#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
DSC1	1823	broad.mit.edu	37	18	28725666	28725666	+	Frame_Shift_Del	DEL	T	T	-	rs199684665		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr18:28725666delT	ENST00000257198.5	-	7	1108	c.847delA	c.(847-849)atcfs	p.I283fs	DSC1_ENST00000257197.3_Frame_Shift_Del_p.I283fs|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	283	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TGTTGTAAGATTTTATATTTC	0.413																																						ENST00000257198.5	0.820000	5.500000e-01	0.750000	6.100000e-01	0.680000	0.688349	0.680000	0.680000																										0				53						c.(847-849)atcfs		desmocollin 1							189.0	190.0	190.0					18																	28725666		2203	4300	6503	SO:0001589	frameshift_variant	1823	0	0					g.chr18:28725666delT	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.847delA	chr18.hg19:g.28725666delT	ENSP00000257198:p.Ile283fs	1					DSC1_ENST00000257197.3_Frame_Shift_Del_p.I283fs|RP11-408H20.2_ENST00000581836.1_RNA	p.I283fs	NM_024421.2	NP_077739.1	0	1	1	1.678323	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)	7	1108	-			Q9HB01	Frame_Shift_Del	DEL	ENST00000257198.5	1	0	hg19	c.847delA	CCDS11894.1	0																																																																																								0.228745		TCGA-HV-A7OL-01A-11D-A33T-08	0.413	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	1	0	1		25			0	0	0	1	68	0	68	68	1	1.920000	-20.000000	1	0.370000	NM_004948, NM_024421		0	82	105	0	445	440	0	0	1	0	0	0	0	0	0	0	1.000000	0	0	0	0	0	0	82	445
CUBN	8029	broad.mit.edu	37	10	16919089	16919089	+	Silent	SNP	G	G	A	rs370685424		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr10:16919089G>A	ENST00000377833.4	-	57	8978	c.8913C>T	c.(8911-8913)tcC>tcT	p.S2971S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2971	CUB 22. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCGTCACAGCGGAACGAGCTG	0.453													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19151	0.0		0.0	False		,,,				2504	0.0					ENST00000377833.4	0.360000	4.000000e-02	0.240000	9.000000e-02	0.150000	0.175896	0.150000	0.140000																										0				241						c.(8911-8913)tcC>tcT		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	A		3,4403	823.8+/-416.5	0,3,2200	62.0	49.0	53.0		8913	-11.8	0.0	10		53	0,8600		0,0,4300	no	coding-synonymous	CUBN	NM_001081.3		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		2971/3624	16919089	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	8029	10	121400	39				g.chr10:16919089G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8913C>T	chr10.hg19:g.16919089G>A		0						p.S2971S	NM_001081.3	NP_001072.2	1	2	3	2.041138	O60494	CUBN_HUMAN		57	8978	-			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	0	1	hg19	c.8913C>T	CCDS7113.1	0																																																																																								0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.453	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	0	0	1	2	2	2	2	0	0	0	0	28	28	28	27	1	1.920000	-6.256320	1	0.370000	NM_001081		0	4	4	0	154	149	0		1			0	0	28	0	0	0.883673	0	0	0	0	0	0	4	154
ARMC3	219681	broad.mit.edu	37	10	23250963	23250963	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr10:23250963G>A	ENST00000298032.5	+	7	772	c.688G>A	c.(688-690)Gac>Aac	p.D230N	ARMC3_ENST00000409049.3_Missense_Mutation_p.D230N|ARMC3_ENST00000376528.4_Intron|ARMC3_ENST00000409983.3_Missense_Mutation_p.D230N	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	230						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AATGCTAAGAGACAATCAAGG	0.368																																						ENST00000298032.5	1.000000	8.400000e-01	1.000000	9.900000e-01	0.990000	0.987257	0.990000	1.000000																										0				47						c.(688-690)Gac>Aac		armadillo repeat containing 3							76.0	69.0	72.0					10																	23250963		2203	4300	6503	SO:0001583	missense	219681	0	0					g.chr10:23250963G>A	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.688G>A	chr10.hg19:g.23250963G>A	ENSP00000298032:p.Asp230Asn	0					ARMC3_ENST00000409983.3_Missense_Mutation_p.D230N|ARMC3_ENST00000376528.4_Intron|ARMC3_ENST00000409049.3_Missense_Mutation_p.D230N	p.D230N	NM_173081.3	NP_775104.2	1	2	3	2.041138	Q5W041	ARMC3_HUMAN		7	772	+			A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	1	1	hg19	c.688G>A	CCDS7142.1	1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478799	0.63849	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049	T;T;T	0.19105	2.17;2.17;2.17	5.67	5.67	0.87782	5.67	5.67	0.87782	Armadillo-like helical (1);Armadillo-type fold (1);	0.258007	0.43747	D	0.000526	T	0.22322	0.0538	L	0.38531	1.155	0.80722	D	1	B;B	0.28713	0.07;0.22	B;B	0.28991	0.055;0.097	T	0.02026	-1.1227	10	0.48119	T	0.1	-1.008	19.746	0.96252	0.0:0.0:1.0:0.0	.	230;230	Q5W041-4;Q5W041	.;ARMC3_HUMAN	N	230;230;166;230	ENSP00000298032:D230N;ENSP00000386943:D230N;ENSP00000387288:D230N	ENSP00000298032:D230N	D	+	1	0	0	ARMC3	23290969	23290969	1.000000	0.71417	0.953000	0.39169	0.899000	0.52679	5.700000	0.68318	2.673000	0.90976	0.650000	0.86243	GAC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.368	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.920000	-20.000000	1	0.370000	NM_173081		0	35	35	0	128	128	1		1			0	0	24	0	0	1.000000	0	0	0	0	0	0	35	128
DUSP13	51207	broad.mit.edu	37	10	76855494	76855494	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr10:76855494G>A	ENST00000472493.2	-	3	311	c.233C>T	c.(232-234)gCc>gTc	p.A78V	DUSP13_ENST00000478873.2_Missense_Mutation_p.A214V|DUSP13_ENST00000607009.1_5'Flank|DUSP13_ENST00000372700.3_Missense_Mutation_p.A128V|DUSP13_ENST00000491677.2_Missense_Mutation_p.A207V|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000605915.1_Missense_Mutation_p.A100V|DUSP13_ENST00000607131.1_Missense_Mutation_p.A171V|DUSP13_ENST00000464872.1_Missense_Mutation_p.A78V	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	78					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GCCTGCAGCGGCATTCACAAC	0.577																																					NSCLC(174;1655 2059 12324 40663 42963)	ENST00000472493.2	1.000000	0	0.070000	2.000000e-02	0.040000	0.077478	0.040000	0.040000																										0				8						c.(232-234)gCc>gTc		dual specificity phosphatase 13							205.0	181.0	189.0					10																	76855494		2203	4300	6503	SO:0001583	missense	51207	0	0					g.chr10:76855494G>A	AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000472493.2:c.233C>T	chr10.hg19:g.76855494G>A	ENSP00000444580:p.Ala78Val	0					DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000607009.1_5'Flank|DUSP13_ENST00000464872.1_Missense_Mutation_p.A78V|DUSP13_ENST00000607131.1_Missense_Mutation_p.A171V|DUSP13_ENST00000372700.3_Missense_Mutation_p.A128V|DUSP13_ENST00000478873.2_Missense_Mutation_p.A214V|DUSP13_ENST00000491677.2_Missense_Mutation_p.A207V|DUSP13_ENST00000605915.1_Missense_Mutation_p.A100V	p.A78V	NM_016364.3	NP_057448.3	1	2	3	2.054153	Q9UII6	DS13B_HUMAN		3	311	-	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)		A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	ENST00000472493.2	0	1	hg19	c.233C>T	CCDS7346.1	0	.	.	.	.	.	.	.	.	.	.	G	8.989	0.977271	0.18812	.	.	ENSG00000079393	ENST00000308475;ENST00000472493;ENST00000491677;ENST00000372698;ENST00000464872;ENST00000372700	T;T;T;T;T	0.60548	0.42;0.42;0.42;0.18;0.42	5.11	-2.7	0.06004	5.11	-2.7	0.06004	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.348638	0.33235	N	0.005130	T	0.30947	0.0781	N	0.13198	0.31	0.31631	N	0.648985	B;P;P	0.41265	0.342;0.678;0.744	B;B;B	0.36534	0.092;0.137;0.227	T	0.48198	-0.9056	10	0.14656	T	0.56	-2.9419	12.3709	0.55254	0.2733:0.0:0.7267:0.0	.	128;207;78	Q9UII6-4;F2Z2C4;Q9UII6	.;.;DUS13_HUMAN	V	78;78;207;171;78;128	ENSP00000311051:A78V;ENSP00000444580:A78V;ENSP00000436312:A207V;ENSP00000434041:A78V;ENSP00000361785:A128V	ENSP00000311051:A78V	A	-	2	0	0	DUSP13	76525500	76525500	0.981000	0.34729	0.126000	0.21872	0.401000	0.30781	2.524000	0.45589	-0.319000	0.08652	-0.150000	0.13652	GCC	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.577	DUSP13-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048786.3	0	0	1	2	20	2	2	1	1	1	1	129	129	129	127	1	1.920000	-1.584131	0	0.370000			0	6	6	0	750	744	0		0			1	0	129	0	0	0.004092	0	0	0	0	0	0	6	750
SFXN4	119559	broad.mit.edu	37	10	120914629	120914629	+	Missense_Mutation	SNP	G	G	A	rs151157939		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr10:120914629G>A	ENST00000355697.2	-	11	696	c.677C>T	c.(676-678)gCg>gTg	p.A226V	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.A217V	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	226					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		GTCCATGACCGCAATCCCCTT	0.478																																						ENST00000355697.2	1.000000	2.000000e-02	0.110000	4.000000e-02	0.060000	0.103322	0.060000	0.060000																										0				11						c.(676-678)gCg>gTg		sideroflexin 4		G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	148.0	124.0	132.0		677	2.4	0.8	10	dbSNP_134	132	1,8599	1.2+/-3.3	0,1,4299	no	missense	SFXN4	NM_213649.1	64	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging	226/338	120914629	2,13004	2203	4300	6503	SO:0001583	missense	119559	17	121412	45				g.chr10:120914629G>A		CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.677C>T	chr10.hg19:g.120914629G>A	ENSP00000347924:p.Ala226Val	0					SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.A217V	p.A226V	NM_213649.1	NP_998814.1	1	2	3	2.054153	Q6P4A7	SFXN4_HUMAN		11	696	-		Lung NSC(174;0.094)|all_lung(145;0.123)	Q6WSU4|Q86TD9	Missense_Mutation	SNP	ENST00000355697.2	0	1	hg19	c.677C>T	CCDS7610.1	0	.	.	.	.	.	.	.	.	.	.	G	9.568	1.120310	0.20877	2.27E-4	1.16E-4	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875;ENST00000369131	T;T;T	0.30714	1.52;1.52;1.52	4.77	2.38	0.29361	4.77	2.38	0.29361	.	0.608708	0.17108	N	0.186736	T	0.19005	0.0456	L	0.36672	1.1	0.09310	N	1	P	0.47677	0.899	B	0.38755	0.281	T	0.08806	-1.0704	10	0.33940	T	0.23	-8.9942	5.8839	0.18870	0.0:0.0913:0.1753:0.7334	.	226	Q6P4A7	SFXN4_HUMAN	V	226;217;109;110	ENSP00000347924:A226V;ENSP00000333200:A217V;ENSP00000358127:A110V	ENSP00000333200:A217V	A	-	2	0	0	SFXN4	120904619	120904619	0.189000	0.23263	0.799000	0.32177	0.166000	0.22503	0.232000	0.17891	0.867000	0.35654	-0.281000	0.10026	GCG	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.478	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3	0	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	1.920000	-2.100855	0	0.370000	XM_058406		0	5	5	0	417	414	0		1	0		0	0	71	0	0	0.936716	3.595399e-01	0	0	0	91	0	5	417
NCAM1	4684	broad.mit.edu	37	11	113078690	113078690	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:113078690C>T	ENST00000533760.1	+	7	1127	c.528C>T	c.(526-528)ggC>ggT	p.G176G	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Silent_p.G284G|NCAM1_ENST00000401611.2_Silent_p.G293G	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	294	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		ACAAGGCTGGCGAGCAGGATG	0.532																																						ENST00000533760.1	1.000000	6.900000e-01	1.000000	8.700000e-01	0.990000	0.954463	0.990000	1.000000																										0				49						c.(526-528)ggC>ggT		neural cell adhesion molecule 1							56.0	56.0	56.0					11																	113078690		2067	4214	6281	SO:0001819	synonymous_variant	4684	0	0					g.chr11:113078690C>T		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.528C>T	chr11.hg19:g.113078690C>T		0					NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Silent_p.G293G|NCAM1_ENST00000316851.7_Silent_p.G284G	p.G176G	NM_001242608.1	NP_001229537.1	1	2	3	2.043829	P13591	NCAM1_HUMAN		7	1127	+		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	0	1	hg19	c.528C>T		1																																																																																								0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.532	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	1	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.920000	-20.000000	1	0.370000	NM_000615		0	18	18	0	72	71	1		1			0	0	8	0	0	0.999990	0	0	0	0	0	0	18	72
CBL	867	broad.mit.edu	37	11	119148958	119148958	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:119148958T>C	ENST00000264033.4	+	8	1554	c.1178T>C	c.(1177-1179)aTt>aCt	p.I393T		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	393	Asp/Glu-rich (acidic).				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E366_Q409del(13)|p.E369_Q409del(1)|p.?(1)|p.E366_K477del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		GATGTAAAGATTGAGCCCTGT	0.368			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													ENST00000264033.4	0.160000	2.000000e-02	0.110000	4.000000e-02	0.070000	0.089532	0.070000	0.070000				"""Dom, Rec"""	yes			Dom, Rec	yes		11	11q23.3	11q23.3	867	T, Mis S, O	Cas-Br-M (murine) ecotropic retroviral transforming				L	L	MLL		AML, JMML, MDS		16	Deletion - In frame(15)|Unknown(1)	p.E366_Q409del(13)|p.E369_Q409del(1)|p.?(1)|p.E366_K477del(1)	haematopoietic_and_lymphoid_tissue(16)	251						c.(1177-1179)aTt>aCt		Cbl proto-oncogene, E3 ubiquitin protein ligase							118.0	111.0	113.0					11																	119148958		2199	4295	6494	SO:0001583	missense	867	1	121412	30	Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	g.chr11:119148958T>C	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1178T>C	chr11.hg19:g.119148958T>C	ENSP00000264033:p.Ile393Thr	0						p.I393T	NM_005188.3	NP_005179.2	1	2	3	2.043829	P22681	CBL_HUMAN		8	1554	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	A3KMP8	Missense_Mutation	SNP	ENST00000264033.4	0	1	hg19	c.1178T>C	CCDS8418.1	0	.	.	.	.	.	.	.	.	.	.	T	17.96	3.515433	0.64634	.	.	ENSG00000110395	ENST00000264033	D	0.96011	-3.88	5.52	5.52	0.82312	5.52	5.52	0.82312	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.96116	0.8734	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97019	0.9742	10	0.87932	D	0	-15.1332	15.9527	0.79855	0.0:0.0:0.0:1.0	.	393	P22681	CBL_HUMAN	T	393	ENSP00000264033:I393T	ENSP00000264033:I393T	I	+	2	0	0	CBL	118654168	118654168	1.000000	0.71417	0.983000	0.44433	0.986000	0.74619	7.655000	0.83696	2.227000	0.72691	0.455000	0.32223	ATT	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.368	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	0	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.920000	-6.046258	1	0.370000	NM_005188		0	6	6	0	462	463	0		1	0		0	0	62	0	0	0.965426	0	0	0	0	1	0	6	462
TTC17	55761	broad.mit.edu	37	11	43471655	43471655	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:43471655C>T	ENST00000039989.4	+	20	2824	c.2810C>T	c.(2809-2811)gCc>gTc	p.A937V		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	937					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						ATAGATTTTGCCACCCCTATA	0.473																																						ENST00000039989.4	0.110000	1.000000e-02	0.080000	2.000000e-02	0.040000	0.063782	0.040000	0.050000																										0				53						c.(2809-2811)gCc>gTc		tetratricopeptide repeat domain 17							121.0	112.0	115.0					11																	43471655		2203	4300	6503	SO:0001583	missense	55761	0	0					g.chr11:43471655C>T	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2810C>T	chr11.hg19:g.43471655C>T	ENSP00000039989:p.Ala937Val	0						p.A937V	NM_018259.5	NP_060729.2	1	2	3	2.042277	Q96AE7	TTC17_HUMAN		20	2824	+			G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	0	1	hg19	c.2810C>T	CCDS31466.1	0	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470025	0.84533	.	.	ENSG00000052841	ENST00000039989	T	0.34667	1.35	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	L	0.47716	1.5	0.80722	D	1	P	0.50443	0.935	B	0.43194	0.411	T	0.12116	-1.0560	10	0.42905	T	0.14	-13.769	20.1392	0.98050	0.0:1.0:0.0:0.0	.	937	Q96AE7	TTC17_HUMAN	V	937	ENSP00000039989:A937V	ENSP00000039989:A937V	A	+	2	0	0	TTC17	43428231	43428231	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.438000	0.80431	2.751000	0.94390	0.591000	0.81541	GCC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.473	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	0	0	1	2	2	2	2	0	0	0	0	94	94	94	94	1	1.920000	-1.908540	0	0.370000	NM_018259		0	6	6	0	687	681	0		1	0		0	0	94	0	0	0.964124	7.013803e-03	0	0	0	12	0	6	687
ZDHHC5	25921	broad.mit.edu	37	11	57466302	57466302	+	Missense_Mutation	SNP	A	A	G	rs369287219		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:57466302A>G	ENST00000287169.3	+	11	2756	c.1394A>G	c.(1393-1395)aAt>aGt	p.N465S	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.N412S	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	465					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CAGACACGCAATGGAAGCCTA	0.557																																						ENST00000287169.3	1.000000	6.900000e-01	1.000000	7.900000e-01	0.910000	0.900437	0.910000	1.000000																										0				18						c.(1393-1395)aAt>aGt		zinc finger, DHHC-type containing 5		A	SER/ASN	0,4402		0,0,2201	96.0	75.0	82.0		1394	5.1	1.0	11		82	1,8591	1.2+/-3.3	0,1,4295	no	missense	ZDHHC5	NM_015457.2	46	0,1,6496	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging	465/716	57466302	1,12993	2201	4296	6497	SO:0001583	missense	25921	2	121412	34				g.chr11:57466302A>G	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1394A>G	chr11.hg19:g.57466302A>G	ENSP00000287169:p.Asn465Ser	0					ZDHHC5_ENST00000527985.1_Missense_Mutation_p.N412S	p.N465S	NM_015457.2	NP_056272.2	1	2	3	2.043824	Q9C0B5	ZDHC5_HUMAN		11	2756	+			Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	ENST00000287169.3	1	1	hg19	c.1394A>G	CCDS7965.1	1	.	.	.	.	.	.	.	.	.	.	A	19.93	3.918245	0.73098	0.0	1.16E-4	ENSG00000156599	ENST00000527985;ENST00000287169;ENST00000529447	T;T;D	0.85013	-0.09;0.89;-1.93	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.269487	0.37219	N	0.002189	D	0.84224	0.5425	L	0.37561	1.115	0.80722	D	1	P	0.42827	0.791	P	0.48873	0.593	D	0.85335	0.1092	10	0.52906	T	0.07	-19.2371	14.709	0.69215	1.0:0.0:0.0:0.0	.	465	Q9C0B5	ZDHC5_HUMAN	S	412;465;299	ENSP00000432202:N412S;ENSP00000287169:N465S;ENSP00000435722:N299S	ENSP00000287169:N465S	N	+	2	0	0	ZDHHC5	57222878	57222878	1.000000	0.71417	0.991000	0.47740	0.979000	0.70002	8.502000	0.90505	2.146000	0.66826	0.460000	0.39030	AAT	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.557	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.920000	-20.000000	1	0.370000	NM_015457		0	48	47	0	238	236	1		1	1		0	0	52	0	0	1.000000	9.999622e-01	0	22	0	56	0	48	238
CTNND1	1500	broad.mit.edu	37	11	57559074	57559074	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:57559074G>A	ENST00000399050.4	+	3	660	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	CTNND1_ENST00000534579.1_5'UTR|CTNND1_ENST00000529873.1_5'UTR|CTNND1_ENST00000533667.1_Intron|CTNND1_ENST00000532463.1_Intron|CTNND1_ENST00000529986.1_Intron|CTNND1_ENST00000530094.1_Intron|CTNND1_ENST00000525902.1_Intron|CTNND1_ENST00000361796.4_Missense_Mutation_p.E42K|CTNND1_ENST00000528232.1_Intron|CTNND1_ENST00000361391.6_Missense_Mutation_p.E42K|CTNND1_ENST00000360682.6_Missense_Mutation_p.E42K|RP11-691N7.6_ENST00000531074.1_3'UTR|CTNND1_ENST00000532844.1_5'UTR|CTNND1_ENST00000527467.1_Intron|CTNND1_ENST00000399039.4_Missense_Mutation_p.E42K|CTNND1_ENST00000526357.1_5'UTR|CTNND1_ENST00000531014.1_Intron|CTNND1_ENST00000530748.1_5'UTR|CTNND1_ENST00000532649.1_5'UTR|CTNND1_ENST00000361332.4_Missense_Mutation_p.E42K|CTNND1_ENST00000358694.6_Missense_Mutation_p.E42K|CTNND1_ENST00000426142.2_Intron|CTNND1_ENST00000428599.2_Missense_Mutation_p.E42K|CTNND1_ENST00000524630.1_Missense_Mutation_p.E42K|CTNND1_ENST00000529526.1_5'UTR|CTNND1_ENST00000526938.1_Missense_Mutation_p.E42K|CTNND1_ENST00000532787.1_Intron|CTNND1_ENST00000528621.1_5'UTR|CTNND1_ENST00000526772.1_Intron|CTNND1_ENST00000529919.1_Missense_Mutation_p.E42K|CTNND1_ENST00000532245.1_Intron|CTNND1_ENST00000415361.2_Intron	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	42					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				GGCGCAGCTGGAACGCGTCCG	0.637																																						ENST00000399050.4	1.000000	6.200000e-01	1.000000	7.300000e-01	0.850000	0.854491	0.850000	1.000000																										0				45						c.(124-126)Gaa>Aaa		catenin (cadherin-associated protein), delta 1							40.0	45.0	44.0					11																	57559074		2089	4199	6288	SO:0001583	missense	1500	0	0					g.chr11:57559074G>A	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.124G>A	chr11.hg19:g.57559074G>A	ENSP00000382004:p.Glu42Lys	0					CTNND1_ENST00000534579.1_5'UTR|CTNND1_ENST00000361332.4_Missense_Mutation_p.E42K|CTNND1_ENST00000529873.1_5'UTR|CTNND1_ENST00000426142.2_Intron|CTNND1_ENST00000526938.1_Missense_Mutation_p.E42K|CTNND1_ENST00000530748.1_5'UTR|CTNND1_ENST00000532245.1_Intron|CTNND1_ENST00000533667.1_Intron|CTNND1_ENST00000532463.1_Intron|CTNND1_ENST00000525902.1_Intron|CTNND1_ENST00000532787.1_Intron|CTNND1_ENST00000415361.2_Intron|CTNND1_ENST00000528621.1_5'UTR|CTNND1_ENST00000361796.4_Missense_Mutation_p.E42K|CTNND1_ENST00000428599.2_Missense_Mutation_p.E42K|CTNND1_ENST00000527467.1_Intron|CTNND1_ENST00000532844.1_5'UTR|CTNND1_ENST00000358694.6_Missense_Mutation_p.E42K|CTNND1_ENST00000530094.1_Intron|CTNND1_ENST00000529986.1_Intron|CTNND1_ENST00000361391.6_Missense_Mutation_p.E42K|CTNND1_ENST00000524630.1_Missense_Mutation_p.E42K|RP11-691N7.6_ENST00000531074.1_3'UTR|CTNND1_ENST00000360682.6_Missense_Mutation_p.E42K|CTNND1_ENST00000399039.4_Missense_Mutation_p.E42K|CTNND1_ENST00000529919.1_Missense_Mutation_p.E42K|CTNND1_ENST00000528232.1_Intron|CTNND1_ENST00000526772.1_Intron|CTNND1_ENST00000531014.1_Intron|CTNND1_ENST00000526357.1_5'UTR|CTNND1_ENST00000529526.1_5'UTR|CTNND1_ENST00000532649.1_5'UTR	p.E42K	NM_001085458.1	NP_001078927.1	1	2	3	2.043824	O60716	CTND1_HUMAN		3	660	+		all_epithelial(135;0.155)	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	ENST00000399050.4	1	1	hg19	c.124G>A	CCDS44604.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.405970	0.83230	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000358694;ENST00000428599;ENST00000526938	T;T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.176390	0.50627	D	0.000116	T	0.35913	0.0948	L	0.59436	1.845	0.36574	D	0.873151	P;P;P;P;P;P	0.42248	0.774;0.774;0.665;0.774;0.762;0.665	B;B;B;B;B;B	0.39379	0.236;0.236;0.119;0.236;0.298;0.119	T	0.47484	-0.9114	10	0.72032	D	0.01	-9.2286	18.7943	0.91988	0.0:0.0:1.0:0.0	.	42;42;42;42;42;42	O60716-3;O60716-2;O60716;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.	K	42	ENSP00000436543:E42K;ENSP00000434808:E42K;ENSP00000381996:E42K;ENSP00000353902:E42K;ENSP00000354907:E42K;ENSP00000382004:E42K;ENSP00000354785:E42K;ENSP00000354823:E42K;ENSP00000351527:E42K;ENSP00000413586:E42K;ENSP00000432041:E42K	ENSP00000351527:E42K	E	+	1	0	0	CTNND1	57315650	57315650	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.153000	0.89640	2.809000	0.96659	0.655000	0.94253	GAA	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.637	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	40	1	1.920000	-20.000000	1	0.370000	NM_001331		0	37	37	0	198	196	1		1	0		0	0	41	0	0	1.000000	0	0	0	0	1	0	37	198
ATG2A	23130	broad.mit.edu	37	11	64666137	64666137	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:64666137G>A	ENST00000377264.3	-	32	4754	c.4642C>T	c.(4642-4644)Cgg>Tgg	p.R1548W	ATG2A_ENST00000421419.2_Missense_Mutation_p.R1550W	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1548					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CGCGGCATCCGCTCACTCGTG	0.607																																						ENST00000377264.3	1.000000	8.700000e-01	1.000000	9.700000e-01	0.990000	0.987410	0.990000	1.000000																										0				55						c.(4642-4644)Cgg>Tgg		autophagy related 2A							92.0	67.0	75.0					11																	64666137		2201	4297	6498	SO:0001583	missense	23130	0	0					g.chr11:64666137G>A		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.4642C>T	chr11.hg19:g.64666137G>A	ENSP00000366475:p.Arg1548Trp	0					ATG2A_ENST00000421419.2_Missense_Mutation_p.R1550W	p.R1548W	NM_015104.2	NP_055919.2	1	2	3	2.043829	Q2TAZ0	ATG2A_HUMAN		32	4754	-			O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	1	1	hg19	c.4642C>T	CCDS31602.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.352957|4.352957	0.82132|0.82132	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000418259|ENST00000421419;ENST00000377264	.|T;T	.|0.07444	.|3.19;3.19	4.27|4.27	3.28|3.28	0.37604|0.37604	4.27|4.27	3.28|3.28	0.37604|0.37604	.|.	.|0.058658	.|0.64402	.|D	.|0.000003	T|T	0.17408|0.17408	0.0418|0.0418	L|L	0.47716|0.47716	1.5|1.5	0.38104|0.38104	D|D	0.937356|0.937356	.|D;D	.|0.76494	.|0.999;0.999	.|P;D	.|0.66084	.|0.874;0.941	T|T	0.00875|0.00875	-1.1531|-1.1531	5|10	.|0.66056	.|D	.|0.02	.|.	9.0664|9.0664	0.36467|0.36467	0.0:0.0:0.6774:0.3226|0.0:0.0:0.6774:0.3226	.|.	.|1548;1550	.|Q2TAZ0;Q2TAZ0-3	.|ATG2A_HUMAN;.	V|W	1351|1550;1548	.|ENSP00000410522:R1550W;ENSP00000366475:R1548W	.|ENSP00000366475:R1548W	A|R	-|-	2|1	0|2	0|2	ATG2A|ATG2A	64422713|64422713	64422713|64422713	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.880000|0.880000	0.50808|0.50808	1.056000|1.056000	0.30480|0.30480	2.370000|2.370000	0.80446|0.80446	0.561000|0.561000	0.74099|0.74099	GCG|CGG	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.607	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.920000	-3.482384	1	0.370000	NM_015104		0	70	70	0	278	274	1		1	1		0	0	53	0	0	1.000000	8.813018e-01	0	7	0	10	0	70	278
SYT12	91683	broad.mit.edu	37	11	66807334	66807334	+	Missense_Mutation	SNP	G	G	A	rs34985365		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:66807334G>A	ENST00000393946.2	+	7	1443	c.281G>A	c.(280-282)cGc>cAc	p.R94H	SYT12_ENST00000527043.1_Missense_Mutation_p.R94H|SYT12_ENST00000526281.1_3'UTR|SYT12_ENST00000525457.1_Missense_Mutation_p.R94H			Q8IV01	SYT12_HUMAN	synaptotagmin XII	94						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						CCACCCAGCCGCAAAGGCAGT	0.637																																					Ovarian(65;2862 3307)	ENST00000393946.2	0.100000	0	0.070000	2.000000e-02	0.040000	0.057232	0.040000	0.040000																										0				20						c.(280-282)cGc>cAc		synaptotagmin XII							78.0	83.0	81.0					11																	66807334		2200	4295	6495	SO:0001583	missense	91683	22	121408	47				g.chr11:66807334G>A	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.281G>A	chr11.hg19:g.66807334G>A	ENSP00000377520:p.Arg94His	0					SYT12_ENST00000527043.1_Missense_Mutation_p.R94H|SYT12_ENST00000525457.1_Missense_Mutation_p.R94H|SYT12_ENST00000526281.1_3'UTR	p.R94H			1	2	3	2.043829	Q8IV01	SYT12_HUMAN		7	1443	+				Missense_Mutation	SNP	ENST00000393946.2	0	1	hg19	c.281G>A	CCDS8154.1	0	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840495	0.71488	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043;ENST00000533427	T;T;T	0.14391	2.51;2.51;2.51	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	L	0.27053	0.805	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.00787	-1.1566	10	0.52906	T	0.07	.	13.8906	0.63736	0.0:0.0:1.0:0.0	rs34985365	94	Q8IV01	SYT12_HUMAN	H	94	ENSP00000377520:R94H;ENSP00000431400:R94H;ENSP00000435316:R94H	ENSP00000377520:R94H	R	+	2	0	0	SYT12	66563910	66563910	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	9.228000	0.95250	2.655000	0.90218	0.462000	0.41574	CGC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.637	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	0	0	1	2	2	2	2	0	0	0	0	122	122	122	120	1	1.920000	-1.977436	0	0.370000	NM_177963		0	6	7	0	782	768	0		1			0	0	122	0	0	0.963202	0	0	0	0	0	0	6	782
ARAP1	116985	broad.mit.edu	37	11	72404390	72404390	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:72404390G>A	ENST00000393609.3	-	29	4136	c.3934C>T	c.(3934-3936)Cgg>Tgg	p.R1312W	ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000393605.3_Missense_Mutation_p.R1072W|ARAP1_ENST00000429686.1_Missense_Mutation_p.R1006W|ARAP1_ENST00000359373.5_Missense_Mutation_p.R1312W|ARAP1_ENST00000426523.1_Missense_Mutation_p.R1067W|ARAP1_ENST00000334211.8_Missense_Mutation_p.R1067W|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.R1312W	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1312	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TTGTAGAGCCGCAAGCAGCTG	0.612																																					Ovarian(102;1198 1520 13195 17913 37529)	ENST00000393609.3	0.150000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.082601	0.060000	0.060000																										0				27						c.(3934-3936)Cgg>Tgg		ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1							66.0	68.0	67.0					11																	72404390		2200	4293	6493	SO:0001583	missense	116985	2	121412	34				g.chr11:72404390G>A	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3934C>T	chr11.hg19:g.72404390G>A	ENSP00000377233:p.Arg1312Trp	0					ARAP1_ENST00000429686.1_Missense_Mutation_p.R1006W|ARAP1_ENST00000426523.1_Missense_Mutation_p.R1067W|ARAP1_ENST00000334211.8_Missense_Mutation_p.R1067W|ARAP1_ENST00000393605.3_Missense_Mutation_p.R1072W|ARAP1_ENST00000455638.2_Missense_Mutation_p.R1312W|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000359373.5_Missense_Mutation_p.R1312W|ARAP1-AS1_ENST00000542022.1_RNA	p.R1312W	NM_001040118.2	NP_001035207.1	1	2	3	2.043829	Q96P48	ARAP1_HUMAN		29	4136	-			A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	0	1	hg19	c.3934C>T	CCDS41687.1	0	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234264	0.58886	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000542596	T;T;T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.74	2.51	0.30379	5.74	2.51	0.30379	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.120365	0.53938	D	0.000046	T	0.77545	0.4146	L	0.38175	1.15	0.42463	D	0.99279	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.985;1.0;0.994;0.978;0.975	T	0.77175	-0.2684	10	0.66056	D	0.02	.	9.5284	0.39178	0.0765:0.0:0.6605:0.263	.	1067;1006;1312;1312;1072	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	W	1312;1312;1072;1067;1312;1067;1006;116	ENSP00000352332:R1312W;ENSP00000390461:R1312W;ENSP00000377230:R1072W;ENSP00000335506:R1067W;ENSP00000377233:R1312W;ENSP00000392264:R1067W;ENSP00000403127:R1006W;ENSP00000441741:R116W	ENSP00000335506:R1067W	R	-	1	2	2	ARAP1	72082038	72082038	0.998000	0.40836	1.000000	0.80357	0.524000	0.34500	2.315000	0.43752	0.761000	0.33130	-0.266000	0.10368	CGG	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.612	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.920000	-2.456572	0	0.370000	NM_001040118		0	5	5	0	434	426	0		1	0		0	0	80	0	0	0.934813	4.552617e-01	0	0	0	118	0	5	434
CREBZF	58487	broad.mit.edu	37	11	85375165	85375165	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:85375165T>C	ENST00000527447.1	-	1	981	c.755A>G	c.(754-756)gAg>gGg	p.E252G	CREBZF_ENST00000398294.2_Missense_Mutation_p.E170G|CREBZF_ENST00000531515.1_Intron|CREBZF_ENST00000534224.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	252	Leucine-zipper. {ECO:0000250}.|bZIP.				negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				TTTGCCCAGCTCCCGATTCTC	0.622											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(172;674 2044 9050 18334 41735)	ENST00000527447.1	1.000000	8.700000e-01	1.000000	9.300000e-01	0.980000	0.974062	0.980000	1.000000																										0				9						c.(754-756)gAg>gGg		CREB/ATF bZIP transcription factor							106.0	120.0	116.0					11																	85375165		2119	4236	6355	SO:0001583	missense	58487	0	0					g.chr11:85375165T>C	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.755A>G	chr11.hg19:g.85375165T>C	ENSP00000433459:p.Glu252Gly	0		OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1236	CREBZF_ENST00000398294.2_Missense_Mutation_p.E170G|CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000531515.1_Intron	p.E252G	NM_001039618.2	NP_001034707.1	1	2	3	2.043829	Q9NS37	ZHANG_HUMAN		1	981	-		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)	B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	ENST00000527447.1	1	1	hg19	c.755A>G	CCDS41697.1	1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.226321	0.39300	.	.	ENSG00000137504	ENST00000398294;ENST00000527447	T;T	0.56611	0.45;0.45	4.89	4.89	0.63831	4.89	4.89	0.63831	Basic-leucine zipper (bZIP) transcription factor (1);bZIP transcription factor, bZIP-1 (1);	0.096735	0.41938	D	0.000795	T	0.37128	0.0992	L	0.34521	1.04	0.34338	D	0.688429	B	0.24651	0.108	B	0.22386	0.039	T	0.45659	-0.9246	9	.	.	.	-7.8605	7.6471	0.28327	0.0:0.1284:0.0:0.8716	.	252	Q9NS37	ZHANG_HUMAN	G	170;252	ENSP00000381342:E170G;ENSP00000433459:E252G	.	E	-	2	0	0	CREBZF	85052813	85052813	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.330000	0.52068	2.058000	0.61347	0.533000	0.62120	GAG	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.622	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2	1	0	1	2	2	2	2	0	0	0	0	161	161	161	160	1	1.920000	-20.000000	1	0.370000	NM_001039618		0	245	243	0	1094	1086	1		1	1		0	0	161	0	0	1.000000	5.713735e-01	0	2	0	8	0	245	1094
USP2	9099	broad.mit.edu	37	11	119230302	119230302	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr11:119230302C>A	ENST00000260187.2	-	4	1188	c.894G>T	c.(892-894)agG>agT	p.R298S	USP2_ENST00000455332.2_Missense_Mutation_p.R55S|USP2_ENST00000525735.1_Missense_Mutation_p.R89S	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	298	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		GCATGTAGAGCCTCTGGAGGC	0.582																																						ENST00000260187.2	0.240000	2.000000e-02	0.160000	5.000000e-02	0.100000	0.120459	0.100000	0.090000																										0				24						c.(892-894)agG>agT		ubiquitin specific peptidase 2							99.0	84.0	89.0					11																	119230302		2199	4295	6494	SO:0001583	missense	9099	0	0					g.chr11:119230302C>A	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.894G>T	chr11.hg19:g.119230302C>A	ENSP00000260187:p.Arg298Ser	0					USP2_ENST00000455332.2_Missense_Mutation_p.R55S|USP2_ENST00000525735.1_Missense_Mutation_p.R89S	p.R298S	NM_004205.4	NP_004196.4	1	2	3	2.043829	O75604	UBP2_HUMAN		4	1188	-		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	ENST00000260187.2	0	1	hg19	c.894G>T	CCDS8422.1	0	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811636	0.32053	.	.	ENSG00000036672	ENST00000455332;ENST00000260187;ENST00000392808;ENST00000525735	T;T;T	0.29655	1.56;1.56;1.56	5.28	2.31	0.28768	5.28	2.31	0.28768	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.196121	0.52532	D	0.000067	T	0.17109	0.0411	N	0.25201	0.72	0.27590	N	0.949293	B;B;B	0.26483	0.15;0.048;0.0	B;B;B	0.28991	0.097;0.057;0.004	T	0.12760	-1.0535	10	0.34782	T	0.22	-7.6172	3.7498	0.08562	0.1619:0.4776:0.0:0.3605	.	55;298;89	E9PPM2;O75604;O75604-4	.;UBP2_HUMAN;.	S	55;298;45;89	ENSP00000407842:R55S;ENSP00000260187:R298S;ENSP00000436952:R89S	ENSP00000260187:R298S	R	-	3	2	2	USP2	118735512	118735512	0.993000	0.37304	0.995000	0.50966	0.905000	0.53344	1.262000	0.32992	0.339000	0.23719	-0.345000	0.07892	AGG	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.582	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	0	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	1.920000	-5.459253	1	0.370000	NM_171997		0	4	4	0	235	233	0		1			0	0	36	0	0	0.889142	0	0	0	0	0	0	4	235
DDX47	51202	broad.mit.edu	37	12	12980302	12980302	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:12980302C>T	ENST00000358007.3	+	11	1251	c.1229C>T	c.(1228-1230)gCc>gTc	p.A410V	DDX47_ENST00000352940.4_Missense_Mutation_p.A361V	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	410					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		CAAAGGTTTGCCCGAATGGTA	0.428																																						ENST00000358007.3	0.070000	0	0.060000	1.000000e-02	0.030000	0.039324	0.030000	0.040000																										0				16						c.(1228-1230)gCc>gTc		DEAD (Asp-Glu-Ala-Asp) box polypeptide 47							223.0	220.0	221.0					12																	12980302		2203	4300	6503	SO:0001583	missense	51202	0	0					g.chr12:12980302C>T	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.1229C>T	chr12.hg19:g.12980302C>T	ENSP00000350698:p.Ala410Val	0					DDX47_ENST00000352940.4_Missense_Mutation_p.A361V	p.A410V	NM_016355.3	NP_057439.2	0	0	0	2.015189	Q9H0S4	DDX47_HUMAN		11	1251	+		Prostate(47;0.0526)	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	0	1	hg19	c.1229C>T	CCDS8655.1	0	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628472	0.67015	.	.	ENSG00000213782	ENST00000352940;ENST00000358007	T;T	0.28454	2.38;1.61	5.75	4.86	0.63082	5.75	4.86	0.63082	.	0.055390	0.64402	D	0.000001	T	0.43299	0.1241	M	0.66378	2.025	0.80722	D	1	B;B	0.25850	0.115;0.136	B;B	0.41236	0.351;0.164	T	0.34378	-0.9831	10	0.35671	T	0.21	-11.3685	14.979	0.71299	0.0:0.9316:0.0:0.0684	.	361;410	G5E955;Q9H0S4	.;DDX47_HUMAN	V	361;410	ENSP00000319578:A361V;ENSP00000350698:A410V	ENSP00000319578:A361V	A	+	2	0	0	DDX47	12871569	12871569	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.531000	0.81973	1.435000	0.47434	0.655000	0.94253	GCC	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.428	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	0	0	1	2	2	2	2	0	0	0	0	167	167	167	167	1	1.920000	-2.068352	0	0.370000	NM_016355		0	6	6	0	938	927	0		1	0		0	0	167	0	0	0.963723	3.881578e-01	0	1	0	185	0	6	938
CUX2	23316	broad.mit.edu	37	12	111758041	111758041	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:111758041C>A	ENST00000261726.6	+	17	2382	c.2228C>A	c.(2227-2229)gCc>gAc	p.A743D		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	743					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GGGGCCCCGGCCTTGGTGAAG	0.756																																						ENST00000261726.6	1.000000	5.000000e-01	1.000000	6.700000e-01	0.880000	0.854981	0.880000	1.000000																										0				55						c.(2227-2229)gCc>gAc		cut-like homeobox 2							4.0	6.0	6.0					12																	111758041		1429	3326	4755	SO:0001583	missense	23316	0	0					g.chr12:111758041C>A	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2228C>A	chr12.hg19:g.111758041C>A	ENSP00000261726:p.Ala743Asp	0						p.A743D	NM_015267.3	NP_056082.2	0	0	0	1.996170	O14529	CUX2_HUMAN		17	2382	+			A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	0	1	hg19	c.2228C>A	CCDS41837.1	1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316955	0.23908	.	.	ENSG00000111249	ENST00000261726	T	0.49432	0.78	4.22	4.22	0.49857	4.22	4.22	0.49857	.	0.488256	0.23708	N	0.045351	T	0.34308	0.0893	L	0.36672	1.1	0.25926	N	0.983054	B	0.20052	0.041	B	0.16289	0.015	T	0.21109	-1.0255	10	0.52906	T	0.07	-3.2681	6.6322	0.22863	0.1789:0.7291:0.0:0.092	.	743	O14529	CUX2_HUMAN	D	743	ENSP00000261726:A743D	ENSP00000261726:A743D	A	+	2	0	0	CUX2	110242424	110242424	0.985000	0.35326	0.297000	0.24988	0.186000	0.23388	3.416000	0.52707	1.909000	0.55274	0.485000	0.47835	GCC	0.358125		TCGA-HV-A7OL-01A-11D-A33T-08	0.756	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	1	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.920000	-20.000000	1	0.370000	NM_015267		0	12	11	0	60	59	0		1			0	0	8	0	0	0.999279	0	0	0	0	0	0	12	60
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.000000e-01	1.000000	9.900000e-01	0.990000	0.994640	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.015189	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.920000	-19.927250	1	0.370000	NM_033360		1593	27	27	6419	84	84	1	1	1	1	1	0	0	15	482	1	1.000000	6.841510e-01	1	4	90	5	515	27	84
PFKM	5213	broad.mit.edu	37	12	48536575	48536575	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:48536575G>A	ENST00000312352.7	+	18	1703	c.1664G>A	c.(1663-1665)cGc>cAc	p.R555H	PFKM_ENST00000551804.1_Missense_Mutation_p.R524H|PFKM_ENST00000547587.1_Missense_Mutation_p.R555H|PFKM_ENST00000395233.2_Missense_Mutation_p.R524H|PFKM_ENST00000340802.6_Missense_Mutation_p.R626H|PFKM_ENST00000359794.5_Missense_Mutation_p.R555H	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	555	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						ACCTGTGACCGCATCAAGCAG	0.488																																						ENST00000312352.7	0.120000	2.000000e-02	0.090000	3.000000e-02	0.060000	0.068618	0.060000	0.060000																										0				35						c.(1663-1665)cGc>cAc		phosphofructokinase, muscle							130.0	117.0	121.0					12																	48536575		2203	4300	6503	SO:0001583	missense	5213	5	121412	39				g.chr12:48536575G>A	M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.1664G>A	chr12.hg19:g.48536575G>A	ENSP00000309438:p.Arg555His	0					PFKM_ENST00000340802.6_Missense_Mutation_p.R626H|PFKM_ENST00000359794.5_Missense_Mutation_p.R555H|PFKM_ENST00000547587.1_Missense_Mutation_p.R555H|PFKM_ENST00000395233.2_Missense_Mutation_p.R524H|PFKM_ENST00000551804.1_Missense_Mutation_p.R524H	p.R555H	NM_001166687.1	NP_001160159.1	0	0	0	2.015189	P08237	PFKAM_HUMAN		18	1703	+			J3KNX3|Q16814|Q16815|Q6ZTT1	Missense_Mutation	SNP	ENST00000312352.7	0	1	hg19	c.1664G>A	CCDS8760.1	0	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795504	0.90453	.	.	ENSG00000152556	ENST00000340802;ENST00000359794;ENST00000395233;ENST00000551804;ENST00000547587;ENST00000312352;ENST00000546465	T;T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	5.21	4.31	0.51392	5.21	4.31	0.51392	Phosphofructokinase domain (2);	0.049858	0.85682	D	0.000000	D	0.91462	0.7305	M	0.92219	3.285	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72982	0.979;0.953;0.933	D	0.93406	0.6764	10	0.62326	D	0.03	-12.3227	15.1275	0.72494	0.0:0.0:0.8573:0.1427	.	524;555;626	P08237-2;P08237;Q6ZTT1	.;K6PF_HUMAN;.	H	626;555;524;524;555;555;170	ENSP00000345771:R626H;ENSP00000352842:R555H;ENSP00000378656:R524H;ENSP00000448177:R524H;ENSP00000449426:R555H;ENSP00000309438:R555H;ENSP00000446519:R170H	ENSP00000309438:R555H	R	+	2	0	0	PFKM	46822842	46822842	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.758000	0.85224	1.541000	0.49316	0.655000	0.94253	CGC	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.488	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1	0	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.920000	-1.868052	0	0.370000	NM_000289		0	7	7	0	615	611	0		1	0		0	0	87	0	0	0.980241	1.304132e-01	0	0	0	48	0	7	615
CCNT1	904	broad.mit.edu	37	12	49087735	49087735	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:49087735G>A	ENST00000261900.3	-	9	1484	c.1262C>T	c.(1261-1263)gCt>gTt	p.A421V		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	421					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						ATTCTGGGCAGCATATGCATA	0.463																																						ENST00000261900.3	0.090000	0	0.060000	2.000000e-02	0.030000	0.046258	0.030000	0.040000																										0				27						c.(1261-1263)gCt>gTt		cyclin T1							138.0	144.0	142.0					12																	49087735		2203	4300	6503	SO:0001583	missense	904	0	0					g.chr12:49087735G>A	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1262C>T	chr12.hg19:g.49087735G>A	ENSP00000261900:p.Ala421Val	0						p.A421V	NM_001240.3	NP_001231.2	0	0	0	2.015189	O60563	CCNT1_HUMAN		9	1484	-			A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	0	1	hg19	c.1262C>T	CCDS8766.1	0	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619480	0.66787	.	.	ENSG00000129315	ENST00000261900	T	0.20598	2.06	5.28	5.28	0.74379	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	L	0.49126	1.545	0.58432	D	0.999998	P	0.41929	0.765	B	0.37198	0.243	T	0.03112	-1.1071	10	0.62326	D	0.03	-14.5086	18.0305	0.89282	0.0:0.0:1.0:0.0	.	421	O60563	CCNT1_HUMAN	V	421	ENSP00000261900:A421V	ENSP00000261900:A421V	A	-	2	0	0	CCNT1	47374002	47374002	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.377000	0.73145	2.634000	0.89283	0.561000	0.74099	GCT	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.463	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	0	0	1	2	2	2	2	0	0	0	0	130	130	130	129	1	1.920000	-2.545472	1	0.370000	NM_001240		0	6	6	0	801	797	0		1			0	0	130	0	0	0.964503	0	0	0	0	0	0	6	801
OSBPL8	114882	broad.mit.edu	37	12	76791663	76791663	+	Silent	SNP	T	T	C	rs35436760	byFrequency	TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:76791663T>C	ENST00000261183.3	-	8	962	c.483A>G	c.(481-483)ctA>ctG	p.L161L	OSBPL8_ENST00000393249.2_Silent_p.L119L|OSBPL8_ENST00000393250.4_Silent_p.L119L	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	161	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						TCCAGCTCTTTAGAGTACCAC	0.363													T|||	13	0.00259585	0.0076	0.0	5008	,	,		17987	0.0		0.002	False		,,,				2504	0.001					ENST00000261183.3	1.000000	8.400000e-01	1.000000	9.500000e-01	0.990000	0.983462	0.990000	1.000000																										0				28						c.(481-483)ctA>ctG		oxysterol binding protein-like 8		T	,	32,4374	36.8+/-68.6	0,32,2171	78.0	71.0	73.0		357,483	-4.0	0.9	12	dbSNP_126	73	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous	OSBPL8	NM_001003712.1,NM_020841.4	,	0,36,6467	CC,CT,TT		0.0465,0.7263,0.2768	,	119/848,161/890	76791663	36,12970	2203	4300	6503	SO:0001819	synonymous_variant	114882	122	121412	52				g.chr12:76791663T>C	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.483A>G	chr12.hg19:g.76791663T>C		0					OSBPL8_ENST00000393249.2_Silent_p.L119L|OSBPL8_ENST00000393250.4_Silent_p.L119L	p.L161L	NM_020841.4	NP_065892.1	0	0	0	1.996170	Q9BZF1	OSBL8_HUMAN		8	962	-			A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Silent	SNP	ENST00000261183.3	1	1	hg19	c.483A>G	CCDS31862.1	1																																																																																								0.358125		TCGA-HV-A7OL-01A-11D-A33T-08	0.363	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	1	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.920000	-2.963092	1	0.370000	NM_020841		0	58	58	0	225	223	1		1			0	0	43	0	0	1.000000	0	0	0	0	0	0	58	225
ANKS1B	56899	broad.mit.edu	37	12	99640630	99640630	+	Missense_Mutation	SNP	C	C	T	rs375089730		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:99640630C>T	ENST00000547776.2	-	13	1768	c.1769G>A	c.(1768-1770)cGa>cAa	p.R590Q	ANKS1B_ENST00000550833.1_5'UTR|ANKS1B_ENST00000547010.1_Missense_Mutation_p.R170Q|ANKS1B_ENST00000329257.7_Missense_Mutation_p.R590Q	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	590						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GTCATCCTGTCGGGAGAGGTC	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		18588	0.0		0.001	False		,,,				2504	0.0					ENST00000547776.2	1.000000	8.500000e-01	1.000000	9.200000e-01	0.990000	0.970987	0.990000	1.000000																										0				70						c.(1768-1770)cGa>cAa		ankyrin repeat and sterile alpha motif domain containing 1B		C	GLN/ARG	0,3774		0,0,1887	124.0	119.0	120.0		1769	3.3	1.0	12		120	1,8193		0,1,4096	no	missense	ANKS1B	NM_152788.4	43	0,1,5983	TT,TC,CC		0.0122,0.0,0.0084	benign	590/1249	99640630	1,11967	1887	4097	5984	SO:0001583	missense	56899	24	120690	48				g.chr12:99640630C>T	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1769G>A	chr12.hg19:g.99640630C>T	ENSP00000449629:p.Arg590Gln	0					ANKS1B_ENST00000329257.7_Missense_Mutation_p.R590Q|ANKS1B_ENST00000550833.1_5'UTR|ANKS1B_ENST00000547010.1_Missense_Mutation_p.R170Q	p.R590Q	NM_152788.4	NP_690001.3	0	0	0	1.996170	Q7Z6G8	ANS1B_HUMAN		13	1768	-		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	1	1	hg19	c.1769G>A	CCDS55872.1	1	.	.	.	.	.	.	.	.	.	.	C	0.986	-0.695588	0.03279	0.0	1.22E-4	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.58358	1.15;0.34;1.16;1.06	5.76	3.26	0.37387	5.76	3.26	0.37387	.	0.838349	0.10666	N	0.648107	T	0.23289	0.0563	N	0.02539	-0.55	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.11966	-1.0566	9	.	.	.	-5.1323	5.7192	0.17978	0.1489:0.0808:0.0:0.7703	.	556;170;590	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	Q	590;170;590;169;556	ENSP00000449629:R590Q;ENSP00000448512:R170Q;ENSP00000331381:R590Q;ENSP00000449894:R556Q	.	R	-	2	0	0	ANKS1B	98164761	98164761	0.847000	0.29606	0.995000	0.50966	0.026000	0.11368	0.765000	0.26546	1.124000	0.41980	-0.238000	0.12139	CGA	0.358125		TCGA-HV-A7OL-01A-11D-A33T-08	0.468	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	1	0	1	2	2	2	2	0	0	0	0	114	114	114	114	1	1.920000	-3.319627	1	0.370000	NM_020140		0	157	156	0	678	673	1		1			0	0	114	0	0	1.000000	0	0	0	0	0	0	157	678
GPR133	283383	broad.mit.edu	37	12	131487822	131487822	+	Silent	SNP	C	C	T	rs549833008		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr12:131487822C>T	ENST00000261654.5	+	10	1678	c.1119C>T	c.(1117-1119)acC>acT	p.T373T	GPR133_ENST00000376682.4_Silent_p.T59T|GPR133_ENST00000535015.1_Silent_p.T405T	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	373					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCCAGGTCACCGTGGAGGGCT	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		19774	0.0		0.001	False		,,,				2504	0.0					ENST00000261654.5	1.000000	9.000000e-01	1.000000	9.900000e-01	0.990000	0.992881	0.990000	1.000000																										0				67						c.(1117-1119)acC>acT		G protein-coupled receptor 133							91.0	76.0	81.0					12																	131487822		2203	4300	6503	SO:0001819	synonymous_variant	283383	1	121412	41				g.chr12:131487822C>T	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1119C>T	chr12.hg19:g.131487822C>T		0					GPR133_ENST00000535015.1_Silent_p.T405T|GPR133_ENST00000376682.4_Silent_p.T59T	p.T373T	NM_198827.3	NP_942122.2	0	0	0	1.996170	Q6QNK2	GP133_HUMAN		10	1678	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	1	1	hg19	c.1119C>T	CCDS9272.1	1																																																																																								0.358125		TCGA-HV-A7OL-01A-11D-A33T-08	0.612	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	1	0	1	2	2	2	2	0	0	0	0	84	84	84	83	1	1.920000	-3.239418	1	0.370000	NM_198827		0	94	92	0	358	354	1		1			0	0	84	0	0	1.000000	0	0	0	0	0	0	94	358
IRS2	8660	broad.mit.edu	37	13	110434482	110434482	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr13:110434482C>T	ENST00000375856.3	-	1	4433	c.3919G>A	c.(3919-3921)Ggg>Agg	p.G1307R		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1307					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			CCCGGCCCCCCGCACCCGCCG	0.692																																					Melanoma(100;613 2409 40847)	ENST00000375856.3	1.000000	6.800000e-01	1.000000	8.300000e-01	0.990000	0.939419	0.990000	1.000000																										0				19						c.(3919-3921)Ggg>Agg		insulin receptor substrate 2							7.0	11.0	10.0					13																	110434482		2019	4064	6083	SO:0001583	missense	8660	0	0					g.chr13:110434482C>T	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3919G>A	chr13.hg19:g.110434482C>T	ENSP00000365016:p.Gly1307Arg	0						p.G1307R	NM_003749.2	NP_003740.2	1	2	3	2.033455	Q9Y4H2	IRS2_HUMAN	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)	1	4433	-	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	0	1	hg19	c.3919G>A	CCDS9510.1	1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464796	0.26335	.	.	ENSG00000185950	ENST00000375856	T	0.59906	0.23	4.12	3.25	0.37280	4.12	3.25	0.37280	.	0.226724	0.22451	U	0.059897	T	0.35128	0.0921	N	0.24115	0.695	0.09310	N	0.999996	P	0.42961	0.795	B	0.28709	0.093	T	0.19257	-1.0311	10	0.51188	T	0.08	-15.5233	10.7615	0.46268	0.1915:0.8085:0.0:0.0	.	1307	Q9Y4H2	IRS2_HUMAN	R	1307	ENSP00000365016:G1307R	ENSP00000365016:G1307R	G	-	1	0	0	IRS2	109232483	109232483	0.998000	0.40836	0.189000	0.23252	0.049000	0.14656	1.090000	0.30902	0.910000	0.36722	0.462000	0.41574	GGG	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.692	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.920000	-3.527049	1	0.370000	NM_003749		0	25	24	0	109	105	0		1			0	0	10	0	0	1.000000	0	0	0	0	0	0	25	109
YLPM1	56252	broad.mit.edu	37	14	75230759	75230759	+	Silent	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr14:75230759G>A	ENST00000552421.1	+	1	691	c.567G>A	c.(565-567)ccG>ccA	p.P189P	YLPM1_ENST00000325680.7_Silent_p.P189P|YLPM1_ENST00000238571.3_Silent_p.P189P			P49750	YLPM1_HUMAN	YLP motif containing 1	189	Pro-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CTGCTCAGCCGTCCCCTTCGC	0.597																																						ENST00000552421.1	0.130000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.067752	0.050000	0.060000																										0				62						c.(565-567)ccG>ccA		YLP motif containing 1							69.0	77.0	74.0					14																	75230759		2073	4196	6269	SO:0001819	synonymous_variant	56252	0	0					g.chr14:75230759G>A	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.567G>A	chr14.hg19:g.75230759G>A		0					YLPM1_ENST00000238571.3_Silent_p.P189P|YLPM1_ENST00000325680.7_Silent_p.P189P	p.P189P			0	1	1	2.024830	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	1	691	+			P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000552421.1	0	1	hg19	c.567G>A		0																																																																																								0.368832		TCGA-HV-A7OL-01A-11D-A33T-08	0.597	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	0	0	1	2	2	2	2	0	0	0	0	51	51	51	50	1	1.920000	-2.767071	1	0.370000	NM_019589		0	5	5	0	469	456	0		1			0	0	51	0	0	0.933172	0	0	0	0	0	0	5	469
STON2	85439	broad.mit.edu	37	14	81743580	81743580	+	Missense_Mutation	SNP	G	G	A	rs201379766		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr14:81743580G>A	ENST00000267540.2	-	4	2275	c.2075C>T	c.(2074-2076)aCg>aTg	p.T692M	STON2_ENST00000555447.1_Missense_Mutation_p.T692M|STON2_ENST00000556280.1_5'Flank	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	692	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		ACTTGTGGCCGTCCTGAGTGT	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		20808	0.0		0.0	False		,,,				2504	0.001					ENST00000267540.2	0.090000	0	0.070000	2.000000e-02	0.040000	0.052183	0.040000	0.040000																										0				34						c.(2074-2076)aCg>aTg		stonin 2		G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	116.0	114.0	115.0		2075	6.1	1.0	14		115	0,8600		0,0,4300	yes	missense	STON2	NM_033104.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	692/906	81743580	1,13005	2203	4300	6503	SO:0001583	missense	85439	9	121412	44				g.chr14:81743580G>A	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2075C>T	chr14.hg19:g.81743580G>A	ENSP00000267540:p.Thr692Met	0					STON2_ENST00000555447.1_Missense_Mutation_p.T692M|STON2_ENST00000556280.1_5'Flank	p.T692M	NM_033104.3	NP_149095.2	0	1	1	2.024830	Q8WXE9	STON2_HUMAN		4	2275	-			G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	0	1	hg19	c.2075C>T	CCDS9875.1	0	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572943	0.45798	2.27E-4	0.0	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.19105	2.17;2.17	6.06	6.06	0.98353	6.06	6.06	0.98353	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.45054	0.1323	M	0.65498	2.005	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.27054	-1.0085	10	0.87932	D	0	-17.0297	14.7345	0.69406	0.0685:0.0:0.9315:0.0	.	692;692	Q8WXE9;G3V2T7	STON2_HUMAN;.	M	692;704;692	ENSP00000450857:T692M;ENSP00000267540:T692M	ENSP00000267540:T692M	T	-	2	0	0	STON2	80813333	80813333	1.000000	0.71417	0.972000	0.41901	0.371000	0.29859	8.029000	0.88807	2.879000	0.98667	0.650000	0.86243	ACG	0.368832		TCGA-HV-A7OL-01A-11D-A33T-08	0.557	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	1.920000	-2.333984	0	0.370000	NM_033104		0	6	6	0	714	705	0		1	0		0	0	115	0	0	0.963681	1.072785e-04	0	0	0	2	0	6	714
LGMN	5641	broad.mit.edu	37	14	93199026	93199026	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr14:93199026C>T	ENST00000393218.2	-	3	443	c.106G>A	c.(106-108)Ggt>Agt	p.G36S	LGMN_ENST00000334869.4_Missense_Mutation_p.G36S|LGMN_ENST00000557434.1_Missense_Mutation_p.G36S|LGMN_ENST00000555699.1_Missense_Mutation_p.G36S	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	36					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		CCATTTGAACCTGCCACGATC	0.443																																						ENST00000393218.2	0.080000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.048678	0.040000	0.040000																										0				18						c.(106-108)Ggt>Agt		legumain							163.0	152.0	156.0					14																	93199026		2203	4300	6503	SO:0001583	missense	5641	0	0					g.chr14:93199026C>T	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.106G>A	chr14.hg19:g.93199026C>T	ENSP00000376911:p.Gly36Ser	0					LGMN_ENST00000557434.1_Missense_Mutation_p.G36S|LGMN_ENST00000555699.1_Missense_Mutation_p.G36S|LGMN_ENST00000334869.4_Missense_Mutation_p.G36S	p.G36S	NM_001008530.2	NP_001008530.1	0	1	1	2.024830	Q99538	LGMN_HUMAN		3	443	-		all_cancers(154;0.0706)	O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	ENST00000393218.2	0	1	hg19	c.106G>A	CCDS9904.1	0	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832172	0.71258	.	.	ENSG00000100600	ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000539531;ENST00000535855;ENST00000553802;ENST00000554397;ENST00000554919;ENST00000554080;ENST00000553371	T;T;T;T;T;T;T;T;T	0.72942	0.48;0.4;0.52;0.4;0.51;0.38;0.38;-0.34;-0.7	4.56	4.56	0.56223	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.87059	0.6083	M	0.90922	3.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.996	D	0.90096	0.4181	10	0.62326	D	0.03	-23.6576	16.0812	0.81005	0.0:1.0:0.0:0.0	.	36;36;36	Q99538;Q86TV2;Q86TV3	LGMN_HUMAN;.;.	S	36;36;36;36;36;36;13;36;36;36;36;36;36	ENSP00000451861:G36S;ENSP00000334052:G36S;ENSP00000452572:G36S;ENSP00000376911:G36S;ENSP00000450854:G36S;ENSP00000450677:G36S;ENSP00000451916:G36S;ENSP00000452268:G36S;ENSP00000451797:G36S	ENSP00000262004:G36S	G	-	1	0	0	LGMN	92268779	92268779	1.000000	0.71417	0.146000	0.22360	0.387000	0.30353	6.348000	0.73009	2.086000	0.62901	0.313000	0.20887	GGT	0.368832		TCGA-HV-A7OL-01A-11D-A33T-08	0.443	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	0	0	1	2	2	2	2	0	0	0	0	159	159	159	153	1	1.920000	-2.286640	0	0.370000	NM_005606		0	8	8	0	989	964	0		1	1		0	0	159	0	0	0.988211	1.661851e-01	0	2	0	78	0	8	989
GABRA5	2558	broad.mit.edu	37	15	27128316	27128316	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr15:27128316G>A	ENST00000335625.5	+	5	1100	c.212G>A	c.(211-213)cGc>cAc	p.R71H	GABRA5_ENST00000557449.1_Intron|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.R71H|GABRA5_ENST00000355395.5_Missense_Mutation_p.R71H	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	71					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CTTTCAGAGCGCATCACTCAG	0.612																																						ENST00000335625.5	1.000000	3.000000e-02	0.170000	6.000000e-02	0.100000	0.141932	0.100000	0.100000																										0				49						c.(211-213)cGc>cAc		gamma-aminobutyric acid (GABA) A receptor, alpha 5	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)						70.0	80.0	77.0					15																	27128316		2147	4228	6375	SO:0001583	missense	2558	4	121152	35				g.chr15:27128316G>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.212G>A	chr15.hg19:g.27128316G>A	ENSP00000335592:p.Arg71His	0					GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.R71H|GABRA5_ENST00000355395.5_Missense_Mutation_p.R71H|GABRA5_ENST00000557449.1_Intron	p.R71H	NM_000810.3	NP_000801.1	1	2	3	2.051060	P31644	GBRA5_HUMAN		5	1100	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	0	1	hg19	c.212G>A	CCDS45194.1	0	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426900	0.83667	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554038;ENST00000554596;ENST00000554599;ENST00000554083	T;T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.13;-1.26;-1.26;-1.26	5.39	4.47	0.54385	5.39	4.47	0.54385	Neurotransmitter-gated ion-channel ligand-binding (3);	0.318671	0.37857	N	0.001907	T	0.81054	0.4743	L	0.55481	1.735	0.36586	D	0.873815	D	0.58268	0.982	P	0.54372	0.75	D	0.86010	0.1500	10	0.72032	D	0.01	.	13.2492	0.60041	0.0765:0.0:0.9235:0.0	.	71	P31644	GBRA5_HUMAN	H	71;71;39;71;71;71;71;39	ENSP00000335592:R71H;ENSP00000347557:R71H;ENSP00000450653:R39H;ENSP00000382953:R71H;ENSP00000451527:R71H;ENSP00000450806:R71H;ENSP00000450717:R71H;ENSP00000450529:R39H	ENSP00000335592:R71H	R	+	2	0	0	GABRA5	24679409	24679409	0.996000	0.38824	0.989000	0.46669	0.806000	0.45545	3.505000	0.53356	1.405000	0.46838	0.555000	0.69702	CGC	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.612	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1	0	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.920000	-3.806431	1	0.370000			0	4	4	0	226	220	0		1			0	0	42	0	0	0.884829	0	0	0	0	0	0	4	226
RYR3	6263	broad.mit.edu	37	15	33954961	33954961	+	Missense_Mutation	SNP	C	C	T	rs371562140		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr15:33954961C>T	ENST00000389232.4	+	35	5300	c.5230C>T	c.(5230-5232)Cgg>Tgg	p.R1744W	RYR3_ENST00000415757.3_Missense_Mutation_p.R1744W	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1744	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.R1744R(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGATGATGTTCGGCAGATCCT	0.552																																						ENST00000389232.4	1.000000	6.900000e-01	0.990000	7.800000e-01	0.870000	0.880153	0.870000	1.000000																										1	Substitution - coding silent(1)	p.R1744R(1)	lung(1)	311						c.(5230-5232)Cgg>Tgg		ryanodine receptor 3		T	TRP/ARG	1,4261		0,1,2130	131.0	139.0	136.0		5230	3.5	0.9	15		136	0,8502		0,0,4251	no	missense	RYR3	NM_001036.3	101	0,1,6381	TT,TC,CC		0.0,0.0235,0.0078	probably-damaging	1744/4871	33954961	1,12763	2131	4251	6382	SO:0001583	missense	6263	3	121180	37				g.chr15:33954961C>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5230C>T	chr15.hg19:g.33954961C>T	ENSP00000373884:p.Arg1744Trp	0					RYR3_ENST00000415757.3_Missense_Mutation_p.R1744W	p.R1744W	NM_001036.3	NP_001027.3	1	2	3	2.051060	Q15413	RYR3_HUMAN		35	5300	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.5230C>T	CCDS45210.1	1	.	.	.	.	.	.	.	.	.	.	c	15.06	2.720660	0.48728	2.35E-4	0.0	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.74421	-0.84;-0.84	5.41	3.54	0.40534	5.41	3.54	0.40534	.	0.359807	0.23604	N	0.046403	T	0.74030	0.3663	L	0.38175	1.15	0.09310	N	0.999998	D;D	0.61697	0.988;0.99	P;P	0.57502	0.766;0.822	T	0.65030	-0.6267	10	0.87932	D	0	.	8.8635	0.35272	0.3151:0.6124:0.0:0.0724	.	1744;1744	Q15413-2;Q15413	.;RYR3_HUMAN	W	1744	ENSP00000373884:R1744W;ENSP00000399610:R1744W	ENSP00000354735:R1744W	R	+	1	2	2	RYR3	31742253	31742253	0.938000	0.31826	0.868000	0.34077	0.894000	0.52154	1.918000	0.40006	0.862000	0.35528	-0.119000	0.15052	CGG	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	70	1	1.920000	-3.154547	1	0.370000			0	64	64	0	333	329	1		1			0	0	71	0	0	1.000000	0	0	0	0	0	0	64	333
RYR3	6263	broad.mit.edu	37	15	34130099	34130099	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr15:34130099T>C	ENST00000389232.4	+	89	11988	c.11918T>C	c.(11917-11919)aTg>aCg	p.M3973T	RYR3_ENST00000415757.3_Missense_Mutation_p.M3968T	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3973					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGAATGACATGTTTAATTAC	0.428																																						ENST00000389232.4	1.000000	9.200000e-01	1.000000	9.900000e-01	0.990000	0.994102	0.990000	1.000000																										0				311						c.(11917-11919)aTg>aCg		ryanodine receptor 3							138.0	137.0	138.0					15																	34130099		1962	4145	6107	SO:0001583	missense	6263	0	0					g.chr15:34130099T>C		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11918T>C	chr15.hg19:g.34130099T>C	ENSP00000373884:p.Met3973Thr	0					RYR3_ENST00000415757.3_Missense_Mutation_p.M3968T	p.M3973T	NM_001036.3	NP_001027.3	1	2	3	2.051060	Q15413	RYR3_HUMAN		89	11988	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.11918T>C	CCDS45210.1	1	.	.	.	.	.	.	.	.	.	.	T	13.01	2.109599	0.37242	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.81739	-1.53	5.4	5.4	0.78164	5.4	5.4	0.78164	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.76011	0.3928	N	0.12831	0.26	0.53005	D	0.99996	P;B	0.52316	0.952;0.012	P;B	0.54499	0.754;0.014	T	0.76389	-0.2977	10	0.30854	T	0.27	.	15.5941	0.76566	0.0:0.0:0.0:1.0	.	3968;3973	Q15413-2;Q15413	.;RYR3_HUMAN	T	3973;3969	ENSP00000373884:M3973T	ENSP00000354735:M3969T	M	+	2	0	0	RYR3	31917391	31917391	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.871000	0.69628	2.272000	0.75746	0.450000	0.29827	ATG	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	98	1	1.920000	-20.000000	1	0.370000			0	142	142	0	573	570	1		1			0	0	99	0	0	1.000000	0	0	0	0	0	0	142	573
MYO9A	4649	broad.mit.edu	37	15	72338352	72338352	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr15:72338352C>T	ENST00000356056.5	-	2	1025	c.553G>A	c.(553-555)Gtt>Att	p.V185I	MYO9A_ENST00000566885.1_Intron|MYO9A_ENST00000424560.1_Missense_Mutation_p.V185I|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Missense_Mutation_p.V185I|RNU2-65P_ENST00000410162.1_RNA|MYO9A_ENST00000564571.1_Missense_Mutation_p.V185I	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	185	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGGTTAATAACTATTAGAATA	0.328																																						ENST00000356056.5	1.000000	8.600000e-01	1.000000	9.600000e-01	0.990000	0.984628	0.990000	1.000000																										0				88						c.(553-555)Gtt>Att		myosin IXA							64.0	68.0	67.0					15																	72338352		2199	4297	6496	SO:0001583	missense	4649	0	0					g.chr15:72338352C>T	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.553G>A	chr15.hg19:g.72338352C>T	ENSP00000348349:p.Val185Ile	0					MYO9A_ENST00000444904.1_Missense_Mutation_p.V185I|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000424560.1_Missense_Mutation_p.V185I|RNU2-65P_ENST00000410162.1_RNA|MYO9A_ENST00000564571.1_Missense_Mutation_p.V185I|MYO9A_ENST00000566885.1_Intron	p.V185I	NM_006901.3	NP_008832.2	1	2	3	2.051849	B2RTY4	MYO9A_HUMAN		2	1025	-			B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	1	1	hg19	c.553G>A	CCDS10239.1	1	.	.	.	.	.	.	.	.	.	.	c	19.42	3.825008	0.71143	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864;ENST00000446448	D;D;D	0.88201	-2.35;-2.35;-2.35	5.8	5.8	0.92144	5.8	5.8	0.92144	Myosin head, motor domain (3);	.	.	.	.	D	0.89037	0.6601	L	0.52573	1.65	0.50171	D	0.999851	P;B;B	0.35139	0.486;0.38;0.268	B;B;B	0.39339	0.268;0.197;0.297	D	0.88674	0.3197	9	0.87932	D	0	.	20.1223	0.97967	0.0:1.0:0.0:0.0	.	185;185;185	B2RTY4-3;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	I	185	ENSP00000348349:V185I;ENSP00000399162:V185I;ENSP00000398250:V185I	ENSP00000261864:V185I	V	-	1	0	0	MYO9A	70125406	70125406	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.017000	0.70805	2.749000	0.94314	0.650000	0.86243	GTT	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.328	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.920000	-20.000000	1	0.370000	NM_006901		0	81	81	0	333	331	1		1			0	0	53	0	0	1.000000	0	0	0	0	0	0	81	333
TBL3	10607	broad.mit.edu	37	16	2024605	2024605	+	Missense_Mutation	SNP	C	C	T	rs573127986		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr16:2024605C>T	ENST00000568546.1	+	5	432	c.304C>T	c.(304-306)Cgc>Tgc	p.R102C		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	102					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CAGCGTTACCCGCCTGTGGAA	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17432	0.0		0.0	False		,,,				2504	0.0				Melanoma(118;616 1651 35077 38081 48633)	ENST00000568546.1	1.000000	7.600000e-01	1.000000	8.700000e-01	0.990000	0.953371	0.990000	1.000000																										0				18						c.(304-306)Cgc>Tgc		transducin (beta)-like 3							30.0	33.0	32.0					16																	2024605		2198	4298	6496	SO:0001583	missense	10607	6	121382	35				g.chr16:2024605C>T	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.304C>T	chr16.hg19:g.2024605C>T	ENSP00000454836:p.Arg102Cys	0						p.R102C	NM_006453.2	NP_006444.2	0	0	0	2.019029	Q12788	TBL3_HUMAN		5	432	+			Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	1	1	hg19	c.304C>T	CCDS10453.1	1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674507	0.29693	.	.	ENSG00000183751	ENST00000332704	.	.	.	4.97	3.0	0.34707	4.97	3.0	0.34707	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.237542	0.39146	N	0.001458	T	0.53642	0.1809	M	0.86651	2.83	0.80722	D	1	P	0.42757	0.789	B	0.25614	0.062	T	0.60949	-0.7161	9	0.72032	D	0.01	-15.7473	10.7503	0.46205	0.0:0.8435:0.0:0.1565	.	102	Q12788	TBL3_HUMAN	C	102	.	ENSP00000331815:R102C	R	+	1	0	0	TBL3	1964606	1964606	0.998000	0.40836	0.556000	0.28293	0.678000	0.39670	3.772000	0.55325	0.505000	0.28104	-0.291000	0.09656	CGC	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.672	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	1	0	1	2	2	2	2	0	0	0	0	33	33	33	30	1	1.920000	-3.470092	1	0.370000	NM_006453		0	52	49	0	228	194	1		1	1		0	0	33	0	0	1.000000	9.859876e-01	0	9	0	23	0	52	228
DNAH3	55567	broad.mit.edu	37	16	20976524	20976524	+	Silent	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr16:20976524G>A	ENST00000261383.3	-	53	8681	c.8682C>T	c.(8680-8682)taC>taT	p.Y2894Y	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2894	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CCACGCGATCGTACACCTCCA	0.562																																						ENST00000261383.3	1.000000	8.300000e-01	1.000000	9.000000e-01	0.970000	0.959708	0.970000	1.000000																										0				202						c.(8680-8682)taC>taT		dynein, axonemal, heavy chain 3							118.0	108.0	111.0					16																	20976524		2201	4300	6501	SO:0001819	synonymous_variant	55567	0	0					g.chr16:20976524G>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8682C>T	chr16.hg19:g.20976524G>A		0					DNAH3_ENST00000415178.1_3'UTR	p.Y2894Y	NM_017539.1	NP_060009.1	0	0	0	2.010160	Q8TD57	DYH3_HUMAN		53	8681	-			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	1	1	hg19	c.8682C>T	CCDS10594.1	1																																																																																								0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.562	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	106	1	1.920000	-20.000000	1	0.370000	NM_017539		0	148	146	0	664	649	1		1			0	0	109	0	0	1.000000	0	0	0	0	0	0	148	664
WDR90	197335	broad.mit.edu	37	16	703653	703653	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr16:703653C>T	ENST00000293879.4	+	12	1362	c.1362C>T	c.(1360-1362)caC>caT	p.H454H	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Silent_p.H454H			Q96KV7	WDR90_HUMAN	WD repeat domain 90	454										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GCCCAATGCACGTTGTCTGCT	0.637																																						ENST00000293879.4	1.000000	9.100000e-01	1.000000	9.900000e-01	0.990000	0.994675	0.990000	1.000000																										0				37						c.(1360-1362)caC>caT		WD repeat domain 90							54.0	60.0	58.0					16																	703653		2069	4192	6261	SO:0001819	synonymous_variant	197335	1	120938	30				g.chr16:703653C>T	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1362C>T	chr16.hg19:g.703653C>T		0					WDR90_ENST00000549091.1_Silent_p.H454H|LA16c-349E10.1_ENST00000573609.1_RNA	p.H454H			0	0	0	2.019029	Q96KV7	WDR90_HUMAN		12	1362	+		Hepatocellular(780;0.0218)	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	ENST00000293879.4	1	1	hg19	c.1362C>T	CCDS42092.1	1																																																																																								0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.637	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.920000	-20.000000	1	0.370000	NM_145294		0	69	69	0	254	252	1		1			0	0	58	0	0	1.000000	0	0	0	0	0	0	69	254
CREBBP	1387	broad.mit.edu	37	16	3801767	3801767	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr16:3801767C>T	ENST00000262367.5	-	20	4548	c.3739G>A	c.(3739-3741)Gag>Aag	p.E1247K	CREBBP_ENST00000382070.3_Missense_Mutation_p.E1209K	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1247	Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTCACATTCTCGCCCTGGATC	0.502			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															ENST00000262367.5	1.000000	8.300000e-01	1.000000	9.500000e-01	0.990000	0.980776	0.990000	1.000000				Dom/Rec	yes			Dom/Rec	yes		16	16p13.3	16p13.3	1387	T, N, F, Mis, O	CREB binding protein (CBP)	yes	yes	Rubinstein-Taybi syndrome	L	L	MLL, MORF, RUNXBP2		ALL, AML, DLBCL, B-NHL 		0				295						c.(3739-3741)Gag>Aag		CREB binding protein							276.0	193.0	221.0					16																	3801767		2197	4300	6497	SO:0001583	missense	1387	0	0					g.chr16:3801767C>T	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3739G>A	chr16.hg19:g.3801767C>T	ENSP00000262367:p.Glu1247Lys	0					CREBBP_ENST00000382070.3_Missense_Mutation_p.E1209K	p.E1247K	NM_004380.2	NP_004371.2	0	0	0	2.019029	Q92793	CBP_HUMAN		20	4548	-		Ovarian(90;0.0266)	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	1	1	hg19	c.3739G>A	CCDS10509.1	1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303906	0.60305	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.83992	-1.79;-1.71	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.75539	0.3863	L	0.42487	1.325	0.53688	D	0.999978	P;P	0.44195	0.828;0.828	B;B	0.28991	0.097;0.097	T	0.78703	-0.2101	10	0.46703	T	0.11	-29.1663	19.3082	0.94173	0.0:1.0:0.0:0.0	.	1277;1247	Q4LE28;Q92793	.;CBP_HUMAN	K	1247;1277;1209	ENSP00000262367:E1247K;ENSP00000371502:E1209K	ENSP00000262367:E1247K	E	-	1	0	0	CREBBP	3741768	3741768	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.577000	0.67444	2.539000	0.85634	0.655000	0.94253	GAG	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.502	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	1	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.920000	-3.188316	1	0.370000	NM_004380		0	51	50	0	202	201	1		1	0		0	0	29	0	0	1.000000	4.221814e-02	0	0	0	2	0	51	202
ATP2A1	487	broad.mit.edu	37	16	28912189	28912189	+	Missense_Mutation	SNP	G	G	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr16:28912189G>C	ENST00000357084.3	+	15	2319	c.2052G>C	c.(2050-2052)aaG>aaC	p.K684N	ATP2A1_ENST00000395503.4_Missense_Mutation_p.K684N|ATP2A1_ENST00000536376.1_Missense_Mutation_p.K559N	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	684					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCTCGCACAAGTCCAAGATTG	0.627																																						ENST00000357084.3	0.130000	1.000000e-02	0.100000	3.000000e-02	0.050000	0.068062	0.050000	0.060000																										0				38						c.(2050-2052)aaG>aaC		ATPase, Ca++ transporting, cardiac muscle, fast twitch 1							76.0	69.0	71.0					16																	28912189		2197	4300	6497	SO:0001583	missense	487	0	0					g.chr16:28912189G>C		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2052G>C	chr16.hg19:g.28912189G>C	ENSP00000349595:p.Lys684Asn	0					ATP2A1_ENST00000395503.4_Missense_Mutation_p.K684N|ATP2A1_ENST00000536376.1_Missense_Mutation_p.K559N	p.K684N	NM_173201.3	NP_775293.1	0	0	0	2.010160	O14983	AT2A1_HUMAN		15	2319	+			A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	0	1	hg19	c.2052G>C	CCDS10643.1	0	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296086	0.81025	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.99769	-6.7;-6.7;-6.7	5.4	4.44	0.53790	5.4	4.44	0.53790	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99896	0.9950	H	0.99783	4.775	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96211	0.9153	10	0.87932	D	0	.	13.0151	0.58753	0.0797:0.0:0.9203:0.0	.	559;684;684	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	N	684;684;721;559	ENSP00000349595:K684N;ENSP00000378879:K684N;ENSP00000443101:K559N	ENSP00000349595:K684N	K	+	3	2	2	ATP2A1	28819690	28819690	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	4.048000	0.57390	1.278000	0.44430	0.555000	0.69702	AAG	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.627	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	0	0	0	2	2	2	2	0	0	0	0	72	72	72	71	1	1.920000	-4.617620	1	0.370000	NM_004320		0	4	0	0	386	385	0		0	0		0	0	72	0	0	0.887876	0	0	0	0	1	0	4	386
PRPF8	10594	broad.mit.edu	37	17	1576724	1576724	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr17:1576724C>T	ENST00000572621.1	-	22	3849	c.3584G>A	c.(3583-3585)cGc>cAc	p.R1195H	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1195H			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1195	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGGCAGGATGCGGCACTCGAA	0.572																																						ENST00000572621.1	0.150000	2.000000e-02	0.110000	4.000000e-02	0.070000	0.083256	0.070000	0.070000																										0				77						c.(3583-3585)cGc>cAc		pre-mRNA processing factor 8							141.0	111.0	121.0					17																	1576724		2203	4300	6503	SO:0001583	missense	10594	0	0					g.chr17:1576724C>T	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3584G>A	chr17.hg19:g.1576724C>T	ENSP00000460348:p.Arg1195His	1					PRPF8_ENST00000304992.6_Missense_Mutation_p.R1195H	p.R1195H			0	1	1	1.640026	Q6P2Q9	PRP8_HUMAN		22	3849	-			O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	0	1	hg19	c.3584G>A	CCDS11010.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.548538	0.96488	.	.	ENSG00000174231	ENST00000304992	D	0.84873	-1.91	6.06	6.06	0.98353	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.95290	0.8472	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95669	0.8722	10	0.87932	D	0	.	20.6244	0.99512	0.0:1.0:0.0:0.0	.	1195	Q6P2Q9	PRP8_HUMAN	H	1195	ENSP00000304350:R1195H	ENSP00000304350:R1195H	R	-	2	0	0	PRPF8	1523474	1523474	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.814000	0.86154	2.879000	0.98667	0.650000	0.86243	CGC	0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.572	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2	0	0	1	2	18	2	2	1	1	1	1	55	55	55	55	1	1.920000	-2.234427	0	0.370000			0	5	5	0	307	304	0		0	0		1	0	55	0	0	0.004233	0	0	0	0	1	0	5	307
GFAP	2670	broad.mit.edu	37	17	42990738	42990738	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr17:42990738C>T	ENST00000253408.5	-	4	744	c.679G>A	c.(679-681)Gcc>Acc	p.A227T	GFAP_ENST00000588735.1_Intron|GFAP_ENST00000586793.1_Missense_Mutation_p.A227T|GFAP_ENST00000591327.1_5'Flank|GFAP_ENST00000435360.2_Missense_Mutation_p.A227T	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	227	Linker 12.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				TCTGGCTTGGCCACGTCAAGC	0.607																																						ENST00000253408.5	0.150000	2.000000e-02	0.110000	4.000000e-02	0.060000	0.078184	0.060000	0.060000																										0				23						c.(679-681)Gcc>Acc		glial fibrillary acidic protein							92.0	72.0	79.0					17																	42990738		2203	4300	6503	SO:0001583	missense	2670	0	0					g.chr17:42990738C>T	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.679G>A	chr17.hg19:g.42990738C>T	ENSP00000253408:p.Ala227Thr	1					GFAP_ENST00000435360.2_Missense_Mutation_p.A227T|GFAP_ENST00000588735.1_Intron|GFAP_ENST00000591327.1_5'Flank|GFAP_ENST00000586793.1_Missense_Mutation_p.A227T	p.A227T	NM_002055.4	NP_002046.1	0	2	2	2.028987	P14136	GFAP_HUMAN		4	744	-		Prostate(33;0.0959)	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	ENST00000253408.5	0	1	hg19	c.679G>A	CCDS11491.1	0	.	.	.	.	.	.	.	.	.	.	C	6.948	0.544765	0.13312	.	.	ENSG00000131095	ENST00000253408;ENST00000421021;ENST00000435360	D;D	0.95853	-3.83;-3.83	4.93	2.92	0.33932	4.93	2.92	0.33932	Filament (1);	0.204172	0.43110	D	0.000602	D	0.88644	0.6492	N	0.17674	0.51	0.30072	N	0.809996	B;B	0.13594	0.008;0.001	B;B	0.16289	0.015;0.007	T	0.82680	-0.0337	10	0.66056	D	0.02	.	4.7956	0.13270	0.4228:0.4185:0.0:0.1588	.	227;227	E9PAX3;P14136	.;GFAP_HUMAN	T	227;202;227	ENSP00000253408:A227T;ENSP00000403962:A227T	ENSP00000253408:A227T	A	-	1	0	0	GFAP	40346264	40346264	0.009000	0.17119	0.653000	0.29593	0.053000	0.15095	0.375000	0.20518	0.788000	0.33755	-0.181000	0.13052	GCC	0.370000		TCGA-HV-A7OL-01A-11D-A33T-08	0.607	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	0	0	1	2	2	2	2	0	0	0	0	60	60	60	59	1	1.920000	-2.521184	1	0.370000	NM_002055		0	5	5	0	406	403	0		1			0	0	60	0	0	0.936695	0	0	0	0	0	0	5	406
TP53	7157	broad.mit.edu	37	17	7578538	7578538	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr17:7578538T>A	ENST00000269305.4	-	5	581	c.392A>T	c.(391-393)aAc>aTc	p.N131I	TP53_ENST00000445888.2_Missense_Mutation_p.N131I|TP53_ENST00000455263.2_Missense_Mutation_p.N131I|TP53_ENST00000420246.2_Missense_Mutation_p.N131I|TP53_ENST00000413465.2_Missense_Mutation_p.N131I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.N131I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	131	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		N -> D (in a sporadic cancer; somatic mutation).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in a sporadic cancer; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.N131del(8)|p.N131I(7)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.N131S(3)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.A129_N131delALN(1)|p.L130fs*16(1)|p.N131T(1)|p.N38I(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAACATCTTGTTGAGGGCAGG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.000000e-01	0.990000	8.800000e-01	0.950000	0.944132	0.950000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		47	Deletion - In frame(21)|Substitution - Missense(12)|Whole gene deletion(8)|Deletion - Frameshift(6)	p.0?(8)|p.N131del(8)|p.N131I(7)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.N131S(3)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.A129_N131delALN(1)|p.L130fs*16(1)|p.N131T(1)|p.N38I(1)	breast(8)|central_nervous_system(7)|upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|liver(4)|lung(3)|adrenal_gland(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|stomach(1)|biliary_tract(1)|pancreas(1)	24185						c.(391-393)aAc>aTc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						46.0	46.0	46.0					17																	7578538		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578538T>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.392A>T	chr17.hg19:g.7578538T>A	ENSP00000269305:p.Asn131Ile	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.N131I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.N131I|TP53_ENST00000420246.2_Missense_Mutation_p.N131I|TP53_ENST00000359597.4_Missense_Mutation_p.N131I|TP53_ENST00000413465.2_Missense_Mutation_p.N131I	p.N131I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.652064	P04637	P53_HUMAN		5	581	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.392A>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.405466	0.83230	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99804	-6.83;-6.83;-6.83;-6.83;-6.83;-6.83;-6.83;-6.83	5.48	5.48	0.80851	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99757	0.9902	M	0.87547	2.89	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.992;0.998;0.992;0.974;0.999;1.0;1.0	D	0.97125	0.9814	10	0.87932	D	0	-30.8858	13.8301	0.63375	0.0:0.0:0.0:1.0	.	92;131;131;38;131;131;131	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	I	131;131;131;131;131;131;120;38;38;131	ENSP00000410739:N131I;ENSP00000352610:N131I;ENSP00000269305:N131I;ENSP00000398846:N131I;ENSP00000391127:N131I;ENSP00000391478:N131I;ENSP00000423862:N38I;ENSP00000424104:N131I	ENSP00000269305:N131I	N	-	2	0	0	TP53	7519263	7519263	1.000000	0.71417	0.998000	0.56505	0.771000	0.43674	7.993000	0.88291	2.206000	0.71126	0.533000	0.62120	AAC	0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	6	0	0	0	0	25	25	25	25	1	1.920000	-20.000000	1	0.370000	NM_000546		0	47	47	0	123	122	1		1	1	1	0	1	25	2101	0	1.000000	8.073882e-01	1	7	446	3	1549	47	123
DHRS7C	201140	broad.mit.edu	37	17	9684814	9684814	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr17:9684814C>T	ENST00000330255.5	-	2	264	c.252G>A	c.(250-252)gtG>gtA	p.V84V	DHRS7C_ENST00000571134.1_Silent_p.V84V	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	84					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						TGGGGTCAGCCACGCTGATCA	0.552																																						ENST00000330255.5	1.000000	7.000000e-01	0.970000	8.000000e-01	0.890000	0.889379	0.890000	0.950000																										0				15						c.(250-252)gtG>gtA		dehydrogenase/reductase (SDR family) member 7C							73.0	80.0	78.0					17																	9684814		2031	4182	6213	SO:0001819	synonymous_variant	201140	0	0					g.chr17:9684814C>T		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.252G>A	chr17.hg19:g.9684814C>T		1					DHRS7C_ENST00000571134.1_Silent_p.V84V	p.V84V	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	0	1	1	1.652064	A6NNS2	DRS7C_HUMAN		2	264	-			B7ZW74|B9EJH3	Silent	SNP	ENST00000330255.5	1	1	hg19	c.252G>A	CCDS56020.1	1																																																																																								0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.552	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.920000	-20.000000	1	0.370000	XM_113912		0	47	47	0	168	167	1		1			0	0	34	0	0	1.000000	0	0	0	0	0	0	47	168
RNF43	54894	broad.mit.edu	37	17	56448270	56448270	+	Splice_Site	SNP	A	A	G			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr17:56448270A>G	ENST00000584437.1	-	2	2331		c.e2+1		RNF43_ENST00000577625.1_Splice_Site|RNF43_ENST00000500597.2_Intron|RNF43_ENST00000407977.2_Splice_Site|RNF43_ENST00000577716.1_Splice_Site|RNF43_ENST00000581868.1_Splice_Site|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000583753.1_Intron			Q68DV7	RNF43_HUMAN	ring finger protein 43						negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTGTGAGTCTACCTTGCTAGC	0.582																																						ENST00000584437.1	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				60						c.e2+1		ring finger protein 43							53.0	49.0	51.0					17																	56448270		2203	4300	6503	SO:0001630	splice_region_variant	54894	0	0					g.chr17:56448270A>G		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.375+1T>C	chr17.hg19:g.56448270A>G		1					RNF43_ENST00000407977.2_Splice_Site|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000500597.2_Intron|RNF43_ENST00000581868.1_Splice_Site|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Splice_Site|RNF43_ENST00000577625.1_Splice_Site				0	2	2	2.036083	Q68DV7	RNF43_HUMAN		2	2331	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Splice_Site	SNP	ENST00000584437.1	1	1	hg19		CCDS11607.1	1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384458	0.82792	.	.	ENSG00000108375	ENST00000407977	.	.	.	5.45	5.45	0.79879	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6985	0.69139	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	RNF43	53803269	53803269	1.000000	0.71417	0.997000	0.53966	0.837000	0.47467	5.913000	0.69957	2.066000	0.61787	0.533000	0.62120	.	0.370000		TCGA-HV-A7OL-01A-11D-A33T-08	0.582	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	1	2	2	2	7	0	0	0	0	54	54	54	52	1	1.920000	-10.801650	1	0.370000	NM_017763	Intron	0	116	116	0	247	242	1		1	1	1	0	1	54	355	0	1.000000	9.635510e-01	1	14	180	0	307	116	247
ARHGAP28	79822	broad.mit.edu	37	18	6859874	6859874	+	Missense_Mutation	SNP	C	C	T	rs190733334	byFrequency	TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr18:6859874C>T	ENST00000383472.4	+	5	808	c.704C>T	c.(703-705)gCg>gTg	p.A235V	ARHGAP28_ENST00000314319.3_Missense_Mutation_p.A76V|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.A183V|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.A235V|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.A76V|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.A71V|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.A76V|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.A58V			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	235					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				GGGAGTTTTGCGGTTCCCAGG	0.433													C|||	3	0.000599042	0.0	0.0	5008	,	,		21764	0.003		0.0	False		,,,				2504	0.0					ENST00000383472.4	0.120000	2.000000e-02	0.090000	3.000000e-02	0.050000	0.066822	0.050000	0.060000																										0				37						c.(703-705)gCg>gTg		Rho GTPase activating protein 28							224.0	213.0	217.0					18																	6859874		2203	4300	6503	SO:0001583	missense	79822	24	121412	48				g.chr18:6859874C>T	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.704C>T	chr18.hg19:g.6859874C>T	ENSP00000372964:p.Ala235Val	1					ARHGAP28_ENST00000532996.1_Missense_Mutation_p.A58V|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.A76V|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.A71V|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.A235V|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.A183V|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.A76V|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.A76V	p.A235V			0	1	1	1.645085	Q9P2N2	RHG28_HUMAN		5	808	+		Colorectal(10;0.168)	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	0	1	hg19	c.704C>T		0	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	8.061	0.768218	0.15983	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.08102	3.3;3.25;3.2;3.2;3.2;3.13	4.44	0.19	0.15125	4.44	0.19	0.15125	.	1.318330	0.04466	N	0.375305	T	0.03136	0.0092	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12630	0.001;0.003;0.006;0.004	B;B;B;B	0.08055	0.001;0.001;0.001;0.003	T	0.42015	-0.9476	10	0.25106	T	0.35	.	7.004	0.24826	0.0:0.5813:0.0:0.4187	.	235;67;76;183	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	V	235;183;76;71;76;76;67;58	ENSP00000382963:A235V;ENSP00000262227:A183V;ENSP00000392660:A76V;ENSP00000437262:A71V;ENSP00000313506:A76V;ENSP00000406907:A76V	ENSP00000262227:A183V	A	+	2	0	0	ARHGAP28	6849874	6849874	0.000000	0.05858	0.001000	0.08648	0.625000	0.37756	0.379000	0.20585	0.014000	0.14944	0.563000	0.77884	GCG	0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.433	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	0	0	1	2	18	2	2	1	1	1	1	86	86	86	85	1	1.920000	-1.522654	0	0.370000	XM_371108		0	6	6	0	450	449	0		0			1	0	86	0	0	0.010173	0	0	0	0	0	0	6	450
ANKRD12	23253	broad.mit.edu	37	18	9255365	9255365	+	Silent	SNP	T	T	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr18:9255365T>C	ENST00000262126.4	+	9	2340	c.2100T>C	c.(2098-2100)ttT>ttC	p.F700F	ANKRD12_ENST00000400020.3_Silent_p.F677F|ANKRD12_ENST00000383440.2_Silent_p.F677F	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	700						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						aagagaatttttttaaaagtg	0.279																																						ENST00000262126.4	0.200000	2.000000e-02	0.140000	5.000000e-02	0.080000	0.101276	0.080000	0.080000																										0				65						c.(2098-2100)ttT>ttC		ankyrin repeat domain 12							39.0	44.0	42.0					18																	9255365		2108	4161	6269	SO:0001819	synonymous_variant	23253	0	0					g.chr18:9255365T>C	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2100T>C	chr18.hg19:g.9255365T>C		1					ANKRD12_ENST00000400020.3_Silent_p.F677F|ANKRD12_ENST00000383440.2_Silent_p.F677F	p.F700F	NM_015208.4	NP_056023.3	0	1	1	1.645085	Q6UB98	ANR12_HUMAN		9	2340	+			O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	0	1	hg19	c.2100T>C	CCDS11843.1	0																																																																																								0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.279	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	0	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	1.920000	-7.556165	1	0.370000	NM_015208		0	4	4	0	208	204	0		1	0		0	0	34	0	0	0.886663	0	0	0	0	1	0	4	208
ILF3	3609	broad.mit.edu	37	19	10793838	10793838	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:10793838G>A	ENST00000590261.1	+	13	1574	c.1574G>A	c.(1573-1575)gGc>gAc	p.G525D	ILF3_ENST00000318511.3_Missense_Mutation_p.G525D|ILF3_ENST00000250241.8_Missense_Mutation_p.G525D|ILF3_ENST00000420083.1_Missense_Mutation_p.G525D|ILF3_ENST00000592763.1_Missense_Mutation_p.G529D|ILF3_ENST00000407004.3_Missense_Mutation_p.G529D|ILF3_ENST00000589998.1_Missense_Mutation_p.G525D|ILF3_ENST00000588657.1_Missense_Mutation_p.G529D|ILF3_ENST00000449870.1_Missense_Mutation_p.G529D			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	525	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			ACAAAGCACGGCAAGAACCCA	0.557																																						ENST00000590261.1	0.100000	0	0.070000	2.000000e-02	0.040000	0.052293	0.040000	0.040000																										0				31						c.(1573-1575)gGc>gAc		interleukin enhancer binding factor 3, 90kDa							96.0	98.0	97.0					19																	10793838		2203	4300	6503	SO:0001583	missense	3609	0	0					g.chr19:10793838G>A	U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.1574G>A	chr19.hg19:g.10793838G>A	ENSP00000468156:p.Gly525Asp	0					ILF3_ENST00000318511.3_Missense_Mutation_p.G525D|ILF3_ENST00000420083.1_Missense_Mutation_p.G525D|ILF3_ENST00000588657.1_Missense_Mutation_p.G529D|ILF3_ENST00000449870.1_Missense_Mutation_p.G529D|ILF3_ENST00000589998.1_Missense_Mutation_p.G525D|ILF3_ENST00000592763.1_Missense_Mutation_p.G529D|ILF3_ENST00000250241.8_Missense_Mutation_p.G525D|ILF3_ENST00000407004.3_Missense_Mutation_p.G529D	p.G525D			0	0	0	1.986796	Q12906	ILF3_HUMAN	Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)	13	1574	+			A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Missense_Mutation	SNP	ENST00000590261.1	0	1	hg19	c.1574G>A	CCDS12246.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.288199	0.95517	.	.	ENSG00000129351	ENST00000336059;ENST00000449870;ENST00000318511;ENST00000420083;ENST00000407004;ENST00000250241	T;T;T;T;T	0.18174	2.28;2.23;2.26;2.31;2.26	5.83	5.83	0.93111	5.83	5.83	0.93111	Double-stranded RNA-binding (2);Double-stranded RNA-binding-like (1);	0.113792	0.64402	D	0.000011	T	0.39572	0.1083	L	0.49126	1.545	0.80722	D	1	D;D;D;D;B;D	0.89917	1.0;0.998;0.999;0.999;0.176;0.992	D;D;D;D;B;P	0.91635	0.999;0.943;0.941;0.968;0.191;0.906	T	0.04467	-1.0949	10	0.87932	D	0	.	18.8865	0.92379	0.0:0.0:1.0:0.0	.	529;529;525;529;525;525	Q12906-4;G5E9M5;Q12906;Q12906-6;Q12906-2;Q12906-5	.;.;ILF3_HUMAN;.;.;.	D	525;529;525;525;529;525	ENSP00000404121:G529D;ENSP00000315205:G525D;ENSP00000405436:G525D;ENSP00000384660:G529D;ENSP00000250241:G525D	ENSP00000250241:G525D	G	+	2	0	0	ILF3	10654838	10654838	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.771000	0.98977	2.761000	0.94854	0.650000	0.86243	GGC	0.355696		TCGA-HV-A7OL-01A-11D-A33T-08	0.557	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1	0	0	1	2	22	5	2	1	1	1	1	89	89	89	88	1	1.920000	-2.687305	1	0.370000			0	5	5	0	597	592	0		0	0		1	0	89	0	0	0.000614	1.289190e-03	0	0	0	65	0	5	597
UPF1	5976	broad.mit.edu	37	19	18960909	18960909	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:18960909G>A	ENST00000599848.1	+	4	696	c.487G>A	c.(487-489)Gca>Aca	p.A163T	UPF1_ENST00000262803.5_Missense_Mutation_p.A163T|UPF1_ENST00000600310.1_3'UTR			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	163	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A163T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CCTTGTGAGGGCAAAATGCAA	0.517																																						ENST00000599848.1	0.120000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.066717	0.050000	0.060000																										1	Substitution - Missense(1)	p.A163T(1)	lung(1)	40						c.(487-489)Gca>Aca		UPF1 regulator of nonsense transcripts homolog (yeast)							89.0	88.0	88.0					19																	18960909		2203	4300	6503	SO:0001583	missense	5976	0	0					g.chr19:18960909G>A	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.487G>A	chr19.hg19:g.18960909G>A	ENSP00000470142:p.Ala163Thr	0					UPF1_ENST00000262803.5_Missense_Mutation_p.A163T|UPF1_ENST00000600310.1_3'UTR	p.A163T			0	0	0	1.986796	Q92900	RENT1_HUMAN		4	696	+			O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	0	1	hg19	c.487G>A		0	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014153	0.93404	.	.	ENSG00000005007	ENST00000262803	D	0.91237	-2.81	4.51	4.51	0.55191	4.51	4.51	0.55191	RNA helicase UPF1, UPF2-interacting domain (1);	0.000000	0.85682	D	0.000000	D	0.94142	0.8121	M	0.86805	2.84	0.80722	D	1	P;P	0.41159	0.74;0.695	P;B	0.49301	0.606;0.415	D	0.95400	0.8489	10	0.87932	D	0	-16.0301	16.5553	0.84483	0.0:0.0:1.0:0.0	.	163;163	Q92900;Q92900-2	RENT1_HUMAN;.	T	163	ENSP00000262803:A163T	ENSP00000262803:A163T	A	+	1	0	0	UPF1	18821909	18821909	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.374000	0.97172	2.221000	0.72209	0.591000	0.81541	GCA	0.355696		TCGA-HV-A7OL-01A-11D-A33T-08	0.517	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	0	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.920000	-2.228895	0	0.370000	NM_002911		0	6	6	0	545	543	0		1	0		0	0	96	0	0	0.964745	2.625662e-03	0	0	0	6	0	6	545
PEPD	5184	broad.mit.edu	37	19	33991872	33991872	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:33991872G>A	ENST00000244137.7	-	4	398	c.365C>T	c.(364-366)gCc>gTc	p.A122V	PEPD_ENST00000436370.3_Intron|PEPD_ENST00000397032.4_Missense_Mutation_p.A122V	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	122					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)	p.A122V(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					GTCGTCCACGGCATACTTCTC	0.557																																						ENST00000244137.7	1.000000	1.000000e-02	0.120000	3.000000e-02	0.060000	0.187122	0.060000	0.060000																										1	Substitution - Missense(1)	p.A122V(1)	lung(1)	17						c.(364-366)gCc>gTc		peptidase D							137.0	144.0	142.0					19																	33991872		2042	4206	6248	SO:0001583	missense	5184	0	0					g.chr19:33991872G>A	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.365C>T	chr19.hg19:g.33991872G>A	ENSP00000244137:p.Ala122Val	1					PEPD_ENST00000397032.4_Missense_Mutation_p.A122V|PEPD_ENST00000436370.3_Intron	p.A122V	NM_000285.3	NP_000276.2	1	2	3	2.336832	P12955	PEPD_HUMAN		4	398	-	Esophageal squamous(110;0.137)		A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	0	1	hg19	c.365C>T	CCDS42544.1	0	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068639	0.36470	.	.	ENSG00000124299	ENST00000244137;ENST00000397032	T;T	0.77098	-1.07;-1.07	5.39	5.39	0.77823	5.39	5.39	0.77823	Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (1);	0.148969	0.64402	D	0.000010	T	0.74427	0.3715	L	0.58925	1.835	0.80722	D	1	B;B	0.17038	0.02;0.017	B;B	0.19666	0.026;0.009	T	0.69450	-0.5142	10	0.32370	T	0.25	-26.8327	14.6656	0.68904	0.0:0.0:1.0:0.0	.	122;122	A8MX47;P12955	.;PEPD_HUMAN	V	122	ENSP00000244137:A122V;ENSP00000380226:A122V	ENSP00000244137:A122V	A	-	2	0	0	PEPD	38683712	38683712	1.000000	0.71417	0.503000	0.27626	0.454000	0.32378	5.746000	0.68681	2.510000	0.84645	0.462000	0.41574	GCC	0.453860		TCGA-HV-A7OL-01A-11D-A33T-08	0.557	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	0	0	1	2	2	2	2	0	0	0	0	101	101	101	99	1	1.920000	-2.172608	0	0.370000	NM_000285		0	6	7	0	682	679	0		1	0		0	0	101	0	0	0.964765	4.522464e-02	0	0	0	32	0	6	682
MAP4K1	11184	broad.mit.edu	37	19	39100239	39100239	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:39100239A>G	ENST00000591517.1	-	13	1031	c.1003T>C	c.(1003-1005)Tgt>Cgt	p.C335R	MAP4K1_ENST00000586296.1_Splice_Site_p.C335R|MAP4K1_ENST00000589130.1_Missense_Mutation_p.C331R|MAP4K1_ENST00000396857.2_Missense_Mutation_p.C335R|MAP4K1_ENST00000423454.2_5'UTR|MAP4K1_ENST00000589002.1_5'UTR	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	335					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TACTCACGACAGCAGTCTGCA	0.582																																						ENST00000591517.1	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				44						c.(1003-1005)Tgt>Cgt		mitogen-activated protein kinase kinase kinase kinase 1							52.0	55.0	54.0					19																	39100239		1970	4177	6147	SO:0001583	missense	11184	0	0					g.chr19:39100239A>G	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1003T>C	chr19.hg19:g.39100239A>G	ENSP00000465039:p.Cys335Arg	1					MAP4K1_ENST00000396857.2_Missense_Mutation_p.C335R|MAP4K1_ENST00000589130.1_Missense_Mutation_p.C331R|MAP4K1_ENST00000589002.1_5'UTR|MAP4K1_ENST00000586296.1_Splice_Site_p.C335R|MAP4K1_ENST00000423454.2_5'UTR	p.C335R	NM_007181.4	NP_009112.1	1	2	3	2.335928	Q92918	M4K1_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)	13	1031	-	all_cancers(60;6.42e-06)|Ovarian(47;0.103)			Missense_Mutation	SNP	ENST00000591517.1	1	1	hg19	c.1003T>C	CCDS59385.1	1	.	.	.	.	.	.	.	.	.	.	.	10.01	1.234740	0.22626	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.71341	-0.56	4.25	0.715	0.18186	4.25	0.715	0.18186	Protein kinase-like domain (1);	0.941218	0.09011	N	0.861554	T	0.50769	0.1635	L	0.29908	0.895	0.29651	N	0.843925	B;B	0.21905	0.062;0.057	B;B	0.17979	0.02;0.014	T	0.40251	-0.9573	10	0.11794	T	0.64	.	3.8459	0.08934	0.4194:0.2013:0.0:0.3793	.	335;335	Q92918-2;Q92918	.;M4K1_HUMAN	R	335	ENSP00000380066:C335R	ENSP00000221409:C335R	C	-	1	0	0	MAP4K1	43792079	43792079	0.569000	0.26643	0.816000	0.32577	0.990000	0.78478	0.529000	0.23019	0.176000	0.19873	0.459000	0.35465	TGT	0.462480		TCGA-HV-A7OL-01A-11D-A33T-08	0.582	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.920000	-20.000000	1	0.370000	NM_001042600		0	43	42	0	99	97	1		1	0		0	0	18	0	0	1.000000	9.926880e-01	0	0	0	21	0	43	99
CEACAM4	1089	broad.mit.edu	37	19	42132119	42132119	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:42132119C>T	ENST00000221954.2	-	2	390	c.280G>A	c.(280-282)Gca>Aca	p.A94T	CEACAM4_ENST00000600925.1_Missense_Mutation_p.A94T	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	94	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.A94T(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						CCACTGTATGCGGCCCCTGGG	0.488																																						ENST00000221954.2	0.110000	0	0.080000	2.000000e-02	0.040000	0.062851	0.040000	0.060000																										1	Substitution - Missense(1)	p.A94T(1)	lung(1)	16						c.(280-282)Gca>Aca		carcinoembryonic antigen-related cell adhesion molecule 4							166.0	157.0	160.0					19																	42132119		2203	4300	6503	SO:0001583	missense	1089	4	121412	41				g.chr19:42132119C>T	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.280G>A	chr19.hg19:g.42132119C>T	ENSP00000221954:p.Ala94Thr	1					CEACAM4_ENST00000600925.1_Missense_Mutation_p.A94T	p.A94T	NM_001817.2	NP_001808.2	1	2	3	2.386725	O75871	CEAM4_HUMAN		2	390	-			Q03715|Q7LDZ7	Missense_Mutation	SNP	ENST00000221954.2	0	1	hg19	c.280G>A	CCDS33033.1	0	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639939	0.47153	.	.	ENSG00000105352	ENST00000221954	T	0.66280	-0.2	1.76	1.76	0.24704	1.76	1.76	0.24704	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76278	0.3965	M	0.84219	2.685	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.73380	0.921;0.98	T	0.61207	-0.7109	9	0.66056	D	0.02	.	6.9535	0.24558	0.0:1.0:0.0:0.0	.	94;94	E7EMX3;O75871	.;CEAM4_HUMAN	T	94	ENSP00000221954:A94T	ENSP00000221954:A94T	A	-	1	0	0	CEACAM4	46823959	46823959	0.000000	0.05858	0.009000	0.14445	0.015000	0.08874	0.618000	0.24373	1.281000	0.44480	0.205000	0.17691	GCA	0.466689		TCGA-HV-A7OL-01A-11D-A33T-08	0.488	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321148.1	0	0	1	2	2	2	2	0	0	0	0	139	139	139	137	1	1.920000	-1.550212	0	0.370000	NM_001817		0	8	8	0	1053	1048	0		1			0	0	139	0	0	0.989154	0	0	0	0	0	0	8	1053
TRPM4	54795	broad.mit.edu	37	19	49671336	49671336	+	Missense_Mutation	SNP	C	C	T	rs376262811		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:49671336C>T	ENST00000252826.5	+	4	556	c.430C>T	c.(430-432)Cgg>Tgg	p.R144W	TRPM4_ENST00000355712.5_Intron|TRPM4_ENST00000427978.2_Missense_Mutation_p.R144W	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	144					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TGGGCTGGTGCGGGCTGCCCA	0.731																																						ENST00000252826.5	0.150000	1.000000e-02	0.110000	4.000000e-02	0.070000	0.079213	0.070000	0.060000																										0				49						c.(430-432)Cgg>Tgg		transient receptor potential cation channel, subfamily M, member 4		C	TRP/ARG,TRP/ARG	1,4399		0,1,2199	28.0	33.0	31.0		430,430	2.0	1.0	19		31	0,8590		0,0,4295	no	missense,missense	TRPM4	NM_001195227.1,NM_017636.3	101,101	0,1,6494	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	144/1070,144/1215	49671336	1,12989	2200	4295	6495	SO:0001583	missense	54795	0	0					g.chr19:49671336C>T	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.430C>T	chr19.hg19:g.49671336C>T	ENSP00000252826:p.Arg144Trp	1					TRPM4_ENST00000427978.2_Missense_Mutation_p.R144W|TRPM4_ENST00000355712.5_Intron	p.R144W	NM_017636.3	NP_060106.2	1	2	3	2.387095	Q8TD43	TRPM4_HUMAN		4	556	+		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	0	1	hg19	c.430C>T	CCDS33073.1	0	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880335	0.72294	2.27E-4	0.0	ENSG00000130529	ENST00000252826;ENST00000427978	T;T	0.03301	3.98;3.98	4.33	1.96	0.26148	4.33	1.96	0.26148	.	0.086004	0.46442	D	0.000284	T	0.12050	0.0293	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72625	0.978;0.952	T	0.01537	-1.1330	10	0.87932	D	0	-31.9032	10.4113	0.44294	0.5303:0.4697:0.0:0.0	.	144;144	Q8TD43-3;Q8TD43	.;TRPM4_HUMAN	W	144	ENSP00000252826:R144W;ENSP00000407492:R144W	ENSP00000252826:R144W	R	+	1	2	2	TRPM4	54363148	54363148	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.336000	0.43938	1.142000	0.42291	0.491000	0.48974	CGG	0.468354		TCGA-HV-A7OL-01A-11D-A33T-08	0.731	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	67	1	1.920000	-3.189999	1	0.370000	NM_017636		0	5	5	0	476	472	0		1	0		0	0	70	0	0	0.936465	3.346890e-02	0	0	0	22	0	5	476
KLK7	5650	broad.mit.edu	37	19	51480876	51480876	+	Silent	SNP	G	G	A	rs17855561		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:51480876G>A	ENST00000391807.1	-	6	779	c.678C>T	c.(676-678)tgC>tgT	p.C226C	KLK7_ENST00000597707.1_Silent_p.C154C|KLK7_ENST00000595820.1_Silent_p.C226C|KLK7_ENST00000336317.4_Silent_p.C113C|CTB-147C22.9_ENST00000594512.1_RNA	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			C -> W (in Ref. 9; AAH32005). {ECO:0000305}.	epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.C226C(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		TGGGTTGGCCGCAAGGGAAAG	0.517																																						ENST00000391807.1	0.130000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.072931	0.060000	0.060000																										1	Substitution - coding silent(1)	p.C226C(1)	lung(1)	19						c.(676-678)tgC>tgT		kallikrein-related peptidase 7							150.0	129.0	136.0					19																	51480876		2203	4300	6503	SO:0001819	synonymous_variant	5650	108	121412	52				g.chr19:51480876G>A	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.678C>T	chr19.hg19:g.51480876G>A		1					KLK7_ENST00000597707.1_Silent_p.C154C|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000336317.4_Silent_p.C113C|KLK7_ENST00000595820.1_Silent_p.C226C	p.C226C	NM_139277.2	NP_644806.1	1	2	3	2.387095	P49862	KLK7_HUMAN		6	779	-		all_neural(266;0.026)	A8K0U5|Q8N5N9|Q8NFV7	Silent	SNP	ENST00000391807.1	0	1	hg19	c.678C>T	CCDS12812.1	0																																																																																								0.468354		TCGA-HV-A7OL-01A-11D-A33T-08	0.517	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	1.920000	-2.042599	0	0.370000	NM_005046		0	6	7	0	605	600	0		1	1		0	0	76	0	0	0.964393	9.920532e-01	0	2	0	928	0	6	605
ZNF581	51545	broad.mit.edu	37	19	56156512	56156512	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:56156512C>T	ENST00000587252.1	+	2	848	c.575C>T	c.(574-576)aCg>aTg	p.T192M	CCDC106_ENST00000586790.1_5'Flank|CCDC106_ENST00000308964.3_5'Flank|ZNF581_ENST00000270451.5_Missense_Mutation_p.T192M|ZNF581_ENST00000588537.1_Missense_Mutation_p.T192M			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CAGAAACACACGCGGTGGAAG	0.632																																						ENST00000587252.1	1.000000	1.000000e-02	0.130000	4.000000e-02	0.070000	0.118474	0.070000	0.070000																										0				3						c.(574-576)aCg>aTg		zinc finger protein 581							39.0	40.0	40.0					19																	56156512		2203	4300	6503	SO:0001583	missense	51545	2	117088	33				g.chr19:56156512C>T	AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.575C>T	chr19.hg19:g.56156512C>T	ENSP00000466047:p.Thr192Met	1					ZNF581_ENST00000270451.5_Missense_Mutation_p.T192M|CCDC106_ENST00000586790.1_5'Flank|ZNF581_ENST00000588537.1_Missense_Mutation_p.T192M|CCDC106_ENST00000308964.3_5'Flank	p.T192M			1	2	3	2.365756	Q9P0T4	ZN581_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	2	848	+		Ovarian(87;0.133)	B2RDM6	Missense_Mutation	SNP	ENST00000587252.1	0	1	hg19	c.575C>T	CCDS12932.1	0	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800114	0.31869	.	.	ENSG00000171425	ENST00000270451	T	0.09538	2.97	3.5	0.0648	0.14354	3.5	0.0648	0.14354	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05547	0.0146	N	0.00760	-1.21	0.24781	N	0.992819	D	0.67145	0.996	P	0.53649	0.731	T	0.36432	-0.9748	9	0.87932	D	0	.	6.9073	0.24315	0.0:0.4032:0.0:0.5968	.	192	Q9P0T4	ZN581_HUMAN	M	192	ENSP00000270451:T192M	ENSP00000270451:T192M	T	+	2	0	0	ZNF581	60848324	60848324	0.000000	0.05858	0.014000	0.15608	0.453000	0.32348	-0.054000	0.11826	-0.004000	0.14419	0.407000	0.27541	ACG	0.464172		TCGA-HV-A7OL-01A-11D-A33T-08	0.632	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453430.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	1.920000	-4.772330	1	0.370000	NM_016535		0	5	5	0	447	438	0		1	0		0	0	54	0	0	0.934131	4.887685e-01	0	0	0	131	0	5	447
TRIM28	10155	broad.mit.edu	37	19	59061796	59061796	+	Missense_Mutation	SNP	G	G	A	rs553301230		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr19:59061796G>A	ENST00000253024.5	+	17	2673	c.2384G>A	c.(2383-2385)cGc>cAc	p.R795H	TRIM28_ENST00000341753.6_Missense_Mutation_p.R713H	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	795	Bromo.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		TTCGAGACGCGCATGAACGAG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		16908	0.001		0.0	False		,,,				2504	0.0					ENST00000253024.5	1.000000	0	0.090000	2.000000e-02	0.050000	0.096193	0.050000	0.060000																										0				19						c.(2383-2385)cGc>cAc		tripartite motif containing 28							78.0	70.0	73.0					19																	59061796		2203	4300	6503	SO:0001583	missense	10155	1	121410	33				g.chr19:59061796G>A		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.2384G>A	chr19.hg19:g.59061796G>A	ENSP00000253024:p.Arg795His	1					TRIM28_ENST00000341753.6_Missense_Mutation_p.R713H	p.R795H	NM_005762.2	NP_005753.1	1	2	3	2.365756	Q13263	TIF1B_HUMAN		17	2673	+		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	0	1	hg19	c.2384G>A	CCDS12985.1	0	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729403	0.48833	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.43688	0.94;0.94	5.06	2.95	0.34219	5.06	2.95	0.34219	Bromodomain (2);	0.154547	0.40469	N	0.001086	T	0.28532	0.0706	L	0.27053	0.805	0.34967	D	0.752756	B;B;B	0.31054	0.306;0.01;0.204	B;B;B	0.31337	0.128;0.025;0.086	T	0.36939	-0.9727	10	0.46703	T	0.11	-21.0615	9.4971	0.38995	0.1711:0.0:0.8289:0.0	.	713;795;795	Q13263-2;B2R8R5;Q13263	.;.;TIF1B_HUMAN	H	795;713	ENSP00000253024:R795H;ENSP00000342232:R713H	ENSP00000253024:R795H	R	+	2	0	0	TRIM28	63753608	63753608	0.633000	0.27181	0.989000	0.46669	0.989000	0.77384	1.837000	0.39201	0.857000	0.35407	0.462000	0.41574	CGC	0.464172		TCGA-HV-A7OL-01A-11D-A33T-08	0.602	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.920000	-2.354596	0	0.370000	NM_005762		0	5	5	0	616	612	0		1	0		0	0	64	0	0	0.936701	9.965438e-01	0	1	0	1476	0	5	616
AADACL3	126767	broad.mit.edu	37	1	12779503	12779503	+	Missense_Mutation	SNP	C	C	G			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:12779503C>G	ENST00000359318.5	+	2	229	c.24C>G	c.(22-24)atC>atG	p.I8M	AADACL3_ENST00000332530.3_Intron	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	8							hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGCTCAGAATCTGTTCTATGC	0.478																																						ENST00000359318.5	1.000000	8.200000e-01	1.000000	8.800000e-01	0.940000	0.943539	0.940000	1.000000																										0				15						c.(22-24)atC>atG		arylacetamide deacetylase-like 3							208.0	212.0	211.0					1																	12779503		1913	4124	6037	SO:0001583	missense	126767	0	0					g.chr1:12779503C>G		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.24C>G	chr1.hg19:g.12779503C>G	ENSP00000352268:p.Ile8Met	0					AADACL3_ENST00000332530.3_Intron	p.I8M	NM_001103170.1	NP_001096640.1	1	2	3	2.062195	Q5VUY0	ADCL3_HUMAN		2	229	+	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	B3KXR9|Q5VUY1	Missense_Mutation	SNP	ENST00000359318.5	1	1	hg19	c.24C>G	CCDS41253.1	1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.112902	0.37242	.	.	ENSG00000188984	ENST00000359318	T	0.07114	3.22	4.44	4.44	0.53790	4.44	4.44	0.53790	.	0.459980	0.21394	N	0.075257	T	0.25158	0.0611	M	0.77313	2.365	0.28056	N	0.933172	D	0.67145	0.996	D	0.63877	0.919	T	0.03121	-1.1070	10	0.72032	D	0.01	-22.8393	10.4714	0.44640	0.0:0.8025:0.1975:0.0	.	8	Q5VUY0	ADCL3_HUMAN	M	8	ENSP00000352268:I8M	ENSP00000352268:I8M	I	+	3	3	3	AADACL3	12702090	12702090	0.319000	0.24607	0.922000	0.36590	0.356000	0.29392	-0.363000	0.07593	2.307000	0.77673	0.491000	0.48974	ATC	0.375774		TCGA-HV-A7OL-01A-11D-A33T-08	0.478	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	1	0	1	2	2	2	2	0	0	0	0	144	144	144	143	1	1.920000	-20.000000	1	0.370000	NM_001103170		0	181	181	0	861	856	1		1			0	0	144	0	0	1.000000	0	0	0	0	0	0	181	861
ADAM30	11085	broad.mit.edu	37	1	120438703	120438703	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:120438703C>T	ENST00000369400.1	-	1	415	c.257G>A	c.(256-258)cGa>cAa	p.R86Q		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	86					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GCGCAGATGTCGGGGCAACAG	0.527																																						ENST00000369400.1	1.000000	2.000000e-02	0.130000	4.000000e-02	0.070000	0.129063	0.070000	0.080000																										0				38						c.(256-258)cGa>cAa		ADAM metallopeptidase domain 30							73.0	68.0	70.0					1																	120438703		2203	4300	6503	SO:0001583	missense	11085	0	0					g.chr1:120438703C>T	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.257G>A	chr1.hg19:g.120438703C>T	ENSP00000358407:p.Arg86Gln	0						p.R86Q	NM_021794.3	NP_068566.2	1	2	3	2.069750	Q9UKF2	ADA30_HUMAN		1	415	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	0	1	hg19	c.257G>A	CCDS907.1	0	.	.	.	.	.	.	.	.	.	.	C	18.29	3.590440	0.66219	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.05996	3.36	4.56	1.5	0.22942	4.56	1.5	0.22942	Peptidase M12B, propeptide (1);	0.000000	0.32655	U	0.005818	T	0.04227	0.0117	L	0.60957	1.885	0.09310	N	1	P	0.52842	0.956	P	0.53490	0.727	T	0.27262	-1.0079	10	0.56958	D	0.05	.	2.9046	0.05716	0.1851:0.5349:0.1794:0.1006	.	86	Q9UKF2	ADA30_HUMAN	Q	86	ENSP00000358407:R86Q	ENSP00000358407:R86Q	R	-	2	0	0	ADAM30	120240226	120240226	0.000000	0.05858	0.000000	0.03702	0.968000	0.65278	-1.640000	0.02009	0.132000	0.18615	0.462000	0.41574	CGA	0.376916		TCGA-HV-A7OL-01A-11D-A33T-08	0.527	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.920000	-2.607044	1	0.370000	NM_021794		0	5	5	0	372	366	0		1			0	0	58	0	0	0.935273	0	0	0	0	0	0	5	372
KPRP	448834	broad.mit.edu	37	1	152732580	152732580	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:152732580C>T	ENST00000606109.1	+	1	544	c.516C>T	c.(514-516)tgC>tgT	p.C172C	KPRP_ENST00000368773.1_Silent_p.C172C			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	172	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.C172C(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCAGTGTGCCAGCCTCAGG	0.522																																						ENST00000606109.1	1.000000	0	0.080000	2.000000e-02	0.040000	0.081509	0.040000	0.040000																										1	Substitution - coding silent(1)	p.C172C(1)	lung(1)	60						c.(514-516)tgC>tgT		keratinocyte proline-rich protein							119.0	121.0	120.0					1																	152732580		2203	4300	6503	SO:0001819	synonymous_variant	448834	0	0					g.chr1:152732580C>T	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.516C>T	chr1.hg19:g.152732580C>T		0					KPRP_ENST00000368773.1_Silent_p.C172C	p.C172C			1	2	3	2.054135	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	1	544	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)			Silent	SNP	ENST00000606109.1	0	1	hg19	c.516C>T	CCDS30862.1	0																																																																																								0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.522	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	0	0	1	2	2	2	2	0	0	0	0	113	113	113	110	1	1.920000	-2.022659	0	0.370000	NM_001025231		0	5	5	0	592	587	0		1			0	0	113	0	0	0.936111	0	0	0	0	0	0	5	592
C1orf110	339512	broad.mit.edu	37	1	162824686	162824686	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:162824686G>A	ENST00000367910.1	-	4	898	c.778C>T	c.(778-780)Cgg>Tgg	p.R260W	C1orf110_ENST00000367912.2_Intron|C1orf110_ENST00000367911.2_Intron|C1orf110_ENST00000524691.1_Intron	NM_178550.4	NP_848645.3	Q86UF4	CA110_HUMAN	chromosome 1 open reading frame 110	260										endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	12						ACCCTGTGCCGGAGATAATGG	0.502																																						ENST00000367910.1	1.000000	1.000000e-02	0.120000	3.000000e-02	0.060000	0.110471	0.060000	0.060000																										0				12						c.(778-780)Cgg>Tgg		chromosome 1 open reading frame 110							84.0	82.0	82.0					1																	162824686		1883	4107	5990	SO:0001583	missense	339512	6	120816	41				g.chr1:162824686G>A	BC040018	CCDS44269.1	1q23.3	2012-06-26			ENSG00000185860	ENSG00000185860			28736	protein-coding gene	gene with protein product						12477932	Standard	NM_178550		Approved	MGC48998	uc001gck.2	Q86UF4	OTTHUMG00000034421	ENST00000367910.1:c.778C>T	chr1.hg19:g.162824686G>A	ENSP00000356886:p.Arg260Trp	0					C1orf110_ENST00000367912.2_Intron|C1orf110_ENST00000524691.1_Intron|C1orf110_ENST00000367911.2_Intron	p.R260W	NM_178550.4	NP_848645.3	1	2	3	2.060271	Q86UF4	CA110_HUMAN		4	898	-			Q5JSG1|Q6ZW57	Missense_Mutation	SNP	ENST00000367910.1	0	1	hg19	c.778C>T	CCDS44269.1	0	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474319	0.43942	.	.	ENSG00000185860	ENST00000367910	.	.	.	4.41	3.5	0.40072	4.41	3.5	0.40072	.	0.000000	0.47455	D	0.000237	T	0.16599	0.0399	L	0.36672	1.1	0.34538	D	0.709987	P	0.46395	0.877	B	0.40901	0.343	T	0.04693	-1.0933	8	0.49607	T	0.09	-7.6072	8.1269	0.31003	0.1093:0.0:0.8907:0.0	.	260	Q86UF4	CA110_HUMAN	W	260	.	ENSP00000356886:R260W	R	-	1	2	2	C1orf110	161091310	161091310	1.000000	0.71417	0.991000	0.47740	0.269000	0.26545	1.845000	0.39279	1.051000	0.40369	0.655000	0.94253	CGG	0.375774		TCGA-HV-A7OL-01A-11D-A33T-08	0.502	C1orf110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083211.2	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.920000	-2.885578	1	0.370000	NM_178550		0	4	4	0	354	351	0		1	0		0	0	64	0	0	0.888972	0	0	0	0	1	0	4	354
MIA3	375056	broad.mit.edu	37	1	222802593	222802593	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:222802593C>T	ENST00000344922.5	+	4	2056	c.2031C>T	c.(2029-2031)ctC>ctT	p.L677L	MIA3_ENST00000344441.6_Silent_p.L677L|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	677					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.L677L(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		AGATAAGGCTCTCTGAGGGAG	0.488																																						ENST00000344922.5	1.000000	7.500000e-01	1.000000	8.300000e-01	0.920000	0.922388	0.920000	1.000000																										1	Substitution - coding silent(1)	p.L677L(1)	pancreas(1)	80						c.(2029-2031)ctC>ctT		melanoma inhibitory activity family, member 3							69.0	71.0	70.0					1																	222802593		1929	4124	6053	SO:0001819	synonymous_variant	375056	0	0					g.chr1:222802593C>T		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.2031C>T	chr1.hg19:g.222802593C>T		0					MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Silent_p.L677L|MIA3_ENST00000470521.1_3'UTR	p.L677L	NM_198551.2	NP_940953.2	1	2	3	2.055428	Q5JRA6	MIA3_HUMAN		4	2056	+			A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Silent	SNP	ENST00000344922.5	1	1	hg19	c.2031C>T	CCDS41470.1	1	.	.	.	.	.	.	.	.	.	.	C	2.388	-0.340457	0.05243	.	.	ENSG00000154305	ENST00000354906	T	0.19806	2.12	4.36	-6.82	0.01698	4.36	-6.82	0.01698	.	.	.	.	.	T	0.06690	0.0171	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.34354	-0.9832	6	0.10111	T	0.7	.	3.8314	0.08876	0.0778:0.2549:0.3136:0.3537	.	.	.	.	F	260	ENSP00000355062:L260F	ENSP00000355062:L260F	L	+	1	0	0	MIA3	220869216	220869216	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-5.357000	0.00128	-2.045000	0.00910	-2.178000	0.00318	CTC	0.374628		TCGA-HV-A7OL-01A-11D-A33T-08	0.488	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	1	0	1	2	2	2	2	0	0	0	0	86	86	86	86	1	1.920000	-20.000000	1	0.370000	NM_198551		0	90	90	0	438	435	1		1			0	0	86	0	0	1.000000	0	0	0	0	0	0	90	438
CSF3R	1441	broad.mit.edu	37	1	36939177	36939177	+	Missense_Mutation	SNP	C	C	T	rs186379741		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:36939177C>T	ENST00000373106.1	-	6	1079	c.532G>A	c.(532-534)Gtg>Atg	p.V178M	CSF3R_ENST00000373103.1_Missense_Mutation_p.V178M|CSF3R_ENST00000440588.2_Missense_Mutation_p.V178M|CSF3R_ENST00000418048.2_Missense_Mutation_p.V178M|CSF3R_ENST00000373104.1_Missense_Mutation_p.V178M|CSF3R_ENST00000361632.4_Missense_Mutation_p.V178M|CSF3R_ENST00000331941.5_Missense_Mutation_p.V178M|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000338937.5_Missense_Mutation_p.V178M	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	178	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TCCTTGGGCACGCAGTCCAGG	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20168	0.0		0.0	False		,,,				2504	0.0					ENST00000373106.1	1.000000	8.300000e-01	1.000000	9.400000e-01	0.990000	0.978602	0.990000	1.000000																										0				38						c.(532-534)Gtg>Atg		colony stimulating factor 3 receptor (granulocyte)	Filgrastim(DB00099)|Pegfilgrastim(DB00019)						76.0	68.0	71.0					1																	36939177		2203	4300	6503	SO:0001583	missense	1441	7	121412	37				g.chr1:36939177C>T	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.532G>A	chr1.hg19:g.36939177C>T	ENSP00000362198:p.Val178Met	0					CSF3R_ENST00000361632.4_Missense_Mutation_p.V178M|CSF3R_ENST00000440588.2_Missense_Mutation_p.V178M|CSF3R_ENST00000418048.2_Missense_Mutation_p.V178M|CSF3R_ENST00000373103.1_Missense_Mutation_p.V178M|CSF3R_ENST00000331941.5_Missense_Mutation_p.V178M|CSF3R_ENST00000338937.5_Missense_Mutation_p.V178M|CSF3R_ENST00000373104.1_Missense_Mutation_p.V178M|CSF3R_ENST00000487540.2_5'Flank	p.V178M	NM_000760.3	NP_000751.1	1	2	3	2.069750	Q99062	CSF3R_HUMAN		6	1079	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)		Missense_Mutation	SNP	ENST00000373106.1	1	1	hg19	c.532G>A	CCDS413.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	7.097	0.573316	0.13623	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	5.22	-0.00103	0.14035	5.22	-0.00103	0.14035	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.150820	0.06140	N	0.672141	T	0.21881	0.0527	L	0.31664	0.95	0.24342	N	0.99496	D;D;P;P	0.54047	0.964;0.958;0.929;0.723	B;B;B;B	0.36418	0.224;0.174;0.084;0.069	T	0.25606	-1.0127	10	0.34782	T	0.22	-5.3635	7.0679	0.25161	0.0:0.3842:0.0:0.6158	.	178;178;178;178	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	M	178	ENSP00000362198:V178M;ENSP00000362196:V178M;ENSP00000362195:V178M;ENSP00000355406:V178M;ENSP00000332180:V178M;ENSP00000401588:V178M;ENSP00000345013:V178M;ENSP00000397568:V178M	ENSP00000332180:V178M	V	-	1	0	0	CSF3R	36711764	36711764	0.188000	0.23250	0.026000	0.17262	0.003000	0.03518	0.000000	0.12993	0.159000	0.19401	-0.192000	0.12808	GTG	0.376916		TCGA-HV-A7OL-01A-11D-A33T-08	0.607	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.920000	-20.000000	1	0.370000	NM_156039		0	61	61	0	254	251	1		1	0		0	0	54	0	0	1.000000	1.750327e-01	0	0	0	4	0	61	254
ZC3H12A	80149	broad.mit.edu	37	1	37947303	37947303	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:37947303A>G	ENST00000373087.6	+	4	801	c.685A>G	c.(685-687)Att>Gtt	p.I229V		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGACAGATTCATTGTGAAGCT	0.572																																						ENST00000373087.6	1.000000	8.800000e-01	1.000000	9.700000e-01	0.990000	0.988538	0.990000	1.000000																										0				21						c.(685-687)Att>Gtt		zinc finger CCCH-type containing 12A							281.0	243.0	256.0					1																	37947303		2203	4300	6503	SO:0001583	missense	80149	0	0					g.chr1:37947303A>G		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.685A>G	chr1.hg19:g.37947303A>G	ENSP00000362179:p.Ile229Val	0						p.I229V	NM_025079.2	NP_079355.2	1	2	3	2.069750				4	801	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)		Missense_Mutation	SNP	ENST00000373087.6	1	1	hg19	c.685A>G	CCDS417.1	1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.753618	0.89753	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.56776	0.44	5.8	5.8	0.92144	5.8	5.8	0.92144	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.69833	0.3155	M	0.66939	2.045	0.80722	D	1	P	0.51351	0.944	D	0.64042	0.921	T	0.71258	-0.4646	10	0.54805	T	0.06	-24.1349	16.1549	0.81657	1.0:0.0:0.0:0.0	.	229	Q5D1E8	ZC12A_HUMAN	V	229	ENSP00000362179:I229V	ENSP00000362174:I229V	I	+	1	0	0	ZC3H12A	37719890	37719890	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.281000	0.95811	2.209000	0.71365	0.533000	0.62120	ATT	0.376916		TCGA-HV-A7OL-01A-11D-A33T-08	0.572	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.920000	-20.000000	1	0.370000	NM_025079		0	97	97	0	398	395	1		1	1		0	0	79	0	0	1.000000	6.120596e-01	0	5	0	5	0	97	398
OR11L1	391189	broad.mit.edu	37	1	248004586	248004586	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr1:248004586C>A	ENST00000355784.2	-	1	668	c.613G>T	c.(613-615)Gcc>Tcc	p.A205S		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	205						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A205S(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CACAGCACGGCAATTGACAGG	0.478																																						ENST00000355784.2	0.350000	1.300000e-01	0.280000	1.700000e-01	0.210000	0.234777	0.210000	0.220000																										1	Substitution - Missense(1)	p.A205S(1)	lung(1)	57						c.(613-615)Gcc>Tcc		olfactory receptor, family 11, subfamily L, member 1							90.0	92.0	91.0					1																	248004586		2203	4300	6503	SO:0001583	missense	391189	0	0					g.chr1:248004586C>A	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.613G>T	chr1.hg19:g.248004586C>A	ENSP00000348033:p.Ala205Ser	0						p.A205S	NM_001001959.1	NP_001001959.1	1	2	3	2.045144	Q8NGX0	O11L1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)	1	668	-	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)			Missense_Mutation	SNP	ENST00000355784.2	1	1	hg19	c.613G>T	CCDS31098.1	0	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399533	0.25291	.	.	ENSG00000197591	ENST00000355784	T	0.37058	1.22	4.27	3.35	0.38373	4.27	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34268	U	0.004118	T	0.25494	0.0620	N	0.17312	0.475	0.09310	N	1	P	0.42993	0.797	P	0.47346	0.544	T	0.04495	-1.0947	10	0.46703	T	0.11	.	5.0642	0.14574	0.0:0.5142:0.2962:0.1896	.	205	Q8NGX0	O11L1_HUMAN	S	205	ENSP00000348033:A205S	ENSP00000348033:A205S	A	-	1	0	0	OR11L1	246071209	246071209	0.000000	0.05858	0.013000	0.15412	0.246000	0.25737	-0.791000	0.04599	1.145000	0.42336	0.543000	0.68304	GCC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.478	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	1.920000	-4.268643	1	0.370000	NM_001001959		0	18	19	0	432	425	0		1			0	0	80	0	0	0.999981	0	0	0	0	0	0	18	432
ADA	100	broad.mit.edu	37	20	43257762	43257762	+	Silent	SNP	G	G	A	rs189751145	byFrequency	TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr20:43257762G>A	ENST00000372874.4	-	3	278	c.144C>T	c.(142-144)aaC>aaT	p.N48N	ADA_ENST00000464097.1_5'Flank|ADA_ENST00000537820.1_Silent_p.N48N	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase	48					adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	TGCCAATGACGTTCAGCAGCC	0.592									Adenosine Deaminase Deficiency				G|||	3	0.000599042	0.0	0.0014	5008	,	,		19734	0.001		0.001	False		,,,				2504	0.0					ENST00000372874.4	0.150000	2.000000e-02	0.110000	4.000000e-02	0.070000	0.082965	0.070000	0.080000																										0				18						c.(142-144)aaC>aaT		adenosine deaminase	Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)						156.0	103.0	121.0					20																	43257762		2203	4300	6503	SO:0001819	synonymous_variant	100	22	121412	45	Adenosine Deaminase Deficiency	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	g.chr20:43257762G>A	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.144C>T	chr20.hg19:g.43257762G>A		0					ADA_ENST00000537820.1_Silent_p.N48N|ADA_ENST00000464097.1_5'Flank	p.N48N	NM_000022.2	NP_000013.2	0	0	0	2.007960	P00813	ADA_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)	3	278	-		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	Q53F92|Q6LA59	Silent	SNP	ENST00000372874.4	0	1	hg19	c.144C>T	CCDS13335.1	0																																																																																								0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.592	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080509.2	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.920000	-3.023610	1	0.370000	NM_000022		0	6	5	0	443	439	0		1	0		0	0	64	0	0	0.963727	1.023690e-01	0	0	0	34	0	6	443
RASSF2	9770	broad.mit.edu	37	20	4771183	4771183	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr20:4771183G>A	ENST00000379400.3	-	7	646	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C	RASSF2_ENST00000478553.1_5'UTR|RASSF2_ENST00000379376.2_Missense_Mutation_p.R151C	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	151					bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						TTGCCACGGCGACGCACCCCA	0.592																																					Melanoma(158;1891 3343 50738)	ENST00000379400.3	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999802	0.990000	1.000000																										0				34						c.(451-453)Cgc>Tgc		Ras association (RalGDS/AF-6) domain family member 2							101.0	76.0	84.0					20																	4771183		2203	4300	6503	SO:0001583	missense	9770	12	121410	38				g.chr20:4771183G>A	D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.451C>T	chr20.hg19:g.4771183G>A	ENSP00000368710:p.Arg151Cys	0					RASSF2_ENST00000478553.1_5'UTR|RASSF2_ENST00000379376.2_Missense_Mutation_p.R151C	p.R151C	NM_014737.2	NP_055552.1	0	0	0	2.007960	P50749	RASF2_HUMAN		7	646	-			A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	1	1	hg19	c.451C>T	CCDS13083.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097623	0.76870	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.16897	2.31;2.31	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.44329	0.1288	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.45381	-0.9265	10	0.87932	D	0	.	12.5495	0.56218	0.0:0.0:0.8336:0.1664	.	151	P50749	RASF2_HUMAN	C	151	ENSP00000368710:R151C;ENSP00000368684:R151C	ENSP00000368684:R151C	R	-	1	0	0	RASSF2	4719183	4719183	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.709000	0.61867	2.706000	0.92434	0.563000	0.77884	CGC	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.592	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077828.1	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.920000	-20.000000	1	0.370000	NM_014737		0	54	54	0	154	152	1		1	0		0	0	25	0	0	1.000000	6.885451e-02	0	0	0	2	0	54	154
PABPC1L	80336	broad.mit.edu	37	20	43545506	43545506	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr20:43545506G>A	ENST00000217073.2	+	3	497	c.497G>A	c.(496-498)cGc>cAc	p.R166H	PABPC1L_ENST00000537323.1_Missense_Mutation_p.R166H|PABPC1L_ENST00000255136.3_Missense_Mutation_p.R166H|PABPC1L_ENST00000217074.4_Missense_Mutation_p.R166H			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	166	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R166H(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						CTGAATGACCGCAAAGTGTGA	0.592																																						ENST00000217073.2	0.160000	3.000000e-02	0.120000	5.000000e-02	0.080000	0.093162	0.080000	0.080000																										1	Substitution - Missense(1)	p.R166H(1)	kidney(1)	20						c.(496-498)cGc>cAc		poly(A) binding protein, cytoplasmic 1-like							81.0	74.0	76.0					20																	43545506		1568	3582	5150	SO:0001583	missense	80336	0	0					g.chr20:43545506G>A	AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.497G>A	chr20.hg19:g.43545506G>A	ENSP00000217073:p.Arg166His	0					PABPC1L_ENST00000255136.3_Missense_Mutation_p.R166H|PABPC1L_ENST00000217074.4_Missense_Mutation_p.R166H|PABPC1L_ENST00000537323.1_Missense_Mutation_p.R166H	p.R166H			0	0	0	2.007960	Q4VXU2	PAP1L_HUMAN		3	497	+			Q4VY17	Missense_Mutation	SNP	ENST00000217073.2	0	1	hg19	c.497G>A	CCDS42878.1	0	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878785	0.72294	.	.	ENSG00000101104	ENST00000217074;ENST00000255136;ENST00000537323;ENST00000217073	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	5.11	4.15	0.48705	5.11	4.15	0.48705	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	M	0.70787	2.145	0.58432	D	0.999999	P	0.43431	0.807	B	0.28638	0.092	D	0.90597	0.4541	10	0.66056	D	0.02	.	13.9611	0.64180	0.0751:0.0:0.9249:0.0	.	166	Q4VXU2	PAP1L_HUMAN	H	166	ENSP00000217074:R166H;ENSP00000255136:R166H;ENSP00000445661:R166H;ENSP00000217073:R166H	ENSP00000217073:R166H	R	+	2	0	0	PABPC1L	42978920	42978920	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.896000	0.87350	2.375000	0.81037	0.563000	0.77884	CGC	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.592	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2	0	0	1	2	2	2	2	0	0	0	0	70	70	70	68	1	1.920000	-2.123705	0	0.370000			0	7	7	0	450	444	0		1	0		0	0	70	0	0	0.979840	0	0	0	0	1	0	7	450
ZNF217	7764	broad.mit.edu	37	20	52198591	52198591	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr20:52198591G>A	ENST00000371471.2	-	2	1200	c.775C>T	c.(775-777)Ccg>Tcg	p.P259S	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.P259S			O75362	ZN217_HUMAN	zinc finger protein 217	259					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CTCGAGGACGGCATTCCTCCT	0.512																																						ENST00000371471.2	0.090000	0	0.070000	2.000000e-02	0.040000	0.050421	0.040000	0.040000																										0				50						c.(775-777)Ccg>Tcg		zinc finger protein 217							102.0	97.0	99.0					20																	52198591		2203	4300	6503	SO:0001583	missense	7764	1	121412	41				g.chr20:52198591G>A	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.775C>T	chr20.hg19:g.52198591G>A	ENSP00000360526:p.Pro259Ser	0					ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.P259S	p.P259S			0	0	0	2.007960	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)	2	1200	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	0	1	hg19	c.775C>T	CCDS13443.1	0	.	.	.	.	.	.	.	.	.	.	G	1.632	-0.518688	0.04171	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.08634	3.07;3.07	5.46	-0.716	0.11212	5.46	-0.716	0.11212	.	0.952709	0.08770	N	0.896438	T	0.05686	0.0149	L	0.33485	1.01	0.09310	N	1	B	0.12630	0.006	B	0.15052	0.012	T	0.43734	-0.9373	10	0.33141	T	0.24	-5.7251	2.3642	0.04315	0.1675:0.1085:0.1954:0.5286	.	259	O75362	ZN217_HUMAN	S	259	ENSP00000360526:P259S;ENSP00000304308:P259S	ENSP00000304308:P259S	P	-	1	0	0	ZNF217	51631998	51631998	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.254000	0.08781	0.235000	0.21160	0.591000	0.81541	CCG	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.512	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	0	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	1.920000	-2.016677	0	0.370000	NM_006526		0	6	6	0	735	726	0		1			0	0	95	0	0	0.963714	0	0	0	0	0	0	6	735
ADRM1	11047	broad.mit.edu	37	20	60883799	60883800	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr20:60883799_60883800GG>TT	ENST00000253003.2	+	10	1252_1253	c.1206_1207GG>TT	c.(1204-1209)gaGGac>gaTTac	p.402_403ED>DY	RP11-157P1.4_ENST00000414042.1_RNA|LAMA5_ENST00000492698.1_Intron	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	402	Interaction with UCHL5.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			ACGAAGAGGAGGACATGAGCCT	0.559																																						ENST00000253003.2	1.000000	6.100000e-01|6.300000e-01	1.000000	7.200000e-01|7.500000e-01	0.850000|0.890000	0.854956|0.881670	0.850000|0.890000	1.000000																										0				5						c.(1204-1206)gaG>gaT|c.(1207-1209)Gac>Tac		adhesion regulating molecule 1																																				SO:0001583	missense	11047	0	0					g.chr20:60883799G>T|g.chr20:60883800G>T	D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	Exception_encountered	chr20.hg19:g.60883799_60883800delinsTT	ENSP00000253003:p.E402_D403delinsDY	0					RP11-157P1.4_ENST00000414042.1_RNA|LAMA5_ENST00000492698.1_Intron	p.E402D|p.D403Y	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	0	0	0	2.007960	Q16186	ADRM1_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.51e-06)	10	1252|1253	+	Breast(26;7.76e-09)		A0PKB1|Q96FJ7|Q9H1P2	Missense_Mutation	SNP	ENST00000253003.2	1	1	hg19	c.1206G>T|c.1207G>T	CCDS13496.1	1																									5.74	-2.65|4.78	0.06095|0.61160																																												2|0			60317194|60317195														0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.559	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080007.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.920000	-3.357177|-18.388050	1	0.370000			0	32	32	0	168|160	165|157	1		1	1		0	0	28	0	0	1.000000	1	0	296|295	0	637|642	0	32	160
C20orf195	79025	broad.mit.edu	37	20	62187669	62187669	+	Missense_Mutation	SNP	C	C	T	rs117659219	byFrequency	TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr20:62187669C>T	ENST00000370098.3	+	2	745	c.653C>T	c.(652-654)gCg>gTg	p.A218V	C20orf195_ENST00000370097.1_Missense_Mutation_p.A218V	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	218	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)				large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			AAGGCGTCGGCGGCTCACCAG	0.622													C|||	3	0.000599042	0.0	0.0014	5008	,	,		16878	0.0		0.002	False		,,,				2504	0.0					ENST00000370098.3	1.000000	7.900000e-01	0.970000	8.400000e-01	0.900000	0.909969	0.900000	1.000000																										0				7						c.(652-654)gCg>gTg		chromosome 20 open reading frame 195		C	VAL/ALA	0,4406		0,0,2203	93.0	98.0	96.0		653	3.2	1.0	20	dbSNP_132	96	6,8592	5.0+/-18.6	0,6,4293	yes	missense	C20orf195	NM_024059.2	64	0,6,6496	TT,TC,CC		0.0698,0.0,0.0461	benign	218/319	62187669	6,12998	2203	4299	6502	SO:0001583	missense	79025	22	121380	50				g.chr20:62187669C>T		CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.653C>T	chr20.hg19:g.62187669C>T	ENSP00000359116:p.Ala218Val	0					C20orf195_ENST00000370097.1_Missense_Mutation_p.A218V	p.A218V	NM_024059.2	NP_076964.1	0	0	0	2.007960	Q9BVV2	CT195_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)	2	745	+	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)			Missense_Mutation	SNP	ENST00000370098.3	1	1	hg19	c.653C>T	CCDS13526.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	2.207	-0.381718	0.04966	0.0	6.98E-4	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.47	3.22	0.36961	5.47	3.22	0.36961	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.731967	0.11933	N	0.515501	T	0.13030	0.0316	N	0.02539	-0.55	0.24278	N	0.995215	B	0.02656	0.0	B	0.01281	0.0	T	0.28267	-1.0049	9	0.02654	T	1	-20.5053	9.1521	0.36969	0.0:0.1496:0.0:0.8504	.	218	Q9BVV2	CT195_HUMAN	V	218	.	ENSP00000359115:A218V	A	+	2	0	0	C20orf195	61658113	61658113	1.000000	0.71417	0.996000	0.52242	0.671000	0.39405	2.401000	0.44513	0.393000	0.25203	-0.302000	0.09304	GCG	0.365303		TCGA-HV-A7OL-01A-11D-A33T-08	0.622	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	1	0	1	2	2	2	2	0	0	0	0	200	200	200	197	1	1.920000	-5.567785	1	0.370000	NM_024059		0	187	184	0	915	900	1		1	1		0	0	200	0	0	1.000000	3.399351e-01	0	4	0	3	0	187	915
UMODL1	89766	broad.mit.edu	37	21	43543258	43543258	+	Missense_Mutation	SNP	A	A	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr21:43543258A>C	ENST00000408910.2	+	17	3145	c.3145A>C	c.(3145-3147)Agc>Cgc	p.S1049R	UMODL1_ENST00000400427.1_Missense_Mutation_p.S1105R|UMODL1_ENST00000408989.2_Missense_Mutation_p.S1177R|UMODL1_ENST00000400424.2_Missense_Mutation_p.S977R|UMODL1_ENST00000400423.2_3'UTR	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1049	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CCTCATGCAGAGCGTAAGACC	0.622																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	ENST00000408910.2	1.000000	5.800000e-01	0.980000	6.900000e-01	0.820000	0.830640	0.820000	1.000000																										0				47						c.(3145-3147)Agc>Cgc		uromodulin-like 1							37.0	39.0	38.0					21																	43543258		2103	4211	6314	SO:0001583	missense	89766	0	0					g.chr21:43543258A>C		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3145A>C	chr21.hg19:g.43543258A>C	ENSP00000386147:p.Ser1049Arg	0					UMODL1_ENST00000400427.1_Missense_Mutation_p.S1105R|UMODL1_ENST00000408989.2_Missense_Mutation_p.S1177R|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000400424.2_Missense_Mutation_p.S977R	p.S1049R	NM_001004416.2	NP_001004416	1	2	3	2.037550	Q5DID0	UROL1_HUMAN		17	3145	+			C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	1	1	hg19	c.3145A>C	CCDS42936.1	0	.	.	.	.	.	.	.	.	.	.	A	13.74	2.328296	0.41197	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	3.13	3.13	0.36017	3.13	3.13	0.36017	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.506608	0.16330	N	0.219167	D	0.84772	0.5546	L	0.52266	1.64	0.38979	D	0.958909	D;D	0.76494	0.999;0.999	D;D	0.73708	0.976;0.981	D	0.83927	0.0304	9	.	.	.	-11.4154	10.9262	0.47191	1.0:0.0:0.0:0.0	.	1177;1049	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	R	1105;977;1177;1049	ENSP00000383279:S1105R;ENSP00000383276:S977R;ENSP00000386126:S1177R;ENSP00000386147:S1049R	.	S	+	1	0	0	UMODL1	42416327	42416327	1.000000	0.71417	0.959000	0.39883	0.192000	0.23643	4.772000	0.62324	1.674000	0.50907	0.260000	0.18958	AGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.622	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.920000	-20.000000	1	0.370000			0	30	30	0	166	165	1		1			0	0	32	0	0	1.000000	0	0	0	0	0	0	30	166
ODC1	4953	broad.mit.edu	37	2	10583672	10583672	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:10583672C>T	ENST00000234111.4	-	7	1120	c.610G>A	c.(610-612)Gat>Aat	p.D204N	ODC1_ENST00000405333.1_Missense_Mutation_p.D204N|ODC1_ENST00000446285.1_5'Flank	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	204					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	GTCTCAGGATCGGTACAGCCG	0.478																																						ENST00000234111.4	0.990000	6.500000e-01	0.900000	7.300000e-01	0.810000	0.818004	0.810000	0.810000																										0				19						c.(610-612)Gat>Aat		ornithine decarboxylase 1	Spermine(DB00127)						77.0	80.0	79.0					2																	10583672		2203	4300	6503	SO:0001583	missense	4953	9	121412	43				g.chr2:10583672C>T		CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.610G>A	chr2.hg19:g.10583672C>T	ENSP00000234111:p.Asp204Asn	0					ODC1_ENST00000446285.1_5'Flank|ODC1_ENST00000405333.1_Missense_Mutation_p.D204N	p.D204N	NM_002539.1	NP_002530.1	1	2	3	2.038702	P11926	DCOR_HUMAN		7	1120	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		Q53TU3|Q6LDS9	Missense_Mutation	SNP	ENST00000234111.4	1	1	hg19	c.610G>A	CCDS1672.1	0	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174909	0.78564	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.52754	0.65;0.65	5.79	4.88	0.63580	5.79	4.88	0.63580	Orn/DAP/Arg decarboxylase 2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48447	0.1500	L	0.61218	1.895	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.46512	-0.9186	10	0.51188	T	0.08	.	16.9563	0.86260	0.0:0.873:0.127:0.0	.	204	P11926	DCOR_HUMAN	N	204;204;75	ENSP00000234111:D204N;ENSP00000385333:D204N	ENSP00000234111:D204N	D	-	1	0	0	ODC1	10501123	10501123	1.000000	0.71417	0.912000	0.35992	0.934000	0.57294	4.734000	0.62043	2.746000	0.94184	0.655000	0.94253	GAT	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.478	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2	0	0	1	2	19	5	2	1	1	1	1	94	94	94	94	1	1.920000	-3.222531	1	0.370000			0	83	82	0	469	465	1		1	1		1	0	94	0	0	1.000000	9.934840e-01	0	13	0	67	0	83	469
FOXD4L1	200350	broad.mit.edu	37	2	114257073	114257073	+	Silent	SNP	C	C	T	rs374836136		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:114257073C>T	ENST00000306507.5	+	1	413	c.240C>T	c.(238-240)agC>agT	p.S80S		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	80					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						GCGGCCCGAGCGACCCCTCAG	0.697																																						ENST00000306507.5	0.160000	2.000000e-02	0.120000	4.000000e-02	0.070000	0.085640	0.070000	0.080000																										0				26						c.(238-240)agC>agT		forkhead box D4-like 1		C		1,4309		0,1,2154	45.0	65.0	59.0		240	-1.0	0.0	2		59	4,8362		0,4,4179	no	coding-synonymous	FOXD4L1	NM_012184.4		0,5,6333	TT,TC,CC		0.0478,0.0232,0.0394		80/409	114257073	5,12671	2155	4183	6338	SO:0001819	synonymous_variant	200350	20	117044	31				g.chr2:114257073C>T	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.240C>T	chr2.hg19:g.114257073C>T		0						p.S80S	NM_012184.4	NP_036316.1	1	2	3	2.038702	Q9NU39	FX4L1_HUMAN		1	413	+			B3KWN1|B9EGF3	Silent	SNP	ENST00000306507.5	0	1	hg19	c.240C>T	CCDS2117.1	0																																																																																								0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.697	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1	0	0	1	2	14	2	2	1	1	1	1	77	77	77	92	1	1.920000	-1.988555	0	0.370000	NM_012184		0	6	6	0	433	346	0		0			1	0	77	0	0	0.017749	0	0	0	0	0	0	6	433
GORASP2	26003	broad.mit.edu	37	2	171818252	171818252	+	Silent	SNP	A	A	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:171818252A>C	ENST00000234160.4	+	8	1718	c.903A>C	c.(901-903)acA>acC	p.T301T	GORASP2_ENST00000493692.1_3'UTR|GORASP2_ENST00000452526.2_Silent_p.T313T	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	301	Pro-rich.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						CAGCTACTACATTACCAGGTA	0.393																																						ENST00000234160.4	1.000000	8.300000e-01	1.000000	9.100000e-01	0.990000	0.968573	0.990000	1.000000																										0				14						c.(901-903)acA>acC		golgi reassembly stacking protein 2, 55kDa							231.0	195.0	207.0					2																	171818252		2203	4300	6503	SO:0001819	synonymous_variant	26003	0	0					g.chr2:171818252A>C		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.903A>C	chr2.hg19:g.171818252A>C		0					GORASP2_ENST00000493692.1_3'UTR|GORASP2_ENST00000452526.2_Silent_p.T313T	p.T301T	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	1	2	3	2.038702	Q9H8Y8	GORS2_HUMAN		8	1718	+			B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Silent	SNP	ENST00000234160.4	1	1	hg19	c.903A>C	CCDS33325.1	1																																																																																								0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.393	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.920000	-20.000000	1	0.370000			0	107	104	0	470	467	1		1	1		0	0	96	0	0	1.000000	9.999999e-01	0	34	0	65	0	107	470
ATL2	64225	broad.mit.edu	37	2	38525479	38525479	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:38525479G>A	ENST00000378954.4	-	12	1440	c.1439C>T	c.(1438-1440)gCg>gTg	p.A480V	ATL2_ENST00000419554.2_Missense_Mutation_p.A480V|ATL2_ENST00000539122.1_Missense_Mutation_p.A309V|ATL2_ENST00000406122.1_Missense_Mutation_p.A309V|ATL2_ENST00000452935.2_Missense_Mutation_p.A462V|ATL2_ENST00000332337.4_Missense_Mutation_p.A462V|ATL2_ENST00000546051.1_Missense_Mutation_p.A309V|ATL2_ENST00000402054.1_Missense_Mutation_p.A309V	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	480					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						AAACATGACCGCAAACAGTGT	0.408																																						ENST00000378954.4	0.170000	2.000000e-02	0.120000	5.000000e-02	0.080000	0.089478	0.080000	0.080000																										0				22						c.(1438-1440)gCg>gTg		atlastin GTPase 2							131.0	118.0	123.0					2																	38525479		2203	4300	6503	SO:0001583	missense	64225	1	121412	37				g.chr2:38525479G>A		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1439C>T	chr2.hg19:g.38525479G>A	ENSP00000368237:p.Ala480Val	0					ATL2_ENST00000402054.1_Missense_Mutation_p.A309V|ATL2_ENST00000546051.1_Missense_Mutation_p.A309V|ATL2_ENST00000406122.1_Missense_Mutation_p.A309V|ATL2_ENST00000452935.2_Missense_Mutation_p.A462V|ATL2_ENST00000332337.4_Missense_Mutation_p.A462V|ATL2_ENST00000539122.1_Missense_Mutation_p.A309V|ATL2_ENST00000419554.2_Missense_Mutation_p.A480V	p.A480V	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	1	2	3	2.038702	Q8NHH9	ATLA2_HUMAN		12	1440	-			B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	0	1	hg19	c.1439C>T	CCDS46260.1	0	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796474	0.50208	.	.	ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051	D;D;D;D;D;D;D;D	0.97138	-4.26;-4.26;-4.26;-4.26;-4.26;-4.26;-4.26;-4.26	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	L	0.31065	0.9	0.80722	D	1	P;B;P;B;B	0.49635	0.926;0.397;0.531;0.183;0.216	B;B;B;B;B	0.31495	0.115;0.062;0.131;0.08;0.05	D	0.91673	0.5352	10	0.18710	T	0.47	-14.909	19.0794	0.93175	0.0:0.0:1.0:0.0	.	309;462;462;480;480	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9	.;.;.;.;ATLA2_HUMAN	V	480;309;309;309;462;480;462;309	ENSP00000368237:A480V;ENSP00000385446:A309V;ENSP00000384062:A309V;ENSP00000446192:A309V;ENSP00000333393:A462V;ENSP00000415336:A480V;ENSP00000390743:A462V;ENSP00000438938:A309V	ENSP00000333393:A462V	A	-	2	0	0	ATL2	38378983	38378983	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	6.583000	0.74053	2.746000	0.94184	0.591000	0.81541	GCG	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.408	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	0	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.920000	-2.398702	0	0.370000	NM_022374		0	6	6	0	414	405	0		1	0		0	0	79	0	0	0.962820	4.238820e-02	0	0	0	19	0	6	414
PSME4	23198	broad.mit.edu	37	2	54120082	54120082	+	Missense_Mutation	SNP	A	A	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:54120082A>T	ENST00000404125.1	-	36	4109	c.4054T>A	c.(4054-4056)Ttt>Att	p.F1352I	PSME4_ENST00000421748.2_Missense_Mutation_p.F496I	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1352					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.F1238V(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GCATCATCAAAATTCCTGAAT	0.363																																						ENST00000404125.1	1.000000	7.700000e-01	1.000000	8.800000e-01	0.990000	0.956310	0.990000	1.000000																										1	Substitution - Missense(1)	p.F1238V(1)	pancreas(1)	60						c.(4054-4056)Ttt>Att		proteasome (prosome, macropain) activator subunit 4							69.0	70.0	69.0					2																	54120082		2203	4300	6503	SO:0001583	missense	23198	0	0					g.chr2:54120082A>T	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.4054T>A	chr2.hg19:g.54120082A>T	ENSP00000384211:p.Phe1352Ile	0					PSME4_ENST00000421748.2_Missense_Mutation_p.F496I	p.F1352I	NM_014614.2	NP_055429.2	1	2	3	2.038702	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)	36	4109	-			Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	1	1	hg19	c.4054T>A	CCDS33197.2	1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.417319	0.83449	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.64438	-0.1;-0.1	5.51	5.51	0.81932	5.51	5.51	0.81932	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73233	0.3561	M	0.72118	2.19	0.80722	D	1	D;D;P	0.59357	0.985;0.959;0.954	P;P;P	0.59357	0.856;0.647;0.721	T	0.70230	-0.4929	10	0.15952	T	0.53	.	15.6258	0.76855	1.0:0.0:0.0:0.0	.	727;496;1352	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	I	496;1352	ENSP00000410830:F496I;ENSP00000384211:F1352I	ENSP00000384211:F1352I	F	-	1	0	0	PSME4	53973586	53973586	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.105000	0.64084	0.454000	0.30748	TTT	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.363	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	1	0	0	2	2	2	2	0	0	0	0	44	44	44	44	1	1.920000	-20.000000	1	0.370000	XM_040158		0	54	54	0	237	235	1		1	1		0	0	44	0	0	1.000000	2.373285e-01	0	3	0	2	0	54	237
TEKT4	150483	broad.mit.edu	37	2	95542419	95542419	+	Missense_Mutation	SNP	G	G	A	rs75603622	byFrequency	TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:95542419G>A	ENST00000295201.4	+	6	1350	c.1213G>A	c.(1213-1215)Gcc>Acc	p.A405T	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	405					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						GAAGGACATTGCCGCCATGAC	0.587													G|||	58	0.0115815	0.0045	0.0072	5008	,	,		18949	0.0179		0.005	False		,,,				2504	0.0245					ENST00000295201.4	1.000000	5.800000e-01	0.960000	6.900000e-01	0.820000	0.826537	0.820000	1.000000																										0				28						c.(1213-1215)Gcc>Acc		tektin 4							78.0	57.0	64.0					2																	95542419		2203	4300	6503	SO:0001583	missense	150483	494	121408	45				g.chr2:95542419G>A	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1213G>A	chr2.hg19:g.95542419G>A	ENSP00000295201:p.Ala405Thr	0					AC097374.2_ENST00000568768.1_RNA	p.A405T	NM_144705.2	NP_653306.1	1	2	3	2.038702	Q8WW24	TEKT4_HUMAN		6	1350	+				Missense_Mutation	SNP	ENST00000295201.4	0	0	hg19	c.1213G>A	CCDS2005.1	0	.	.	.	.	.	.	.	.	.	.	.	7.574	0.667319	0.14710	.	.	ENSG00000163060	ENST00000295201	T	0.02812	4.15	2.43	-2.21	0.06973	2.43	-2.21	0.06973	.	0.433987	0.24289	N	0.039834	T	0.04724	0.0128	M	0.89414	3.03	0.25870	N	0.983722	B	0.10296	0.003	B	0.15484	0.013	T	0.43360	-0.9396	10	0.17832	T	0.49	-6.8803	6.926	0.24416	0.1368:0.0:0.6998:0.1633	rs3209453	405	Q8WW24	TEKT4_HUMAN	T	405	ENSP00000295201:A405T	ENSP00000295201:A405T	A	+	1	0	0	TEKT4	94906146	94906146	0.004000	0.15560	0.111000	0.21465	0.365000	0.29674	0.130000	0.15850	-0.321000	0.08627	-0.923000	0.02734	GCC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.587	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	1	0	0	2	2	2	2	0	0	0	0	26	26	26	25	1	1.920000	-0.553865	0	0.370000	NM_144705		0	33	10	0	184	181	1		1	1		0	0	26	0	0	1.000000	9.057854e-01	0	25	0	0	0	33	184
GPAT2	150763	broad.mit.edu	37	2	96690307	96690307	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:96690307G>A	ENST00000434632.1	-	16	1996	c.1537C>T	c.(1537-1539)Cgg>Tgg	p.R513W	GPAT2_ENST00000359548.4_Missense_Mutation_p.R513W|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.R442W|GPAT2_ENST00000377137.3_Missense_Mutation_p.R513W			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	513					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						ACGTGCGCCCGCAGCAGGCTC	0.642																																						ENST00000434632.1	0.140000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.072248	0.060000	0.060000																										0				16						c.(1537-1539)Cgg>Tgg		glycerol-3-phosphate acyltransferase 2, mitochondrial							45.0	52.0	50.0					2																	96690307		2091	4225	6316	SO:0001583	missense	150763	7	121098	40				g.chr2:96690307G>A	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1537C>T	chr2.hg19:g.96690307G>A	ENSP00000389395:p.Arg513Trp	0					GPAT2_ENST00000453542.1_Missense_Mutation_p.R442W|GPAT2_ENST00000359548.4_Missense_Mutation_p.R513W|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000377137.3_Missense_Mutation_p.R513W	p.R513W			1	2	3	2.038702	Q6NUI2	GPAT2_HUMAN		16	1996	-			Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	0	1	hg19	c.1537C>T	CCDS42714.1	0	.	.	.	.	.	.	.	.	.	.	g	14.62	2.588560	0.46110	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542;ENST00000377137	T;T;T;T	0.77877	-1.12;-1.12;-0.13;-1.13	4.63	3.66	0.41972	4.63	3.66	0.41972	.	0.754991	0.12365	N	0.475318	T	0.81730	0.4884	L	0.43152	1.355	0.32553	N	0.532168	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.998;1.0	D;P;P;P;D	0.66084	0.913;0.809;0.847;0.721;0.941	T	0.81138	-0.1069	10	0.66056	D	0.02	-5.7184	9.2268	0.37412	0.0:0.0:0.6973:0.3027	.	442;513;519;513;442	E9PE95;Q6NUI2-3;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;.;GPAT2_HUMAN;.	W	513;513;442;513	ENSP00000352547:R513W;ENSP00000389395:R513W;ENSP00000393770:R442W;ENSP00000366341:R513W	ENSP00000352547:R513W	R	-	1	2	2	GPAT2	96054034	96054034	0.001000	0.12720	0.992000	0.48379	0.233000	0.25261	0.401000	0.20948	0.964000	0.38108	0.637000	0.83480	CGG	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.642	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	72	1	1.920000	-2.913566	1	0.370000	NM_207328		0	5	5	0	441	435	0		1	0		0	0	73	0	0	0.935625	2.014839e-03	0	0	0	5	0	5	441
SPHKAP	80309	broad.mit.edu	37	2	228855826	228855826	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr2:228855826G>T	ENST00000392056.3	-	11	4895	c.4849C>A	c.(4849-4851)Cca>Aca	p.P1617T	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P1588T	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1617						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGACACTCTGGCTCCAGGTCA	0.557																																						ENST00000392056.3	1.000000	8.600000e-01	1.000000	9.700000e-01	0.990000	0.987004	0.990000	1.000000																										0				185						c.(4849-4851)Cca>Aca		SPHK1 interactor, AKAP domain containing							47.0	49.0	48.0					2																	228855826		2203	4300	6503	SO:0001583	missense	80309	1	121406	31				g.chr2:228855826G>T		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4849C>A	chr2.hg19:g.228855826G>T	ENSP00000375909:p.Pro1617Thr	0					SPHKAP_ENST00000344657.5_Missense_Mutation_p.P1588T	p.P1617T	NM_001142644.1	NP_001136116.1	0	0	0	2.022532	Q2M3C7	SPKAP_HUMAN		11	4895	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	1	1	hg19	c.4849C>A	CCDS46537.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053706	0.75960	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.05996	3.36;3.36	6.17	6.17	0.99709	6.17	6.17	0.99709	A-kinase anchor 110kDa, C-terminal (1);	0.167578	0.52532	D	0.000066	T	0.24353	0.0590	M	0.78049	2.395	0.48341	D	0.999631	D;D	0.76494	0.999;0.999	D;D	0.74674	0.961;0.984	T	0.00043	-1.2223	10	0.44086	T	0.13	.	13.0796	0.59107	0.0723:0.0:0.9277:0.0	.	1617;1588	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	T	1617;1588	ENSP00000375909:P1617T;ENSP00000339886:P1588T	ENSP00000339886:P1588T	P	-	1	0	0	SPHKAP	228564070	228564070	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.992000	0.63889	2.941000	0.99782	0.655000	0.94253	CCA	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.557	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	1	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	1.920000	-20.000000	1	0.370000	NM_030623		0	67	66	0	263	261	1		1			0	0	33	0	0	1.000000	0	0	0	0	0	0	67	263
CEP97	79598	broad.mit.edu	37	3	101446386	101446386	+	Splice_Site	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:101446386G>A	ENST00000341893.3	+	3	1097		c.e3+1		CEP97_ENST00000327230.4_Splice_Site|CEP97_ENST00000494050.1_Splice_Site			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa						cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						TAATCTTAAGGTGAATGGTTT	0.343																																						ENST00000341893.3	1.000000	7.300000e-01	1.000000	8.100000e-01	0.900000	0.905378	0.900000	1.000000																										0				29						c.e3+1		centrosomal protein 97kDa							125.0	127.0	126.0					3																	101446386		2203	4300	6503	SO:0001630	splice_region_variant	79598	1	121412	31				g.chr3:101446386G>A	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.345+1G>A	chr3.hg19:g.101446386G>A		0					CEP97_ENST00000327230.4_Splice_Site|CEP97_ENST00000494050.1_Splice_Site				1	2	3	2.039940	Q8IW35	CEP97_HUMAN		3	1097	+			B5MDY8|Q8NA71|Q9H5T9	Splice_Site	SNP	ENST00000341893.3	1	1	hg19		CCDS2944.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419147	0.83559	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	.	.	.	5.64	5.64	0.86602	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7156	0.96119	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	CEP97	102929076	102929076	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.703000	0.98714	2.658000	0.90341	0.655000	0.94253	.	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.343	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.920000	-20.000000	1	0.370000	NM_024548	Intron	0	75	74	0	372	369	0		1			0	0	48	0	0	1.000000	0	0	0	0	0	0	75	372
CPNE4	131034	broad.mit.edu	37	3	131442441	131442441	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:131442441C>T	ENST00000512055.1	-	7	2335	c.209G>A	c.(208-210)tGc>tAc	p.C70Y	CPNE4_ENST00000429747.1_Missense_Mutation_p.C70Y|CPNE4_ENST00000502818.1_Missense_Mutation_p.C88Y|CPNE4_ENST00000512332.1_Missense_Mutation_p.C88Y|CPNE4_ENST00000511604.1_Missense_Mutation_p.C70Y			Q96A23	CPNE4_HUMAN	copine IV	70	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TGGGTTTATGCAGGTGCGAAT	0.418																																						ENST00000512055.1	0.100000	0	0.070000	2.000000e-02	0.040000	0.061040	0.040000	0.040000																										0				39						c.(208-210)tGc>tAc		copine IV							111.0	111.0	111.0					3																	131442441		2203	4300	6503	SO:0001583	missense	131034	0	0					g.chr3:131442441C>T	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.209G>A	chr3.hg19:g.131442441C>T	ENSP00000421705:p.Cys70Tyr	0					CPNE4_ENST00000512332.1_Missense_Mutation_p.C88Y|CPNE4_ENST00000429747.1_Missense_Mutation_p.C70Y|CPNE4_ENST00000502818.1_Missense_Mutation_p.C88Y|CPNE4_ENST00000511604.1_Missense_Mutation_p.C70Y	p.C70Y			1	2	3	2.039940	Q96A23	CPNE4_HUMAN		7	2335	-			D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	0	1	hg19	c.209G>A	CCDS3072.1	0	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404858	0.62288	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818;ENST00000505881;ENST00000514999;ENST00000505957	T;T;T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07	5.38	5.38	0.77491	5.38	5.38	0.77491	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.120680	0.85682	D	0.000000	T	0.58524	0.2128	M	0.77616	2.38	0.49299	D	0.999775	B;B	0.30482	0.147;0.281	B;B	0.42495	0.221;0.389	T	0.61973	-0.6952	10	0.72032	D	0.01	-7.8453	19.1819	0.93627	0.0:1.0:0.0:0.0	.	88;70	Q96A23-2;Q96A23	.;CPNE4_HUMAN	Y	70;70;88;70;88;70;70;70	ENSP00000421705:C70Y;ENSP00000411904:C70Y;ENSP00000424853:C88Y;ENSP00000423811:C70Y;ENSP00000421646:C88Y;ENSP00000425506:C70Y;ENSP00000427561:C70Y;ENSP00000421394:C70Y	ENSP00000411904:C70Y	C	-	2	0	0	CPNE4	132925131	132925131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.896000	0.56266	2.542000	0.85734	0.555000	0.69702	TGC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.418	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.920000	-2.003323	0	0.370000	NM_130808		0	6	6	0	724	716	0		1			0	0	107	0	0	0.963854	0	0	0	0	0	0	6	724
ST6GAL1	6480	broad.mit.edu	37	3	186769122	186769122	+	Silent	SNP	G	G	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:186769122G>C	ENST00000169298.3	+	5	1367	c.693G>C	c.(691-693)ctG>ctC	p.L231L	ST6GAL1_ENST00000457772.2_5'UTR|ST6GAL1_ENST00000448044.1_Silent_p.L231L	NM_173216.2	NP_775323.1	P15907	SIAT1_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 1	231					cellular protein metabolic process (GO:0044267)|humoral immune response (GO:0006959)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)|sialyltransferase activity (GO:0008373)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		CCATTCGCCTGATGAACTCTC	0.453																																						ENST00000169298.3	0.700000	3.200000e-01	0.580000	3.900000e-01	0.470000	0.493781	0.470000	0.480000																										0				7						c.(691-693)ctG>ctC		ST6 beta-galactosamide alpha-2,6-sialyltranferase 1							107.0	95.0	99.0					3																	186769122		2203	4300	6503	SO:0001819	synonymous_variant	6480	0	0					g.chr3:186769122G>C	X62822	CCDS3285.1, CCDS46973.1	3q27-q28	2013-02-26	2003-01-14	2005-02-07	ENSG00000073849	ENSG00000073849	2.4.99.1		10860	protein-coding gene	gene with protein product	"""ST6Gal I"""	109675	"""sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)"""	SIAT1		2408023	Standard	NM_003032		Approved		uc003frd.3	P15907	OTTHUMG00000156500	ENST00000169298.3:c.693G>C	chr3.hg19:g.186769122G>C		0					ST6GAL1_ENST00000457772.2_5'UTR|ST6GAL1_ENST00000448044.1_Silent_p.L231L	p.L231L	NM_173216.2	NP_775323.1	1	2	3	2.039940	P15907	SIAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	5	1367	+	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		A8KA14|B2R513|D3DNV3	Silent	SNP	ENST00000169298.3	0	1	hg19	c.693G>C	CCDS3285.1	0																																																																																								0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.453	ST6GAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344399.1	0	0	1	2	2	2	2	0	0	0	0	46	46	46	45	1	1.920000	-9.658928	1	0.370000	NM_173216		0	26	25	0	270	266	0		1	0		0	0	46	0	0	1.000000	2.381361e-02	0	0	0	3	0	26	270
CDCP1	64866	broad.mit.edu	37	3	45153640	45153640	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:45153640T>C	ENST00000296129.1	-	3	724	c.590A>G	c.(589-591)cAc>cGc	p.H197R	CDCP1_ENST00000425231.2_Missense_Mutation_p.H197R|CDCP1_ENST00000490471.1_5'Flank	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	197						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		CCATGGGAGGTGTAAGGCCAT	0.522																																						ENST00000296129.1	0.180000	3.000000e-02	0.130000	5.000000e-02	0.080000	0.105593	0.080000	0.080000																										0				29						c.(589-591)cAc>cGc		CUB domain containing protein 1							166.0	158.0	161.0					3																	45153640		2203	4300	6503	SO:0001583	missense	64866	0	0					g.chr3:45153640T>C	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.590A>G	chr3.hg19:g.45153640T>C	ENSP00000296129:p.His197Arg	0					CDCP1_ENST00000425231.2_Missense_Mutation_p.H197R|CDCP1_ENST00000490471.1_5'Flank	p.H197R	NM_022842.3	NP_073753.3	1	2	3	2.039940	Q9H5V8	CDCP1_HUMAN		3	724	-			Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	0	1	hg19	c.590A>G	CCDS2727.1	0	.	.	.	.	.	.	.	.	.	.	T	14.05	2.419653	0.42918	.	.	ENSG00000163814	ENST00000296129;ENST00000425231	T;T	0.41065	1.92;1.01	5.42	4.25	0.50352	5.42	4.25	0.50352	.	0.712205	0.14693	N	0.304050	T	0.41050	0.1142	L	0.54323	1.7	0.27687	N	0.946243	B;B	0.30439	0.279;0.279	B;B	0.31101	0.124;0.124	T	0.34950	-0.9808	10	0.59425	D	0.04	.	12.6997	0.57024	0.0:0.0:0.1375:0.8625	.	197;197	Q9H5V8-3;Q9H5V8	.;CDCP1_HUMAN	R	197	ENSP00000296129:H197R;ENSP00000399342:H197R	ENSP00000296129:H197R	H	-	2	0	0	CDCP1	45128644	45128644	0.981000	0.34729	0.994000	0.49952	0.773000	0.43773	2.658000	0.46733	0.872000	0.35775	0.460000	0.39030	CAC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.522	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	0	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	1.920000	-3.025161	1	0.370000	NM_022842		0	8	8	0	493	488	0		1	0		0	0	82	0	0	0.989036	1.765649e-01	0	0	0	42	0	8	493
TLR9	54106	broad.mit.edu	37	3	52257640	52257640	+	Missense_Mutation	SNP	C	C	T	rs147300053		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:52257640C>T	ENST00000360658.2	-	2	1325	c.692G>A	c.(691-693)cGc>cAc	p.R231H	TLR9_ENST00000494383.1_Silent_p.P384P|TLR9_ENST00000597542.1_Missense_Mutation_p.R255H	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	231					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	TTTGACGATGCGGTTGTAGGA	0.617																																						ENST00000360658.2	0.300000	3.000000e-02	0.200000	7.000000e-02	0.120000	0.147746	0.120000	0.120000																										0				30						c.(691-693)cGc>cAc		toll-like receptor 9	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	C	HIS/ARG	0,4406		0,0,2203	40.0	30.0	33.0		692	-8.8	0.2	3	dbSNP_134	33	3,8597	2.2+/-6.3	0,3,4297	no	missense	TLR9	NM_017442.3	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign	231/1033	52257640	3,13003	2203	4300	6503	SO:0001583	missense	54106	3	121284	36				g.chr3:52257640C>T	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.692G>A	chr3.hg19:g.52257640C>T	ENSP00000353874:p.Arg231His	0					TLR9_ENST00000494383.1_Silent_p.P384P|TLR9_ENST00000597542.1_Missense_Mutation_p.R255H	p.R231H	NM_017442.3	NP_059138.1	1	2	3	2.039940	Q9NR96	TLR9_HUMAN		2	1325	-			B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	0	1	hg19	c.692G>A	CCDS2848.1	0	.	.	.	.	.	.	.	.	.	.	C	8.690	0.907217	0.17833	0.0	3.49E-4	ENSG00000239732	ENST00000360658	T	0.58210	0.35	5.38	-8.75	0.00834	5.38	-8.75	0.00834	.	0.955010	0.08543	N	0.930202	T	0.34337	0.0894	L	0.35288	1.05	0.09310	N	0.999997	B;B	0.11235	0.002;0.004	B;B	0.06405	0.002;0.002	T	0.22347	-1.0219	10	0.25106	T	0.35	.	12.031	0.53397	0.1005:0.6148:0.0:0.2847	.	328;231	B4E0A1;Q9NR96	.;TLR9_HUMAN	H	231	ENSP00000353874:R231H	ENSP00000353874:R231H	R	-	2	0	0	TLR9	52232680	52232680	0.003000	0.15002	0.245000	0.24217	0.163000	0.22366	-0.725000	0.04942	-1.469000	0.01890	-0.982000	0.02568	CGC	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.617	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1	0	0	1	2	2	2	2	0	0	0	0	36	36	36	35	1	1.920000	-3.305162	1	0.370000			0	4	4	0	187	185	0		1	0		0	0	36	0	0	0.888765	4.580858e-03	0	0	0	4	0	4	187
STAB1	23166	broad.mit.edu	37	3	52551596	52551596	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:52551596G>A	ENST00000321725.6	+	44	4670	c.4594G>A	c.(4594-4596)Ggg>Agg	p.G1532R		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1532	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGGTTACAGCGGGGATGGCAT	0.622																																						ENST00000321725.6	1.000000	7.500000e-01	1.000000	8.500000e-01	0.960000	0.941527	0.960000	1.000000																										0				76						c.(4594-4596)Ggg>Agg		stabilin 1							49.0	51.0	50.0					3																	52551596		2202	4299	6501	SO:0001583	missense	23166	0	0					g.chr3:52551596G>A	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.4594G>A	chr3.hg19:g.52551596G>A	ENSP00000312946:p.Gly1532Arg	0						p.G1532R	NM_015136.2	NP_055951.2	1	2	3	2.039940	Q9NY15	STAB1_HUMAN		44	4670	+			A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	1	1	hg19	c.4594G>A	CCDS33768.1	1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965659	0.74131	.	.	ENSG00000010327	ENST00000321725	D	0.93953	-3.32	4.81	4.81	0.61882	4.81	4.81	0.61882	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.485095	0.20593	N	0.089304	D	0.96445	0.8840	M	0.81942	2.565	0.46336	D	0.998995	D	0.89917	1.0	D	0.72982	0.979	D	0.96640	0.9473	10	0.62326	D	0.03	.	14.9699	0.71226	0.0:0.0:1.0:0.0	.	1532	Q9NY15	STAB1_HUMAN	R	1532	ENSP00000312946:G1532R	ENSP00000312946:G1532R	G	+	1	0	0	STAB1	52526636	52526636	1.000000	0.71417	0.984000	0.44739	0.352000	0.29268	3.707000	0.54838	2.380000	0.81148	0.655000	0.94253	GGG	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.622	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.920000	-3.052333	1	0.370000	NM_015136		0	59	59	0	271	269	1		1	0		0	0	53	0	0	1.000000	2.246025e-01	0	0	0	5	0	59	271
VGLL3	389136	broad.mit.edu	37	3	87017871	87017871	+	Missense_Mutation	SNP	G	G	A	rs368641887	byFrequency	TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:87017871G>A	ENST00000398399.2	-	3	1169	c.806C>T	c.(805-807)gCg>gTg	p.A269V	VGLL3_ENST00000383698.3_Missense_Mutation_p.A269V	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		AATCCTGGCCGCATGCACTGA	0.572													G|||	3	0.000599042	0.0	0.0	5008	,	,		17341	0.0		0.0	False		,,,				2504	0.0031					ENST00000398399.2	0.260000	3.000000e-02	0.180000	6.000000e-02	0.100000	0.129861	0.100000	0.100000																										0				19						c.(805-807)gCg>gTg		vestigial-like family member 3		G	VAL/ALA	0,4276		0,0,2138	69.0	70.0	70.0		806	5.7	0.5	3		70	1,8499		0,1,4249	no	missense	VGLL3	NM_016206.2	64	0,1,6387	AA,AG,GG		0.0118,0.0,0.0078	possibly-damaging	269/327	87017871	1,12775	2138	4250	6388	SO:0001583	missense	389136	13	121192	41				g.chr3:87017871G>A	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.806C>T	chr3.hg19:g.87017871G>A	ENSP00000381436:p.Ala269Val	0					VGLL3_ENST00000383698.3_Missense_Mutation_p.A269V	p.A269V	NM_016206.2	NP_057290.2	1	2	3	2.039940				3	1169	-	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		Missense_Mutation	SNP	ENST00000398399.2	0	1	hg19	c.806C>T	CCDS43110.1	0	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945134	0.73672	0.0	1.18E-4	ENSG00000206538	ENST00000398399;ENST00000383698	T;T	0.52754	0.82;0.65	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.486738	0.20579	N	0.089580	T	0.44953	0.1318	L	0.54323	1.7	0.47949	D	0.99955	P	0.45428	0.858	B	0.35655	0.207	T	0.48917	-0.8992	10	0.45353	T	0.12	-0.046	19.446	0.94847	0.0:0.0:1.0:0.0	.	269	A8MV65	VGLL3_HUMAN	V	269	ENSP00000381436:A269V;ENSP00000373199:A269V	ENSP00000373199:A269V	A	-	2	0	0	VGLL3	87100561	87100561	0.956000	0.32656	0.475000	0.27278	0.820000	0.46376	6.223000	0.72257	2.709000	0.92574	0.561000	0.74099	GCG	0.372322		TCGA-HV-A7OL-01A-11D-A33T-08	0.572	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	0	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	1.920000	-2.918883	1	0.370000	NM_016206		0	4	4	0	216	213	0		1			0	0	40	0	0	0.887917	0	0	0	0	0	0	4	216
MUC4	4585	broad.mit.edu	37	3	195517556	195517556	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr3:195517556T>A	ENST00000463781.3	-	2	1354	c.895A>T	c.(895-897)Aca>Tca	p.T299S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T299S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	304					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATCAAATGTTACTAAGGCT	0.483																																						ENST00000463781.3	0.160000	3.000000e-02	0.120000	5.000000e-02	0.080000	0.091528	0.080000	0.080000																										0				51						c.(895-897)Aca>Tca		mucin 4, cell surface associated							185.0	173.0	176.0					3																	195517556		1997	4171	6168	SO:0001583	missense	4585	0	0					g.chr3:195517556T>A	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.895A>T	chr3.hg19:g.195517556T>A	ENSP00000417498:p.Thr299Ser	0					MUC4_ENST00000475231.1_Missense_Mutation_p.T299S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	p.T299S	NM_018406.6	NP_060876.5	0	1	1	2.023077	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	2	1354	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	0	1	hg19	c.895A>T	CCDS54700.1	0	.	.	.	.	.	.	.	.	.	.	-	6.636	0.485876	0.12641	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.54071	0.59;0.62	3.57	-2.63	0.06133	3.57	-2.63	0.06133	.	.	.	.	.	T	0.33030	0.0849	L	0.47190	1.495	0.09310	N	1	B;B	0.32781	0.259;0.384	B;B	0.25759	0.063;0.048	T	0.20140	-1.0284	9	0.15066	T	0.55	.	4.0135	0.09632	0.4013:0.1048:0.0:0.4939	.	299;304	E7ESK3;Q99102	.;MUC4_HUMAN	S	299;299;273	ENSP00000417498:T299S;ENSP00000420243:T299S	ENSP00000376209:T273S	T	-	1	0	0	MUC4	197001951	197001951	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.781000	0.04648	-0.425000	0.07371	-0.416000	0.06073	ACA	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.483	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	0	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	1.920000	-4.847725	1	0.370000	NM_018406		0	7	7	0	460	457	0		1			0	0	93	0	0	0.980318	0	0	0	0	0	0	7	460
ENAM	10117	broad.mit.edu	37	4	71508260	71508260	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr4:71508260C>A	ENST00000396073.3	+	9	1398	c.1117C>A	c.(1117-1119)Cgt>Agt	p.R373S	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	373					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			ACAAGTAGCTCGTCCAGGAAA	0.438																																						ENST00000396073.3	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999257	0.990000	1.000000																										0				6						c.(1117-1119)Cgt>Agt		enamelin							109.0	114.0	112.0					4																	71508260		2203	4300	6503	SO:0001583	missense	10117	0	0					g.chr4:71508260C>A	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1117C>A	chr4.hg19:g.71508260C>A	ENSP00000379383:p.Arg373Ser	0					ENAM_ENST00000472903.1_Intron	p.R373S	NM_031889.2	NP_114095.2	1	2	3	2.061157	Q9NRM1	ENAM_HUMAN	Lung(101;0.235)	9	1398	+			Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	1	1	hg19	c.1117C>A	CCDS3544.2	1	.	.	.	.	.	.	.	.	.	.	C	9.070	0.996778	0.19043	.	.	ENSG00000132464	ENST00000396073	T	0.31510	1.49	5.93	1.05	0.20165	5.93	1.05	0.20165	.	0.946121	0.08814	N	0.889824	T	0.37489	0.1005	M	0.69358	2.11	0.09310	N	1	P	0.43024	0.798	P	0.48488	0.579	T	0.24083	-1.0170	10	0.48119	T	0.1	0.5722	4.3221	0.11022	0.4017:0.3948:0.1299:0.0735	.	373	Q9NRM1	ENAM_HUMAN	S	373	ENSP00000379383:R373S	ENSP00000379383:R373S	R	+	1	0	0	ENAM	71727124	71727124	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.768000	0.26590	-0.116000	0.11893	-0.182000	0.12963	CGT	0.375774		TCGA-HV-A7OL-01A-11D-A33T-08	0.438	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	1	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.920000	-3.713108	1	0.370000	NM_031889		0	168	166	0	632	627	1		1			0	0	99	0	0	1.000000	0	0	0	0	0	0	168	632
SLC12A7	10723	broad.mit.edu	37	5	1081769	1081769	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr5:1081769C>T	ENST00000264930.5	-	9	1263	c.1220G>A	c.(1219-1221)aGc>aAc	p.S407N		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	407					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGGCAGTGCGCTGGCACGGCT	0.657																																						ENST00000264930.5	0.150000	2.000000e-02	0.110000	4.000000e-02	0.060000	0.076868	0.060000	0.060000																										0				32						c.(1219-1221)aGc>aAc		solute carrier family 12 (potassium/chloride transporter), member 7	Potassium Chloride(DB00761)						99.0	87.0	91.0					5																	1081769		2203	4300	6503	SO:0001583	missense	10723	1	121362	28				g.chr5:1081769C>T	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1220G>A	chr5.hg19:g.1081769C>T	ENSP00000264930:p.Ser407Asn	0						p.S407N	NM_006598.2	NP_006589.2	1	2	3	2.038376	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)	9	1263	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	0	1	hg19	c.1220G>A	CCDS34129.1	0	.	.	.	.	.	.	.	.	.	.	C	4.580	0.107775	0.08780	.	.	ENSG00000113504	ENST00000264930	D	0.84442	-1.85	4.09	1.77	0.24775	4.09	1.77	0.24775	.	1.016290	0.07831	N	0.961315	T	0.77765	0.4179	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.58713	-0.7588	10	0.15066	T	0.55	.	8.0261	0.30438	0.0:0.5903:0.3043:0.1054	.	407	Q9Y666	S12A7_HUMAN	N	407	ENSP00000264930:S407N	ENSP00000264930:S407N	S	-	2	0	0	SLC12A7	1134769	1134769	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.155000	0.16362	0.686000	0.31488	0.491000	0.48974	AGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.657	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	0	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	1.920000	-4.826088	1	0.370000	NM_006598		0	5	5	0	414	410	0		1	0		0	0	51	0	0	0.936310	9.622736e-03	0	0	0	10	0	5	414
PCDHGA6	56109	broad.mit.edu	37	5	140755802	140755802	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr5:140755802C>T	ENST00000517434.1	+	1	2152	c.2152C>T	c.(2152-2154)Cgc>Tgc	p.R718C	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	718					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGACTGCAGCGCTGGCACAA	0.647																																						ENST00000517434.1	1.000000	9.100000e-01	1.000000	9.800000e-01	0.990000	0.992188	0.990000	1.000000																										0				2						c.(2152-2154)Cgc>Tgc		protocadherin gamma subfamily A, 6							85.0	94.0	91.0					5																	140755802		2203	4300	6503	SO:0001583	missense	56109	0	0					g.chr5:140755802C>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2152C>T	chr5.hg19:g.140755802C>T	ENSP00000429601:p.Arg718Cys	0					PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	p.R718C	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	1	2	3	2.030408	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2152	+			A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	1	1	hg19	c.2152C>T	CCDS54926.1	1	.	.	.	.	.	.	.	.	.	.	.	11.42	1.632413	0.29068	.	.	ENSG00000253731	ENST00000517434	T	0.23147	1.92	5.15	3.22	0.36961	5.15	3.22	0.36961	.	2.171190	0.04336	U	0.353247	T	0.40448	0.1117	M	0.86651	2.83	0.28148	N	0.929514	B;B	0.32010	0.351;0.047	B;B	0.29176	0.099;0.066	T	0.49679	-0.8914	10	0.72032	D	0.01	.	12.5336	0.56131	0.3755:0.6245:0.0:0.0	.	718;718	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	C	718	ENSP00000429601:R718C	ENSP00000429601:R718C	R	+	1	0	0	PCDHGA6	140735986	140735986	0.000000	0.05858	0.961000	0.40146	0.199000	0.23934	0.469000	0.22067	1.511000	0.48818	0.655000	0.94253	CGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.647	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	1	0	1	2	2	2	2	0	0	0	0	128	128	128	127	1	1.920000	-3.588126	1	0.370000	NM_018919		0	137	135	0	555	550	1		1			0	0	128	0	0	1.000000	0	0	0	0	0	0	137	555
ERBB2IP	55914	broad.mit.edu	37	5	65288599	65288599	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr5:65288599G>A	ENST00000284037.5	+	3	442	c.53G>A	c.(52-54)cGa>cAa	p.R18Q	ERBB2IP_ENST00000380943.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.R18Q	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	18					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CGCTGTCTACGAGGGGAAGAG	0.363																																						ENST00000284037.5	1.000000	7.700000e-01	1.000000	8.600000e-01	0.950000	0.938816	0.950000	1.000000																										0				36						c.(52-54)cGa>cAa		erbb2 interacting protein							135.0	134.0	134.0					5																	65288599		2203	4300	6503	SO:0001583	missense	55914	0	0					g.chr5:65288599G>A		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.53G>A	chr5.hg19:g.65288599G>A	ENSP00000284037:p.Arg18Gln	0					ERBB2IP_ENST00000416865.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.R18Q|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.R18Q	p.R18Q	NM_001253697.1	NP_001240626.1	1	2	3	2.038376	Q96RT1	LAP2_HUMAN		3	442	+		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	1	1	hg19	c.53G>A	CCDS58953.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.516152	0.96402	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T;T	0.40476	1.23;1.23;1.39;1.23;1.42;1.03;1.3;1.22;1.26;1.03	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.62085	0.2399	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.85130	0.922;0.997;0.934;0.996;0.99;0.992;0.983;0.994	T	0.64437	-0.6408	10	0.66056	D	0.02	.	18.6235	0.91330	0.0:0.0:1.0:0.0	.	18;18;18;18;18;18;18;18	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.;.	Q	18	ENSP00000284037:R18Q;ENSP00000370330:R18Q;ENSP00000397833:R18Q;ENSP00000370326:R18Q;ENSP00000370323:R18Q;ENSP00000370322:R18Q;ENSP00000370325:R18Q;ENSP00000422766:R18Q;ENSP00000426632:R18Q;ENSP00000422015:R18Q	ENSP00000284037:R18Q	R	+	2	0	0	ERBB2IP	65324355	65324355	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.756000	0.98918	2.388000	0.81334	0.655000	0.94253	CGA	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.363	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	1	0	1	2	2	2	2	0	0	0	0	81	81	81	80	1	1.920000	-2.966861	1	0.370000	NM_018695		0	87	86	0	406	401	1		1			0	0	81	0	0	1.000000	0	0	0	0	0	0	87	406
CNOT6	57472	broad.mit.edu	37	5	179992902	179992902	+	Silent	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr5:179992902G>A	ENST00000393356.1	+	9	1066	c.642G>A	c.(640-642)gcG>gcA	p.A214A	CNOT6_ENST00000261951.4_Silent_p.A214A			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	214	Nuclease domain. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		CATCATGGGCGCTAAACTGGG	0.418																																						ENST00000393356.1	0.140000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.069018	0.060000	0.060000																										0				23						c.(640-642)gcG>gcA		CCR4-NOT transcription complex, subunit 6							116.0	108.0	111.0					5																	179992902		2203	4300	6503	SO:0001819	synonymous_variant	57472	1	121412	35				g.chr5:179992902G>A	AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.642G>A	chr5.hg19:g.179992902G>A		0					CNOT6_ENST00000261951.4_Silent_p.A214A	p.A214A			1	2	3	2.030408	Q9ULM6	CNOT6_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	9	1066	+	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	A7MD46|D3DWR0	Silent	SNP	ENST00000393356.1	0	1	hg19	c.642G>A	CCDS4455.1	0																																																																																								0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.418	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.920000	-2.334326	0	0.370000	NM_015455		0	5	5	0	462	457	0		1	0		0	0	66	0	0	0.936073	0	0	0	0	1	0	5	462
ARG1	383	broad.mit.edu	37	6	131894445	131894445	+	Missense_Mutation	SNP	T	T	C	rs149310631		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr6:131894445T>C	ENST00000368087.3	+	1	162	c.23T>C	c.(22-24)aTa>aCa	p.I8T	ARG1_ENST00000498260.1_3'UTR|ARG1_ENST00000356962.2_Missense_Mutation_p.I8T			P05089	ARGI1_HUMAN	arginase 1	8					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|liver development (GO:0001889)|lung development (GO:0030324)|mammary gland involution (GO:0060056)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of endothelial cell proliferation (GO:0001938)|protein homotrimerization (GO:0070207)|regulation of L-arginine import (GO:0010963)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to herbicide (GO:0009635)|response to manganese ion (GO:0010042)|response to methylmercury (GO:0051597)|response to selenium ion (GO:0010269)|response to vitamin A (GO:0033189)|response to vitamin E (GO:0033197)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	arginase activity (GO:0004053)|manganese ion binding (GO:0030145)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|skin(3)	14	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	TCCAGAACCATAGGGATTATT	0.423																																						ENST00000368087.3	1.000000	8.100000e-01	0.990000	8.800000e-01	0.940000	0.942874	0.940000	0.990000																										0				14						c.(22-24)aTa>aCa		arginase 1	L-Ornithine(DB00129)						105.0	100.0	102.0					6																	131894445		2203	4300	6503	SO:0001583	missense	383	1	121412	35				g.chr6:131894445T>C		CCDS5145.1, CCDS59038.1	6q23	2013-05-01	2013-05-01		ENSG00000118520	ENSG00000118520	3.5.3.1		663	protein-coding gene	gene with protein product		608313	"""arginase, liver"""			22959135	Standard	NM_000045		Approved		uc003qcp.2	P05089	OTTHUMG00000015566	ENST00000368087.3:c.23T>C	chr6.hg19:g.131894445T>C	ENSP00000357066:p.Ile8Thr	1					ARG1_ENST00000498260.1_3'UTR|ARG1_ENST00000356962.2_Missense_Mutation_p.I8T	p.I8T			0	1	1	1.667650	P05089	ARGI1_HUMAN		1	162	+	Breast(56;0.0753)		A6NEA0|Q5JWT5|Q5JWT6|Q8TE72|Q9BS50	Missense_Mutation	SNP	ENST00000368087.3	1	1	hg19	c.23T>C	CCDS5145.1	1	.	.	.	.	.	.	.	.	.	.	T	8.586	0.883549	0.17467	.	.	ENSG00000118520	ENST00000368087;ENST00000356962;ENST00000476845	D;D;D	0.86366	-2.11;-2.11;-2.11	5.79	5.79	0.91817	5.79	5.79	0.91817	Ureohydrolase domain (1);	0.325628	0.33290	N	0.005063	D	0.84325	0.5447	M	0.82323	2.585	0.09310	N	0.999999	B;B	0.30793	0.251;0.295	B;B	0.40410	0.318;0.328	T	0.80315	-0.1434	10	0.56958	D	0.05	-5.487	8.5965	0.33718	0.0:0.085:0.0:0.915	.	8;8	P05089-2;P05089	.;ARGI1_HUMAN	T	8	ENSP00000357066:I8T;ENSP00000349446:I8T;ENSP00000417694:I8T	ENSP00000349446:I8T	I	+	2	0	0	ARG1	131936138	131936138	0.030000	0.19436	0.132000	0.22025	0.004000	0.04260	2.543000	0.45752	2.213000	0.71641	0.533000	0.62120	ATA	0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.423	ARG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042223.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.920000	-20.000000	1	0.370000			0	68	67	0	205	202	1		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	68	205
FAM135A	57579	broad.mit.edu	37	6	71232278	71232278	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr6:71232278C>T	ENST00000418814.2	+	13	1706	c.1092C>T	c.(1090-1092)taC>taT	p.Y364Y	FAM135A_ENST00000457062.2_Silent_p.Y347Y|FAM135A_ENST00000505769.1_Silent_p.Y364Y|FAM135A_ENST00000505868.1_Silent_p.Y364Y|FAM135A_ENST00000370479.3_Silent_p.Y347Y|FAM135A_ENST00000361499.3_Silent_p.Y364Y	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	364										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						CCATTGCATACCAGGAACTTC	0.333																																						ENST00000418814.2	1.000000	8.400000e-01	0.990000	9.000000e-01	0.950000	0.949985	0.950000	0.990000																										0				38						c.(1090-1092)taC>taT		family with sequence similarity 135, member A							110.0	117.0	115.0					6																	71232278		2203	4300	6503	SO:0001819	synonymous_variant	57579	0	0					g.chr6:71232278C>T	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.1092C>T	chr6.hg19:g.71232278C>T		1					FAM135A_ENST00000370479.3_Silent_p.Y347Y|FAM135A_ENST00000505769.1_Silent_p.Y364Y|FAM135A_ENST00000361499.3_Silent_p.Y364Y|FAM135A_ENST00000457062.2_Silent_p.Y347Y|FAM135A_ENST00000505868.1_Silent_p.Y364Y	p.Y364Y	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	0	1	1	1.667650	Q9P2D6	F135A_HUMAN		13	1706	+			A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Silent	SNP	ENST00000418814.2	1	1	hg19	c.1092C>T	CCDS55028.1	1																																																																																								0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.333	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	1	0	1	2	2	2	2	0	0	0	0	97	97	97	97	1	1.920000	-20.000000	1	0.370000	NM_020819		0	108	108	0	345	344	0		1			0	0	97	0	0	1.000000	0	0	0	0	0	0	108	345
RRAGD	58528	broad.mit.edu	37	6	90097155	90097155	+	Silent	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr6:90097155G>A	ENST00000369415.4	-	2	579	c.303C>T	c.(301-303)tgC>tgT	p.C101C	RRAGD_ENST00000492783.1_5'UTR|RRAGD_ENST00000359203.3_Intron	NM_021244.4	NP_067067.1			Ras-related GTP binding D									p.C101C(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		CATCTTCCCGGCATATCTTAT	0.428																																						ENST00000369415.4	0.070000	1.000000e-02	0.050000	2.000000e-02	0.030000	0.039388	0.030000	0.040000																										1	Substitution - coding silent(1)	p.C101C(1)	large_intestine(1)	15						c.(301-303)tgC>tgT		Ras-related GTP binding D							158.0	174.0	169.0					6																	90097155		2203	4300	6503	SO:0001819	synonymous_variant	58528	0	0					g.chr6:90097155G>A	AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.303C>T	chr6.hg19:g.90097155G>A		1					RRAGD_ENST00000492783.1_5'UTR|RRAGD_ENST00000359203.3_Intron	p.C101C	NM_021244.4	NP_067067.1	0	1	1	1.667650				2	579	-		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		Silent	SNP	ENST00000369415.4	0	1	hg19	c.303C>T	CCDS5022.1	0																																																																																								0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.428	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041484.1	0	0	1	2	2	2	2	0	0	0	0	172	172	172	171	1	1.920000	-1.953115	0	0.370000	NM_021244		0	8	9	0	993	981	0		1	0		0	0	172	0	0	0.988877	1.809577e-03	0	0	0	7	0	8	993
ECT2L	345930	broad.mit.edu	37	6	139206663	139206663	+	Silent	SNP	A	A	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr6:139206663A>C	ENST00000423192.1	+	16	2210	c.2049A>C	c.(2047-2049)gcA>gcC	p.A683A	ECT2L_ENST00000367682.2_Silent_p.A683A|ECT2L_ENST00000541398.1_Intron			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	683	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TGATACCAGCATTCCGAACTT	0.443			"""N, Splice, Mis"""		ETP ALL																																	ENST00000423192.1	0.140000	2.000000e-02	0.110000	4.000000e-02	0.070000	0.079176	0.070000	0.070000				Rec	yes			Rec	yes		6	6q24.1	6q24.1	345930	N, Splice, Mis	epithelial cell transforming sequence 2 oncogene-like				L	L			ETP ALL		0				30						c.(2047-2049)gcA>gcC		epithelial cell transforming 2 like							110.0	104.0	106.0					6																	139206663		1918	4121	6039	SO:0001819	synonymous_variant	345930	0	0					g.chr6:139206663A>C		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2049A>C	chr6.hg19:g.139206663A>C		1					ECT2L_ENST00000367682.2_Silent_p.A683A|ECT2L_ENST00000541398.1_Intron	p.A683A			0	1	1	1.667650	Q008S8	ECT2L_HUMAN		16	2210	+			B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	ENST00000423192.1	0	1	hg19	c.2049A>C	CCDS43508.1	0																																																																																								0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.443	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	0	0	0	2	18	2	2	1	1	1	1	70	70	70	70	1	1.920000	-6.459637	1	0.370000	NM_001077706		0	6	6	0	378	372	0		0	0		1	0	70	0	0	0.009128	0	0	0	0	1	0	6	378
PCOLCE	5118	broad.mit.edu	37	7	100204241	100204241	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr7:100204241C>T	ENST00000223061.5	+	6	1208	c.928C>T	c.(928-930)Cct>Tct	p.P310S	PCOLCE-AS1_ENST00000446022.1_RNA|PCOLCE-AS1_ENST00000442166.2_RNA	NM_002593.3	NP_002584.2	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	310					multicellular organismal development (GO:0007275)|positive regulation of peptidase activity (GO:0010952)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					AGAGGAATCTCCTTCAGCCCC	0.572																																						ENST00000223061.5	1.000000	6.900000e-01	1.000000	8.200000e-01	0.970000	0.932832	0.970000	1.000000																										0				23						c.(928-930)Cct>Tct		procollagen C-endopeptidase enhancer							30.0	32.0	31.0					7																	100204241		2203	4300	6503	SO:0001583	missense	5118	0	0					g.chr7:100204241C>T	L33799	CCDS5700.1	7q22	2008-07-18			ENSG00000106333	ENSG00000106333			8738	protein-coding gene	gene with protein product	"""procollagen, type 1, COOH-terminal proteinase enhancer"", ""procollagen C-proteinase enhancer 1"""	600270				8824813, 9799793	Standard	NM_002593		Approved	PCPE, PCPE1	uc003uvo.3	Q15113	OTTHUMG00000156675	ENST00000223061.5:c.928C>T	chr7.hg19:g.100204241C>T	ENSP00000223061:p.Pro310Ser	0					PCOLCE-AS1_ENST00000446022.1_RNA|PCOLCE-AS1_ENST00000442166.2_RNA	p.P310S	NM_002593.3	NP_002584.2	0	0	0	2.019785	Q15113	PCOC1_HUMAN		6	1208	+	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)		B2R9E1|O14550	Missense_Mutation	SNP	ENST00000223061.5	1	1	hg19	c.928C>T	CCDS5700.1	1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.429560	0.25726	.	.	ENSG00000106333	ENST00000223061	T	0.19938	2.11	4.69	3.78	0.43462	4.69	3.78	0.43462	.	0.932278	0.09080	N	0.851413	T	0.11580	0.0282	N	0.08118	0	0.18873	N	0.999988	B	0.23937	0.094	B	0.16722	0.016	T	0.22800	-1.0206	10	0.48119	T	0.1	-3.7786	7.9145	0.29810	0.0:0.8816:0.0:0.1184	.	310	Q15113	PCOC1_HUMAN	S	310	ENSP00000223061:P310S	ENSP00000223061:P310S	P	+	1	0	0	PCOLCE	100042177	100042177	0.001000	0.12720	0.003000	0.11579	0.007000	0.05969	1.043000	0.30316	1.134000	0.42165	0.407000	0.27541	CCT	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.572	PCOLCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345285.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.920000	-20.000000	1	0.370000	NM_002593		0	31	30	0	139	137	0		1	1		0	0	30	0	0	1.000000	1	0	8	0	534	0	31	139
POM121L12	285877	broad.mit.edu	37	7	53104235	53104235	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr7:53104235G>T	ENST00000408890.4	+	1	887	c.871G>T	c.(871-873)Gct>Tct	p.A291S		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	291										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CACCCAGTCTGCTGGCCCCTT	0.607																																						ENST00000408890.4	0.970000	6.000000e-01	0.880000	6.800000e-01	0.770000	0.786903	0.770000	0.770000																										0				61						c.(871-873)Gct>Tct		POM121 transmembrane nucleoporin-like 12							42.0	46.0	45.0					7																	53104235		1997	4169	6166	SO:0001583	missense	285877	0	0					g.chr7:53104235G>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.871G>T	chr7.hg19:g.53104235G>T	ENSP00000386133:p.Ala291Ser	0						p.A291S	NM_182595.3	NP_872401.3	0	0	0	2.019785	Q8N7R1	P1L12_HUMAN		1	887	+			Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	1	1	hg19	c.871G>T	CCDS43584.1	0	.	.	.	.	.	.	.	.	.	.	G	9.797	1.179487	0.21787	.	.	ENSG00000221900	ENST00000408890	T	0.26810	1.71	1.78	0.86	0.19042	1.78	0.86	0.19042	.	.	.	.	.	T	0.24122	0.0584	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.66602	0.945	T	0.12578	-1.0542	9	0.87932	D	0	.	6.0476	0.19768	0.0:0.3261:0.6739:0.0	.	291	Q8N7R1	P1L12_HUMAN	S	291	ENSP00000386133:A291S	ENSP00000386133:A291S	A	+	1	0	0	POM121L12	53071729	53071729	0.000000	0.05858	0.018000	0.16275	0.002000	0.02628	-0.523000	0.06230	0.316000	0.23135	-0.304000	0.09214	GCT	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.607	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.920000	-20.000000	1	0.370000	NM_182595		0	56	55	0	330	327	1		1			0	0	61	0	0	1.000000	0	0	0	0	0	0	56	330
COL1A2	1278	broad.mit.edu	37	7	94052353	94052353	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr7:94052353C>T	ENST00000297268.6	+	40	2959	c.2488C>T	c.(2488-2490)Cga>Tga	p.R830*		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	830			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TCCAGTTGGCCGAACTGGAGA	0.567										HNSCC(75;0.22)																												ENST00000297268.6	1.000000	9.000000e-01	1.000000	9.900000e-01	0.990000	0.992100	0.990000	1.000000																									COL1A2/PLAG1(3)	0				115						c.(2488-2490)Cga>Tga		collagen, type I, alpha 2	Collagenase(DB00048)						156.0	145.0	149.0					7																	94052353		2203	4300	6503	SO:0001587	stop_gained	1278	0	0					g.chr7:94052353C>T	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2488C>T	chr7.hg19:g.94052353C>T	ENSP00000297268:p.Arg830*	0	HNSCC(75;0.22)					p.R830*	NM_000089.3	NP_000080.2	0	0	0	2.019785	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)	40	2959	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Nonsense_Mutation	SNP	ENST00000297268.6	0	1	hg19	c.2488C>T	CCDS34682.1	1	.	.	.	.	.	.	.	.	.	.	C	44	11.258435	0.99538	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	.	.	.	5.23	4.34	0.51931	5.23	4.34	0.51931	.	0.146062	0.46758	D	0.000268	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5039	0.75722	0.1397:0.8603:0.0:0.0	.	.	.	.	X	830;831	.	ENSP00000297268:R830X	R	+	1	2	2	COL1A2	93890289	93890289	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	1.529000	0.35996	1.335000	0.45486	0.563000	0.77884	CGA	0.367660		TCGA-HV-A7OL-01A-11D-A33T-08	0.567	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.920000	-3.235997	1	0.370000	NM_000089		0	108	105	0	427	421	1		1	0		0	0	80	0	0	1.000000	1	0	1	0	1188	0	108	427
ABCB8	11194	broad.mit.edu	37	7	150741223	150741223	+	Missense_Mutation	SNP	G	G	A	rs575426628		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr7:150741223G>A	ENST00000297504.6	+	16	2048	c.1982G>A	c.(1981-1983)cGc>cAc	p.R661H	ABCB8_ENST00000498578.1_Missense_Mutation_p.R644H|ABCB8_ENST00000542328.1_Missense_Mutation_p.R556H|ABCB8_ENST00000358849.4_Missense_Mutation_p.R644H|ABCB8_ENST00000356058.4_3'UTR			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	661	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	AGTGCAGGCCGCACGGTGCTG	0.642																																						ENST00000297504.6	0.180000	2.000000e-02	0.130000	4.000000e-02	0.080000	0.090840	0.080000	0.080000																										0				26						c.(1981-1983)cGc>cAc		ATP-binding cassette, sub-family B (MDR/TAP), member 8	Doxorubicin(DB00997)						60.0	51.0	54.0					7																	150741223		2203	4299	6502	SO:0001583	missense	11194	2	121406	34				g.chr7:150741223G>A	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1982G>A	chr7.hg19:g.150741223G>A	ENSP00000297504:p.Arg661His	0					ABCB8_ENST00000542328.1_Missense_Mutation_p.R556H|ABCB8_ENST00000498578.1_Missense_Mutation_p.R644H|ABCB8_ENST00000358849.4_Missense_Mutation_p.R644H|ABCB8_ENST00000356058.4_3'UTR	p.R661H			1	2	3	2.033338	Q9NUT2	ABCB8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	16	2048	+			A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	0	1	hg19	c.1982G>A		0	.	.	.	.	.	.	.	.	.	.	G	33	5.237329	0.95240	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578	D;D;D;T	0.85088	-1.94;-1.94;-1.94;-0.67	4.79	4.79	0.61399	4.79	4.79	0.61399	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.90734	0.7092	M	0.65320	2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.996;0.998	D	0.90458	0.4444	10	0.49607	T	0.09	-2.0118	15.719	0.77694	0.0:0.0:1.0:0.0	.	556;644;661;644	G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2	.;.;ABCB8_HUMAN;.	H	644;627;661;556;644	ENSP00000351717:R644H;ENSP00000297504:R661H;ENSP00000438776:R556H;ENSP00000418271:R644H	ENSP00000297504:R661H	R	+	2	0	0	ABCB8	150372156	150372156	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.512000	0.60469	2.651000	0.90000	0.563000	0.77884	CGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.642	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	0	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	1.920000	-4.472165	1	0.370000	NM_007188		0	5	5	0	349	346	0		1	0		0	0	49	0	0	0.936564	6.280345e-01	0	0	0	137	0	5	349
MYOM2	9172	broad.mit.edu	37	8	2041801	2041801	+	Missense_Mutation	SNP	G	G	A	rs367658424		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr8:2041801G>A	ENST00000262113.4	+	17	2149	c.2008G>A	c.(2008-2010)Gtg>Atg	p.V670M	MYOM2_ENST00000523438.1_Missense_Mutation_p.V95M	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	670	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCTCAGGTTCGTGGTGCACGG	0.498													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18588	0.0		0.0	False		,,,				2504	0.0					ENST00000262113.4	1.000000	7.300000e-01	1.000000	8.200000e-01	0.920000	0.916391	0.920000	1.000000																										0				104						c.(2008-2010)Gtg>Atg		myomesin 2							141.0	115.0	124.0					8																	2041801		2203	4300	6503	SO:0001583	missense	9172	2	121412	37				g.chr8:2041801G>A		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2008G>A	chr8.hg19:g.2041801G>A	ENSP00000262113:p.Val670Met	0					MYOM2_ENST00000523438.1_Missense_Mutation_p.V95M	p.V670M	NM_003970.2	NP_003961.2	1	2	3	2.035597	P54296	MYOM2_HUMAN		17	2149	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	1	1	hg19	c.2008G>A	CCDS5957.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095427	0.76870	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.57595	0.39;0.39	5.44	4.57	0.56435	5.44	4.57	0.56435	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.065948	0.64402	D	0.000013	T	0.70307	0.3209	M	0.76328	2.33	0.41362	D	0.987435	D	0.76494	0.999	D	0.65443	0.935	T	0.75238	-0.3388	10	0.72032	D	0.01	.	14.5057	0.67750	0.071:0.0:0.929:0.0	.	670	P54296	MYOM2_HUMAN	M	670;95	ENSP00000262113:V670M;ENSP00000428396:V95M	ENSP00000262113:V670M	V	+	1	0	0	MYOM2	2029208	2029208	1.000000	0.71417	0.913000	0.36048	0.847000	0.48162	6.115000	0.71566	1.298000	0.44778	0.655000	0.94253	GTG	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.498	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.920000	-20.000000	1	0.370000	NM_003970		0	67	67	0	324	319	1		1			0	0	69	0	0	1.000000	0	0	0	0	0	0	67	324
LZTS1	11178	broad.mit.edu	37	8	20112535	20112535	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr8:20112535C>T	ENST00000381569.1	-	2	515	c.158G>A	c.(157-159)gGc>gAc	p.G53D	LZTS1_ENST00000265801.6_Missense_Mutation_p.G53D|LZTS1_ENST00000522290.1_Missense_Mutation_p.G53D			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	53					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GCTGGACTTGCCGTGACCGGA	0.577																																						ENST00000381569.1	0.120000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.060613	0.050000	0.050000																										0				29						c.(157-159)gGc>gAc		leucine zipper, putative tumor suppressor 1							94.0	88.0	90.0					8																	20112535		2203	4300	6503	SO:0001583	missense	11178	0	0					g.chr8:20112535C>T	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.158G>A	chr8.hg19:g.20112535C>T	ENSP00000370981:p.Gly53Asp	0					LZTS1_ENST00000265801.6_Missense_Mutation_p.G53D|LZTS1_ENST00000522290.1_Missense_Mutation_p.G53D	p.G53D			1	2	3	2.035597	Q9Y250	LZTS1_HUMAN		2	515	-			D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	0	1	hg19	c.158G>A	CCDS6015.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.43|15.43	2.830957|2.830957	0.50845|0.50845	.|.	.|.	ENSG00000061337|ENSG00000061337	ENST00000334294|ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	.|T;T;T	.|0.24151	.|2.2;2.2;1.87	5.98|5.98	5.98|5.98	0.97165|0.97165	5.98|5.98	5.98|5.98	0.97165|0.97165	.|.	.|0.457888	.|0.25601	.|N	.|0.029548	.|T	.|0.17577	.|0.0422	N|N	0.14661|0.14661	0.345|0.345	0.42195|0.42195	D|D	0.991743|0.991743	.|P;P	.|0.41366	.|0.589;0.747	.|B;B	.|0.39258	.|0.295;0.255	.|T	.|0.02844	.|-1.1103	.|10	.|0.62326	.|D	.|0.03	.|-41.4352	13.5254|13.5254	0.61593|0.61593	0.0:0.8439:0.1561:0.0|0.0:0.8439:0.1561:0.0	.|.	.|53;53	.|Q9Y250-4;Q9Y250	.|.;LZTS1_HUMAN	.|D	-1|53	.|ENSP00000370981:G53D;ENSP00000265801:G53D;ENSP00000429263:G53D	.|ENSP00000265801:G53D	.|G	-|-	.|2	.|0	.|0	LZTS1|LZTS1	20156815|20156815	20156815|20156815	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.993000|0.993000	0.82548|0.82548	2.376000|2.376000	0.44292|0.44292	2.835000|2.835000	0.97688|0.97688	0.650000|0.650000	0.86243|0.86243	.|GGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.577	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	0	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	1.920000	-2.374609	0	0.370000	NM_021020		0	5	5	0	527	523	0		1			0	0	72	0	0	0.936566	0	0	0	0	0	0	5	527
FBXW2	26190	broad.mit.edu	37	9	123527025	123527025	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:123527025G>A	ENST00000608872.1	-	8	1364	c.1177C>T	c.(1177-1179)Cgg>Tgg	p.R393W	FBXW2_ENST00000340778.5_Missense_Mutation_p.R328W|FBXW2_ENST00000493559.1_Intron	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	393					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						CTCTCTGTCCGCAAGTCCATG	0.517																																						ENST00000608872.1	0.130000	2.000000e-02	0.100000	4.000000e-02	0.060000	0.074241	0.060000	0.060000																										0				4						c.(1177-1179)Cgg>Tgg		F-box and WD repeat domain containing 2							107.0	105.0	105.0					9																	123527025		1948	4154	6102	SO:0001583	missense	26190	0	0					g.chr9:123527025G>A	AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1177C>T	chr9.hg19:g.123527025G>A	ENSP00000476369:p.Arg393Trp	0					FBXW2_ENST00000493559.1_Intron|FBXW2_ENST00000340778.5_Missense_Mutation_p.R328W	p.R393W	NM_012164.3	NP_036296.2	1	2	3	2.030095	Q9UKT8	FBXW2_HUMAN		8	1364	-			B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	ENST00000608872.1	0	1	hg19	c.1177C>T	CCDS43872.1	0	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972103	0.34754	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.19250	2.16;2.16	4.95	0.397	0.16314	4.95	0.397	0.16314	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.35422	0.0931	L	0.47716	1.5	0.58432	D	0.999996	B;D;D	0.89917	0.107;1.0;0.999	B;D;D	0.75020	0.009;0.985;0.985	T	0.09443	-1.0674	10	0.72032	D	0.01	-9.1372	13.1259	0.59354	0.0:0.0:0.4582:0.5418	.	328;393;393	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	W	393;328;393	ENSP00000363036:R393W;ENSP00000341161:R328W	ENSP00000341161:R328W	R	-	1	2	2	FBXW2	122566846	122566846	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.010000	0.40913	0.155000	0.19261	0.563000	0.77884	CGG	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.517	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053834.2	0	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	1.920000	-1.804728	0	0.370000			0	7	7	0	573	569	0		1	0		0	0	90	0	0	0.980224	5.114182e-01	0	1	0	129	0	7	573
ANGPTL2	23452	broad.mit.edu	37	9	129854112	129854112	+	Silent	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:129854112G>A	ENST00000373425.3	-	4	1736	c.1119C>T	c.(1117-1119)tcC>tcT	p.S373S	RALGPS1_ENST00000373436.1_Intron|ANGPTL2_ENST00000373417.1_Silent_p.S71S|RALGPS1_ENST00000424082.2_Intron|RALGPS1_ENST00000259351.5_Intron|RALGPS1_ENST00000373434.1_Intron|RALGPS1_ENST00000394022.3_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	373	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.S373S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						CTTTGCGGCCGGACCAGTCCT	0.552																																						ENST00000373425.3	0.060000	0	0.050000	1.000000e-02	0.020000	0.032339	0.020000	0.030000																										1	Substitution - coding silent(1)	p.S373S(1)	urinary_tract(1)	18						c.(1117-1119)tcC>tcT		angiopoietin-like 2							191.0	192.0	192.0					9																	129854112		2203	4300	6503	SO:0001819	synonymous_variant	23452	0	0					g.chr9:129854112G>A	AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.1119C>T	chr9.hg19:g.129854112G>A		0					RALGPS1_ENST00000259351.5_Intron|RALGPS1_ENST00000394022.3_Intron|RALGPS1_ENST00000424082.2_Intron|RALGPS1_ENST00000373434.1_Intron|RALGPS1_ENST00000373436.1_Intron|ANGPTL2_ENST00000373417.1_Silent_p.S71S	p.S373S	NM_012098.2	NP_036230.1	1	2	3	2.030095	Q9UKU9	ANGL2_HUMAN		4	1736	-			Q5JT58|Q8NCH7	Silent	SNP	ENST00000373425.3	0	1	hg19	c.1119C>T	CCDS6868.1	0																																																																																								0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.552	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054129.1	0	0	1	2	2	2	2	0	0	0	0	224	224	224	220	1	1.920000	-1.705499	0	0.370000	NM_012098		0	8	9	0	1458	1440	0		1	0		0	0	224	0	0	0.988781	1.385979e-02	0	0	0	28	0	8	1458
PRRX2	51450	broad.mit.edu	37	9	132481624	132481624	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:132481624G>A	ENST00000372469.4	+	2	601	c.374G>A	c.(373-375)cGc>cAc	p.R125H	RP11-483H20.6_ENST00000440413.1_RNA	NM_016307.3	NP_057391.1	Q99811	PRRX2_HUMAN	paired related homeobox 2	125					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)|pancreas(1)	3		Ovarian(14;0.00556)				GTGTTCGAGCGCACGCACTAC	0.701																																						ENST00000372469.4	0.830000	1.300000e-01	0.590000	2.300000e-01	0.380000	0.417604	0.380000	0.340000																										0				3						c.(373-375)cGc>cAc		paired related homeobox 2							20.0	21.0	21.0					9																	132481624		2184	4291	6475	SO:0001583	missense	51450	0	0					g.chr9:132481624G>A	AF061970	CCDS6926.1	9q34.11	2011-06-20			ENSG00000167157	ENSG00000167157		"""Homeoboxes / PRD class"""	21338	protein-coding gene	gene with protein product		604675				11063257	Standard	NM_016307		Approved	PRX2, PMX2	uc004byh.3	Q99811	OTTHUMG00000020790	ENST00000372469.4:c.374G>A	chr9.hg19:g.132481624G>A	ENSP00000361547:p.Arg125His	0					RP11-483H20.6_ENST00000440413.1_RNA	p.R125H	NM_016307.3	NP_057391.1	1	2	3	2.030095	Q99811	PRRX2_HUMAN		2	601	+		Ovarian(14;0.00556)	Q5SZB5|Q9UIB3	Missense_Mutation	SNP	ENST00000372469.4	0	1	hg19	c.374G>A	CCDS6926.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.387915|5.387915	0.95988|0.95988	.|.	.|.	ENSG00000167157|ENSG00000167157	ENST00000557730|ENST00000372469	.|D	.|0.96334	.|-3.98	4.18|4.18	4.18|4.18	0.49190|0.49190	4.18|4.18	4.18|4.18	0.49190|0.49190	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97340|0.97340	0.9130|0.9130	L|L	0.58925|0.58925	1.835|1.835	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.80764	.|0.994	D|D	0.98098|0.98098	1.0413|1.0413	5|10	.|0.87932	.|D	.|0	.|.	15.6697|15.6697	0.77264|0.77264	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|125	.|Q99811	.|PRRX2_HUMAN	T|H	40|125	.|ENSP00000361547:R125H	.|ENSP00000361547:R125H	A|R	+|+	1|2	0|0	0|0	PRRX2|PRRX2	131521445|131521445	131521445|131521445	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.471000|5.471000	0.66762|0.66762	2.187000|2.187000	0.69744|0.69744	0.462000|0.462000	0.41574|0.41574	GCA|CGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.701	PRRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054598.2	0	0	1	2	2	2	2	0	0	0	0	11	11	11	11	1	1.920000	-8.845400	1	0.370000	NM_016307		0	4	4	0	57	57	0		1	0		0	0	11	0	0	0.892642	6.561796e-01	0	0	0	31	0	4	57
FIBCD1	84929	broad.mit.edu	37	9	133779512	133779512	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:133779512C>T	ENST00000372338.4	-	7	1567	c.1325G>A	c.(1324-1326)gGc>gAc	p.G442D	FIBCD1_ENST00000253018.4_Intron|FIBCD1_ENST00000448616.1_Missense_Mutation_p.G442D|FIBCD1_ENST00000372337.2_Missense_Mutation_p.G284D	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	442	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		GTACTGCCAGCCGGTCCAGGA	0.637																																						ENST00000372338.4	0.150000	2.000000e-02	0.110000	4.000000e-02	0.060000	0.076868	0.060000	0.060000																										0				12						c.(1324-1326)gGc>gAc		fibrinogen C domain containing 1							75.0	71.0	72.0					9																	133779512		2203	4300	6503	SO:0001583	missense	84929	0	0					g.chr9:133779512C>T	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.1325G>A	chr9.hg19:g.133779512C>T	ENSP00000361413:p.Gly442Asp	0					FIBCD1_ENST00000253018.4_Intron|FIBCD1_ENST00000448616.1_Missense_Mutation_p.G442D|FIBCD1_ENST00000372337.2_Missense_Mutation_p.G284D	p.G442D	NM_032843.4	NP_116232.3	1	2	3	2.030095	Q8N539	FBCD1_HUMAN		7	1567	-	all_hematologic(7;0.0028)		A3KFK0|Q6UXK6|Q96SJ7	Missense_Mutation	SNP	ENST00000372338.4	0	1	hg19	c.1325G>A	CCDS6937.1	0	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702186	0.88924	.	.	ENSG00000130720	ENST00000448616;ENST00000372338;ENST00000372337	D;D;D	0.82619	-1.63;-1.63;-1.63	4.66	4.66	0.58398	4.66	4.66	0.58398	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.91116	0.7203	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92390	0.5920	10	0.66056	D	0.02	.	16.1061	0.81223	0.0:1.0:0.0:0.0	.	442	Q8N539	FBCD1_HUMAN	D	442;442;284	ENSP00000414501:G442D;ENSP00000361413:G442D;ENSP00000361412:G284D	ENSP00000361412:G284D	G	-	2	0	0	FIBCD1	132769333	132769333	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.967000	0.70403	2.138000	0.66242	0.455000	0.32223	GGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.637	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	0	0	1	2	2	2	2	0	0	0	0	87	87	87	86	1	1.920000	-2.916400	1	0.370000	NM_032843		0	5	5	0	414	409	0		1			0	0	87	0	0	0.935907	0	0	0	0	0	0	5	414
CDKN2A	1029	broad.mit.edu	37	9	21971120	21971120	+	Nonsense_Mutation	SNP	G	G	A	rs121913388		TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:21971120G>A	ENST00000304494.5	-	2	508	c.238C>T	c.(238-240)Cga>Tga	p.R80*	CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	80			R -> L (in a head and neck tumor).|R -> P (in CMM2; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGCACGGGTCGGGTGAGAGTG	0.726	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	6.700000e-01	0.970000	7.900000e-01	0.890000	0.887197	0.890000	0.990000	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17																								1474	Whole gene deletion(1316)|Substitution - Nonsense(100)|Unknown(44)|Substitution - Missense(7)|Deletion - Frameshift(6)|Deletion - In frame(1)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)	haematopoietic_and_lymphoid_tissue(298)|skin(206)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(76)|oesophagus(72)|upper_aerodigestive_tract(63)|soft_tissue(60)|pleura(51)|pancreas(37)|ovary(36)|kidney(32)|breast(32)|biliary_tract(16)|thyroid(15)|NS(14)|stomach(14)|large_intestine(7)|autonomic_ganglia(7)|meninges(7)|liver(6)|salivary_gland(4)|thymus(4)|vulva(3)|endometrium(3)|prostate(2)	4199	GRCh37	CM014695	CDKN2A	M	rs121913388	c.(238-240)Cga>Tga		cyclin-dependent kinase inhibitor 2A							11.0	14.0	13.0					9																	21971120		2172	4246	6418	SO:0001587	stop_gained	1029	0	0					g.chr9:21971120G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.238C>T	chr9.hg19:g.21971120G>A	ENSP00000307101:p.Arg80*	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*	p.R80*	NM_000077.4	NP_000068.1	0	1	1	1.677653	P42771	CD2A1_HUMAN		2	508	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.238C>T	CCDS6510.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.328457|7.328457	0.98214|0.98214	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	D;D|.	0.86497|.	-2.13;-2.02|.	5.93|5.93	5.01|5.01	0.66863|0.66863	5.93|5.93	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.37136|.	N|.	0.002233|.	T|.	0.44561|.	0.1299|.	L|L	0.36672|0.36672	1.1|1.1	0.47511|0.47511	D|D	0.999443|0.999443	D|.	0.59357|.	0.985|.	B|.	0.40602|.	0.334|.	T|.	0.34825|.	-0.9813|.	10|.	0.13108|0.02654	T|T	0.6|1	-2.989|-2.989	8.7197|8.7197	0.34434|0.34434	0.0759:0.0:0.7715:0.1526|0.0759:0.0:0.7715:0.1526	.|.	135|.	Q8N726|.	CD2A2_HUMAN|.	L|X	135;94|80	ENSP00000355153:P135L;ENSP00000432664:P94L|.	ENSP00000355153:P135L|ENSP00000307101:R80X	P|R	-|-	2|1	0|2	0|2	CDKN2A|CDKN2A	21961120|21961120	21961120|21961120	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	2.363000|2.363000	0.44178|0.44178	1.464000|1.464000	0.47987|0.47987	0.650000|0.650000	0.86243|0.86243	CCG|CGA	0.226994		TCGA-HV-A7OL-01A-11D-A33T-08	0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	11	1	1.920000	-3.594689	1	0.370000	NM_000077		0	28	21	0	90	75	0		1	1	1	0	0	16	155	0	1.000000	9.999910e-01	1	56	33	10	115	28	90
PRUNE2	158471	broad.mit.edu	37	9	79438590	79438590	+	Silent	SNP	T	T	C			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:79438590T>C	ENST00000376718.3	-	6	837	c.714A>G	c.(712-714)ggA>ggG	p.G238G	PRUNE2_ENST00000376713.3_Silent_p.G238G|PRUNE2_ENST00000428286.1_5'UTR	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	238					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CTTTTATTTCTCCATCTGACA	0.373																																						ENST00000376718.3	1.000000	6.900000e-01	0.930000	7.600000e-01	0.840000	0.848710	0.840000	0.840000																										0				16						c.(712-714)ggA>ggG		prune homolog 2 (Drosophila)							162.0	134.0	144.0					9																	79438590		2203	4300	6503	SO:0001819	synonymous_variant	158471	0	0					g.chr9:79438590T>C	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.714A>G	chr9.hg19:g.79438590T>C		0					PRUNE2_ENST00000376713.3_Silent_p.G238G|PRUNE2_ENST00000428286.1_5'UTR	p.G238G	NM_015225.2	NP_056040.2	1	2	3	2.030095	Q8WUY3	PRUN2_HUMAN		6	837	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	1	1	hg19	c.714A>G	CCDS47982.1	0																																																																																								0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.373	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.920000	-20.000000	1	0.370000	NM_138818		0	90	90	0	486	485	1		1			0	0	76	0	0	1.000000	0	0	0	0	0	0	90	486
COL5A1	1289	broad.mit.edu	37	9	137593148	137593148	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chr9:137593148G>A	ENST00000371817.3	+	4	1037	c.623G>A	c.(622-624)gGc>gAc	p.G208D	COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	208	Laminin G-like.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ATCGTGTTTGGCACCCGGATC	0.552																																						ENST00000371817.3	0.540000	1.400000e-01	0.410000	2.000000e-01	0.290000	0.315003	0.290000	0.280000																										0				115						c.(622-624)gGc>gAc		collagen, type V, alpha 1							142.0	108.0	119.0					9																	137593148		2203	4300	6503	SO:0001583	missense	1289	0	0					g.chr9:137593148G>A	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.623G>A	chr9.hg19:g.137593148G>A	ENSP00000360882:p.Gly208Asp	0					COL5A1_ENST00000464187.1_3'UTR	p.G208D	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	1	2	3	2.030095	P20908	CO5A1_HUMAN		4	1037	+		Myeloproliferative disorder(178;0.0341)	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	1	1	hg19	c.623G>A	CCDS6982.1	0	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075833	0.55646	.	.	ENSG00000130635	ENST00000371817	D	0.95918	-3.85	4.93	4.04	0.47022	4.93	4.04	0.47022	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000001	D	0.97870	0.9300	H	0.95260	3.645	0.58432	D	0.999994	P	0.52692	0.955	P	0.57204	0.815	D	0.98523	1.0624	10	0.87932	D	0	.	13.5115	0.61515	0.0763:0.0:0.9237:0.0	.	208	P20908	CO5A1_HUMAN	D	208	ENSP00000360882:G208D	ENSP00000360882:G208D	G	+	2	0	0	COL5A1	136732969	136732969	1.000000	0.71417	0.742000	0.31022	0.439000	0.31926	9.489000	0.97949	1.196000	0.43129	0.491000	0.48974	GGC	0.371163		TCGA-HV-A7OL-01A-11D-A33T-08	0.552	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.920000	-11.499900	1	0.370000	NM_000093		0	8	8	0	143	141	0		1	0		0	0	27	0	0	0.989415	2.436969e-01	0	0	0	16	0	8	143
SCML1	6322	broad.mit.edu	37	X	17770059	17770059	+	Silent	SNP	C	C	T			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chrX:17770059C>T	ENST00000380041.3	+	7	1156	c.828C>T	c.(826-828)tgC>tgT	p.C276C	SCML1_ENST00000380045.3_Silent_p.C155C|SCML1_ENST00000398080.1_Silent_p.C155C|SCML1_ENST00000380043.3_Silent_p.C249C	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	276	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					TTGCATTATGCCCTCTTGTCG	0.448																																						ENST00000380041.3	0.040000	0	0.030000	0	0.010000	0.022227	0.010000	0.020000																										0				10						c.(826-828)tgC>tgT		sex comb on midleg-like 1 (Drosophila)							377.0	317.0	337.0					X																	17770059		2203	4300	6503	SO:0001819	synonymous_variant	6322	0	0					g.chrX:17770059C>T		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.828C>T	chrX.hg19:g.17770059C>T							SCML1_ENST00000380043.3_Silent_p.C249C|SCML1_ENST00000398080.1_Silent_p.C155C|SCML1_ENST00000380045.3_Silent_p.C155C	p.C276C	NM_001037540.1	NP_001032629.1	0	1	1		Q9UN30	SCML1_HUMAN		7	1156	+	Hepatocellular(33;0.183)		B0FZN6|B2RA08|Q5H968|Q5H969	Silent	SNP	ENST00000380041.3	0	1	hg19	c.828C>T	CCDS35210.1	0																																																																																								0.370000		TCGA-HV-A7OL-01A-11D-A33T-08	0.448	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	0	0	1	2	2	2	2	0	0	0	0	152	152	152	152	1	1.920000	-1.737522	0	0.370000	NM_006746		0	7	7	0	962	951	0		1	0		0	0	152	0	0	0.979802	0	0	0	0	1	0	7	962
PCDH11X	27328	broad.mit.edu	37	X	91090548	91090548	+	Silent	SNP	A	A	G			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chrX:91090548A>G	ENST00000373094.1	+	1	890	c.45A>G	c.(43-45)gcA>gcG	p.A15A	PCDH11X_ENST00000361655.2_Silent_p.A15A|PCDH11X_ENST00000298274.8_Silent_p.A15A|PCDH11X_ENST00000395337.2_Silent_p.A15A|PCDH11X_ENST00000361724.1_Silent_p.A15A|PCDH11X_ENST00000406881.1_Silent_p.A15A|PCDH11X_ENST00000504220.2_Silent_p.A15A|PCDH11X_ENST00000373097.1_Silent_p.A15A|PCDH11X_ENST00000373088.1_Silent_p.A15A	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	15					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TCCTGCTAGCATGCGTGGTGT	0.478																																					NSCLC(38;925 1092 2571 38200 45895)	ENST00000373094.1	0.150000	2.000000e-02	0.120000	5.000000e-02	0.070000	0.086886	0.070000	0.080000																										0				159						c.(43-45)gcA>gcG		protocadherin 11 X-linked							139.0	108.0	119.0					X																	91090548		2203	4300	6503	SO:0001819	synonymous_variant	27328	0	0					g.chrX:91090548A>G	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.45A>G	chrX.hg19:g.91090548A>G							PCDH11X_ENST00000298274.8_Silent_p.A15A|PCDH11X_ENST00000361724.1_Silent_p.A15A|PCDH11X_ENST00000373088.1_Silent_p.A15A|PCDH11X_ENST00000395337.2_Silent_p.A15A|PCDH11X_ENST00000504220.2_Silent_p.A15A|PCDH11X_ENST00000361655.2_Silent_p.A15A|PCDH11X_ENST00000406881.1_Silent_p.A15A|PCDH11X_ENST00000373097.1_Silent_p.A15A	p.A15A	NM_032968.3	NP_116750.1	0	1	1		Q9BZA7	PC11X_HUMAN		1	890	+			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	0	1	hg19	c.45A>G	CCDS14461.1	0																																																																																								0.370000		TCGA-HV-A7OL-01A-11D-A33T-08	0.478	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	0	0	0	2	18	2	2	1	1	1	1	36	36	36	36	1	1.920000	-8.192649	1	0.370000	NM_032969		0	6	6	0	208	207	0		0			1	0	36	0	0	0.008958	0	0	0	0	0	0	6	208
DIAPH2	1730	broad.mit.edu	37	X	96185760	96185760	+	Missense_Mutation	SNP	T	T	G			TCGA-HV-A7OL-01A-11D-A33T-08	TCGA-HV-A7OL-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0760de9f-10f1-43db-a96a-7c82c37d4cf3	306b21fa-27e2-44ab-8b5b-583be65a9182	g.chrX:96185760T>G	ENST00000324765.8	+	10	1354	c.1007T>G	c.(1006-1008)cTt>cGt	p.L336R	DIAPH2_ENST00000373054.4_Missense_Mutation_p.L332R|DIAPH2_ENST00000373049.4_Missense_Mutation_p.L336R|DIAPH2_ENST00000355827.4_Missense_Mutation_p.L336R|DIAPH2_ENST00000373061.3_Missense_Mutation_p.L336R			O60879	DIAP2_HUMAN	diaphanous-related formin 2	336	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						ATAAATGCCCTTGTCACTTCT	0.303																																						ENST00000324765.8	1.000000	7.300000e-01	0.960000	8.100000e-01	0.890000	0.890351	0.890000	0.920000																										0				51						c.(1006-1008)cTt>cGt		diaphanous-related formin 2							96.0	87.0	90.0					X																	96185760		2203	4299	6502	SO:0001583	missense	1730	0	0					g.chrX:96185760T>G	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1007T>G	chrX.hg19:g.96185760T>G	ENSP00000321348:p.Leu336Arg						DIAPH2_ENST00000355827.4_Missense_Mutation_p.L336R|DIAPH2_ENST00000373061.3_Missense_Mutation_p.L336R|DIAPH2_ENST00000373054.4_Missense_Mutation_p.L332R|DIAPH2_ENST00000373049.4_Missense_Mutation_p.L336R	p.L336R			0	1	1		O60879	DIAP2_HUMAN		10	1354	+			A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	1	1	hg19	c.1007T>G	CCDS14467.1	1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.234447	0.58886	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9	4.93	4.93	0.64822	4.93	4.93	0.64822	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000011	D	0.96411	0.8829	M	0.89095	3.005	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.97111	0.9804	10	0.87932	D	0	.	13.9748	0.64265	0.0:0.0:0.0:1.0	.	336;336;343	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	R	336;332;336;336;336;343	ENSP00000362152:L336R;ENSP00000362145:L332R;ENSP00000348082:L336R;ENSP00000362140:L336R;ENSP00000321348:L336R	ENSP00000321348:L336R	L	+	2	0	0	DIAPH2	96072416	96072416	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.424000	0.80242	1.745000	0.51790	0.481000	0.45027	CTT	0.370000		TCGA-HV-A7OL-01A-11D-A33T-08	0.303	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.920000	-20.000000	1	0.370000	NM_006729, NM_007309		0	65	64	0	125	124	1		1	1		0	0	28	0	0	1.000000	2.743426e-01	0	3	0	0	0	65	125
