#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
AMPD3	272	broad.mit.edu	37	11	10503680	10503680	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr11:10503680C>T	ENST00000396554.3	+	4	865	c.524C>T	c.(523-525)gCg>gTg	p.A175V	AMPD3_ENST00000444303.2_Missense_Mutation_p.A7V	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	166					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GAGAAGTATGCGCGGCTCGCC	0.607																																						ENST00000396554.3	0.270000	0.050000	2.000000e-01	8.000000e-02	0.130000	0.148470	0.130000	0.120000																										0				25						c.(523-525)gCg>gTg		adenosine monophosphate deaminase 3							112.0	118.0	116.0					11																	10503680		2201	4294	6495	SO:0001583	missense	272	1	121412	40				g.chr11:10503680C>T	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.524C>T	chr11.hg19:g.10503680C>T	ENSP00000379802:p.Ala175Val	0					AMPD3_ENST00000444303.2_Missense_Mutation_p.A7V	p.A175V	NM_000480.2	NP_000471.1	1	2	3	2.014420	Q01432	AMPD3_HUMAN		4	865	+			A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	0	1	hg19	c.524C>T	CCDS7802.1	0	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692577	0.48202	.	.	ENSG00000133805	ENST00000444303;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67	5.88	5.88	0.94601	5.88	5.88	0.94601	.	0.050747	0.85682	D	0.000000	T	0.29423	0.0733	N	0.04090	-0.28	0.38538	D	0.949131	B;B;B	0.26635	0.155;0.004;0.155	B;B;B	0.26416	0.069;0.002;0.069	T	0.20042	-1.0287	10	0.38643	T	0.18	-13.7119	16.4824	0.84161	0.0:0.8692:0.1308:0.0	.	173;166;175	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	V	7;175;166;166;173;166	ENSP00000396000:A7V;ENSP00000379802:A175V;ENSP00000433284:A166V;ENSP00000379801:A166V;ENSP00000436987:A173V;ENSP00000431648:A166V	ENSP00000379801:A166V	A	+	2	0	0	AMPD3	10460256	10460256	0.999000	0.42202	0.930000	0.37139	0.153000	0.21895	4.014000	0.57145	2.782000	0.95742	0.655000	0.94253	GCG	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.607	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	0	0	1		2	2	2	1		1	0	185		185	182	1	3.860000	-1.945176	0	0.130000	NM_000480			6	6		760	745	0		1	0		1	0	185	0		0.962853	3.224494e-03	0	0	0	9	0	6	760
IPO7	10527	broad.mit.edu	37	11	9459508	9459508	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr11:9459508G>A	ENST00000379719.3	+	21	2618	c.2476G>A	c.(2476-2478)Gac>Aac	p.D826N		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	826					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TAATGATGTTGACTGTTTCTT	0.313																																						ENST00000379719.3	1.000000	0.610000	1	8.200000e-01	0.990000	0.936807	0.990000	1.000000																										0				29						c.(2476-2478)Gac>Aac		importin 7							77.0	75.0	76.0					11																	9459508		2201	4294	6495	SO:0001583	missense	10527	0	0					g.chr11:9459508G>A	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.2476G>A	chr11.hg19:g.9459508G>A	ENSP00000369042:p.Asp826Asn	0						p.D826N	NM_006391.2	NP_006382.1	1	2	3	2.014420	O95373	IPO7_HUMAN		21	2618	+			A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	0	1	hg19	c.2476G>A	CCDS31425.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880990	0.91740	.	.	ENSG00000205339	ENST00000379719	T	0.49139	0.79	4.93	4.93	0.64822	4.93	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70710	0.3255	M	0.84683	2.71	0.80722	D	1	D	0.69078	0.997	D	0.66847	0.947	T	0.71984	-0.4427	10	0.31617	T	0.26	.	18.1413	0.89641	0.0:0.0:1.0:0.0	.	826	O95373	IPO7_HUMAN	N	826	ENSP00000369042:D826N	ENSP00000369042:D826N	D	+	1	0	0	IPO7	9416084	9416084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.756000	0.98918	2.270000	0.75569	0.460000	0.39030	GAC	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.313	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	0	0	1		12	5	2	1		1	1	65		65	65	1	3.860000	-16.846620	1	0.130000	NM_006391			13	13		187	184	0		1	1		1	0	65	0		0.640492	3.876983e-01	0	6	0	53	0	13	187
DEPDC7	91614	broad.mit.edu	37	11	33050274	33050274	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr11:33050274T>C	ENST00000241051.3	+	4	810	c.718T>C	c.(718-720)Tcc>Ccc	p.S240P	DEPDC7_ENST00000311388.3_Missense_Mutation_p.S231P	NM_001077242.1	NP_001070710.1	Q96QD5	DEPD7_HUMAN	DEP domain containing 7	240					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17						TAAGAGGCAGTCCACCATGGT	0.413																																						ENST00000241051.3	1.000000	0.770000	1	9.400000e-01	0.990000	0.975620	0.990000	1.000000																										0				17						c.(718-720)Tcc>Ccc		DEP domain containing 7							119.0	114.0	115.0					11																	33050274		1931	4147	6078	SO:0001583	missense	91614	0	0					g.chr11:33050274T>C		CCDS41632.1, CCDS41633.1	11p13	2006-03-24			ENSG00000121690	ENSG00000121690			29899	protein-coding gene	gene with protein product		612294				10568747	Standard	NM_001077242		Approved		uc001mub.3	Q96QD5	OTTHUMG00000166242	ENST00000241051.3:c.718T>C	chr11.hg19:g.33050274T>C	ENSP00000241051:p.Ser240Pro	0					DEPDC7_ENST00000311388.3_Missense_Mutation_p.S231P	p.S240P	NM_001077242.1	NP_001070710.1	1	2	3	2.014420	Q96QD5	DEPD7_HUMAN		4	810	+			G5E941|Q8N602|Q8NCU9|Q9UGK5	Missense_Mutation	SNP	ENST00000241051.3	1	1	hg19	c.718T>C	CCDS41632.1	1	.	.	.	.	.	.	.	.	.	.	T	2.338	-0.351861	0.05173	.	.	ENSG00000121690	ENST00000241051;ENST00000311388	T;T	0.14266	2.53;2.52	6.07	2.0	0.26442	6.07	2.0	0.26442	.	0.384731	0.32015	N	0.006715	T	0.04003	0.0112	N	0.02247	-0.625	0.22827	N	0.998685	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34104	-0.9842	10	0.31617	T	0.26	0.2132	2.4874	0.04601	0.1154:0.4476:0.1129:0.3241	.	231;240	G5E941;Q96QD5	.;DEPD7_HUMAN	P	240;231	ENSP00000241051:S240P;ENSP00000308971:S231P	ENSP00000241051:S240P	S	+	1	0	0	DEPDC7	33006850	33006850	0.907000	0.30839	0.989000	0.46669	0.025000	0.11179	0.078000	0.14761	0.400000	0.25396	-0.250000	0.11733	TCC	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.413	DEPDC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388655.1	1	0	1		2	2	2	0		0	0	116		116	114	1	3.860000	-7.762204	1	0.130000	NM_139160			28	28		377	376	0		1	0		0	0	116	0		1.000000	8.527828e-02	0	0	0	7	0	28	377
CADM1	23705	broad.mit.edu	37	11	115047275	115047275	+	Silent	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr11:115047275G>A	ENST00000452722.3	-	10	1268	c.1248C>T	c.(1246-1248)gaC>gaT	p.D416D	CADM1_ENST00000331581.6_Silent_p.D445D|CADM1_ENST00000537058.1_Silent_p.D427D|CADM1_ENST00000542447.2_Silent_p.D388D|CADM1_ENST00000536727.1_Silent_p.D417D|CADM1_ENST00000537140.1_Intron	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.D416D(2)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CGTCTGCTGCGTCATCGGCTC	0.453																																						ENST00000452722.3	1.000000	0.940000	1	9.900000e-01	0.990000	0.996676	0.990000	1.000000																										2	Substitution - coding silent(2)	p.D416D(2)	cervix(1)|large_intestine(1)	32						c.(1246-1248)gaC>gaT		cell adhesion molecule 1							235.0	212.0	220.0					11																	115047275		2201	4296	6497	SO:0001819	synonymous_variant	23705	1	121412	36				g.chr11:115047275G>A	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1248C>T	chr11.hg19:g.115047275G>A		0					CADM1_ENST00000537058.1_Silent_p.D427D|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000536727.1_Silent_p.D417D|CADM1_ENST00000331581.6_Silent_p.D445D|CADM1_ENST00000542447.2_Silent_p.D388D	p.D416D	NM_014333.3	NP_055148.3	1	2	3	2.015390				10	1268	-	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		Silent	SNP	ENST00000452722.3	1	1	hg19	c.1248C>T	CCDS8373.1	1	.	.	.	.	.	.	.	.	.	.	G	2.658	-0.280418	0.05642	.	.	ENSG00000182985	ENST00000545380	.	.	.	5.36	3.36	0.38483	5.36	3.36	0.38483	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52704	-0.8540	4	.	.	.	.	7.2924	0.26374	0.3073:0.0:0.6927:0.0	.	.	.	.	C	387	.	.	R	-	1	0	0	CADM1	114552485	114552485	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.417000	0.44653	1.491000	0.48482	0.655000	0.94253	CGC	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.453	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	1	0	1		2	2	2	0		0	0	214		214	208	1	3.860000	-10.968760	1	0.130000	NM_014333			46	45		551	545	0		1	0		0	0	214	0		1.000000	8.420706e-01	0	0	0	42	0	46	551
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.970000	1	9.900000e-01	0.990000	0.997089	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	1.994619	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	81		81	81	1	3.860000	-8.544739	1	0.130000	NM_033360			18	18		172	172	0		1	1	1	0	0	81	522		0.999986	1.147111e-01	1	4	23	2	595	18	172
LRRIQ1	84125	broad.mit.edu	37	12	85449402	85449402	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr12:85449402T>A	ENST00000393217.2	+	8	892	c.831T>A	c.(829-831)aaT>aaA	p.N277K		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	277	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAGAAAAAAATTCTTTGTTAA	0.279																																						ENST00000393217.2	1.000000	0.650000	1	8.600000e-01	0.990000	0.950542	0.990000	1.000000																										0				83						c.(829-831)aaT>aaA		leucine-rich repeats and IQ motif containing 1							24.0	27.0	26.0					12																	85449402		2158	4261	6419	SO:0001583	missense	84125	0	0					g.chr12:85449402T>A	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.831T>A	chr12.hg19:g.85449402T>A	ENSP00000376910:p.Asn277Lys	0						p.N277K	NM_001079910.1	NP_001073379.1	1	3	4	1.957678	Q96JM4	LRIQ1_HUMAN		8	892	+			Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	1	1	hg19	c.831T>A	CCDS41816.1	1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.106995	0.00356	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.44881	0.91	5.27	-3.75	0.04372	5.27	-3.75	0.04372	.	1.107710	0.06767	N	0.782885	T	0.13884	0.0336	N	0.03608	-0.345	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.002;0.003	T	0.27123	-1.0083	10	0.02654	T	1	.	4.8548	0.13554	0.4249:0.0:0.2576:0.3174	.	277;252	Q96JM4;C9JI57	LRIQ1_HUMAN;.	K	277;252;277	ENSP00000376910:N277K	ENSP00000256007:N277K	N	+	3	2	2	LRRIQ1	83973533	83973533	0.000000	0.05858	0.006000	0.13384	0.025000	0.11179	-0.697000	0.05098	-0.763000	0.04658	0.260000	0.18958	AAT	0.200662		TCGA-HV-AA8V-01A-11D-A40W-08	0.279	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	0	0	1		2	2	2	0		0	0	122		122	122	1	3.860000	-19.619020	1	0.130000	NM_032165			16	16		241	237	0		1			0	0	122	0		0.999933	0	0	0	0	0	0	16	241
ACSBG1	23205	broad.mit.edu	37	15	78500376	78500376	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr15:78500376T>A	ENST00000258873.4	-	2	405	c.200A>T	c.(199-201)gAg>gTg	p.E67V	ACSBG1_ENST00000558828.1_5'UTR|ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000560817.1_Intron	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	67					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						ATTCACCTTCTCTGGCACTGA	0.597																																						ENST00000258873.4	1.000000	0.210000	9.300000e-01	3.700000e-01	0.610000	0.637178	0.610000	1.000000																										0				37						c.(199-201)gAg>gTg		acyl-CoA synthetase bubblegum family member 1							79.0	63.0	69.0					15																	78500376		2196	4293	6489	SO:0001583	missense	23205	0	0					g.chr15:78500376T>A	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.200A>T	chr15.hg19:g.78500376T>A	ENSP00000258873:p.Glu67Val	0					ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000560817.1_Intron|ACSBG1_ENST00000558828.1_5'UTR	p.E67V	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	1	2	3	2.013130	Q96GR2	ACBG1_HUMAN		2	405	-			B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	0	1	hg19	c.200A>T	CCDS10298.1	0	.	.	.	.	.	.	.	.	.	.	T	10.44	1.351684	0.24512	.	.	ENSG00000103740	ENST00000258873	T	0.34859	1.34	3.78	0.137	0.14787	3.78	0.137	0.14787	.	0.529823	0.16096	N	0.229804	T	0.29093	0.0723	L	0.61218	1.895	0.09310	N	1	B;B	0.31125	0.309;0.309	B;B	0.29785	0.081;0.107	T	0.18053	-1.0349	10	0.46703	T	0.11	-9.9024	4.2711	0.10787	0.3575:0.0:0.1854:0.4571	.	67;67	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	V	67	ENSP00000258873:E67V	ENSP00000258873:E67V	E	-	2	0	0	ACSBG1	76287431	76287431	0.015000	0.18098	0.022000	0.16811	0.030000	0.12068	0.155000	0.16362	0.007000	0.14760	0.402000	0.26972	GAG	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.597	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	0	0	1		2	2	2	0		0	0	32		32	31	1	3.860000	-6.933227	1	0.130000	NM_015162			4	4		113	111	0		1			0	0	32	0		0.887568	0	0	0	0	0	0	4	113
TP53	7157	broad.mit.edu	37	17	7578478	7578478	+	Missense_Mutation	SNP	G	G	C	rs137852790|rs137852791		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr17:7578478G>C	ENST00000269305.4	-	5	641	c.452C>G	c.(451-453)cCc>cGc	p.P151R	TP53_ENST00000420246.2_Missense_Mutation_p.P151R|TP53_ENST00000445888.2_Missense_Mutation_p.P151R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P151R|TP53_ENST00000455263.2_Missense_Mutation_p.P151R|TP53_ENST00000359597.4_Missense_Mutation_p.P151R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151H(31)|p.P151R(9)|p.0?(8)|p.P151L(7)|p.T150fs*16(6)|p.?(5)|p.P58H(2)|p.P19H(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P58R(1)|p.Q144_G154del11(1)|p.P19R(1)|p.Q144fs*16(1)|p.P152fs*14(1)|p.P151fs*30(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGGGCGGGGGTGTGGAATC	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.870000	1	9.900000e-01	0.990000	0.992636	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		90	Substitution - Missense(53)|Deletion - Frameshift(14)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(2)	p.P151H(31)|p.P151R(9)|p.0?(8)|p.P151L(7)|p.T150fs*16(6)|p.?(5)|p.P58H(2)|p.P19H(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P58R(1)|p.Q144_G154del11(1)|p.P19R(1)|p.Q144fs*16(1)|p.P152fs*14(1)|p.P151fs*30(1)|p.T18fs*16(1)|p.T150_P151delTP(1)	lung(17)|large_intestine(13)|ovary(10)|skin(8)|oesophagus(8)|breast(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|central_nervous_system(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|urinary_tract(2)|liver(2)|vulva(1)	24185						c.(451-453)cCc>cGc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						54.0	55.0	55.0					17																	7578478		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578478G>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.452C>G	chr17.hg19:g.7578478G>C	ENSP00000269305:p.Pro151Arg	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.P151R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P151R|TP53_ENST00000420246.2_Missense_Mutation_p.P151R|TP53_ENST00000359597.4_Missense_Mutation_p.P151R|TP53_ENST00000413465.2_Missense_Mutation_p.P151R	p.P151R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	1	2	3	1.886721	P04637	P53_HUMAN		5	641	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.452C>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749177	0.49257	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	5.59	4.63	0.57726	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99891	0.9948	M	0.91406	3.205	0.54753	D	0.999985	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.999;0.999;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.994;0.996;0.991;0.997;0.997;1.0	D	0.96236	0.9172	10	0.87932	D	0	-14.1156	12.4691	0.55777	0.0812:0.0:0.9188:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151R;ENSP00000352610:P151R;ENSP00000269305:P151R;ENSP00000398846:P151R;ENSP00000391127:P151R;ENSP00000391478:P151R;ENSP00000425104:P19R;ENSP00000423862:P58R;ENSP00000424104:P151R	ENSP00000269305:P151R	P	-	2	0	0	TP53	7519203	7519203	1.000000	0.71417	0.974000	0.42286	0.058000	0.15608	6.711000	0.74675	1.515000	0.48885	0.655000	0.94253	CCC	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	85		85	84	1	3.860000	-8.080614	1	0.130000	NM_000546			21	20		233	230	1		1	1	1	0	0	85	1758		0.999998	7.411411e-01	1	4	159	27	1968	21	233
NPC1	4864	broad.mit.edu	37	18	21121386	21121386	+	Missense_Mutation	SNP	C	C	T	rs146874573		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr18:21121386C>T	ENST00000269228.5	-	15	2811	c.2257G>A	c.(2257-2259)Gtg>Atg	p.V753M	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Missense_Mutation_p.V435M	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	753	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GCTGGCATCACGGACAATGCT	0.512																																						ENST00000269228.5	1.000000	0.580000	1	7.700000e-01	0.990000	0.914808	0.990000	1.000000																										0				38						c.(2257-2259)Gtg>Atg		Niemann-Pick disease, type C1		C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	77.0	69.0	72.0		2257	-11.8	0.0	18	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense	NPC1	NM_000271.4	21	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	753/1279	21121386	2,13004	2203	4300	6503	SO:0001583	missense	4864	18	121412	44				g.chr18:21121386C>T	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2257G>A	chr18.hg19:g.21121386C>T	ENSP00000269228:p.Val753Met	0					NPC1_ENST00000412552.2_Missense_Mutation_p.V435M|NPC1_ENST00000540608.1_5'UTR	p.V753M	NM_000271.4	NP_000262.2	1	2	3	2.015846	O15118	NPC1_HUMAN		15	2811	-	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)		B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	1	1	hg19	c.2257G>A	CCDS11878.1	1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370474	0.42003	2.27E-4	1.16E-4	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.91740	-2.9;-2.9	5.89	-11.8	0.00035	5.89	-11.8	0.00035	Sterol-sensing domain (1);	1.444430	0.03929	N	0.284945	T	0.81602	0.4857	L	0.38175	1.15	0.09310	N	1	P;P	0.38711	0.643;0.643	B;B	0.25884	0.064;0.064	T	0.75139	-0.3423	10	0.46703	T	0.11	-1.0E-4	7.997	0.30273	0.22:0.08:0.0709:0.6291	.	764;753	Q59GR1;O15118	.;NPC1_HUMAN	M	753;435;598	ENSP00000269228:V753M;ENSP00000408606:V435M	ENSP00000269228:V753M	V	-	1	0	0	NPC1	19375384	19375384	0.000000	0.05858	0.000000	0.03702	0.112000	0.19704	-0.730000	0.04915	-3.092000	0.00247	-1.075000	0.02238	GTG	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.512	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	1	0	1		2	2	2	0		0	0	66		66	66	1	3.860000	-12.485540	1	0.130000	NM_000271			15	15		234	229	0		1	1		0	0	66	0		0.999867	2.705912e-01	0	4	0	12	0	15	234
SMAD4	4089	broad.mit.edu	37	18	48575159	48575159	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr18:48575159C>T	ENST00000342988.3	+	3	891	c.353C>T	c.(352-354)gCg>gTg	p.A118V	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000588745.1_Missense_Mutation_p.A118V|SMAD4_ENST00000398417.2_Missense_Mutation_p.A118V|SMAD4_ENST00000452201.2_Missense_Mutation_p.A118V	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	118	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)|p.A118V(2)|p.A118E(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGTCAGTATGCGTTTGACTTA	0.398																																						ENST00000342988.3	1.000000	0.880000	1	9.900000e-01	0.990000	0.993081	0.990000	1.000000																										43	Whole gene deletion(36)|Unknown(4)|Substitution - Missense(3)	p.0?(36)|p.?(4)|p.A118V(2)|p.A118E(1)	pancreas(28)|large_intestine(4)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	454						c.(352-354)gCg>gTg		SMAD family member 4							171.0	153.0	159.0					18																	48575159		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48575159C>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.353C>T	chr18.hg19:g.48575159C>T	ENSP00000341551:p.Ala118Val	1					SMAD4_ENST00000452201.2_Missense_Mutation_p.A118V|SMAD4_ENST00000588745.1_Missense_Mutation_p.A118V|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.A118V	p.A118V	NM_005359.5	NP_005350.1	2	2	4	1.878351	Q13485	SMAD4_HUMAN		3	891	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.353C>T	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.260508	0.95368	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	T;T;T	0.78364	-1.17;-1.17;-1.17	5.48	5.48	0.80851	5.48	5.48	0.80851	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.90170	0.6928	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91673	0.5352	10	0.72032	D	0.01	.	18.1041	0.89515	0.0:1.0:0.0:0.0	.	118	Q13485	SMAD4_HUMAN	V	118	ENSP00000409551:A118V;ENSP00000341551:A118V;ENSP00000381452:A118V	ENSP00000341551:A118V	A	+	2	0	0	SMAD4	46829157	46829157	1.000000	0.71417	0.994000	0.49952	0.854000	0.48673	7.793000	0.85851	2.540000	0.85666	0.585000	0.79938	GCG	0.178082		TCGA-HV-AA8V-01A-11D-A40W-08	0.398	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	6	0		0	0	94		94	94	1	3.860000	-3.221870	1	0.130000	NM_005359			22	22		251	249	0		1	0	1	0	1	94	692		0.999999	2.331952e-01	1	0	44	11	741	22	251
KHSRP	8570	broad.mit.edu	37	19	6417818	6417818	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr19:6417818A>G	ENST00000398148.3	-	11	1105	c.1013T>C	c.(1012-1014)aTt>aCt	p.I338T	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	338	Gly-rich.|KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						ACTCCGGCCAATGACCACGCC	0.642											OREG0025200	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(55;593 1006 2067 9135 22980)	ENST00000398148.3	1.000000	0.460000	1	6.800000e-01	0.970000	0.877675	0.970000	1.000000																										0				17						c.(1012-1014)aTt>aCt		KH-type splicing regulatory protein							51.0	56.0	54.0					19																	6417818		2116	4241	6357	SO:0001583	missense	8570	0	0					g.chr19:6417818A>G	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1013T>C	chr19.hg19:g.6417818A>G	ENSP00000381216:p.Ile338Thr	0		OREG0025200	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	633	MIR3940_ENST00000579148.1_RNA	p.I338T	NM_003685.2	NP_003676.2	2	2	4	2.025459	Q92945	FUBP2_HUMAN		11	1105	-			O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	1	1	hg19	c.1013T>C	CCDS45936.1	1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495956	0.64186	.	.	ENSG00000088247	ENST00000398148;ENST00000201886;ENST00000424942	T	0.63913	-0.07	5.22	5.22	0.72569	5.22	5.22	0.72569	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.050085	0.85682	N	0.000000	D	0.86041	0.5838	H	0.97415	4	0.80722	D	1	D	0.71674	0.998	D	0.97110	1.0	D	0.90820	0.4708	10	0.87932	D	0	.	14.1092	0.65111	1.0:0.0:0.0:0.0	.	338	Q92945	FUBP2_HUMAN	T	338;338;294	ENSP00000381216:I338T	ENSP00000201886:I338T	I	-	2	0	0	KHSRP	6368818	6368818	1.000000	0.71417	0.982000	0.44146	0.936000	0.57629	9.079000	0.94032	1.964000	0.57103	0.460000	0.39030	ATT	0.230088		TCGA-HV-AA8V-01A-11D-A40W-08	0.642	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1	1	0	1		2	2	2	0		0	0	38		38	38	1	3.860000	-11.642600	1	0.130000				8	8		141	141	1		1	1		0	0	38	0		0.989991	9.492369e-01	0	11	0	84	0	8	141
AADACL3	126767	broad.mit.edu	37	1	12785321	12785321	+	Silent	SNP	C	C	T	rs370572357		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr1:12785321C>T	ENST00000359318.5	+	4	616	c.411C>T	c.(409-411)ttC>ttT	p.F137F	AADACL3_ENST00000332530.3_Silent_p.F67F	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	137							hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GTGACAGTTTCGGAGGGGCAA	0.572																																						ENST00000359318.5	1.000000	0.950000	1	9.900000e-01	0.990000	0.997141	0.990000	1.000000																										0				15						c.(409-411)ttC>ttT		arylacetamide deacetylase-like 3		C	,	1,3889		0,1,1944	89.0	93.0	92.0		201,411	-2.5	0.0	1		92	1,8287		0,1,4143	no	coding-synonymous,coding-synonymous	AADACL3	NM_001103169.1,NM_001103170.1	,	0,2,6087	TT,TC,CC		0.0121,0.0257,0.0164	,	67/281,137/351	12785321	2,12176	1945	4144	6089	SO:0001819	synonymous_variant	126767	10	120894	41				g.chr1:12785321C>T		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.411C>T	chr1.hg19:g.12785321C>T		0					AADACL3_ENST00000332530.3_Silent_p.F67F	p.F137F	NM_001103170.1	NP_001096640.1	2	2	4	2.023596	Q5VUY0	ADCL3_HUMAN		4	616	+	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	B3KXR9|Q5VUY1	Silent	SNP	ENST00000359318.5	1	1	hg19	c.411C>T	CCDS41253.1	1																																																																																								0.230088		TCGA-HV-AA8V-01A-11D-A40W-08	0.572	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	1	0	1		2	2	2	0		0	0	112		112	109	1	3.860000	-2.920848	1	0.130000	NM_001103170			31	31		364	359	0		1			0	0	112	0		1.000000	0	0	0	0	0	0	31	364
UBR4	23352	broad.mit.edu	37	1	19488970	19488970	+	Missense_Mutation	SNP	A	A	G			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr1:19488970A>G	ENST00000375254.3	-	35	4927	c.4900T>C	c.(4900-4902)Tca>Cca	p.S1634P	UBR4_ENST00000375217.2_Missense_Mutation_p.S1634P|UBR4_ENST00000375226.2_Missense_Mutation_p.S1634P|UBR4_ENST00000375267.2_Missense_Mutation_p.S1634P	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1634					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACCCAGTCTGAGTCTACTTCA	0.507																																						ENST00000375254.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999964	0.990000	1.000000																										0				171						c.(4900-4902)Tca>Cca		ubiquitin protein ligase E3 component n-recognin 4							130.0	119.0	122.0					1																	19488970		2203	4300	6503	SO:0001583	missense	23352	0	0					g.chr1:19488970A>G	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4900T>C	chr1.hg19:g.19488970A>G	ENSP00000364403:p.Ser1634Pro	0					UBR4_ENST00000375217.2_Missense_Mutation_p.S1634P|UBR4_ENST00000375267.2_Missense_Mutation_p.S1634P|UBR4_ENST00000375226.2_Missense_Mutation_p.S1634P	p.S1634P	NM_020765.2	NP_065816.2	2	2	4	2.038355	Q5T4S7	UBR4_HUMAN		35	4927	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	1	1	hg19	c.4900T>C	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.746021	0.89663	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000001	T	0.75488	0.3856	L	0.39898	1.24	0.80722	D	1	D	0.54601	0.967	D	0.65874	0.939	T	0.76887	-0.2793	10	0.62326	D	0.03	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1634	Q5T4S7	UBR4_HUMAN	P	1634;1634;1634;1634;344;850	ENSP00000364403:S1634P;ENSP00000364416:S1634P;ENSP00000364365:S1634P;ENSP00000364374:S1634P	ENSP00000364365:S1634P	S	-	1	0	0	UBR4	19361557	19361557	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.904000	0.92590	2.333000	0.79357	0.482000	0.46254	TCA	0.230088		TCGA-HV-AA8V-01A-11D-A40W-08	0.507	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	1	0	1		2	2	2	0		0	0	178		178	175	1	3.860000	-15.460630	1	0.130000	NM_020765			56	56		579	567	1		1	1		0	0	178	0		1.000000	4.236018e-01	0	4	0	12	0	56	579
ADCY10	55811	broad.mit.edu	37	1	167802257	167802257	+	Silent	SNP	C	C	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr1:167802257C>A	ENST00000367851.4	-	25	3745	c.3561G>T	c.(3559-3561)gtG>gtT	p.V1187V	ADCY10_ENST00000545172.1_Silent_p.V1034V|ADCY10_ENST00000367848.1_Silent_p.V1095V	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1187					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CCTGCCGATTCACATAATGAA	0.488																																						ENST00000367851.4			0	0																														0				63						c.(3559-3561)gtG>gtT		adenylate cyclase 10 (soluble)							147.0	150.0	149.0					1																	167802257		2203	4300	6503	SO:0001819	synonymous_variant	55811	0	0					g.chr1:167802257C>A	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3561G>T	chr1.hg19:g.167802257C>A							ADCY10_ENST00000367848.1_Silent_p.V1095V|ADCY10_ENST00000545172.1_Silent_p.V1034V	p.V1187V	NM_018417.4	NP_060887.2					Q96PN6	ADCYA_HUMAN		25	3745	-			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	1	1	hg19	c.3561G>T	CCDS1265.1																																																																																											TCGA-HV-AA8V-01A-11D-A40W-08	0.488	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	1	0	1		2	2	2	0		0	0	195		195	193	1	3.860000	-9.730177	1	0.130000	NM_018417			46	46		608	601	0		1			0	0	195	0		1.000000	0	0	0	0	0	0	46	608
NPEPL1	79716	broad.mit.edu	37	20	57268896	57268896	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr20:57268896G>A	ENST00000356091.6	+	2	542	c.254G>A	c.(253-255)cGg>cAg	p.R85Q	NPEPL1_ENST00000525817.1_Missense_Mutation_p.R37Q|STX16-NPEPL1_ENST00000530122.1_3'UTR|NPEPL1_ENST00000525967.1_Missense_Mutation_p.R57Q	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	85						cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			AGGGTGAGCCGGCACAACAGC	0.682																																						ENST00000356091.6	1.000000	0.610000	1	8.500000e-01	0.990000	0.946567	0.990000	1.000000																										0				14						c.(253-255)cGg>cAg		aminopeptidase-like 1							25.0	32.0	30.0					20																	57268896		2092	4199	6291	SO:0001583	missense	79716	0	0					g.chr20:57268896G>A	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060	ENST00000356091.6:c.254G>A	chr20.hg19:g.57268896G>A	ENSP00000348395:p.Arg85Gln	0					STX16-NPEPL1_ENST00000530122.1_3'UTR|NPEPL1_ENST00000525817.1_Missense_Mutation_p.R37Q|NPEPL1_ENST00000525967.1_Missense_Mutation_p.R57Q	p.R85Q	NM_024663.3	NP_078939.3	1	2	3	1.981085	Q8NDH3	PEPL1_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)	2	542	+	all_lung(29;0.0175)		A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Missense_Mutation	SNP	ENST00000356091.6	0	1	hg19	c.254G>A	CCDS46621.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.923514	0.97110	.	.	ENSG00000215440	ENST00000525967;ENST00000525817;ENST00000356091	T;T;T	0.58358	0.39;0.47;0.34	4.97	4.97	0.65823	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	M	0.83384	2.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.79841	-0.1633	10	0.72032	D	0.01	-28.8711	17.2194	0.86953	0.0:0.0:1.0:0.0	.	85;37;57	Q8NDH3;G5EA34;E9PN47	PEPL1_HUMAN;.;.	Q	57;37;85	ENSP00000434810:R57Q;ENSP00000437112:R37Q;ENSP00000348395:R85Q	ENSP00000348395:R85Q	R	+	2	0	0	NPEPL1	56702303	56702303	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	9.378000	0.97191	2.304000	0.77564	0.505000	0.49811	CGG	0.180096		TCGA-HV-AA8V-01A-11D-A40W-08	0.682	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080402.6	0	0	1		2	2	2	0		0	0	36		36	36	1	3.860000	-5.742045	1	0.130000	NM_024663			11	11		150	148	0		1	1		0	0	36	0		0.998411	6.818107e-01	0	2	0	31	0	11	150
GNAS	2778	broad.mit.edu	37	20	57484420	57484420	+	Missense_Mutation	SNP	C	C	T	rs11554273		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr20:57484420C>T	ENST00000371085.3	+	8	1025	c.601C>T	c.(601-603)Cgt>Tgt	p.R201C	GNAS_ENST00000354359.7_Missense_Mutation_p.R202C|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.R187C|GNAS_ENST00000371100.4_Missense_Mutation_p.R844C|GNAS_ENST00000371095.3_Missense_Mutation_p.R187C|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186C|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.R830C	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201C(228)|p.R844C(9)|p.R201S(5)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTTCGCTGCCGTGTCCTGAC	0.428			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371085.3	1.000000	0.960000	1	9.900000e-01	0.990000	0.997182	0.990000	1.000000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		242	Substitution - Missense(242)	p.R201C(228)|p.R844C(9)|p.R201S(5)	pituitary(141)|pancreas(35)|large_intestine(14)|ovary(12)|thyroid(10)|adrenal_gland(7)|biliary_tract(6)|parathyroid(5)|liver(3)|kidney(3)|testis(2)|upper_aerodigestive_tract(2)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)	441						c.(601-603)Cgt>Tgt		GNAS complex locus							80.0	78.0	79.0					20																	57484420		2203	4300	6503	SO:0001583	missense	2778	1	121412	31				g.chr20:57484420C>T	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.601C>T	chr20.hg19:g.57484420C>T	ENSP00000360126:p.Arg201Cys	0	TSP Lung(22;0.16)				GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186C|GNAS_ENST00000371102.4_Missense_Mutation_p.R830C|GNAS_ENST00000354359.7_Missense_Mutation_p.R202C|GNAS_ENST00000371095.3_Missense_Mutation_p.R187C|GNAS_ENST00000306090.10_Missense_Mutation_p.R187C|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844C	p.R201C	NM_000516.4	NP_000507.1	1	2	3	1.981085	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	8	1025	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	1	1	hg19	c.601C>T	CCDS13472.1	1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215896	0.79352	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99466	-5.95;-5.95;-5.95;-5.95;-5.95;-2.99;-5.95	5.53	4.53	0.55603	5.53	4.53	0.55603	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	H	0.99732	4.735	0.80722	D	1	D;D;D;D	0.89917	0.999;0.983;0.979;1.0	D;P;P;D	0.97110	0.939;0.845;0.643;1.0	D	0.96814	0.9599	10	0.87932	D	0	.	13.0593	0.58997	0.2437:0.7563:0.0:0.0	rs11554273	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	C	844;830;187;201;202;186;187	ENSP00000360141:R844C;ENSP00000360143:R830C;ENSP00000360136:R187C;ENSP00000360126:R201C;ENSP00000346328:R202C;ENSP00000265620:R186C;ENSP00000304472:R187C	ENSP00000265620:R186C	R	+	1	0	0	GNAS	56917815	56917815	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	4.055000	0.57441	2.596000	0.87737	0.563000	0.77884	CGT	0.180096		TCGA-HV-AA8V-01A-11D-A40W-08	0.428	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	1	0	1		2	2	6	0		0	0	78		78	78	1	3.860000	-2.598634	1	0.130000	NM_000516			25	24		261	257	0		1	1	1	0	1	78	646		1.000000	1	1	163	54	1286	682	25	261
NDUFV3	4731	broad.mit.edu	37	21	44317096	44317096	+	Silent	SNP	G	G	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr21:44317096G>T	ENST00000340344.4	+	2	174	c.108G>T	c.(106-108)gcG>gcT	p.A36A	NDUFV3_ENST00000354250.2_Silent_p.A36A|NDUFV3_ENST00000460259.1_3'UTR	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa	36					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		CTTTGTCTGCGGAATCAGGGA	0.418																																						ENST00000340344.4	1.000000	0.770000	1	9.400000e-01	0.990000	0.975573	0.990000	1.000000																										0				10						c.(106-108)gcG>gcT		NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa							80.0	79.0	80.0					21																	44317096		2203	4300	6503	SO:0001819	synonymous_variant	4731	0	0					g.chr21:44317096G>T		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.108G>T	chr21.hg19:g.44317096G>T		0					NDUFV3_ENST00000354250.2_Silent_p.A36A|NDUFV3_ENST00000460259.1_3'UTR	p.A36A	NM_001001503.1	NP_001001503.1	1	2	3	2.009494	P56181	NDUV3_HUMAN		2	174	+			A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Silent	SNP	ENST00000340344.4	1	1	hg19	c.108G>T	CCDS33573.1	1																																																																																								0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.418	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2	1	0	0		2	2	2	0		0	0	112		112	112	1	3.860000	-2.559133	1	0.130000				27	26		362	354	1		1	1		0	0	112	0		1.000000	9.941789e-01	0	20	0	90	0	27	362
CECR1	51816	broad.mit.edu	37	22	17662742	17662742	+	Silent	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr22:17662742C>T	ENST00000399839.1	-	9	1680	c.1410G>A	c.(1408-1410)agG>agA	p.R470R	CECR1_ENST00000330232.4_Silent_p.R229R|CECR1_ENST00000449907.2_Silent_p.R428R|CECR1_ENST00000262607.3_Silent_p.R470R|CECR1_ENST00000399837.2_Silent_p.R470R	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	470					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GTTTGAGGGTCCTCAGGTCAG	0.547																																						ENST00000399839.1	1.000000	0.660000	1	8.400000e-01	0.990000	0.943307	0.990000	1.000000																										0				25						c.(1408-1410)agG>agA		cat eye syndrome chromosome region, candidate 1							91.0	78.0	82.0					22																	17662742		2203	4300	6503	SO:0001819	synonymous_variant	51816	0	0					g.chr22:17662742C>T	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1410G>A	chr22.hg19:g.17662742C>T		0					CECR1_ENST00000449907.2_Silent_p.R428R|CECR1_ENST00000262607.3_Silent_p.R470R|CECR1_ENST00000330232.4_Silent_p.R229R|CECR1_ENST00000399837.2_Silent_p.R470R	p.R470R	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	2	2	4	2.039256	Q9NZK5	CECR1_HUMAN		9	1680	-		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Silent	SNP	ENST00000399839.1	1	1	hg19	c.1410G>A	CCDS13742.1	1																																																																																								0.230088		TCGA-HV-AA8V-01A-11D-A40W-08	0.547	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1	0	0	1		13	2	2	1		1	1	101		101	101	1	3.860000	-19.998860	1	0.130000				20	19		315	309	0		1	1		1	0	101	0		0.913206	2.866182e-01	0	2	0	15	0	20	315
MED15	51586	broad.mit.edu	37	22	20939239	20939239	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr22:20939239T>C	ENST00000263205.7	+	15	1970	c.1901T>C	c.(1900-1902)tTc>tCc	p.F634S	MED15_ENST00000541476.1_Missense_Mutation_p.F568S|MED15_ENST00000542773.1_3'UTR|MED15_ENST00000406969.1_Missense_Mutation_p.F568S|MED15_ENST00000425759.2_Missense_Mutation_p.F483S|MED15_ENST00000382974.2_Missense_Mutation_p.F523S|MED15_ENST00000292733.7_Missense_Mutation_p.F594S	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	634					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TCACCTGTCTTCAACCATTCC	0.647																																						ENST00000263205.7	1.000000	0.990000	1	9.900000e-01	0.990000	0.999174	0.990000	1.000000																										0				25						c.(1900-1902)tTc>tCc		mediator complex subunit 15							173.0	152.0	159.0					22																	20939239		2203	4300	6503	SO:0001583	missense	51586	0	0					g.chr22:20939239T>C	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1901T>C	chr22.hg19:g.20939239T>C	ENSP00000263205:p.Phe634Ser	0					MED15_ENST00000382974.2_Missense_Mutation_p.F523S|MED15_ENST00000542773.1_3'UTR|MED15_ENST00000406969.1_Missense_Mutation_p.F568S|MED15_ENST00000292733.7_Missense_Mutation_p.F594S|MED15_ENST00000425759.2_Missense_Mutation_p.F483S|MED15_ENST00000541476.1_Missense_Mutation_p.F568S	p.F634S	NM_001003891.1	NP_001003891.1	2	2	4	2.039256	Q96RN5	MED15_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)	15	1970	+	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	ENST00000263205.7	1	1	hg19	c.1901T>C	CCDS33602.1	1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.334132	0.81801	.	.	ENSG00000099917	ENST00000425759;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312	.	.	.	4.72	4.72	0.59763	4.72	4.72	0.59763	Mediator complex, subunit Med15, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.997;0.999;0.997;0.999;0.997	D;D;D;D;D;D	0.83275	0.984;0.995;0.996;0.991;0.988;0.995	T	0.74115	-0.3769	9	0.30854	T	0.27	.	12.1678	0.54139	0.0:0.0:0.0:1.0	.	564;613;250;568;594;634	B4DGD6;Q6PKB8;B3KWF1;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;.;.;MED15_HUMAN	S	483;594;634;568;523;568;564	.	ENSP00000263205:F634S	F	+	2	0	0	MED15	19269239	19269239	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.597000	0.82733	1.771000	0.52183	0.459000	0.35465	TTC	0.230088		TCGA-HV-AA8V-01A-11D-A40W-08	0.647	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	0	0	1		2	2	2	0		0	0	169		169	165	1	3.860000	-20.000000	1	0.130000	NM_015889			49	49		578	569	1		1	1		0	0	169	0		1.000000	9.998191e-01	0	30	0	119	0	49	578
MYH9	4627	broad.mit.edu	37	22	36685180	36685180	+	Missense_Mutation	SNP	C	C	T	rs549408311		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr22:36685180C>T	ENST00000216181.5	-	32	4738	c.4508G>A	c.(4507-4509)cGc>cAc	p.R1503H		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1503					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CATCTCCGTGCGGAACTGCTT	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated				c|||	1	0.000199681	0.0	0.0	5008	,	,		19132	0.0		0.0	False		,,,				2504	0.001					ENST00000216181.5	1.000000	0.480000	1	6.700000e-01	0.900000	0.857889	0.900000	1.000000				Dom	yes			Dom	yes		22	22q13.1	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	yes	Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome	L	L	ALK		ALCL		0				86						c.(4507-4509)cGc>cAc		myosin, heavy chain 9, non-muscle							103.0	77.0	86.0					22																	36685180		2203	4300	6503	SO:0001583	missense	4627	2	121412	37	Hereditary Macrothrombocytopenia, MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	g.chr22:36685180C>T		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4508G>A	chr22.hg19:g.36685180C>T	ENSP00000216181:p.Arg1503His	0						p.R1503H	NM_002473.4	NP_002464.1	1	2	3	2.013593	P35579	MYH9_HUMAN		32	4738	-			A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	1	1	hg19	c.4508G>A	CCDS13927.1	1	.	.	.	.	.	.	.	.	.	.	c	27.6	4.849169	0.91277	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	T	0.78003	-1.14	5.2	5.2	0.72013	5.2	5.2	0.72013	Myosin tail (1);	0.179769	0.49305	D	0.000160	D	0.86293	0.5898	L	0.61387	1.9	0.80722	D	1	D	0.69078	0.997	D	0.64877	0.93	D	0.87483	0.2422	10	0.87932	D	0	.	19.1126	0.93323	0.0:1.0:0.0:0.0	.	1503	P35579	MYH9_HUMAN	H	925;105;1503	ENSP00000216181:R1503H	ENSP00000216181:R1503H	R	-	2	0	0	MYH9	35015126	35015126	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.876000	0.63079	2.586000	0.87340	0.556000	0.70494	CGC	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	1	0	1		2	2	2	0		0	0	50		50	50	1	3.860000	-13.768890	1	0.130000	NM_002473			11	11		193	190	0		1	1		0	0	50	0		0.998340	1	0	51	0	808	0	11	193
IRS1	3667	broad.mit.edu	37	2	227660886	227660886	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr2:227660886G>A	ENST00000305123.5	-	1	3589	c.2569C>T	c.(2569-2571)Cgg>Tgg	p.R857W	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	857					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CTCGTGGGCCGGGCCAGGCGG	0.662																																						ENST00000305123.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999945	0.990000	1.000000																										0				69						c.(2569-2571)Cgg>Tgg		insulin receptor substrate 1							32.0	42.0	39.0					2																	227660886		2203	4300	6503	SO:0001583	missense	3667	0	0					g.chr2:227660886G>A		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2569C>T	chr2.hg19:g.227660886G>A	ENSP00000304895:p.Arg857Trp	0					IRS1_ENST00000498335.1_5'Flank	p.R857W	NM_005544.2	NP_005535.1	1	2	3	2.012538	P35568	IRS1_HUMAN		1	3589	-		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Missense_Mutation	SNP	ENST00000305123.5	0	1	hg19	c.2569C>T	CCDS2463.1	1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025202	0.54683	.	.	ENSG00000169047	ENST00000305123	D	0.85484	-1.99	4.96	4.06	0.47325	4.96	4.06	0.47325	.	0.000000	0.64402	D	0.000004	D	0.89301	0.6676	L	0.49126	1.545	0.39337	D	0.965517	D	0.89917	1.0	D	0.91635	0.999	D	0.90424	0.4419	10	0.87932	D	0	-13.9538	12.3313	0.55041	0.0:0.0:0.568:0.432	.	857	P35568	IRS1_HUMAN	W	857	ENSP00000304895:R857W	ENSP00000304895:R857W	R	-	1	2	2	IRS1	227369130	227369130	0.995000	0.38212	0.900000	0.35374	0.934000	0.57294	1.962000	0.40442	1.269000	0.44280	0.650000	0.86243	CGG	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.662	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	0	0	1		19	3	2	1		1	2	78		78	77	1	3.860000	-2.806913	1	0.130000	NM_005544			33	33		277	273	1		1	0		1	0	78	0		0.983165	4.613975e-01	0	1	0	22	0	33	277
MAP4K3	8491	broad.mit.edu	37	2	39526942	39526942	+	Splice_Site	SNP	C	C	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr2:39526942C>A	ENST00000263881.3	-	16	1444	c.1120G>T	c.(1120-1122)Gat>Tat	p.D374Y	MAP4K3_ENST00000437545.1_Splice_Site_p.D290Y|MAP4K3_ENST00000341681.5_Splice_Site_p.D353Y|MAP4K3_ENST00000536018.1_5'UTR	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	374					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				AGTTGCAGATCCTAATAGTAC	0.264																																						ENST00000263881.3	1.000000	0.820000	1	9.900000e-01	0.990000	0.988273	0.990000	1.000000																										0				44						c.(1120-1122)Gat>Tat		mitogen-activated protein kinase kinase kinase kinase 3							34.0	37.0	36.0					2																	39526942		2200	4277	6477	SO:0001630	splice_region_variant	8491	0	0					g.chr2:39526942C>A	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.1120-1G>T	chr2.hg19:g.39526942C>A		0					MAP4K3_ENST00000536018.1_5'UTR|MAP4K3_ENST00000341681.5_Splice_Site_p.D353Y|MAP4K3_ENST00000437545.1_Splice_Site_p.D290Y	p.D374Y	NM_003618.3	NP_003609.2	1	2	3	2.013081	Q8IVH8	M4K3_HUMAN		16	1444	-		all_hematologic(82;0.211)	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Splice_Site	SNP	ENST00000263881.3	1	0	hg19	c.1120G>T	CCDS1803.1	1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242524	0.39598	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.15952	2.38;2.38;2.38	5.49	5.49	0.81192	5.49	5.49	0.81192	Protein kinase-like domain (1);	0.149260	0.64402	D	0.000018	T	0.14700	0.0355	L	0.28274	0.84	0.80722	D	1	B;B	0.17465	0.001;0.022	B;B	0.10450	0.002;0.005	T	0.09640	-1.0665	9	.	.	.	.	19.3536	0.94401	0.0:1.0:0.0:0.0	.	353;374	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	Y	374;290;353	ENSP00000263881:D374Y;ENSP00000416958:D290Y;ENSP00000345434:D353Y	.	D	-	1	0	0	MAP4K3	39380446	39380446	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	6.208000	0.72165	2.578000	0.87016	0.313000	0.20887	GAT	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.264	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	1	0	1		2	2	2	0		0	0	56		56	56	1	3.860000	-19.997910	1	0.130000	NM_003618	Missense_Mutation		17	16		191	190	0		1	0		0	0	56	0		0.999969	8.970671e-02	0	0	0	6	0	17	191
HJURP	55355	broad.mit.edu	37	2	234749480	234749480	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr2:234749480C>A	ENST00000411486.2	-	8	2011	c.1946G>T	c.(1945-1947)aGt>aTt	p.S649I	HJURP_ENST00000441687.1_Missense_Mutation_p.S564I|HJURP_ENST00000434039.1_5'Flank|HJURP_ENST00000432087.1_Missense_Mutation_p.S595I	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	649					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GCCCAGTAGACTTTTTCTGCA	0.488																																						ENST00000411486.2	1.000000	0.670000	1	8.300000e-01	0.990000	0.940657	0.990000	1.000000																										0				38						c.(1945-1947)aGt>aTt		Holliday junction recognition protein							91.0	94.0	93.0					2																	234749480		2203	4300	6503	SO:0001583	missense	55355	0	0					g.chr2:234749480C>A		CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1946G>T	chr2.hg19:g.234749480C>A	ENSP00000414109:p.Ser649Ile	0					HJURP_ENST00000441687.1_Missense_Mutation_p.S564I|HJURP_ENST00000432087.1_Missense_Mutation_p.S595I|HJURP_ENST00000434039.1_5'Flank	p.S649I	NM_018410.3	NP_060880.3	1	2	3	2.012538	Q8NCD3	HJURP_HUMAN		8	2011	-		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	1	1	hg19	c.1946G>T	CCDS33406.1	1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144038	0.37825	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.11385	3.13;3.13;3.13;2.78	4.28	2.41	0.29592	4.28	2.41	0.29592	.	0.821288	0.10885	N	0.623347	T	0.08670	0.0215	L	0.44542	1.39	0.09310	N	1	P;P;P	0.37955	0.612;0.612;0.478	B;B;B	0.33750	0.169;0.169;0.081	T	0.28650	-1.0037	10	0.42905	T	0.14	-0.0459	5.1147	0.14829	0.2129:0.6805:0.0:0.1066	.	564;595;649	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	I	649;595;564;564	ENSP00000414109:S649I;ENSP00000407208:S595I;ENSP00000401944:S564I;ENSP00000393253:S564I	ENSP00000414109:S649I	S	-	2	0	0	HJURP	234414219	234414219	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.131000	0.15870	0.696000	0.31696	0.563000	0.77884	AGT	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.488	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	0	0	1		2	2	2	0		0	0	107		107	105	1	3.860000	-20.000000	1	0.130000	NM_018410			24	24		362	354	1		1	1		0	0	107	0		1.000000	2.279446e-01	0	3	0	11	0	24	362
GATA2	2624	broad.mit.edu	37	3	128199973	128199973	+	Silent	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr3:128199973C>T	ENST00000341105.2	-	6	1663	c.1332G>A	c.(1330-1332)ccG>ccA	p.P444P	GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Silent_p.P444P|GATA2_ENST00000430265.2_Silent_p.P430P	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	444					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P444P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GGCTGAAGGGCGGGAGGTGGC	0.657			Mis		AML(CML blast transformation)																																	ENST00000341105.2	1.000000	0.960000	1	9.900000e-01	0.990000	0.997188	0.990000	1.000000				Dom	yes			Dom	yes		3	3q21.3	3q21.3	2624	Mis	GATA binding protein 2				L	L			AML(CML blast transformation)		1	Substitution - coding silent(1)	p.P444P(1)	lung(1)	79						c.(1330-1332)ccG>ccA		GATA binding protein 2							97.0	87.0	91.0					3																	128199973		2203	4300	6503	SO:0001819	synonymous_variant	2624	2	121412	35				g.chr3:128199973C>T	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1332G>A	chr3.hg19:g.128199973C>T		0					GATA2_ENST00000430265.2_Silent_p.P430P|GATA2_ENST00000487848.1_Silent_p.P444P|GATA2_ENST00000489987.1_5'UTR	p.P444P	NM_032638.4	NP_116027.2	1	2	3	2.015952	P23769	GATA2_HUMAN		6	1663	-			D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Silent	SNP	ENST00000341105.2	1	1	hg19	c.1332G>A	CCDS3049.1	1																																																																																								0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.657	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	1	0	1		2	2	2	0		0	0	52		52	48	1	3.860000	-3.017765	1	0.130000	NM_032638			22	20		222	215	0		1	0		0	0	52	0		0.999999	2.008178e-01	0	1	0	8	0	22	222
LRRIQ4	344657	broad.mit.edu	37	3	169550783	169550783	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr3:169550783G>A	ENST00000340806.6	+	4	1342	c.1342G>A	c.(1342-1344)Gaa>Aaa	p.E448K		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	448										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						AGCTTTGAAAGAATTACGGCT	0.403																																						ENST00000340806.6	1.000000	0.830000	1	9.900000e-01	0.990000	0.988605	0.990000	1.000000																										0				30						c.(1342-1344)Gaa>Aaa		leucine-rich repeats and IQ motif containing 4							60.0	59.0	59.0					3																	169550783		1836	4090	5926	SO:0001583	missense	344657	0	0					g.chr3:169550783G>A		CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.1342G>A	chr3.hg19:g.169550783G>A	ENSP00000342188:p.Glu448Lys	0						p.E448K	NM_001080460.1	NP_001073929.1	1	2	3	2.015952	A6NIV6	LRIQ4_HUMAN		4	1342	+				Missense_Mutation	SNP	ENST00000340806.6	1	1	hg19	c.1342G>A	CCDS46951.1	1	.	.	.	.	.	.	.	.	.	.	G	6.345	0.431770	0.12045	.	.	ENSG00000188306	ENST00000340806	T	0.57907	0.37	5.56	2.35	0.29111	5.56	2.35	0.29111	.	0.249318	0.33180	N	0.005186	T	0.26484	0.0647	N	0.12663	0.25	0.28781	N	0.899839	B	0.18310	0.027	B	0.26310	0.068	T	0.11518	-1.0584	10	0.13108	T	0.6	.	2.8532	0.05564	0.3803:0.2331:0.3866:0.0	.	448	A6NIV6	LRIQ4_HUMAN	K	448	ENSP00000342188:E448K	ENSP00000342188:E448K	E	+	1	0	0	LRRIQ4	171033477	171033477	0.998000	0.40836	0.994000	0.49952	0.597000	0.36814	0.850000	0.27737	0.691000	0.31592	0.561000	0.74099	GAA	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.403	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	1	0	1		2	2	2	0		0	0	68		68	65	1	3.860000	-3.221906	1	0.130000	NM_001080460			18	17		204	196	0		1	0		0	0	68	0		0.999979	0	0	1	0	0	0	18	204
CNTN4	152330	broad.mit.edu	37	3	3084848	3084848	+	Splice_Site	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr3:3084848G>A	ENST00000397461.1	+	21	3082		c.e21+1		CNTN4_ENST00000427331.1_Splice_Site|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000448906.2_Splice_Site|CNTN4_ENST00000358480.3_Splice_Site|CNTN4_ENST00000397459.2_Splice_Site|CNTN4_ENST00000418658.1_Splice_Site	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4						axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CGAAAGCCACGTAAGAACAGA	0.428																																						ENST00000397461.1	1.000000	0.550000	1	7.700000e-01	0.990000	0.916537	0.990000	1.000000																										0				61						c.e21+1		contactin 4							60.0	61.0	61.0					3																	3084848		2203	4300	6503	SO:0001630	splice_region_variant	152330	0	0					g.chr3:3084848G>A	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2698+1G>A	chr3.hg19:g.3084848G>A		0					CNTN4_ENST00000448906.2_Splice_Site|CNTN4_ENST00000397459.2_Splice_Site|CNTN4_ENST00000418658.1_Splice_Site|CNTN4_ENST00000427331.1_Splice_Site|CNTN4_ENST00000358480.3_Splice_Site|CNTN4-AS1_ENST00000442749.2_RNA		NM_001206955.1	NP_001193884.1	1	2	3	2.015952	Q8IWV2	CNTN4_HUMAN		21	3082	+		Ovarian(110;0.156)	B2RAX3|Q8IX14|Q8TC35	Splice_Site	SNP	ENST00000397461.1	1	1	hg19		CCDS43041.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400540	0.83120	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	.	.	.	5.22	5.22	0.72569	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1349	0.93424	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	CNTN4	3059848	3059848	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.585000	0.98223	2.606000	0.88127	0.655000	0.94253	.	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.428	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2	1	0	1		2	2	2	0		0	0	41		41	41	1	3.860000	-3.310327	1	0.130000		Intron		11	11		166	163	0		1			0	0	41	0		0.998348	0	0	0	0	0	0	11	166
SACM1L	22908	broad.mit.edu	37	3	45751115	45751115	+	Silent	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr3:45751115C>T	ENST00000389061.5	+	5	663	c.459C>T	c.(457-459)ttC>ttT	p.F153F	SACM1L_ENST00000418611.1_Silent_p.F50F|SACM1L_ENST00000464524.1_3'UTR|SACM1L_ENST00000541314.1_Silent_p.F92F	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	153	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		GTCCTGAATTCCAAGAAATGA	0.343																																						ENST00000389061.5	1.000000	0.880000	1	9.900000e-01	0.990000	0.992793	0.990000	1.000000																										0				23						c.(457-459)ttC>ttT		SAC1 suppressor of actin mutations 1-like (yeast)							89.0	84.0	85.0					3																	45751115		2203	4300	6503	SO:0001819	synonymous_variant	22908	0	0					g.chr3:45751115C>T	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.459C>T	chr3.hg19:g.45751115C>T		0					SACM1L_ENST00000418611.1_Silent_p.F50F|SACM1L_ENST00000541314.1_Silent_p.F92F|SACM1L_ENST00000464524.1_3'UTR	p.F153F	NM_014016.3	NP_054735.3	1	2	3	2.015952	Q9NTJ5	SAC1_HUMAN		5	663	+			A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Silent	SNP	ENST00000389061.5	1	1	hg19	c.459C>T	CCDS33745.1	1																																																																																								0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.343	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	1	0	1		2	2	2	0		0	0	84		84	82	1	3.860000	-3.142701	1	0.130000	NM_014016			22	22		246	243	0		1	0		0	0	84	0		0.999999	3.961269e-01	0	1	0	15	0	22	246
CACNA1D	776	broad.mit.edu	37	3	53769492	53769492	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr3:53769492G>A	ENST00000350061.5	+	20	3224	c.2713G>A	c.(2713-2715)Gca>Aca	p.A905T	CACNA1D_ENST00000288139.4_Missense_Mutation_p.A925T|CACNA1D_ENST00000422281.2_Missense_Mutation_p.A905T	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	905					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCCCTGGCCGCAGAGGACCC	0.627																																						ENST00000350061.5	0.520000	0.090000	3.900000e-01	1.600000e-01	0.260000	0.282056	0.260000	0.240000																										0				90						c.(2713-2715)Gca>Aca		calcium channel, voltage-dependent, L type, alpha 1D subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						84.0	71.0	76.0					3																	53769492		2203	4300	6503	SO:0001583	missense	776	2	121412	39				g.chr3:53769492G>A	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2713G>A	chr3.hg19:g.53769492G>A	ENSP00000288133:p.Ala905Thr	0					CACNA1D_ENST00000288139.4_Missense_Mutation_p.A925T|CACNA1D_ENST00000422281.2_Missense_Mutation_p.A905T	p.A905T	NM_001128840.1	NP_001122312.1	1	2	3	2.015952	Q01668	CAC1D_HUMAN		20	3224	+			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	0	1	hg19	c.2713G>A	CCDS46848.1	0	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595482	0.66219	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.46	4.58	0.56647	5.46	4.58	0.56647	.	0.066144	0.64402	N	0.000015	D	0.98601	0.9532	M	0.89414	3.03	0.80722	D	1	D;D;D;D	0.89917	1.0;0.986;1.0;0.972	D;P;D;P	0.79108	0.988;0.659;0.992;0.816	D	0.99655	1.0992	10	0.87932	D	0	.	16.7269	0.85424	0.0:0.1292:0.8708:0.0	.	905;598;905;925	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	T	905;925;905;598	ENSP00000288133:A905T;ENSP00000288139:A925T;ENSP00000409174:A905T;ENSP00000418014:A598T	ENSP00000288139:A925T	A	+	1	0	0	CACNA1D	53744532	53744532	1.000000	0.71417	0.106000	0.21319	0.197000	0.23852	7.906000	0.87423	1.407000	0.46875	0.555000	0.69702	GCA	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.627	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	0	0	1		2	2	2	0		0	0	104		104	103	1	3.860000	-2.701529	1	0.130000	NM_000720			5	5		337	333	0		1	0		0	0	104	0		0.936038	1.045313e-03	0	0	0	3	0	5	337
PARL	55486	broad.mit.edu	37	3	183547482	183547482	+	Silent	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr3:183547482G>A	ENST00000317096.4	-	10	1104	c.1044C>T	c.(1042-1044)taC>taT	p.Y348Y	PARL_ENST00000311101.5_Silent_p.Y298Y|PARL_ENST00000435888.1_Silent_p.Y264Y	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	348					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.Y348Y(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GTTCATGACCGTAAGTAACAT	0.423																																						ENST00000317096.4	0.290000	0.050000	2.200000e-01	9.000000e-02	0.140000	0.160970	0.140000	0.150000																										1	Substitution - coding silent(1)	p.Y348Y(1)	prostate(1)	17						c.(1042-1044)taC>taT		presenilin associated, rhomboid-like							123.0	127.0	126.0					3																	183547482		2203	4300	6503	SO:0001819	synonymous_variant	55486	1	121410	32				g.chr3:183547482G>A	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.1044C>T	chr3.hg19:g.183547482G>A		0					PARL_ENST00000311101.5_Silent_p.Y298Y|PARL_ENST00000435888.1_Silent_p.Y264Y	p.Y348Y	NM_018622.5	NP_061092.3	1	2	3	2.015952	Q9H300	PARL_HUMAN	all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)	10	1104	-	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		Q96CQ4|Q9BTJ6|Q9P1E3	Silent	SNP	ENST00000317096.4	0	1	hg19	c.1044C>T	CCDS3248.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.66|11.66	1.706359|1.706359	0.30232|0.30232	.|.	.|.	ENSG00000175193|ENSG00000175193	ENST00000450375;ENST00000417784|ENST00000418450	T|.	0.51325|.	0.71|.	5.71|5.71	-6.81|-6.81	0.01704|0.01704	5.71|5.71	-6.81|-6.81	0.01704|0.01704	.|.	.|.	.|.	.|.	.|.	T|T	0.65883|0.65883	0.2734|0.2734	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.68981|0.68981	-0.5266|-0.5266	5|4	.|.	.|.	.|.	-19.5416|-19.5416	18.3207|18.3207	0.90237|0.90237	0.3327:0.0:0.6673:0.0|0.3327:0.0:0.6673:0.0	.|.	.|.	.|.	.|.	W|M	62;140|81	ENSP00000402689:R62W|.	.|.	R|T	-|-	1|2	2|0	2|0	PARL|PARL	185030176|185030176	185030176|185030176	0.001000|0.001000	0.12720|0.12720	0.801000|0.801000	0.32222|0.32222	0.966000|0.966000	0.64601|0.64601	-1.489000|-1.489000	0.02306|0.02306	-1.663000|-1.663000	0.01481|0.01481	-0.414000|-0.414000	0.06135|0.06135	CGG|ACG	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.423	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	0	0	1		12	4	2	1		1	1	230		230	228	1	3.860000	-1.824079	0	0.130000	NM_018622			6	6		700	691	0		0	0		1	0	230	0		0.111495	3.156164e-02	0	0	0	107	0	6	700
CMYA5	202333	broad.mit.edu	37	5	79084856	79084856	+	Missense_Mutation	SNP	T	T	G	rs146960317		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr5:79084856T>G	ENST00000446378.2	+	10	11649	c.11618T>G	c.(11617-11619)tTt>tGt	p.F3873C	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3873	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GATAACTACTTTTTCTATGTG	0.393													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19361	0.0		0.0	False		,,,				2504	0.0					ENST00000446378.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999555	0.990000	1.000000																										0				128						c.(11617-11619)tTt>tGt		cardiomyopathy associated 5							175.0	174.0	174.0					5																	79084856		1901	4120	6021	SO:0001583	missense	202333	2	120838	37				g.chr5:79084856T>G	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11618T>G	chr5.hg19:g.79084856T>G	ENSP00000394770:p.Phe3873Cys	0					CTC-431G16.2_ENST00000421252.2_RNA	p.F3873C	NM_153610.3	NP_705838.3	1	2	3	2.011985	Q8N3K9	CMYA5_HUMAN		10	11649	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	1	1	hg19	c.11618T>G	CCDS47238.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	22.5	4.298641	0.81025	.	.	ENSG00000164309	ENST00000446378	T	0.54071	0.59	5.75	5.75	0.90469	5.75	5.75	0.90469	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65026	0.2652	L	0.40543	1.245	0.47308	D	0.999382	D	0.89917	1.0	D	0.72625	0.978	T	0.67925	-0.5544	9	0.87932	D	0	.	15.7296	0.77790	0.0:0.0:0.0:1.0	.	3873	Q8N3K9	CMYA5_HUMAN	C	3873	ENSP00000394770:F3873C	ENSP00000394770:F3873C	F	+	2	0	0	CMYA5	79120612	79120612	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.181000	0.77682	2.188000	0.69820	0.528000	0.53228	TTT	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.393	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	0	0	1		2	2	2	0		0	0	181		181	180	1	3.860000	-20.000000	1	0.130000	NM_153610			55	55		601	596	0		1	0		0	0	181	0		1.000000	1.149432e-01	0	0	0	7	0	55	601
PCDHGA5	56110	broad.mit.edu	37	5	140744450	140744450	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr5:140744450G>A	ENST00000518069.1	+	1	553	c.553G>A	c.(553-555)Gga>Aga	p.G185R	PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	185	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGGTAAGCGGAACTGATGG	0.552																																						ENST00000518069.1	1.000000	0.910000	1	9.900000e-01	0.990000	0.995015	0.990000	1.000000																										0				18						c.(553-555)Gga>Aga		protocadherin gamma subfamily A, 5							62.0	63.0	63.0					5																	140744450		2024	4190	6214	SO:0001583	missense	56110	0	0					g.chr5:140744450G>A	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.553G>A	chr5.hg19:g.140744450G>A	ENSP00000429834:p.Gly185Arg	0					PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	p.G185R	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	1	2	3	2.011985	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	553	+			Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	1	1	hg19	c.553G>A	CCDS54925.1	1	.	.	.	.	.	.	.	.	.	.	.	0.025	-1.381306	0.01204	.	.	ENSG00000253485	ENST00000518069	T	0.19532	2.14	5.52	4.6	0.57074	5.52	4.6	0.57074	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.14614	0.0353	L	0.39514	1.22	0.09310	N	1	B;B	0.26809	0.16;0.1	B;B	0.25614	0.062;0.047	T	0.29058	-1.0024	9	0.08381	T	0.77	.	7.6206	0.28183	0.1456:0.1436:0.7108:0.0	.	185;185	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	R	185	ENSP00000429834:G185R	ENSP00000429834:G185R	G	+	1	0	0	PCDHGA5	140724634	140724634	0.000000	0.05858	0.525000	0.27900	0.701000	0.40568	0.662000	0.25038	2.756000	0.94617	0.563000	0.77884	GGA	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.552	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	1	0	1		2	2	2	0		0	0	87		87	86	1	3.860000	-2.966613	1	0.130000	NM_018918			22	21		236	233	0		1	0		0	0	87	0		0.999999	8.134394e-03	0	0	0	2	0	22	236
BMP5	653	broad.mit.edu	37	6	55739380	55739380	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr6:55739380T>A	ENST00000370830.3	-	1	982	c.284A>T	c.(283-285)gAa>gTa	p.E95V	BMP5_ENST00000446683.2_Missense_Mutation_p.E95V	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	95					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTCCGACTCTTCAGGATTTTC	0.507																																						ENST00000370830.3	1.000000	0.620000	1	7.600000e-01	0.960000	0.906011	0.960000	1.000000																										0				45						c.(283-285)gAa>gTa		bone morphogenetic protein 5							143.0	134.0	137.0					6																	55739380		2203	4300	6503	SO:0001583	missense	653	0	0					g.chr6:55739380T>A		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.284A>T	chr6.hg19:g.55739380T>A	ENSP00000359866:p.Glu95Val	0					BMP5_ENST00000446683.2_Missense_Mutation_p.E95V	p.E95V	NM_021073.2	NP_066551.1	2	2	4	1.907696	P22003	BMP5_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)	1	982	-	Lung NSC(77;0.0462)		B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	1	1	hg19	c.284A>T	CCDS4958.1	1	.	.	.	.	.	.	.	.	.	.	T	11.34	1.611182	0.28712	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	T;T	0.74002	-0.8;-0.45	5.82	5.82	0.92795	5.82	5.82	0.92795	Transforming growth factor-beta, N-terminal (1);	0.246245	0.43579	D	0.000543	T	0.57227	0.2039	L	0.46157	1.445	0.54753	D	0.99998	P;B	0.37141	0.584;0.083	B;B	0.37833	0.259;0.175	T	0.65792	-0.6082	10	0.54805	T	0.06	.	10.5161	0.44889	0.0:0.0719:0.0:0.9281	.	95;95	B4E0Y4;P22003	.;BMP5_HUMAN	V	95	ENSP00000359866:E95V;ENSP00000391818:E95V	ENSP00000359866:E95V	E	-	2	0	0	BMP5	55847339	55847339	0.896000	0.30565	0.939000	0.37840	0.945000	0.59286	1.407000	0.34657	2.216000	0.71823	0.528000	0.53228	GAA	0.190999		TCGA-HV-AA8V-01A-11D-A40W-08	0.507	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1	1	0	1		2	2	2	0		0	0	146		146	145	1	3.860000	-20.000000	1	0.130000				27	26		476	469	0		1			0	0	146	0		1.000000	0	0	0	0	0	0	27	476
NT5E	4907	broad.mit.edu	37	6	86197162	86197162	+	Silent	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr6:86197162C>T	ENST00000257770.3	+	5	1108	c.1059C>T	c.(1057-1059)tgC>tgT	p.C353C	NT5E_ENST00000369651.3_Silent_p.C353C	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	353					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	CTCAATCATGCCGCTTTAGAG	0.413																																					Melanoma(140;797 1765 2035 2752 18208)	ENST00000257770.3	1.000000	0.070000	2.900000e-01	1.200000e-01	0.180000	0.242443	0.180000	0.170000																										0				25						c.(1057-1059)tgC>tgT		5'-nucleotidase, ecto (CD73)	Cytarabine(DB00987)|Pentoxifylline(DB00806)						163.0	155.0	158.0					6																	86197162		2203	4300	6503	SO:0001819	synonymous_variant	4907	0	0					g.chr6:86197162C>T	X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.1059C>T	chr6.hg19:g.86197162C>T		1					NT5E_ENST00000369651.3_Silent_p.C353C	p.C353C	NM_002526.3	NP_002517.1	1	2	3	1.863648	P21589	5NTD_HUMAN		5	1108	+		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)	B3KQI8|O75520|Q5W116	Silent	SNP	ENST00000257770.3	0	1	hg19	c.1059C>T	CCDS5002.1	0	.	.	.	.	.	.	.	.	.	.	C	4.556	0.103180	0.08731	.	.	ENSG00000135318	ENST00000416334;ENST00000437581	.	.	.	5.48	4.61	0.57282	5.48	4.61	0.57282	.	.	.	.	.	T	0.60183	0.2249	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61451	-0.7060	4	.	.	.	-11.8388	14.096	0.65021	0.0:0.9277:0.0:0.0723	.	.	.	.	V	118;49	.	.	A	+	2	0	0	NT5E	86253881	86253881	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	2.258000	0.43249	1.318000	0.45170	0.557000	0.71058	GCC	0.179594		TCGA-HV-AA8V-01A-11D-A40W-08	0.413	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1	0	0	1		14	2	2	0		0	1	156		156	155	1	3.860000	-1.863692	0	0.130000				6	6		565	555	0		0	0		0	0	156	0		0.051280	1.977727e-02	0	0	0	17	0	6	565
BEND3	57673	broad.mit.edu	37	6	107391539	107391539	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr6:107391539G>A	ENST00000369042.1	-	4	1046	c.856C>T	c.(856-858)Cgg>Tgg	p.R286W	BEND3_ENST00000429433.2_Missense_Mutation_p.R286W			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	286	BEN 1. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CTGCAGCCCCGGGAGAAGTCC	0.637																																						ENST00000369042.1	1.000000	0.490000	1	7.300000e-01	0.990000	0.903717	0.990000	1.000000																										0				30						c.(856-858)Cgg>Tgg		BEN domain containing 3							18.0	18.0	18.0					6																	107391539		2189	4251	6440	SO:0001583	missense	57673	0	0					g.chr6:107391539G>A	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.856C>T	chr6.hg19:g.107391539G>A	ENSP00000358038:p.Arg286Trp	1					BEND3_ENST00000429433.2_Missense_Mutation_p.R286W	p.R286W			1	2	3	1.863648	Q5T5X7	BEND3_HUMAN		4	1046	-			A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	1	1	hg19	c.856C>T	CCDS34507.1	1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101677	0.56183	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	T;T	0.45668	0.89;0.89	5.32	5.32	0.75619	5.32	5.32	0.75619	BEN domain (2);	0.197966	0.40728	N	0.001029	T	0.48314	0.1493	L	0.56769	1.78	0.43494	D	0.995733	D	0.76494	0.999	D	0.63033	0.91	T	0.50440	-0.8828	10	0.87932	D	0	-0.939	11.8908	0.52628	0.0:0.0:0.7097:0.2903	.	286	Q5T5X7	BEND3_HUMAN	W	286	ENSP00000358038:R286W;ENSP00000411268:R286W	ENSP00000358038:R286W	R	-	1	2	2	BEND3	107498232	107498232	0.993000	0.37304	0.994000	0.49952	0.916000	0.54674	2.915000	0.48805	2.774000	0.95407	0.561000	0.74099	CGG	0.179594		TCGA-HV-AA8V-01A-11D-A40W-08	0.637	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	1	0	1		2	2	2	0		0	0	33		33	33	1	3.860000	-3.326893	1	0.130000	NM_020913			8	8		123	122	0		1	0		0	0	33	0		0.989772	0	0	0	0	1	0	8	123
CALD1	800	broad.mit.edu	37	7	134613527	134613527	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr7:134613527G>A	ENST00000361675.2	+	4	323	c.94G>A	c.(94-96)Gat>Aat	p.D32N	CALD1_ENST00000424922.1_Missense_Mutation_p.D26N|CALD1_ENST00000393118.2_Missense_Mutation_p.D26N|CALD1_ENST00000495522.1_Missense_Mutation_p.D26N|CALD1_ENST00000422748.1_Missense_Mutation_p.D32N|CALD1_ENST00000361901.2_Missense_Mutation_p.D32N|CALD1_ENST00000361388.2_Missense_Mutation_p.D32N|CALD1_ENST00000543443.1_Missense_Mutation_p.D37N|CALD1_ENST00000417172.1_Missense_Mutation_p.D32N			Q05682	CALD1_HUMAN	caldesmon 1	32	Myosin and calmodulin-binding. {ECO:0000250}.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GAGGAATGACGATGATGAAGA	0.587																																						ENST00000361675.2	1.000000	0.780000	1	9.900000e-01	0.990000	0.984838	0.990000	1.000000																										0				43						c.(94-96)Gat>Aat		caldesmon 1							53.0	49.0	51.0					7																	134613527		2203	4300	6503	SO:0001583	missense	800	0	0					g.chr7:134613527G>A	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.94G>A	chr7.hg19:g.134613527G>A	ENSP00000354826:p.Asp32Asn	0					CALD1_ENST00000422748.1_Missense_Mutation_p.D32N|CALD1_ENST00000361901.2_Missense_Mutation_p.D32N|CALD1_ENST00000361388.2_Missense_Mutation_p.D32N|CALD1_ENST00000417172.1_Missense_Mutation_p.D32N|CALD1_ENST00000495522.1_Missense_Mutation_p.D26N|CALD1_ENST00000543443.1_Missense_Mutation_p.D37N|CALD1_ENST00000424922.1_Missense_Mutation_p.D26N|CALD1_ENST00000393118.2_Missense_Mutation_p.D26N	p.D32N			1	2	3	2.015671	Q05682	CALD1_HUMAN		4	323	+			A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	1	1	hg19	c.94G>A	CCDS5835.1	1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.802103	0.70682	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000454108;ENST00000361675;ENST00000361901;ENST00000445569;ENST00000435928;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.55	5.55	0.83447	5.55	5.55	0.83447	.	0.000000	0.46758	D	0.000267	T	0.72203	0.3431	M	0.75264	2.295	0.31913	N	0.614431	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.999;0.998;0.998;0.998;0.998;0.999;0.999	T	0.73678	-0.3907	10	0.30078	T	0.28	-35.6861	17.6838	0.88251	0.0:0.0:1.0:0.0	.	37;32;26;26;32;32;32;32	F5H1Z9;A8K0X1;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;CALD1_HUMAN;.	N	32;32;32;32;32;32;32;46;32;26;26;26;37	ENSP00000398826:D32N;ENSP00000411476:D32N;ENSP00000355000:D32N;ENSP00000395710:D32N;ENSP00000401988:D32N;ENSP00000354826:D32N;ENSP00000354513:D32N;ENSP00000390926:D46N;ENSP00000416611:D32N;ENSP00000376826:D26N;ENSP00000393621:D26N;ENSP00000419673:D26N;ENSP00000445641:D37N	ENSP00000355000:D32N	D	+	1	0	0	CALD1	134264067	134264067	1.000000	0.71417	0.966000	0.40874	0.260000	0.26232	6.465000	0.73538	2.600000	0.87896	0.561000	0.74099	GAT	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.587	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	1	0	1		2	2	2	0		0	0	32		32	31	1	3.860000	-17.415180	1	0.130000	NM_033138			12	12		129	123	0		1	0	1	0	0	32	476		0.999024	9.999845e-01	1	0	68	243	691	12	129
FAM84B	157638	broad.mit.edu	37	8	127569401	127569401	+	Silent	SNP	C	C	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:127569401C>A	ENST00000304916.3	-	2	689	c.234G>T	c.(232-234)ctG>ctT	p.L78L	RP11-89K10.1_ENST00000517773.1_RNA|RP11-89K10.1_ENST00000520512.1_RNA|FAM84B_ENST00000517458.1_5'Flank|RP11-103H7.5_ENST00000524320.1_RNA|RP11-89K10.1_ENST00000519880.1_RNA	NM_174911.4	NP_777571.1	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	78						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			CCACCTCGTGCAGCCGCGGAT	0.716																																						ENST00000304916.3	1.000000	0.670000	1	9.900000e-01	0.990000	0.972709	0.990000	1.000000																										0				5						c.(232-234)ctG>ctT		family with sequence similarity 84, member B							11.0	12.0	12.0					8																	127569401		2147	4182	6329	SO:0001819	synonymous_variant	157638	0	0					g.chr8:127569401C>A	AJ417849	CCDS6358.1	8q24.13	2006-02-09				ENSG00000168672			24166	protein-coding gene	gene with protein product	"""breast cancer membrane-associated protein 101"", ""neurological/sensory 2"""	609483				12477722	Standard	NM_174911		Approved	BCMP101, NSE2	uc003yrz.2	Q96KN1		ENST00000304916.3:c.234G>T	chr8.hg19:g.127569401C>A		1					FAM84B_ENST00000517458.1_5'Flank|RP11-89K10.1_ENST00000519880.1_RNA|RP11-89K10.1_ENST00000517773.1_RNA|RP11-89K10.1_ENST00000520512.1_RNA|RP11-103H7.5_ENST00000524320.1_RNA	p.L78L	NM_174911.4	NP_777571.1	2	3	5	2.155993	Q96KN1	FA84B_HUMAN	STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)	2	689	-	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)			Silent	SNP	ENST00000304916.3	1	1	hg19	c.234G>T	CCDS6358.1	1																																																																																								0.271967		TCGA-HV-AA8V-01A-11D-A40W-08	0.716	FAM84B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381487.1	1	0	1		2	2	2	0		0	0	25		25	22	1	3.860000	-12.193250	1	0.130000	NM_174911			7	7		85	82	0		1	1		0	0	25	0		0.979699	9.135970e-02	0	2	0	4	0	7	85
BAI1	575	broad.mit.edu	37	8	143603456	143603456	+	Missense_Mutation	SNP	G	G	A	rs200093247		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:143603456G>A	ENST00000517894.1	+	21	4049	c.3155G>A	c.(3154-3156)cGc>cAc	p.R1052H	BAI1_ENST00000323289.5_Missense_Mutation_p.R1052H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1052					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ATCCGCAAGCGCTTCCTCTGC	0.657																																						ENST00000517894.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				57						c.(3154-3156)cGc>cAc		brain-specific angiogenesis inhibitor 1							31.0	41.0	38.0					8																	143603456		2199	4297	6496	SO:0001583	missense	575	0	0					g.chr8:143603456G>A	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3155G>A	chr8.hg19:g.143603456G>A	ENSP00000430945:p.Arg1052His	1					BAI1_ENST00000323289.5_Missense_Mutation_p.R1052H	p.R1052H			2	3	5	2.155993	O14514	BAI1_HUMAN		21	4049	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)			Missense_Mutation	SNP	ENST00000517894.1	0	1	hg19	c.3155G>A		1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434877	0.83885	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.38722	1.12;1.12	3.78	3.78	0.43462	3.78	3.78	0.43462	.	0.151347	0.45126	U	0.000396	T	0.48429	0.1499	L	0.54323	1.7	0.58432	D	0.999998	P	0.44734	0.842	P	0.48952	0.596	T	0.53351	-0.8451	10	0.54805	T	0.06	.	14.6053	0.68475	0.0:0.0:1.0:0.0	.	1052	E9PBK0	.	H	1052	ENSP00000430945:R1052H;ENSP00000313046:R1052H	ENSP00000313046:R1052H	R	+	2	0	0	BAI1	143600458	143600458	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	9.490000	0.97952	1.641000	0.50575	0.305000	0.20034	CGC	0.271967		TCGA-HV-AA8V-01A-11D-A40W-08	0.657	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	0	0	1		17	2	2	1		1	1	37		37	37	1	3.860000	-3.322475	1	0.130000	NM_001702			27	25		175	174	0		1	0		1	0	37	0		0.954763	0	0	0	0	1	0	27	175
CLDN23	137075	broad.mit.edu	37	8	8560232	8560232	+	Silent	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:8560232G>A	ENST00000519106.1	+	1	785	c.324G>A	c.(322-324)gaG>gaA	p.E108E		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	108					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		GGCAGGACGAGCCCAACTTCG	0.697																																						ENST00000519106.1	1.000000	0.920000	1	9.900000e-01	0.990000	0.995249	0.990000	1.000000																										0				2						c.(322-324)gaG>gaA		claudin 23							15.0	19.0	17.0					8																	8560232		2169	4252	6421	SO:0001819	synonymous_variant	137075	0	0					g.chr8:8560232G>A	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.324G>A	chr8.hg19:g.8560232G>A		0						p.E108E	NM_194284.2	NP_919260.2	1	2	3	1.900620	Q96B33	CLD23_HUMAN		1	785	+		Hepatocellular(245;0.217)	Q08AJ3	Silent	SNP	ENST00000519106.1	1	1	hg19	c.324G>A	CCDS55195.1	1																																																																																								0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.697	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	1	0	1		2	2	2	0		0	0	34		34	34	1	3.860000	-19.671100	1	0.130000	NM_194284			13	12		119	117	1		1	1		0	0	34	0		0.999562	6.145632e-01	0	11	0	9	0	13	119
ENTPD4	9583	broad.mit.edu	37	8	23297388	23297388	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:23297388C>A	ENST00000358689.4	-	9	1158	c.923G>T	c.(922-924)gGa>gTa	p.G308V	ENTPD4_ENST00000521321.1_5'Flank|ENTPD4_ENST00000356206.6_Missense_Mutation_p.G300V|ENTPD4_ENST00000417069.2_Missense_Mutation_p.G300V	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	308					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		AACATCACATCCCAAGTTAAA	0.403																																						ENST00000358689.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				25						c.(922-924)gGa>gTa		ectonucleoside triphosphate diphosphohydrolase 4							174.0	153.0	160.0					8																	23297388		2203	4300	6503	SO:0001583	missense	9583	0	0					g.chr8:23297388C>A	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.923G>T	chr8.hg19:g.23297388C>A	ENSP00000351520:p.Gly308Val	1					ENTPD4_ENST00000417069.2_Missense_Mutation_p.G300V|ENTPD4_ENST00000521321.1_5'Flank|ENTPD4_ENST00000356206.6_Missense_Mutation_p.G300V	p.G308V	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	2	5	7	2.379566	Q9Y227	ENTP4_HUMAN		9	1158	-		Prostate(55;0.114)	D3DSS3|O15092	Missense_Mutation	SNP	ENST00000358689.4	1	1	hg19	c.923G>T	CCDS6041.1	1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747739	0.89663	.	.	ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069	T;T;T	0.10763	2.84;2.84;2.84	6.04	6.04	0.98038	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.43523	0.1251	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.40194	-0.9576	10	0.51188	T	0.08	-20.4904	19.1586	0.93522	0.0:1.0:0.0:0.0	.	300;300;308	Q8NE73;Q9Y227-2;Q9Y227	.;.;ENTP4_HUMAN	V	300;308;300	ENSP00000348536:G300V;ENSP00000351520:G308V;ENSP00000408573:G300V	ENSP00000348536:G300V	G	-	2	0	0	ENTPD4	23353333	23353333	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.391000	0.79828	2.873000	0.98535	0.563000	0.77884	GGA	0.343396		TCGA-HV-AA8V-01A-11D-A40W-08	0.403	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	1	0	1		2	2	2	0		0	0	112		112	112	1	3.860000	-15.876950	1	0.130000	NM_004901			45	45		381	379	0		1	0		0	0	112	0		1.000000	8.511444e-01	0	0	0	31	0	45	381
ADAM7	8756	broad.mit.edu	37	8	24324330	24324330	+	Silent	SNP	C	C	T	rs143068519		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:24324330C>T	ENST00000175238.6	+	6	491	c.408C>T	c.(406-408)aaC>aaT	p.N136N	ADAM7_ENST00000441335.2_Silent_p.N136N|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Silent_p.N136N	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TCAGAATAAACGACCAAAGAT	0.373													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18511	0.0		0.0	False		,,,				2504	0.0					ENST00000175238.6	1.000000	0.770000	1	9.500000e-01	0.990000	0.976968	0.990000	1.000000																										0				64						c.(406-408)aaC>aaT		ADAM metallopeptidase domain 7		C		4,4402	6.2+/-15.9	0,4,2199	87.0	88.0	88.0		408	1.6	0.1	8	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAM7	NM_003817.2		0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384		136/755	24324330	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	8756	10	121412	42				g.chr8:24324330C>T	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.408C>T	chr8.hg19:g.24324330C>T		1					ADAM7_ENST00000380789.1_Silent_p.N136N|ADAM7_ENST00000441335.2_Silent_p.N136N|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	p.N136N	NM_003817.3	NP_003808.2	2	5	7	2.379566	Q9H2U9	ADAM7_HUMAN		6	491	+		Prostate(55;0.0181)	A8K8X7|O75959|Q6PEJ6	Silent	SNP	ENST00000175238.6	1	1	hg19	c.408C>T	CCDS6045.1	1																																																																																								0.343396		TCGA-HV-AA8V-01A-11D-A40W-08	0.373	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	1	0	1		2	2	2	0		0	0	99		99	97	1	3.860000	-20.000000	1	0.130000	NM_003817			24	24		399	394	0		1			0	0	99	0		1.000000	0	0	0	0	0	0	24	399
GPR124	25960	broad.mit.edu	37	8	37693106	37693106	+	Missense_Mutation	SNP	C	C	T	rs370919357		TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:37693106C>T	ENST00000412232.2	+	13	1881	c.1868C>T	c.(1867-1869)cCg>cTg	p.P623L	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	623					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CAGCTGCCCCCGAGTCTATTC	0.647													C|||	1	0.000199681	0.0	0.0014	5008	,	,		12429	0.0		0.0	False		,,,				2504	0.0					ENST00000412232.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999075	0.990000	1.000000																										0				37						c.(1867-1869)cCg>cTg		G protein-coupled receptor 124		C	LEU/PRO	0,4406		0,0,2203	77.0	93.0	87.0		1868	5.3	1.0	8		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR124	NM_032777.9	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	623/1339	37693106	1,13005	2203	4300	6503	SO:0001583	missense	25960	4	121412	42				g.chr8:37693106C>T	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1868C>T	chr8.hg19:g.37693106C>T	ENSP00000406367:p.Pro623Leu	1					GPR124_ENST00000315215.7_Intron	p.P623L	NM_032777.9	NP_116166.9	2	5	7	2.379566	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)	13	1881	+			A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	1	1	hg19	c.1868C>T	CCDS6097.2	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106064	0.77096	0.0	1.16E-4	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.57595	0.39	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.201328	0.43579	D	0.000547	T	0.50222	0.1603	L	0.59436	1.845	0.80722	D	1	P	0.40681	0.727	B	0.33960	0.173	T	0.58792	-0.7574	10	0.62326	D	0.03	-27.3238	18.9399	0.92601	0.0:1.0:0.0:0.0	.	623	Q96PE1	GP124_HUMAN	L	616;623	ENSP00000406367:P623L	ENSP00000406367:P623L	P	+	2	0	0	GPR124	37812264	37812264	0.998000	0.40836	1.000000	0.80357	0.748000	0.42578	2.875000	0.48491	2.497000	0.84241	0.655000	0.94253	CCG	0.343396		TCGA-HV-AA8V-01A-11D-A40W-08	0.647	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2	1	0	1		2	2	2	0		0	0	171		171	168	1	3.860000	-2.258096	0	0.130000				55	54		789	755	0		1	0		0	0	171	0		1.000000	9.196754e-01	0	0	0	63	0	55	789
CLVS1	157807	broad.mit.edu	37	8	62212502	62212502	+	Missense_Mutation	SNP	G	G	A	rs187032551	byFrequency	TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:62212502G>A	ENST00000519846.1	+	3	588	c.116G>A	c.(115-117)cGc>cAc	p.R39H	RP11-787D18.1_ENST00000518064.1_RNA|CLVS1_ENST00000518592.1_Intron|RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000325897.4_Missense_Mutation_p.R39H			Q8IUQ0	CLVS1_HUMAN	clavesin 1	39					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						GAGAAAGCTCGCCTGGAACTG	0.433													G|||	2	0.000399361	0.0	0.0	5008	,	,		19602	0.0		0.002	False		,,,				2504	0.0					ENST00000519846.1	1.000000	0.890000	1	9.900000e-01	0.990000	0.993652	0.990000	1.000000																										0				41						c.(115-117)cGc>cAc		clavesin 1							81.0	75.0	77.0					8																	62212502		2203	4300	6503	SO:0001583	missense	157807	62	121408	50				g.chr8:62212502G>A	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.116G>A	chr8.hg19:g.62212502G>A	ENSP00000428402:p.Arg39His	0					CLVS1_ENST00000518592.1_Intron|RP11-787D18.1_ENST00000518064.1_RNA|CLVS1_ENST00000325897.4_Missense_Mutation_p.R39H|RP11-787D18.1_ENST00000521801.1_RNA	p.R39H			1	2	3	2.013997	Q8IUQ0	CLVS1_HUMAN		3	588	+			B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	ENST00000519846.1	1	1	hg19	c.116G>A	CCDS6176.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	22.1	4.238068	0.79800	.	.	ENSG00000177182	ENST00000522621;ENST00000519846;ENST00000325897	T;T	0.80653	-1.4;-1.4	5.79	5.79	0.91817	5.79	5.79	0.91817	Phosphatidylinositol transfer protein-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88905	0.6564	M	0.68728	2.09	0.51482	D	0.99992	D;D;D	0.89917	1.0;0.995;0.999	D;D;P	0.67103	0.949;0.91;0.868	D	0.88451	0.3049	10	0.56958	D	0.05	-1.6018	20.0313	0.97540	0.0:0.0:1.0:0.0	.	39;39;39	E5RK22;Q8IUQ0;Q8IUQ0-2	.;CLVS1_HUMAN;.	H	39	ENSP00000428402:R39H;ENSP00000325506:R39H	ENSP00000325506:R39H	R	+	2	0	0	CLVS1	62375056	62375056	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.772000	0.55325	2.746000	0.94184	0.655000	0.94253	CGC	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.433	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	1	0	1		2	2	2	0		0	0	87		87	87	1	3.860000	-20.000000	1	0.130000	NM_173519			23	23		256	254	0		1			0	0	87	0		1.000000	0	0	0	0	0	0	23	256
FBXL6	26233	broad.mit.edu	37	8	145580129	145580129	+	Silent	SNP	T	T	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr8:145580129T>A	ENST00000331890.5	-	7	1120	c.1056A>T	c.(1054-1056)ggA>ggT	p.G352G	SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000455319.2_Silent_p.G346G|FBXL6_ENST00000526524.1_5'UTR|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	352					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GGAAGCCTGGTCCGGGAGCCA	0.652																																						ENST00000331890.5	1.000000	0.470000	1	6.300000e-01	0.830000	0.823157	0.830000	1.000000																										0				5						c.(1054-1056)ggA>ggT		F-box and leucine-rich repeat protein 6							40.0	44.0	43.0					8																	145580129		2203	4298	6501	SO:0001819	synonymous_variant	26233	0	0					g.chr8:145580129T>A	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1056A>T	chr8.hg19:g.145580129T>A		1					SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|FBXL6_ENST00000455319.2_Silent_p.G346G|TMEM249_ENST00000531225.1_5'Flank|FBXL6_ENST00000526524.1_5'UTR|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank	p.G352G	NM_012162.2	NP_036294.2	2	3	5	2.155993	Q8N531	FBXL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)	7	1120	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q53G43|Q9H5W9|Q9UKC7	Silent	SNP	ENST00000331890.5	1	1	hg19	c.1056A>T	CCDS6422.1	0																																																																																								0.271967		TCGA-HV-AA8V-01A-11D-A40W-08	0.652	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	1	0	1		2	2	2	0		0	0	63		63	63	1	3.860000	-15.198480	1	0.130000	NM_024555			13	13		280	276	0		1	1		0	0	63	0		0.999523	7.069337e-01	0	17	0	37	0	13	280
ALDH1A1	216	broad.mit.edu	37	9	75531895	75531895	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr9:75531895G>A	ENST00000297785.3	-	9	1030	c.976C>T	c.(976-978)Cgg>Tgg	p.R326W	ALDH1A1_ENST00000376939.1_3'UTR	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	326					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	TTCTTAGCCCGCTCAACACTC	0.458																																						ENST00000297785.3	0.370000	0.060000	2.700000e-01	1.100000e-01	0.180000	0.197993	0.180000	0.160000																										0				17						c.(976-978)Cgg>Tgg		aldehyde dehydrogenase 1 family, member A1	Tretinoin(DB00755)|Vitamin A(DB00162)						111.0	109.0	110.0					9																	75531895		2203	4300	6503	SO:0001583	missense	216	2	121412	35				g.chr9:75531895G>A	K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.976C>T	chr9.hg19:g.75531895G>A	ENSP00000297785:p.Arg326Trp	0					ALDH1A1_ENST00000376939.1_3'UTR	p.R326W	NM_000689.4	NP_000680.2	1	2	3	1.994920	P00352	AL1A1_HUMAN		9	1030	-			O00768|Q5SYR1	Missense_Mutation	SNP	ENST00000297785.3	0	1	hg19	c.976C>T	CCDS6644.1	0	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767293	0.49574	.	.	ENSG00000165092	ENST00000297785	T	0.78003	-1.14	5.96	4.1	0.47936	5.96	4.1	0.47936	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.64402	D	0.000001	D	0.89556	0.6749	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.91235	0.5017	10	0.87932	D	0	.	15.5066	0.75745	0.0:0.0:0.4719:0.5281	.	247;326	B4DDF8;P00352	.;AL1A1_HUMAN	W	326	ENSP00000297785:R326W	ENSP00000297785:R326W	R	-	1	2	2	ALDH1A1	74721715	74721715	0.000000	0.05858	0.988000	0.46212	0.417000	0.31264	0.133000	0.15912	0.834000	0.34852	-0.182000	0.12963	CGG	0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.458	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052679.1	0	0	1		2	2	2	0		0	0	131		131	131	1	3.860000	-2.055238	0	0.130000				5	5		485	476	0		1	0		0	0	131	0		0.934747	4.665339e-01	0	0	0	135	0	5	485
FOXB2	442425	broad.mit.edu	37	9	79635329	79635329	+	Silent	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chr9:79635329C>T	ENST00000376708.1	+	1	759	c.759C>T	c.(757-759)gcC>gcT	p.A253A		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	253	Poly-Ala.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(8)|ovary(1)	10						GCTCGgccgccgccgctgccg	0.746																																						ENST00000376708.1	1.000000	0.270000	1	4.800000e-01	0.780000	0.755049	0.780000	1.000000																										0				10						c.(757-759)gcC>gcT		forkhead box B2							9.0	11.0	11.0					9																	79635329		2126	4196	6322	SO:0001819	synonymous_variant	442425	0	0					g.chr9:79635329C>T		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.759C>T	chr9.hg19:g.79635329C>T		0						p.A253A	NM_001013735.1	NP_001013757.1	1	2	3	1.994920	Q5VYV0	FOXB2_HUMAN		1	759	+				Silent	SNP	ENST00000376708.1	0	1	hg19	c.759C>T	CCDS35045.1	0																																																																																								0.183099		TCGA-HV-AA8V-01A-11D-A40W-08	0.746	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	0	0	1		2	2	2	0		0	0	32		32	32	1	3.860000	-8.273290	1	0.130000	NM_001013735			4	4		87	78	0		1			0	0	32	0		0.865672	0	0	0	0	0	0	4	87
MORF4L2	9643	broad.mit.edu	37	X	102931572	102931572	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chrX:102931572T>A	ENST00000441076.2	-	4	688	c.384A>T	c.(382-384)gaA>gaT	p.E128D	MORF4L2_ENST00000423833.2_Missense_Mutation_p.E128D|MORF4L2_ENST00000422154.2_Missense_Mutation_p.E128D|MORF4L2_ENST00000360458.1_Missense_Mutation_p.E128D|MORF4L2_ENST00000433176.2_Missense_Mutation_p.E128D|MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000451301.1_Missense_Mutation_p.E128D	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	128	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						ATGGTTTTAATTCTTCAGGAA	0.478																																						ENST00000441076.2	1.000000	0.770000	9.800000e-01	8.500000e-01	0.920000	0.918017	0.920000	0.970000																										0				13						c.(382-384)gaA>gaT		mortality factor 4 like 2							170.0	181.0	177.0					X																	102931572		2203	4300	6503	SO:0001583	missense	9643	0	0					g.chrX:102931572T>A	AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.384A>T	chrX.hg19:g.102931572T>A	ENSP00000391969:p.Glu128Asp						MORF4L2_ENST00000423833.2_Missense_Mutation_p.E128D|MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000433176.2_Missense_Mutation_p.E128D|MORF4L2_ENST00000422154.2_Missense_Mutation_p.E128D|MORF4L2_ENST00000360458.1_Missense_Mutation_p.E128D|MORF4L2_ENST00000451301.1_Missense_Mutation_p.E128D	p.E128D	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	0	1	1		Q15014	MO4L2_HUMAN		4	688	-			B3KP92|D3DXA5|Q567V0|Q8J026	Missense_Mutation	SNP	ENST00000441076.2	1	1	hg19	c.384A>T	CCDS14512.1	1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178374	0.57692	.	.	ENSG00000123562	ENST00000360458;ENST00000372620;ENST00000433176;ENST00000422154;ENST00000451301;ENST00000372619;ENST00000441076;ENST00000423833;ENST00000434230;ENST00000418819;ENST00000442614	T;T;T;T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9	4.58	0.833	0.18875	4.58	0.833	0.18875	.	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	M	0.77406	2.37	0.49915	D	0.999839	D	0.55385	0.971	P	0.61722	0.893	T	0.03433	-1.1037	10	0.25106	T	0.35	-4.4154	7.0906	0.25282	0.0:0.4174:0.0:0.5826	.	128	Q15014	MO4L2_HUMAN	D	128;10;128;128;128;110;128;128;128;128;128	ENSP00000353643:E128D;ENSP00000361703:E10D;ENSP00000415476:E128D;ENSP00000394417:E128D;ENSP00000410532:E128D;ENSP00000391969:E128D;ENSP00000416120:E128D;ENSP00000413664:E128D;ENSP00000393283:E128D;ENSP00000400938:E128D	ENSP00000353643:E128D	E	-	3	2	2	MORF4L2	102818228	102818228	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	0.755000	0.26405	0.035000	0.15519	0.486000	0.48141	GAA	0.130000		TCGA-HV-AA8V-01A-11D-A40W-08	0.478	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057732.1	1	0	1		2	2	2	0		0	0	258		258	255	1	3.860000	-20.000000	1	0.130000	NM_012286			94	93		648	637	1		1	1		0	0	258	0		1.000000	1	0	47	0	135	0	94	648
MAGEB10	139422	broad.mit.edu	37	X	27839749	27839749	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chrX:27839749G>T	ENST00000356790.2	+	3	571	c.326G>T	c.(325-327)gGc>gTc	p.G109V		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	109										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						TTTCCCAGAGGCCCTGTAGAT	0.433																																						ENST00000356790.2	1.000000	0.610000	9.700000e-01	7.600000e-01	0.890000	0.874589	0.890000	0.990000																										0				26						c.(325-327)gGc>gTc		melanoma antigen family B, 10							51.0	44.0	46.0					X																	27839749		2202	4300	6502	SO:0001583	missense	139422	0	0					g.chrX:27839749G>T		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.326G>T	chrX.hg19:g.27839749G>T	ENSP00000368304:p.Gly109Val							p.G109V	NM_182506.3	NP_872312.2	0	1	1		Q96LZ2	MAGBA_HUMAN		3	571	+			Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	1	1	hg19	c.326G>T	CCDS35221.1	1	.	.	.	.	.	.	.	.	.	.	G	6.997	0.554038	0.13374	.	.	ENSG00000177689	ENST00000356790	T	0.01725	4.67	2.62	-1.12	0.09808	2.62	-1.12	0.09808	.	2.059270	0.02888	U	0.133736	T	0.02688	0.0081	L	0.58669	1.825	0.09310	N	1	P	0.42827	0.791	B	0.39419	0.299	T	0.37709	-0.9694	10	0.87932	D	0	.	2.8839	0.05656	0.4159:0.2379:0.3461:0.0	.	109	Q96LZ2	MAGBA_HUMAN	V	109	ENSP00000368304:G109V	ENSP00000368304:G109V	G	+	2	0	0	MAGEB10	27749670	27749670	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.294000	0.19047	-0.403000	0.07622	0.422000	0.28245	GGC	0.130000		TCGA-HV-AA8V-01A-11D-A40W-08	0.433	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	1	0	1		2	2	2	0		0	0	24		24	24	1	3.860000	-19.999860	1	0.130000	NM_182506			13	12		59	58	1		1			0	0	24	0		0.999642	0	0	0	0	0	0	13	59
PNMA5	114824	broad.mit.edu	37	X	152159280	152159280	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8V-01A-11D-A40W-08	TCGA-HV-AA8V-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b232a50f-86ac-46b8-b90f-97355698a754	a91f227e-e168-4f76-af62-e5e0aabcfb17	g.chrX:152159280C>T	ENST00000439251.1	-	2	1301	c.863G>A	c.(862-864)cGt>cAt	p.R288H	PNMA5_ENST00000535214.1_Missense_Mutation_p.R288H|PNMA5_ENST00000452693.1_Missense_Mutation_p.R288H|PNMA5_ENST00000361887.5_Missense_Mutation_p.R288H	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	288					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					ATGTTTCAGACGAATCATGTC	0.562																																						ENST00000439251.1	0.990000	0.600000	9.500000e-01	7.200000e-01	0.850000	0.841755	0.850000	0.910000																										0				25						c.(862-864)cGt>cAt		paraneoplastic Ma antigen family member 5							43.0	44.0	43.0					X																	152159280		2203	4298	6501	SO:0001583	missense	114824	2	121282	33				g.chrX:152159280C>T	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.863G>A	chrX.hg19:g.152159280C>T	ENSP00000388850:p.Arg288His						PNMA5_ENST00000535214.1_Missense_Mutation_p.R288H|PNMA5_ENST00000361887.5_Missense_Mutation_p.R288H|PNMA5_ENST00000452693.1_Missense_Mutation_p.R288H	p.R288H	NM_001103150.1	NP_001096620.1	0	1	1		Q96PV4	PNMA5_HUMAN		2	1301	-	Acute lymphoblastic leukemia(192;6.56e-05)		B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	ENST00000439251.1	1	1	hg19	c.863G>A	CCDS14718.1	1	.	.	.	.	.	.	.	.	.	.	c	16.12	3.034229	0.54896	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	2.97	2.1	0.27182	2.97	2.1	0.27182	.	.	.	.	.	T	0.26122	0.0637	M	0.84683	2.71	0.09310	N	1	P	0.48503	0.911	P	0.45343	0.477	T	0.18840	-1.0324	9	0.72032	D	0.01	-25.6602	5.2804	0.15673	0.0:0.8331:0.0:0.1669	.	288	Q96PV4	PNMA5_HUMAN	H	288	ENSP00000354834:R288H;ENSP00000445775:R288H;ENSP00000388850:R288H;ENSP00000392342:R288H	ENSP00000354834:R288H	R	-	2	0	0	PNMA5	151909936	151909936	0.906000	0.30813	0.023000	0.16930	0.160000	0.22226	0.939000	0.28978	0.669000	0.31146	0.287000	0.19450	CGT	0.130000		TCGA-HV-AA8V-01A-11D-A40W-08	0.562	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	1	0	1		2	2	2	0		0	0	54		54	53	1	3.860000	-20.000000	1	0.130000	NM_052926			25	25		180	175	1		1			0	0	54	0		1.000000	0	0	0	0	0	0	25	180
