#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PNLIP	5406	broad.mit.edu	37	10	118318720	118318721	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			-	A	-	-		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr10:118318720_118318721insA	ENST00000369221.2	+	10	1013_1014	c.985_986insA	c.(985-987)gatfs	p.D329fs		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	329					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	TCACTATGCTGATAGATATCCT	0.401																																						ENST00000369221.2	0.790000	5.600000e-01	0.740000	0.610000	0.670000	0.678694	0.670000	0.680000																										0				43						c.(985-987)gatfs		pancreatic lipase	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)																																			SO:0001589	frameshift_variant	5406	0	0					g.chr10:118318720_118318721insA	BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.986dupA	chr10.hg19:g.118318721_118318721dupA	ENSP00000358223:p.Asp329fs	0						p.D329fs	NM_000936.2	NP_000927.1	0	1	1	2.037845	P16233	LIPP_HUMAN		10	1013_1014	+			Q5VSQ2	Frame_Shift_Ins	INS	ENST00000369221.2	0	1	hg19	c.985_986insA	CCDS7594.1	0																																																																																								0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.401	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	1	0	1		2	2		0	0	0	0	66	0	66	65	1	1.930000	-20.000000	1	0.630000	NM_000936		0	104	105	0	383	378	0	0	1	0		0	0	66	0	0	1.000000	1		0	0	160	0	104	383
INPP5F	22876	broad.mit.edu	37	10	121551520	121551521	+	Frame_Shift_Ins	INS	-	-	GAGG			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr10:121551520_121551521insGAGG	ENST00000361976.2	+	5	750_751	c.584_585insGAGG	c.(583-588)gagaggfs	p.-196fs	INPP5F_ENST00000369081.1_Frame_Shift_Ins_p.-100fs|INPP5F_ENST00000369083.3_Frame_Shift_Ins_p.-196fs	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F						cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		AGCACTGGGGAGAGGGACGGTC	0.5																																						ENST00000361976.2	0.580000	4.000000e-01	0.540000	0.440000	0.490000	0.498000	0.490000	0.500000																										0				42						c.(583-588)gagaggfs		inositol polyphosphate-5-phosphatase F																																				SO:0001589	frameshift_variant	22876	0	0					g.chr10:121551520_121551521insGAGG	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.585_588dupGAGG	chr10.hg19:g.121551521_121551524dupGAGG	ENSP00000354519:p.Arg196fs	0					INPP5F_ENST00000369081.1_Frame_Shift_Ins_p.-100fs|INPP5F_ENST00000369083.3_Frame_Shift_Ins_p.-196fs	p.-196fs	NM_014937.3	NP_055752.1	0	1	1	2.037845	Q01968	OCRL_HUMAN		5	750_751	+		Lung NSC(174;0.109)|all_lung(145;0.142)	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Frame_Shift_Ins	INS	ENST00000361976.2	0	1	hg19	c.584_585insGAGG	CCDS7616.1	0																																																																																								0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.500	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	1	0	1		2	2		0	0	0	0	117	0	117	115	1	1.930000	-20.000000	1	0.630000	NM_014937		0	105	110	0	566	562	0	0	1	0		0	0	117	0	0	1.000000	3.663019e-01		0	0	8	0	105	566
RPRD2	23248	broad.mit.edu	37	1	150443776	150443776	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			T	-	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr1:150443776delT	ENST00000369068.4	+	11	2356	c.2352delT	c.(2350-2352)aatfs	p.N784fs	RPRD2_ENST00000401000.4_Frame_Shift_Del_p.N758fs|RPRD2_ENST00000539519.1_Frame_Shift_Del_p.N758fs|RPRD2_ENST00000492220.1_3'UTR	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	784	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AGCTCTCCAATTCTGTATCTA	0.507																																						ENST00000369068.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999826	0.990000	1.000000																										0				37						c.(2350-2352)aatfs		regulation of nuclear pre-mRNA domain containing 2							85.0	79.0	81.0					1																	150443776		1887	4110	5997	SO:0001589	frameshift_variant	23248	0	0					g.chr1:150443776delT	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2352delT	chr1.hg19:g.150443776delT	ENSP00000358064:p.Asn784fs	1					RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Frame_Shift_Del_p.N758fs|RPRD2_ENST00000539519.1_Frame_Shift_Del_p.N758fs	p.N784fs	NM_015203.3	NP_056018.2	1	2	3	2.653221	Q5VT52	RPRD2_HUMAN		11	2356	+			A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Frame_Shift_Del	DEL	ENST00000369068.4	1	1	hg19	c.2352delT	CCDS44216.1	1																																																																																								0.713833		TCGA-HV-AA8X-01A-11D-A397-08	0.507	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	1	0	1		2	2		0	0	0	0	32	0	32	33	1	1.930000	-20.000000	1	0.630000	NM_015203		0	89	91	0	199	199	0	0	1	1		0	0	32	0	0	1.000000	1		18	0	44	0	89	199
PRSS1	5644	broad.mit.edu	37	7	142458419	142458421	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			TGA	-	TGA	TGA		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr7:142458419_142458421delTGA	ENST00000311737.7	+	2	60_62	c.54_56delTGA	c.(52-57)tttgat>ttt	p.D22del	PRSS1_ENST00000486171.1_In_Frame_Del_p.D22del	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	22			D -> G (in PCTT; increased rate of activation). {ECO:0000269|PubMed:10930381}.		cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CTGCCCCCTTTGATGATGATGAC	0.527																																						ENST00000311737.7	0.390000	2.600000e-01	0.360000	0.290000	0.320000	0.334147	0.320000	0.320000																										0				38	GRCh37	CM035652	PRSS1	M		c.(52-57)tttgat>ttt		protease, serine, 1 (trypsin 1)	Aprotinin(DB06692)																																			SO:0001651	inframe_deletion	5644	0	0					g.chr7:142458419_142458421delTGA	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.54_56delTGA	chr7.hg19:g.142458428_142458430delTGA	ENSP00000308720:p.Asp22del	0					PRSS1_ENST00000486171.1_In_Frame_Del_p.D22del	p.D22del	NM_002769.4	NP_002760.1	1	2	3	2.083494	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)	2	60_62	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	In_Frame_Del	DEL	ENST00000311737.7	1	0	hg19	c.54_56delTGA	CCDS5872.1	0																																																																																								0.632316		TCGA-HV-AA8X-01A-11D-A397-08	0.527	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2	1	0	0		139	2	2	0	0	0	20	176	0	176	181	1	1.930000	-20.000000	1	0.630000			0	122	257	0	1075	857	0	0	1	0	1	0	0	176	87	0	0.046923	1	9.999971e-01	0	30	540	123	122	1075
KDM6A	7403	broad.mit.edu	37	X	44969494	44969503	+	Splice_Site	DEL	AGTAAGTCAA	AGTAAGTCAA	-			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			AGTAAGTCAA	-	AGTAAGTCAA	AGTAAGTCAA		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chrX:44969494_44969503delAGTAAGTCAA	ENST00000377967.4	+	28	4217	c.4176delAGTAAGTCAA	c.(4174-4176)tta>tt	p.L1392fs	KDM6A_ENST00000479423.1_3'UTR|KDM6A_ENST00000543216.1_Splice_Site_p.L1313fs|KDM6A_ENST00000536777.1_Splice_Site_p.L1347fs|KDM6A_ENST00000382899.4_Splice_Site_p.L1399fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1392					canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						AATTTACATTAGTAAGTCAAATCAACATGT	0.376			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	ENST00000377967.4	0.630000	3.400000e-01	0.560000	0.410000	0.480000	0.492298	0.480000	0.480000				Rec	yes			Rec	yes		X	Xp11.2	Xp11.2	7403	D, N, F, S	"""lysine (K)-specific demethylase 6A, UTX"""				"""E, L"""	E, L			renal, oesophageal SCC, MM		6	Whole gene deletion(6)	p.0?(6)	oesophagus(2)|breast(2)|pancreas(2)	170						c.(4174-4176)tta>tt		lysine (K)-specific demethylase 6A																																				SO:0001630	splice_region_variant	7403	0	0					g.chrX:44969494_44969503delAGTAAGTCAA	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.4176+1AGTAAGTCAA>-	chrX.hg19:g.44969494_44969503delAGTAAGTCAA							KDM6A_ENST00000536777.1_Splice_Site_p.L1347fs|KDM6A_ENST00000382899.4_Splice_Site_p.L1399fs|KDM6A_ENST00000543216.1_Splice_Site_p.L1313fs|KDM6A_ENST00000479423.1_3'UTR	p.L1392fs	NM_021140.2	NP_066963.2	0	1	1		O15550	KDM6A_HUMAN		28	4217	+			Q52LL9|Q5JVQ7	Splice_Site	DEL	ENST00000377967.4	1	1	hg19	c.4176delAGTAAGTCAA	CCDS14265.1	0																																																																																								0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.376	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	0	0	1		20	2	2	0	0	0	1	43	0	43	44	1	1.930000	-20.000000	1	0.630000	NM_021140	Frame_Shift_Del	0	36	61	0	200	225	0	0	1	0	1	0	0	43	288	0	0.999218	9.958940e-01	1	0	85	50	329	36	200
RBM17	84991	broad.mit.edu	37	10	6157416	6157416	+	Splice_Site	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr10:6157416C>T	ENST00000446108.1	+	12	1747	c.1103C>T	c.(1102-1104)gCg>gTg	p.A368V	RBM17_ENST00000476706.1_3'UTR|RBM17_ENST00000379888.4_Splice_Site_p.A368V	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	368	RRM.				alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						TGCCTTTCAGCGGTTGTTGAC	0.353																																						ENST00000446108.1	0.140000	3.000000e-02	0.110000	0.050000	0.070000	0.086063	0.070000	0.080000																										0				19						c.(1102-1104)gCg>gTg		RNA binding motif protein 17							173.0	159.0	164.0					10																	6157416		2203	4300	6503	SO:0001630	splice_region_variant	84991	0	0					g.chr10:6157416C>T	AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.1103-1C>T	chr10.hg19:g.6157416C>T		1					RBM17_ENST00000476706.1_3'UTR|RBM17_ENST00000379888.4_Splice_Site_p.A368V	p.A368V	NM_001145547.1	NP_001139019.1	0	1	1	1.380522	Q96I25	SPF45_HUMAN		12	1747	+			Q96GY6	Splice_Site	SNP	ENST00000446108.1	1	0	hg19	c.1103C>T	CCDS7077.1	0	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653982	0.88056	.	.	ENSG00000134453	ENST00000379888;ENST00000446108	.	.	.	4.93	4.93	0.64822	4.930000	4.930000	0.648220	RNA recognition motif domain, eukaryote (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.87617	0.6222	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91544	0.5252	8	.	.	.	.	18.519	0.90944	0.0:1.0:0.0:0.0	.	368	Q96I25	SPF45_HUMAN	V	368	.	.	A	+	2	0	0	RBM17	6197422	6197422	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.091000	0.76923	2.424000	0.82194	0.655000	0.94253	GCG	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.353	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046635.1	1	0	1	2	2	2	2	0	0	0	0	83	0	83	82	1	1.930000	-3.264751	1	0.630000	NM_032905	Missense_Mutation	0	11	11	0	289	286	0		1	1		0	0	83	0	0	0.998324	9.938181e-01	0	14	0	217	0	11	289
MYO3A	53904	broad.mit.edu	37	10	26432452	26432452	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr10:26432452C>A	ENST00000265944.5	+	21	2504	c.2338C>A	c.(2338-2340)Ctg>Atg	p.L780M	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	780	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AGATATGTTTCTGCAAAAGCC	0.383																																						ENST00000265944.5	1.000000	7.100000e-01	0.950000	0.790000	0.860000	0.871853	0.860000	1.000000																										0				146						c.(2338-2340)Ctg>Atg		myosin IIIA							140.0	137.0	138.0					10																	26432452		2203	4300	6503	SO:0001583	missense	53904	0	0					g.chr10:26432452C>A	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2338C>A	chr10.hg19:g.26432452C>A	ENSP00000265944:p.Leu780Met	0					MYO3A_ENST00000543632.1_Intron	p.L780M	NM_017433.4	NP_059129.3	0	0	0	2.041878	Q8NEV4	MYO3A_HUMAN		21	2504	+			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	1	1	hg19	c.2338C>A	CCDS7148.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159247	0.78226	.	.	ENSG00000095777	ENST00000265944	D	0.87179	-2.22	6.02	6.02	0.97574	6.020000	6.020000	0.975740	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.91968	0.7456	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91867	0.5504	10	0.72032	D	0.01	.	11.775	0.51981	0.0:0.8651:0.0:0.1349	.	780	Q8NEV4	MYO3A_HUMAN	M	780	ENSP00000265944:L780M	ENSP00000265944:L780M	L	+	1	2	2	MYO3A	26472458	26472458	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.744000	0.47450	2.857000	0.98124	0.650000	0.86243	CTG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.383	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	1	0	1	2	2	2	2	0	0	0	0	63	0	63	63	1	1.930000	-20.000000	1	0.630000	NM_017433		0	90	89	0	238	236	1		1	0		0	0	63	0	0	1.000000	3.062954e-01	0	0	0	4	0	90	238
LZTS2	84445	broad.mit.edu	37	10	102765276	102765276	+	Missense_Mutation	SNP	C	C	T	rs368966948		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr10:102765276C>T	ENST00000370220.1	+	3	4193	c.1130C>T	c.(1129-1131)gCg>gTg	p.A377V	LZTS2_ENST00000370223.3_Missense_Mutation_p.A377V					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GAGGACTGTGCGGCCCAGGCA	0.657																																					Esophageal Squamous(8;38 437 13604 19902 37640)	ENST00000370220.1	0.150000	2.000000e-02	0.110000	0.040000	0.070000	0.081989	0.070000	0.070000																										0				22						c.(1129-1131)gCg>gTg		leucine zipper, putative tumor suppressor 2		C	VAL/ALA	1,4395		0,1,2197	22.0	27.0	25.0		1130	1.6	0.0	10		25	0,8564		0,0,4282	no	missense	LZTS2	NM_032429.2	64	0,1,6479	TT,TC,CC		0.0,0.0227,0.0077	benign	377/670	102765276	1,12959	2198	4282	6480	SO:0001583	missense	84445	4	120942	31				g.chr10:102765276C>T	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1130C>T	chr10.hg19:g.102765276C>T	ENSP00000359240:p.Ala377Val	0					LZTS2_ENST00000370223.3_Missense_Mutation_p.A377V	p.A377V			0	1	1	2.037845				3	4193	+				Missense_Mutation	SNP	ENST00000370220.1	0	1	hg19	c.1130C>T	CCDS7507.1	0	.	.	.	.	.	.	.	.	.	.	C	12.45	1.941222	0.34283	2.27E-4	0.0	ENSG00000107816	ENST00000370223;ENST00000315797;ENST00000370220	T;T	0.48836	0.8;0.8	5.09	1.64	0.23874	5.090000	1.640000	0.238740	.	0.379079	0.28284	N	0.015912	T	0.33644	0.0870	L	0.31420	0.93	0.09310	N	0.999999	B	0.12630	0.006	B	0.10450	0.005	T	0.29119	-1.0022	10	0.48119	T	0.1	4.0816	10.9855	0.47520	0.0:0.7431:0.0:0.2569	.	377	Q9BRK4	LZTS2_HUMAN	V	377	ENSP00000359243:A377V;ENSP00000359240:A377V	ENSP00000314437:A377V	A	+	2	0	0	LZTS2	102755266	102755266	0.000000	0.05858	0.000000	0.03702	0.364000	0.29643	0.846000	0.27682	0.519000	0.28406	0.561000	0.74099	GCG	0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.657	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	0	0	1	2	2	2	2	0	0	0	0	49	0	49	49	1	1.930000	-3.474056	1	0.630000	XM_046743		0	5	5	0	224	223	0		1	0		0	0	49	0	0	0.936784	8.626110e-01	0	0	0	164	0	5	224
LRP5	4041	broad.mit.edu	37	11	68216515	68216515	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr11:68216515T>C	ENST00000294304.7	+	23	4931	c.4825T>C	c.(4825-4827)Tcc>Ccc	p.S1609P	LRP5_ENST00000529481.1_3'UTR	NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1609	Pro-rich.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCCCCCTCCGTCCCCCTGCAC	0.582																																						ENST00000294304.7	0.160000	1.000000e-02	0.110000	0.040000	0.070000	0.080685	0.070000	0.060000																										0				63						c.(4825-4827)Tcc>Ccc		low density lipoprotein receptor-related protein 5							33.0	36.0	35.0					11																	68216515		2200	4292	6492	SO:0001583	missense	4041	0	0					g.chr11:68216515T>C	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4825T>C	chr11.hg19:g.68216515T>C	ENSP00000294304:p.Ser1609Pro	0					LRP5_ENST00000529481.1_3'UTR	p.S1609P	NM_002335.2	NP_002326.2	0	0	0	2.039546	O75197	LRP5_HUMAN		23	4931	+			Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	0	1	hg19	c.4825T>C	CCDS8181.1	0	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019969	0.54576	.	.	ENSG00000162337	ENST00000294304	D	0.96830	-4.14	4.53	4.53	0.55603	4.530000	4.530000	0.556030	.	0.000000	0.46145	U	0.000317	D	0.97791	0.9275	M	0.78637	2.42	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.98611	1.0663	10	0.87932	D	0	.	14.0922	0.64998	0.0:0.0:0.0:1.0	.	1609;1609	Q9UES7;O75197	.;LRP5_HUMAN	P	1609	ENSP00000294304:S1609P	ENSP00000294304:S1609P	S	+	1	0	0	LRP5	67973091	67973091	1.000000	0.71417	0.932000	0.37286	0.021000	0.10359	7.395000	0.79876	1.919000	0.55581	0.454000	0.30748	TCC	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.582	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	0	0	1	2	2	2	2	0	0	0	0	40	0	40	39	1	1.930000	-2.425109	0	0.630000	NM_002335		0	4	4	0	190	185	0		1	0		0	0	40	0	0	0.885006	9.771287e-01	0	0	0	356	0	4	190
GDPD4	220032	broad.mit.edu	37	11	76982196	76982196	+	Missense_Mutation	SNP	C	C	T	rs367777591		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr11:76982196C>T	ENST00000376217.2	-	6	629	c.379G>A	c.(379-381)Gtg>Atg	p.V127M	GDPD4_ENST00000315938.4_Missense_Mutation_p.V127M|GDPD4_ENST00000527489.1_5'Flank			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	127					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						AAACATGCCACGTAGAAGGCC	0.483																																						ENST00000376217.2	1.000000	6.600000e-01	1.000000	0.760000	0.870000	0.876294	0.870000	1.000000																										0				20						c.(379-381)Gtg>Atg		glycerophosphodiester phosphodiesterase domain containing 4		C	MET/VAL	0,4400		0,0,2200	94.0	83.0	87.0		379	-2.0	0.0	11		87	1,8583	1.2+/-3.3	0,1,4291	no	missense	GDPD4	NM_182833.1	21	0,1,6491	TT,TC,CC		0.0116,0.0,0.0077	benign	127/521	76982196	1,12983	2200	4292	6492	SO:0001583	missense	220032	3	121412	34				g.chr11:76982196C>T	AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.379G>A	chr11.hg19:g.76982196C>T	ENSP00000365390:p.Val127Met	0					GDPD4_ENST00000527489.1_5'Flank|GDPD4_ENST00000315938.4_Missense_Mutation_p.V127M	p.V127M			0	0	0	2.039546	Q6W3E5	GDPD4_HUMAN		6	629	-			Q7Z5B0	Missense_Mutation	SNP	ENST00000376217.2	1	1	hg19	c.379G>A		1	.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228315	0.06022	0.0	1.16E-4	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.16073	2.37;2.43	4.55	-2.0	0.07433	4.550000	-2.000000	0.074330	.	0.670270	0.15204	N	0.274867	T	0.07728	0.0194	L	0.29908	0.895	0.09310	N	1	P	0.38167	0.621	B	0.26969	0.075	T	0.21109	-1.0255	10	0.39692	T	0.17	-0.5584	5.3776	0.16174	0.5872:0.1974:0.0:0.2154	.	127	Q6W3E5-2	.	M	127	ENSP00000365390:V127M;ENSP00000320815:V127M	ENSP00000320815:V127M	V	-	1	0	0	GDPD4	76659844	76659844	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.182000	0.09726	-0.554000	0.06150	-0.500000	0.04577	GTG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.483	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382075.1	1	0	1	2	2	2	2	0	0	0	0	26	0	26	26	1	1.930000	-20.000000	1	0.630000	NM_182833		0	43	43	0	112	111	1		1			0	0	26	0	0	1.000000	0	0	0	0	0	0	43	112
ROBO3	64221	broad.mit.edu	37	11	124749808	124749808	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr11:124749808G>A	ENST00000397801.1	+	26	4114	c.3922G>A	c.(3922-3924)Gtg>Atg	p.V1308M	ROBO3_ENST00000525482.1_3'UTR|ROBO3_ENST00000543966.1_Missense_Mutation_p.V71M|ROBO3_ENST00000538940.1_Missense_Mutation_p.V1286M	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1308					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GGTCCAGGCCGTGCCCCTGGC	0.692																																						ENST00000397801.1	1.000000	5.800000e-01	1.000000	0.740000	0.920000	0.887922	0.920000	1.000000																										0				35						c.(3922-3924)Gtg>Atg		roundabout, axon guidance receptor, homolog 3 (Drosophila)							12.0	17.0	15.0					11																	124749808		2027	4174	6201	SO:0001583	missense	64221	5	120614	34				g.chr11:124749808G>A	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.3922G>A	chr11.hg19:g.124749808G>A	ENSP00000380903:p.Val1308Met	0					ROBO3_ENST00000543966.1_Missense_Mutation_p.V71M|ROBO3_ENST00000525482.1_3'UTR|ROBO3_ENST00000538940.1_Missense_Mutation_p.V1286M	p.V1308M	NM_022370.3	NP_071765.2	0	0	0	2.039546	Q96MS0	ROBO3_HUMAN		26	4114	+	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		Missense_Mutation	SNP	ENST00000397801.1	0	1	hg19	c.3922G>A	CCDS44755.1	1	.	.	.	.	.	.	.	.	.	.	G	5.514	0.279841	0.10458	.	.	ENSG00000154134	ENST00000397801;ENST00000538940;ENST00000543966	T;T;T	0.64438	-0.1;-0.09;0.88	5.28	-0.16	0.13375	5.280000	-0.160000	0.133750	.	1.155830	0.06713	N	0.773491	T	0.45276	0.1334	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.23119	-1.0197	10	0.29301	T	0.29	.	7.3071	0.26453	0.2549:0.0:0.6225:0.1226	.	1308	Q96MS0	ROBO3_HUMAN	M	1308;1286;71	ENSP00000380903:V1308M;ENSP00000441797:V1286M;ENSP00000438799:V71M	ENSP00000380903:V1308M	V	+	1	0	0	ROBO3	124255018	124255018	0.001000	0.12720	0.002000	0.10522	0.021000	0.10359	0.938000	0.28965	-0.348000	0.08286	-1.004000	0.02495	GTG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.692	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	1	0	1	2	2	2	2	0	0	0	0	11	0	11	11	1	1.930000	-20.000000	1	0.630000	XM_370663		0	16	16	0	39	37	1		1	1		0	0	11	0	0	0.999968	9.658442e-01	0	3	0	14	0	16	39
NOP2	4839	broad.mit.edu	37	12	6672578	6672578	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr12:6672578G>A	ENST00000322166.5	-	8	912	c.791C>T	c.(790-792)tCt>tTt	p.S264F	NOP2_ENST00000541778.1_Missense_Mutation_p.S260F|NOP2_ENST00000399466.2_Missense_Mutation_p.S260F|NOP2_ENST00000545200.1_Missense_Mutation_p.S260F|NOP2_ENST00000542015.1_Intron|NOP2_ENST00000537442.1_Missense_Mutation_p.S264F|NOP2_ENST00000382421.3_Missense_Mutation_p.S297F	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	264					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						CAGGTATTCAGAACGAGACCG	0.542											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000322166.5	1.000000	9.600000e-01	1.000000	0.990000	0.990000	0.997286	0.990000	1.000000																										0				19						c.(790-792)tCt>tTt		NOP2 nucleolar protein							75.0	76.0	76.0					12																	6672578		1940	4143	6083	SO:0001583	missense	4839	0	0					g.chr12:6672578G>A		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.791C>T	chr12.hg19:g.6672578G>A	ENSP00000313272:p.Ser264Phe	1		OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	635	NOP2_ENST00000542015.1_Intron|NOP2_ENST00000382421.3_Missense_Mutation_p.S297F|NOP2_ENST00000541778.1_Missense_Mutation_p.S260F|NOP2_ENST00000545200.1_Missense_Mutation_p.S260F|NOP2_ENST00000537442.1_Missense_Mutation_p.S264F|NOP2_ENST00000399466.2_Missense_Mutation_p.S260F	p.S264F	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	0	2	2	1.824452	P46087	NOP2_HUMAN		8	912	-			A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	0	1	hg19	c.791C>T	CCDS58203.1	1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.005824	0.54254	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944	T;T;T;T;T;T;T	0.48201	2.4;2.42;2.43;2.4;2.4;2.4;0.82	5.19	5.19	0.71726	5.190000	5.190000	0.717260	.	1.209700	0.05601	N	0.576322	T	0.66247	0.2770	M	0.84082	2.675	0.20563	N	0.999886	P	0.41131	0.739	P	0.49276	0.605	T	0.56463	-0.7975	10	0.66056	D	0.02	-1.1433	11.9695	0.53055	0.0:0.0:0.7038:0.2962	.	260	P46087-2	.	F	264;297;260;260;264;260;140	ENSP00000444437:S264F;ENSP00000371858:S297F;ENSP00000439422:S260F;ENSP00000382392:S260F;ENSP00000313272:S264F;ENSP00000443150:S260F;ENSP00000440754:S140F	ENSP00000313272:S264F	S	-	2	0	0	NOP2	6542839	6542839	0.016000	0.18221	0.035000	0.18076	0.993000	0.82548	1.893000	0.39758	2.436000	0.82500	0.561000	0.74099	TCT	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.542	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	1	0	1	2	2	2	2	0	0	0	0	16	0	16	16	1	1.930000	-20.000000	1	0.630000	NM_006170		0	24	24	0	33	33	1		1	1		0	0	16	0	0	1.000000	9.999992e-01	0	36	0	7	0	24	33
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	7.600000e-01	1.000000	0.870000	0.990000	0.956221	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	2	2	4	2.580085	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.707417		TCGA-HV-AA8X-01A-11D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	21	2	2	2	0	11	0	0	37	8006	37	37	1	1.930000	-20.000000	1	0.630000	NM_033360		2547	50	50	5486	156	154	1	1	1	1	1	0	0	37	431	1	1.000000	9.976111e-01	1	17	134	13	392	50	156
TUBA1B	10376	broad.mit.edu	37	12	49523505	49523505	+	Splice_Site	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr12:49523505G>A	ENST00000336023.5	-	2	98	c.4C>T	c.(4-6)Cgt>Tgt	p.R2C	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000551496.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547712.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	2					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						ATGCACTCACGCTGCGGGAAG	0.468																																						ENST00000336023.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999961	0.990000	1.000000																										0				12						c.(4-6)Cgt>Tgt		tubulin, alpha 1b							51.0	49.0	49.0					12																	49523505		2203	4300	6503	SO:0001630	splice_region_variant	10376	0	0					g.chr12:49523505G>A	AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.4-1C>T	chr12.hg19:g.49523505G>A		1					RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA|RP11-386G11.10_ENST00000547712.1_RNA|RP11-386G11.10_ENST00000551496.1_RNA	p.R2C	NM_006082.2	NP_006073.2	0	2	2	1.819576	P68363	TBA1B_HUMAN		2	98	-			P04687|P05209|Q27I68|Q8WU19	Splice_Site	SNP	ENST00000336023.5	1	0	hg19	c.4C>T	CCDS31792.1	1	.	.	.	.	.	.	.	.	.	.	g	16.25	3.071607	0.55646	.	.	ENSG00000123416	ENST00000336023;ENST00000551373;ENST00000429203;ENST00000550367	T;T	0.71698	-0.59;-0.59	4.85	4.85	0.62838	4.850000	4.850000	0.628380	Tubulin/FtsZ, GTPase domain (2);	0.000000	0.47455	U	0.000228	D	0.86543	0.5958	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89528	0.3783	10	0.87932	D	0	.	16.7309	0.85434	0.0:0.0:1.0:0.0	.	2	P68363	TBA1B_HUMAN	C	2	ENSP00000336799:R2C;ENSP00000449325:R2C	ENSP00000336799:R2C	R	-	1	0	0	TUBA1B	47809772	47809772	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.776000	0.99001	2.235000	0.73313	0.655000	0.94253	CGT	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.468	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409005.1	1	0	1	2	2	2	2	0	0	0	0	42	0	42	42	1	1.930000	-20.000000	1	0.630000	NM_006082	Missense_Mutation	0	65	60	0	86	84	1		1	1		0	0	42	0	0	1.000000	1	0	207	0	122	0	65	86
OSBPL8	114882	broad.mit.edu	37	12	76779953	76779953	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr12:76779953C>A	ENST00000261183.3	-	14	2007	c.1528G>T	c.(1528-1530)Gaa>Taa	p.E510*	OSBPL8_ENST00000393250.4_Nonsense_Mutation_p.E468*|OSBPL8_ENST00000393249.2_Nonsense_Mutation_p.E468*	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	510					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						AATACCTGTTCAGCAATATAA	0.318																																						ENST00000261183.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999784	0.990000	1.000000																										0				28						c.(1528-1530)Gaa>Taa		oxysterol binding protein-like 8							44.0	42.0	43.0					12																	76779953		2203	4298	6501	SO:0001587	stop_gained	114882	0	0					g.chr12:76779953C>A	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.1528G>T	chr12.hg19:g.76779953C>A	ENSP00000261183:p.Glu510*	1					OSBPL8_ENST00000393249.2_Nonsense_Mutation_p.E468*|OSBPL8_ENST00000393250.4_Nonsense_Mutation_p.E468*	p.E510*	NM_020841.4	NP_065892.1	0	2	2	1.819576	Q9BZF1	OSBL8_HUMAN		14	2007	-			A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Nonsense_Mutation	SNP	ENST00000261183.3	0	1	hg19	c.1528G>T	CCDS31862.1	1	.	.	.	.	.	.	.	.	.	.	C	43	9.950176	0.99303	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540;ENST00000546946	.	.	.	5.65	5.65	0.86999	5.650000	5.650000	0.869990	.	0.094278	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.0275	19.724	0.96154	0.0:1.0:0.0:0.0	.	.	.	.	X	468;510;495;468;510;510;485	.	ENSP00000261183:E510X	E	-	1	0	0	OSBPL8	75304084	75304084	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.092000	0.71414	2.654000	0.90174	0.557000	0.71058	GAA	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.318	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	1	0	1	2	2	2	2	0	0	0	0	32	0	32	32	1	1.930000	-20.000000	1	0.630000	NM_020841		0	59	59	0	84	84	1		1	1	0	0	0	32	0	0	1.000000	8.526269e-01	0	4	0	3	1	59	84
KSR2	283455	broad.mit.edu	37	12	117977587	117977587	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr12:117977587G>A	ENST00000339824.5	-	10	2351	c.1624C>T	c.(1624-1626)Ccg>Tcg	p.P542S	KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000302438.5_Missense_Mutation_p.P239S|KSR2_ENST00000425217.1_Missense_Mutation_p.P513S			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	542	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGAGAAGGCGGCGTGGCACTA	0.647																																						ENST00000339824.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999955	0.990000	1.000000																										0				67						c.(1624-1626)Ccg>Tcg		kinase suppressor of ras 2							69.0	80.0	77.0					12																	117977587		2122	4211	6333	SO:0001583	missense	283455	0	0					g.chr12:117977587G>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1624C>T	chr12.hg19:g.117977587G>A	ENSP00000339952:p.Pro542Ser	1					KSR2_ENST00000302438.5_Missense_Mutation_p.P239S|KSR2_ENST00000425217.1_Missense_Mutation_p.P513S|KSR2_ENST00000545002.1_5'UTR	p.P542S			0	2	2	1.819576	Q6VAB6	KSR2_HUMAN		10	2351	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	1	1	hg19	c.1624C>T		1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260144	0.80246	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;D	0.86297	-1.27;-1.26;-2.1	5.04	5.04	0.67666	5.040000	5.040000	0.676660	.	0.000000	0.85682	D	0.000000	D	0.84611	0.5510	L	0.29908	0.895	0.80722	D	1	D	0.59357	0.985	P	0.53102	0.718	T	0.80214	-0.1475	10	0.02654	T	1	.	18.5691	0.91128	0.0:0.0:1.0:0.0	.	542	Q6VAB6	KSR2_HUMAN	S	513;542;239;214	ENSP00000389715:P513S;ENSP00000339952:P542S;ENSP00000305466:P239S	ENSP00000305466:P239S	P	-	1	0	0	KSR2	116461970	116461970	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	9.569000	0.98170	2.601000	0.87937	0.655000	0.94253	CCG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.647	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	1	0	1	2	2	2	2	0	0	0	0	47	0	47	46	1	1.930000	-20.000000	1	0.630000	NM_173598		0	64	60	0	85	85	1		1			0	0	47	0	0	1.000000	0	0	0	0	0	0	64	85
OR4K17	390436	broad.mit.edu	37	14	20586444	20586444	+	Silent	SNP	C	C	T	rs374355972		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr14:20586444C>T	ENST00000315543.4	+	1	879	c.879C>T	c.(877-879)ttC>ttT	p.F293F		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTTGGCCCTTCGGCAACCACT	0.418																																						ENST00000315543.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999880	0.990000	1.000000																										0				21						c.(877-879)ttC>ttT		olfactory receptor, family 4, subfamily K, member 17		C		0,4406		0,0,2203	95.0	87.0	90.0		879	-1.4	0.1	14		90	1,8599		0,1,4299	no	coding-synonymous	OR4K17	NM_001004715.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		293/344	20586444	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	390436	18	121406	44				g.chr14:20586444C>T		CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.879C>T	chr14.hg19:g.20586444C>T		0						p.F293F	NM_001004715.1	NP_001004715.1	1	2	3	2.070656	Q8NGC6	OR4KH_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	1	879	+	all_cancers(95;0.00108)		Q6IF12	Silent	SNP	ENST00000315543.4	1	1	hg19	c.879C>T	CCDS32030.1	1																																																																																								0.632316		TCGA-HV-AA8X-01A-11D-A397-08	0.418	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1	1	0	1	2	2	2	2	0	0	0	0	38	0	38	37	1	1.930000	-20.000000	1	0.630000			0	72	72	0	104	104	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	72	104
NPAS3	64067	broad.mit.edu	37	14	34270091	34270091	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr14:34270091G>A	ENST00000356141.4	+	12	2578	c.2578G>A	c.(2578-2580)Ggc>Agc	p.G860S	NPAS3_ENST00000346562.2_Missense_Mutation_p.G828S|NPAS3_ENST00000548645.1_Missense_Mutation_p.G830S|NPAS3_ENST00000357798.5_Missense_Mutation_p.G847S|NPAS3_ENST00000551492.1_Missense_Mutation_p.G865S			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	860					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TAACAGCCCCGGCTTTGGCCT	0.652																																						ENST00000356141.4	1.000000	6.700000e-01	1.000000	0.880000	0.990000	0.956200	0.990000	1.000000																										0				40						c.(2578-2580)Ggc>Agc		neuronal PAS domain protein 3							43.0	29.0	34.0					14																	34270091		2202	4300	6502	SO:0001583	missense	64067	0	0					g.chr14:34270091G>A	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2578G>A	chr14.hg19:g.34270091G>A	ENSP00000348460:p.Gly860Ser	0					NPAS3_ENST00000357798.5_Missense_Mutation_p.G847S|NPAS3_ENST00000548645.1_Missense_Mutation_p.G830S|NPAS3_ENST00000551492.1_Missense_Mutation_p.G865S|NPAS3_ENST00000346562.2_Missense_Mutation_p.G828S	p.G860S			1	2	3	2.055636	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	12	2578	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	0	1	hg19	c.2578G>A	CCDS53891.1	1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751605	0.31046	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.11169	3.07;2.9;2.96;2.96;2.93;2.8	5.02	5.02	0.67125	5.020000	5.020000	0.671250	.	0.054609	0.64402	D	0.000001	T	0.08133	0.0203	L	0.27053	0.805	0.80722	D	1	B;B;B;B	0.17667	0.023;0.013;0.023;0.023	B;B;B;B	0.15052	0.012;0.005;0.012;0.012	T	0.19192	-1.0313	10	0.37606	T	0.19	.	9.6998	0.40180	0.1303:0.0:0.8697:0.0	.	830;860;828;847	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	S	834;865;828;830;860;847	ENSP00000448373:G834S;ENSP00000450392:G865S;ENSP00000319610:G828S;ENSP00000448916:G830S;ENSP00000348460:G860S;ENSP00000350446:G847S	ENSP00000319610:G828S	G	+	1	0	0	NPAS3	33339842	33339842	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	4.058000	0.57463	2.310000	0.77875	0.484000	0.47621	GGC	0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.652	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1	1	0	1	2	2	2	2	0	0	0	0	12	0	12	12	1	1.930000	-20.000000	1	0.630000			0	13	13	0	24	24	1		1	0		0	0	12	0	0	0.999836	0	0	0	0	1	0	13	24
GPHN	10243	broad.mit.edu	37	14	67626189	67626189	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr14:67626189G>T	ENST00000315266.5	+	18	2916	c.1795G>T	c.(1795-1797)Gtt>Ttt	p.V599F	GPHN_ENST00000305960.9_Missense_Mutation_p.V568F|GPHN_ENST00000543237.1_Missense_Mutation_p.V645F|GPHN_ENST00000478722.1_Missense_Mutation_p.V632F|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	599	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		TTTTGGCAGGGTTTTTATGAA	0.333			T	MLL	AL																																	ENST00000315266.5	0.080000	0	0.060000	0.010000	0.030000	0.039941	0.030000	0.040000				Dom	yes			Dom	yes		14	14q24	14q24	10243	T	gephyrin (GPH)				L	L	MLL		AL		0				12						c.(1795-1797)Gtt>Ttt		gephyrin							163.0	164.0	163.0					14																	67626189		2203	4300	6503	SO:0001583	missense	10243	0	0					g.chr14:67626189G>T	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1795G>T	chr14.hg19:g.67626189G>T	ENSP00000312771:p.Val599Phe	0					GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000543237.1_Missense_Mutation_p.V645F|GPHN_ENST00000478722.1_Missense_Mutation_p.V632F|GPHN_ENST00000305960.9_Missense_Mutation_p.V568F	p.V599F	NM_001024218.1	NP_001019389.1	0	0	0	2.047579	Q9NQX3	GEPH_HUMAN		18	2916	+		all_cancers(7;0.0476)|all_hematologic(31;0.0116)	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	0	1	hg19	c.1795G>T	CCDS32103.1	0	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845302	0.91197	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960;ENST00000555503	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	5.66	5.66	0.87406	5.660000	5.660000	0.874060	Molybdenum cofactor synthesis (1);Molybdenum cofactor biosynthesis, conserved site (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.93012	0.7776	H	0.98005	4.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.996;0.999;0.996	D	0.95232	0.8343	10	0.87932	D	0	-9.3676	18.5075	0.90902	0.0:0.0:1.0:0.0	.	568;645;599;632	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	F	599;632;645;568;124	ENSP00000312771:V599F;ENSP00000417901:V632F;ENSP00000438404:V645F;ENSP00000303019:V568F;ENSP00000452009:V124F	ENSP00000303019:V568F	V	+	1	0	0	GPHN	66695942	66695942	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.326000	0.96389	2.669000	0.90835	0.591000	0.81541	GTT	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.333	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	0	0	1	2	2	2	2	0	0	0	0	105	0	105	105	1	1.930000	-2.877532	1	0.630000	NM_020806		0	5	5	0	464	463	0		1	1		0	0	105	0	0	0.937501	4.720076e-02	0	2	0	24	0	5	464
C15orf41	84529	broad.mit.edu	37	15	36989551	36989551	+	Silent	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr15:36989551G>A	ENST00000566621.1	+	8	754	c.504G>A	c.(502-504)ctG>ctA	p.L168L	C15orf41_ENST00000569302.1_Silent_p.L168L|C15orf41_ENST00000338183.4_Silent_p.L70L|C15orf41_ENST00000565792.1_3'UTR|C15orf41_ENST00000562877.1_Silent_p.L70L|C15orf41_ENST00000437989.2_Silent_p.L168L|C15orf41_ENST00000567389.1_Silent_p.L70L	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41	168										kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		ATGAGGTCCTGCTGAGAGACT	0.423																																						ENST00000566621.1	0.210000	8.000000e-02	0.180000	0.100000	0.140000	0.147651	0.140000	0.140000																										0				12						c.(502-504)ctG>ctA		chromosome 15 open reading frame 41							189.0	189.0	189.0					15																	36989551		1918	4141	6059	SO:0001819	synonymous_variant	84529	0	0					g.chr15:36989551G>A	BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.504G>A	chr15.hg19:g.36989551G>A		0					C15orf41_ENST00000437989.2_Silent_p.L168L|C15orf41_ENST00000338183.4_Silent_p.L70L|C15orf41_ENST00000565792.1_3'UTR|C15orf41_ENST00000562877.1_Silent_p.L70L|C15orf41_ENST00000569302.1_Silent_p.L168L|C15orf41_ENST00000567389.1_Silent_p.L70L	p.L168L	NM_001130010.1	NP_001123482.1	0	0	0	2.018792	Q9Y2V0	CO041_HUMAN		8	754	+		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)	B2RD87	Silent	SNP	ENST00000566621.1	0	1	hg19	c.504G>A	CCDS45215.1	0																																																																																								0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.423	C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419741.1	0	0	0	2	22	3	2	1	0	1	1	58	0	58	58	1	1.930000	-4.106372	1	0.630000	NM_032499		0	19	19	0	403	397	0		0	0		1	0	58	0	0	0.353964	6.137167e-02	0	2	0	17	0	19	403
RPAP1	26015	broad.mit.edu	37	15	41813192	41813192	+	Silent	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr15:41813192C>T	ENST00000304330.4	-	22	3308	c.3192G>A	c.(3190-3192)tcG>tcA	p.S1064S	RPAP1_ENST00000561603.1_Intron	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1064	Leu-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCGGGCTGGCGAGCAATGAG	0.662																																						ENST00000304330.4	0.950000	6.200000e-01	0.870000	0.690000	0.780000	0.790947	0.780000	0.790000																										0				45						c.(3190-3192)tcG>tcA		RNA polymerase II associated protein 1							50.0	47.0	48.0					15																	41813192		2202	4298	6500	SO:0001819	synonymous_variant	26015	0	0					g.chr15:41813192C>T	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3192G>A	chr15.hg19:g.41813192C>T		0					RPAP1_ENST00000561603.1_Intron	p.S1064S	NM_015540.2	NP_056355.2	0	0	0	2.018792	Q9BWH6	RPAP1_HUMAN		22	3308	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	ENST00000304330.4	1	1	hg19	c.3192G>A	CCDS10079.1	0																																																																																								0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.662	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	1	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	1.930000	-4.774033	1	0.630000	NM_015540		0	61	60	0	182	176	1		1	1		0	0	46	0	0	1.000000	9.996594e-01	0	16	0	23	0	61	182
ACAN	176	broad.mit.edu	37	15	89382241	89382241	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr15:89382241G>A	ENST00000561243.1	+	2	418	c.418G>A	c.(418-420)Gag>Aag	p.E140K	ACAN_ENST00000559004.1_Missense_Mutation_p.E140K|ACAN_ENST00000558207.1_Missense_Mutation_p.E140K|ACAN_ENST00000352105.7_Missense_Mutation_p.E140K|ACAN_ENST00000439576.2_Missense_Mutation_p.E140K			P16112	PGCA_HUMAN	aggrecan	140	G1-A.|Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCATGGCATCGAGGACAGCGA	0.612																																						ENST00000561243.1	1.000000	9.200000e-01	1.000000	0.990000	0.990000	0.993905	0.990000	1.000000																										0				93						c.(418-420)Gag>Aag		aggrecan							87.0	96.0	93.0					15																	89382241		2120	4236	6356	SO:0001583	missense	176	8	121108	40				g.chr15:89382241G>A	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.418G>A	chr15.hg19:g.89382241G>A	ENSP00000453342:p.Glu140Lys	0					ACAN_ENST00000559004.1_Missense_Mutation_p.E140K|ACAN_ENST00000558207.1_Missense_Mutation_p.E140K|ACAN_ENST00000352105.7_Missense_Mutation_p.E140K|ACAN_ENST00000439576.2_Missense_Mutation_p.E140K	p.E140K			0	0	0	2.018792	P16112	PGCA_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)	2	418	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	1	1	hg19	c.418G>A	CCDS53970.1	1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980547	0.92982	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02656	4.21;4.21	5.6	5.6	0.85130	5.600000	5.600000	0.851300	.	0.000000	0.33005	N	0.005399	T	0.20820	0.0501	M	0.88570	2.965	0.51482	D	0.999925	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.931;0.949;0.995	T	0.00379	-1.1777	10	0.72032	D	0.01	-10.703	18.9733	0.92724	0.0:0.0:1.0:0.0	.	140;140;140	E7ENV9;E7EX88;Q6PID9	.;.;.	K	140	ENSP00000387356:E140K;ENSP00000341615:E140K	ENSP00000268134:E140K	E	+	1	0	0	ACAN	87183245	87183245	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	9.715000	0.98748	2.806000	0.96561	0.655000	0.94253	GAG	0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.612	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	1	0	1	2	2	2	2	0	0	0	0	93	0	93	92	1	1.930000	-14.451170	1	0.630000	NM_001135		0	146	144	0	282	281	1		1	0		0	0	93	0	0	1.000000	1.173906e-01	0	0	0	2	0	146	282
ST8SIA2	8128	broad.mit.edu	37	15	93007522	93007522	+	Silent	SNP	G	G	A	rs377119605		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr15:93007522G>A	ENST00000268164.3	+	6	1272	c.1035G>A	c.(1033-1035)ccG>ccA	p.P345P	ST8SIA2_ENST00000539113.1_Silent_p.P324P	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	345					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			AGGCCAGCCCGCATACCATGC	0.572																																						ENST00000268164.3	0.250000	1.000000e-01	0.210000	0.130000	0.160000	0.175586	0.160000	0.170000																										0				20						c.(1033-1035)ccG>ccA		ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2							92.0	85.0	88.0					15																	93007522		2198	4298	6496	SO:0001819	synonymous_variant	8128	12	121412	44				g.chr15:93007522G>A	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.1035G>A	chr15.hg19:g.93007522G>A		0					ST8SIA2_ENST00000539113.1_Silent_p.P324P	p.P345P	NM_006011.3	NP_006002.1	0	0	0	2.018792	Q92186	SIA8B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)	6	1272	+	Lung NSC(78;0.0893)|all_lung(78;0.125)		Q4VAZ0|Q92470|Q92746	Silent	SNP	ENST00000268164.3	1	1	hg19	c.1035G>A	CCDS10372.1	0																																																																																								0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.572	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	1	0	1	2	2	2	2	0	0	0	0	74	0	74	74	1	1.930000	-2.594330	1	0.630000	NM_006011		0	22	22	0	386	385	0		1	0		0	0	74	0	0	0.999999	3.259868e-03	0	0	0	2	0	22	386
SLC5A11	115584	broad.mit.edu	37	16	24883505	24883505	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr16:24883505G>A	ENST00000347898.3	+	5	959	c.337G>A	c.(337-339)Gcc>Acc	p.A113T	SLC5A11_ENST00000567758.1_Missense_Mutation_p.A113T|SLC5A11_ENST00000545376.1_Missense_Mutation_p.A78T|SLC5A11_ENST00000424767.2_Missense_Mutation_p.A113T|SLC5A11_ENST00000539472.1_Missense_Mutation_p.A49T|SLC5A11_ENST00000565769.1_Missense_Mutation_p.A49T|SLC5A11_ENST00000449109.2_Missense_Mutation_p.A49T|SLC5A11_ENST00000568579.1_Missense_Mutation_p.A78T|SLC5A11_ENST00000569071.1_Missense_Mutation_p.A49T	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		GCTGATGTTGGCCTGGATCTT	0.517																																						ENST00000347898.3	0.290000	8.000000e-02	0.230000	0.110000	0.160000	0.178191	0.160000	0.160000																										0				49						c.(337-339)Gcc>Acc		solute carrier family 5 (sodium/inositol cotransporter), member 11							327.0	295.0	306.0					16																	24883505		2197	4300	6497	SO:0001583	missense	115584	0	0					g.chr16:24883505G>A	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.337G>A	chr16.hg19:g.24883505G>A	ENSP00000289932:p.Ala113Thr	0					SLC5A11_ENST00000545376.1_Missense_Mutation_p.A78T|SLC5A11_ENST00000565769.1_Missense_Mutation_p.A49T|SLC5A11_ENST00000567758.1_Missense_Mutation_p.A113T|SLC5A11_ENST00000568579.1_Missense_Mutation_p.A78T|SLC5A11_ENST00000449109.2_Missense_Mutation_p.A49T|SLC5A11_ENST00000569071.1_Missense_Mutation_p.A49T|SLC5A11_ENST00000539472.1_Missense_Mutation_p.A49T|SLC5A11_ENST00000424767.2_Missense_Mutation_p.A113T	p.A113T	NM_052944.3	NP_443176.2	0	1	1	2.036749				5	959	+				Missense_Mutation	SNP	ENST00000347898.3	1	1	hg19	c.337G>A	CCDS10625.1	0	.	.	.	.	.	.	.	.	.	.	g	22.0	4.226797	0.79576	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.25;-2.3	4.89	-1.42	0.08913	4.890000	-1.420000	0.089130	.	0.240762	0.41001	D	0.000971	D	0.93396	0.7894	M	0.91140	3.18	0.37318	D	0.909431	P;P;B;D	0.64830	0.783;0.877;0.444;0.994	P;P;B;D	0.69479	0.542;0.628;0.36;0.964	D	0.93660	0.6981	10	0.87932	D	0	.	13.9133	0.63881	0.0:0.0:0.3469:0.6531	.	78;113;113;49	B7Z329;Q8WWX8-2;Q8WWX8;Q05BF1	.;.;SC5AB_HUMAN;.	T	113;49;113;78;49	ENSP00000289932:A113T;ENSP00000389606:A49T;ENSP00000416782:A113T;ENSP00000441384:A78T;ENSP00000441018:A49T	ENSP00000289932:A113T	A	+	1	0	0	SLC5A11	24791006	24791006	1.000000	0.71417	0.976000	0.42696	0.994000	0.84299	0.404000	0.20999	-0.547000	0.06207	0.443000	0.29094	GCC	0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.517	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	1	0	1	2	2	2	2	0	0	0	0	33	0	33	32	1	1.930000	-3.950166	1	0.630000	NM_052944		0	9	9	0	166	164	0		1			0	0	33	0	0	0.994300	0	0	0	0	0	0	9	166
TPPP3	51673	broad.mit.edu	37	16	67424140	67424140	+	Silent	SNP	G	G	A	rs137924465	byFrequency	TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr16:67424140G>A	ENST00000564104.1	-	3	1309	c.468C>T	c.(466-468)gaC>gaT	p.D156D	TPPP3_ENST00000290942.5_Silent_p.D156D|TPPP3_ENST00000393957.2_Silent_p.D156D|TPPP3_ENST00000562206.1_Silent_p.D156D|RNU1-123P_ENST00000458950.1_RNA			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	156					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		AGCCACTGTCGTCCAGGATGT	0.627													g|||	2	0.000399361	0.0015	0.0	5008	,	,		19622	0.0		0.0	False		,,,				2504	0.0					ENST00000564104.1	1.000000	7.500000e-01	0.990000	0.820000	0.900000	0.903976	0.900000	1.000000																										0				7						c.(466-468)gaC>gaT		tubulin polymerization-promoting protein family member 3			,	4,4392	8.1+/-20.4	0,4,2194	124.0	97.0	106.0		468,468	0.5	1.0	16	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TPPP3	NM_015964.2,NM_016140.2	,	0,5,6493	AA,AG,GG		0.0116,0.091,0.0385	,	156/177,156/177	67424140	5,12991	2198	4300	6498	SO:0001819	synonymous_variant	51673	10	121412	42				g.chr16:67424140G>A	BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.468C>T	chr16.hg19:g.67424140G>A		0					TPPP3_ENST00000562206.1_Silent_p.D156D|TPPP3_ENST00000290942.5_Silent_p.D156D|TPPP3_ENST00000393957.2_Silent_p.D156D|RNU1-123P_ENST00000458950.1_RNA	p.D156D			0	1	1	2.036749	Q9BW30	TPPP3_HUMAN		3	1309	-		Ovarian(137;0.0563)	Q49AH9|Q9Y326|Q9Y6H0	Silent	SNP	ENST00000564104.1	1	1	hg19	c.468C>T	CCDS10835.1	1																																																																																								0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.627	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421787.2	0	0	1	2	16	69	2	1	0	1	1	68	0	68	68	1	1.930000	-20.000000	1	0.630000	NM_015964		0	90	90	0	224	223	1		1	1		1	0	68	0	0	1.000000	1	0	906	0	984	0	90	224
C16orf74	404550	broad.mit.edu	37	16	85743833	85743833	+	Missense_Mutation	SNP	C	C	T	rs377716191		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr16:85743833C>T	ENST00000284245.4	-	3	292	c.109G>A	c.(109-111)Gac>Aac	p.D37N	C16orf74_ENST00000602583.1_Missense_Mutation_p.D25N|C16orf74_ENST00000602758.1_Intron|C16orf74_ENST00000602914.1_Intron|C16orf74_ENST00000602719.1_Missense_Mutation_p.D37N|C16orf74_ENST00000602766.1_5'UTR|C16orf74_ENST00000602675.1_5'UTR	NM_206967.2	NP_996850.1	Q96GX8	CP074_HUMAN	chromosome 16 open reading frame 74	37																	ATGATGATGTCGGGCACGTCC	0.662																																						ENST00000284245.4	1.000000	7.800000e-01	1.000000	0.960000	0.990000	0.979696	0.990000	1.000000																										0										c.(109-111)Gac>Aac		chromosome 16 open reading frame 74							17.0	22.0	20.0					16																	85743833		2133	4236	6369	SO:0001583	missense	404550	2	120106	29				g.chr16:85743833C>T	BC009078	CCDS45540.1	16q24.1	2014-05-28			ENSG00000154102	ENSG00000154102			23362	protein-coding gene	gene with protein product							Standard	NM_206967		Approved	MGC17624	uc002fjc.4	Q96GX8	OTTHUMG00000183875	ENST00000284245.4:c.109G>A	chr16.hg19:g.85743833C>T	ENSP00000284245:p.Asp37Asn	0					C16orf74_ENST00000602583.1_Missense_Mutation_p.D25N|C16orf74_ENST00000602914.1_Intron|C16orf74_ENST00000602758.1_Intron|C16orf74_ENST00000602719.1_Missense_Mutation_p.D37N|C16orf74_ENST00000602675.1_5'UTR|C16orf74_ENST00000602766.1_5'UTR	p.D37N	NM_206967.2	NP_996850.1	0	1	1	2.036749	Q96GX8	CP074_HUMAN		3	292	-				Missense_Mutation	SNP	ENST00000284245.4	1	1	hg19	c.109G>A	CCDS45540.1	1	.	.	.	.	.	.	.	.	.	.	C	5.934	0.356442	0.11239	.	.	ENSG00000154102	ENST00000284245	.	.	.	4.85	-0.84	0.10755	4.850000	-0.840000	0.107550	.	0.448478	0.20948	N	0.082807	T	0.12220	0.0297	.	.	.	0.24242	N	0.995352	B	0.12630	0.006	B	0.06405	0.002	T	0.34725	-0.9817	8	0.02654	T	1	-27.196	8.0544	0.30596	0.0:0.3031:0.0:0.6969	.	37	Q96GX8	CP074_HUMAN	N	37	.	ENSP00000284245:D37N	D	-	1	0	0	C16orf74	84301334	84301334	0.980000	0.34600	0.996000	0.52242	0.986000	0.74619	-0.165000	0.09968	-0.129000	0.11620	0.561000	0.74099	GAC	0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.662	C16orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467253.1	1	0	0	2	2	2	2	0	0	0	0	15	0	15	15	1	1.930000	-20.000000	1	0.630000	NM_206967		0	20	20	0	34	34	1		1	1		0	0	15	0	0	0.999999	9.997900e-01	0	6	0	24	0	20	34
SLFN13	146857	broad.mit.edu	37	17	33771812	33771812	+	Silent	SNP	G	G	T	rs372414173		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr17:33771812G>T	ENST00000285013.6	-	3	1163	c.888C>A	c.(886-888)acC>acA	p.T296T	SLFN13_ENST00000526861.1_Silent_p.T296T|SLFN13_ENST00000533791.1_Silent_p.T296T|SLFN13_ENST00000360502.2_Intron|SLFN13_ENST00000534689.1_Intron|SLFN13_ENST00000542635.1_Silent_p.T296T	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	296						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CTACGATTTTGGTGCTGTACT	0.413																																						ENST00000285013.6	1.000000	7.600000e-01	0.970000	0.820000	0.890000	0.895798	0.890000	1.000000																										0				31						c.(886-888)acC>acA		schlafen family member 13		G		0,4406		0,0,2203	179.0	171.0	174.0		888	0.1	0.0	17		174	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLFN13	NM_144682.5		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		296/898	33771812	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	146857	1	121412	33				g.chr17:33771812G>T	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.888C>A	chr17.hg19:g.33771812G>T		1					SLFN13_ENST00000360502.2_Intron|SLFN13_ENST00000534689.1_Intron|SLFN13_ENST00000526861.1_Silent_p.T296T|SLFN13_ENST00000533791.1_Silent_p.T296T|SLFN13_ENST00000542635.1_Silent_p.T296T	p.T296T	NM_144682.5	NP_653283.3	1	3	4	3.365530	Q68D06	SLN13_HUMAN		3	1163	-			E1P645|Q658M1|Q6ZS51|Q96A81	Silent	SNP	ENST00000285013.6	1	1	hg19	c.888C>A	CCDS32620.1	1																																																																																								0.773006		TCGA-HV-AA8X-01A-11D-A397-08	0.413	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	1	0	1	2	2	2	2	0	0	0	0	99	0	99	98	1	1.930000	-2.890562	1	0.630000	NM_144682		0	144	142	0	689	686	1		1	1		0	0	99	0	0	1.000000	9.997143e-01	0	3	0	55	0	144	689
PLEKHH3	79990	broad.mit.edu	37	17	40825305	40825305	+	Missense_Mutation	SNP	C	C	T	rs139853357		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr17:40825305C>T	ENST00000591022.1	-	6	1045	c.658G>A	c.(658-660)Ggg>Agg	p.G220R	PLEKHH3_ENST00000412503.1_Missense_Mutation_p.G220R|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.G220R|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	220					signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		TCTGGGTCCCCGCAACTTTCC	0.597																																						ENST00000591022.1	0.990000	7.400000e-01	0.940000	0.800000	0.870000	0.878064	0.870000	0.880000																										0				13						c.(658-660)Ggg>Agg		pleckstrin homology domain containing, family H (with MyTH4 domain) member 3		C	ARG/GLY	2,4404	4.2+/-10.8	0,2,2201	64.0	69.0	67.0		658	2.4	0.2	17	dbSNP_134	67	0,8600		0,0,4300	yes	missense	PLEKHH3	NM_024927.4	125	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging	220/794	40825305	2,13004	2203	4300	6503	SO:0001583	missense	79990	10	121410	41				g.chr17:40825305C>T	BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.658G>A	chr17.hg19:g.40825305C>T	ENSP00000468678:p.Gly220Arg	1					PLEKHH3_ENST00000293349.6_Missense_Mutation_p.G220R|PLEKHH3_ENST00000456950.2_5'UTR|PLEKHH3_ENST00000412503.1_Missense_Mutation_p.G220R	p.G220R	NM_024927.4	NP_079203	0	1	1	1.405324	Q7Z736	PKHH3_HUMAN		6	1045	-		Breast(137;0.00116)	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	ENST00000591022.1	1	1	hg19	c.658G>A	CCDS11434.1	1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186768	0.38609	4.54E-4	0.0	ENSG00000068137	ENST00000293349;ENST00000412503	T;T	0.45276	0.9;0.9	5.55	2.39	0.29439	5.550000	2.390000	0.294390	.	0.526619	0.17507	N	0.171775	T	0.19485	0.0468	N	0.14661	0.345	0.09310	N	1	B;B	0.30741	0.143;0.293	B;B	0.15484	0.013;0.01	T	0.13202	-1.0518	10	0.22706	T	0.39	-25.3623	6.8604	0.24064	0.0:0.4169:0.428:0.155	.	220;220	Q7Z736-2;Q7Z736	.;PKHH3_HUMAN	R	220	ENSP00000293349:G220R;ENSP00000411885:G220R	ENSP00000293349:G220R	G	-	1	0	0	PLEKHH3	38078831	38078831	0.000000	0.05858	0.202000	0.23494	0.954000	0.61252	0.178000	0.16820	0.415000	0.25817	0.655000	0.94253	GGG	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.597	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1	1	0	1	2	2	2	2	0	0	0	0	77	0	77	77	1	1.930000	-3.142702	1	0.630000	NM_024927		0	96	96	0	139	138	1		1	1		0	0	77	0	0	1.000000	9.999966e-01	0	26	0	5	0	96	139
TP53	7157	broad.mit.edu	37	17	7577505	7577505	+	Missense_Mutation	SNP	T	T	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr17:7577505T>A	ENST00000269305.4	-	7	965	c.776A>T	c.(775-777)gAc>gTc	p.D259V	TP53_ENST00000455263.2_Missense_Mutation_p.D259V|TP53_ENST00000445888.2_Missense_Mutation_p.D259V|TP53_ENST00000359597.4_Missense_Mutation_p.D259V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.D259V|TP53_ENST00000420246.2_Missense_Mutation_p.D259V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	259	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in a sporadic cancer; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> S (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D259V(18)|p.0?(8)|p.D259G(4)|p.D259F(3)|p.D259fs*5(2)|p.?(1)|p.E258fs*85(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.D259S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACCTGGAGTCTTCCAGTGT	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.980000	6.500000e-01	0.930000	0.740000	0.830000	0.840095	0.830000	0.850000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		41	Substitution - Missense(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	p.D259V(18)|p.0?(8)|p.D259G(4)|p.D259F(3)|p.D259fs*5(2)|p.?(1)|p.E258fs*85(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.D259S(1)	lung(8)|upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|stomach(3)|central_nervous_system(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|oesophagus(2)|liver(2)|skin(2)|pancreas(1)|breast(1)	24185						c.(775-777)gAc>gTc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						134.0	95.0	108.0					17																	7577505		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577505T>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.776A>T	chr17.hg19:g.7577505T>A	ENSP00000269305:p.Asp259Val	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.D259V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.D259V|TP53_ENST00000420246.2_Missense_Mutation_p.D259V|TP53_ENST00000359597.4_Missense_Mutation_p.D259V|TP53_ENST00000413465.2_Missense_Mutation_p.D259V	p.D259V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.422606	P04637	P53_HUMAN		7	965	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.776A>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636906	0.47049	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.52	4.52	0.55395	4.520000	4.520000	0.553950	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.164918	0.53938	D	0.000053	D	0.99557	0.9841	M	0.82630	2.6	0.80722	D	1	P;P;P;P;P	0.52842	0.482;0.483;0.537;0.815;0.956	P;B;P;P;P	0.57244	0.692;0.401;0.63;0.795;0.816	D	0.98404	1.0569	10	0.62326	D	0.03	-22.926	7.6416	0.28296	0.1888:0.0:0.0:0.8112	.	259;259;259;259;259	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	V	259;259;259;259;259;259;248;127	ENSP00000410739:D259V;ENSP00000352610:D259V;ENSP00000269305:D259V;ENSP00000398846:D259V;ENSP00000391127:D259V;ENSP00000391478:D259V;ENSP00000425104:D127V	ENSP00000269305:D259V	D	-	2	0	0	TP53	7518230	7518230	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	2.616000	0.46376	2.036000	0.60181	0.379000	0.24179	GAC	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.587	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	30	0	30	30	1	1.930000	-20.000000	1	0.630000	NM_000546		0	42	41	0	64	64	1		1	1	1	0	0	30	669	0	1.000000	1	1	37	281	15	308	42	64
CACNA1G	8913	broad.mit.edu	37	17	48650072	48650072	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr17:48650072T>C	ENST00000359106.5	+	6	904	c.904T>C	c.(904-906)Tat>Cat	p.Y302H	CACNA1G_ENST00000513689.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000515765.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000510115.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507336.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000360761.4_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507896.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000358244.5_Missense_Mutation_p.Y302H|CACNA1G_ENST00000352832.5_Missense_Mutation_p.Y302H|CACNA1G_ENST00000510366.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000512389.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000515411.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000514717.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000416767.4_Missense_Mutation_p.Y302H|CACNA1G_ENST00000514181.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000513964.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000429973.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507510.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000505165.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000442258.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000502264.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000515165.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000514079.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000354983.4_Missense_Mutation_p.Y302H|CACNA1G_ENST00000503485.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507609.1_Missense_Mutation_p.Y302H	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	302					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CGGTCTGGACTATGAGGCCTA	0.637																																						ENST00000359106.5	1.000000	7.600000e-01	1.000000	0.880000	0.990000	0.957725	0.990000	1.000000																										0				47						c.(904-906)Tat>Cat		calcium channel, voltage-dependent, T type, alpha 1G subunit	Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						38.0	43.0	41.0					17																	48650072		2108	4225	6333	SO:0001583	missense	8913	0	0					g.chr17:48650072T>C	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.904T>C	chr17.hg19:g.48650072T>C	ENSP00000352011:p.Tyr302His	0					CACNA1G_ENST00000515411.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000354983.4_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507896.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000513689.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000352832.5_Missense_Mutation_p.Y302H|CACNA1G_ENST00000515765.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000514717.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000429973.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507336.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000505165.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000510115.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000514079.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000512389.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000514181.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507609.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000360761.4_Missense_Mutation_p.Y302H|CACNA1G_ENST00000515165.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000416767.4_Missense_Mutation_p.Y302H|CACNA1G_ENST00000510366.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000502264.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000507510.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000358244.5_Missense_Mutation_p.Y302H|CACNA1G_ENST00000503485.1_Missense_Mutation_p.Y302H|CACNA1G_ENST00000442258.2_Missense_Mutation_p.Y302H|CACNA1G_ENST00000513964.1_Missense_Mutation_p.Y302H	p.Y302H	NM_018896.4	NP_061496.2	0	0	0	2.050067	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)	6	904	+	Breast(11;6.7e-17)		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	1	1	hg19	c.904T>C	CCDS45730.1	1	.	.	.	.	.	.	.	.	.	.	t	10.56	1.385505	0.25031	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96967	-4.04;-4.04;-4.19;-3.98;-4.03;-4.04;-4.06;-4.14;-4.1;-4.12;-4.13;-4.0;-4.01;-4.08;-4.03;-3.98;-4.06;-4.02;-4.0;-4.07;-4.04;-4.01;-4.06;-4.0;-4.06;-4.06	5.36	4.29	0.51040	5.360000	4.290000	0.510400	Ion transport (1);	0.408184	0.18169	N	0.149521	D	0.96163	0.8749	L	0.39245	1.2	0.34568	D	0.713136	D;B;D;D;D;D;D;B;D;B;B;B;B;B;D;B;D;B;B;B;D;B;B;B;B;D	0.89917	0.999;0.015;0.99;0.998;0.994;0.999;0.999;0.014;0.999;0.015;0.014;0.012;0.015;0.014;1.0;0.007;0.999;0.028;0.015;0.015;0.999;0.015;0.014;0.016;0.002;0.998	D;B;D;D;D;D;D;B;D;B;B;B;B;B;D;B;D;B;B;B;D;B;B;B;B;D	0.87578	0.997;0.035;0.942;0.986;0.942;0.972;0.998;0.035;0.994;0.035;0.016;0.021;0.035;0.035;0.998;0.035;0.992;0.011;0.035;0.035;0.996;0.035;0.027;0.052;0.003;0.985	D	0.96169	0.9121	10	0.42905	T	0.14	.	8.0638	0.30648	0.0:0.1531:0.0:0.8469	.	302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302;302	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	H	302	ENSP00000353990:Y302H;ENSP00000339302:Y302H;ENSP00000392390:Y302H;ENSP00000347078:Y302H;ENSP00000409759:Y302H;ENSP00000425522:Y302H;ENSP00000426261:Y302H;ENSP00000425451:Y302H;ENSP00000422407:Y302H;ENSP00000426814:Y302H;ENSP00000427238:Y302H;ENSP00000423112:Y302H;ENSP00000420918:Y302H;ENSP00000426172:Y302H;ENSP00000423045:Y302H;ENSP00000427173:Y302H;ENSP00000426098:Y302H;ENSP00000425698:Y302H;ENSP00000426232:Y302H;ENSP00000423317:Y302H;ENSP00000350979:Y302H;ENSP00000352011:Y302H;ENSP00000414388:Y302H;ENSP00000423155:Y302H;ENSP00000422268:Y302H;ENSP00000421518:Y302H	ENSP00000339302:Y302H	Y	+	1	0	0	CACNA1G	46005071	46005071	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	2.449000	0.44935	2.055000	0.61198	0.414000	0.27820	TAT	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.637	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	1	0	1	2	2	2	2	0	0	0	0	19	0	19	19	1	1.930000	-20.000000	1	0.630000	NM_018896		0	37	37	0	78	78	1		1			0	0	19	0	0	1.000000	0	0	0	0	0	0	37	78
OSBPL1A	114876	broad.mit.edu	37	18	21894274	21894274	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr18:21894274C>T	ENST00000319481.3	-	12	1114	c.908G>A	c.(907-909)tGc>tAc	p.C303Y	OSBPL1A_ENST00000357041.4_5'Flank	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	303	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					GTCATCAAAGCATTTAATAAA	0.363																																						ENST00000319481.3	0.680000	4.300000e-01	0.620000	0.490000	0.550000	0.558792	0.550000	0.550000																										0				36						c.(907-909)tGc>tAc		oxysterol binding protein-like 1A							102.0	102.0	102.0					18																	21894274		2203	4300	6503	SO:0001583	missense	114876	0	0					g.chr18:21894274C>T	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.908G>A	chr18.hg19:g.21894274C>T	ENSP00000320291:p.Cys303Tyr	0					OSBPL1A_ENST00000357041.4_5'Flank	p.C303Y	NM_080597.3	NP_542164.2	0	0	0	2.029361	Q9BXW6	OSBL1_HUMAN		12	1114	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	1	1	hg19	c.908G>A	CCDS11884.1	0	.	.	.	.	.	.	.	.	.	.	C	22.7	4.328865	0.81690	.	.	ENSG00000141447	ENST00000319481	T	0.43688	0.94	5.7	5.7	0.88788	5.700000	5.700000	0.887880	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.65260	0.2674	M	0.68593	2.085	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.83275	0.996;0.986	T	0.62676	-0.6804	10	0.45353	T	0.12	-16.9032	19.8161	0.96568	0.0:1.0:0.0:0.0	.	303;303	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	Y	303	ENSP00000320291:C303Y	ENSP00000320291:C303Y	C	-	2	0	0	OSBPL1A	20148272	20148272	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.709000	0.74665	2.680000	0.91292	0.585000	0.79938	TGC	0.627654		TCGA-HV-AA8X-01A-11D-A397-08	0.363	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	1	0	0	2	2	2	2	0	0	0	0	55	0	55	55	1	1.930000	-20.000000	1	0.630000	NM_080597		0	65	64	0	305	304	1		1	0		0	0	55	0	0	1.000000	5.495974e-01	0	0	0	10	0	65	305
OSBPL1A	114876	broad.mit.edu	37	18	21897296	21897296	+	Silent	SNP	C	C	T	rs367725053		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr18:21897296C>T	ENST00000319481.3	-	10	1007	c.801G>A	c.(799-801)agG>agA	p.R267R		NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	267	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CTTACTGTTTCCTATACCATG	0.313																																						ENST00000319481.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				36						c.(799-801)agG>agA		oxysterol binding protein-like 1A		C		0,4406		0,0,2203	107.0	116.0	113.0		801	3.8	1.0	18		113	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OSBPL1A	NM_080597.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		267/951	21897296	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	114876	1	121408	34				g.chr18:21897296C>T	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.801G>A	chr18.hg19:g.21897296C>T		0						p.R267R	NM_080597.3	NP_542164.2	0	0	0	2.029361	Q9BXW6	OSBL1_HUMAN		10	1007	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	1	1	hg19	c.801G>A	CCDS11884.1	1																																																																																								0.627654		TCGA-HV-AA8X-01A-11D-A397-08	0.313	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	1	0	1	2	2	2	2	0	0	0	0	61	0	61	61	1	1.930000	-20.000000	1	0.630000	NM_080597		0	189	188	0	251	249	1		1	0		0	0	61	0	0	1.000000	8.751383e-01	0	0	0	7	0	189	251
OSBPL1A	114876	broad.mit.edu	37	18	21898597	21898597	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr18:21898597C>A	ENST00000319481.3	-	9	906	c.700G>T	c.(700-702)Gca>Tca	p.A234S		NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	234	Interaction with RAB7A.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CGTTTCAATGCTTTGTAGATG	0.279																																						ENST00000319481.3	0.770000	5.300000e-01	0.710000	0.580000	0.640000	0.653284	0.640000	0.650000																										0				36						c.(700-702)Gca>Tca		oxysterol binding protein-like 1A							40.0	41.0	41.0					18																	21898597		2202	4295	6497	SO:0001583	missense	114876	0	0					g.chr18:21898597C>A	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.700G>T	chr18.hg19:g.21898597C>A	ENSP00000320291:p.Ala234Ser	0						p.A234S	NM_080597.3	NP_542164.2	0	0	0	2.029361	Q9BXW6	OSBL1_HUMAN		9	906	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	1	1	hg19	c.700G>T	CCDS11884.1	0	.	.	.	.	.	.	.	.	.	.	C	4.909	0.169002	0.09339	.	.	ENSG00000141447	ENST00000319481	T	0.44881	0.91	5.56	1.49	0.22878	5.560000	1.490000	0.228780	Ankyrin repeat-containing domain (2);	0.491348	0.21599	N	0.071965	T	0.22551	0.0544	N	0.25647	0.755	0.58432	D	0.999998	B;B	0.12630	0.006;0.006	B;B	0.15870	0.014;0.014	T	0.07731	-1.0757	10	0.08599	T	0.76	-5.6116	6.4427	0.21859	0.1097:0.4683:0.3476:0.0743	.	234;234	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	S	234	ENSP00000320291:A234S	ENSP00000320291:A234S	A	-	1	0	0	OSBPL1A	20152595	20152595	0.676000	0.27567	0.851000	0.33527	0.873000	0.50193	0.364000	0.20325	0.284000	0.22305	0.650000	0.86243	GCA	0.627654		TCGA-HV-AA8X-01A-11D-A397-08	0.279	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	1	0	1	2	2	2	2	0	0	0	0	58	0	58	58	1	1.930000	-20.000000	1	0.630000	NM_080597		0	89	89	0	343	341	1		1	0		0	0	58	0	0	1.000000	3.626491e-01	0	0	0	6	0	89	343
SMAD4	4089	broad.mit.edu	37	18	48575209	48575209	+	Nonsense_Mutation	SNP	C	C	T	rs377767326		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr18:48575209C>T	ENST00000342988.3	+	3	941	c.403C>T	c.(403-405)Cga>Tga	p.R135*	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.R135*|SMAD4_ENST00000588745.1_Nonsense_Mutation_p.R135*|SMAD4_ENST00000452201.2_Nonsense_Mutation_p.R135*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	135	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R135*(4)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCACTACGAACGAGTTGTATC	0.328																																						ENST00000342988.3	0.270000	7.000000e-02	0.210000	0.100000	0.150000	0.164494	0.150000	0.150000																										44	Whole gene deletion(36)|Substitution - Nonsense(4)|Unknown(4)	p.0?(36)|p.R135*(4)|p.?(4)	pancreas(27)|large_intestine(4)|stomach(3)|breast(3)|upper_aerodigestive_tract(2)|lung(2)|gastrointestinal_tract_(site_indeterminate)(1)|oesophagus(1)|NS(1)	454	GRCh37	CM064283	SMAD4	M		c.(403-405)Cga>Tga		SMAD family member 4							128.0	115.0	119.0					18																	48575209		2203	4300	6503	SO:0001587	stop_gained	4089	0	0					g.chr18:48575209C>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.403C>T	chr18.hg19:g.48575209C>T	ENSP00000341551:p.Arg135*	1					SMAD4_ENST00000452201.2_Nonsense_Mutation_p.R135*|SMAD4_ENST00000588745.1_Nonsense_Mutation_p.R135*|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.R135*	p.R135*	NM_005359.5	NP_005350.1	0	1	1	1.390667	Q13485	SMAD4_HUMAN		3	941	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Nonsense_Mutation	SNP	ENST00000342988.3	0	1	hg19	c.403C>T	CCDS11950.1	0	.	.	.	.	.	.	.	.	.	.	C	42	9.183954	0.99092	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	.	.	.	5.48	4.57	0.56435	5.480000	4.570000	0.564350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5925	0.68378	0.1465:0.8535:0.0:0.0	.	.	.	.	X	135	.	ENSP00000341551:R135X	R	+	1	2	2	SMAD4	46829207	46829207	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.732000	0.26072	2.540000	0.85666	0.585000	0.79938	CGA	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.328	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1	2	2	2	2	0	0	0	0	39	0	39	39	1	1.930000	-13.213000	1	0.630000	NM_005359		0	9	9	0	120	118	0		1	1	1	0	0	39	342	0	0.994360	4.705243e-01	9.999691e-01	3	20	18	292	9	120
ALPK2	115701	broad.mit.edu	37	18	56204451	56204451	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr18:56204451T>C	ENST00000361673.3	-	5	3181	c.2968A>G	c.(2968-2970)Aca>Gca	p.T990A	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	990						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GTTAATGTTGTTGGCTTCTCC	0.488																																						ENST00000361673.3	0.090000	0	0.070000	0.020000	0.030000	0.046016	0.030000	0.040000																										0				84						c.(2968-2970)Aca>Gca		alpha-kinase 2							109.0	101.0	104.0					18																	56204451		2203	4300	6503	SO:0001583	missense	115701	0	0					g.chr18:56204451T>C	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2968A>G	chr18.hg19:g.56204451T>C	ENSP00000354991:p.Thr990Ala	1					RP11-1151B14.4_ENST00000591360.1_RNA	p.T990A	NM_052947.3	NP_443179.3	0	1	1	1.390667	Q86TB3	ALPK2_HUMAN		5	3181	-			Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	0	1	hg19	c.2968A>G	CCDS11966.2	0	.	.	.	.	.	.	.	.	.	.	T	9.351	1.065556	0.20067	.	.	ENSG00000198796	ENST00000361673	T	0.52295	0.67	5.41	-6.33	0.01988	5.410000	-6.330000	0.019880	.	1.692290	0.03097	N	0.160562	T	0.28234	0.0697	L	0.31926	0.97	0.09310	N	1	B;B	0.22909	0.077;0.046	B;B	0.19391	0.025;0.011	T	0.07986	-1.0744	10	0.22109	T	0.4	0.3807	0.8581	0.01187	0.2972:0.1997:0.0999:0.4031	.	990;990	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	A	990	ENSP00000354991:T990A	ENSP00000354991:T990A	T	-	1	0	0	ALPK2	54355431	54355431	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.379000	0.07437	-1.405000	0.02048	-2.480000	0.00198	ACA	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.488	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	0	0	1	2	2	2	2	0	0	0	0	70	0	70	69	1	1.930000	-3.396322	1	0.630000	NM_052947		0	4	4	0	229	224	0		1			0	0	70	0	0	0.885993	0	0	0	0	0	0	4	229
IL4I1	259307	broad.mit.edu	37	19	50399114	50399114	+	Silent	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr19:50399114G>A	ENST00000391826.2	-	3	352	c.210C>T	c.(208-210)gcC>gcT	p.A70A	IL4I1_ENST00000595948.1_Silent_p.A92A|IL4I1_ENST00000341114.3_Silent_p.A92A	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	70						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CCACCAGCCCGGCCACACCAG	0.627																																						ENST00000391826.2	0.210000	9.000000e-02	0.180000	0.110000	0.140000	0.151300	0.140000	0.140000																										0				16						c.(208-210)gcC>gcT		interleukin 4 induced 1	Flavin adenine dinucleotide(DB03147)						100.0	107.0	105.0					19																	50399114		2203	4300	6503	SO:0001819	synonymous_variant	259307	1	121410	36				g.chr19:50399114G>A	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.210C>T	chr19.hg19:g.50399114G>A		0					IL4I1_ENST00000341114.3_Silent_p.A92A|IL4I1_ENST00000595948.1_Silent_p.A92A	p.A70A	NM_152899.1	NP_690863.1	1	2	3	2.058099	Q96RQ9	OXLA_HUMAN		3	352	-		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	1	1	hg19	c.210C>T	CCDS12787.1	0																																																																																								0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.627	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1	1	0	1	2	2	2	2	0	0	0	0	146	0	146	146	1	1.930000	-4.599387	1	0.630000			0	32	32	0	660	655	0		1	0		0	0	146	0	0	1.000000	2.095457e-02	0	0	0	5	0	32	660
SIGLEC7	27036	broad.mit.edu	37	19	51647834	51647834	+	Missense_Mutation	SNP	T	T	C			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr19:51647834T>C	ENST00000317643.6	+	2	674	c.605T>C	c.(604-606)cTc>cCc	p.L202P	SIGLEC7_ENST00000600577.1_Intron|SIGLEC7_ENST00000305628.7_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	202	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		TCCTCAGTGCTCACCCTCATC	0.657																																						ENST00000317643.6	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.060179	0.050000	0.060000																										0				29						c.(604-606)cTc>cCc		sialic acid binding Ig-like lectin 7							63.0	62.0	62.0					19																	51647834		2203	4300	6503	SO:0001583	missense	27036	0	0					g.chr19:51647834T>C	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.605T>C	chr19.hg19:g.51647834T>C	ENSP00000323328:p.Leu202Pro	0					SIGLEC7_ENST00000600577.1_Intron|SIGLEC7_ENST00000305628.7_Intron	p.L202P	NM_014385.2	NP_055200.1	1	2	3	2.058099	Q9Y286	SIGL7_HUMAN		2	674	+		all_neural(266;0.0199)	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	ENST00000317643.6	0	1	hg19	c.605T>C	CCDS12826.1	0	.	.	.	.	.	.	.	.	.	.	.	14.00	2.404089	0.42613	.	.	ENSG00000168995	ENST00000317643	T	0.09630	2.96	2.9	2.9	0.33743	2.900000	2.900000	0.337430	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35555	N	0.003139	T	0.34600	0.0903	M	0.90483	3.12	0.43662	D	0.996083	D	0.89917	1.0	D	0.97110	1.0	T	0.16335	-1.0406	10	0.66056	D	0.02	.	7.6424	0.28300	0.0:0.0:0.0:1.0	.	202	Q9Y286	SIGL7_HUMAN	P	202	ENSP00000323328:L202P	ENSP00000323328:L202P	L	+	2	0	0	SIGLEC7	56339646	56339646	0.058000	0.20735	0.647000	0.29507	0.017000	0.09413	3.019000	0.49635	1.360000	0.45960	0.432000	0.28606	CTC	0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.657	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	0	0	1	2	2	2	2	0	0	0	0	59	0	59	58	1	1.930000	-6.404988	1	0.630000	NM_016543		0	6	5	0	362	355	0		1	0		0	0	59	0	0	0.962842	4.079551e-04	0	0	0	2	0	6	362
TSEN34	79042	broad.mit.edu	37	19	54696142	54696142	+	Silent	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr19:54696142C>T	ENST00000396383.1	+	4	974	c.663C>T	c.(661-663)taC>taT	p.Y221Y	TSEN34_ENST00000302937.4_Silent_p.Y221Y|MBOAT7_ENST00000245615.1_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|TSEN34_ENST00000396388.2_Silent_p.Y221Y|MBOAT7_ENST00000391754.1_5'Flank|MBOAT7_ENST00000474910.1_5'Flank|TSEN34_ENST00000429671.2_Silent_p.Y221Y|MBOAT7_ENST00000338624.6_5'Flank|MBOAT7_ENST00000431666.2_5'Flank			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	221					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AGCTGCGCTACAGTATCTACA	0.642																																					Esophageal Squamous(37;841 964 4869 42824)	ENST00000396383.1	0.720000	4.200000e-01	0.630000	0.480000	0.540000	0.560702	0.540000	0.550000																										0				10						c.(661-663)taC>taT		TSEN34 tRNA splicing endonuclease subunit							60.0	63.0	62.0					19																	54696142		1947	4134	6081	SO:0001819	synonymous_variant	79042	0	0					g.chr19:54696142C>T	AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.663C>T	chr19.hg19:g.54696142C>T		0					MBOAT7_ENST00000245615.1_5'Flank|TSEN34_ENST00000302937.4_Silent_p.Y221Y|MBOAT7_ENST00000338624.6_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|MBOAT7_ENST00000391754.1_5'Flank|TSEN34_ENST00000429671.2_Silent_p.Y221Y|TSEN34_ENST00000396388.2_Silent_p.Y221Y|MBOAT7_ENST00000431666.2_5'Flank|MBOAT7_ENST00000474910.1_5'Flank	p.Y221Y			1	2	3	2.069353	Q9BSV6	SEN34_HUMAN		4	974	+	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Silent	SNP	ENST00000396383.1	1	1	hg19	c.663C>T	CCDS42609.1	0																																																																																								0.632316		TCGA-HV-AA8X-01A-11D-A397-08	0.642	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	1	0	1	2	2	2	2	0	0	0	0	57	0	57	54	1	1.930000	-20.000000	1	0.630000	NM_024075		0	51	51	0	245	240	1		1	1		0	0	57	0	0	1.000000	1	0	32	0	140	0	51	245
LILRB1	10859	broad.mit.edu	37	19	55144146	55144146	+	Missense_Mutation	SNP	A	A	C	rs563262541	byFrequency	TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr19:55144146A>C	ENST00000396331.1	+	7	1250	c.893A>C	c.(892-894)tAc>tCc	p.Y298S	LILRB1_ENST00000427581.2_Missense_Mutation_p.Y334S|LILRB1_ENST00000396317.1_Missense_Mutation_p.Y298S|LILRB1_ENST00000396332.4_Missense_Mutation_p.Y298S|LILRB1_ENST00000396327.3_Missense_Mutation_p.Y298S|LILRB1_ENST00000396321.2_Missense_Mutation_p.Y298S|LILRB1_ENST00000434867.2_Missense_Mutation_p.Y298S|LILRB1_ENST00000324602.7_Missense_Mutation_p.Y298S|LILRB1_ENST00000448689.1_Missense_Mutation_p.Y298S|LILRB1_ENST00000396315.1_Missense_Mutation_p.Y298S|LILRB1_ENST00000418536.2_Missense_Mutation_p.Y298S	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	298	Ig-like C2-type 3.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		TACAGATGCTACGGTGCACAC	0.672										HNSCC(37;0.09)			a|||	2	0.000399361	0.0015	0.0	5008	,	,		16509	0.0		0.0	False		,,,				2504	0.0					ENST00000396331.1	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.067131	0.050000	0.060000																										0				74						c.(892-894)tAc>tCc		leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1							47.0	49.0	49.0					19																	55144146		2203	4298	6501	SO:0001583	missense	10859	35	121412	46				g.chr19:55144146A>C	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.893A>C	chr19.hg19:g.55144146A>C	ENSP00000379622:p.Tyr298Ser	0	HNSCC(37;0.09)				LILRB1_ENST00000324602.7_Missense_Mutation_p.Y298S|LILRB1_ENST00000418536.2_Missense_Mutation_p.Y298S|LILRB1_ENST00000396315.1_Missense_Mutation_p.Y298S|LILRB1_ENST00000427581.2_Missense_Mutation_p.Y334S|LILRB1_ENST00000396321.2_Missense_Mutation_p.Y298S|LILRB1_ENST00000434867.2_Missense_Mutation_p.Y298S|LILRB1_ENST00000396327.3_Missense_Mutation_p.Y298S|LILRB1_ENST00000396317.1_Missense_Mutation_p.Y298S|LILRB1_ENST00000396332.4_Missense_Mutation_p.Y298S|LILRB1_ENST00000448689.1_Missense_Mutation_p.Y298S	p.Y298S	NM_006669.3	NP_006660.3	0	0	0	2.046403	Q8NHL6	LIRB1_HUMAN		7	1250	+			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	0	1	hg19	c.893A>C	CCDS42617.1	0	.	.	.	.	.	.	.	.	.	.	A	5.091	0.202429	0.09652	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76	2.03	0.938	0.19500	2.030000	0.938000	0.195000	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.252811	0.20873	N	0.084132	T	0.16557	0.0398	M	0.74467	2.265	0.09310	N	0.999994	B;B;P;B;B	0.37233	0.34;0.004;0.588;0.01;0.005	B;B;P;B;B	0.45506	0.261;0.031;0.483;0.031;0.052	T	0.08848	-1.0702	10	0.48119	T	0.1	.	5.3334	0.15945	0.7111:0.2889:0.0:0.0	.	298;298;298;298;298	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	S	298;298;298;298;298;298;298;298;334;298;298	ENSP00000379614:Y298S;ENSP00000391514:Y298S;ENSP00000409968:Y298S;ENSP00000379622:Y298S;ENSP00000379618:Y298S;ENSP00000315997:Y298S;ENSP00000405243:Y298S;ENSP00000379623:Y298S;ENSP00000395004:Y334S;ENSP00000379610:Y298S;ENSP00000379608:Y298S	ENSP00000315997:Y298S	Y	+	2	0	0	LILRB1	59835958	59835958	0.000000	0.05858	0.217000	0.23759	0.009000	0.06853	-0.248000	0.08854	0.015000	0.14971	-1.341000	0.01249	TAC	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.672	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4	0	0	1	2	2	2	2	0	0	0	0	53	0	53	57	1	1.930000	-2.586779	1	0.630000			0	5	4	0	276	266	0		1	0		0	0	53	0	0	0.931307	0	0	0	0	1	0	5	276
ZNF266	10781	broad.mit.edu	37	19	9526402	9526402	+	Silent	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr19:9526402C>T	ENST00000592904.1	-	4	2208	c.132G>A	c.(130-132)gtG>gtA	p.V44V	ZNF266_ENST00000361151.1_Silent_p.V44V|ZNF266_ENST00000588221.1_Silent_p.V44V|ZNF266_ENST00000588933.1_Silent_p.V44V|ZNF266_ENST00000590306.1_Silent_p.V44V|ZNF266_ENST00000592292.1_Silent_p.V44V|ZNF266_ENST00000361451.2_Silent_p.V44V			Q14584	ZN266_HUMAN	zinc finger protein 266	44					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						TTTTAAGTTGCACTTTCCATT	0.418																																						ENST00000592904.1	0.210000	5.000000e-02	0.170000	0.080000	0.120000	0.129499	0.120000	0.120000																										0				28						c.(130-132)gtG>gtA		zinc finger protein 266							121.0	114.0	116.0					19																	9526402		2203	4300	6503	SO:0001819	synonymous_variant	10781	2	121412	31				g.chr19:9526402C>T	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.132G>A	chr19.hg19:g.9526402C>T		0					ZNF266_ENST00000361451.2_Silent_p.V44V|ZNF266_ENST00000588933.1_Silent_p.V44V|ZNF266_ENST00000588221.1_Silent_p.V44V|ZNF266_ENST00000361151.1_Silent_p.V44V|ZNF266_ENST00000592292.1_Silent_p.V44V|ZNF266_ENST00000590306.1_Silent_p.V44V	p.V44V			0	0	0	2.022215	Q14584	ZN266_HUMAN		4	2208	-			A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Silent	SNP	ENST00000592904.1	1	1	hg19	c.132G>A	CCDS12213.1	0																																																																																								0.627654		TCGA-HV-AA8X-01A-11D-A397-08	0.418	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1	0	0	1	2	2	2	2	0	0	0	0	46	0	46	45	1	1.930000	-10.564710	1	0.630000			0	9	8	0	232	230	0		1	1		0	0	46	0	0	0.994143	6.444420e-02	0	2	0	8	0	9	232
KIR3DL2	3812	broad.mit.edu	37	19	55378105	55378105	+	Silent	SNP	G	G	A	rs190401211		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr19:55378105G>A	ENST00000326321.3	+	9	1320	c.1287G>A	c.(1285-1287)acG>acA	p.T429T	RNU6-222P_ENST00000362438.1_RNA|KIR3DL2_ENST00000270442.5_Silent_p.T412T|KIR3DL1_ENST00000402254.2_Silent_p.T429T	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	429					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		GCGTGTACACGGAACTTCCAA	0.522																																						ENST00000326321.3	1.000000	9.200000e-01	1.000000	0.970000	0.990000	0.991880	0.990000	1.000000																										0				23						c.(1285-1287)acG>acA		killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2							288.0	281.0	283.0					19																	55378105		2203	4300	6503	SO:0001819	synonymous_variant	3812	0	0					g.chr19:55378105G>A	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1287G>A	chr19.hg19:g.55378105G>A		0					KIR3DL2_ENST00000270442.5_Silent_p.T412T|KIR3DL1_ENST00000402254.2_Silent_p.T429T|RNU6-222P_ENST00000362438.1_RNA	p.T429T	NM_006737.3	NP_006728.2	0	0	0	2.046403	P43630	KI3L2_HUMAN		9	1320	+			Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Silent	SNP	ENST00000326321.3	1	1	hg19	c.1287G>A	CCDS12906.1	1																																																																																								0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.522	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1	1	0	1	2	2	2	2	0	0	0	0	186	0	186	185	1	1.930000	-19.883200	1	0.630000			0	288	285	0	599	593	0		1			0	0	186	0	0	1.000000	0	0	0	0	0	0	288	599
TMEM63A	9725	broad.mit.edu	37	1	226037743	226037743	+	Silent	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr1:226037743C>T	ENST00000366835.3	-	21	2211	c.1941G>A	c.(1939-1941)cgG>cgA	p.R647R		NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	647					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					AGAGGTTGTGCCGGTCCACCA	0.602																																						ENST00000366835.3	1.000000	0	0.090000	0.020000	0.050000	0.095629	0.050000	0.060000																										0				24						c.(1939-1941)cgG>cgA		transmembrane protein 63A							132.0	118.0	122.0					1																	226037743		2203	4300	6503	SO:0001819	synonymous_variant	9725	0	0					g.chr1:226037743C>T		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1941G>A	chr1.hg19:g.226037743C>T		1						p.R647R	NM_014698.2	NP_055513.2	1	2	3	2.645449	O94886	CSCL1_HUMAN		21	2211	-	Breast(184;0.197)		Q53GI7|Q5TE96|Q8N2U2	Silent	SNP	ENST00000366835.3	0	1	hg19	c.1941G>A	CCDS31042.1	0																																																																																								0.715220		TCGA-HV-AA8X-01A-11D-A397-08	0.602	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	0	0	1	2	2	2	2	0	0	0	0	77	0	77	77	1	1.930000	-1.924587	0	0.630000	NM_014698		0	6	6	0	470	465	0		1	0		0	0	77	0	0	0.964027	9.782602e-01	0	1	0	549	0	6	470
PER3	8863	broad.mit.edu	37	1	7887612	7887612	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr1:7887612C>T	ENST00000361923.2	+	17	2774	c.2599C>T	c.(2599-2601)Cca>Tca	p.P867S	PER3_ENST00000377532.3_Missense_Mutation_p.P875S|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	867	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		ATCGTTTTTGCCATGTCCATT	0.537																																						ENST00000361923.2	0.060000	0	0.050000	0.010000	0.020000	0.031841	0.020000	0.030000																										0				39						c.(2599-2601)Cca>Tca		period circadian clock 3							179.0	174.0	175.0					1																	7887612		2203	4300	6503	SO:0001583	missense	8863	0	0					g.chr1:7887612C>T	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2599C>T	chr1.hg19:g.7887612C>T	ENSP00000355031:p.Pro867Ser	0					RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.P875S	p.P867S	NM_016831.1	NP_058515.1	0	0	0	2.047870	P56645	PER3_HUMAN		17	2774	+	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	0	1	hg19	c.2599C>T	CCDS89.1	0	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234770	0.39498	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.13196	2.61;2.65	4.32	4.32	0.51571	4.320000	4.320000	0.515710	.	0.845655	0.10846	N	0.627733	T	0.12178	0.0296	L	0.41573	1.285	0.09310	N	0.999997	P;P;P;P	0.46784	0.816;0.816;0.884;0.816	B;B;B;B	0.39152	0.152;0.152;0.292;0.152	T	0.13176	-1.0519	10	0.46703	T	0.11	.	9.4843	0.38919	0.0:0.892:0.0:0.108	.	867;875;875;867	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	S	875;867;78	ENSP00000366755:P875S;ENSP00000355031:P867S	ENSP00000355031:P867S	P	+	1	0	0	PER3	7810199	7810199	0.001000	0.12720	0.049000	0.19019	0.057000	0.15508	0.675000	0.25232	2.240000	0.73641	0.555000	0.69702	CCA	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.537	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	0	0	1	2	2	2	2	0	0	0	0	149	0	149	146	1	1.930000	-1.879840	0	0.630000	NM_016831		0	7	7	0	765	755	0		1	0		0	0	149	0	0	0.979723	9.266273e-02	0	0	0	48	0	7	765
RERE	473	broad.mit.edu	37	1	8418382	8418382	+	Missense_Mutation	SNP	G	G	A	rs368040659		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr1:8418382G>A	ENST00000337907.3	-	21	4847	c.4213C>T	c.(4213-4215)Cgc>Tgc	p.R1405C	RERE_ENST00000400908.2_Missense_Mutation_p.R1405C|RERE_ENST00000476556.1_Missense_Mutation_p.R851C|RERE_ENST00000377464.1_Missense_Mutation_p.R1137C|RERE_ENST00000400907.2_Intron	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1405					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GATGCCATGCGCTCTGCGTGG	0.642																																						ENST00000337907.3	0.590000	1.900000e-01	0.480000	0.270000	0.360000	0.382482	0.360000	0.360000																										0				49						c.(4213-4215)Cgc>Tgc		arginine-glutamic acid dipeptide (RE) repeats		G	CYS/ARG,CYS/ARG,CYS/ARG	0,4398		0,0,2199	78.0	64.0	69.0		4213,2551,4213	5.6	1.0	1		69	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	RERE	NM_001042681.1,NM_001042682.1,NM_012102.3	180,180,180	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	1405/1567,851/1013,1405/1567	8418382	1,12997	2199	4300	6499	SO:0001583	missense	473	1	121310	21				g.chr1:8418382G>A	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.4213C>T	chr1.hg19:g.8418382G>A	ENSP00000338629:p.Arg1405Cys	0					RERE_ENST00000400908.2_Missense_Mutation_p.R1405C|RERE_ENST00000476556.1_Missense_Mutation_p.R851C|RERE_ENST00000377464.1_Missense_Mutation_p.R1137C|RERE_ENST00000400907.2_Intron	p.R1405C	NM_012102.3	NP_036234.3	0	0	0	2.047870	Q9P2R6	RERE_HUMAN		21	4847	-	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	0	1	hg19	c.4213C>T	CCDS95.1	0	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347872	0.82022	0.0	1.16E-4	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T	0.60548	0.18;0.2;0.18	5.61	5.61	0.85477	5.610000	5.610000	0.854770	.	.	.	.	.	T	0.78065	0.4225	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79732	-0.1680	9	0.87932	D	0	-28.4026	18.9896	0.92786	0.0:0.0:1.0:0.0	.	1405	Q9P2R6	RERE_HUMAN	C	1405;1137;851;1405	ENSP00000338629:R1405C;ENSP00000366684:R1137C;ENSP00000383700:R1405C	ENSP00000338629:R1405C	R	-	1	0	0	RERE	8340969	8340969	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.049000	0.57397	2.793000	0.96121	0.655000	0.94253	CGC	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.642	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1	1	0	0	2	2	2	2	0	0	0	0	19	0	19	19	1	1.930000	-17.733590	1	0.630000			0	11	11	0	86	86	1		1	1		0	0	19	0	0	0.998658	9.978381e-01	0	12	0	78	0	11	86
RAD54L	8438	broad.mit.edu	37	1	46726266	46726266	+	Missense_Mutation	SNP	C	C	T	rs149141765		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr1:46726266C>T	ENST00000371975.4	+	6	1134	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W	RAD54L_ENST00000442598.1_Missense_Mutation_p.R154W	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	154					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R154W(1)		breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		TAAGGTTTTGCGGCCTCATCA	0.537								Direct reversal of damage;Homologous recombination					C|||	1	0.000199681	0.0	0.0	5008	,	,		22956	0.001		0.0	False		,,,				2504	0.0					ENST00000371975.4	0.100000	0	0.080000	0.020000	0.040000	0.053756	0.040000	0.040000																										1	Substitution - Missense(1)	p.R154W(1)	cervix(1)	25						c.(460-462)Cgg>Tgg	Direct reversal of damage;Homologous recombination	RAD54-like (S. cerevisiae)		C	TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	139.0	128.0	132.0		460,460	3.8	1.0	1	dbSNP_134	132	0,8600		0,0,4300	no	missense,missense	RAD54L	NM_001142548.1,NM_003579.3	101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	154/748,154/748	46726266	2,13004	2203	4300	6503	SO:0001583	missense	8438	2	121412	39				g.chr1:46726266C>T	X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.460C>T	chr1.hg19:g.46726266C>T	ENSP00000361043:p.Arg154Trp	0					RAD54L_ENST00000442598.1_Missense_Mutation_p.R154W	p.R154W	NM_003579.3	NP_003570.2	0	0	0	2.046825	Q92698	RAD54_HUMAN		6	1134	+	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)	Q5TE31|Q6IUY3	Missense_Mutation	SNP	ENST00000371975.4	0	1	hg19	c.460C>T	CCDS532.1	0	.	.	.	.	.	.	.	.	.	.	C	18.39	3.614125	0.66672	4.54E-4	0.0	ENSG00000085999	ENST00000442598;ENST00000371975	D;D	0.95205	-3.64;-3.64	5.75	3.8	0.43715	5.750000	3.800000	0.437150	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98550	1.0636	10	0.87932	D	0	-18.6346	13.7348	0.62811	0.4359:0.5641:0.0:0.0	.	154	Q92698	RAD54_HUMAN	W	154	ENSP00000396113:R154W;ENSP00000361043:R154W	ENSP00000361043:R154W	R	+	1	2	2	RAD54L	46498853	46498853	0.999000	0.42202	0.996000	0.52242	0.998000	0.95712	1.055000	0.30467	0.698000	0.31739	0.655000	0.94253	CGG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.537	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021272.1	0	0	1	2	2	2	2	0	0	0	0	63	0	63	61	1	1.930000	-1.705155	0	0.630000	NM_003579		0	5	5	0	346	338	0		1	0		0	0	63	0	0	0.934116	2.560576e-02	0	0	0	14	0	5	346
C1orf101	257044	broad.mit.edu	37	1	244724041	244724041	+	Silent	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr1:244724041G>A	ENST00000366534.4	+	10	1155	c.1101G>A	c.(1099-1101)aaG>aaA	p.K367K	C1orf101_ENST00000366533.4_Silent_p.K367K|C1orf101_ENST00000366531.3_Silent_p.K216K|C1orf101_ENST00000473875.1_3'UTR	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	367						CatSper complex (GO:0036128)		p.K367N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TTCTTCTTAAGTTTGCCAGAT	0.408																																						ENST00000366534.4	1.000000	5.000000e-02	0.170000	0.080000	0.110000	0.157187	0.110000	0.120000																										1	Substitution - Missense(1)	p.K367N(1)	large_intestine(1)	36						c.(1099-1101)aaG>aaA		chromosome 1 open reading frame 101							95.0	97.0	96.0					1																	244724041		2203	4300	6503	SO:0001819	synonymous_variant	257044	0	0					g.chr1:244724041G>A	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.1101G>A	chr1.hg19:g.244724041G>A		1					C1orf101_ENST00000366531.3_Silent_p.K216K|C1orf101_ENST00000473875.1_3'UTR|C1orf101_ENST00000366533.4_Silent_p.K367K	p.K367K	NM_001130957.1	NP_001124429.1	1	2	3	2.645449	Q5SY80	CA101_HUMAN	all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)	10	1155	+	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Silent	SNP	ENST00000366534.4	1	1	hg19	c.1101G>A	CCDS44340.1	0																																																																																								0.715220		TCGA-HV-AA8X-01A-11D-A397-08	0.408	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	0	0	1	2	2	2	2	0	0	0	0	51	0	51	50	1	1.930000	-10.870750	1	0.630000	NM_173807		0	11	11	0	386	383	0		1	0		0	0	51	0	0	0.998316	2.864080e-03	0	0	0	3	0	11	386
KIF16B	55614	broad.mit.edu	37	20	16360059	16360059	+	Missense_Mutation	SNP	C	C	G			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr20:16360059C>G	ENST00000354981.2	-	19	2745	c.2588G>C	c.(2587-2589)tGt>tCt	p.C863S	KIF16B_ENST00000355755.3_Missense_Mutation_p.C863S|KIF16B_ENST00000408042.1_Missense_Mutation_p.C863S|KIF16B_ENST00000378003.2_Missense_Mutation_p.C89S	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	863	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						ACATTTTAAACACTCTAGGAT	0.403																																						ENST00000354981.2	0.110000	2.000000e-02	0.080000	0.030000	0.050000	0.063919	0.050000	0.060000																										0				74						c.(2587-2589)tGt>tCt		kinesin family member 16B							151.0	148.0	149.0					20																	16360059		2203	4300	6503	SO:0001583	missense	55614	0	0					g.chr20:16360059C>G	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2588G>C	chr20.hg19:g.16360059C>G	ENSP00000347076:p.Cys863Ser	0					KIF16B_ENST00000355755.3_Missense_Mutation_p.C863S|KIF16B_ENST00000378003.2_Missense_Mutation_p.C89S|KIF16B_ENST00000408042.1_Missense_Mutation_p.C863S	p.C863S	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	0	0	0	2.039696	Q96L93	KI16B_HUMAN		19	2745	-			A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	0	1	hg19	c.2588G>C	CCDS13122.1	0	.	.	.	.	.	.	.	.	.	.	C	0.484	-0.878412	0.02550	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	5.6	-10.4	0.00318	5.600000	-10.400000	0.003180	.	0.880733	0.10214	N	0.701715	T	0.04952	0.0133	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12013	0.001;0.005;0.001;0.001	B;B;B;B	0.13407	0.006;0.009;0.009;0.003	T	0.26780	-1.0093	10	0.17832	T	0.49	.	5.1572	0.15040	0.1466:0.2449:0.073:0.5355	.	863;863;863;863	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	S	863;863;707;89;863	ENSP00000347076:C863S;ENSP00000347995:C863S;ENSP00000367242:C89S;ENSP00000384164:C863S	ENSP00000347076:C863S	C	-	2	0	0	KIF16B	16308059	16308059	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.795000	0.04580	-2.085000	0.00864	-0.781000	0.03364	TGT	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.403	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	0	0	1	2	2	2	2	0	0	0	0	92	0	92	92	1	1.930000	-7.927780	1	0.630000	NM_017683		0	9	9	0	485	482	0		1	0		0	0	92	0	0	0.994141	2.911041e-02	0	0	0	13	0	9	485
MCM5	4174	broad.mit.edu	37	22	35796511	35796511	+	Missense_Mutation	SNP	G	G	A	rs367630495		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr22:35796511G>A	ENST00000216122.4	+	2	234	c.80G>A	c.(79-81)cGc>cAc	p.R27H	MCM5_ENST00000382011.5_Missense_Mutation_p.R27H	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	27					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						GGGCAGGCCCGCAAATCGCAG	0.647																																						ENST00000216122.4	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.065343	0.050000	0.060000																										0				29						c.(79-81)cGc>cAc		minichromosome maintenance complex component 5							37.0	42.0	40.0					22																	35796511		2203	4299	6502	SO:0001583	missense	4174	0	0					g.chr22:35796511G>A		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.80G>A	chr22.hg19:g.35796511G>A	ENSP00000216122:p.Arg27His	0					MCM5_ENST00000382011.5_Missense_Mutation_p.R27H	p.R27H	NM_006739.3	NP_006730.2	0	0	0	2.026077	P33992	MCM5_HUMAN		2	234	+			O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	ENST00000216122.4	0	1	hg19	c.80G>A	CCDS13915.1	0	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874705	0.72180	.	.	ENSG00000100297	ENST00000216122;ENST00000382011;ENST00000416905	T;T;T	0.31247	4.19;3.84;1.5	5.08	5.08	0.68730	5.080000	5.080000	0.687300	.	0.420814	0.26563	N	0.023669	T	0.14787	0.0357	N	0.03608	-0.345	0.41628	D	0.989009	B;B	0.11235	0.004;0.004	B;B	0.04013	0.001;0.001	T	0.07195	-1.0785	10	0.41790	T	0.15	-21.2565	11.5797	0.50883	0.0832:0.0:0.9168:0.0	.	27;27	B1AHB1;P33992	.;MCM5_HUMAN	H	27	ENSP00000216122:R27H;ENSP00000371441:R27H;ENSP00000393977:R27H	ENSP00000216122:R27H	R	+	2	0	0	MCM5	34126511	34126511	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.291000	0.72719	2.342000	0.79632	0.455000	0.32223	CGC	0.627654		TCGA-HV-AA8X-01A-11D-A397-08	0.647	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3	0	0	1	2	2	2	2	0	0	0	0	57	0	57	57	1	1.930000	-2.686801	1	0.630000			0	5	6	0	282	279	0		1	0		0	0	57	0	0	0.936926	4.178626e-01	0	0	0	71	0	5	282
DPP10	57628	broad.mit.edu	37	2	116066832	116066832	+	Missense_Mutation	SNP	C	C	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:116066832C>A	ENST00000410059.1	+	2	558	c.78C>A	c.(76-78)agC>agA	p.S26R	DPP10_ENST00000393147.2_Missense_Mutation_p.S30R|DPP10_ENST00000310323.8_Missense_Mutation_p.S19R|DPP10_ENST00000409163.1_5'UTR	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	26	Mediates effects on KCND2.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GAAGTAACAGCCCTCCACAGA	0.403																																						ENST00000410059.1	1.000000	6.500000e-01	0.960000	0.750000	0.850000	0.856236	0.850000	1.000000																										0				101						c.(76-78)agC>agA		dipeptidyl-peptidase 10 (non-functional)							185.0	170.0	175.0					2																	116066832		2203	4300	6503	SO:0001583	missense	57628	0	0					g.chr2:116066832C>A	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.78C>A	chr2.hg19:g.116066832C>A	ENSP00000386565:p.Ser26Arg	0					DPP10_ENST00000310323.8_Missense_Mutation_p.S19R|DPP10_ENST00000409163.1_5'UTR|DPP10_ENST00000393147.2_Missense_Mutation_p.S30R	p.S26R	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	0	0	0	2.039531	Q8N608	DPP10_HUMAN		2	558	+			A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	1	1	hg19	c.78C>A	CCDS46400.1	1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011923	0.35511	.	.	ENSG00000175497	ENST00000410059;ENST00000393146;ENST00000393147;ENST00000310323	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.6	2.8	0.32819	5.600000	2.800000	0.328190	.	0.000000	0.85682	D	0.000000	T	0.39306	0.1073	M	0.66939	2.045	0.49389	D	0.999782	B;B;B;B	0.34103	0.331;0.437;0.113;0.192	B;B;B;B	0.32342	0.144;0.117;0.046;0.046	T	0.48139	-0.9061	10	0.87932	D	0	-1.0384	10.6572	0.45682	0.0:0.7958:0.0:0.2042	.	19;30;22;26	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	R	26;22;30;19	ENSP00000386565:S26R;ENSP00000376854:S22R;ENSP00000376855:S30R;ENSP00000309066:S19R	ENSP00000309066:S19R	S	+	3	2	2	DPP10	115783302	115783302	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.653000	0.24902	1.369000	0.46134	0.655000	0.94253	AGC	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.403	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	1	0	1	2	2	2	2	0	0	0	0	19	0	19	19	1	1.930000	-20.000000	1	0.630000	NM_020868		0	48	48	0	130	126	1		1	1		0	0	19	0	0	1.000000	5.156707e-01	0	5	0	1	0	48	130
NEB	4703	broad.mit.edu	37	2	152420121	152420121	+	Splice_Site	SNP	G	G	A	rs375357016		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:152420121G>A	ENST00000172853.10	-	91	13736	c.13589C>T	c.(13588-13590)gCg>gTg	p.A4530V	NEB_ENST00000603639.1_Splice_Site_p.A6231V|NEB_ENST00000604864.1_Splice_Site_p.A6231V|NEB_ENST00000427231.2_Splice_Site_p.A6231V|NEB_ENST00000409198.1_Splice_Site_p.A4530V|NEB_ENST00000397345.3_Splice_Site_p.A6231V			P20929	NEBU_HUMAN	nebulin	4530					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.A4530E(1)|p.A6231E(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTACTTACCGCACTCCTCAT	0.473																																						ENST00000172853.10	1.000000	8.500000e-01	1.000000	0.910000	0.980000	0.965202	0.980000	1.000000																										2	Substitution - Missense(2)	p.A4530E(1)|p.A6231E(1)	endometrium(2)	301						c.(13588-13590)gCg>gTg		nebulin		G	VAL/ALA,VAL/ALA,VAL/ALA	1,3955		0,1,1977	234.0	222.0	226.0		13589,18692,18692	-5.0	0.5	2		226	0,8318		0,0,4159	no	missense-near-splice,missense-near-splice,missense-near-splice	NEB	NM_004543.4,NM_001164508.1,NM_001164507.1	64,64,64	0,1,6136	AA,AG,GG		0.0,0.0253,0.0081	benign,benign,benign	4530/6670,6231/8526,6231/8526	152420121	1,12273	1978	4159	6137	SO:0001630	splice_region_variant	4703	5	120904	43				g.chr2:152420121G>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.13590+1C>T	chr2.hg19:g.152420121G>A		1					NEB_ENST00000603639.1_Splice_Site_p.A6231V|NEB_ENST00000409198.1_Splice_Site_p.A4530V|NEB_ENST00000427231.2_Splice_Site_p.A6231V|NEB_ENST00000604864.1_Splice_Site_p.A6231V|NEB_ENST00000397345.3_Splice_Site_p.A6231V	p.A4530V			1	2	3	2.468950	P20929	NEBU_HUMAN		91	13736	-			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	SNP	ENST00000172853.10	1	0	hg19	c.13589C>T		1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225906	0.39300	2.53E-4	0.0	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.54	-4.98	0.03019	5.540000	-4.980000	0.030190	.	0.604415	0.18713	N	0.133230	T	0.22859	0.0552	L	0.44542	1.39	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.11329	0.003;0.006	T	0.01805	-1.1270	10	0.39692	T	0.17	.	14.0005	0.64431	0.6299:0.0:0.3701:0.0	.	4530;961	P20929;Q14215	NEBU_HUMAN;.	V	4530;6231;6231;579;961;4530	ENSP00000386259:A4530V;ENSP00000380505:A6231V;ENSP00000416578:A6231V;ENSP00000410961:A961V;ENSP00000172853:A4530V	ENSP00000172853:A4530V	A	-	2	0	0	NEB	152128367	152128367	0.876000	0.30132	0.537000	0.28052	0.860000	0.49131	0.075000	0.14686	-1.451000	0.01933	-0.259000	0.10710	GCG	0.703727		TCGA-HV-AA8X-01A-11D-A397-08	0.473	NEB-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	110	0	110	110	1	1.930000	-20.000000	1	0.630000	NM_004543	Missense_Mutation	0	193	193	0	596	593	1		1	1		0	0	110	0	0	1.000000	2.540230e-01	0	2	0	2	0	193	596
TTN	7273	broad.mit.edu	37	2	179438185	179438185	+	Missense_Mutation	SNP	G	G	A	rs55992239		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:179438185G>A	ENST00000591111.1	-	276	67975	c.67751C>T	c.(67750-67752)cCg>cTg	p.P22584L	TTN_ENST00000342175.6_Missense_Mutation_p.P15352L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P15285L|TTN_ENST00000460472.2_Missense_Mutation_p.P15160L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P24225L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P21657L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22584	Fibronectin type-III 64. {ECO:0000255|PROSITE-ProRule:PRU00316}.		P -> L. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTTGGGCGGATCAGGGGG	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		19723	0.0		0.0	False		,,,				2504	0.001					ENST00000591111.1	1.000000	0	0.130000	0.020000	0.040000	0.198145	0.040000	0.050000																										0				1448						c.(67750-67752)cCg>cTg		titin		G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,3808		0,0,1904	99.0	99.0	99.0		45479,64970,45854,46055	6.1	1.0	2	dbSNP_129	99	3,8251		0,3,4124	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	98,98,98,98	0,3,6028	AA,AG,GG		0.0363,0.0,0.0249	probably-damaging,probably-damaging,probably-damaging,probably-damaging	15160/26927,21657/33424,15285/27052,15352/27119	179438185	3,12059	1904	4127	6031	SO:0001583	missense	7273	8	118970	44				g.chr2:179438185G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67751C>T	chr2.hg19:g.179438185G>A	ENSP00000465570:p.Pro22584Leu	1					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P21657L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P15160L|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P24225L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P15352L|TTN_ENST00000359218.5_Missense_Mutation_p.P15285L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.P22584L			1	2	3	2.468950	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	67975	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.67751C>T		0	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804563	0.50315	0.0	3.63E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	6.08	6.08	0.98989	6.080000	6.080000	0.989890	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84656	0.5520	H	0.95402	3.665	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.87855	0.2660	9	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	rs55992239	15160;15285;15352;22584	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	21657;15160;15352;15285;15158	ENSP00000343764:P21657L;ENSP00000434586:P15160L;ENSP00000340554:P15352L;ENSP00000352154:P15285L	ENSP00000340554:P15352L	P	-	2	0	0	TTN	179146431	179146431	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	2.894000	0.99253	0.655000	0.94253	CCG	0.703727		TCGA-HV-AA8X-01A-11D-A397-08	0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	54	0	54	54	1	1.930000	-2.303879	0	0.630000	NM_133378		0	5	5	0	477	468	0		1			0	0	54	0	0	0.934700	0	0	0	0	0	0	5	477
TTN	7273	broad.mit.edu	37	2	179635138	179635138	+	Splice_Site	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:179635138C>T	ENST00000591111.1	-	35	8605		c.e35+1		TTN_ENST00000342175.6_Splice_Site|TTN_ENST00000360870.5_Splice_Site|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Splice_Site|TTN_ENST00000460472.2_Splice_Site|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000589042.1_Splice_Site|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Splice_Site			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCAACTTACTCTCCACGTG	0.433																																						ENST00000591111.1	1.000000	5.000000e-02	0.250000	0.080000	0.120000	0.263749	0.120000	0.110000																										0				1448						c.e35+1		titin							70.0	69.0	69.0					2																	179635138		2203	4300	6503	SO:0001630	splice_region_variant	7273	0	0					g.chr2:179635138C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.8380+1G>A	chr2.hg19:g.179635138C>T		1					TTN_ENST00000360870.5_Splice_Site|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Splice_Site|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Splice_Site|TTN_ENST00000589042.1_Splice_Site|TTN_ENST00000342175.6_Splice_Site|TTN_ENST00000359218.5_Splice_Site|TTN-AS1_ENST00000584485.1_RNA				1	2	3	2.468950	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	35	8605	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	ENST00000591111.1	1	1	hg19			0	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080897	0.76528	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	6.06	6.06	0.98353	6.060000	6.060000	0.983530	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6282	0.99521	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	TTN	179343383	179343383	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	7.814000	0.86154	2.871000	0.98454	0.655000	0.94253	.	0.703727		TCGA-HV-AA8X-01A-11D-A397-08	0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	62	0	62	62	1	1.930000	-11.311390	1	0.630000	NM_133378	Intron	0	11	11	0	364	363	0		1		0	0	0	62	0	0	0.998367	0	0	0	0	0	1	11	364
SOX11	6664	broad.mit.edu	37	2	5833606	5833606	+	Silent	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:5833606G>A	ENST00000322002.3	+	1	808	c.753G>A	c.(751-753)ccG>ccA	p.P251P	AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA|AC108025.2_ENST00000420221.1_RNA|AC010729.1_ENST00000455579.2_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	251					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		AGGAACCACCGCACCAGCAGC	0.657																																						ENST00000322002.3	1.000000	4.600000e-01	1.000000	0.630000	0.840000	0.823198	0.840000	1.000000																										0				13						c.(751-753)ccG>ccA		SRY (sex determining region Y)-box 11							11.0	10.0	10.0					2																	5833606		2070	4101	6171	SO:0001819	synonymous_variant	6664	0	0					g.chr2:5833606G>A		CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.753G>A	chr2.hg19:g.5833606G>A		0					AC010729.1_ENST00000455579.2_RNA|AC108025.2_ENST00000420221.1_RNA|AC108025.2_ENST00000453678.1_RNA|AC107057.2_ENST00000458264.1_RNA	p.P251P	NM_003108.3	NP_003099.1	0	0	0	2.039820	P35716	SOX11_HUMAN		1	808	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		Q4ZFV8	Silent	SNP	ENST00000322002.3	0	1	hg19	c.753G>A	CCDS1654.1	0																																																																																								0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.657	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206698.1	1	0	1	2	2	2	2	0	0	0	0	10	0	10	10	1	1.930000	-19.987300	1	0.630000	NM_003108		0	10	9	0	28	28	0		1	0		0	0	10	0	0	0.997875	8.048780e-02	0	0	0	2	0	10	28
C2orf71	388939	broad.mit.edu	37	2	29296840	29296840	+	Silent	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:29296840G>A	ENST00000331664.5	-	1	287	c.288C>T	c.(286-288)acC>acT	p.T96T		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	96					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						AAGAGGTTTTGGTTCCTGGGA	0.483																																						ENST00000331664.5	1.000000	8.900000e-01	1.000000	0.940000	0.990000	0.982143	0.990000	1.000000																										0				60						c.(286-288)acC>acT		chromosome 2 open reading frame 71							250.0	234.0	239.0					2																	29296840		1943	4137	6080	SO:0001819	synonymous_variant	388939	0	0					g.chr2:29296840G>A		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.288C>T	chr2.hg19:g.29296840G>A		0						p.T96T	NM_001029883.2	NP_001025054.1	0	0	0	2.039820	A6NGG8	CB071_HUMAN		1	287	-				Silent	SNP	ENST00000331664.5	1	1	hg19	c.288C>T	CCDS42669.1	1																																																																																								0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.483	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	1	0	1	2	2	2	2	0	0	0	0	123	0	123	123	1	1.930000	-14.444490	1	0.630000	NM_001029883		0	184	183	0	392	390	1		1	0		0	0	123	0	0	1.000000	0	0	0	0	1	0	184	392
VWA3B	200403	broad.mit.edu	37	2	98928694	98928694	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:98928694G>A	ENST00000477737.1	+	28	3971	c.3767G>A	c.(3766-3768)cGt>cAt	p.R1256H	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1256										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GCGGCCGGGCGTCTAGGACTC	0.607																																						ENST00000477737.1	1.000000	9.800000e-01	1.000000	0.990000	0.990000	0.998782	0.990000	1.000000																										0				70						c.(3766-3768)cGt>cAt		von Willebrand factor A domain containing 3B							48.0	57.0	54.0					2																	98928694		2088	4216	6304	SO:0001583	missense	200403	0	0					g.chr2:98928694G>A	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3767G>A	chr2.hg19:g.98928694G>A	ENSP00000417955:p.Arg1256His	0					VWA3B_ENST00000490947.2_3'UTR	p.R1256H	NM_144992.4	NP_659429.4	0	0	0	2.039820	Q502W6	VWA3B_HUMAN		28	3971	+			B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	1	1	hg19	c.3767G>A	CCDS42718.1	1	.	.	.	.	.	.	.	.	.	.	G	9.632	1.136653	0.21123	.	.	ENSG00000168658	ENST00000477737;ENST00000473149;ENST00000358269	T	0.07216	3.21	4.09	-2.35	0.06684	4.090000	-2.350000	0.066840	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.09310	N	1	B	0.21452	0.056	B	0.13407	0.009	T	0.41466	-0.9507	9	0.39692	T	0.17	.	1.1526	0.01789	0.3414:0.1436:0.3684:0.1466	.	1256	Q502W6	VWA3B_HUMAN	H	1256;722;378	ENSP00000417955:R1256H	ENSP00000351009:R378H	R	+	2	0	0	VWA3B	98295126	98295126	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.062000	0.11674	-0.480000	0.06803	-1.121000	0.02013	CGT	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.607	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	1	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	1.930000	-20.000000	1	0.630000	NM_144992		0	69	69	0	112	111	1		1	0		0	0	46	0	0	1.000000	0	0	0	0	1	0	69	112
FN1	2335	broad.mit.edu	37	2	216274779	216274779	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr2:216274779G>A	ENST00000359671.1	-	14	2265	c.2000C>T	c.(1999-2001)aCc>aTc	p.T667I	FN1_ENST00000336916.4_Missense_Mutation_p.T667I|FN1_ENST00000346544.3_Missense_Mutation_p.T667I|FN1_ENST00000357009.2_Missense_Mutation_p.T667I|FN1_ENST00000421182.1_Missense_Mutation_p.T667I|FN1_ENST00000345488.5_Missense_Mutation_p.T667I|FN1_ENST00000357867.4_Missense_Mutation_p.T667I|FN1_ENST00000446046.1_Missense_Mutation_p.T667I|FN1_ENST00000443816.1_Missense_Mutation_p.T667I|FN1_ENST00000356005.4_Missense_Mutation_p.T667I|FN1_ENST00000354785.4_Missense_Mutation_p.T667I|FN1_ENST00000323926.6_Missense_Mutation_p.T667I|FN1_ENST00000432072.2_Missense_Mutation_p.T667I			P02751	FINC_HUMAN	fibronectin 1	667	Fibronectin type-III 1.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GCCTTTGATGGTGTAGGAGTT	0.488																																						ENST00000359671.1	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																									FN1/ALK(2)	0				109						c.(1999-2001)aCc>aTc		fibronectin 1	Ocriplasmin(DB08888)						180.0	171.0	174.0					2																	216274779		2203	4300	6503	SO:0001583	missense	2335	0	0					g.chr2:216274779G>A		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2000C>T	chr2.hg19:g.216274779G>A	ENSP00000352696:p.Thr667Ile	1					FN1_ENST00000357867.4_Missense_Mutation_p.T667I|FN1_ENST00000345488.5_Missense_Mutation_p.T667I|FN1_ENST00000336916.4_Missense_Mutation_p.T667I|FN1_ENST00000432072.2_Missense_Mutation_p.T667I|FN1_ENST00000446046.1_Missense_Mutation_p.T667I|FN1_ENST00000357009.2_Missense_Mutation_p.T667I|FN1_ENST00000346544.3_Missense_Mutation_p.T667I|FN1_ENST00000356005.4_Missense_Mutation_p.T667I|FN1_ENST00000323926.6_Missense_Mutation_p.T667I|FN1_ENST00000421182.1_Missense_Mutation_p.T667I|FN1_ENST00000443816.1_Missense_Mutation_p.T667I|FN1_ENST00000354785.4_Missense_Mutation_p.T667I	p.T667I			1	2	3	2.468950	P02751	FINC_HUMAN		14	2265	-		Renal(323;0.127)	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	1	1	hg19	c.2000C>T		1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187476	0.78789	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15	5.65	2.88	0.33553	5.650000	2.880000	0.335530	.	0.312951	0.30969	N	0.008503	T	0.67711	0.2922	L	0.55990	1.75	0.80722	D	1	D;D;P;P;P;D;D;P;P;D	0.89917	1.0;0.999;0.85;0.894;0.913;1.0;1.0;0.894;0.894;1.0	D;D;P;P;P;D;D;P;P;D	0.91635	0.999;0.995;0.521;0.701;0.711;0.989;0.999;0.701;0.701;0.999	T	0.65429	-0.6170	10	0.41790	T	0.15	.	10.4784	0.44678	0.2083:0.0:0.7917:0.0	.	667;667;667;667;667;667;667;667;667;667	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	I	667	ENSP00000394423:T667I;ENSP00000323534:T667I;ENSP00000338200:T667I;ENSP00000350534:T667I;ENSP00000346839:T667I;ENSP00000352696:T667I;ENSP00000265312:T667I;ENSP00000273049:T667I;ENSP00000349509:T667I;ENSP00000410422:T667I;ENSP00000415018:T667I;ENSP00000399538:T667I;ENSP00000348285:T667I	ENSP00000265313:T667I	T	-	2	0	0	FN1	215983024	215983024	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	5.754000	0.68743	0.870000	0.35726	0.655000	0.94253	ACC	0.703727		TCGA-HV-AA8X-01A-11D-A397-08	0.488	FN1-204	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	31	0	31	31	1	1.930000	-20.000000	1	0.630000	NM_212476		0	107	106	0	103	102	0		1	0		0	0	31	0	0	1.000000	1	0	0	0	180	0	107	103
CAND2	23066	broad.mit.edu	37	3	12856671	12856671	+	Silent	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr3:12856671C>T	ENST00000456430.2	+	8	1079	c.1038C>T	c.(1036-1038)gaC>gaT	p.D346D	CAND2_ENST00000295989.5_Silent_p.D253D	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	346	Poly-Asp.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						ATGACGATGACATGAGCTGGA	0.617																																					GBM(43;676 868 1633 6395 37496)	ENST00000456430.2	1.000000	8.000000e-01	0.990000	0.880000	0.940000	0.937121	0.940000	0.990000																										0				37						c.(1036-1038)gaC>gaT		cullin-associated and neddylation-dissociated 2 (putative)							60.0	67.0	65.0					3																	12856671		2156	4255	6411	SO:0001819	synonymous_variant	23066	0	0					g.chr3:12856671C>T		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1038C>T	chr3.hg19:g.12856671C>T		1					CAND2_ENST00000295989.5_Silent_p.D253D	p.D346D	NM_001162499.1	NP_001155971.1	0	1	1	1.411057	O75155	CAND2_HUMAN		8	1079	+			B9EGM9|E9KL24	Silent	SNP	ENST00000456430.2	1	1	hg19	c.1038C>T	CCDS54554.1	1																																																																																								0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.617	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	1	0	1	2	2	2	2	0	0	0	0	50	0	50	50	1	1.930000	-20.000000	1	0.630000	XM_371617		0	66	65	0	74	74	1		1	0		0	0	50	0	0	1.000000	2.243672e-01	0	0	0	2	0	66	74
NEK10	152110	broad.mit.edu	37	3	27385769	27385769	+	Missense_Mutation	SNP	A	A	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr3:27385769A>T	ENST00000429845.2	-	6	718	c.356T>A	c.(355-357)aTa>aAa	p.I119K	NEK10_ENST00000341435.5_Missense_Mutation_p.I119K			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	119					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TTACCTGCTTATGAGTCTATT	0.368																																						ENST00000429845.2	1.000000	8.000000e-01	0.990000	0.870000	0.940000	0.935054	0.940000	0.990000																										0				41						c.(355-357)aTa>aAa		NIMA-related kinase 10							96.0	80.0	85.0					3																	27385769		1566	3579	5145	SO:0001583	missense	152110	0	0					g.chr3:27385769A>T	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.356T>A	chr3.hg19:g.27385769A>T	ENSP00000395849:p.Ile119Lys	1					NEK10_ENST00000341435.5_Missense_Mutation_p.I119K	p.I119K			0	1	1	1.411057	Q6ZWH5	NEK10_HUMAN		6	718	-			A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	1	1	hg19	c.356T>A		1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.516764	0.44763	.	.	ENSG00000163491	ENST00000341435;ENST00000396636;ENST00000435750	T;T	0.69806	-0.43;1.43	5.77	4.6	0.57074	5.770000	4.600000	0.570740	.	0.321330	0.34362	N	0.004032	T	0.43322	0.1242	N	0.08118	0	0.80722	D	1	B	0.27068	0.167	B	0.23275	0.045	T	0.39165	-0.9627	10	0.59425	D	0.04	.	7.8361	0.29371	0.7204:0.1429:0.0:0.1367	.	119	Q6ZWH5	NEK10_HUMAN	K	119	ENSP00000343847:I119K;ENSP00000395338:I119K	ENSP00000343847:I119K	I	-	2	0	0	NEK10	27360773	27360773	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.392000	0.34486	1.093000	0.41377	0.533000	0.62120	ATA	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.368	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	1	0	1	2	2	2	2	0	0	0	0	24	0	24	24	1	1.930000	-20.000000	1	0.630000	NM_152534		0	61	61	0	68	67	1		1			0	0	24	0	0	1.000000	0	0	0	0	0	0	61	68
STAB1	23166	broad.mit.edu	37	3	52554552	52554552	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr3:52554552G>A	ENST00000321725.6	+	53	5712	c.5636G>A	c.(5635-5637)cGg>cAg	p.R1879Q		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1879					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TTTGAGACCCGGCCCCTGCGA	0.652																																						ENST00000321725.6	0.970000	6.400000e-01	0.910000	0.720000	0.820000	0.823216	0.820000	0.830000																										0				76						c.(5635-5637)cGg>cAg		stabilin 1							45.0	44.0	44.0					3																	52554552		2202	4300	6502	SO:0001583	missense	23166	1	121274	32				g.chr3:52554552G>A	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5636G>A	chr3.hg19:g.52554552G>A	ENSP00000312946:p.Arg1879Gln	1						p.R1879Q	NM_015136.2	NP_055951.2	0	1	1	1.411057	Q9NY15	STAB1_HUMAN		53	5712	+			A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	1	1	hg19	c.5636G>A	CCDS33768.1	0	.	.	.	.	.	.	.	.	.	.	G	7.127	0.579134	0.13686	.	.	ENSG00000010327	ENST00000321725	D	0.84442	-1.85	5.58	-3.3	0.05003	5.580000	-3.300000	0.050030	.	0.623306	0.16047	N	0.232123	T	0.56863	0.2014	N	0.03608	-0.345	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.48603	-0.9021	10	0.25751	T	0.34	.	1.1024	0.01687	0.4049:0.1113:0.1451:0.3386	.	1879	Q9NY15	STAB1_HUMAN	Q	1879	ENSP00000312946:R1879Q	ENSP00000312946:R1879Q	R	+	2	0	0	STAB1	52529592	52529592	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	0.111000	0.15458	-0.269000	0.09298	-0.136000	0.14681	CGG	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.652	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	1	0	1	2	2	2	2	0	0	0	0	31	0	31	30	1	1.930000	-20.000000	1	0.630000	NM_015136		0	45	43	0	72	72	1		1	0		0	0	31	0	0	1.000000	9.376665e-01	0	0	0	10	0	45	72
GPR171	29909	broad.mit.edu	37	3	150916417	150916417	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr3:150916417C>T	ENST00000309180.5	-	3	987	c.757G>A	c.(757-759)Gtc>Atc	p.V253I	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_013308.3	NP_037440.3	O14626	GP171_HUMAN	G protein-coupled receptor 171	253					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(4)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	15			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCAGTTATGACTTCTGTCTGG	0.458																																						ENST00000309180.5	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.063813	0.050000	0.060000																										0				15						c.(757-759)Gtc>Atc		G protein-coupled receptor 171							112.0	110.0	110.0					3																	150916417		2203	4300	6503	SO:0001583	missense	29909	0	0					g.chr3:150916417C>T	AF002986	CCDS3155.1	3q25.1	2012-08-21			ENSG00000174946	ENSG00000174946		"""GPCR / Class A : Orphans"""	30057	protein-coding gene	gene with protein product	"""platelet activating receptor homolog"""					9370294	Standard	NM_013308		Approved	H963	uc003eyq.4	O14626	OTTHUMG00000159861	ENST00000309180.5:c.757G>A	chr3.hg19:g.150916417C>T	ENSP00000308479:p.Val253Ile	0					MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	p.V253I	NM_013308.3	NP_037440.3	0	1	1	2.037829	O14626	GP171_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)	3	987	-			D3DNJ4|Q8IV06	Missense_Mutation	SNP	ENST00000309180.5	0	1	hg19	c.757G>A	CCDS3155.1	0	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016594	0.35606	.	.	ENSG00000174946	ENST00000309180	T	0.20738	2.05	5.61	2.71	0.32032	5.610000	2.710000	0.320320	GPCR, rhodopsin-like superfamily (1);	0.245951	0.32028	N	0.006693	T	0.12944	0.0314	L	0.33485	1.01	0.31077	N	0.712308	B	0.10296	0.003	B	0.13407	0.009	T	0.22730	-1.0208	10	0.19147	T	0.46	-10.4765	6.008	0.19557	0.2855:0.5747:0.0:0.1398	.	253	O14626	GP171_HUMAN	I	253	ENSP00000308479:V253I	ENSP00000308479:V253I	V	-	1	0	0	GPR171	152399107	152399107	0.035000	0.19736	0.207000	0.23584	0.987000	0.75469	0.419000	0.21247	0.241000	0.21283	0.650000	0.86243	GTC	0.628831		TCGA-HV-AA8X-01A-11D-A397-08	0.458	GPR171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357793.1	0	0	1	2	2	2	2	0	0	0	0	46	0	46	46	1	1.930000	-5.252497	1	0.630000	NM_013308		0	4	4	0	241	240	0		1	0		0	0	46	0	0	0.890149	4.897479e-04	0	0	0	2	0	4	241
DMXL1	1657	broad.mit.edu	37	5	118484750	118484750	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr5:118484750G>T	ENST00000311085.8	+	18	3308	c.3228G>T	c.(3226-3228)atG>atT	p.M1076I	DMXL1_ENST00000539542.1_Missense_Mutation_p.M1076I	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1076										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ACTTTGTGATGCATGTAAGTA	0.413																																						ENST00000311085.8	0.610000	3.800000e-01	0.550000	0.430000	0.490000	0.497850	0.490000	0.490000																										0				86						c.(3226-3228)atG>atT		Dmx-like 1							156.0	158.0	158.0					5																	118484750		2202	4300	6502	SO:0001583	missense	1657	0	0					g.chr5:118484750G>T	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3228G>T	chr5.hg19:g.118484750G>T	ENSP00000309690:p.Met1076Ile	0					DMXL1_ENST00000539542.1_Missense_Mutation_p.M1076I	p.M1076I	NM_005509.4	NP_005500.4	0	0	0	2.049633	Q9Y485	DMXL1_HUMAN		18	3308	+		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		Missense_Mutation	SNP	ENST00000311085.8	1	1	hg19	c.3228G>T	CCDS4125.1	0	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339688	0.41398	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.30182	1.54;1.54	5.65	5.65	0.86999	5.650000	5.650000	0.869990	.	0.039008	0.85682	D	0.000000	T	0.31949	0.0813	L	0.42581	1.335	0.51012	D	0.999902	B;B	0.21821	0.061;0.021	B;B	0.19946	0.027;0.012	T	0.03278	-1.1053	10	0.41790	T	0.15	-15.3466	20.0965	0.97849	0.0:0.0:1.0:0.0	.	1076;1076	F5H269;Q9Y485	.;DMXL1_HUMAN	I	1076	ENSP00000309690:M1076I;ENSP00000439479:M1076I	ENSP00000309690:M1076I	M	+	3	0	0	DMXL1	118512649	118512649	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.545000	0.60698	2.824000	0.97209	0.655000	0.94253	ATG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.413	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	1	0	1	2	2	2	2	0	0	0	0	78	0	78	78	1	1.930000	-20.000000	1	0.630000	NM_005509		0	59	59	0	321	317	1		1	0		0	0	78	0	0	1.000000	2.501606e-02	0	0	0	2	0	59	321
ADAMTS16	170690	broad.mit.edu	37	5	5303758	5303758	+	Missense_Mutation	SNP	C	C	T	rs550504360		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr5:5303758C>T	ENST00000274181.7	+	20	3203	c.3065C>T	c.(3064-3066)gCg>gTg	p.A1022V		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1022	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCGGCCAGAGCGCAGCTGCTG	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17388	0.0		0.0	False		,,,				2504	0.001					ENST00000274181.7	0.210000	3.000000e-02	0.150000	0.060000	0.090000	0.110077	0.090000	0.100000																										0				107						c.(3064-3066)gCg>gTg		ADAM metallopeptidase with thrombospondin type 1 motif, 16							42.0	51.0	48.0					5																	5303758		2155	4269	6424	SO:0001583	missense	170690	3	121168	34				g.chr5:5303758C>T	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3065C>T	chr5.hg19:g.5303758C>T	ENSP00000274181:p.Ala1022Val	0						p.A1022V	NM_139056.2	NP_620687.2	1	2	3	2.058374	Q8TE57	ATS16_HUMAN		20	3203	+			C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	0	1	hg19	c.3065C>T	CCDS43299.1	0	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580800	0.28180	.	.	ENSG00000145536	ENST00000274181	T	0.55234	0.53	4.79	4.79	0.61399	4.790000	4.790000	0.613990	.	0.128592	0.52532	D	0.000076	T	0.43211	0.1237	L	0.33753	1.03	0.32102	N	0.590414	B;B	0.25719	0.132;0.101	B;B	0.23716	0.048;0.03	T	0.51671	-0.8676	10	0.36615	T	0.2	.	15.7068	0.77588	0.0:1.0:0.0:0.0	.	1022;1022	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	V	1022	ENSP00000274181:A1022V	ENSP00000274181:A1022V	A	+	2	0	0	ADAMTS16	5356758	5356758	0.630000	0.27155	0.040000	0.18447	0.026000	0.11368	3.024000	0.49674	2.359000	0.80004	0.650000	0.86243	GCG	0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.627	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	0	0	1	2	2	2	2	0	0	0	0	34	0	34	34	1	1.930000	-3.703256	1	0.630000	NM_139056		0	5	5	0	166	162	0		1	0		0	0	34	0	0	0.934529	0	0	0	0	1	0	5	166
CCNO	10309	broad.mit.edu	37	5	54527370	54527370	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr5:54527370G>A	ENST00000282572.4	-	3	1042	c.886C>T	c.(886-888)Cgg>Tgg	p.R296W	RP11-506H20.1_ENST00000506435.1_RNA	NM_021147.3	NP_066970.3	P22674	CCNO_HUMAN	cyclin O	296					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cell cycle (GO:0007049)|cell division (GO:0051301)|cilium assembly (GO:0042384)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)|embryo development (GO:0009790)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	uracil DNA N-glycosylase activity (GO:0004844)			endometrium(1)|lung(3)|skin(1)	5		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)			CGCGAGACCCGCAGCATGCGG	0.667																																						ENST00000282572.4	1.000000	6.500000e-01	0.970000	0.750000	0.850000	0.855491	0.850000	1.000000																										0				5						c.(886-888)Cgg>Tgg		cyclin O							34.0	36.0	35.0					5																	54527370		2203	4299	6502	SO:0001583	missense	10309	0	0					g.chr5:54527370G>A	M87499	CCDS34157.1	5q11.2	2010-11-15	2007-07-26	2007-07-26	ENSG00000152669	ENSG00000152669			18576	protein-coding gene	gene with protein product		607752	"""cyclin U"""	CCNU			Standard	NR_125346		Approved	UDG2, FLJ22422, UNG2	uc003jpw.3	P22674	OTTHUMG00000162598	ENST00000282572.4:c.886C>T	chr5.hg19:g.54527370G>A	ENSP00000282572:p.Arg296Trp	0					RP11-506H20.1_ENST00000506435.1_RNA	p.R296W	NM_021147.3	NP_066970.3	1	2	3	2.058374	P22674	CCNO_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)	3	1042	-		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	A8K1W5|Q0P6J2|Q9H6B0|Q9UMD5	Missense_Mutation	SNP	ENST00000282572.4	1	1	hg19	c.886C>T	CCDS34157.1	1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.540955	0.45280	.	.	ENSG00000152669	ENST00000282572	T	0.44881	0.91	5.61	-1.39	0.08997	5.610000	-1.390000	0.089970	Cyclin, C-terminal (1);Cyclin-like (3);	1.557100	0.03904	N	0.280760	T	0.30823	0.0777	N	0.14661	0.345	0.09310	N	1	D	0.58620	0.983	P	0.47376	0.545	T	0.28004	-1.0057	10	0.72032	D	0.01	.	5.1563	0.15036	0.0643:0.1857:0.3444:0.4056	.	296	P22674	CCNO_HUMAN	W	296	ENSP00000282572:R296W	ENSP00000282572:R296W	R	-	1	2	2	CCNO	54563127	54563127	0.030000	0.19436	0.006000	0.13384	0.430000	0.31655	0.723000	0.25939	0.006000	0.14734	-0.500000	0.04577	CGG	0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.667	CCNO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369707.1	1	0	1	2	2	2	2	0	0	0	0	31	0	31	31	1	1.930000	-20.000000	1	0.630000	NM_021147		0	47	47	0	128	124	1		1	1		0	0	31	0	0	1.000000	9.999363e-01	0	20	0	24	0	47	128
ZFYVE16	9765	broad.mit.edu	37	5	79745505	79745505	+	Missense_Mutation	SNP	C	C	G			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr5:79745505C>G	ENST00000338008.5	+	8	3379	c.3199C>G	c.(3199-3201)Cta>Gta	p.L1067V	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.L1067V|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.L1067V	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1067					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		AAATGCTAATCTACTCGTGAA	0.323																																					Melanoma(150;1452 1854 16018 17851 37292)	ENST00000338008.5	0.970000	7.000000e-01	0.910000	0.760000	0.830000	0.842133	0.830000	0.840000																										0				51						c.(3199-3201)Cta>Gta		zinc finger, FYVE domain containing 16							137.0	126.0	130.0					5																	79745505		2202	4299	6501	SO:0001583	missense	9765	0	0					g.chr5:79745505C>G	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.3199C>G	chr5.hg19:g.79745505C>G	ENSP00000337159:p.Leu1067Val	0					ZFYVE16_ENST00000505560.1_Missense_Mutation_p.L1067V|ZFYVE16_ENST00000510158.1_Missense_Mutation_p.L1067V	p.L1067V	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	0	0	0	2.049633	Q7Z3T8	ZFY16_HUMAN		8	3379	+		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	1	1	hg19	c.3199C>G	CCDS4050.1	0	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352893	0.61293	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.66280	-0.2;-0.2;-0.2	5.91	5.91	0.95273	5.910000	5.910000	0.952730	.	0.000000	0.49305	D	0.000142	T	0.75057	0.3798	M	0.71036	2.16	0.49687	D	0.999811	D	0.65815	0.995	D	0.64144	0.922	T	0.77099	-0.2713	10	0.87932	D	0	-8.6405	11.5991	0.50993	0.0:0.8886:0.0:0.1114	.	1067	Q7Z3T8	ZFY16_HUMAN	V	1067	ENSP00000337159:L1067V;ENSP00000423663:L1067V;ENSP00000426848:L1067V	ENSP00000337159:L1067V	L	+	1	2	2	ZFYVE16	79781261	79781261	1.000000	0.71417	0.991000	0.47740	0.459000	0.32528	3.339000	0.52135	2.804000	0.96469	0.650000	0.86243	CTA	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.323	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	1	0	1	2	2	2	2	0	0	0	0	72	0	72	72	1	1.930000	-20.000000	1	0.630000	NM_014733		0	113	113	0	314	312	1		1	1		0	0	72	0	0	1.000000	8.936050e-01	0	7	0	6	0	113	314
NR2F1	7025	broad.mit.edu	37	5	92924048	92924048	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr5:92924048G>A	ENST00000327111.3	+	2	2576	c.889G>A	c.(889-891)Gac>Aac	p.D297N	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	297					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		GGCCTTCATGGACCACATCCG	0.657																																						ENST00000327111.3	0.640000	3.800000e-01	0.580000	0.430000	0.500000	0.512377	0.500000	0.500000																										0				21						c.(889-891)Gac>Aac		nuclear receptor subfamily 2, group F, member 1							40.0	40.0	40.0					5																	92924048		2202	4300	6502	SO:0001583	missense	7025	0	0					g.chr5:92924048G>A	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.889G>A	chr5.hg19:g.92924048G>A	ENSP00000325819:p.Asp297Asn	0					NR2F1-AS1_ENST00000513055.1_RNA	p.D297N	NM_005654.4	NP_005645.1	0	0	0	2.049633	P10589	COT1_HUMAN		2	2576	+		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		Missense_Mutation	SNP	ENST00000327111.3	1	1	hg19	c.889G>A	CCDS4068.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.521082	0.96416	.	.	ENSG00000175745	ENST00000327111	D	0.96967	-4.19	4.3	4.3	0.51218	4.300000	4.300000	0.512180	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.170267	0.49305	D	0.000157	D	0.97486	0.9177	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.98117	1.0423	10	0.62326	D	0.03	.	16.543	0.84407	0.0:0.0:1.0:0.0	.	297	P10589	COT1_HUMAN	N	297	ENSP00000325819:D297N	ENSP00000325819:D297N	D	+	1	0	0	NR2F1	92949804	92949804	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.535000	0.98064	2.205000	0.71048	0.313000	0.20887	GAC	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.657	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	1	0	1	2	2	2	2	0	0	0	0	56	0	56	55	1	1.930000	-20.000000	1	0.630000	NM_005654		0	48	48	0	253	249	1		1	0		0	0	56	0	0	1.000000	9.794424e-01	0	0	0	35	0	48	253
PCDHGA3	56112	broad.mit.edu	37	5	140725536	140725536	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr5:140725536G>A	ENST00000253812.6	+	1	1936	c.1936G>A	c.(1936-1938)Gtc>Atc	p.V646I	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	646	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.			V -> I (in Ref. 1; AAD43717). {ECO:0000305}.	homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGTGGCCGTCCAGGACCA	0.711																																						ENST00000253812.6	0.260000	1.000000e-01	0.220000	0.130000	0.170000	0.180057	0.170000	0.180000																										0				1						c.(1936-1938)Gtc>Atc		protocadherin gamma subfamily A, 3							13.0	21.0	19.0					5																	140725536		2150	4266	6416	SO:0001583	missense	56112	22	119154	35				g.chr5:140725536G>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1936G>A	chr5.hg19:g.140725536G>A	ENSP00000253812:p.Val646Ile	0					PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	p.V646I	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	0	0	0	2.049633	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1936	+			Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	0	1	hg19	c.1936G>A	CCDS47290.1	0	.	.	.	.	.	.	.	.	.	.	.	19.31	3.802551	0.70682	.	.	ENSG00000254245	ENST00000253812	T	0.61510	0.1	5.12	5.12	0.69794	5.120000	5.120000	0.697940	Cadherin (4);Cadherin-like (1);	0.000000	0.30329	U	0.009862	T	0.69566	0.3125	M	0.85462	2.755	0.30617	N	0.75885	D;P	0.53619	0.961;0.861	P;P	0.51324	0.666;0.458	T	0.75789	-0.3194	10	0.72032	D	0.01	.	12.0577	0.53544	0.0807:0.0:0.9193:0.0	.	646;646	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	I	646	ENSP00000253812:V646I	ENSP00000253812:V646I	V	+	1	0	0	PCDHGA3	140705720	140705720	1.000000	0.71417	0.978000	0.43139	0.998000	0.95712	5.628000	0.67791	2.566000	0.86566	0.558000	0.71614	GTC	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.711	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	0	0	0	2	7	2	2	0	0	0	1	73	0	73	87	1	1.930000	-19.982850	1	0.630000	NM_018916		0	19	7	0	331	115	0		1			0	0	73	0	0	0.524334	0	0	0	0	0	0	19	331
BEND3	57673	broad.mit.edu	37	6	107391144	107391144	+	Silent	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr6:107391144C>T	ENST00000369042.1	-	4	1441	c.1251G>A	c.(1249-1251)cgG>cgA	p.R417R	BEND3_ENST00000429433.2_Silent_p.R417R			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	417	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CGGGGAAGAGCCGGTGGAGGA	0.632																																						ENST00000369042.1	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.061701	0.050000	0.050000																										0				30						c.(1249-1251)cgG>cgA		BEN domain containing 3							49.0	53.0	52.0					6																	107391144		2203	4300	6503	SO:0001819	synonymous_variant	57673	0	0					g.chr6:107391144C>T	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.1251G>A	chr6.hg19:g.107391144C>T		1					BEND3_ENST00000429433.2_Silent_p.R417R	p.R417R			0	1	1	1.402712	Q5T5X7	BEND3_HUMAN		4	1441	-			A2RRH2|Q9HCL9	Silent	SNP	ENST00000369042.1	0	1	hg19	c.1251G>A	CCDS34507.1	0																																																																																								0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.632	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	0	0	0	2	2	2	2	0	0	0	0	53	0	53	52	1	1.930000	-5.850452	1	0.630000	NM_020913		0	4	4	0	169	167	0		1			0	0	53	0	0	0.888569	0	0	0	0	0	0	4	169
VPS52	6293	broad.mit.edu	37	6	33234430	33234430	+	Silent	SNP	G	G	A	rs571192587|rs184438144		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr6:33234430G>A	ENST00000445902.2	-	12	1403	c.1185C>T	c.(1183-1185)cgC>cgT	p.R395R	VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000436044.2_Silent_p.R270R|VPS52_ENST00000478934.1_5'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	395					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						AAAGGTATTCGCGGCAGGAAT	0.512																																						ENST00000445902.2	0.180000	4.000000e-02	0.140000	0.060000	0.090000	0.106619	0.090000	0.100000																										0				28						c.(1183-1185)cgC>cgT		vacuolar protein sorting 52 homolog (S. cerevisiae)							72.0	73.0	73.0					6																	33234430		1511	2709	4220	SO:0001819	synonymous_variant	6293	3	118000	32				g.chr6:33234430G>A	AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1185C>T	chr6.hg19:g.33234430G>A		0					VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000436044.2_Silent_p.R270R|VPS52_ENST00000482399.1_3'UTR	p.R395R	NM_022553.4	NP_072047.4	0	0	0	2.008919	Q8N1B4	VPS52_HUMAN		12	1403	-			A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Silent	SNP	ENST00000445902.2	1	1	hg19	c.1185C>T	CCDS4770.2	0																																																																																								0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.512	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	0	0	1	2	2	2	2	0	0	0	0	52	0	52	50	1	1.930000	-3.482629	1	0.630000	NM_022553		0	8	8	0	254	247	0		1	1		0	0	52	0	0	0.988467	8.124794e-01	0	6	0	94	0	8	254
UBR2	23304	broad.mit.edu	37	6	42571440	42571440	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr6:42571440G>A	ENST00000372899.1	+	5	904	c.646G>A	c.(646-648)Gca>Aca	p.A216T	UBR2_ENST00000372901.1_Missense_Mutation_p.A216T|UBR2_ENST00000372903.2_Missense_Mutation_p.A216T	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	216					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A216T(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGAATTGCCAGCAGATTTAGA	0.313																																						ENST00000372899.1	1.000000	7.800000e-01	1.000000	0.850000	0.920000	0.927897	0.920000	1.000000																										1	Substitution - Missense(1)	p.A216T(1)	pancreas(1)	64						c.(646-648)Gca>Aca		ubiquitin protein ligase E3 component n-recognin 2							116.0	123.0	121.0					6																	42571440		2203	4297	6500	SO:0001583	missense	23304	0	0					g.chr6:42571440G>A	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.646G>A	chr6.hg19:g.42571440G>A	ENSP00000361990:p.Ala216Thr	0					UBR2_ENST00000372903.2_Missense_Mutation_p.A216T|UBR2_ENST00000372901.1_Missense_Mutation_p.A216T	p.A216T	NM_015255.2	NP_056070.1	0	0	0	2.008919	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)	5	904	+	Colorectal(47;0.196)		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	1	1	hg19	c.646G>A	CCDS4870.1	1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928522	0.34002	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.73469	-0.75;0.21;0.21	5.58	1.67	0.24075	5.580000	1.670000	0.240750	.	0.829390	0.10744	N	0.639102	T	0.30166	0.0756	N	0.08118	0	0.80722	D	1	B;B	0.15473	0.004;0.013	B;B	0.25506	0.007;0.061	T	0.25187	-1.0139	10	0.12430	T	0.62	-7.2156	6.1466	0.20289	0.0821:0.3568:0.4611:0.1	.	216;216	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	T	216	ENSP00000361994:A216T;ENSP00000361990:A216T;ENSP00000361992:A216T	ENSP00000361990:A216T	A	+	1	0	0	UBR2	42679418	42679418	0.996000	0.38824	0.998000	0.56505	0.988000	0.76386	0.427000	0.21379	0.728000	0.32382	0.650000	0.86243	GCA	0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.313	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	1	0	1	2	2	2	2	0	0	0	0	76	0	76	76	1	1.930000	-20.000000	1	0.630000	NM_015255		0	110	110	0	259	257	1		1	1		0	0	76	0	0	1.000000	9.096810e-01	0	7	0	5	0	110	259
MEP1A	4224	broad.mit.edu	37	6	46761185	46761185	+	Missense_Mutation	SNP	C	C	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr6:46761185C>T	ENST00000230588.4	+	1	59	c.50C>T	c.(49-51)gCc>gTc	p.A17V		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	17					digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A17V(1)		NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			TTGCTTTTTGCCCACATAGCA	0.348																																						ENST00000230588.4	0.070000	0	0.050000	0.010000	0.020000	0.034290	0.020000	0.030000																										1	Substitution - Missense(1)	p.A17V(1)	lung(1)	42						c.(49-51)gCc>gTc		meprin A, alpha (PABA peptide hydrolase)							218.0	199.0	205.0					6																	46761185		2203	4300	6503	SO:0001583	missense	4224	0	0					g.chr6:46761185C>T		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.50C>T	chr6.hg19:g.46761185C>T	ENSP00000230588:p.Ala17Val	0						p.A17V	NM_005588.2	NP_005579.2	0	0	0	2.008919	Q16819	MEP1A_HUMAN	Lung(136;0.192)	1	59	+			A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	0	1	hg19	c.50C>T	CCDS4918.1	0	.	.	.	.	.	.	.	.	.	.	C	3.305	-0.142020	0.06669	.	.	ENSG00000112818	ENST00000230588	T	0.24151	1.87	5.21	-0.00269	0.14028	5.210000	-0.002690	0.140280	.	0.705821	0.14141	N	0.338738	T	0.04272	0.0118	N	0.25890	0.77	0.09310	N	0.999995	B;B	0.12013	0.004;0.005	B;B	0.10450	0.005;0.002	T	0.45673	-0.9245	10	0.11794	T	0.64	-3.8338	7.5808	0.27963	0.0:0.4834:0.0:0.5166	.	17;17	B7ZL91;Q16819	.;MEP1A_HUMAN	V	17	ENSP00000230588:A17V	ENSP00000230588:A17V	A	+	2	0	0	MEP1A	46869144	46869144	0.004000	0.15560	0.783000	0.31826	0.135000	0.20990	-0.290000	0.08354	-0.016000	0.14127	0.655000	0.94253	GCC	0.625279		TCGA-HV-AA8X-01A-11D-A397-08	0.348	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	0	0	1	2	2	2	2	0	0	0	0	101	0	101	101	1	1.930000	-1.636543	0	0.630000	NM_005588		0	5	5	0	531	526	0		1			0	0	101	0	0	0.936260	0	0	0	0	0	0	5	531
TMEM200A	114801	broad.mit.edu	37	6	130761706	130761706	+	Missense_Mutation	SNP	G	G	T			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr6:130761706G>T	ENST00000296978.3	+	3	1010	c.139G>T	c.(139-141)Gat>Tat	p.D47Y	TMEM200A_ENST00000545622.1_Missense_Mutation_p.D47Y|TMEM200A_ENST00000392429.1_Missense_Mutation_p.D47Y	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	47						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GCCCCGGGCAGATGTTGTGGT	0.507																																						ENST00000296978.3	1.000000	9.000000e-01	1.000000	0.940000	0.970000	0.972677	0.970000	0.990000																										0				52						c.(139-141)Gat>Tat		transmembrane protein 200A							123.0	126.0	125.0					6																	130761706		2203	4300	6503	SO:0001583	missense	114801	0	0					g.chr6:130761706G>T	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.139G>T	chr6.hg19:g.130761706G>T	ENSP00000296978:p.Asp47Tyr	1					TMEM200A_ENST00000392429.1_Missense_Mutation_p.D47Y|TMEM200A_ENST00000545622.1_Missense_Mutation_p.D47Y	p.D47Y	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	0	1	1	1.402712	Q86VY9	T200A_HUMAN		3	1010	+			Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	1	1	hg19	c.139G>T	CCDS5140.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935617	0.73442	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.6	5.6	0.85130	5.600000	5.600000	0.851300	.	0.000000	0.85682	D	0.000000	T	0.75620	0.3874	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77446	-0.2585	9	0.87932	D	0	.	19.6088	0.95594	0.0:0.0:1.0:0.0	.	47	Q86VY9	T200A_HUMAN	Y	47	.	ENSP00000296978:D47Y	D	+	1	0	0	TMEM200A	130803399	130803399	1.000000	0.71417	0.657000	0.29651	0.908000	0.53690	9.668000	0.98619	2.623000	0.88846	0.650000	0.86243	GAT	0.459854		TCGA-HV-AA8X-01A-11D-A397-08	0.507	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	1	0	1	2	2	2	2	0	0	0	0	76	0	76	75	1	1.930000	-20.000000	1	0.630000	NM_052913		0	155	151	0	160	157	1		1	0		0	0	76	0	0	1.000000	9.986552e-01	0	0	0	14	0	155	160
TSPAN12	23554	broad.mit.edu	37	7	120478922	120478922	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr7:120478922G>A	ENST00000222747.3	-	4	801	c.194C>T	c.(193-195)cCg>cTg	p.P65L	TSPAN12_ENST00000415871.1_Missense_Mutation_p.P65L	NM_012338.3	NP_036470.1	O95859	TSN12_HUMAN	tetraspanin 12	65					angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|regulation of angiogenesis (GO:0045765)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.P65Q(1)		endometrium(3)|kidney(1)|lung(4)|ovary(1)|skin(1)	10	all_neural(327;0.117)					AATCATGACCGGATGAACCAC	0.373																																						ENST00000222747.3	0.080000	0	0.060000	0.010000	0.030000	0.040245	0.030000	0.040000																										1	Substitution - Missense(1)	p.P65Q(1)	lung(1)	10						c.(193-195)cCg>cTg		tetraspanin 12							162.0	153.0	156.0					7																	120478922		2203	4300	6503	SO:0001583	missense	23554	0	0					g.chr7:120478922G>A	AF124522	CCDS5777.1	7q31.31	2013-02-14	2005-03-21	2005-03-21	ENSG00000106025	ENSG00000106025		"""Tetraspanins"""	21641	protein-coding gene	gene with protein product		613138	"""transmembrane 4 superfamily member 12"""	TM4SF12			Standard	NM_012338		Approved	NET-2	uc003vjk.3	O95859	OTTHUMG00000156980	ENST00000222747.3:c.194C>T	chr7.hg19:g.120478922G>A	ENSP00000222747:p.Pro65Leu	0					TSPAN12_ENST00000415871.1_Missense_Mutation_p.P65L	p.P65L	NM_012338.3	NP_036470.1	1	2	3	2.053747	O95859	TSN12_HUMAN		4	801	-	all_neural(327;0.117)		A4D0V8|B4DRG6|Q549U9|Q8N5Y0	Missense_Mutation	SNP	ENST00000222747.3	0	1	hg19	c.194C>T	CCDS5777.1	0	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127309	0.77549	.	.	ENSG00000106025	ENST00000222747;ENST00000415871;ENST00000441017;ENST00000433758;ENST00000424710;ENST00000430985	T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	5.99	5.99	0.97316	5.990000	5.990000	0.973160	.	0.052782	0.85682	D	0.000000	T	0.70500	0.3231	L	0.45581	1.43	0.80722	D	1	B	0.32829	0.386	B	0.32465	0.146	T	0.65047	-0.6263	10	0.21540	T	0.41	-14.5881	20.5371	0.99232	0.0:0.0:1.0:0.0	.	65	O95859	TSN12_HUMAN	L	65	ENSP00000222747:P65L;ENSP00000397699:P65L;ENSP00000411158:P65L;ENSP00000399059:P65L;ENSP00000404942:P65L;ENSP00000388819:P65L	ENSP00000222747:P65L	P	-	2	0	0	TSPAN12	120266158	120266158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.398000	0.90195	2.857000	0.98124	0.650000	0.86243	CCG	0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.373	TSPAN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346951.1	0	0	1	2	2	2	2	0	0	0	0	89	0	89	88	1	1.930000	-1.800648	0	0.630000	NM_012338		0	6	6	0	541	539	0		1	0		0	0	89	0	0	0.964745	3.449631e-02	0	0	0	22	0	6	541
ASB15	142685	broad.mit.edu	37	7	123269120	123269120	+	Missense_Mutation	SNP	G	G	A	rs370081452	byFrequency	TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr7:123269120G>A	ENST00000451558.1	+	12	1593	c.1072G>A	c.(1072-1074)Gtt>Att	p.V358I	ASB15_ENST00000275699.3_Missense_Mutation_p.V358I|ASB15_ENST00000434204.1_Missense_Mutation_p.V358I|ASB15_ENST00000451215.1_Missense_Mutation_p.V358I|ASB15_ENST00000540573.1_Missense_Mutation_p.V358I			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	358					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.V358I(1)		breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						GTATTTTGGCGTTTCTAATAA	0.458													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		21776	0.0		0.0	False		,,,				2504	0.0					ENST00000451558.1	1.000000	7.200000e-01	0.960000	0.790000	0.870000	0.877417	0.870000	1.000000																										1	Substitution - Missense(1)	p.V358I(1)	endometrium(1)	12						c.(1072-1074)Gtt>Att		ankyrin repeat and SOCS box containing 15		G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	153.0	138.0	143.0		1072	5.3	0.9	7		143	0,8600		0,0,4300	no	missense	ASB15	NM_080928.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	358/589	123269120	1,13005	2203	4300	6503	SO:0001583	missense	142685	4	121412	40				g.chr7:123269120G>A	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1072G>A	chr7.hg19:g.123269120G>A	ENSP00000397655:p.Val358Ile	0					ASB15_ENST00000275699.3_Missense_Mutation_p.V358I|ASB15_ENST00000451215.1_Missense_Mutation_p.V358I|ASB15_ENST00000434204.1_Missense_Mutation_p.V358I|ASB15_ENST00000540573.1_Missense_Mutation_p.V358I	p.V358I			1	2	3	2.053747	Q8WXK1	ASB15_HUMAN		12	1593	+			Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	1	1	hg19	c.1072G>A	CCDS34742.1	1	.	.	.	.	.	.	.	.	.	.	g	24.4	4.523476	0.85600	2.27E-4	0.0	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000542545;ENST00000275699	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	6.17	5.3	0.74995	6.170000	5.300000	0.749950	Ankyrin repeat-containing domain (4);	0.082444	0.50627	N	0.000109	T	0.73001	0.3531	L	0.45137	1.4	0.58432	D	0.999998	D	0.89917	1.0	D	0.73380	0.98	T	0.75938	-0.3141	10	0.72032	D	0.01	.	15.8585	0.79005	0.0644:0.0:0.9356:0.0	.	358	Q8WXK1	ASB15_HUMAN	I	358;358;358;358;147;358	ENSP00000397655:V358I;ENSP00000390963:V358I;ENSP00000416433:V358I;ENSP00000438643:V358I;ENSP00000275699:V358I	ENSP00000275699:V358I	V	+	1	0	0	ASB15	123056356	123056356	1.000000	0.71417	0.950000	0.38849	0.882000	0.50991	7.633000	0.83260	1.644000	0.50603	-0.119000	0.15052	GTT	0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.458	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1	1	0	1	2	2	2	2	0	0	0	0	65	0	65	63	1	1.930000	-6.701459	1	0.630000			0	95	94	0	250	249	1		1			0	0	65	0	0	1.000000	0	0	0	0	0	0	95	250
HOXA5	3202	broad.mit.edu	37	7	27182747	27182747	+	Silent	SNP	C	C	T	rs202017218		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr7:27182747C>T	ENST00000222726.3	-	1	540	c.480G>A	c.(478-480)gcG>gcA	p.A160A	RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA5_ENST00000520854.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|HOXA6_ENST00000521478.1_5'Flank|HOXA3_ENST00000521401.1_5'Flank	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	160					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A160A(2)		central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						TCTGCGCACTCGCCTGCTCGC	0.692													C|||	1	0.000199681	0.0008	0.0	5008	,	,		10202	0.0		0.0	False		,,,				2504	0.0				Colon(119;75 2200 7557 42868)	ENST00000222726.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999564	0.990000	1.000000																										2	Substitution - coding silent(2)	p.A160A(2)	lung(2)	16						c.(478-480)gcG>gcA		homeobox A5							57.0	70.0	65.0					7																	27182747		2199	4295	6494	SO:0001819	synonymous_variant	3202	1	120976	27				g.chr7:27182747C>T		CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.480G>A	chr7.hg19:g.27182747C>T		0					HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000521197.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000521401.1_5'Flank|HOXA5_ENST00000520854.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA	p.A160A	NM_019102.3	NP_061975.2	1	2	3	2.053747	P20719	HXA5_HUMAN		1	540	-			A4D179|O43367|Q96CY6	Silent	SNP	ENST00000222726.3	1	1	hg19	c.480G>A	CCDS5406.1	1																																																																																								0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.692	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1	1	0	1	2	2	2	2	0	0	0	0	117	0	117	111	1	1.930000	-19.540590	1	0.630000			0	188	184	0	339	328	0		1	0		0	0	117	0	0	1.000000	2.921013e-01	0	0	0	3	0	188	339
SSPO	23145	broad.mit.edu	37	7	149516508	149516508	+	RNA	SNP	C	C	T	rs376818048		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr7:149516508C>T	ENST00000378016.2	+	0	11911							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCGCCGCCTGCGGGCATACCG	0.706																																						ENST00000378016.2	0.720000	2.900000e-01	0.580000	0.370000	0.470000	0.486957	0.470000	0.460000																										0												SCO-spondin		C		0,3896		0,0,1948	14.0	19.0	17.0		11925	3.2	1.0	7		17	11,8233		0,11,4111	no	coding-notMod3	SSPO	NM_198455.2		0,11,6059	TT,TC,CC		0.1334,0.0,0.0906			149516508	11,12129	1948	4122	6070			23145	57	120318	45				g.chr7:149516508C>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149516508C>T		0									1	2	3	2.083494	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)	0	11911	+	Melanoma(164;0.165)|Ovarian(565;0.177)		Q76B61	RNA	SNP	ENST00000378016.2	0	1	hg19			0																																																																																								0.632316		TCGA-HV-AA8X-01A-11D-A397-08	0.706	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript		0	0	1	2	2	2	2	0	0	0	0	30	0	30	29	1	1.930000	-4.090216	1	0.630000			0	19	19	0	111	105	0		1			0	0	30	0	0	0.999991	0	0	0	0	0	0	19	111
MAPK15	225689	broad.mit.edu	37	8	144804265	144804265	+	Silent	SNP	G	G	A	rs369868387	byFrequency	TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chr8:144804265G>A	ENST00000338033.4	+	14	1598	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P		NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	493					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGCTTCCTCCGGAGGCCCGGC	0.652													g|||	2	0.000399361	0.0	0.0	5008	,	,		11717	0.0		0.0	False		,,,				2504	0.002					ENST00000338033.4	1.000000	8.900000e-01	1.000000	0.950000	0.990000	0.985667	0.990000	1.000000																										0				12						c.(1477-1479)ccG>ccA		mitogen-activated protein kinase 15		G		1,3737		0,1,1868	57.0	65.0	63.0		1479	-0.7	0.0	8		63	1,8163		0,1,4081	no	coding-synonymous	MAPK15	NM_139021.2		0,2,5949	AA,AG,GG		0.0122,0.0268,0.0168		493/545	144804265	2,11900	1869	4082	5951	SO:0001819	synonymous_variant	225689	11	120794	45				g.chr8:144804265G>A	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1479G>A	chr8.hg19:g.144804265G>A		0						p.P493P	NM_139021.2	NP_620590.2	1	2	3	2.057093	Q8TD08	MK15_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)	14	1598	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q2TCF9|Q8N362	Silent	SNP	ENST00000338033.4	1	1	hg19	c.1479G>A	CCDS6409.2	1																																																																																								0.631162		TCGA-HV-AA8X-01A-11D-A397-08	0.652	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1	1	0	1	2	2	2	2	0	0	0	0	89	0	89	86	1	1.930000	-12.365830	1	0.630000	NM_139021		0	144	139	0	300	298	0		1	1		0	0	89	0	0	1.000000	1	0	25	0	30	0	144	300
DCAF12L2	340578	broad.mit.edu	37	X	125299404	125299404	+	Silent	SNP	G	G	A	rs200451403		TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chrX:125299404G>A	ENST00000360028.2	-	1	530	c.504C>T	c.(502-504)ggC>ggT	p.G168G	DCAF12L2_ENST00000538699.1_Silent_p.G168G			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	168										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TGGGGTTTTCGCCGCCGGTGG	0.672													G|||	8	0.00211921	0.0053	0.0	3775	,	,		10935	0.001		0.0	False		,,,				2504	0.0					ENST00000360028.2	1.000000	6.900000e-01	0.930000	0.760000	0.840000	0.847277	0.840000	0.840000																										0				64						c.(502-504)ggC>ggT		DDB1 and CUL4 associated factor 12-like 2		G		18,3817		0,14,4,1618,567	62.0	69.0	67.0		504	-7.2	0.0	X		67	0,6728		0,0,0,2428,1872	no	coding-synonymous	DCAF12L2	NM_001013628.2		0,14,4,4046,2439	AA,AG,A,GG,G		0.0,0.4694,0.1704		168/464	125299404	18,10545	2203	4300	6503	SO:0001819	synonymous_variant	340578	47	121400	49				g.chrX:125299404G>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.504C>T	chrX.hg19:g.125299404G>A							DCAF12L2_ENST00000538699.1_Silent_p.G168G	p.G168G			0	1	1		Q5VW00	DC122_HUMAN		1	530	-			B2RN42	Silent	SNP	ENST00000360028.2	1	1	hg19	c.504C>T	CCDS43991.1	0																																																																																								0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.672	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	1	0	1	2	2	2	2	0	0	0	0	58	0	58	57	1	1.930000	-3.222832	1	0.630000	NM_001013628		0	82	77	0	226	219	1		1			0	0	58	0	0	1.000000	0	0	0	0	0	0	82	226
DCAF12L1	139170	broad.mit.edu	37	X	125686253	125686253	+	Silent	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chrX:125686253G>A	ENST00000371126.1	-	1	581	c.339C>T	c.(337-339)tgC>tgT	p.C113C		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	113										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						ACTTGGTGCCGCACACCACCT	0.637																																						ENST00000371126.1	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.063747	0.050000	0.060000																										0				68						c.(337-339)tgC>tgT		DDB1 and CUL4 associated factor 12-like 1							112.0	85.0	94.0					X																	125686253		2203	4300	6503	SO:0001819	synonymous_variant	139170	0	0					g.chrX:125686253G>A	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.339C>T	chrX.hg19:g.125686253G>A								p.C113C	NM_178470.4	NP_848565.2	0	1	1		Q5VU92	DC121_HUMAN		1	581	-			Q8IYK3	Silent	SNP	ENST00000371126.1	0	1	hg19	c.339C>T	CCDS14610.1	0																																																																																								0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.637	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	0	0	1	2	2	2	2	0	0	0	0	61	0	61	60	1	1.930000	-2.516897	1	0.630000	NM_178470		0	5	5	0	291	290	0		1			0	0	61	0	0	0.937504	0	0	0	0	0	0	5	291
BRWD3	254065	broad.mit.edu	37	X	79985487	79985487	+	Missense_Mutation	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chrX:79985487G>A	ENST00000373275.4	-	13	1376	c.1160C>T	c.(1159-1161)aCg>aTg	p.T387M		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	387					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AATTCTTGCCGTTCCATCTCG	0.299																																						ENST00000373275.4	0.190000	3.000000e-02	0.140000	0.050000	0.090000	0.104876	0.090000	0.090000																										0				87						c.(1159-1161)aCg>aTg		bromodomain and WD repeat domain containing 3							157.0	132.0	140.0					X																	79985487		2203	4299	6502	SO:0001583	missense	254065	0	0					g.chrX:79985487G>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1160C>T	chrX.hg19:g.79985487G>A	ENSP00000362372:p.Thr387Met							p.T387M	NM_153252.4	NP_694984	0	1	1		Q6RI45	BRWD3_HUMAN		13	1376	-			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	0	1	hg19	c.1160C>T	CCDS14447.1	0	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237206	0.79800	.	.	ENSG00000165288	ENST00000373275	T	0.69561	-0.41	4.37	4.37	0.52481	4.370000	4.370000	0.524810	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82655	0.5084	M	0.83953	2.67	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.85220	0.1026	9	.	.	.	-2.364	16.3826	0.83473	0.0:0.0:1.0:0.0	.	387	Q6RI45	BRWD3_HUMAN	M	387	ENSP00000362372:T387M	.	T	-	2	0	0	BRWD3	79872143	79872143	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.207000	0.77899	2.035000	0.60131	0.513000	0.50165	ACG	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.299	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	0	0	1	2	2	2	2	0	0	0	0	29	0	29	29	1	1.930000	-2.940823	1	0.630000	NM_153252		0	5	5	0	174	173	0		1	0		0	0	29	0	0	0.937510	1.274968e-03	0	0	0	2	0	5	174
GDI1	2664	broad.mit.edu	37	X	153665646	153665646	+	Splice_Site	SNP	G	G	A			TCGA-HV-AA8X-01A-11D-A397-08	TCGA-HV-AA8X-10A-01D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7182fcdb-756e-4594-b1db-a47c8efe035e	37f4dcba-087f-4744-994d-8921693c6c9e	g.chrX:153665646G>A	ENST00000447750.2	+	1	380		c.e1+1			NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1						negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGTCTCACCGTAAGTGCGGC	0.697																																						ENST00000447750.2	0.200000	2.000000e-02	0.140000	0.050000	0.090000	0.101985	0.090000	0.080000																										0				16						c.e1+1		GDP dissociation inhibitor 1							68.0	45.0	53.0					X																	153665646		2201	4300	6501	SO:0001630	splice_region_variant	2664	0	0					g.chrX:153665646G>A	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.45+1G>A	chrX.hg19:g.153665646G>A									NM_001493.2	NP_001484.1	0	1	1		P31150	GDIA_HUMAN		1	380	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Splice_Site	SNP	ENST00000447750.2	0	1	hg19		CCDS35452.1	0	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469539	0.43839	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	.	.	.	3.71	3.71	0.42584	3.710000	3.710000	0.425840	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1083	0.53825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	GDI1	153318840	153318840	1.000000	0.71417	0.982000	0.44146	0.236000	0.25371	8.579000	0.90781	1.690000	0.51089	0.284000	0.19432	.	0.630000		TCGA-HV-AA8X-01A-11D-A397-08	0.697	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081649.2	0	0	0	2	2	2	2	0	0	0	0	28	0	28	28	1	1.930000	-6.268873	1	0.630000	NM_001493	Intron	0	4	2	0	149	149	0		1			0	0	28	0	0	0.888297	0	0	0	0	0	0	4	149
