0.0	.	30;30	Q6ZMJ4-2;Q6ZMJ4	.;IL34_HUMAN	M	30	ENSP00000397863:T30M;ENSP00000288098:T30M	ENSP00000288098:T30M	T	+	2	0	0	IL34	69246002	69246002	0.002000	0.14202	0.051000	0.19133	0.015000	0.08874	1.190000	0.32126	2.258000	0.74832	0.456000	0.33151	ACG	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.572	IL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268971.3	1	0	1	2	2	2	2	0	0	0	0	94	94	94	93	1	1.940000	-15.244260	1	0.640000	NM_152456		0	44	45	0	385	382	1		1	0		0	0	94	0	0	1.000000	4.345854e-01	0	0	0	14	0	44	385
ZNF821	55565	broad.mit.edu	37	16	71913839	71913839	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr16:71913839C>T	ENST00000565601.1	-	2	418	c.11G>A	c.(10-12)cGg>cAg	p.R4Q	ZNF821_ENST00000446827.2_Missense_Mutation_p.R4Q|ZNF821_ENST00000425432.1_Missense_Mutation_p.R4Q|ZNF821_ENST00000564134.1_Missense_Mutation_p.R4Q|RP11-498D10.3_ENST00000561979.1_RNA|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000564943.1_5'UTR|ZNF821_ENST00000313565.6_Missense_Mutation_p.R4Q	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R4L(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						TGTCTGTTTCCGACGGGACAT	0.438																																						ENST00000565601.1	1.000000	0.410000	0.520000	0.440000	0.470000	0.509320	0.470000	0.480000																										1	Substitution - Missense(1)	p.R4L(1)	lung(1)	13						c.(10-12)cGg>cAg		zinc finger protein 821							285.0	272.0	276.0					16																	71913839		2198	4300	6498	SO:0001583	missense	55565	0	0					g.chr16:71913839C>T	AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.11G>A	chr16.hg19:g.71913839C>T	ENSP00000455648:p.Arg4Gln	0					ZNF821_ENST00000446827.2_Missense_Mutation_p.R4Q|ZNF821_ENST00000564134.1_Missense_Mutation_p.R4Q|ZNF821_ENST00000425432.1_Missense_Mutation_p.R4Q|ZNF821_ENST00000313565.6_Missense_Mutation_p.R4Q|RP11-498D10.3_ENST00000561979.1_RNA|ZNF821_ENST00000564943.1_5'UTR|ATXN1L_ENST00000569119.1_Intron	p.R4Q	NM_001201553.1	NP_001188482.1	1	2	3	2.120359	O75541	ZN821_HUMAN		2	418	-			A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	ENST00000565601.1	1	1	hg19	c.11G>A	CCDS56006.1	0	.	.	.	.	.	.	.	.	.	.	C	19.96	3.924263	0.73213	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01505	6.15;4.82;4.82	5.75	5.75	0.90469	5.75	5.75	0.90469	.	0.197314	0.41605	D	0.000844	T	0.04861	0.0131	N	0.19112	0.55	0.52501	D	0.999955	D;D	0.64830	0.994;0.99	P;D	0.66847	0.885;0.947	T	0.57963	-0.7720	10	0.51188	T	0.08	-12.0468	16.6641	0.85248	0.0:1.0:0.0:0.0	.	4;4	B4DKK4;O75541-2	.;.	Q	4	ENSP00000398089:R4Q;ENSP00000313822:R4Q;ENSP00000405908:R4Q	ENSP00000313822:R4Q	R	-	2	0	0	ZNF821	70471340	70471340	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.962000	0.56766	2.696000	0.92011	0.655000	0.94253	CGG	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.438	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1	1	0	1	2	2	2	2	0	0	0	0	165	165	165	164	1	1.940000	-20.000000	1	0.640000	NM_017530		0	204	203	0	1157	1152	1		1	0		0	0	165	0	0	1.000000	4.008999e-01	0	0	0	9	0	204	1157
HP	3240	broad.mit.edu	37	16	72094379	72094379	+	Missense_Mutation	SNP	G	G	A	rs189039907		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr16:72094379G>A	ENST00000355906.5	+	7	869	c.811G>A	c.(811-813)Gat>Aat	p.D271N	HP_ENST00000398131.2_Missense_Mutation_p.D212N|HP_ENST00000357763.4_Missense_Mutation_p.D307N|HPR_ENST00000561690.1_5'Flank|HPR_ENST00000356967.5_Intron|HPR_ENST00000540303.2_5'Flank|HP_ENST00000570083.1_Missense_Mutation_p.D212N|HP_ENST00000565574.1_Missense_Mutation_p.D212N|HP_ENST00000562526.1_Intron	NM_005143.3	NP_005134.1	P00738	HPT_HUMAN	haptoglobin	271	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|immune system process (GO:0002376)|negative regulation of hydrogen peroxide catabolic process (GO:2000296)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of cell death (GO:0010942)|response to hydrogen peroxide (GO:0042542)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)	antioxidant activity (GO:0016209)|hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)		BRCA - Breast invasive adenocarcinoma(221;0.00015)|Kidney(780;0.000529)		ACCTTCAAAGGATTATGCAGA	0.458																																						ENST00000355906.5	1.000000	0.160000	0.320000	0.200000	0.250000	0.300196	0.250000	0.250000																										0				7						c.(811-813)Gat>Aat		haptoglobin							98.0	97.0	98.0					16																	72094379		1933	4151	6084	SO:0001583	missense	3240	10	120896	39				g.chr16:72094379G>A		CCDS45524.1, CCDS45525.1	16q22.2	2012-10-02			ENSG00000257017	ENSG00000257017			5141	protein-coding gene	gene with protein product		140100				11109501, 9352226	Standard	NM_005143		Approved		uc002fbr.4	P00738		ENST00000355906.5:c.811G>A	chr16.hg19:g.72094379G>A	ENSP00000348170:p.Asp271Asn	0					HPR_ENST00000540303.2_5'Flank|HP_ENST00000357763.4_Missense_Mutation_p.D307N|HP_ENST00000562526.1_Intron|HP_ENST00000565574.1_Missense_Mutation_p.D212N|HP_ENST00000570083.1_Missense_Mutation_p.D212N|HPR_ENST00000561690.1_5'Flank|HPR_ENST00000356967.5_Intron|HP_ENST00000398131.2_Missense_Mutation_p.D212N	p.D271N	NM_005143.3	NP_005134.1	1	2	3	2.120359	P00738	HPT_HUMAN		7	869	+		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)	B0AZL5|P00737|Q0VAC4|Q0VAC5|Q2PP15|Q3B7J0|Q6LBY9|Q9UC67	Missense_Mutation	SNP	ENST00000355906.5	0	1	hg19	c.811G>A	CCDS45524.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	g	12.22	1.872195	0.33069	.	.	ENSG00000257017	ENST00000355906;ENST00000398131;ENST00000405951;ENST00000357763	D;D	0.88741	-2.42;-2.42	5.12	3.18	0.36537	5.12	3.18	0.36537	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.058620	0.64402	N	0.000005	D	0.82577	0.5067	L	0.33245	0.995	0.80722	D	1	B;B;B;B	0.26120	0.006;0.142;0.035;0.013	B;B;B;B	0.28784	0.02;0.094;0.053;0.065	T	0.77765	-0.2465	10	0.49607	T	0.09	.	10.5318	0.44981	0.1575:0.0:0.8425:0.0	.	93;146;212;271	Q6PEJ8;Q6NSB4;Q0VAC5;P00738	.;.;.;HPT_HUMAN	N	271;212;146;247	ENSP00000348170:D271N;ENSP00000381199:D212N	ENSP00000348170:D271N	D	+	1	0	0	HP	70651880	70651880	1.000000	0.71417	0.313000	0.25210	0.827000	0.46813	3.043000	0.49823	0.768000	0.33290	-0.124000	0.14976	GAT	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.458	HP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421680.1	0	0	1	2	20	2	2	1	1	1	1	50	50	50	48	1	1.940000	-2.920855	1	0.640000	NM_005143		0	24	24	0	282	280	0		1	0		1	0	50	0	0	0.772769	2.547856e-01	0	0	0	12	0	24	282
EMR3	84658	broad.mit.edu	37	19	14749135	14749135	+	Silent	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr19:14749135G>A	ENST00000253673.5	-	11	1366	c.1266C>T	c.(1264-1266)atC>atT	p.I422I	EMR3_ENST00000599900.1_Silent_p.I207I|EMR3_ENST00000443157.2_Silent_p.I296I|EMR3_ENST00000344373.4_Silent_p.I370I	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	422					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						AAGCACCGGCGATGATGGAGC	0.582																																						ENST00000253673.5	0.540000	0.270000	0.470000	0.330000	0.390000	0.407915	0.390000	0.400000																										0				50						c.(1264-1266)atC>atT		egf-like module containing, mucin-like, hormone receptor-like 3							76.0	62.0	67.0					19																	14749135		2203	4300	6503	SO:0001819	synonymous_variant	84658	1	121412	27				g.chr19:14749135G>A	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1266C>T	chr19.hg19:g.14749135G>A		1					EMR3_ENST00000344373.4_Silent_p.I370I|EMR3_ENST00000443157.2_Silent_p.I296I|EMR3_ENST00000599900.1_Silent_p.I207I	p.I422I	NM_032571.3	NP_115960.2	0	1	1	1.787483	Q9BY15	EMR3_HUMAN		11	1366	-				Silent	SNP	ENST00000253673.5	1	1	hg19	c.1266C>T	CCDS12315.1	0																																																																																								0.579439		TCGA-HV-A5A6-01A-11D-A26I-08	0.582	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	0	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.940000	-20.000000	1	0.640000	NM_032571		0	29	29	0	165	165	1		1	0		0	0	34	0	0	1.000000	2.408578e-02	0	0	0	2	0	29	165
RYR1	6261	broad.mit.edu	37	19	38939147	38939147	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr19:38939147C>T	ENST00000359596.3	+	10	953	c.953C>T	c.(952-954)tCc>tTc	p.S318F	RYR1_ENST00000360985.3_Missense_Mutation_p.S318F|RYR1_ENST00000355481.4_Missense_Mutation_p.S318F			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	318	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTCCGCATCTCCAAGGTCAGT	0.642																																						ENST00000359596.3	1.000000	0.020000	1.000000	0.040000	0.070000	0.287849	0.070000	0.070000																										0				285						c.(952-954)tCc>tTc		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						105.0	98.0	100.0					19																	38939147		2203	4300	6503	SO:0001583	missense	6261	0	0					g.chr19:38939147C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.953C>T	chr19.hg19:g.38939147C>T	ENSP00000352608:p.Ser318Phe	1					RYR1_ENST00000360985.3_Missense_Mutation_p.S318F|RYR1_ENST00000355481.4_Missense_Mutation_p.S318F	p.S318F			1	2	3	2.282149	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	10	953	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	0	1	hg19	c.953C>T	CCDS33011.1	0	.	.	.	.	.	.	.	.	.	.	C	16.29	3.080776	0.55753	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.85955	-2.05;-2.05;-2.05	4.51	4.51	0.55191	4.51	4.51	0.55191	MIR motif (2);MIR (2);	0.090463	0.46145	U	0.000315	D	0.92315	0.7562	M	0.79926	2.475	0.43863	D	0.996461	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93476	0.6823	10	0.87932	D	0	.	16.1498	0.81605	0.0:1.0:0.0:0.0	.	318;318	P21817-2;P21817	.;RYR1_HUMAN	F	318	ENSP00000352608:S318F;ENSP00000347667:S318F;ENSP00000354254:S318F	ENSP00000347667:S318F	S	+	2	0	0	RYR1	43630987	43630987	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.239000	0.78182	2.348000	0.79779	0.491000	0.48974	TCC	0.682652		TCGA-HV-A5A6-01A-11D-A26I-08	0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	0	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	1.940000	-2.849770	1	0.640000			0	13	13	0	715	710	0		1			0	0	105	0	0	0.999512	0	0	0	0	0	0	13	715
SYT3	84258	broad.mit.edu	37	19	51133050	51133050	+	Missense_Mutation	SNP	A	A	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr19:51133050A>T	ENST00000338916.4	-	3	1686	c.1053T>A	c.(1051-1053)ttT>ttA	p.F351L	SYT3_ENST00000544769.1_Missense_Mutation_p.F351L|SYT3_ENST00000593901.1_Missense_Mutation_p.F351L|SYT3_ENST00000600079.1_Missense_Mutation_p.F351L	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	351	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CCTTGGTCTGAAACTTTTTCT	0.632																																						ENST00000338916.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				35						c.(1051-1053)ttT>ttA		synaptotagmin III							49.0	50.0	50.0					19																	51133050		2203	4300	6503	SO:0001583	missense	84258	0	0					g.chr19:51133050A>T	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1053T>A	chr19.hg19:g.51133050A>T	ENSP00000340914:p.Phe351Leu	1					SYT3_ENST00000593901.1_Missense_Mutation_p.F351L|SYT3_ENST00000600079.1_Missense_Mutation_p.F351L|SYT3_ENST00000544769.1_Missense_Mutation_p.F351L	p.F351L	NM_032298.2	NP_115674.1	1	2	3	2.478776	Q9BQG1	SYT3_HUMAN		3	1686	-		all_neural(266;0.131)	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	1	1	hg19	c.1053T>A	CCDS12798.1	1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.471928	0.26423	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.68624	-0.34;-0.34	4.67	-4.51	0.03483	4.67	-4.51	0.03483	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.083116	0.47455	U	0.000232	T	0.44307	0.1287	N	0.12961	0.28	0.50039	D	0.999842	B	0.25955	0.138	B	0.18561	0.022	T	0.03157	-1.1066	10	0.29301	T	0.29	.	17.5164	0.87775	0.183:0.0:0.817:0.0	.	351	Q9BQG1	SYT3_HUMAN	L	351	ENSP00000340914:F351L;ENSP00000438883:F351L	ENSP00000340914:F351L	F	-	3	2	2	SYT3	55824862	55824862	0.967000	0.33354	0.971000	0.41717	0.461000	0.32589	0.042000	0.13949	-0.918000	0.03808	-0.250000	0.11733	TTT	0.696356		TCGA-HV-A5A6-01A-11D-A26I-08	0.632	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	1.940000	-20.000000	1	0.640000	NM_032298		0	156	154	0	217	215	0		1	0		0	0	54	0	0	1.000000	1.749958e-01	0	0	0	2	0	156	217
MYO1F	4542	broad.mit.edu	37	19	8609328	8609328	+	Silent	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr19:8609328G>A	ENST00000338257.8	-	14	1644	c.1377C>T	c.(1375-1377)agC>agT	p.S459S	AC092316.2_ENST00000581156.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	459	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CGTCCAAGACGCTCATGATGC	0.667																																						ENST00000338257.8	0.650000	0.310000	0.570000	0.380000	0.470000	0.482034	0.470000	0.470000																										0				42						c.(1375-1377)agC>agT		myosin IF							15.0	20.0	18.0					19																	8609328		2052	4206	6258	SO:0001819	synonymous_variant	4542	0	0					g.chr19:8609328G>A	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1377C>T	chr19.hg19:g.8609328G>A		1					AC092316.2_ENST00000581156.1_RNA	p.S459S	NM_012335.3	NP_036467.2	0	1	1	1.787483	O00160	MYO1F_HUMAN		14	1644	-			Q8WWN7	Silent	SNP	ENST00000338257.8	1	1	hg19	c.1377C>T	CCDS42494.1	0																																																																																								0.579439		TCGA-HV-A5A6-01A-11D-A26I-08	0.667	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.940000	-20.000000	1	0.640000			0	24	24	0	112	110	0		1	0		0	0	24	0	0	1.000000	5.574143e-01	0	0	0	10	0	24	112
ZNF784	147808	broad.mit.edu	37	19	56135868	56135868	+	Silent	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr19:56135868G>A	ENST00000325351.4	-	1	99	c.60C>T	c.(58-60)tcC>tcT	p.S20S	ZNF784_ENST00000591479.1_Silent_p.S20S	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	20					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GTGGCTCCTGGGATCGCGACT	0.716																																						ENST00000325351.4	1.000000	0.320000	1.000000	0.470000	0.680000	0.712254	0.680000	1.000000																										0				1						c.(58-60)tcC>tcT		zinc finger protein 784							9.0	10.0	10.0					19																	56135868		2161	4224	6385	SO:0001819	synonymous_variant	147808	0	0					g.chr19:56135868G>A	AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.60C>T	chr19.hg19:g.56135868G>A		1					ZNF784_ENST00000591479.1_Silent_p.S20S	p.S20S	NM_203374.1	NP_976308.1	1	2	3	2.493615	Q8NCA9	ZN784_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	1	99	-				Silent	SNP	ENST00000325351.4	1	1	hg19	c.60C>T	CCDS12930.1	0																																																																																								0.699599		TCGA-HV-A5A6-01A-11D-A26I-08	0.716	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453355.2	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.940000	-17.312020	1	0.640000	NM_203374		0	9	8	0	48	47	0		1	0		0	0	15	0	0	0.994662	2.661550e-01	0	1	0	5	0	9	48
CEPT1	10390	broad.mit.edu	37	1	111702113	111702113	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:111702113G>T	ENST00000545121.1	+	3	659	c.451G>T	c.(451-453)Gaa>Taa	p.E151*	CEPT1_ENST00000357172.4_Nonsense_Mutation_p.E151*	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1	151					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	TCCTCTGGGAGAACTTTTTGA	0.378																																						ENST00000545121.1	1.000000	0.780000	1.000000	0.840000	0.910000	0.916826	0.910000	1.000000																										0				8						c.(451-453)Gaa>Taa		choline/ethanolamine phosphotransferase 1	Choline(DB00122)						133.0	133.0	133.0					1																	111702113		2203	4300	6503	SO:0001587	stop_gained	10390	0	0					g.chr1:111702113G>T	AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.451G>T	chr1.hg19:g.111702113G>T	ENSP00000441980:p.Glu151*	0					CEPT1_ENST00000357172.4_Nonsense_Mutation_p.E151*	p.E151*	NM_001007794.1	NP_001007795.1	1	2	3	2.140631	Q9Y6K0	CEPT1_HUMAN		3	659	+		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)	Q69YJ9|Q9P0Y8	Nonsense_Mutation	SNP	ENST00000545121.1	0	1	hg19	c.451G>T	CCDS830.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.135643	0.97315	.	.	ENSG00000134255	ENST00000545121;ENST00000357172	.	.	.	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-41.1206	16.8534	0.86000	0.0:0.0:1.0:0.0	.	.	.	.	X	151	.	ENSP00000349696:E151X	E	+	1	0	0	CEPT1	111503636	111503636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.568000	0.86640	0.655000	0.94253	GAA	0.648986		TCGA-HV-A5A6-01A-11D-A26I-08	0.378	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034462.2	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.940000	-20.000000	1	0.640000	NM_006090		0	148	148	0	372	370	1		1	1		0	0	27	0	0	1.000000	9.842258e-01	0	2	0	17	0	148	372
CAPZA1	829	broad.mit.edu	37	1	113162484	113162485	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			T|C	A|T	T|C	T|C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:113162484_113162485TC>AT	ENST00000263168.3	+	1	690_691	c.18_19TC>AT	c.(16-21)gaTCgt>gaATgt	p.6_7DR>EC	ST7L_ENST00000369668.2_5'Flank|ST7L_ENST00000544629.1_5'Flank|ST7L_ENST00000543570.1_5'Flank|ST7L_ENST00000343210.7_5'Flank|ST7L_ENST00000369666.1_5'Flank|CAPZA1_ENST00000476936.1_3'UTR|ST7L_ENST00000358039.4_5'Flank|ST7L_ENST00000490067.1_5'Flank|ST7L_ENST00000538187.1_5'Flank|ST7L_ENST00000360743.4_5'Flank|ST7L_ENST00000463235.1_Intron|ST7L_ENST00000369669.1_5'Flank	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	6					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTTCGATGATCGTGTGTCGGA	0.668																																						ENST00000263168.3	1.000000	0.240000	0.570000|0.580000	0.320000	0.430000	0.469779|0.473732	0.430000	0.410000																										0				9						c.(16-18)gaT>gaA|c.(19-21)Cgt>Tgt		capping protein (actin filament) muscle Z-line, alpha 1																																				SO:0001583	missense	829	0	0					g.chr1:113162484T>A|g.chr1:113162485C>T	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	Exception_encountered	chr1.hg19:g.113162484_113162485delinsAT	ENSP00000263168:p.D6_R7delinsEC	0					ST7L_ENST00000358039.4_5'Flank|ST7L_ENST00000360743.4_5'Flank|ST7L_ENST00000369666.1_5'Flank|ST7L_ENST00000369669.1_5'Flank|CAPZA1_ENST00000476936.1_3'UTR|ST7L_ENST00000538187.1_5'Flank|ST7L_ENST00000343210.7_5'Flank|ST7L_ENST00000369668.2_5'Flank|ST7L_ENST00000544629.1_5'Flank|ST7L_ENST00000463235.1_Intron|ST7L_ENST00000543570.1_5'Flank|ST7L_ENST00000490067.1_5'Flank	p.D6E|p.R7C	NM_006135.2	NP_006126.1	1	2	3	2.140631	P52907	CAZA1_HUMAN		1	690|691	+	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)	Q53FQ6|Q6FHD5	Missense_Mutation	SNP	ENST00000263168.3	0	1	hg19	c.18T>A|c.19C>T	CCDS30805.1	0																									6.17	6.17	0.99709																																												2|0			112964007|112964008														0.648986		TCGA-HV-A5A6-01A-11D-A26I-08	0.668	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032567.2	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.940000	-19.981850|-19.972810	1	0.640000	NM_006135		0	13	13	0	88|87	88|87	1		1	1		0	0	16	0	0	0.999655|0.999657	9.983661e-01|9.985749e-01	0	24	0	55|56	0	13	87
SPEN	23013	broad.mit.edu	37	1	16262018	16262018	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:16262018C>T	ENST00000375759.3	+	11	9487	c.9283C>T	c.(9283-9285)Cag>Tag	p.Q3095*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3095					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCACCTCTCCCAGGGCGAGGT	0.617																																						ENST00000375759.3	1.000000	0.300000	0.520000	0.360000	0.420000	0.467017	0.420000	0.420000																										0				149						c.(9283-9285)Cag>Tag		spen family transcriptional repressor							81.0	66.0	71.0					1																	16262018		2203	4300	6503	SO:0001587	stop_gained	23013	0	0					g.chr1:16262018C>T		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.9283C>T	chr1.hg19:g.16262018C>T	ENSP00000364912:p.Gln3095*	0						p.Q3095*	NM_015001.2	NP_055816.2	1	2	3	2.135344	Q96T58	MINT_HUMAN		11	9487	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	ENST00000375759.3	0	1	hg19	c.9283C>T	CCDS164.1	0	.	.	.	.	.	.	.	.	.	.	C	50	17.181384	0.99881	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.34	5.34	0.76211	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-12.7426	19.0275	0.92939	0.0:1.0:0.0:0.0	.	.	.	.	X	3095	.	ENSP00000364912:Q3095X	Q	+	1	0	0	SPEN	16134605	16134605	0.998000	0.40836	0.977000	0.42913	0.846000	0.48090	3.935000	0.56560	2.494000	0.84150	0.491000	0.48974	CAG	0.648986		TCGA-HV-A5A6-01A-11D-A26I-08	0.617	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.940000	-3.319644	1	0.640000	NM_015001		0	36	36	0	237	236	1		1	1		0	0	43	0	0	1.000000	9.056351e-01	0	3	0	26	0	36	237
TUFT1	7286	broad.mit.edu	37	1	151552137	151552137	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:151552137A>G	ENST00000368849.3	+	11	999	c.937A>G	c.(937-939)Aaa>Gaa	p.K313E	TUFT1_ENST00000538902.1_Missense_Mutation_p.K332E|TUFT1_ENST00000368848.2_Missense_Mutation_p.K288E|TUFT1_ENST00000353024.3_Missense_Mutation_p.K254E|TUFT1_ENST00000392712.3_Missense_Mutation_p.K258E	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	313					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CCAGAATTCAAAAGCTGTGAT	0.547																																						ENST00000368849.3	1.000000	0.330000	0.650000	0.410000	0.520000	0.542988	0.520000	0.510000																										0				13						c.(937-939)Aaa>Gaa		tuftelin 1							58.0	53.0	54.0					1																	151552137		2203	4300	6503	SO:0001583	missense	7286	0	0					g.chr1:151552137A>G	AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.937A>G	chr1.hg19:g.151552137A>G	ENSP00000357842:p.Lys313Glu	0					TUFT1_ENST00000353024.3_Missense_Mutation_p.K254E|TUFT1_ENST00000368848.2_Missense_Mutation_p.K288E|TUFT1_ENST00000538902.1_Missense_Mutation_p.K332E|TUFT1_ENST00000392712.3_Missense_Mutation_p.K258E	p.K313E	NM_020127.2	NP_064512.1	1	2	3	2.093433	Q9NNX1	TUFT1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)	11	999	+	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Missense_Mutation	SNP	ENST00000368849.3	1	1	hg19	c.937A>G	CCDS1000.1	0	.	.	.	.	.	.	.	.	.	.	A	24.6	4.553081	0.86127	.	.	ENSG00000143367	ENST00000368849;ENST00000392712;ENST00000353024;ENST00000368848;ENST00000538902	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.050570	0.85682	D	0.000000	T	0.74921	0.3780	M	0.71581	2.175	0.35617	D	0.809083	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.91635	0.997;0.999;0.984	T	0.76710	-0.2859	10	0.37606	T	0.19	-22.6669	14.4941	0.67674	1.0:0.0:0.0:0.0	.	332;288;313	F5H607;Q9NNX1-2;Q9NNX1	.;.;TUFT1_HUMAN	E	313;258;254;288;332	ENSP00000357842:K313E;ENSP00000376476:K258E;ENSP00000343781:K254E;ENSP00000357841:K288E;ENSP00000437997:K332E	ENSP00000343781:K254E	K	+	1	0	0	TUFT1	149818761	149818761	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.020000	0.70826	2.304000	0.77564	0.528000	0.53228	AAA	0.644550		TCGA-HV-A5A6-01A-11D-A26I-08	0.547	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.940000	-20.000000	1	0.640000	NM_020127		0	19	19	0	98	97	1		1	1		0	0	21	0	0	0.999994	9.705357e-01	0	9	0	24	0	19	98
NFASC	23114	broad.mit.edu	37	1	204957892	204957892	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:204957892G>A	ENST00000401399.1	+	22	2924	c.2725G>A	c.(2725-2727)Ggg>Agg	p.G909R	NFASC_ENST00000539706.1_Missense_Mutation_p.G1012R|NFASC_ENST00000360049.4_Missense_Mutation_p.G1012R|NFASC_ENST00000339876.6_Missense_Mutation_p.G909R|NFASC_ENST00000367170.4_Missense_Mutation_p.G1016R|NFASC_ENST00000338515.6_Missense_Mutation_p.G1016R|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000513543.1_Missense_Mutation_p.G1012R|NFASC_ENST00000367169.4_Missense_Mutation_p.G909R|NFASC_ENST00000367171.4_Missense_Mutation_p.G1001R|NFASC_ENST00000404076.1_Missense_Mutation_p.G995R|NFASC_ENST00000367172.4_Missense_Mutation_p.G1016R|NFASC_ENST00000338586.6_Missense_Mutation_p.G1016R|NFASC_ENST00000404907.1_Missense_Mutation_p.G1012R			O94856	NFASC_HUMAN	neurofascin	917	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGTGGGCTCTGGGGAAGCCGT	0.592																																						ENST00000401399.1	1.000000	0.020000	0.090000	0.040000	0.060000	0.095237	0.060000	0.060000																										0				81						c.(2725-2727)Ggg>Agg		neurofascin							74.0	73.0	74.0					1																	204957892		2203	4300	6503	SO:0001583	missense	23114	0	0					g.chr1:204957892G>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2725G>A	chr1.hg19:g.204957892G>A	ENSP00000385637:p.Gly909Arg	0					NFASC_ENST00000338586.6_Missense_Mutation_p.G1016R|NFASC_ENST00000338515.6_Missense_Mutation_p.G1016R|NFASC_ENST00000513543.1_Missense_Mutation_p.G1012R|NFASC_ENST00000367172.4_Missense_Mutation_p.G1016R|NFASC_ENST00000367170.4_Missense_Mutation_p.G1016R|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000367171.4_Missense_Mutation_p.G1001R|NFASC_ENST00000404076.1_Missense_Mutation_p.G995R|NFASC_ENST00000367169.4_Missense_Mutation_p.G909R|NFASC_ENST00000360049.4_Missense_Mutation_p.G1012R|NFASC_ENST00000404907.1_Missense_Mutation_p.G1012R|NFASC_ENST00000539706.1_Missense_Mutation_p.G1012R|NFASC_ENST00000339876.6_Missense_Mutation_p.G909R	p.G909R			1	2	3	2.093433	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)	22	2924	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	0	1	hg19	c.2725G>A	CCDS53460.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.612808|5.612808	0.96637|0.96637	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393|ENST00000413225	T;T;T;T;D;T;T;T;D;T;D;T;T;T|.	0.91996|.	-0.05;-0.05;-0.05;-0.05;-2.95;-0.05;-0.05;-0.05;-2.95;-0.05;-2.95;-0.05;-0.05;-0.05|.	5.57|5.57	5.57|5.57	0.84162|0.84162	5.57|5.57	5.57|5.57	0.84162|0.84162	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.000000|.	0.49916|.	D|.	0.000140|.	D|.	0.86732|.	0.6003|.	M|M	0.92970|0.92970	3.365|3.365	0.38365|0.38365	D|D	0.944703|0.944703	D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.997;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D;D|.	0.97110|.	1.0;0.999;0.995;1.0;0.998;1.0;1.0;0.999;0.999|.	D|.	0.90619|.	0.4558|.	10|.	0.87932|.	D|.	0|.	.|.	19.1402|19.1402	0.93444|0.93444	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1016;1027;1012;1016;1016;909;1001;909;1012|.	O94856;O94856-11;O94856-8;O94856-7;F8W8X7;O94856-4;F8W791;O94856-9;O94856-3|.	NFASC_HUMAN;.;.;.;.;.;.;.;.|.	R|X	1016;1001;1016;1016;909;1016;1027;1012;1012;909;995;909;1012;1012;1003|34	ENSP00000356140:G1016R;ENSP00000356139:G1001R;ENSP00000356138:G1016R;ENSP00000342128:G1016R;ENSP00000344786:G909R;ENSP00000343509:G1016R;ENSP00000438614:G1012R;ENSP00000353154:G1012R;ENSP00000356137:G909R;ENSP00000385676:G995R;ENSP00000385637:G909R;ENSP00000384061:G1012R;ENSP00000425908:G1012R;ENSP00000415031:G1003R|.	ENSP00000295776:G1027R|.	G|W	+|+	1|2	0|0	0|0	NFASC|NFASC	203224515|203224515	203224515|203224515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.413000|9.413000	0.97351|0.97351	2.600000|2.600000	0.87896|0.87896	0.655000|0.655000	0.94253|0.94253	GGG|TGG	0.644550		TCGA-HV-A5A6-01A-11D-A26I-08	0.592	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	0	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	1.940000	-2.892106	1	0.640000	NM_001005388		0	9	9	0	451	449	0		1			0	0	77	0	0	0.994200	0	0	0	0	0	0	9	451
LUZP1	7798	broad.mit.edu	37	1	23420022	23420022	+	Missense_Mutation	SNP	C	C	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:23420022C>G	ENST00000302291.4	-	4	1534	c.733G>C	c.(733-735)Ggc>Cgc	p.G245R	LUZP1_ENST00000314174.5_Missense_Mutation_p.G245R|LUZP1_ENST00000418342.1_Missense_Mutation_p.G245R|LUZP1_ENST00000374623.3_Missense_Mutation_p.G245R			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	245					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		GAAGAGATGCCATCCTCAATC	0.393																																						ENST00000302291.4	1.000000	0.810000	1.000000	0.880000	0.950000	0.948852	0.950000	1.000000																										0				31						c.(733-735)Ggc>Cgc		leucine zipper protein 1							134.0	122.0	126.0					1																	23420022		2203	4300	6503	SO:0001583	missense	7798	0	0					g.chr1:23420022C>G	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.733G>C	chr1.hg19:g.23420022C>G	ENSP00000303758:p.Gly245Arg	0					LUZP1_ENST00000314174.5_Missense_Mutation_p.G245R|LUZP1_ENST00000418342.1_Missense_Mutation_p.G245R|LUZP1_ENST00000374623.3_Missense_Mutation_p.G245R	p.G245R			1	2	3	2.140631	Q86V48	LUZP1_HUMAN		4	1534	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	1	1	hg19	c.733G>C	CCDS30628.1	1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291930	0.59976	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174;ENST00000471849	T;T;T;T;T	0.43294	2.75;2.75;2.75;2.53;0.95	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.000000	0.49305	D	0.000143	T	0.55289	0.1911	L	0.46157	1.445	0.40391	D	0.979547	D;D	0.71674	0.998;0.998	D;D	0.69142	0.962;0.962	T	0.50947	-0.8767	10	0.41790	T	0.15	.	13.0796	0.59107	0.0:0.9277:0.0:0.0723	.	245;245	Q86V48-2;Q86V48	.;LUZP1_HUMAN	R	245	ENSP00000393460:G245R;ENSP00000363752:G245R;ENSP00000303758:G245R;ENSP00000313705:G245R;ENSP00000428061:G245R	ENSP00000303758:G245R	G	-	1	0	0	LUZP1	23292609	23292609	1.000000	0.71417	0.666000	0.29783	0.800000	0.45204	5.782000	0.68973	2.941000	0.99782	0.655000	0.94253	GGC	0.648986		TCGA-HV-A5A6-01A-11D-A26I-08	0.393	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	1	0	1	2	2	2	2	0	0	0	0	28	28	28	27	1	1.940000	-20.000000	1	0.640000	NM_033631		0	120	119	0	282	281	1		1	1		0	0	28	0	0	1.000000	8.466670e-01	0	3	0	7	0	120	282
PLPPR4	9890	broad.mit.edu	37	1	99762345	99762345	+	Missense_Mutation	SNP	G	G	C			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:99762345G>C	ENST00000370185.3	+	3	957	c.460G>C	c.(460-462)Ggg>Cgg	p.G154R	LPPR4_ENST00000457765.1_Missense_Mutation_p.G154R|LPPR4_ENST00000370184.1_5'Flank	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		154					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AAGAAGAAATGGGGTCGGACT	0.463																																						ENST00000370185.3	1.000000	0.920000	1.000000	0.980000	0.990000	0.992461	0.990000	1.000000																										0				72						c.(460-462)Ggg>Cgg									96.0	102.0	100.0					1																	99762345		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr1:99762345G>C																												ENST00000370185.3:c.460G>C	chr1.hg19:g.99762345G>C	ENSP00000359204:p.Gly154Arg	0					LPPR4_ENST00000370184.1_5'Flank|LPPR4_ENST00000457765.1_Missense_Mutation_p.G154R	p.G154R	NM_014839.4	NP_055654.2	1	2	3	2.140631	Q7Z2D5	LPPR4_HUMAN		3	957	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	1	1	hg19	c.460G>C	CCDS757.1	1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279059	0.40294	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178	T;T	0.14640	2.49;2.49	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.18002	0.0432	L	0.38175	1.15	0.80722	D	1	D;B	0.69078	0.997;0.004	D;B	0.67103	0.949;0.006	T	0.03025	-1.1081	10	0.21540	T	0.41	-25.1467	19.5717	0.95423	0.0:0.0:1.0:0.0	.	154;154	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	R	154	ENSP00000359204:G154R;ENSP00000394913:G154R	ENSP00000263178:G154R	G	+	1	0	0	RP4-788L13.1	99534933	99534933	1.000000	0.71417	0.996000	0.52242	0.738000	0.42128	6.651000	0.74372	2.644000	0.89710	0.655000	0.94253	GGG	0.648986		TCGA-HV-A5A6-01A-11D-A26I-08	0.463	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.940000	-14.707600	1	0.640000			0	173	171	0	355	349	0		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	173	355
KCNH1	3756	broad.mit.edu	37	1	210856924	210856924	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr1:210856924C>T	ENST00000271751.4	-	11	2696	c.2669G>A	c.(2668-2670)cGc>cAc	p.R890H	KCNH1_ENST00000367007.4_Missense_Mutation_p.R863H			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	890					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GTTGTCCAGGCGCAAGTCGCT	0.592																																						ENST00000271751.4	1.000000	0.060000	0.180000	0.090000	0.120000	0.160264	0.120000	0.120000																										0				68						c.(2668-2670)cGc>cAc		potassium voltage-gated channel, subfamily H (eag-related), member 1							73.0	67.0	69.0					1																	210856924		2203	4300	6503	SO:0001583	missense	3756	0	0					g.chr1:210856924C>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2669G>A	chr1.hg19:g.210856924C>T	ENSP00000271751:p.Arg890His	0					KCNH1_ENST00000367007.4_Missense_Mutation_p.R863H	p.R890H			1	2	3	2.093433	O95259	KCNH1_HUMAN		11	2696	-			B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	1	1	hg19	c.2669G>A	CCDS1496.1	0	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870929	0.72065	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99537	-6.03;-6.11	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.99444	0.9803	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.71184	0.858;0.972	D	0.98847	1.0757	10	0.56958	D	0.05	.	18.1618	0.89710	0.0:1.0:0.0:0.0	.	863;890	Q14CL3;O95259	.;KCNH1_HUMAN	H	890;863	ENSP00000271751:R890H;ENSP00000355974:R863H	ENSP00000271751:R890H	R	-	2	0	0	KCNH1	208923547	208923547	1.000000	0.71417	0.907000	0.35723	0.337000	0.28794	7.538000	0.82048	2.290000	0.77057	0.561000	0.74099	CGC	0.644550		TCGA-HV-A5A6-01A-11D-A26I-08	0.592	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.940000	-4.084644	1	0.640000	NM_002238		0	11	11	0	267	264	0		1			0	0	41	0	0	0.998326	0	0	0	0	0	0	11	267
PCSK2	5126	broad.mit.edu	37	20	17417442	17417442	+	Missense_Mutation	SNP	G	G	A	rs144151196		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr20:17417442G>A	ENST00000262545.2	+	8	1114	c.799G>A	c.(799-801)Gcc>Acc	p.A267T	PCSK2_ENST00000536609.1_Missense_Mutation_p.A232T|PCSK2_ENST00000377899.1_Missense_Mutation_p.A248T	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	267	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CATCTACAGCGCCAGCTGGGG	0.617																																						ENST00000262545.2	1.000000	0.700000	0.960000	0.780000	0.860000	0.870026	0.860000	1.000000																										0				53						c.(799-801)Gcc>Acc		proprotein convertase subtilisin/kexin type 2	"""Insulin(DB00071)|Insulin Regular(DB00030)"	G	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	55.0	49.0	51.0		742,694,799	5.4	1.0	20	dbSNP_134	51	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PCSK2	NM_001201528.1,NM_001201529.1,NM_002594.3	58,58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	248/620,232/604,267/639	17417442	1,13005	2203	4300	6503	SO:0001583	missense	5126	2	121410	33				g.chr20:17417442G>A	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.799G>A	chr20.hg19:g.17417442G>A	ENSP00000262545:p.Ala267Thr	0					PCSK2_ENST00000377899.1_Missense_Mutation_p.A248T|PCSK2_ENST00000536609.1_Missense_Mutation_p.A232T	p.A267T	NM_002594.3	NP_002585.2	1	2	3	2.092438	P16519	NEC2_HUMAN		8	1114	+			B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	1	1	hg19	c.799G>A	CCDS13125.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.555701	0.96514	0.0	1.16E-4	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	D;D;D	0.87729	-2.29;-2.29;-2.29	5.38	5.38	0.77491	5.38	5.38	0.77491	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.94918	0.8357	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.955	D	0.95800	0.8832	10	0.87932	D	0	-30.2528	17.6879	0.88261	0.0:0.0:1.0:0.0	.	232;267	B4DFQ3;P16519	.;NEC2_HUMAN	T	248;267;232	ENSP00000367131:A248T;ENSP00000262545:A267T;ENSP00000437458:A232T	ENSP00000262545:A267T	A	+	1	0	0	PCSK2	17365442	17365442	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	9.413000	0.97351	2.519000	0.84933	0.655000	0.94253	GCC	0.644550		TCGA-HV-A5A6-01A-11D-A26I-08	0.617	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	1	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	1.940000	-6.173506	1	0.640000	NM_002594		0	76	76	0	202	199	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	76	202
BCR	613	broad.mit.edu	37	22	23596046	23596046	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr22:23596046G>A	ENST00000305877.8	+	2	2091	c.1340G>A	c.(1339-1341)cGc>cAc	p.R447H	BCR_ENST00000359540.3_Missense_Mutation_p.R447H	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	447					actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GAGGAGCAGCGCCGGCACCAA	0.622			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																	ENST00000305877.8	1.000000	0.800000	1.000000	0.890000	0.980000	0.958621	0.980000	1.000000				Dom	yes			Dom	yes		22	22q11.21	22q11.21	613	T	breakpoint cluster region				L	L	ABL1,  FGFR1, JAK2 		CML, ALL, AML	BCR/JAK2(6)	0				35						c.(1339-1341)cGc>cAc		breakpoint cluster region	Bosutinib(DB06616)|Ponatinib(DB08901)						60.0	52.0	55.0					22																	23596046		2202	4299	6501	SO:0001583	missense	613	0	0					g.chr22:23596046G>A		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.1340G>A	chr22.hg19:g.23596046G>A	ENSP00000303507:p.Arg447His	0					BCR_ENST00000359540.3_Missense_Mutation_p.R447H	p.R447H	NM_004327.3	NP_004318.3	2	2	4	2.171594	P11274	BCR_HUMAN		2	2091	+			P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	1	1	hg19	c.1340G>A	CCDS13806.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.104628|5.104628	0.94245|0.94245	.|.	.|.	ENSG00000186716|ENSG00000186716	ENST00000334149|ENST00000305877;ENST00000359540	.|T;T	.|0.30714	.|1.55;1.52	5.37|5.37	5.37|5.37	0.77165|0.77165	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	.|0.139385	.|0.47852	.|D	.|0.000211	T|T	0.33147|0.33147	0.0853|0.0853	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.61080	.|0.873;0.989;0.981	.|B;P;P	.|0.51974	.|0.256;0.686;0.488	T|T	0.04593|0.04593	-1.0940|-1.0940	6|10	0.13470|0.72032	T|D	0.59|0.01	.|.	12.4859|12.4859	0.55872|0.55872	0.0818:0.0:0.9182:0.0|0.0818:0.0:0.9182:0.0	.|.	.|36;447;447	.|B4E065;P11274-2;P11274	.|.;.;BCR_HUMAN	T|H	112|447	.|ENSP00000303507:R447H;ENSP00000352535:R447H	ENSP00000335450:A112T|ENSP00000303507:R447H	A|R	+|+	1|2	0|0	0|0	BCR|BCR	21926046|21926046	21926046|21926046	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.513000|2.513000	0.45494|0.45494	2.688000|2.688000	0.91661|0.91661	0.591000|0.591000	0.81541|0.81541	GCC|CGC	0.661654		TCGA-HV-A5A6-01A-11D-A26I-08	0.622	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	1.940000	-20.000000	1	0.640000	NM_004327		0	82	82	0	196	195	1		1	1		0	0	49	0	0	1.000000	9.992319e-01	0	9	0	19	0	82	196
MOV10L1	54456	broad.mit.edu	37	22	50589311	50589311	+	Missense_Mutation	SNP	G	G	A	rs372963947		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr22:50589311G>A	ENST00000262794.5	+	21	2958	c.2875G>A	c.(2875-2877)Gca>Aca	p.A959T	MOV10L1_ENST00000540615.1_Missense_Mutation_p.A939T|MOV10L1_ENST00000395858.3_Missense_Mutation_p.A959T|MOV10L1_ENST00000354853.2_Intron|MOV10L1_ENST00000395852.1_Missense_Mutation_p.A86T|MOV10L1_ENST00000395843.1_Intron|MOV10L1_ENST00000545383.1_Missense_Mutation_p.A959T	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	959					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TGCTTGTGGCGCACATAATCC	0.577																																						ENST00000262794.5	0.990000	0.610000	0.930000	0.710000	0.820000	0.824307	0.820000	0.830000																										0				67						c.(2875-2877)Gca>Aca		Mov10 RISC complex RNA helicase like 1		G	THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	129.0	106.0	113.0		2875,2815,256,2875	2.0	0.3	22		113	1,8599		0,1,4299	no	missense,missense,missense,missense	MOV10L1	NM_001164104.1,NM_001164105.1,NM_001164106.1,NM_018995.2	58,58,58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	959/1166,939/1166,86/339,959/1212	50589311	1,13005	2203	4300	6503	SO:0001583	missense	54456	8	121412	38				g.chr22:50589311G>A	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2875G>A	chr22.hg19:g.50589311G>A	ENSP00000262794:p.Ala959Thr	1					MOV10L1_ENST00000395852.1_Missense_Mutation_p.A86T|MOV10L1_ENST00000540615.1_Missense_Mutation_p.A939T|MOV10L1_ENST00000395858.3_Missense_Mutation_p.A959T|MOV10L1_ENST00000395843.1_Intron|MOV10L1_ENST00000545383.1_Missense_Mutation_p.A959T|MOV10L1_ENST00000354853.2_Intron	p.A959T	NM_018995.2	NP_061868.1	0	1	1	1.430720	Q9BXT6	M10L1_HUMAN		21	2958	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	ENST00000262794.5	1	1	hg19	c.2875G>A	CCDS14084.1	0	.	.	.	.	.	.	.	.	.	.	.	9.423	1.083604	0.20309	0.0	1.16E-4	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615;ENST00000395852	D;D;T;D;D	0.92752	-1.86;-1.86;-1.44;-2.06;-3.1	5.47	2.05	0.26809	5.47	2.05	0.26809	.	0.372221	0.26106	N	0.026316	D	0.84906	0.5576	L	0.27053	0.805	0.21220	N	0.999751	P;B;P;P	0.46987	0.863;0.019;0.587;0.888	B;B;B;P	0.44561	0.324;0.016;0.181;0.453	T	0.76099	-0.3083	10	0.33141	T	0.24	-14.1676	6.3649	0.21449	0.1608:0.0:0.4837:0.3554	.	939;86;959;959	F5H403;Q9BXT6-2;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	T	959;959;959;939;86	ENSP00000438978:A959T;ENSP00000262794:A959T;ENSP00000379199:A959T;ENSP00000438542:A939T;ENSP00000379193:A86T	ENSP00000262794:A959T	A	+	1	0	0	MOV10L1	48931438	48931438	0.899000	0.30636	0.334000	0.25495	0.053000	0.15095	1.890000	0.39728	0.670000	0.31165	-0.136000	0.14681	GCA	0.475524		TCGA-HV-A5A6-01A-11D-A26I-08	0.577	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.940000	-20.000000	1	0.640000	NM_018995		0	33	31	0	51	51	1		1	0		0	0	31	0	0	1.000000	0	0	0	0	1	0	33	51
NCKAP5	344148	broad.mit.edu	37	2	133542913	133542913	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr2:133542913C>A	ENST00000409261.1	-	14	1844	c.1471G>T	c.(1471-1473)Gtt>Ttt	p.V491F	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.V491F|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	491										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGGTTTGGAACTGCTTGGAGC	0.502																																						ENST00000409261.1	1.000000	0.040000	0.130000	0.060000	0.090000	0.148187	0.090000	0.090000																										0				118						c.(1471-1473)Gtt>Ttt		NCK-associated protein 5							118.0	119.0	118.0					2																	133542913		2017	4198	6215	SO:0001583	missense	344148	0	0					g.chr2:133542913C>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1471G>T	chr2.hg19:g.133542913C>A	ENSP00000387128:p.Val491Phe	0					NCKAP5_ENST00000317721.6_Missense_Mutation_p.V491F|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron	p.V491F	NM_207363.2	NP_997246.2	1	2	3	2.131913	O14513	NCKP5_HUMAN		14	1844	-			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	1	1	hg19	c.1471G>T	CCDS46418.1	0	.	.	.	.	.	.	.	.	.	.	c	2.579	-0.297922	0.05532	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12039	2.72;2.72	5.11	-3.94	0.04130	5.11	-3.94	0.04130	.	1.465370	0.05533	U	0.564360	T	0.07593	0.0191	N	0.19112	0.55	0.09310	N	1	B	0.18610	0.029	B	0.16289	0.015	T	0.40040	-0.9584	10	0.66056	D	0.02	.	2.5501	0.04747	0.1056:0.2809:0.3501:0.2633	.	491	O14513	NCKP5_HUMAN	F	491	ENSP00000387128:V491F;ENSP00000380603:V491F	ENSP00000380603:V491F	V	-	1	0	0	NCKAP5	133259383	133259383	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.038000	0.12144	-0.609000	0.05724	-0.162000	0.13425	GTT	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.502	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	0	0	1	2	2	2	2	0	0	0	0	67	67	67	66	1	1.940000	-3.378445	1	0.640000	NM_207481		0	14	14	0	473	468	0		1			0	0	67	0	0	0.999743	0	0	0	0	0	0	14	473
C2orf44	80304	broad.mit.edu	37	2	24262175	24262175	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr2:24262175A>G	ENST00000295148.4	-	2	247	c.190T>C	c.(190-192)Tcc>Ccc	p.S64P	C2orf44_ENST00000406895.3_Missense_Mutation_p.S64P	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	64									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGCCCAGGACAACCCACAG	0.517			T	ALK	NSCLC																																	ENST00000295148.4	1.000000	0.750000	1.000000	0.830000	0.910000	0.915815	0.910000	1.000000				Dom	yes			Dom	yes		2	2p23.3	2p23.3	80304	T	chromosome 2 open reading frame 44				E	E	ALK		NSCLC	C2orf44/ALK(2)	0				24						c.(190-192)Tcc>Ccc		chromosome 2 open reading frame 44							127.0	109.0	115.0					2																	24262175		2203	4300	6503	SO:0001583	missense	80304	0	0					g.chr2:24262175A>G	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.190T>C	chr2.hg19:g.24262175A>G	ENSP00000295148:p.Ser64Pro	0					C2orf44_ENST00000406895.3_Missense_Mutation_p.S64P	p.S64P	NM_025203.2	NP_079479.1	1	2	3	2.127734	Q9H6R7	CB044_HUMAN		2	247	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		D6W532|Q8IYK0|Q9HBP5	Missense_Mutation	SNP	ENST00000295148.4	1	1	hg19	c.190T>C	CCDS1705.1	1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599470	0.66332	.	.	ENSG00000163026	ENST00000295148;ENST00000406895;ENST00000443232	T;T;T	0.54071	3.31;3.31;0.59	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.230586	0.47455	D	0.000236	T	0.66117	0.2757	M	0.62723	1.935	0.30894	N	0.730021	D;D	0.63880	0.993;0.993	P;P	0.61132	0.884;0.884	T	0.68236	-0.5462	10	0.36615	T	0.2	-4.878	15.4386	0.75165	1.0:0.0:0.0:0.0	.	64;64	Q9H6R7-2;Q9H6R7	.;CB044_HUMAN	P	64	ENSP00000295148:S64P;ENSP00000385816:S64P;ENSP00000413426:S64P	ENSP00000295148:S64P	S	-	1	0	0	C2orf44	24115679	24115679	1.000000	0.71417	0.935000	0.37517	0.714000	0.41099	7.490000	0.81461	2.115000	0.64714	0.533000	0.62120	TCC	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.517	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	1.940000	-20.000000	1	0.640000	NM_025203		0	82	82	0	204	202	1		1	0		0	0	59	0	0	1.000000	2.021935e-01	0	0	0	3	0	82	204
CAD	790	broad.mit.edu	37	2	27449518	27449518	+	Splice_Site	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr2:27449518G>A	ENST00000403525.1	+	13	2111		c.e13+1		CAD_ENST00000264705.4_Splice_Site			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase						apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAGCTCAGGTACGAGGATG	0.542																																						ENST00000403525.1	1.000000	0.790000	1.000000	0.900000	0.990000	0.963996	0.990000	1.000000																										0				92						c.e13+1		carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase							63.0	58.0	60.0					2																	27449518		2203	4300	6503	SO:0001630	splice_region_variant	790	0	0					g.chr2:27449518G>A	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.1967+1G>A	chr2.hg19:g.27449518G>A		0					CAD_ENST00000264705.4_Splice_Site				1	2	3	2.127734	O76075	DFFB_HUMAN		13	2111	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Splice_Site	SNP	ENST00000403525.1	1	1	hg19			1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828761	0.71258	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	.	.	.	5.06	5.06	0.68205	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0413	0.86490	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	CAD	27303022	27303022	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	8.942000	0.92970	2.358000	0.79984	0.485000	0.47835	.	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.542	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	16	1	1.940000	-20.000000	1	0.640000		Intron	0	55	55	0	119	118	1		1	0		0	0	17	0	0	1.000000	0	0	1	0	0	0	55	119
B3GALT1	8708	broad.mit.edu	37	2	168726199	168726199	+	Missense_Mutation	SNP	G	G	A	rs148250645	byFrequency	TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr2:168726199G>A	ENST00000392690.3	+	1	742	c.650G>A	c.(649-651)cGc>cAc	p.R217H	AC016723.4_ENST00000430546.1_RNA|AC016723.4_ENST00000436982.2_RNA|B3GALT1_ENST00000305861.1_Missense_Mutation_p.R217H			Q9Y5Z6	B3GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1	217					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18						CGGGATGTCCGCAGTAAGTGG	0.453													G|||	4	0.000798722	0.0	0.0	5008	,	,		21143	0.004		0.0	False		,,,				2504	0.0					ENST00000392690.3	1.000000	0.850000	1.000000	0.930000	0.990000	0.977349	0.990000	1.000000																										0				18						c.(649-651)cGc>cAc		UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1		G	HIS/ARG	0,4406		0,0,2203	104.0	102.0	103.0		650	5.1	1.0	2	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	yes	missense	B3GALT1	NM_020981.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	217/327	168726199	1,13005	2203	4300	6503	SO:0001583	missense	8708	21	121412	44				g.chr2:168726199G>A	E07739	CCDS2227.1	2q24.3	2013-02-19			ENSG00000172318	ENSG00000172318		"""Beta 3-glycosyltransferases"""	916	protein-coding gene	gene with protein product		603093				9582303	Standard	NM_020981		Approved	beta3Gal-T1	uc002udz.1	Q9Y5Z6	OTTHUMG00000132163	ENST00000392690.3:c.650G>A	chr2.hg19:g.168726199G>A	ENSP00000376456:p.Arg217His	0					AC016723.4_ENST00000430546.1_RNA|B3GALT1_ENST00000305861.1_Missense_Mutation_p.R217H|AC016723.4_ENST00000436982.2_RNA	p.R217H			1	2	3	2.131913	Q9Y5Z6	B3GT1_HUMAN		1	742	+			D3DPB8|Q53SS2	Missense_Mutation	SNP	ENST00000392690.3	1	1	hg19	c.650G>A	CCDS2227.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	13.23	2.174355	0.38413	0.0	1.16E-4	ENSG00000172318	ENST00000305861;ENST00000392690	D;D	0.85258	-1.96;-1.96	6.02	5.12	0.69794	6.02	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	L	0.28274	0.84	0.58432	D	0.99999	B	0.20671	0.047	B	0.19946	0.027	T	0.72827	-0.4175	10	0.39692	T	0.17	-16.8954	16.7521	0.85488	0.0:0.0:0.8704:0.1295	.	217	Q9Y5Z6	B3GT1_HUMAN	H	217	ENSP00000303740:R217H;ENSP00000376456:R217H	ENSP00000303740:R217H	R	+	2	0	0	B3GALT1	168434445	168434445	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.976000	0.88070	2.865000	0.98341	0.655000	0.94253	CGC	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.453	B3GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255211.2	1	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	1.940000	-9.285806	1	0.640000	NM_020981		0	94	93	0	200	198	1		1			0	0	36	0	0	1.000000	0	0	0	0	0	0	94	200
ECT2	1894	broad.mit.edu	37	3	172534509	172534509	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr3:172534509C>T	ENST00000392692.3	+	24	2713	c.2537C>T	c.(2536-2538)aCt>aTt	p.T846I	ECT2_ENST00000417960.1_Missense_Mutation_p.T814I|ECT2_ENST00000441497.2_Missense_Mutation_p.T815I|ECT2_ENST00000232458.5_Missense_Mutation_p.T815I|ECT2_ENST00000427830.1_Missense_Mutation_p.T815I|ECT2_ENST00000540509.1_Missense_Mutation_p.T846I	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	846					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			TTCTCCAAAACTCCAAAAAGA	0.378																																						ENST00000392692.3	1.000000	0.760000	1.000000	0.850000	0.940000	0.931692	0.940000	1.000000																										0				37						c.(2536-2538)aCt>aTt		epithelial cell transforming 2							64.0	66.0	65.0					3																	172534509		2203	4299	6502	SO:0001583	missense	1894	0	0					g.chr3:172534509C>T	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.2537C>T	chr3.hg19:g.172534509C>T	ENSP00000376457:p.Thr846Ile	0					ECT2_ENST00000417960.1_Missense_Mutation_p.T814I|ECT2_ENST00000232458.5_Missense_Mutation_p.T815I|ECT2_ENST00000427830.1_Missense_Mutation_p.T815I|ECT2_ENST00000441497.2_Missense_Mutation_p.T815I|ECT2_ENST00000540509.1_Missense_Mutation_p.T846I	p.T846I	NM_001258315.1	NP_001245244.1	1	2	3	2.129753	Q9H8V3	ECT2_HUMAN	Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)	24	2713	+	Ovarian(172;0.00197)|Breast(254;0.158)		Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	1	1	hg19	c.2537C>T	CCDS58860.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523463	0.85600	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	T;T;T;T;T;T	0.75260	-0.8;-0.86;-0.92;-0.8;-0.8;-0.86	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.129180	0.64402	D	0.000001	D	0.84465	0.5478	M	0.73217	2.22	0.80722	D	1	P;D;D;D;B	0.63880	0.867;0.967;0.966;0.993;0.134	P;P;P;P;B	0.61003	0.533;0.823;0.744;0.882;0.041	D	0.85923	0.1447	10	0.87932	D	0	-7.6751	18.3345	0.90283	0.0:1.0:0.0:0.0	.	846;291;846;815;814	Q9H8V3;Q96SJ9;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.;.	I	815;846;815;814;815;846	ENSP00000232458:T815I;ENSP00000376457:T846I;ENSP00000401910:T815I;ENSP00000415876:T814I;ENSP00000412259:T815I;ENSP00000443160:T846I	ENSP00000232458:T815I	T	+	2	0	0	ECT2	174017203	174017203	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.978000	0.70501	2.630000	0.89119	0.561000	0.74099	ACT	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.378	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	1	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.940000	-20.000000	1	0.640000	NM_018098		0	77	77	0	185	184	1		1	1		0	0	21	0	0	1.000000	1	0	33	0	48	0	77	185
LRIT3	345193	broad.mit.edu	37	4	110791281	110791281	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr4:110791281G>A	ENST00000594814.1	+	4	1376	c.1376G>A	c.(1375-1377)aGt>aAt	p.S459N	LRIT3_ENST00000327908.3_Missense_Mutation_p.S276N|LRIT3_ENST00000379920.3_Missense_Mutation_p.S414N|LRIT3_ENST00000409621.2_Missense_Mutation_p.S276N	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	459					regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		AAGAATGGAAGTAAGCTTCCT	0.468																																						ENST00000594814.1	0.180000	0.050000	0.140000	0.070000	0.100000	0.112815	0.100000	0.100000																										0				16						c.(1375-1377)aGt>aAt		leucine-rich repeat, immunoglobulin-like and transmembrane domains 3							69.0	70.0	69.0					4																	110791281		2203	4300	6503	SO:0001583	missense	345193	0	0					g.chr4:110791281G>A	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1376G>A	chr4.hg19:g.110791281G>A	ENSP00000469759:p.Ser459Asn	1					LRIT3_ENST00000327908.3_Missense_Mutation_p.S276N|LRIT3_ENST00000379920.3_Missense_Mutation_p.S414N|LRIT3_ENST00000409621.2_Missense_Mutation_p.S276N	p.S459N	NM_198506.3	NP_940908.3	0	1	1	1.861229	Q3SXY7	LRIT3_HUMAN		4	1376	+			C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	1	1	hg19	c.1376G>A	CCDS3688.3	0	.	.	.	.	.	.	.	.	.	.	G	0.339	-0.951342	0.02285	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.58358	0.34;0.52;0.34	5.06	0.19	0.15125	5.06	0.19	0.15125	.	0.885835	0.09711	N	0.765695	T	0.31009	0.0783	N	0.24115	0.695	0.09310	N	1	B;B	0.13594	0.001;0.008	B;B	0.12156	0.001;0.007	T	0.22836	-1.0205	10	0.13470	T	0.59	.	4.3391	0.11101	0.4444:0.1716:0.384:0.0	.	414;276	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	N	276;414;276	ENSP00000328222:S276N;ENSP00000369252:S414N;ENSP00000386734:S276N	ENSP00000328222:S276N	S	+	2	0	0	LRIT3	111010730	111010730	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	0.091000	0.15046	0.160000	0.19432	-0.123000	0.14984	AGT	0.587156		TCGA-HV-A5A6-01A-11D-A26I-08	0.468	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	0	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.940000	-11.774240	1	0.640000	NM_198506		0	10	10	0	253	249	0		1			0	0	30	0	0	0.996797	0	0	0	0	0	0	10	253
KLHL5	51088	broad.mit.edu	37	4	39083623	39083623	+	Missense_Mutation	SNP	A	A	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr4:39083623A>T	ENST00000504108.1	+	4	1165	c.882A>T	c.(880-882)ttA>ttT	p.L294F	KLHL5_ENST00000261426.5_Missense_Mutation_p.L233F|KLHL5_ENST00000381930.3_Missense_Mutation_p.L294F|KLHL5_ENST00000261425.3_Missense_Mutation_p.L248F|KLHL5_ENST00000508137.2_Missense_Mutation_p.L107F|KLHL5_ENST00000359687.2_Missense_Mutation_p.L294F	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	294						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						AGTGCCTGTTATCTACAGCTT	0.343																																						ENST00000504108.1	1.000000	0.030000	0.110000	0.050000	0.070000	0.132640	0.070000	0.080000																										0				29						c.(880-882)ttA>ttT		kelch-like family member 5							119.0	111.0	114.0					4																	39083623		2203	4300	6503	SO:0001583	missense	51088	0	0					g.chr4:39083623A>T	AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.882A>T	chr4.hg19:g.39083623A>T	ENSP00000423897:p.Leu294Phe	0					KLHL5_ENST00000508137.2_Missense_Mutation_p.L107F|KLHL5_ENST00000359687.2_Missense_Mutation_p.L294F|KLHL5_ENST00000381930.3_Missense_Mutation_p.L294F|KLHL5_ENST00000261425.3_Missense_Mutation_p.L248F|KLHL5_ENST00000261426.5_Missense_Mutation_p.L233F	p.L294F	NM_015990.4	NP_057074.3	1	2	3	2.127070	Q96PQ7	KLHL5_HUMAN		4	1165	+			A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Missense_Mutation	SNP	ENST00000504108.1	0	1	hg19	c.882A>T	CCDS33974.1	0	.	.	.	.	.	.	.	.	.	.	A	20.8	4.046001	0.75846	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.45	-3.8	0.04307	5.45	-3.8	0.04307	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.86961	0.6059	M	0.80616	2.505	0.58432	D	0.999998	D;D;D	0.89917	0.985;1.0;1.0	P;D;D	0.87578	0.868;0.998;0.996	D	0.85649	0.1281	10	0.87932	D	0	.	12.1229	0.53902	0.267:0.1183:0.6147:0.0	.	233;294;294	F8WAE7;Q96PQ7;Q96PQ7-2	.;KLHL5_HUMAN;.	F	328;248;107;294;294;294;233	ENSP00000261425:L248F;ENSP00000423080:L107F;ENSP00000423897:L294F;ENSP00000352716:L294F;ENSP00000371355:L294F;ENSP00000261426:L233F	ENSP00000261425:L248F	L	+	3	2	2	KLHL5	38760018	38760018	0.997000	0.39634	0.918000	0.36340	0.982000	0.71751	0.453000	0.21811	-0.821000	0.04312	-0.561000	0.04177	TTA	0.647887		TCGA-HV-A5A6-01A-11D-A26I-08	0.343	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1	0	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.940000	-9.656365	1	0.640000			0	10	10	0	419	415	0		1	0		0	0	34	0	0	0.996808	6.460234e-02	0	0	0	16	0	10	419
ZGRF1	55345	broad.mit.edu	37	4	113511003	113511003	+	Missense_Mutation	SNP	T	T	A	rs375347159		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr4:113511003T>A	ENST00000505019.1	-	11	3129	c.3004A>T	c.(3004-3006)Aca>Tca	p.T1002S	C4orf21_ENST00000309071.5_Missense_Mutation_p.T1002S	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1002						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		GGGCTCAATGTAGAGATGTTT	0.358																																						ENST00000505019.1	1.000000	0.940000	1.000000	0.990000	0.990000	0.996542	0.990000	1.000000																										0				45						c.(3004-3006)Aca>Tca									58.0	59.0	59.0					4																	113511003		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr4:113511003T>A																												ENST00000505019.1:c.3004A>T	chr4.hg19:g.113511003T>A	ENSP00000424737:p.Thr1002Ser	1					C4orf21_ENST00000309071.5_Missense_Mutation_p.T1002S	p.T1002S	NM_018392.4	NP_060862.3	0	1	1	1.861229	Q86YA3	ZGRF1_HUMAN		11	3129	-		Ovarian(17;0.156)	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	1	1	hg19	c.3004A>T		1	.	.	.	.	.	.	.	.	.	.	T	8.042	0.764003	0.15914	.	.	ENSG00000138658	ENST00000505019;ENST00000309071	D;T	0.82984	-1.67;1.92	5.23	1.42	0.22433	5.23	1.42	0.22433	.	0.154469	0.30584	N	0.009308	T	0.81283	0.4790	L	0.57536	1.79	0.23298	N	0.997957	D;P	0.52996	0.957;0.95	P;P	0.52856	0.711;0.684	T	0.70044	-0.4980	10	0.20046	T	0.44	-3.4573	6.8286	0.23897	0.0:0.2906:0.0:0.7094	.	1002;1002	Q86YA3;G5EA02	CD021_HUMAN;.	S	1002	ENSP00000424737:T1002S;ENSP00000309095:T1002S	ENSP00000309095:T1002S	T	-	1	0	0	C4orf21	113730452	113730452	0.001000	0.12720	0.002000	0.10522	0.064000	0.16182	-0.294000	0.08309	0.073000	0.16731	0.477000	0.44152	ACA	0.587156		TCGA-HV-A5A6-01A-11D-A26I-08	0.358	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.940000	-20.000000	1	0.640000			0	104	103	0	151	149	0		1	0		0	0	32	0	0	1.000000	0	0	1	0	0	0	104	151
PCDHA7	56141	broad.mit.edu	37	5	140215907	140215907	+	Missense_Mutation	SNP	C	C	T	rs370874344		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr5:140215907C>T	ENST00000525929.1	+	1	1939	c.1939C>T	c.(1939-1941)Ctt>Ttt	p.L647F	PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.L647F|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	647	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCCACCGCCTTCTGGTGCT	0.672																																					NSCLC(160;258 2013 5070 22440 28951)	ENST00000525929.1	0.100000	0.010000	0.080000	0.020000	0.040000	0.055590	0.040000	0.050000																										0				63						c.(1939-1941)Ctt>Ttt		protocadherin alpha 7		C	,,,,,,PHE/LEU,,,PHE/LEU	0,4406		0,0,2203	62.0	66.0	65.0		,,,,,,1939,,,1939	2.7	1.0	5		65	1,8597	1.2+/-3.3	0,1,4298	no	intron,intron,intron,intron,intron,intron,missense,intron,intron,missense	PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_031411.1,NM_031849.1,NM_031852.1	,,,,,,22,,,22	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,,,,	,,,,,,647/938,,,647/790	140215907	1,13003	2203	4299	6502	SO:0001583	missense	56141	4	121400	40				g.chr5:140215907C>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1939C>T	chr5.hg19:g.140215907C>T	ENSP00000436426:p.Leu647Phe	1					PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.L647F|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	p.L647F	NM_018910.2	NP_061733.1	0	1	1	1.467848	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1939	+			O75282	Missense_Mutation	SNP	ENST00000525929.1	0	1	hg19	c.1939C>T	CCDS54918.1	0	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839491	0.51057	0.0	1.16E-4	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.56776	0.44;0.44	3.57	2.67	0.31697	3.57	2.67	0.31697	Cadherin (4);Cadherin-like (1);	0.000000	0.26373	U	0.024756	T	0.67924	0.2945	M	0.70275	2.135	0.37052	D	0.897663	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.73566	-0.3942	10	0.87932	D	0	.	10.3044	0.43672	0.0:0.899:0.0:0.101	.	647;647	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	F	647	ENSP00000436426:L647F;ENSP00000367365:L647F	ENSP00000367365:L647F	L	+	1	0	0	PCDHA7	140196091	140196091	0.008000	0.16893	0.997000	0.53966	0.436000	0.31835	0.148000	0.16224	0.787000	0.33731	0.462000	0.41574	CTT	0.475524		TCGA-HV-A5A6-01A-11D-A26I-08	0.672	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	0	0	0	2	2	2	2	0	0	0	0	60	60	60	59	1	1.940000	-7.124412	1	0.640000	NM_018910		0	6	6	0	261	259	0		1	0		0	0	60	0	0	0.964641	0	0	0	0	1	0	6	261
PCDHGB7	56099	broad.mit.edu	37	5	140798705	140798705	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr5:140798705A>G	ENST00000398594.2	+	1	1279	c.1279A>G	c.(1279-1281)Agg>Ggg	p.R427G	PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	427	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCACAGACAGGGGCAAGCC	0.512																																						ENST00000398594.2	0.130000	0.020000	0.100000	0.030000	0.060000	0.070284	0.060000	0.060000																										0				56						c.(1279-1281)Agg>Ggg		protocadherin gamma subfamily B, 7							41.0	49.0	46.0					5																	140798705		2137	4233	6370	SO:0001583	missense	56099	0	0					g.chr5:140798705A>G	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1279A>G	chr5.hg19:g.140798705A>G	ENSP00000381594:p.Arg427Gly	1					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank	p.R427G	NM_018927.3	NP_061750.1	0	1	1	1.467848	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1279	+			Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	0	1	hg19	c.1279A>G	CCDS47293.1	0	.	.	.	.	.	.	.	.	.	.	a	0.022	-1.406676	0.01155	.	.	ENSG00000254122	ENST00000398594	T	0.01665	4.7	5.48	2.98	0.34508	5.48	2.98	0.34508	Cadherin (4);Cadherin-like (1);	0.246709	0.20343	U	0.094184	T	0.01092	0.0036	N	0.12611	0.24	0.09310	N	1	B;B	0.17038	0.02;0.009	B;B	0.20384	0.029;0.018	T	0.49504	-0.8933	10	0.19590	T	0.45	.	4.0845	0.09940	0.5796:0.2387:0.0668:0.1149	.	427;427	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	G	427	ENSP00000381594:R427G	ENSP00000381594:R427G	R	+	1	2	2	PCDHGB7	140778889	140778889	0.000000	0.05858	0.933000	0.37362	0.268000	0.26511	0.449000	0.21744	0.338000	0.23692	0.402000	0.26972	AGG	0.475524		TCGA-HV-A5A6-01A-11D-A26I-08	0.512	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	0	0	0	2	2	2	2	0	0	0	0	39	39	39	39	1	1.940000	-7.413249	1	0.640000	NM_018927		0	5	5	0	175	172	0		1	0		0	0	39	0	0	0.935641	1.261034e-03	0	0	0	2	0	5	175
AHRR	57491	broad.mit.edu	37	5	434610	434610	+	Silent	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr5:434610G>A	ENST00000505113.1	+	11	1811	c.1767G>A	c.(1765-1767)tcG>tcA	p.S589S	AHRR_ENST00000316418.5_Silent_p.S607S|AHRR_ENST00000506456.1_Silent_p.S445S|AHRR_ENST00000512529.1_Silent_p.S435S	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	589	Needed for transcriptional repression. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TGTACATCTCGCACCTGGGGC	0.667																																						ENST00000505113.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999994	0.990000	1.000000																										0				20						c.(1765-1767)tcG>tcA		aryl-hydrocarbon receptor repressor							32.0	35.0	34.0					5																	434610		2102	4232	6334	SO:0001819	synonymous_variant	57491	3	121012	30				g.chr5:434610G>A	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.1767G>A	chr5.hg19:g.434610G>A		1					AHRR_ENST00000316418.5_Silent_p.S607S|AHRR_ENST00000512529.1_Silent_p.S435S|AHRR_ENST00000506456.1_Silent_p.S445S	p.S589S	NM_001242412.1	NP_001229341.1	1	3	4	2.766949	A9YTQ3	AHRR_HUMAN	Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)	11	1811	+			A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	1	1	hg19	c.1767G>A	CCDS56355.1	1																																																																																								0.751381		TCGA-HV-A5A6-01A-11D-A26I-08	0.667	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	15	1	1.940000	-20.000000	1	0.640000	NM_020731		0	60	59	0	119	119	1		1	1		0	0	16	0	0	1.000000	2.653755e-01	0	2	0	1	0	60	119
CDH9	1007	broad.mit.edu	37	5	26889954	26889954	+	Silent	SNP	T	T	C			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr5:26889954T>C	ENST00000231021.4	-	9	1675	c.1503A>G	c.(1501-1503)aaA>aaG	p.K501K		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	501	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CCTGCCCAGGTTTTGCATTTT	0.308																																					Melanoma(8;187 585 15745 40864 52829)	ENST00000231021.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				137						c.(1501-1503)aaA>aaG		cadherin 9, type 2 (T1-cadherin)							77.0	79.0	79.0					5																	26889954		2203	4300	6503	SO:0001819	synonymous_variant	1007	0	0					g.chr5:26889954T>C	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1503A>G	chr5.hg19:g.26889954T>C		1						p.K501K	NM_016279.3	NP_057363.3	1	3	4	2.829217	Q9ULB4	CADH9_HUMAN		9	1675	-			Q3B7I5	Silent	SNP	ENST00000231021.4	1	1	hg19	c.1503A>G	CCDS3893.1	1																																																																																								0.738676		TCGA-HV-A5A6-01A-11D-A26I-08	0.308	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.940000	-20.000000	1	0.640000	NM_016279		0	181	181	0	200	198	0		1			0	0	19	0	0	1.000000	0	0	0	0	0	0	181	200
KIF4B	285643	broad.mit.edu	37	5	154394186	154394186	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr5:154394186G>A	ENST00000435029.4	+	1	927	c.767G>A	c.(766-768)cGt>cAt	p.R256H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	256	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAAGGGGATCGTCTAAAAGAG	0.438																																						ENST00000435029.4	1.000000	0.900000	1.000000	0.940000	0.980000	0.980439	0.980000	1.000000																										0				58						c.(766-768)cGt>cAt		kinesin family member 4B							125.0	126.0	126.0					5																	154394186		2203	4300	6503	SO:0001583	missense	285643	3	121412	37				g.chr5:154394186G>A	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.767G>A	chr5.hg19:g.154394186G>A	ENSP00000387875:p.Arg256His	1						p.R256H	NM_001099293.1	NP_001092763.1	0	1	1	1.467848	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)	1	927	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)		Missense_Mutation	SNP	ENST00000435029.4	1	1	hg19	c.767G>A	CCDS47324.1	1	.	.	.	.	.	.	.	.	.	.	g	15.48	2.846628	0.51164	.	.	ENSG00000226650	ENST00000435029	T	0.75704	-0.96	1.73	-0.196	0.13232	1.73	-0.196	0.13232	Kinesin, motor domain (4);	.	.	.	.	D	0.85796	0.5780	M	0.92880	3.355	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.82358	-0.0497	9	0.87932	D	0	.	5.6824	0.17784	0.3387:0.0:0.6613:0.0	.	256	Q2VIQ3	KIF4B_HUMAN	H	256	ENSP00000387875:R256H	ENSP00000387875:R256H	R	+	2	0	0	KIF4B	154374379	154374379	0.928000	0.31464	0.987000	0.45799	0.991000	0.79684	3.002000	0.49496	-0.068000	0.12953	-0.137000	0.14449	CGT	0.475524		TCGA-HV-A5A6-01A-11D-A26I-08	0.438	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.940000	-20.000000	1	0.640000			0	174	170	0	183	180	1		1			0	0	57	0	0	1.000000	0	0	0	0	0	0	174	183
JARID2	3720	broad.mit.edu	37	6	15497190	15497190	+	Silent	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr6:15497190C>T	ENST00000341776.2	+	7	1978	c.1734C>T	c.(1732-1734)cgC>cgT	p.R578R	JARID2_ENST00000397311.3_Silent_p.R406R|JARID2_ENST00000541660.1_Silent_p.R540R	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	578	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGTCGGTCCGCGCTCAGGTGG	0.652																																						ENST00000341776.2	0.770000	0.370000	0.670000	0.460000	0.550000	0.569464	0.550000	0.560000																										0				59						c.(1732-1734)cgC>cgT		jumonji, AT rich interactive domain 2							61.0	54.0	56.0					6																	15497190		2203	4300	6503	SO:0001819	synonymous_variant	3720	2	121408	29				g.chr6:15497190C>T	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1734C>T	chr6.hg19:g.15497190C>T		1					JARID2_ENST00000541660.1_Silent_p.R540R|JARID2_ENST00000397311.3_Silent_p.R406R	p.R578R	NM_004973.3	NP_004964.2	0	1	1	1.785526	Q92833	JARD2_HUMAN		7	1978	+	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Silent	SNP	ENST00000341776.2	1	1	hg19	c.1734C>T	CCDS4533.1	0																																																																																								0.579439		TCGA-HV-A5A6-01A-11D-A26I-08	0.652	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	1.940000	-20.000000	1	0.640000	NM_004973		0	23	23	0	87	87	1		1	0		0	0	12	0	0	1.000000	2.934624e-01	0	0	0	5	0	23	87
TTBK1	84630	broad.mit.edu	37	6	43251409	43251409	+	Silent	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr6:43251409G>A	ENST00000259750.4	+	14	3014	c.2931G>A	c.(2929-2931)gcG>gcA	p.A977A		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	977					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GGGCCCGAGCGCCCCTGGAGA	0.697																																						ENST00000259750.4	0.640000	0.380000	0.580000	0.440000	0.500000	0.514067	0.500000	0.510000																										0				53						c.(2929-2931)gcG>gcA		tau tubulin kinase 1							21.0	26.0	24.0					6																	43251409		2200	4296	6496	SO:0001819	synonymous_variant	84630	15	121356	40				g.chr6:43251409G>A	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2931G>A	chr6.hg19:g.43251409G>A		1						p.A977A	NM_032538.1	NP_115927.1	0	1	1	1.790127	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)	14	3014	+			A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	1	1	hg19	c.2931G>A	CCDS34455.1	0																																																																																								0.576271		TCGA-HV-A5A6-01A-11D-A26I-08	0.697	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.940000	-3.539157	1	0.640000			0	46	45	0	194	193	1		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	46	194
MTO1	25821	broad.mit.edu	37	6	74210401	74210401	+	Silent	SNP	A	A	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr6:74210401A>G	ENST00000370300.4	+	13	2187	c.2097A>G	c.(2095-2097)tcA>tcG	p.S699S	MTO1_ENST00000498286.1_Silent_p.S674S|MTO1_ENST00000370305.1_Silent_p.S625S|MTO1_ENST00000415954.2_Silent_p.S714S	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	699					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TGAATGAATCATCCAAGACTG	0.398																																						ENST00000370300.4	0.140000	0.020000	0.100000	0.040000	0.060000	0.084500	0.060000	0.060000																										0				27						c.(2095-2097)tcA>tcG		mitochondrial tRNA translation optimization 1							90.0	86.0	87.0					6																	74210401		2203	4300	6503	SO:0001819	synonymous_variant	25821	0	0					g.chr6:74210401A>G	AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.2097A>G	chr6.hg19:g.74210401A>G		0					MTO1_ENST00000370305.1_Silent_p.S625S|MTO1_ENST00000415954.2_Silent_p.S714S|MTO1_ENST00000498286.1_Silent_p.S674S	p.S699S	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	1	2	3	2.074786	Q9Y2Z2	MTO1_HUMAN		13	2187	+			B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Silent	SNP	ENST00000370300.4	0	1	hg19	c.2097A>G	CCDS4979.1	0																																																																																								0.642289		TCGA-HV-A5A6-01A-11D-A26I-08	0.398	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041215.2	0	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.940000	-3.426537	1	0.640000	NM_012123		0	7	7	0	324	322	0		1	0		0	0	29	0	0	0.980471	2.421131e-01	0	0	0	39	0	7	324
CHST12	55501	broad.mit.edu	37	7	2473140	2473140	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr7:2473140G>A	ENST00000258711.6	+	2	1001	c.866G>A	c.(865-867)cGc>cAc	p.R289H		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	289					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		GCCTCGGCGCGCGAGGCCTTC	0.652																																						ENST00000258711.6	1.000000	0.720000	1.000000	0.800000	0.880000	0.892362	0.880000	1.000000																										0				21						c.(865-867)cGc>cAc		carbohydrate (chondroitin 4) sulfotransferase 12							43.0	45.0	44.0					7																	2473140		2202	4295	6497	SO:0001583	missense	55501	0	0					g.chr7:2473140G>A	AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.866G>A	chr7.hg19:g.2473140G>A	ENSP00000258711:p.Arg289His	1						p.R289H	NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	1	3	4	3.140805	Q9NRB3	CHSTC_HUMAN		2	1001	+		Ovarian(82;0.0253)	A4D1Z9|Q502W3|Q9NXY7	Missense_Mutation	SNP	ENST00000258711.6	1	1	hg19	c.866G>A	CCDS5333.1	1	.	.	.	.	.	.	.	.	.	.	G	9.812	1.183472	0.21870	.	.	ENSG00000136213	ENST00000258711	T	0.74106	-0.81	5.27	4.38	0.52667	5.27	4.38	0.52667	.	1.737820	0.03407	N	0.204206	T	0.66626	0.2808	L	0.32530	0.975	0.23673	N	0.997141	P	0.34615	0.459	B	0.19666	0.026	T	0.57825	-0.7744	10	0.48119	T	0.1	-6.0021	13.4009	0.60883	0.0759:0.0:0.9241:0.0	.	289	Q9NRB3	CHSTC_HUMAN	H	289	ENSP00000258711:R289H	ENSP00000258711:R289H	R	+	2	0	0	CHST12	2439666	2439666	0.995000	0.38212	0.794000	0.32065	0.913000	0.54294	2.682000	0.46934	1.221000	0.43506	0.462000	0.41574	CGC	0.763903		TCGA-HV-A5A6-01A-11D-A26I-08	0.652	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060170.3	1	0	1	2	2	2	2	0	0	0	0	74	74	74	72	1	1.940000	-20.000000	1	0.640000	NM_018641		0	104	100	0	464	448	1		1	1		0	0	74	0	0	1.000000	1	0	28	0	89	0	104	464
FAM126A	84668	broad.mit.edu	37	7	23000935	23000935	+	Silent	SNP	A	A	G			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr7:23000935A>G	ENST00000432176.2	-	9	982	c.750T>C	c.(748-750)aaT>aaC	p.N250N	FAM126A_ENST00000409923.1_Silent_p.N250N|FAM126A_ENST00000498833.1_5'UTR	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	250					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						CCCATTCTCCATTATAACTAT	0.294																																						ENST00000432176.2	1.000000	0.260000	0.460000	0.300000	0.360000	0.447703	0.360000	0.360000																										0				23						c.(748-750)aaT>aaC		family with sequence similarity 126, member A							55.0	60.0	58.0					7																	23000935		2203	4299	6502	SO:0001819	synonymous_variant	84668	0	0					g.chr7:23000935A>G	BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.750T>C	chr7.hg19:g.23000935A>G		1					FAM126A_ENST00000498833.1_5'UTR|FAM126A_ENST00000409923.1_Silent_p.N250N	p.N250N	NM_032581.3	NP_115970.2	1	3	4	3.140805	Q9BYI3	HYCCI_HUMAN		9	982	-			A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Silent	SNP	ENST00000432176.2	1	1	hg19	c.750T>C	CCDS5377.1	0	.	.	.	.	.	.	.	.	.	.	A	7.238	0.600710	0.13939	.	.	ENSG00000122591	ENST00000440481	.	.	.	5.29	5.29	0.74685	5.29	5.29	0.74685	.	.	.	.	.	T	0.71239	0.3316	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70722	-0.4794	4	.	.	.	-20.4149	15.2237	0.73333	1.0:0.0:0.0:0.0	.	.	.	.	T	302	.	.	M	-	2	0	0	FAM126A	22967460	22967460	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.815000	0.55651	2.008000	0.58898	0.528000	0.53228	ATG	0.763903		TCGA-HV-A5A6-01A-11D-A26I-08	0.294	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250230.1	1	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	1.940000	-11.272510	1	0.640000	NM_032581		0	48	48	0	601	593	0		1	0		0	0	38	0	0	1.000000	1.714472e-01	0	1	0	9	0	48	601
TECPR1	25851	broad.mit.edu	37	7	97863071	97863071	+	Missense_Mutation	SNP	G	G	T	rs113639233		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr7:97863071G>T	ENST00000447648.2	-	11	1633	c.1334C>A	c.(1333-1335)gCc>gAc	p.A445D	TECPR1_ENST00000542604.1_Missense_Mutation_p.A375D|TECPR1_ENST00000379795.3_Missense_Mutation_p.A445D			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	445					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CAGGCCTGAGGCTGAGTTCCC	0.647																																						ENST00000447648.2	1.000000	0.230000	1.000000	0.320000	0.430000	0.545835	0.430000	0.390000																										0				26						c.(1333-1335)gCc>gAc		tectonin beta-propeller repeat containing 1							19.0	22.0	21.0					7																	97863071		2048	4189	6237	SO:0001583	missense	25851	0	0					g.chr7:97863071G>T		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.1334C>A	chr7.hg19:g.97863071G>T	ENSP00000404923:p.Ala445Asp	1					TECPR1_ENST00000542604.1_Missense_Mutation_p.A375D|TECPR1_ENST00000379795.3_Missense_Mutation_p.A445D	p.A445D			1	2	3	2.508307	Q7Z6L1	TCPR1_HUMAN		11	1633	-			A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	0	0	hg19	c.1334C>A	CCDS47648.1	0	.	.	.	.	.	.	.	.	.	.	G	5.957	0.360476	0.11296	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	T;T;T	0.31247	1.5;1.5;1.5	3.73	3.73	0.42828	3.73	3.73	0.42828	.	1.167180	0.06148	N	0.673577	T	0.19846	0.0477	N	0.08118	0	0.09310	N	0.999998	B;B	0.29341	0.216;0.242	B;B	0.31191	0.125;0.068	T	0.08066	-1.0740	10	0.12430	T	0.62	-14.1381	14.8693	0.70444	0.0:0.0:1.0:0.0	.	375;445	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	D	445;445;375	ENSP00000404923:A445D;ENSP00000369121:A445D;ENSP00000441121:A375D	ENSP00000369121:A445D	A	-	2	0	0	TECPR1	97701007	97701007	0.059000	0.20769	0.081000	0.20488	0.039000	0.13416	2.694000	0.47035	1.826000	0.53198	0.462000	0.41574	GCC	0.699599		TCGA-HV-A5A6-01A-11D-A26I-08	0.647	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	1	0	0	2	2	2	2	0	0	0	0	13	13	13	13	1	1.940000	-8.149257	1	0.640000	NM_015395		0	14	14	0	120	119	1		1	1		0	0	13	0	0	0.999798	8.835639e-01	0	19	0	16	0	14	120
OR2A14	135941	broad.mit.edu	37	7	143826995	143826995	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr7:143826995C>T	ENST00000408899.2	+	1	845	c.790C>T	c.(790-792)Cgc>Tgc	p.R264C		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					CCCCAAGTCCCGCCATCCTGA	0.542																																						ENST00000408899.2	0.600000	0.450000	0.570000	0.480000	0.520000	0.529005	0.520000	0.530000																										0				22						c.(790-792)Cgc>Tgc		olfactory receptor, family 2, subfamily A, member 14							115.0	121.0	119.0					7																	143826995		1981	4170	6151	SO:0001583	missense	135941	0	0					g.chr7:143826995C>T		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.790C>T	chr7.hg19:g.143826995C>T	ENSP00000386137:p.Arg264Cys	1						p.R264C	NM_001001659.1	NP_001001659.1	0	1	1	1.455483	Q96R47	O2A14_HUMAN		1	845	+	Melanoma(164;0.0783)		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	1	1	hg19	c.790C>T	CCDS43672.1	0	.	.	.	.	.	.	.	.	.	.	C	4.537	0.099753	0.08681	.	.	ENSG00000221938	ENST00000408899	T	0.00130	8.69	4.18	-5.49	0.02584	4.18	-5.49	0.02584	GPCR, rhodopsin-like superfamily (1);	2.119410	0.03153	U	0.168207	T	0.00144	0.0004	L	0.35414	1.06	0.09310	N	1	B	0.19817	0.039	B	0.21546	0.035	T	0.33904	-0.9850	10	0.72032	D	0.01	0.4492	11.4184	0.49967	0.7699:0.1508:0.0:0.0792	.	264	Q96R47	O2A14_HUMAN	C	264	ENSP00000386137:R264C	ENSP00000386137:R264C	R	+	1	0	0	OR2A14	143457928	143457928	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.560000	0.00921	-0.882000	0.03987	-0.310000	0.09108	CGC	0.475524		TCGA-HV-A5A6-01A-11D-A26I-08	0.542	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	132	1	1.940000	-5.033565	1	0.640000			0	147	144	0	450	444	1		1			0	0	132	0	0	1.000000	0	0	0	0	0	0	147	450
AP3M2	10947	broad.mit.edu	37	8	42023053	42023053	+	Silent	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chr8:42023053C>T	ENST00000518421.1	+	7	1069	c.778C>T	c.(778-780)Ctg>Ttg	p.L260L	AP3M2_ENST00000174653.3_Silent_p.L260L|AP3M2_ENST00000517922.1_Silent_p.L260L|AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000396926.3_Silent_p.L260L	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	260	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			CTTCCGCCTGCTGTCTTACCA	0.453																																						ENST00000518421.1	1.000000	0.040000	1.000000	0.060000	0.090000	0.308508	0.090000	0.080000																										0				17						c.(778-780)Ctg>Ttg		adaptor-related protein complex 3, mu 2 subunit							185.0	162.0	170.0					8																	42023053		2203	4300	6503	SO:0001819	synonymous_variant	10947	0	0					g.chr8:42023053C>T	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.778C>T	chr8.hg19:g.42023053C>T		1					AP3M2_ENST00000396926.3_Silent_p.L260L|AP3M2_ENST00000174653.3_Silent_p.L260L|AP3M2_ENST00000517922.1_Silent_p.L260L|AP3M2_ENST00000520685.1_Intron	p.L260L	NM_001134296.1	NP_001127768.1	1	2	3	2.335731	P53677	AP3M2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)	7	1069	+	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	B2RCR0|D3DSY2|Q7Z472	Silent	SNP	ENST00000518421.1	1	1	hg19	c.778C>T	CCDS6125.1	0																																																																																								0.688797		TCGA-HV-A5A6-01A-11D-A26I-08	0.453	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1	0	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.940000	-2.732411	1	0.640000			0	18	18	0	767	755	0		1	0		0	0	91	0	0	0.999979	1.235539e-01	0	0	0	25	0	18	767
ARHGAP6	395	broad.mit.edu	37	X	11187680	11187680	+	Missense_Mutation	SNP	G	G	A	rs376590462		TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chrX:11187680G>A	ENST00000337414.4	-	9	2626	c.1754C>T	c.(1753-1755)aCg>aTg	p.T585M	ARHGAP6_ENST00000491514.1_5'UTR|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.T585M|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.T410M|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.T382M|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.T394M|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.T382M|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.T617M	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	585	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GATGATGGCCGTGCTCTCCTC	0.483																																						ENST00000337414.4	0.630000	0.420000	0.580000	0.470000	0.520000	0.528350	0.520000	0.520000																										0				38						c.(1753-1755)aCg>aTg		Rho GTPase activating protein 6		G	MET/THR,MET/THR,MET/THR	1,3834		0,1,1631,571	167.0	129.0	142.0		1754,1145,1754	5.6	1.0	X		142	0,6728		0,0,2428,1872	no	missense,missense,missense	ARHGAP6	NM_006125.2,NM_013423.2,NM_013427.2	81,81,81	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging,probably-damaging	585/766,382/772,585/975	11187680	1,10562	2203	4300	6503	SO:0001583	missense	395	1	121412	36				g.chrX:11187680G>A	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1754C>T	chrX.hg19:g.11187680G>A	ENSP00000338967:p.Thr585Met						ARHGAP6_ENST00000380732.3_Missense_Mutation_p.T617M|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.T394M|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.T410M|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.T382M|ARHGAP6_ENST00000491514.1_5'UTR|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.T585M|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.T382M	p.T585M	NM_013427.2	NP_038286.2	0	1	1		O43182	RHG06_HUMAN		9	2626	-			B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	1	1	hg19	c.1754C>T	CCDS14140.1	0	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622793	0.66787	2.61E-4	0.0	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.57	5.57	0.84162	5.57	5.57	0.84162	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.53938	D	0.000044	T	0.55641	0.1933	L	0.45051	1.395	0.58432	D	0.999995	D;D;D;D;D	0.89917	0.999;0.996;1.0;0.998;1.0	P;P;D;D;D	0.69824	0.791;0.813;0.966;0.917;0.964	T	0.55829	-0.8079	10	0.54805	T	0.06	.	14.2504	0.66016	0.0:0.0:0.8507:0.1493	.	394;382;585;585;585	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	M	410;382;382;585;421;585;394;617	ENSP00000438135:T410M;ENSP00000370112:T382M;ENSP00000302312:T382M;ENSP00000338967:T585M;ENSP00000370093:T421M;ENSP00000370094:T585M;ENSP00000389394:T394M;ENSP00000370108:T617M	ENSP00000302312:T382M	T	-	2	0	0	ARHGAP6	11097601	11097601	1.000000	0.71417	0.975000	0.42487	0.717000	0.41224	6.141000	0.71744	2.344000	0.79699	0.544000	0.68410	ACG	0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.483	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.940000	-20.000000	1	0.640000	NM_013427		0	86	85	0	426	424	1		1	1		0	0	56	0	0	1.000000	5.749979e-01	0	5	0	6	0	86	426
SLC7A3	84889	broad.mit.edu	37	X	70149579	70149579	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chrX:70149579C>T	ENST00000374299.3	-	2	413	c.269G>A	c.(268-270)cGg>cAg	p.R90Q	SLC7A3_ENST00000298085.4_Missense_Mutation_p.R90Q			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	90					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	ACGGGGAACCCGGGCACCAAA	0.542																																						ENST00000374299.3	1.000000	0.580000	0.930000	0.680000	0.800000	0.810000	0.800000	1.000000																										0				31						c.(268-270)cGg>cAg		solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						96.0	69.0	78.0					X																	70149579		2203	4300	6503	SO:0001583	missense	84889	1	121410	21				g.chrX:70149579C>T	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.269G>A	chrX.hg19:g.70149579C>T	ENSP00000363417:p.Arg90Gln						SLC7A3_ENST00000298085.4_Missense_Mutation_p.R90Q	p.R90Q			0	1	1		Q8WY07	CTR3_HUMAN		2	413	-	Renal(35;0.156)		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	1	1	hg19	c.269G>A	CCDS14404.1	0	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954560	0.92726	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.89875	-2.58;-2.58	4.7	4.7	0.59300	4.7	4.7	0.59300	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.94145	0.8122	M	0.87269	2.87	0.80722	D	1	D	0.62365	0.991	P	0.60012	0.867	D	0.95016	0.8156	10	0.62326	D	0.03	.	15.7504	0.77980	0.0:1.0:0.0:0.0	.	90	Q8WY07	CTR3_HUMAN	Q	90	ENSP00000363417:R90Q;ENSP00000298085:R90Q	ENSP00000298085:R90Q	R	-	2	0	0	SLC7A3	70066304	70066304	1.000000	0.71417	0.961000	0.40146	0.906000	0.53458	7.511000	0.81718	2.168000	0.68352	0.529000	0.55759	CGG	0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.542	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.940000	-20.000000	1	0.640000	NM_032803		0	33	33	0	95	95	1		1			0	0	22	0	0	1.000000	0	0	0	0	0	0	33	95
COL4A5	1287	broad.mit.edu	37	X	107849999	107849999	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-A5A6-01A-11D-A26I-08	TCGA-HV-A5A6-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cef48024-e351-4de9-a83b-f3c10fe9e0f7	bc5bef8e-3ef9-4f30-9ed9-5b861c924522	g.chrX:107849999C>A	ENST00000361603.2	+	29	2516	c.2272C>A	c.(2272-2274)Cca>Aca	p.P758T	COL4A5_ENST00000328300.6_Missense_Mutation_p.P758T	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	758	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ATTACCTGGGCCACCTGGGCC	0.507									Alport syndrome with Diffuse Leiomyomatosis																													ENST00000361603.2	0.110000	0.020000	0.090000	0.040000	0.060000	0.067096	0.060000	0.060000																										0				99						c.(2272-2274)Cca>Aca		collagen, type IV, alpha 5							146.0	118.0	127.0					X																	107849999		2203	4300	6503	SO:0001583	missense	1287	0	0		Alport syndrome with Diffuse Leiomyomatosis	Familial Cancer Database		g.chrX:107849999C>A	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.2272C>A	chrX.hg19:g.107849999C>A	ENSP00000354505:p.Pro758Thr						COL4A5_ENST00000328300.6_Missense_Mutation_p.P758T	p.P758T	NM_000495.4	NP_000486.1	0	1	1		P29400	CO4A5_HUMAN		29	2516	+			Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	0	1	hg19	c.2272C>A	CCDS14543.1	0	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392716	0.62066	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.97710	-4.5;-4.5	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.121540	0.56097	D	0.000027	D	0.98071	0.9364	M	0.66506	2.035	0.53688	D	0.999976	D;D;D	0.69078	0.982;0.997;0.982	P;D;P	0.63113	0.812;0.911;0.812	D	0.97820	1.0256	10	0.14656	T	0.56	.	18.6523	0.91435	0.0:1.0:0.0:0.0	.	758;366;758	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	T	758	ENSP00000331902:P758T;ENSP00000354505:P758T	ENSP00000331902:P758T	P	+	1	0	0	COL4A5	107736655	107736655	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.456000	0.80751	2.348000	0.79779	0.600000	0.82982	CCA	0.640000		TCGA-HV-A5A6-01A-11D-A26I-08	0.507	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2	0	0	1	2	2	2	2	0	0	0	0	65	65	65	64	1	1.940000	-3.117730	1	0.640000			0	11	11	0	545	541	0		1	0		0	0	65	0	0	0.998291	2.901728e-03	0	0	0	4	0	11	545
