#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SORCS3	22986	broad.mit.edu	37	10	106924113	106924113	+	Silent	SNP	C	C	T	rs547019749		TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr10:106924113C>T	ENST00000369701.3	+	12	2012	c.1785C>T	c.(1783-1785)tcC>tcT	p.S595S		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	595					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCATCTCCTCCGATGGGGGCA	0.433													c|||	1	0.000199681	0.0	0.0	5008	,	,		18208	0.001		0.0	False		,,,				2504	0.0				NSCLC(116;1497 1690 7108 13108 14106)	ENST00000369701.3	1.000000	0.030000	0.160000	0.060000	0.100000	0.148218	0.100000	0.100000																										0				131						c.(1783-1785)tcC>tcT		sortilin-related VPS10 domain containing receptor 3							105.0	95.0	98.0					10																	106924113		2203	4300	6503	SO:0001819	synonymous_variant	22986	23	121406	44				g.chr10:106924113C>T	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1785C>T	chr10.hg19:g.106924113C>T		0						p.S595S	NM_014978.1	NP_055793.1	1	2	3	2.086066	Q9UPU3	SORC3_HUMAN		12	2012	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	Q5VXF9|Q9NQJ2	Silent	SNP	ENST00000369701.3	1	1	hg19	c.1785C>T	CCDS7558.1	0																																																																																								0.405941		TCGA-HZ-7919-01A-11D-2154-08	0.433	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	0	0	1		2	2	2	0		0	0	35		35	35	1	1.870000	-2.949334	1	0.400000	NM_014978			6	6		299	294	0		1			0	0	35	0		0.963558	0	0	0	0	0	0	6	299
INPP5F	22876	broad.mit.edu	37	10	121510593	121510593	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr10:121510593G>A	ENST00000361976.2	+	2	269	c.103G>A	c.(103-105)Gat>Aat	p.D35N	INPP5F_ENST00000369083.3_Missense_Mutation_p.D35N	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TTTAGCTACTGATCTACTTCT	0.328											OREG0020583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000361976.2	1.000000	0.980000	1.000000	0.990000	0.990000	0.998857	0.990000	1.000000																										0				42						c.(103-105)Gat>Aat		inositol polyphosphate-5-phosphatase F							188.0	173.0	178.0					10																	121510593		2203	4300	6503	SO:0001583	missense	22876	0	0					g.chr10:121510593G>A	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.103G>A	chr10.hg19:g.121510593G>A	ENSP00000354519:p.Asp35Asn	0		OREG0020583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1512	INPP5F_ENST00000369083.3_Missense_Mutation_p.D35N	p.D35N	NM_014937.3	NP_055752.1	1	2	3	2.086066	Q01968	OCRL_HUMAN		2	269	+		Lung NSC(174;0.109)|all_lung(145;0.142)	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	1	1	hg19	c.103G>A	CCDS7616.1	1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.981610	0.93044	.	.	ENSG00000198825	ENST00000361976;ENST00000369083	T;T	0.58797	0.81;0.31	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.74520	0.3727	L	0.59436	1.845	0.80722	D	1	D;D	0.67145	0.988;0.996	P;D	0.79784	0.815;0.993	T	0.73395	-0.3996	10	0.59425	D	0.04	-30.4133	19.4436	0.94836	0.0:0.0:1.0:0.0	.	35;35	Q9Y2H2;Q9Y2H2-3	SAC2_HUMAN;.	N	35	ENSP00000354519:D35N;ENSP00000358079:D35N	ENSP00000354519:D35N	D	+	1	0	0	INPP5F	121500583	121500583	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	7.483000	0.81158	2.894000	0.99253	0.591000	0.81541	GAT	0.405941		TCGA-HZ-7919-01A-11D-2154-08	0.328	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	1	0	1		2	2	2	0		0	0	52		52	52	1	1.870000	-20.000000	1	0.400000	NM_014937			80	80		253	252	1		1	1		0	0	52	0		1.000000	8.804175e-01	0	2	0	12	0	80	253
ZPR1	8882	broad.mit.edu	37	11	116652933	116652933	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr11:116652933C>T	ENST00000227322.3	-	12	1179	c.1120G>A	c.(1120-1122)Gac>Aac	p.D374N		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		374					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		TTGGAACTGTCGCCCAGTGTG	0.458																																						ENST00000227322.3	0.240000	0.050000	0.170000	0.080000	0.120000	0.137433	0.120000	0.120000																										0				9						c.(1120-1122)Gac>Aac									116.0	99.0	105.0					11																	116652933		2201	4296	6497	SO:0001583	missense	0	0	0					g.chr11:116652933C>T																												ENST00000227322.3:c.1120G>A	chr11.hg19:g.116652933C>T	ENSP00000227322:p.Asp374Asn	0						p.D374N	NM_003904.3	NP_003895.1	1	2	3	2.075745	O75312	ZPR1_HUMAN		12	1179	-	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)	Q2TAA0	Missense_Mutation	SNP	ENST00000227322.3	0	1	hg19	c.1120G>A	CCDS8375.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.735372|5.735372	0.96865|0.96865	.|.	.|.	ENSG00000109917|ENSG00000109917	ENST00000227322|ENST00000429220	T|.	0.44881|.	0.91|.	6.02|6.02	6.02|6.02	0.97574|0.97574	6.02|6.02	6.02|6.02	0.97574|0.97574	Zinc finger, ZPR1-type (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88343|0.88343	0.6411|0.6411	H|H	0.95780|0.95780	3.72|3.72	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.90566|0.90566	0.4519|0.4519	10|5	0.72032|.	D|.	0.01|.	-35.8364|-35.8364	20.5407|20.5407	0.99260|0.99260	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	374|.	O75312|.	ZPR1_HUMAN|.	N|Q	374|300	ENSP00000227322:D374N|.	ENSP00000227322:D374N|.	D|R	-|-	1|2	0|0	0|0	ZNF259|ZNF259	116158143|116158143	116158143|116158143	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.861000|0.861000	0.49209|0.49209	6.708000|6.708000	0.74660|0.74660	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GAC|CGA	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.458	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106283.2	0	0	1		2	2	2	0		0	0	39		39	39	1	1.870000	-2.637301	1	0.400000				8	8		339	336	0		1	1		0	0	39	0		0.989196	9.106167e-01	0	8	0	175	0	8	339
SIDT2	51092	broad.mit.edu	37	11	117058103	117058103	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr11:117058103G>C	ENST00000324225.4	+	11	1556	c.1025G>C	c.(1024-1026)cGa>cCa	p.R342P	SIDT2_ENST00000431081.2_Missense_Mutation_p.R346P	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	342					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		GGTCACCCTCGAGTCCTGGCT	0.522																																						ENST00000324225.4	1.000000	0.760000	0.990000	0.820000	0.900000	0.905483	0.900000	1.000000																										0				36						c.(1024-1026)cGa>cCa		SID1 transmembrane family, member 2							179.0	136.0	151.0					11																	117058103		2201	4296	6497	SO:0001583	missense	51092	0	0					g.chr11:117058103G>C	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1025G>C	chr11.hg19:g.117058103G>C	ENSP00000314023:p.Arg342Pro	0					SIDT2_ENST00000431081.2_Missense_Mutation_p.R346P	p.R342P	NM_001040455.1	NP_001035545.1	1	2	3	2.075745	Q8NBJ9	SIDT2_HUMAN		11	1556	+	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	1	1	hg19	c.1025G>C	CCDS31682.1	1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250742	0.39797	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.18810	2.19;2.22;2.21	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.308789	0.32473	N	0.006059	T	0.14830	0.0358	N	0.03154	-0.405	0.34842	D	0.740825	B;P;B;P	0.40032	0.416;0.699;0.324;0.471	B;B;P;P	0.48488	0.443;0.224;0.482;0.579	T	0.28364	-1.0046	10	0.33940	T	0.23	-23.5708	12.0315	0.53399	0.0826:0.0:0.9174:0.0	.	342;346;342;342	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	P	342;342;346	ENSP00000314023:R342P;ENSP00000278951:R342P;ENSP00000399635:R346P	ENSP00000278951:R342P	R	+	2	0	0	SIDT2	116563313	116563313	0.924000	0.31332	1.000000	0.80357	0.972000	0.66771	4.485000	0.60279	2.576000	0.86940	0.561000	0.74099	CGA	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.522	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	1	0	1		2	2	2	0		0	0	92		92	91	1	1.870000	-2.972818	1	0.400000	NM_015996			117	116		531	526	1		1	1		0	0	92	0		1.000000	9.975743e-01	0	6	0	37	0	117	531
TCP11L1	55346	broad.mit.edu	37	11	33094069	33094069	+	Silent	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr11:33094069G>A	ENST00000334274.4	+	10	1777	c.1377G>A	c.(1375-1377)caG>caA	p.Q459Q	TCP11L1_ENST00000432887.1_Silent_p.Q459Q|TCP11L1_ENST00000324357.9_Silent_p.Q238Q|TCP11L1_ENST00000531632.2_Silent_p.Q459Q	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	459						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						CGGGTCATCAGAAGCCATTGC	0.463																																						ENST00000334274.4	1.000000	0.780000	0.970000	0.840000	0.890000	0.904446	0.890000	1.000000																										0				6						c.(1375-1377)caG>caA		t-complex 11, testis-specific-like 1							152.0	146.0	148.0					11																	33094069		2202	4298	6500	SO:0001819	synonymous_variant	55346	0	0					g.chr11:33094069G>A	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.1377G>A	chr11.hg19:g.33094069G>A		0					TCP11L1_ENST00000531632.2_Silent_p.Q459Q|TCP11L1_ENST00000432887.1_Silent_p.Q459Q|TCP11L1_ENST00000324357.9_Silent_p.Q238Q	p.Q459Q	NM_018393.3	NP_060863.3	1	2	3	2.075745	Q9NUJ3	T11L1_HUMAN		10	1777	+			D3DR01|Q8IVX4	Silent	SNP	ENST00000334274.4	1	1	hg19	c.1377G>A	CCDS7882.1	1	.	.	.	.	.	.	.	.	.	.	G	8.692	0.907562	0.17833	.	.	ENSG00000176148	ENST00000528962	.	.	.	5.41	5.41	0.78517	5.41	5.41	0.78517	.	.	.	.	.	T	0.70919	0.3279	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69383	-0.5160	4	.	.	.	-34.9109	14.752	0.69533	0.0:0.1444:0.8556:0.0	.	.	.	.	K	75	.	.	E	+	1	0	0	TCP11L1	33050645	33050645	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.822000	0.48073	2.530000	0.85305	0.313000	0.20887	GAA	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.463	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	1	0	1		2	2	2	0		0	0	109		109	107	1	1.870000	-20.000000	1	0.400000	NM_018393			192	191		875	870	1		1	1		0	0	109	0		1.000000	9.967641e-01	0	16	0	25	0	192	875
OR5T3	390154	broad.mit.edu	37	11	56019769	56019769	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr11:56019769C>T	ENST00000303059.3	+	1	94	c.94C>T	c.(94-96)Cca>Tca	p.P32S		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					ATACAGGAATCCACTGAAGAA	0.358																																						ENST00000303059.3	1.000000	0.920000	1.000000	0.990000	0.990000	0.995244	0.990000	1.000000																										0				39						c.(94-96)Cca>Tca		olfactory receptor, family 5, subfamily T, member 3							98.0	96.0	96.0					11																	56019769		2201	4296	6497	SO:0001583	missense	390154	0	0					g.chr11:56019769C>T	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.94C>T	chr11.hg19:g.56019769C>T	ENSP00000305403:p.Pro32Ser	0						p.P32S	NM_001004747.1	NP_001004747.1	1	2	3	2.075745	Q8NGG3	OR5T3_HUMAN		1	94	+	Esophageal squamous(21;0.00448)		Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	1	1	hg19	c.94C>T	CCDS31524.1	1	.	.	.	.	.	.	.	.	.	.	C	0.416	-0.910669	0.02434	.	.	ENSG00000172489	ENST00000303059	T	0.02197	4.4	4.23	-0.0294	0.13918	4.23	-0.0294	0.13918	.	4.020620	0.00871	U	0.002031	T	0.01222	0.0040	N	0.04705	-0.18	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.41893	-0.9483	10	0.07990	T	0.79	.	2.0557	0.03581	0.156:0.4868:0.1525:0.2047	.	32	Q8NGG3	OR5T3_HUMAN	S	32	ENSP00000305403:P32S	ENSP00000305403:P32S	P	+	1	0	0	OR5T3	55776345	55776345	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.396000	0.07278	0.131000	0.18576	-0.366000	0.07423	CCA	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.358	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	1	0	1		2	2	2	0		0	0	49		49	48	1	1.870000	-4.205829	1	0.400000	NM_001004747			89	89		307	305	1		1			0	0	49	0		1.000000	0	0	0	0	0	0	89	307
ESAM	90952	broad.mit.edu	37	11	124626110	124626110	+	Silent	SNP	T	T	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr11:124626110T>C	ENST00000278927.5	-	4	729	c.600A>G	c.(598-600)ccA>ccG	p.P200P	RP11-677M14.3_ENST00000504932.2_RNA|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	200	Ig-like C2-type.				blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		CACCTAATGCTGGTGCAAAGA	0.562																																						ENST00000278927.5	1.000000	0.960000	1.000000	0.990000	0.990000	0.997660	0.990000	1.000000																										0				16						c.(598-600)ccA>ccG		endothelial cell adhesion molecule							58.0	51.0	54.0					11																	124626110		2201	4299	6500	SO:0001819	synonymous_variant	90952	0	0					g.chr11:124626110T>C	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.600A>G	chr11.hg19:g.124626110T>C		0					RP11-677M14.3_ENST00000504932.2_RNA|ESAM_ENST00000442070.2_Intron	p.P200P	NM_138961.2	NP_620411.2	1	2	3	2.075745	Q96AP7	ESAM_HUMAN		4	729	-	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	B4DVN8|Q96T50	Silent	SNP	ENST00000278927.5	1	1	hg19	c.600A>G	CCDS8453.1	1																																																																																								0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.562	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	1	0	1		2	2	2	0		0	0	31		31	31	1	1.870000	-20.000000	1	0.400000	NM_138961			53	53		162	162	1		1	1		0	0	31	0		1.000000	1	0	10	0	98	0	53	162
KCNA5	3741	broad.mit.edu	37	12	5155075	5155075	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr12:5155075G>A	ENST00000252321.3	+	1	1991	c.1762G>A	c.(1762-1764)Gtc>Atc	p.V588I		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	588					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GAAGTGTAACGTCAAGGCCAA	0.592																																						ENST00000252321.3	1.000000	0.690000	0.980000	0.780000	0.880000	0.884370	0.880000	1.000000																										0				52						c.(1762-1764)Gtc>Atc		potassium voltage-gated channel, shaker-related subfamily, member 5	Dalfampridine(DB06637)						39.0	39.0	39.0					12																	5155075		2203	4300	6503	SO:0001583	missense	3741	0	0					g.chr12:5155075G>A	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1762G>A	chr12.hg19:g.5155075G>A	ENSP00000252321:p.Val588Ile	1						p.V588I	NM_002234.3	NP_002225.2	0	1	1	1.673073	P22460	KCNA5_HUMAN		1	1991	+			Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	1	1	hg19	c.1762G>A	CCDS8536.1	1	.	.	.	.	.	.	.	.	.	.	G	7.036	0.561517	0.13498	.	.	ENSG00000130037	ENST00000252321	D	0.97279	-4.32	5.5	3.64	0.41730	5.5	3.64	0.41730	.	0.104471	0.38492	U	0.001664	D	0.87665	0.6234	N	0.01352	-0.895	0.21445	N	0.999687	B	0.06786	0.001	B	0.04013	0.001	T	0.78513	-0.2175	10	0.24483	T	0.36	.	9.733	0.40372	0.2849:0.5814:0.1337:0.0	.	588	P22460	KCNA5_HUMAN	I	588	ENSP00000252321:V588I	ENSP00000252321:V588I	V	+	1	0	0	KCNA5	5025336	5025336	0.990000	0.36364	1.000000	0.80357	0.936000	0.57629	0.640000	0.24705	0.668000	0.31126	-0.311000	0.09066	GTC	0.257426		TCGA-HZ-7919-01A-11D-2154-08	0.592	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	1	0	1		2	2	2	0		0	0	33		33	33	1	1.870000	-20.000000	1	0.400000	NM_002234			48	48		163	161	1		1	0		0	0	33	0		1.000000	8.830963e-01	0	0	0	15	0	48	163
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999996	0.990000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	2	3	2.514875	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.500000		TCGA-HZ-7919-01A-11D-2154-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	14		14	14	1	1.870000	-20.000000	1	0.400000	NM_033360			36	36		82	81	1		1	1	1	0	0	14	402		1.000000	9.999963e-01	1	26	182	25	495	36	82
KRT4	3851	broad.mit.edu	37	12	53202606	53202606	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr12:53202606C>G	ENST00000551956.1	-	5	1355	c.863G>C	c.(862-864)aGc>aCc	p.S288T	KRT4_ENST00000458244.2_Missense_Mutation_p.S268T|KRT4_ENST00000293774.4_Missense_Mutation_p.S362T			P19013	K2C4_HUMAN	keratin 4	302	Coil 1B.|Rod.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						GGACGTGTCGCTGACATGGGT	0.577																																					Pancreas(190;284 2995 41444 45903)	ENST00000551956.1	1.000000	0.790000	1.000000	0.880000	0.970000	0.953336	0.970000	1.000000																										0				29						c.(862-864)aGc>aCc		keratin 4							87.0	80.0	83.0					12																	53202606		2203	4300	6503	SO:0001583	missense	3851	0	0					g.chr12:53202606C>G		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.863G>C	chr12.hg19:g.53202606C>G	ENSP00000448220:p.Ser288Thr	0					KRT4_ENST00000293774.4_Missense_Mutation_p.S362T|KRT4_ENST00000458244.2_Missense_Mutation_p.S268T	p.S288T			1	2	3	2.087795	P19013	K2C4_HUMAN		5	1355	-			F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000551956.1	1	1	hg19	c.863G>C	CCDS41787.2	1	.	.	.	.	.	.	.	.	.	.	C	10.42	1.346494	0.24426	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	D;T;D	0.88975	-2.45;-1.16;-2.45	5.75	1.28	0.21552	5.75	1.28	0.21552	Filament (1);	0.601484	0.14726	N	0.302055	D	0.93109	0.7806	M	0.83012	2.62	0.09310	N	1	P	0.46277	0.875	P	0.49953	0.627	D	0.88388	0.3006	10	0.87932	D	0	.	22.2785	0.99969	0.0:0.2887:0.7113:0.0	.	302	P19013	K2C4_HUMAN	T	288;362;268	ENSP00000448220:S288T;ENSP00000293774:S362T;ENSP00000387904:S268T	ENSP00000293774:S362T	S	-	2	0	0	KRT4	51488873	51488873	0.954000	0.32549	0.007000	0.13788	0.290000	0.27261	1.644000	0.37228	0.329000	0.23460	0.655000	0.94253	AGC	0.405941		TCGA-HZ-7919-01A-11D-2154-08	0.577	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	1	0	0		2	2	2	0		0	0	75		75	75	1	1.870000	-20.000000	1	0.400000	NM_002272			87	87		363	361	1		1	1		0	0	75	0		1.000000	8.156212e-01	0	12	0	3	0	87	363
CD163L1	283316	broad.mit.edu	37	12	7531847	7531847	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr12:7531847C>A	ENST00000313599.3	-	9	2155	c.2098G>T	c.(2098-2100)Gct>Tct	p.A700S	CD163L1_ENST00000416109.2_Missense_Mutation_p.A710S|CD163L1_ENST00000396630.1_Missense_Mutation_p.A700S|CD163L1_ENST00000544331.1_5'UTR			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	700	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ACTTTTCCAGCACACCTGCTG	0.463																																						ENST00000313599.3	0.200000	0.050000	0.160000	0.070000	0.110000	0.121636	0.110000	0.110000																										0				96						c.(2098-2100)Gct>Tct		CD163 molecule-like 1							102.0	79.0	87.0					12																	7531847		2203	4300	6503	SO:0001583	missense	283316	0	0					g.chr12:7531847C>A	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2098G>T	chr12.hg19:g.7531847C>A	ENSP00000315945:p.Ala700Ser	1					CD163L1_ENST00000396630.1_Missense_Mutation_p.A700S|CD163L1_ENST00000544331.1_5'UTR|CD163L1_ENST00000416109.2_Missense_Mutation_p.A710S	p.A700S			0	1	1	1.673073	Q9NR16	C163B_HUMAN		9	2155	-			B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	0	1	hg19	c.2098G>T	CCDS8577.1	0	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100219	0.56183	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34667	1.35;1.35;1.35	2.79	1.87	0.25490	2.79	1.87	0.25490	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.483859	0.14903	U	0.291704	T	0.29976	0.0750	N	0.17922	0.545	0.23331	N	0.997896	P;D	0.55605	0.926;0.972	P;P	0.57152	0.73;0.814	T	0.11891	-1.0569	10	0.10636	T	0.68	.	6.9468	0.24522	0.0:0.8482:0.0:0.1518	.	710;700	E7EVK4;Q9NR16	.;C163B_HUMAN	S	700;710;700	ENSP00000315945:A700S;ENSP00000393474:A710S;ENSP00000379871:A700S	ENSP00000315945:A700S	A	-	1	0	0	CD163L1	7423114	7423114	0.103000	0.21917	0.599000	0.28851	0.548000	0.35241	-0.006000	0.12833	1.492000	0.48499	0.455000	0.32223	GCT	0.257426		TCGA-HZ-7919-01A-11D-2154-08	0.463	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	0	0	1		2	2	2	0		0	0	41		41	41	1	1.870000	-3.643158	1	0.400000	NM_174941			8	8		286	284	0		1	0		0	0	41	0		0.989336	2.995674e-03	0	0	0	3	0	8	286
PRIM1	5557	broad.mit.edu	37	12	57144844	57144844	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr12:57144844A>G	ENST00000338193.6	-	2	275	c.239T>C	c.(238-240)aTa>aCa	p.I80T	HSD17B6_ENST00000555805.1_5'Flank|HSD17B6_ENST00000554643.1_5'Flank|PRIM1_ENST00000552408.1_5'UTR|HSD17B6_ENST00000554150.1_5'Flank|HSD17B6_ENST00000555159.1_5'Flank	NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	80					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						TACTGCGCCTATATCAATCTT	0.328																																						ENST00000338193.6	1.000000	0.420000	1.000000	0.580000	0.780000	0.780151	0.780000	1.000000																										0				8						c.(238-240)aTa>aCa		primase, DNA, polypeptide 1 (49kDa)							105.0	89.0	94.0					12																	57144844		1815	4068	5883	SO:0001583	missense	5557	0	0					g.chr12:57144844A>G	BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.239T>C	chr12.hg19:g.57144844A>G	ENSP00000350491:p.Ile80Thr	0					HSD17B6_ENST00000554150.1_5'Flank|HSD17B6_ENST00000555805.1_5'Flank|HSD17B6_ENST00000554643.1_5'Flank|HSD17B6_ENST00000555159.1_5'Flank|PRIM1_ENST00000552408.1_5'UTR	p.I80T	NM_000946.2	NP_000937.1	1	2	3	2.087795	P49642	PRI1_HUMAN		2	275	-				Missense_Mutation	SNP	ENST00000338193.6	0	1	hg19	c.239T>C	CCDS44926.1	0	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350526	0.82132	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000550770	T;T	0.55052	0.54;0.6	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.049442	0.85682	D	0.000000	T	0.77532	0.4144	M	0.92880	3.355	0.80722	D	1	D;D	0.65815	0.995;0.971	D;P	0.69142	0.962;0.821	T	0.82989	-0.0183	10	0.59425	D	0.04	-11.0372	14.3283	0.66534	1.0:0.0:0.0:0.0	.	80;80	F8VSB2;P49642	.;PRI1_HUMAN	T	80;80;83	ENSP00000350491:I80T;ENSP00000450185:I83T	ENSP00000350491:I80T	I	-	2	0	0	PRIM1	55431111	55431111	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	8.801000	0.91905	2.100000	0.63781	0.454000	0.30748	ATA	0.405941		TCGA-HZ-7919-01A-11D-2154-08	0.328	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406956.1	1	0	1		2	2	2	0		0	0	8		8	8	1	1.870000	-19.767750	1	0.400000	NM_000946			11	11		62	62	0		1	1		0	0	8	0		0.998774	8.825210e-01	0	9	0	15	0	11	62
GPR12	2835	broad.mit.edu	37	13	27333003	27333003	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr13:27333003G>A	ENST00000381436.2	-	1	1424	c.962C>T	c.(961-963)cCg>cTg	p.P321L	GPR12_ENST00000405846.3_Missense_Mutation_p.P321L			P47775	GPR12_HUMAN	G protein-coupled receptor 12	321					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		GAGACTGGACGGGATGCAGCC	0.557																																						ENST00000381436.2	0.220000	0.050000	0.170000	0.080000	0.120000	0.130983	0.120000	0.120000																										0				33						c.(961-963)cCg>cTg		G protein-coupled receptor 12							79.0	79.0	79.0					13																	27333003		2203	4300	6503	SO:0001583	missense	2835	1	121412	26				g.chr13:27333003G>A	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.962C>T	chr13.hg19:g.27333003G>A	ENSP00000370844:p.Pro321Leu	1					GPR12_ENST00000405846.3_Missense_Mutation_p.P321L	p.P321L			0	2	2	2.034786	P47775	GPR12_HUMAN		1	1424	-	Colorectal(5;5.77e-05)	Breast(139;0.198)	Q5T8P3	Missense_Mutation	SNP	ENST00000381436.2	0	1	hg19	c.962C>T	CCDS9319.1	0	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896130	0.72639	.	.	ENSG00000132975	ENST00000405846;ENST00000381436	T;T	0.36157	1.27;1.27	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	L	0.58101	1.795	0.80722	D	1	D	0.53885	0.963	B	0.43082	0.407	T	0.44787	-0.9305	10	0.62326	D	0.03	.	19.3487	0.94376	0.0:0.0:1.0:0.0	.	321	P47775	GPR12_HUMAN	L	321	ENSP00000384932:P321L;ENSP00000370844:P321L	ENSP00000370844:P321L	P	-	2	0	0	GPR12	26231003	26231003	1.000000	0.71417	0.819000	0.32651	0.982000	0.71751	9.739000	0.98837	2.594000	0.87642	0.511000	0.50034	CCG	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.557	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2	0	0	1		2	2	2	0		0	0	37		37	35	1	1.870000	-3.127367	1	0.400000				8	8		332	326	0		1			0	0	37	0		0.988792	0	0	0	0	0	0	8	332
MDGA2	161357	broad.mit.edu	37	14	47504469	47504469	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr14:47504469A>T	ENST00000399232.2	-	8	1721	c.1357T>A	c.(1357-1359)Ttg>Atg	p.L453M	MDGA2_ENST00000357362.3_Missense_Mutation_p.L224M|MDGA2_ENST00000439988.3_Missense_Mutation_p.L522M|MDGA2_ENST00000426342.1_Missense_Mutation_p.L224M	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	453	Ig-like 5.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CTGGTGACCAATGGTGATTTT	0.378																																						ENST00000399232.2	0.180000	0.040000	0.140000	0.070000	0.100000	0.108970	0.100000	0.100000																										0				76						c.(1357-1359)Ttg>Atg		MAM domain containing glycosylphosphatidylinositol anchor 2							169.0	142.0	150.0					14																	47504469		1872	4104	5976	SO:0001583	missense	161357	0	0					g.chr14:47504469A>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1357T>A	chr14.hg19:g.47504469A>T	ENSP00000382178:p.Leu453Met	0					MDGA2_ENST00000357362.3_Missense_Mutation_p.L224M|MDGA2_ENST00000426342.1_Missense_Mutation_p.L224M|MDGA2_ENST00000439988.3_Missense_Mutation_p.L522M	p.L453M	NM_001113498.2	NP_001106970.3	0	0	0	2.009772	Q7Z553	MDGA2_HUMAN		8	1721	-			F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	0	1	hg19	c.1357T>A		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.99|10.99	1.506599|1.506599	0.26949|0.26949	.|.	.|.	ENSG00000139915|ENSG00000139915	ENST00000554762|ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	.|T;T;T;T	.|0.68624	.|-0.34;-0.34;-0.34;-0.34	5.52|5.52	1.83|1.83	0.25207|0.25207	5.52|5.52	1.83|1.83	0.25207|0.25207	.|Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.154328	.|0.28470	.|U	.|0.015227	T|T	0.50171|0.50171	0.1600|0.1600	L|L	0.33710|0.33710	1.025|1.025	0.80722|0.80722	D|D	1|1	.|B;B	.|0.33528	.|0.234;0.416	.|B;B	.|0.35114	.|0.087;0.196	T|T	0.37079|0.37079	-0.9721|-0.9721	5|10	.|0.52906	.|T	.|0.07	.|.	4.4546|4.4546	0.11637|0.11637	0.5216:0.0:0.3346:0.1439|0.5216:0.0:0.3346:0.1439	.|.	.|224;453	.|F6W3S7;Q7Z553	.|.;MDGA2_HUMAN	N|M	227|453;224;522;224	.|ENSP00000400011:L453M;ENSP00000405456:L224M;ENSP00000382178:L522M;ENSP00000349925:L224M	.|ENSP00000349925:L224M	I|L	-|-	2|1	0|2	0|2	MDGA2|MDGA2	46574219|46574219	46574219|46574219	0.995000|0.995000	0.38212|0.38212	0.999000|0.999000	0.59377|0.59377	0.971000|0.971000	0.66376|0.66376	1.154000|1.154000	0.31688|0.31688	0.068000|0.068000	0.16574|0.16574	-0.512000|-0.512000	0.04463|0.04463	ATT|TTG	0.385246		TCGA-HZ-7919-01A-11D-2154-08	0.378	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	0	0	1		2	2	2	0		0	0	70		70	70	1	1.870000	-3.136223	1	0.400000	NM_182830			10	10		479	474	0		1			0	0	70	0		0.996776	0	0	0	0	0	0	10	479
TTLL5	23093	broad.mit.edu	37	14	76330128	76330128	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr14:76330128C>T	ENST00000298832.9	+	29	3650	c.3445C>T	c.(3445-3447)Caa>Taa	p.Q1149*	TTLL5_ENST00000554510.1_Nonsense_Mutation_p.Q658*|TTLL5_ENST00000557636.1_Nonsense_Mutation_p.Q1164*|TTLL5_ENST00000556893.1_Nonsense_Mutation_p.Q700*	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	1149					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		CTATCAGCTTCAATTTGCCCT	0.522																																						ENST00000298832.9	1.000000	0.860000	1.000000	0.920000	0.990000	0.973715	0.990000	1.000000																										0				50						c.(3445-3447)Caa>Taa		tubulin tyrosine ligase-like family, member 5							98.0	98.0	98.0					14																	76330128		2203	4300	6503	SO:0001587	stop_gained	23093	0	0					g.chr14:76330128C>T	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.3445C>T	chr14.hg19:g.76330128C>T	ENSP00000298832:p.Gln1149*	0					TTLL5_ENST00000557636.1_Nonsense_Mutation_p.Q1164*|TTLL5_ENST00000556893.1_Nonsense_Mutation_p.Q700*|TTLL5_ENST00000554510.1_Nonsense_Mutation_p.Q658*	p.Q1149*	NM_015072.4	NP_055887.3	0	0	0	2.009772	Q6EMB2	TTLL5_HUMAN		29	3650	+			B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Nonsense_Mutation	SNP	ENST00000298832.9	0	1	hg19	c.3445C>T	CCDS32124.1	1	.	.	.	.	.	.	.	.	.	.	C	43	10.490315	0.99415	.	.	ENSG00000119685	ENST00000286653;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	.	.	.	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.432376	0.27424	N	0.019434	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	14.9992	0.71459	0.1417:0.8583:0.0:0.0	.	.	.	.	X	223;1164;1149;700;700;658	.	ENSP00000286653:Q223X	Q	+	1	0	0	TTLL5	75399881	75399881	0.991000	0.36638	0.999000	0.59377	0.945000	0.59286	2.927000	0.48900	2.894000	0.99253	0.655000	0.94253	CAA	0.385246		TCGA-HZ-7919-01A-11D-2154-08	0.522	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	1	0	1		2	2	2	0		0	0	104		104	104	1	1.870000	-20.000000	1	0.400000	NM_015072			161	159		623	608	1		1	1		0	0	104	0		1.000000	9.999535e-01	0	8	0	49	0	161	623
DUOXA2	405753	broad.mit.edu	37	15	45406819	45406819	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr15:45406819G>A	ENST00000323030.5	+	1	301	c.16G>A	c.(16-18)Ggc>Agc	p.G6S	DUOX2_ENST00000603300.1_5'Flank|DUOX2_ENST00000389039.6_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	6					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		CCTGTGGAACGGCGTACTGCC	0.632																																						ENST00000323030.5	1.000000	0.750000	1.000000	0.870000	0.990000	0.954320	0.990000	1.000000																										0										c.(16-18)Ggc>Agc		dual oxidase maturation factor 2							76.0	64.0	68.0					15																	45406819		2198	4298	6496	SO:0001583	missense	405753	1	121410	33				g.chr15:45406819G>A	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.16G>A	chr15.hg19:g.45406819G>A	ENSP00000319705:p.Gly6Ser	0					DUOX2_ENST00000603300.1_5'Flank|DUOX2_ENST00000389039.6_5'Flank	p.G6S	NM_207581.3	NP_997464.2	1	2	3	2.059272	Q1HG44	DOXA2_HUMAN		1	301	+		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	B2RPI9|H0YNQ6	Missense_Mutation	SNP	ENST00000323030.5	1	1	hg19	c.16G>A	CCDS10118.2	1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836709	0.71373	.	.	ENSG00000140274	ENST00000323030;ENST00000350243	T	0.57752	0.38	4.98	4.06	0.47325	4.98	4.06	0.47325	.	0.262703	0.39475	N	0.001347	T	0.54159	0.1841	L	0.32530	0.975	0.46185	D	0.998911	D	0.76494	0.999	P	0.56088	0.791	T	0.56001	-0.8051	10	0.52906	T	0.07	-18.908	12.4824	0.55852	0.0813:0.0:0.9186:0.0	.	6	Q1HG44	DOXA2_HUMAN	S	6	ENSP00000319705:G6S	ENSP00000319705:G6S	G	+	1	0	0	DUOXA2	43194111	43194111	1.000000	0.71417	0.040000	0.18447	0.274000	0.26718	5.890000	0.69774	1.231000	0.43661	0.591000	0.81541	GGC	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.632	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1	1	0	1		2	2	2	0		0	0	27		27	27	1	1.870000	-3.493627	1	0.400000	NM_207581			43	42		170	165	1		1	1		0	0	27	0		1.000000	1	0	107	0	142	0	43	170
GLCE	26035	broad.mit.edu	37	15	69553486	69553486	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr15:69553486A>C	ENST00000261858.2	+	4	875	c.647A>C	c.(646-648)cAg>cCg	p.Q216P	GLCE_ENST00000559420.2_Missense_Mutation_p.Q152P|GLCE_ENST00000559500.1_3'UTR	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	216					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						CAGATTGCACAGTATGGATTA	0.373																																						ENST00000261858.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999734	0.990000	1.000000																										0				18						c.(646-648)cAg>cCg		glucuronic acid epimerase							114.0	105.0	108.0					15																	69553486		2200	4298	6498	SO:0001583	missense	26035	0	0					g.chr15:69553486A>C	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.647A>C	chr15.hg19:g.69553486A>C	ENSP00000261858:p.Gln216Pro	0					GLCE_ENST00000559420.2_Missense_Mutation_p.Q152P|GLCE_ENST00000559500.1_3'UTR	p.Q216P	NM_015554.1	NP_056369.1	1	2	3	2.059272	O94923	GLCE_HUMAN		4	875	+			Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	1	1	hg19	c.647A>C	CCDS32277.1	1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.278449	0.80692	.	.	ENSG00000138604	ENST00000261858	T	0.59502	0.26	5.94	5.94	0.96194	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.76905	0.4053	M	0.81942	2.565	0.80722	D	1	D	0.61697	0.99	D	0.70487	0.969	T	0.80238	-0.1465	10	0.87932	D	0	-8.1086	15.2185	0.73288	1.0:0.0:0.0:0.0	.	216	O94923	GLCE_HUMAN	P	216	ENSP00000261858:Q216P	ENSP00000261858:Q216P	Q	+	2	0	0	GLCE	67340540	67340540	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.198000	0.94994	2.265000	0.75225	0.482000	0.46254	CAG	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.373	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	68		68	68	1	1.870000	-20.000000	1	0.400000	NM_015554			114	114		352	348	1		1	1		0	0	68	0		1.000000	9.994562e-01	0	14	0	23	0	114	352
THSD4	79875	broad.mit.edu	37	15	71704038	71704038	+	Missense_Mutation	SNP	G	G	A	rs183837037		TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr15:71704038G>A	ENST00000355327.3	+	7	1162	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	THSD4_ENST00000261862.6_Missense_Mutation_p.R343H			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	343					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AAAGGCAATCGCAAATGTGAG	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		18190	0.001		0.0	False		,,,				2504	0.0					ENST00000355327.3	1.000000	0.760000	1.000000	0.870000	0.990000	0.954636	0.990000	1.000000																										0				42						c.(1027-1029)cGc>cAc		thrombospondin, type I, domain containing 4							50.0	48.0	49.0					15																	71704038		1950	4153	6103	SO:0001583	missense	79875	1	120904	26				g.chr15:71704038G>A	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1028G>A	chr15.hg19:g.71704038G>A	ENSP00000347484:p.Arg343His	0					THSD4_ENST00000261862.6_Missense_Mutation_p.R343H	p.R343H			1	2	3	2.059272	Q6ZMP0	THSD4_HUMAN		7	1162	+			B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	0	1	hg19	c.1028G>A	CCDS10238.2	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.95	2.390891	0.42410	.	.	ENSG00000187720	ENST00000355327;ENST00000261862	T;T	0.71817	-0.6;-0.6	5.47	3.37	0.38596	5.47	3.37	0.38596	.	0.225081	0.38605	N	0.001633	T	0.54532	0.1864	N	0.13168	0.305	0.27987	N	0.935816	D;B	0.59357	0.985;0.013	P;B	0.49683	0.619;0.003	T	0.51608	-0.8684	10	0.54805	T	0.06	.	2.8813	0.05648	0.2513:0.0:0.5304:0.2183	.	343;343	Q6ZMP0-2;Q6ZMP0	.;THSD4_HUMAN	H	343	ENSP00000347484:R343H;ENSP00000261862:R343H	ENSP00000261862:R343H	R	+	2	0	0	THSD4	69491092	69491092	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	1.507000	0.35758	1.324000	0.45282	-0.142000	0.14014	CGC	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.423	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	0	0	1		2	2	2	0		0	0	32		32	32	1	1.870000	-20.000000	1	0.400000	NM_024817			48	48		191	185	0		1	1		0	0	32	0		1.000000	9.784606e-01	0	7	0	19	0	48	191
ARIH1	25820	broad.mit.edu	37	15	72858942	72858942	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr15:72858942G>A	ENST00000379887.4	+	8	1264	c.950G>A	c.(949-951)tGt>tAt	p.C317Y		NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	317					cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						CCTGTTAAATGTAAGGTGAGT	0.318																																						ENST00000379887.4	0.160000	0.040000	0.130000	0.060000	0.090000	0.098158	0.090000	0.090000																										0				14						c.(949-951)tGt>tAt		ariadne RBR E3 ubiquitin protein ligase 1							210.0	206.0	208.0					15																	72858942		2198	4297	6495	SO:0001583	missense	25820	0	0					g.chr15:72858942G>A	AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.950G>A	chr15.hg19:g.72858942G>A	ENSP00000369217:p.Cys317Tyr	0						p.C317Y	NM_005744.3	NP_005735.2	1	2	3	2.059272	Q9Y4X5	ARI1_HUMAN		8	1264	+			B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Missense_Mutation	SNP	ENST00000379887.4	0	1	hg19	c.950G>A	CCDS10244.1	0	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572572	0.86542	.	.	ENSG00000166233	ENST00000379887;ENST00000299305	D	0.94280	-3.39	5.27	5.27	0.74061	5.27	5.27	0.74061	Zinc finger, C6HC-type (2);Zinc finger, RING-type (1);	0.000000	0.85682	D	0.000000	D	0.98257	0.9423	H	0.99026	4.405	0.80722	D	1	D	0.76494	0.999	D	0.68353	0.957	D	0.99809	1.1040	10	0.87932	D	0	.	18.9619	0.92680	0.0:0.0:1.0:0.0	.	317	Q9Y4X5	ARI1_HUMAN	Y	317;287	ENSP00000369217:C317Y	ENSP00000299305:C287Y	C	+	2	0	0	ARIH1	70645996	70645996	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.204000	0.95041	2.460000	0.83146	0.644000	0.83932	TGT	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.318	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257350.1	0	0	1		2	2	2	0		0	0	80		80	79	1	1.870000	-3.096007	1	0.400000	NM_005744			11	11		598	594	0		1	1		0	0	80	0		0.998291	4.380575e-01	0	4	0	73	0	11	598
BNC1	646	broad.mit.edu	37	15	83926674	83926674	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr15:83926674C>T	ENST00000345382.2	-	5	2590	c.2505G>A	c.(2503-2505)acG>acA	p.T835T	BNC1_ENST00000569704.1_Silent_p.T828T|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	835					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TGTGGACTTGCGTTATTGGGT	0.517																																						ENST00000345382.2	1.000000	0.690000	0.950000	0.760000	0.850000	0.860995	0.850000	1.000000																										0				56						c.(2503-2505)acG>acA		basonuclin 1							121.0	104.0	109.0					15																	83926674		2203	4300	6503	SO:0001819	synonymous_variant	646	0	0					g.chr15:83926674C>T	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2505G>A	chr15.hg19:g.83926674C>T		0					BNC1_ENST00000569704.1_Silent_p.T828T|RP11-382A20.4_ENST00000565495.1_RNA	p.T835T	NM_001717.3	NP_001708.3	1	2	3	2.060585	Q01954	BNC1_HUMAN		5	2590	-			Q15840	Silent	SNP	ENST00000345382.2	1	1	hg19	c.2505G>A	CCDS10324.1	1																																																																																								0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.517	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	1	0	1		2	2	2	0		0	0	87		87	87	1	1.870000	-20.000000	1	0.400000	NM_001717			76	76		367	362	1		1			0	0	87	0		1.000000	0	0	0	0	0	0	76	367
AKAP13	11214	broad.mit.edu	37	15	86212982	86212982	+	Silent	SNP	T	T	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr15:86212982T>C	ENST00000394518.2	+	14	5117	c.5022T>C	c.(5020-5022)ttT>ttC	p.F1674F	RP11-815J21.4_ENST00000558980.1_RNA|AKAP13_ENST00000361243.2_Silent_p.F1678F|AKAP13_ENST00000560579.1_3'UTR	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1674					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						AGCAGGGATTTAATTACTGTA	0.348																																					Melanoma(94;603 1453 3280 32295 32951)	ENST00000394518.2	1.000000	0.700000	0.970000	0.780000	0.870000	0.875690	0.870000	1.000000																										0				98						c.(5020-5022)ttT>ttC		A kinase (PRKA) anchor protein 13							151.0	141.0	145.0					15																	86212982		2202	4299	6501	SO:0001819	synonymous_variant	11214	0	0					g.chr15:86212982T>C	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.5022T>C	chr15.hg19:g.86212982T>C		0					AKAP13_ENST00000361243.2_Silent_p.F1678F|AKAP13_ENST00000560579.1_3'UTR|RP11-815J21.4_ENST00000558980.1_RNA	p.F1674F	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	1	2	3	2.060585	Q12802	AKP13_HUMAN		14	5117	+			Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	1	1	hg19	c.5022T>C	CCDS32319.1	1																																																																																								0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.348	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	1	0	1		2	2	2	0		0	0	56		56	56	1	1.870000	-20.000000	1	0.400000	NM_007200			83	82		392	386	1		1	1		0	0	56	0		1.000000	9.999996e-01	0	42	0	59	0	83	392
ZNF174	7727	broad.mit.edu	37	16	3452365	3452365	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr16:3452365G>A	ENST00000268655.4	+	1	946	c.361G>A	c.(361-363)Gtg>Atg	p.V121M	ZNF174_ENST00000572544.1_Missense_Mutation_p.V121M|ZNF174_ENST00000575752.1_Missense_Mutation_p.V121M|ZNF174_ENST00000344823.5_Missense_Mutation_p.V121M|ZSCAN32_ENST00000304926.3_5'Flank|ZSCAN32_ENST00000439568.2_5'Flank|ZSCAN32_ENST00000422427.2_5'Flank|ZNF174_ENST00000571936.1_Missense_Mutation_p.V121M|ZSCAN32_ENST00000396852.4_5'Flank|ZSCAN32_ENST00000573830.1_5'Flank	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	121	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						TGTGACCCTCGTGGAAGATTT	0.498																																						ENST00000268655.4	0.360000	0.180000	0.310000	0.210000	0.260000	0.270253	0.260000	0.260000																										0				12						c.(361-363)Gtg>Atg		zinc finger protein 174							65.0	67.0	66.0					16																	3452365		2197	4300	6497	SO:0001583	missense	7727	0	0					g.chr16:3452365G>A	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.361G>A	chr16.hg19:g.3452365G>A	ENSP00000268655:p.Val121Met	1					ZSCAN32_ENST00000439568.2_5'Flank|ZSCAN32_ENST00000304926.3_5'Flank|ZSCAN32_ENST00000396852.4_5'Flank|ZNF174_ENST00000571936.1_Missense_Mutation_p.V121M|ZSCAN32_ENST00000422427.2_5'Flank|ZNF174_ENST00000344823.5_Missense_Mutation_p.V121M|ZSCAN32_ENST00000573830.1_5'Flank|ZNF174_ENST00000572544.1_Missense_Mutation_p.V121M|ZNF174_ENST00000575752.1_Missense_Mutation_p.V121M	p.V121M	NM_003450.2	NP_003441.1	0	2	2	2.090281	Q15697	ZN174_HUMAN		1	946	+			Q53Y68|Q9BQ34	Missense_Mutation	SNP	ENST00000268655.4	1	1	hg19	c.361G>A	CCDS10504.1	0	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380339	0.42207	.	.	ENSG00000103343	ENST00000344823;ENST00000268655	T;T	0.07021	3.23;3.23	4.5	4.5	0.54988	4.5	4.5	0.54988	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.43747	D	0.000531	T	0.25232	0.0613	M	0.71206	2.165	0.36337	D	0.859256	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.986;0.992;0.973	T	0.03761	-1.1006	10	0.87932	D	0	.	10.9404	0.47270	0.0:0.1892:0.8108:0.0	.	121;121;121	Q15697;Q15697-2;Q8IZN5	ZN174_HUMAN;.;.	M	121	ENSP00000339781:V121M;ENSP00000268655:V121M	ENSP00000268655:V121M	V	+	1	0	0	ZNF174	3392366	3392366	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	3.912000	0.56386	2.790000	0.95986	0.655000	0.94253	GTG	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.498	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251510.1	1	0	1		2	2	2	0		0	0	66		66	65	1	1.870000	-6.228818	1	0.400000	NM_003450			32	30		575	571	0		1	0		0	0	66	0		1.000000	2.754438e-01	0	0	0	19	0	32	575
ITGAL	3683	broad.mit.edu	37	16	30505643	30505643	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr16:30505643G>A	ENST00000356798.6	+	12	1504	c.1324G>A	c.(1324-1326)Gga>Aga	p.G442R	ITGAL_ENST00000568012.1_3'UTR|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Missense_Mutation_p.G359R	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	442					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GCCACAGGGCGGAGGACACTG	0.647																																					NSCLC(110;1462 1641 3311 33990 49495)	ENST00000356798.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				76						c.(1324-1326)Gga>Aga		integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)						44.0	44.0	44.0					16																	30505643		2197	4300	6497	SO:0001583	missense	3683	4	121402	34				g.chr16:30505643G>A		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1324G>A	chr16.hg19:g.30505643G>A	ENSP00000349252:p.Gly442Arg	1					ITGAL_ENST00000358164.5_Missense_Mutation_p.G359R|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000568012.1_3'UTR	p.G442R	NM_002209.2	NP_002200.2	0	2	2	2.076500	P20701	ITAL_HUMAN		12	1504	+			O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	1	1	hg19	c.1324G>A	CCDS32433.1	1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671567	0.29693	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.10860	2.83;2.83	5.67	-11.3	0.00108	5.67	-11.3	0.00108	.	2.121790	0.01509	N	0.017858	T	0.07007	0.0178	L	0.31157	0.91	0.09310	N	1	B;B	0.16802	0.015;0.019	B;B	0.11329	0.004;0.006	T	0.09079	-1.0691	10	0.25751	T	0.34	.	9.7973	0.40742	0.0953:0.1684:0.6527:0.0836	.	359;442	Q96HB1;P20701	.;ITAL_HUMAN	R	442;359	ENSP00000349252:G442R;ENSP00000350886:G359R	ENSP00000349252:G442R	G	+	1	0	0	ITGAL	30413144	30413144	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.357000	0.07651	-2.335000	0.00629	-1.012000	0.02466	GGA	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.647	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2	1	0	1		2	2	2	0		0	0	56		56	55	1	1.870000	-20.000000	1	0.400000				147	147		189	184	1		1	0		0	0	56	0		1.000000	9.705919e-01	0	0	0	10	0	147	189
CDH11	1009	broad.mit.edu	37	16	64981819	64981819	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr16:64981819C>T	ENST00000268603.4	-	13	2693	c.2078G>A	c.(2077-2079)cGc>cAc	p.R693H	CDH11_ENST00000566827.1_Missense_Mutation_p.R567H|CDH11_ENST00000394156.3_3'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	693					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GATGTCTTTGCGGGGGATAAA	0.488			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																												ENST00000268603.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000				Dom	yes			Dom	yes		16	16q22.1	16q22.1	1009	T	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""				M	M	USP6		aneurysmal bone cysts		0				88						c.(2077-2079)cGc>cAc		cadherin 11, type 2, OB-cadherin (osteoblast)							140.0	135.0	137.0					16																	64981819		2203	4300	6503	SO:0001583	missense	1009	1	121412	32				g.chr16:64981819C>T	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.2078G>A	chr16.hg19:g.64981819C>T	ENSP00000268603:p.Arg693His	1	TSP Lung(24;0.17)				CDH11_ENST00000394156.3_3'UTR|CDH11_ENST00000566827.1_Missense_Mutation_p.R567H	p.R693H	NM_001797.2	NP_001788.2	0	2	2	2.051423	P55287	CAD11_HUMAN		13	2693	-		Ovarian(137;0.0973)	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	1	1	hg19	c.2078G>A	CCDS10803.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591103	0.86851	.	.	ENSG00000140937	ENST00000268603;ENST00000538390	T	0.78924	-1.22	6.17	6.17	0.99709	6.17	6.17	0.99709	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.90549	0.7038	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.91017	0.4854	10	0.87932	D	0	.	19.8676	0.96824	0.0:1.0:0.0:0.0	.	693	P55287	CAD11_HUMAN	H	693;676	ENSP00000268603:R693H	ENSP00000268603:R693H	R	-	2	0	0	CDH11	63539320	63539320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGC	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.488	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	1	0	1		2	2	2	0		0	0	116		116	114	1	1.870000	-20.000000	1	0.400000	NM_033664			290	288		475	471	1		1	0		0	0	116	0		1.000000	1	0	0	0	260	0	290	475
ST3GAL2	6483	broad.mit.edu	37	16	70415640	70415640	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr16:70415640G>C	ENST00000393640.4	-	6	3112	c.1005C>G	c.(1003-1005)atC>atG	p.I335M	ST3GAL2_ENST00000342907.2_Missense_Mutation_p.I335M|RP11-529K1.4_ENST00000566960.1_RNA			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	335					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				CCAGCATGTCGATGATGTGGG	0.667																																						ENST00000393640.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				11						c.(1003-1005)atC>atG		ST3 beta-galactoside alpha-2,3-sialyltransferase 2							64.0	55.0	58.0					16																	70415640		2198	4300	6498	SO:0001583	missense	6483	0	0					g.chr16:70415640G>C	U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.1005C>G	chr16.hg19:g.70415640G>C	ENSP00000377257:p.Ile335Met	1					RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.I335M	p.I335M			0	2	2	2.051423	Q16842	SIA4B_HUMAN		6	3112	-		Ovarian(137;0.0694)	O00654	Missense_Mutation	SNP	ENST00000393640.4	1	1	hg19	c.1005C>G	CCDS10890.1	1	.	.	.	.	.	.	.	.	.	.	g	22.1	4.248254	0.80024	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.32515	1.45;1.45	6.07	-2.78	0.05859	6.07	-2.78	0.05859	.	0.042535	0.85682	D	0.000000	T	0.42131	0.1189	M	0.76727	2.345	0.49798	D	0.999827	D	0.63880	0.993	P	0.59487	0.858	T	0.41716	-0.9493	10	0.66056	D	0.02	-32.3009	7.3993	0.26954	0.4899:0.0:0.4023:0.1078	.	335	Q16842	SIA4B_HUMAN	M	335	ENSP00000345477:I335M;ENSP00000377257:I335M	ENSP00000345477:I335M	I	-	3	3	3	ST3GAL2	68973141	68973141	0.170000	0.23016	0.988000	0.46212	0.670000	0.39368	-0.349000	0.07731	-0.283000	0.09115	-0.224000	0.12420	ATC	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.667	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268968.1	1	0	1		2	2	2	0		0	0	47		47	46	1	1.870000	-20.000000	1	0.400000	NM_006927			137	136		262	260	1		1	1		0	0	47	0		1.000000	9.312713e-01	0	4	0	7	0	137	262
MBTPS1	8720	broad.mit.edu	37	16	84120998	84120998	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr16:84120998T>C	ENST00000343411.3	-	9	1594	c.1099A>G	c.(1099-1101)Atc>Gtc	p.I367V	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	367	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AAGCGGGCGATGTTATCTTCA	0.408																																						ENST00000343411.3	1.000000	0.840000	1.000000	0.930000	0.990000	0.977037	0.990000	1.000000																										0				41						c.(1099-1101)Atc>Gtc		membrane-bound transcription factor peptidase, site 1							110.0	103.0	105.0					16																	84120998		2200	4300	6500	SO:0001583	missense	8720	2	121412	32				g.chr16:84120998T>C	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1099A>G	chr16.hg19:g.84120998T>C	ENSP00000344223:p.Ile367Val	1					MBTPS1_ENST00000569770.1_5'UTR	p.I367V	NM_003791.2	NP_003782.1	0	2	2	2.078655	Q14703	MBTP1_HUMAN		9	1594	-			A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	ENST00000343411.3	1	1	hg19	c.1099A>G	CCDS10941.1	1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.997441	0.54147	.	.	ENSG00000140943	ENST00000343411	T	0.38887	1.11	5.26	5.26	0.73747	5.26	5.26	0.73747	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.36441	0.0967	N	0.12569	0.235	0.80722	D	1	B	0.34103	0.437	P	0.44422	0.449	T	0.36456	-0.9747	10	0.44086	T	0.13	-27.4813	15.4764	0.75485	0.0:0.0:0.0:1.0	.	367	Q14703	MBTP1_HUMAN	V	367	ENSP00000344223:I367V	ENSP00000344223:I367V	I	-	1	0	0	MBTPS1	82678499	82678499	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.972000	0.88022	2.113000	0.64589	0.460000	0.39030	ATC	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.408	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	1	0	1		2	2	2	0		0	0	55		55	55	1	1.870000	-20.000000	1	0.400000	NM_003791			94	93		362	356	1		1	1		0	0	55	0		1.000000	1	0	45	0	159	0	94	362
FANCA	2175	broad.mit.edu	37	16	89838200	89838200	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr16:89838200C>T	ENST00000389301.3	-	23	2067	c.2037G>A	c.(2035-2037)gtG>gtA	p.V679V	FANCA_ENST00000567284.2_5'UTR|FANCA_ENST00000568369.1_Silent_p.V679V	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	679					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TTTCAGAAATCACTGCCACCT	0.527			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													ENST00000389301.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000			yes	Rec		Fanconi anaemia A	yes	Rec		Fanconi anaemia A	16	16q24.3	16q24.3	2175	D, Mis, N, F, S	"""Fanconi anemia, complementation group A"""				L	L		AML, leukemia			0				47						c.(2035-2037)gtG>gtA	Involved in tolerance or repair of DNA crosslinks	Fanconi anemia, complementation group A							118.0	99.0	105.0					16																	89838200		2198	4300	6498	SO:0001819	synonymous_variant	2175	0	0		Fanconi Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	g.chr16:89838200C>T	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.2037G>A	chr16.hg19:g.89838200C>T		1					FANCA_ENST00000568369.1_Silent_p.V679V|FANCA_ENST00000567284.2_5'UTR	p.V679V	NM_000135.2	NP_000126.2	0	2	2	2.078655	O15360	FANCA_HUMAN		23	2067	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	ENST00000389301.3	1	1	hg19	c.2037G>A	CCDS32515.1	1																																																																																								0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.527	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1	1	0	1		2	2	2	0		0	0	51		51	50	1	1.870000	-20.000000	1	0.400000				150	147		201	201	1		1	1		0	0	51	0		1.000000	9.662978e-01	0	5	0	5	0	150	201
ALDH3A2	224	broad.mit.edu	37	17	19575061	19575061	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr17:19575061G>T	ENST00000176643.6	+	9	1681	c.1235G>T	c.(1234-1236)gGa>gTa	p.G412V	ALDH3A2_ENST00000395575.2_Missense_Mutation_p.G412V|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.G412V|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.G412V|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.G412V|ALDH3A2_ENST00000571163.1_Intron			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	412			G -> R (in SLS). {ECO:0000269|PubMed:9829906}.		cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					GCTTATCACGGAAAACATAGT	0.413																																						ENST00000176643.6	1.000000	0.670000	0.910000	0.740000	0.820000	0.829754	0.820000	0.820000																										0				13						c.(1234-1236)gGa>gTa		aldehyde dehydrogenase 3 family, member A2							112.0	112.0	112.0					17																	19575061		2203	4300	6503	SO:0001583	missense	224	0	0					g.chr17:19575061G>T	L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1235G>T	chr17.hg19:g.19575061G>T	ENSP00000176643:p.Gly412Val	0					ALDH3A2_ENST00000571163.1_Intron|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.G412V|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.G412V|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.G412V|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.G412V	p.G412V			1	2	3	2.083920	P51648	AL3A2_HUMAN		9	1681	+	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)		Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	ENST00000176643.6	1	1	hg19	c.1235G>T	CCDS11210.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.756577	0.98941	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	D;D;D	0.89123	-2.47;-2.47;-2.47	6.06	6.06	0.98353	6.06	6.06	0.98353	Aldehyde dehydrogenase domain (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.96543	0.8872	H	0.95402	3.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96956	0.9698	10	0.87932	D	0	-23.5621	19.6125	0.95613	0.0:0.0:1.0:0.0	.	412;412	P51648;P51648-2	AL3A2_HUMAN;.	V	412	ENSP00000176643:G412V;ENSP00000378942:G412V;ENSP00000345774:G412V	ENSP00000176643:G412V	G	+	2	0	0	ALDH3A2	19515653	19515653	1.000000	0.71417	0.993000	0.49108	0.773000	0.43773	8.292000	0.89930	2.879000	0.98667	0.650000	0.86243	GGA	0.404762		TCGA-HZ-7919-01A-11D-2154-08	0.413	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1	1	0	1		2	2	2	0		0	0	71		71	71	1	1.870000	-20.000000	1	0.400000				96	94		493	488	1		1	1		0	0	71	0		1.000000	1	0	37	0	106	0	96	493
MXRA7	439921	broad.mit.edu	37	17	74681156	74681156	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr17:74681156C>G	ENST00000355797.3	-	3	506	c.498G>C	c.(496-498)caG>caC	p.Q166H	MXRA7_ENST00000375036.2_Missense_Mutation_p.Q166H|MXRA7_ENST00000592148.1_Missense_Mutation_p.Q209H|MXRA7_ENST00000589082.1_Missense_Mutation_p.Q11H|MXRA7_ENST00000588114.1_Missense_Mutation_p.Q11H|MXRA7_ENST00000449428.2_Missense_Mutation_p.Q166H|MXRA7_ENST00000585519.1_Missense_Mutation_p.Q11H	NM_001008528.1	NP_001008528.1	P84157	MXRA7_HUMAN	matrix-remodelling associated 7	166						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						CAGCCTACCTCTGCTCCTCCT	0.622																																						ENST00000355797.3	1.000000	0.830000	0.980000	0.880000	0.930000	0.931515	0.930000	0.950000																										0				6						c.(496-498)caG>caC		matrix-remodelling associated 7							143.0	133.0	136.0					17																	74681156		2203	4300	6503	SO:0001583	missense	439921	0	0					g.chr17:74681156C>G	BC053983	CCDS32745.1, CCDS32746.1, CCDS45786.1	17q25.1	2007-08-01				ENSG00000182534			7541	protein-coding gene	gene with protein product							Standard	XM_005257382		Approved	FLJ46603, TMAP1, PS1TP1	uc002jsk.1	P84157		ENST00000355797.3:c.498G>C	chr17.hg19:g.74681156C>G	ENSP00000348050:p.Gln166His	1					MXRA7_ENST00000592148.1_Missense_Mutation_p.Q209H|MXRA7_ENST00000585519.1_Missense_Mutation_p.Q11H|MXRA7_ENST00000589082.1_Missense_Mutation_p.Q11H|MXRA7_ENST00000375036.2_Missense_Mutation_p.Q166H|MXRA7_ENST00000588114.1_Missense_Mutation_p.Q11H|MXRA7_ENST00000449428.2_Missense_Mutation_p.Q166H	p.Q166H	NM_001008528.1	NP_001008528.1	0	1	1	1.659738	P84157	MXRA7_HUMAN		3	506	-			Q0P5W3	Missense_Mutation	SNP	ENST00000355797.3	1	1	hg19	c.498G>C	CCDS32745.1	1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573895	0.28092	.	.	ENSG00000182534	ENST00000355797;ENST00000449428;ENST00000375036;ENST00000392488	T;T;T	0.35236	1.32;1.32;1.32	5.27	1.74	0.24563	5.27	1.74	0.24563	.	0.144210	0.46758	N	0.000267	T	0.21427	0.0516	N	0.25647	0.755	0.22629	N	0.998912	B;B;B	0.25390	0.125;0.063;0.063	B;B;B	0.26202	0.067;0.037;0.037	T	0.13150	-1.0520	10	0.49607	T	0.09	-18.8343	4.6255	0.12476	0.0:0.5361:0.1835:0.2804	.	166;166;166	P84157-2;P84157-3;P84157	.;.;MXRA7_HUMAN	H	166	ENSP00000348050:Q166H;ENSP00000391466:Q166H;ENSP00000364176:Q166H	ENSP00000348050:Q166H	Q	-	3	2	2	MXRA7	72192751	72192751	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.740000	0.26188	0.590000	0.29694	0.462000	0.41574	CAG	0.250000		TCGA-HZ-7919-01A-11D-2154-08	0.622	MXRA7-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450983.1	1	0	1		2	2	2	0		0	0	128		128	127	1	1.870000	-5.631252	1	0.400000	NM_001008529			224	222		721	709	1		1	1		0	0	128	0		1.000000	1	0	16	0	333	0	224	721
RBBP8	5932	broad.mit.edu	37	18	20516852	20516852	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr18:20516852C>G	ENST00000399722.2	+	2	389	c.38C>G	c.(37-39)tCt>tGt	p.S13C	RBBP8_ENST00000399725.2_Missense_Mutation_p.S13C|RBBP8_ENST00000327155.5_Missense_Mutation_p.S13C|RBBP8_ENST00000360790.5_Missense_Mutation_p.S13C	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	13					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AGCCCTAACTCTGCAGATACA	0.358								Homologous recombination																														ENST00000399722.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				24						c.(37-39)tCt>tGt	Homologous recombination	retinoblastoma binding protein 8							154.0	154.0	154.0					18																	20516852		2203	4300	6503	SO:0001583	missense	5932	0	0					g.chr18:20516852C>G	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.38C>G	chr18.hg19:g.20516852C>G	ENSP00000382628:p.Ser13Cys	1					RBBP8_ENST00000360790.5_Missense_Mutation_p.S13C|RBBP8_ENST00000399725.2_Missense_Mutation_p.S13C|RBBP8_ENST00000327155.5_Missense_Mutation_p.S13C	p.S13C	NM_203291.1	NP_976036.1	1	2	3	2.499969	Q99708	COM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;0.00196)	2	389	+	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	1	1	hg19	c.38C>G	CCDS11875.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322656	0.81580	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T;T	0.45276	1.16;0.9;1.16;0.93;1.16	5.42	5.42	0.78866	5.42	5.42	0.78866	.	0.144596	0.48286	D	0.000188	T	0.64450	0.2599	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.67150	-0.5743	10	0.87932	D	0	-13.2429	17.4189	0.87508	0.0:1.0:0.0:0.0	.	13;13;13	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	C	13	ENSP00000323050:S13C;ENSP00000382630:S13C;ENSP00000382628:S13C;ENSP00000382627:S13C;ENSP00000354024:S13C	ENSP00000323050:S13C	S	+	2	0	0	RBBP8	18770850	18770850	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.710000	0.54860	2.525000	0.85131	0.655000	0.94253	TCT	0.500000		TCGA-HZ-7919-01A-11D-2154-08	0.358	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	1	0	1		2	2	2	0		0	0	98		98	98	1	1.870000	-19.997520	1	0.400000	NM_203291			289	285		582	579	1		1	1		0	0	98	0		1.000000	1	0	33	0	42	0	289	582
FHOD3	80206	broad.mit.edu	37	18	34289290	34289290	+	Silent	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr18:34289290G>A	ENST00000359247.4	+	14	1893	c.1893G>A	c.(1891-1893)tcG>tcA	p.S631S	FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000257209.4_Silent_p.S648S|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000445677.1_Silent_p.S610S|FHOD3_ENST00000590592.1_Silent_p.S823S	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	631	Poly-Ser.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CCAGCGTCTCGTCCTCCAGCA	0.567																																						ENST00000359247.4	0.250000	0.060000	0.190000	0.090000	0.140000	0.150569	0.140000	0.140000																										0				90						c.(1891-1893)tcG>tcA		formin homology 2 domain containing 3							60.0	48.0	52.0					18																	34289290		2203	4300	6503	SO:0001819	synonymous_variant	80206	1	121412	34				g.chr18:34289290G>A	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1893G>A	chr18.hg19:g.34289290G>A		1					FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Silent_p.S823S|FHOD3_ENST00000445677.1_Silent_p.S610S|FHOD3_ENST00000257209.4_Silent_p.S648S	p.S631S	NM_001281739.1	NP_001268668.1	0	1	1	1.689471	Q2V2M9	FHOD3_HUMAN		14	1893	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	1	1	hg19	c.1893G>A		0																																																																																								0.253731		TCGA-HZ-7919-01A-11D-2154-08	0.567	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	0	0	1		2	2	2	0		0	0	28		28	27	1	1.870000	-10.260900	1	0.400000	XM_371114			9	9		253	251	0		1	1		0	0	28	0		0.994246	1.643716e-01	0	3	0	16	0	9	253
SMAD4	4089	broad.mit.edu	37	18	48604787	48604787	+	Missense_Mutation	SNP	G	G	C	rs377767385		TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr18:48604787G>C	ENST00000342988.3	+	12	2147	c.1609G>C	c.(1609-1611)Gac>Cac	p.D537H	SMAD4_ENST00000398417.2_Missense_Mutation_p.D537H|SMAD4_ENST00000588745.1_Missense_Mutation_p.D441H|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	537	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.D537Y(3)|p.?(2)|p.L536fs*11(1)|p.L536fs*14(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CCAGCTCCTAGACGAAGTACT	0.488																																						ENST00000342988.3	1.000000	0.790000	0.990000	0.860000	0.930000	0.930178	0.930000	1.000000																										43	Whole gene deletion(36)|Substitution - Missense(3)|Deletion - Frameshift(2)|Unknown(2)	p.0?(36)|p.D537Y(3)|p.?(2)|p.L536fs*11(1)|p.L536fs*14(1)	pancreas(26)|large_intestine(7)|lung(3)|breast(3)|stomach(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1609-1611)Gac>Cac		SMAD family member 4							79.0	82.0	81.0					18																	48604787		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48604787G>C	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1609G>C	chr18.hg19:g.48604787G>C	ENSP00000341551:p.Asp537His	1					SMAD4_ENST00000588745.1_Missense_Mutation_p.D441H|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.D537H	p.D537H	NM_005359.5	NP_005350.1	0	1	1	1.689471	Q13485	SMAD4_HUMAN		12	2147	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1609G>C	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921809	0.73213	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98075	-4.7;-4.7	6.07	6.07	0.98685	6.07	6.07	0.98685	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.99133	0.9701	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99323	1.0907	10	0.87932	D	0	.	19.4308	0.94765	0.0:0.0:1.0:0.0	.	537	Q13485	SMAD4_HUMAN	H	537	ENSP00000341551:D537H;ENSP00000381452:D537H	ENSP00000341551:D537H	D	+	1	0	0	SMAD4	46858785	46858785	1.000000	0.71417	0.972000	0.41901	0.957000	0.61999	9.633000	0.98432	2.885000	0.99019	0.655000	0.94253	GAC	0.253731		TCGA-HZ-7919-01A-11D-2154-08	0.488	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	2	0		0	0	78		78	77	1	1.870000	-4.948732	1	0.400000	NM_005359			98	97		308	307	1		1	1	1	0	0	78	341		1.000000	1	1	29	84	71	317	98	308
SH3GL1	6455	broad.mit.edu	37	19	4364084	4364084	+	Splice_Site	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr19:4364084C>T	ENST00000269886.3	-	5	644		c.e5+1		SH3GL1_ENST00000417295.2_Splice_Site|AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000598564.1_Splice_Site	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1						central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		AGGAGCAGCACCTGGATCTCC	0.647			T	MLL	AL																																NSCLC(94;1152 2133 30346 33362)	ENST00000269886.3	1.000000	0.760000	1.000000	0.880000	0.990000	0.958266	0.990000	1.000000				Dom	yes			Dom	yes		19	19p13.3	19p13.3	6455	T	SH3-domain GRB2-like 1 (EEN)				L	L	MLL		AL		0				26						c.e5+1		SH3-domain GRB2-like 1							35.0	31.0	32.0					19																	4364084		2203	4300	6503	SO:0001630	splice_region_variant	6455	0	0					g.chr19:4364084C>T		CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.465+1G>A	chr19.hg19:g.4364084C>T		0					AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000598564.1_Splice_Site|SH3GL1_ENST00000417295.2_Splice_Site		NM_003025.3	NP_003016.1	1	2	3	2.071686	Q99961	SH3G1_HUMAN		5	644	-			B4DRA1|E7EVZ4|M0QZV5|Q99668	Splice_Site	SNP	ENST00000269886.3	1	1	hg19		CCDS32874.1	1	.	.	.	.	.	.	.	.	.	.	.	21.9	4.212855	0.79352	.	.	ENSG00000141985	ENST00000269886;ENST00000417295	.	.	.	4.98	4.98	0.66077	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2215	0.86958	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	SH3GL1	4315084	4315084	1.000000	0.71417	0.994000	0.49952	0.761000	0.43186	7.773000	0.85462	2.315000	0.78130	0.561000	0.74099	.	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.647	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1	1	0	1		2	2	2	0		0	0	36		36	36	1	1.870000	-20.000000	1	0.400000	NM_003025	Intron		45	45		177	176	1		1	1		0	0	36	0		1.000000	4.365776e-01	0	6	0	1	0	45	177
LMTK3	114783	broad.mit.edu	37	19	49000674	49000674	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr19:49000674G>A	ENST00000600059.1	-	11	3879	c.3652C>T	c.(3652-3654)Cag>Tag	p.Q1218*	LMTK3_ENST00000270238.3_Nonsense_Mutation_p.Q1247*			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1218	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CTGTTCCCCTGAGGGGGTCCC	0.662																																						ENST00000600059.1	1.000000	0.720000	1.000000	0.800000	0.890000	0.898291	0.890000	1.000000																										0				16						c.(3652-3654)Cag>Tag		lemur tyrosine kinase 3							47.0	54.0	51.0					19																	49000674		2088	4200	6288	SO:0001587	stop_gained	114783	0	0					g.chr19:49000674G>A	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.3652C>T	chr19.hg19:g.49000674G>A	ENSP00000472020:p.Gln1218*	0					LMTK3_ENST00000270238.3_Nonsense_Mutation_p.Q1247*	p.Q1218*			1	2	3	2.099785	Q96Q04	LMTK3_HUMAN		11	3879	-		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q4G0U1	Nonsense_Mutation	SNP	ENST00000600059.1	0	1	hg19	c.3652C>T		1	.	.	.	.	.	.	.	.	.	.	G	42	9.180309	0.99091	.	.	ENSG00000142235	ENST00000270238	.	.	.	3.8	3.8	0.43715	3.8	3.8	0.43715	.	0.399027	0.19919	N	0.103125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	11.3704	0.49696	0.0:0.0:1.0:0.0	.	.	.	.	X	1247	.	ENSP00000270238:Q1247X	Q	-	1	0	0	LMTK3	53692486	53692486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.540000	0.45727	2.134000	0.65973	0.563000	0.77884	CAG	0.407115		TCGA-HZ-7919-01A-11D-2154-08	0.662	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	1	0	1		2	2	2	0		0	0	65		65	64	1	1.870000	-3.370307	1	0.400000	NM_052895			83	83		386	382	1		1	1		0	0	65	0		1.000000	2.918281e-01	0	2	0	4	0	83	386
SPHK2	56848	broad.mit.edu	37	19	49129495	49129495	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr19:49129495C>T	ENST00000245222.4	+	3	753	c.387C>T	c.(385-387)cgC>cgT	p.R129R	SPHK2_ENST00000601712.1_Silent_p.R93R|SPHK2_ENST00000600537.1_Silent_p.R70R|AC022154.7_ENST00000598735.1_RNA|SPHK2_ENST00000340932.3_Silent_p.R93R|SPHK2_ENST00000599033.1_3'UTR|SPHK2_ENST00000598088.1_Silent_p.R129R|SPHK2_ENST00000599748.1_Silent_p.R93R|AC022154.7_ENST00000600303.1_RNA|SPHK2_ENST00000599029.1_Silent_p.R93R|SPHK2_ENST00000443164.1_Silent_p.R191R|AC022154.7_ENST00000594850.1_RNA	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	129	Required for binding to sulfatide and phosphoinositides and for membrane localization.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		gggcccggcgcAGAGCCACTC	0.701																																						ENST00000245222.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999139	0.990000	1.000000																										0				19						c.(385-387)cgC>cgT		sphingosine kinase 2							8.0	9.0	9.0					19																	49129495		2089	4122	6211	SO:0001819	synonymous_variant	56848	0	0					g.chr19:49129495C>T	AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.387C>T	chr19.hg19:g.49129495C>T		0					SPHK2_ENST00000600537.1_Silent_p.R70R|AC022154.7_ENST00000600303.1_RNA|SPHK2_ENST00000599748.1_Silent_p.R93R|AC022154.7_ENST00000594850.1_RNA|AC022154.7_ENST00000598735.1_RNA|SPHK2_ENST00000599033.1_3'UTR|SPHK2_ENST00000443164.1_Silent_p.R191R|SPHK2_ENST00000599029.1_Silent_p.R93R|SPHK2_ENST00000601712.1_Silent_p.R93R|SPHK2_ENST00000598088.1_Silent_p.R129R|SPHK2_ENST00000340932.3_Silent_p.R93R	p.R129R	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	1	2	3	2.099785	Q9NRA0	SPHK2_HUMAN		3	753	+		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	ENST00000245222.4	1	1	hg19	c.387C>T	CCDS12727.1	1																																																																																								0.407115		TCGA-HZ-7919-01A-11D-2154-08	0.701	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466153.1	1	0	1		2	2	2	0		0	0	10		10	10	1	1.870000	-20.000000	1	0.400000				37	35		98	97	1		1	0		0	0	10	0		1.000000	0	0	1	0	0	0	37	98
KIF1B	23095	broad.mit.edu	37	1	10425167	10425167	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:10425167G>C	ENST00000377086.1	+	42	4578	c.4376G>C	c.(4375-4377)aGa>aCa	p.R1459T	KIF1B_ENST00000377081.1_Missense_Mutation_p.R1459T|KIF1B_ENST00000263934.6_Missense_Mutation_p.R1413T			O60333	KIF1B_HUMAN	kinesin family member 1B	1459					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GGTATGCAGAGAAGGAGAAGA	0.393																																						ENST00000377086.1	1.000000	0.520000	0.830000	0.610000	0.700000	0.725801	0.700000	0.700000																										0				71						c.(4375-4377)aGa>aCa		kinesin family member 1B							45.0	48.0	47.0					1																	10425167		2203	4300	6503	SO:0001583	missense	23095	0	0					g.chr1:10425167G>C	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4376G>C	chr1.hg19:g.10425167G>C	ENSP00000366290:p.Arg1459Thr	0					KIF1B_ENST00000377081.1_Missense_Mutation_p.R1459T|KIF1B_ENST00000263934.6_Missense_Mutation_p.R1413T	p.R1459T			1	2	3	2.106042	O60333	KIF1B_HUMAN		42	4578	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	1	1	hg19	c.4376G>C		0	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919984	0.92249	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.77620	-1.01;-1.11;-1.11	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.87196	0.6117	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.991;1.0;0.981	D;D;D;D;D;D	0.85130	0.997;0.996;0.996;0.992;0.997;0.943	D	0.88273	0.2931	10	0.87932	D	0	.	18.9755	0.92735	0.0:0.0:1.0:0.0	.	1445;1419;1459;1433;1459;1413	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	T	1459;1413;1459;1459	ENSP00000263934:R1413T;ENSP00000366290:R1459T;ENSP00000366284:R1459T	ENSP00000263934:R1413T	R	+	2	0	0	KIF1B	10347754	10347754	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.458000	0.83093	0.650000	0.86243	AGA	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.393	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1	1	0	0		2	2	2	0		0	0	35		35	35	1	1.870000	-20.000000	1	0.400000				44	41		274	269	1		1	1		0	0	35	0		1.000000	8.446035e-01	0	5	0	18	0	44	274
KIF1B	23095	broad.mit.edu	37	1	10425187	10425187	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:10425187G>C	ENST00000377086.1	+	42	4598	c.4396G>C	c.(4396-4398)Gat>Cat	p.D1466H	KIF1B_ENST00000377081.1_Missense_Mutation_p.D1466H|KIF1B_ENST00000263934.6_Missense_Mutation_p.D1420H			O60333	KIF1B_HUMAN	kinesin family member 1B	1466					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AAAAATCTTAGATACGTCAGT	0.448																																						ENST00000377086.1	1.000000	0.570000	0.870000	0.650000	0.750000	0.766273	0.750000	0.740000																										0				71						c.(4396-4398)Gat>Cat		kinesin family member 1B							52.0	55.0	54.0					1																	10425187		2203	4300	6503	SO:0001583	missense	23095	0	0					g.chr1:10425187G>C	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4396G>C	chr1.hg19:g.10425187G>C	ENSP00000366290:p.Asp1466His	0					KIF1B_ENST00000377081.1_Missense_Mutation_p.D1466H|KIF1B_ENST00000263934.6_Missense_Mutation_p.D1420H	p.D1466H			1	2	3	2.106042	O60333	KIF1B_HUMAN		42	4598	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	1	1	hg19	c.4396G>C		0	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828534	0.90955	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.80393	-1.27;-1.36;-1.37	5.29	5.29	0.74685	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.89846	0.6833	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.996	D	0.90856	0.4735	10	0.87932	D	0	.	18.9755	0.92735	0.0:0.0:1.0:0.0	.	1452;1426;1466;1440;1466;1420	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	H	1466;1420;1466;1466	ENSP00000263934:D1420H;ENSP00000366290:D1466H;ENSP00000366284:D1466H	ENSP00000263934:D1420H	D	+	1	0	0	KIF1B	10347774	10347774	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	9.869000	0.99810	2.458000	0.83093	0.650000	0.86243	GAT	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.448	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1	1	0	0		2	2	2	0		0	0	36		36	36	1	1.870000	-20.000000	1	0.400000				54	51		313	308	1		1	0		0	0	36	0		1.000000	7.375224e-01	0	1	0	16	0	54	313
KIF1B	23095	broad.mit.edu	37	1	10425500	10425500	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:10425500G>A	ENST00000377086.1	+	43	4748	c.4546G>A	c.(4546-4548)Gag>Aag	p.E1516K	KIF1B_ENST00000377081.1_Missense_Mutation_p.E1516K|KIF1B_ENST00000263934.6_Missense_Mutation_p.E1470K			O60333	KIF1B_HUMAN	kinesin family member 1B	1516					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GCTGCTGCGTGAGAGACTTGG	0.507																																						ENST00000377086.1	1.000000	0.770000	1.000000	0.870000	0.970000	0.949555	0.970000	1.000000																										0				71						c.(4546-4548)Gag>Aag		kinesin family member 1B							74.0	73.0	74.0					1																	10425500		2203	4300	6503	SO:0001583	missense	23095	0	0					g.chr1:10425500G>A	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4546G>A	chr1.hg19:g.10425500G>A	ENSP00000366290:p.Glu1516Lys	0					KIF1B_ENST00000377081.1_Missense_Mutation_p.E1516K|KIF1B_ENST00000263934.6_Missense_Mutation_p.E1470K	p.E1516K			1	2	3	2.106042	O60333	KIF1B_HUMAN		43	4748	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	1	1	hg19	c.4546G>A		1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685715	0.88639	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.74106	-0.74;-0.81;-0.81	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.109676	0.64402	D	0.000010	D	0.84880	0.5570	M	0.67397	2.05	0.80722	D	1	P;P;P;D;P;B	0.65815	0.627;0.954;0.485;0.995;0.856;0.241	B;P;B;D;B;B	0.67548	0.242;0.541;0.146;0.952;0.193;0.051	D	0.83946	0.0314	10	0.42905	T	0.14	.	19.3772	0.94517	0.0:0.0:1.0:0.0	.	1502;1476;1516;1490;1516;1470	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	K	1516;1470;1516;1516	ENSP00000263934:E1470K;ENSP00000366290:E1516K;ENSP00000366284:E1516K	ENSP00000263934:E1470K	E	+	1	0	0	KIF1B	10348087	10348087	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.861000	0.99562	2.560000	0.86352	0.650000	0.86243	GAG	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.507	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1	1	0	1		2	2	2	0		0	0	51		51	49	1	1.870000	-3.347118	1	0.400000				69	60		290	254	1		1	1		0	0	51	0		1.000000	9.943889e-01	0	5	0	31	0	69	290
ANGPTL7	10218	broad.mit.edu	37	1	11252354	11252354	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:11252354A>G	ENST00000376819.3	+	2	643	c.404A>G	c.(403-405)tAc>tGc	p.Y135C	MTOR_ENST00000361445.4_Intron	NM_021146.2	NP_066969.1	O43827	ANGL7_HUMAN	angiopoietin-like 7	135	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.39e-06)|COAD - Colon adenocarcinoma(227;0.000244)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0487)		TCTTCCCTCTACCAGAAGAAC	0.502																																						ENST00000376819.3	1.000000	0.910000	1.000000	0.980000	0.990000	0.992217	0.990000	1.000000																										0				10						c.(403-405)tAc>tGc		angiopoietin-like 7							195.0	157.0	170.0					1																	11252354		2203	4300	6503	SO:0001583	missense	10218	0	0					g.chr1:11252354A>G	Y16132	CCDS128.1	1p36	2013-02-06			ENSG00000171819	ENSG00000171819		"""Fibrinogen C domain containing"""	24078	protein-coding gene	gene with protein product						9727400, 11682471	Standard	NM_021146		Approved	CDT6, AngX	uc001ase.4	O43827	OTTHUMG00000002002	ENST00000376819.3:c.404A>G	chr1.hg19:g.11252354A>G	ENSP00000366015:p.Tyr135Cys	0					MTOR_ENST00000361445.4_Intron	p.Y135C	NM_021146.2	NP_066969.1	1	2	3	2.106042	O43827	ANGL7_HUMAN		2	643	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	B2R9B2|F1T0A6|Q4ZGK4	Missense_Mutation	SNP	ENST00000376819.3	1	1	hg19	c.404A>G	CCDS128.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.304749	0.81247	.	.	ENSG00000171819	ENST00000376819	T	0.77358	-1.09	6.17	6.17	0.99709	6.17	6.17	0.99709	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.162445	0.56097	D	0.000024	D	0.87075	0.6087	M	0.80508	2.5	0.54753	D	0.999986	D	0.69078	0.997	D	0.68353	0.957	D	0.87855	0.2660	10	0.54805	T	0.06	.	11.8437	0.52371	0.8695:0.0:0.0:0.1305	.	135	O43827	ANGL7_HUMAN	C	135	ENSP00000366015:Y135C	ENSP00000366015:Y135C	Y	+	2	0	0	ANGPTL7	11174941	11174941	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.667000	0.68067	2.371000	0.80710	0.533000	0.62120	TAC	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.502	ANGPTL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005564.1	1	0	1		2	2	2	0		0	0	106		106	105	1	1.870000	-20.000000	1	0.400000	NM_021146			124	123		461	458	1		1	0		0	0	106	0		1.000000	1.172165e-01	0	0	0	3	0	124	461
PALMD	54873	broad.mit.edu	37	1	100111897	100111897	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:100111897G>C	ENST00000263174.4	+	1	399	c.24G>C	c.(22-24)aaG>aaC	p.K8N	PALMD_ENST00000605497.1_Missense_Mutation_p.K8N	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	8					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		AGCTGGTGAAGGGAAGACTCC	0.517																																						ENST00000263174.4	1.000000	0.600000	0.830000	0.660000	0.730000	0.753436	0.730000	0.740000																										0				31						c.(22-24)aaG>aaC		palmdelphin							115.0	109.0	111.0					1																	100111897		2203	4300	6503	SO:0001583	missense	54873	0	0					g.chr1:100111897G>C	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.24G>C	chr1.hg19:g.100111897G>C	ENSP00000263174:p.Lys8Asn	0					PALMD_ENST00000605497.1_Missense_Mutation_p.K8N	p.K8N	NM_017734.4	NP_060204.1	1	2	3	2.095766	Q9NP74	PALMD_HUMAN		1	399	+		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	1	1	hg19	c.24G>C	CCDS758.1	0	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631881	0.46944	.	.	ENSG00000099260	ENST00000263174	T	0.22945	1.93	5.52	3.66	0.41972	5.52	3.66	0.41972	.	0.171232	0.49916	D	0.000127	T	0.23133	0.0559	L	0.59436	1.845	0.53005	D	0.999967	D	0.54047	0.964	P	0.52672	0.706	T	0.02603	-1.1135	10	0.87932	D	0	-11.1216	9.9661	0.41725	0.2732:0.0:0.7268:0.0	.	8	Q9NP74	PALMD_HUMAN	N	8	ENSP00000263174:K8N	ENSP00000263174:K8N	K	+	3	2	2	PALMD	99884485	99884485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.717000	0.47227	0.702000	0.31825	0.561000	0.74099	AAG	0.407115		TCGA-HZ-7919-01A-11D-2154-08	0.517	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	1	0	1		2	2	2	0		0	0	76		76	75	1	1.870000	-2.402428	0	0.400000	NM_017734			94	92		551	545	1		1	0		0	0	76	0		1.000000	8.820106e-01	0	0	0	24	0	94	551
RSBN1	54665	broad.mit.edu	37	1	114340098	114340098	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:114340098G>C	ENST00000261441.5	-	2	1327	c.1264C>G	c.(1264-1266)Ctc>Gtc	p.L422V		NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	422						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGTCTGGGAGATAAGCAGCC	0.393																																						ENST00000261441.5	1.000000	0.570000	0.880000	0.650000	0.760000	0.771509	0.760000	0.750000																										0				29						c.(1264-1266)Ctc>Gtc		round spermatid basic protein 1							51.0	53.0	52.0					1																	114340098		2203	4300	6503	SO:0001583	missense	54665	0	0					g.chr1:114340098G>C	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.1264C>G	chr1.hg19:g.114340098G>C	ENSP00000261441:p.Leu422Val	0						p.L422V	NM_018364.3	NP_060834.2	1	2	3	2.081241	Q5VWQ0	RSBN1_HUMAN		2	1327	-	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	ENST00000261441.5	1	1	hg19	c.1264C>G	CCDS862.1	0	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586901	0.46110	.	.	ENSG00000081019	ENST00000261441	.	.	.	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	M	0.81802	2.56	0.58432	D	0.999999	D	0.67145	0.996	D	0.75484	0.986	T	0.77490	-0.2568	9	0.87932	D	0	-8.013	10.3789	0.44099	0.1484:0.0:0.8516:0.0	.	422	Q5VWQ0	RSBN1_HUMAN	V	422	.	ENSP00000261441:L422V	L	-	1	0	0	RSBN1	114141621	114141621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.716000	0.61916	2.824000	0.97209	0.655000	0.94253	CTC	0.404762		TCGA-HZ-7919-01A-11D-2154-08	0.393	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	1	0	1		2	2	2	0		0	0	54		54	54	1	1.870000	-20.000000	1	0.400000	NM_018364			46	46		260	255	1		1	1		0	0	54	0		1.000000	9.247564e-01	0	6	0	21	0	46	260
MUC1	4582	broad.mit.edu	37	1	155161799	155161799	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:155161799T>G	ENST00000368395.1	-	2	405	c.334A>C	c.(334-336)Acc>Ccc	p.T112P	MUC1_ENST00000462215.1_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000368390.3_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000368398.3_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	892					cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTGGCGGGGTGGTGGAGCCC	0.711			T	IGH@	B-NHL																																	ENST00000368395.1	1.000000	0.830000	1.000000	0.990000	0.990000	0.986776	0.990000	1.000000				Dom	yes			Dom	yes		1	1q21	1q21	4582	T	"""mucin 1, transmembrane"""				L	L	IGH@		B-NHL		0				10						c.(334-336)Acc>Ccc		mucin 1, cell surface associated																																				SO:0001583	missense	4582	181	120668	36				g.chr1:155161799T>G	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.334A>C	chr1.hg19:g.155161799T>G	ENSP00000357380:p.Thr112Pro	0					RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000368390.3_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000368398.3_Intron	p.T112P	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	1	2	3	2.106713	P15941	MUC1_HUMAN	Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)	2	405	-	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Missense_Mutation	SNP	ENST00000368395.1	0	1	hg19	c.334A>C	CCDS55640.1	1	.	.	.	.	.	.	.	.	.	.	T	8.249	0.808546	0.16467	.	.	ENSG00000185499	ENST00000368395;ENST00000425082	T	0.20200	2.09	2.73	0.35	0.16037	2.73	0.35	0.16037	.	2.188600	0.02617	N	0.102742	T	0.11024	0.0269	N	0.14661	0.345	0.09310	N	0.999999	D	0.65815	0.995	D	0.68483	0.958	T	0.17684	-1.0361	10	0.39692	T	0.17	.	3.1844	0.06596	0.0:0.2782:0.2183:0.5034	.	112	P15941	MUC1_HUMAN	P	112	ENSP00000357380:T112P	ENSP00000357380:T112P	T	-	1	0	0	MUC1	153428423	153428423	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.417000	0.07088	0.027000	0.15297	-1.038000	0.02383	ACC	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.711	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086735.1	0	0	1		20	60	2	2		2	2	21		21	21	1	1.870000	-2.661886	1	0.400000	NM_002456			26	25		84	80	0		1	0		2	0	21	0		0.829618	9.822628e-01	0	12	0	377	0	26	84
RNPEP	6051	broad.mit.edu	37	1	201966564	201966564	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:201966564C>T	ENST00000295640.4	+	5	1015	c.972C>T	c.(970-972)atC>atT	p.I324I	RP11-465N4.4_ENST00000419190.1_RNA|RP11-465N4.4_ENST00000415582.1_RNA|RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.5_ENST00000608886.1_RNA|RNPEP_ENST00000367286.3_Silent_p.I285I	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	324					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		ATGTCATCATCCATGAGATCT	0.547																																					GBM(19;39 479 7473 13131 19462)	ENST00000295640.4	1.000000	0.750000	1.000000	0.820000	0.900000	0.906802	0.900000	1.000000																										0				21						c.(970-972)atC>atT		arginyl aminopeptidase (aminopeptidase B)							124.0	110.0	115.0					1																	201966564		2203	4300	6503	SO:0001819	synonymous_variant	6051	0	0					g.chr1:201966564C>T	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.972C>T	chr1.hg19:g.201966564C>T		0					RP11-465N4.5_ENST00000608886.1_RNA|RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000415582.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA|RNPEP_ENST00000367286.3_Silent_p.I285I	p.I324I	NM_020216.3	NP_064601.3	1	2	3	2.106713	Q9H4A4	AMPB_HUMAN		5	1015	+			Q9BVM9|Q9H1D4|Q9NPT7	Silent	SNP	ENST00000295640.4	1	1	hg19	c.972C>T	CCDS1418.1	1																																																																																								0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.547	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	1	0	0		2	2	2	0		0	0	102		102	101	1	1.870000	-20.000000	1	0.400000	NM_020216			109	109		503	499	0		1	1		0	0	102	0		1.000000	1	0	58	0	162	0	109	503
RNPEP	6051	broad.mit.edu	37	1	201966573	201966573	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:201966573C>T	ENST00000295640.4	+	5	1024	c.981C>T	c.(979-981)atC>atT	p.I327I	RP11-465N4.4_ENST00000419190.1_RNA|RP11-465N4.4_ENST00000415582.1_RNA|RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.5_ENST00000608886.1_RNA|RNPEP_ENST00000367286.3_Silent_p.I288I	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	327					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TCCATGAGATCTCCCACAGTT	0.542																																					GBM(19;39 479 7473 13131 19462)	ENST00000295640.4	1.000000	0.680000	0.930000	0.750000	0.830000	0.845933	0.830000	0.830000																										0				21						c.(979-981)atC>atT		arginyl aminopeptidase (aminopeptidase B)							122.0	108.0	113.0					1																	201966573		2203	4300	6503	SO:0001819	synonymous_variant	6051	0	0					g.chr1:201966573C>T	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.981C>T	chr1.hg19:g.201966573C>T		0					RP11-465N4.5_ENST00000608886.1_RNA|RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000415582.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA|RNPEP_ENST00000367286.3_Silent_p.I288I	p.I327I	NM_020216.3	NP_064601.3	1	2	3	2.106713	Q9H4A4	AMPB_HUMAN		5	1024	+			Q9BVM9|Q9H1D4|Q9NPT7	Silent	SNP	ENST00000295640.4	1	1	hg19	c.981C>T	CCDS1418.1	0																																																																																								0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.542	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	1	0	0		2	2	2	0		0	0	99		99	98	1	1.870000	-20.000000	1	0.400000	NM_020216			100	100		508	505	1		1	1		0	0	99	0		1.000000	1	0	53	0	160	0	100	508
BTG2	7832	broad.mit.edu	37	1	203276480	203276480	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:203276480T>G	ENST00000290551.4	+	2	462	c.391T>G	c.(391-393)Tcc>Gcc	p.S131A	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	131					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			ACTGGCCGCCTCCTGTGGGCT	0.652																																						ENST00000290551.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999498	0.990000	1.000000																										0				9						c.(391-393)Tcc>Gcc		BTG family, member 2							43.0	47.0	46.0					1																	203276480		2203	4300	6503	SO:0001583	missense	7832	0	0					g.chr1:203276480T>G		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.391T>G	chr1.hg19:g.203276480T>G	ENSP00000290551:p.Ser131Ala	0					RP11-134P9.1_ENST00000457348.1_lincRNA	p.S131A	NM_006763.2	NP_006754.1	1	2	3	2.106713	P78543	BTG2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.203)	2	462	+			A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	1	1	hg19	c.391T>G	CCDS1437.1	1	.	.	.	.	.	.	.	.	.	.	T	8.763	0.924122	0.18056	.	.	ENSG00000159388	ENST00000290551	T	0.24151	1.87	5.06	3.91	0.45181	5.06	3.91	0.45181	.	0.094228	0.45361	D	0.000365	T	0.19248	0.0462	L	0.44542	1.39	0.32156	N	0.58352	B	0.14805	0.011	B	0.16289	0.015	T	0.09164	-1.0687	10	0.38643	T	0.18	-12.5884	6.3092	0.21154	0.0:0.0854:0.1574:0.7572	.	131	P78543	BTG2_HUMAN	A	131	ENSP00000290551:S131A	ENSP00000290551:S131A	S	+	1	0	0	BTG2	201543103	201543103	1.000000	0.71417	0.995000	0.50966	0.423000	0.31445	1.427000	0.34881	1.911000	0.55334	0.260000	0.18958	TCC	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.652	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	1	0	1		2	2	2	0		0	0	69		69	68	1	1.870000	-20.000000	1	0.400000	NM_006763			144	142		479	475	1		1	1		0	0	69	0		1.000000	9.998827e-01	0	3	0	43	0	144	479
CCDC27	148870	broad.mit.edu	37	1	3673402	3673402	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:3673402A>T	ENST00000294600.2	+	4	743	c.659A>T	c.(658-660)cAg>cTg	p.Q220L		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	220										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		GTCGCATCTCAGAGCTGCCTG	0.572																																						ENST00000294600.2	1.000000	0.040000	0.200000	0.070000	0.120000	0.179848	0.120000	0.110000																										0				36						c.(658-660)cAg>cTg		coiled-coil domain containing 27							50.0	49.0	49.0					1																	3673402		2203	4300	6503	SO:0001583	missense	148870	0	0					g.chr1:3673402A>T		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.659A>T	chr1.hg19:g.3673402A>T	ENSP00000294600:p.Gln220Leu	0						p.Q220L	NM_152492.2	NP_689705.2	1	2	3	2.106042	Q2M243	CCD27_HUMAN		4	743	+	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)	Q5TBV3|Q96M50	Missense_Mutation	SNP	ENST00000294600.2	0	1	hg19	c.659A>T	CCDS50.1	0	.	.	.	.	.	.	.	.	.	.	A	12.01	1.809654	0.31961	.	.	ENSG00000162592	ENST00000294600	T	0.21031	2.03	3.84	1.11	0.20524	3.84	1.11	0.20524	.	0.944655	0.08686	N	0.908701	T	0.14570	0.0352	L	0.29908	0.895	0.09310	N	1	P	0.42584	0.784	B	0.40101	0.319	T	0.21484	-1.0244	10	0.66056	D	0.02	-10.1696	3.8496	0.08949	0.5575:0.2248:0.0:0.2177	.	220	Q2M243	CCD27_HUMAN	L	220	ENSP00000294600:Q220L	ENSP00000294600:Q220L	Q	+	2	0	0	CCDC27	3663262	3663262	0.065000	0.20965	0.006000	0.13384	0.246000	0.25737	1.393000	0.34497	0.584000	0.29591	0.260000	0.18958	CAG	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.572	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009740.1	0	0	0		2	2	2	0		0	0	25		25	25	1	1.870000	-7.021168	1	0.400000	NM_152492			5	5		223	222	0		1			0	0	25	0		0.937506	0	0	0	0	0	0	5	223
MARK1	4139	broad.mit.edu	37	1	220752846	220752846	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr1:220752846A>C	ENST00000366917.4	+	2	468	c.202A>C	c.(202-204)Aag>Cag	p.K68Q	MARK1_ENST00000485104.1_3'UTR|MARK1_ENST00000366918.4_Missense_Mutation_p.K68Q|MARK1_ENST00000402574.1_5'UTR					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AACAATAGGGAAGGGAAATTT	0.433																																						ENST00000366917.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999976	0.990000	1.000000																										0				63						c.(202-204)Aag>Cag		MAP/microtubule affinity-regulating kinase 1							94.0	89.0	90.0					1																	220752846		2203	4300	6503	SO:0001583	missense	4139	0	0					g.chr1:220752846A>C	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.202A>C	chr1.hg19:g.220752846A>C	ENSP00000355884:p.Lys68Gln	0					MARK1_ENST00000402574.1_5'UTR|MARK1_ENST00000485104.1_3'UTR|MARK1_ENST00000366918.4_Missense_Mutation_p.K68Q	p.K68Q			1	2	3	2.103513				2	468	+				Missense_Mutation	SNP	ENST00000366917.4	1	1	hg19	c.202A>C	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.032418	0.93575	.	.	ENSG00000116141	ENST00000366918;ENST00000366917	T;T	0.65364	1.78;-0.15	5.76	5.76	0.90799	5.76	5.76	0.90799	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64516	0.2605	N	0.16567	0.415	0.80722	D	1	P;D;D	0.69078	0.895;0.985;0.997	B;P;P	0.61592	0.313;0.681;0.891	T	0.70622	-0.4821	10	0.87932	D	0	.	16.0789	0.80985	1.0:0.0:0.0:0.0	.	68;68;68	B4DIB3;Q9P0L2;Q9P0L2-3	.;MARK1_HUMAN;.	Q	68	ENSP00000355885:K68Q;ENSP00000355884:K68Q	ENSP00000355884:K68Q	K	+	1	0	0	MARK1	218819469	218819469	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.192000	0.70111	0.460000	0.39030	AAG	0.408284		TCGA-HZ-7919-01A-11D-2154-08	0.433	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1	1	0	1		2	2	2	0		0	0	51		51	50	1	1.870000	-20.000000	1	0.400000				122	121		356	353	1		1	0		0	0	51	0		1.000000	1.639172e-01	0	0	0	3	0	122	356
RIN2	54453	broad.mit.edu	37	20	19981313	19981313	+	Silent	SNP	C	C	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr20:19981313C>G	ENST00000255006.6	+	12	2717	c.2568C>G	c.(2566-2568)ctC>ctG	p.L856L	RIN2_ENST00000440354.2_Silent_p.L374L|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	807	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						GAAAGACCCTCCTTGTGAGAC	0.498																																						ENST00000255006.6	0.970000	0.700000	0.900000	0.760000	0.830000	0.838373	0.830000	0.840000																										0				27						c.(2566-2568)ctC>ctG		Ras and Rab interactor 2							153.0	150.0	151.0					20																	19981313		2037	4204	6241	SO:0001819	synonymous_variant	54453	0	0					g.chr20:19981313C>G	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2568C>G	chr20.hg19:g.19981313C>G		0					RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Silent_p.L374L	p.L856L	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	1	2	3	2.055373	Q8WYP3	RIN2_HUMAN		12	2717	+			Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000255006.6	1	1	hg19	c.2568C>G	CCDS56182.1	0																																																																																								0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.498	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1	1	0	1		2	2	2	0		0	0	111		111	111	1	1.870000	-3.225761	1	0.400000				135	133		674	669	1		1	1		0	0	111	0		1.000000	1	0	30	0	114	0	135	674
TOX2	84969	broad.mit.edu	37	20	42694633	42694633	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr20:42694633C>T	ENST00000358131.5	+	6	1396	c.1188C>T	c.(1186-1188)ggC>ggT	p.G396G	TOX2_ENST00000423191.2_Silent_p.G372G|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000341197.4_Silent_p.G414G|TOX2_ENST00000372999.1_Silent_p.G372G	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	396	Pro-rich.				female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			ACGCCCAGGGCGCCCTCCTCA	0.711																																						ENST00000358131.5	1.000000	0.610000	0.930000	0.700000	0.810000	0.821121	0.810000	1.000000																										0				26						c.(1186-1188)ggC>ggT		TOX high mobility group box family member 2							26.0	29.0	28.0					20																	42694633		2202	4297	6499	SO:0001819	synonymous_variant	84969	0	0					g.chr20:42694633C>T	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1188C>T	chr20.hg19:g.42694633C>T		0					TOX2_ENST00000372999.1_Silent_p.G372G|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000341197.4_Silent_p.G414G|TOX2_ENST00000423191.2_Silent_p.G372G	p.G396G	NM_001098798.1	NP_001092268.1	1	2	3	2.055373	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)	6	1396	+		Myeloproliferative disorder(115;0.00452)	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	1	1	hg19	c.1188C>T	CCDS42875.1	0																																																																																								0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.711	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2	1	0	1		2	2	2	0		0	0	31		31	31	1	1.870000	-20.000000	1	0.400000				45	43		231	225	0		1			0	0	31	0		1.000000	0	0	0	0	0	0	45	231
COL6A2	1292	broad.mit.edu	37	21	47545202	47545202	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			T	A	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr21:47545202T>A	ENST00000300527.4	+	24	1897	c.1793T>A	c.(1792-1794)gTg>gAg	p.V598E	COL6A2_ENST00000357838.4_Missense_Mutation_p.V598E|COL6A2_ENST00000397763.1_Missense_Mutation_p.V598E|COL6A2_ENST00000409416.1_Missense_Mutation_p.V598E|COL6A2_ENST00000310645.5_Missense_Mutation_p.V598E	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	598	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ATGACCTACGTGAGGGAGACC	0.687																																						ENST00000300527.4	0.180000	0.080000	0.150000	0.100000	0.120000	0.131362	0.120000	0.130000																										0				43						c.(1792-1794)gTg>gAg		collagen, type VI, alpha 2							98.0	97.0	97.0					21																	47545202		2203	4300	6503	SO:0001583	missense	1292	0	0					g.chr21:47545202T>A	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1793T>A	chr21.hg19:g.47545202T>A	ENSP00000300527:p.Val598Glu	1					COL6A2_ENST00000357838.4_Missense_Mutation_p.V598E|COL6A2_ENST00000397763.1_Missense_Mutation_p.V598E|COL6A2_ENST00000310645.5_Missense_Mutation_p.V598E|COL6A2_ENST00000409416.1_Missense_Mutation_p.V598E	p.V598E	NM_001849.3	NP_001840.3	0	1	1	1.747637	P12110	CO6A2_HUMAN		24	1897	+	Breast(49;0.245)		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	1	1	hg19	c.1793T>A	CCDS13728.1	0	.	.	.	.	.	.	.	.	.	.	T	26.8	4.773717	0.90108	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	D;D;D;D;D;T	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33;-1.12	4.51	4.51	0.55191	4.51	4.51	0.55191	.	0.286383	0.35739	N	0.003001	D	0.95551	0.8554	M	0.65498	2.005	0.54753	D	0.999989	D;D;D	0.69078	0.995;0.997;0.994	P;D;P	0.66497	0.841;0.944;0.9	D	0.95952	0.8955	10	0.87932	D	0	-19.3525	13.8316	0.63384	0.0:0.0:0.0:1.0	.	598;598;598	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	E	598;598;598;598;598;139	ENSP00000300527:V598E;ENSP00000350497:V598E;ENSP00000312529:V598E;ENSP00000387115:V598E;ENSP00000380870:V598E;ENSP00000395751:V139E	ENSP00000300527:V598E	V	+	2	0	0	COL6A2	46369630	46369630	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.636000	0.83301	1.683000	0.51011	0.472000	0.43445	GTG	0.287411		TCGA-HZ-7919-01A-11D-2154-08	0.687	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1	0	0	1		2	2	2	0		0	0	147		147	144	1	1.870000	-19.999730	1	0.400000				30	30		959	943	0		1	0		0	0	147	0		1.000000	9.999976e-01	0	0	0	634	0	30	959
SLC5A1	6523	broad.mit.edu	37	22	32464533	32464533	+	Silent	SNP	C	C	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr22:32464533C>A	ENST00000266088.4	+	5	673	c.423C>A	c.(421-423)atC>atA	p.I141I	SLC5A1_ENST00000543737.1_Silent_p.I14I	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	141					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	GCCAGCGGATCCAGGTCTACC	0.602																																						ENST00000266088.4	1.000000	0.780000	1.000000	0.870000	0.960000	0.946964	0.960000	1.000000																										0				37						c.(421-423)atC>atA		solute carrier family 5 (sodium/glucose cotransporter), member 1	Canagliflozin(DB08907)						161.0	126.0	138.0					22																	32464533		2203	4300	6503	SO:0001819	synonymous_variant	6523	0	0					g.chr22:32464533C>A		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.423C>A	chr22.hg19:g.32464533C>A		0					SLC5A1_ENST00000543737.1_Silent_p.I14I	p.I141I	NM_000343.3	NP_000334.1	1	2	3	2.095467	P13866	SC5A1_HUMAN		5	673	+			B2R7E2|B7Z4Q9|B7ZA69	Silent	SNP	ENST00000266088.4	1	1	hg19	c.423C>A	CCDS13902.1	1																																																																																								0.407115		TCGA-HZ-7919-01A-11D-2154-08	0.602	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	1	0	1		2	2	2	0		0	0	60		60	60	1	1.870000	-20.000000	1	0.400000	NM_000343			88	88		374	370	1		1	1		0	0	60	0		1.000000	1	0	30	0	93	0	88	374
ENTHD1	150350	broad.mit.edu	37	22	40257992	40257992	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr22:40257992A>C	ENST00000325157.6	-	3	620	c.370T>G	c.(370-372)Tct>Gct	p.S124A		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	124	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.									breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					ACTTGCTTAGATTTTTCCCGG	0.353																																						ENST00000325157.6	0.330000	0.070000	0.250000	0.120000	0.170000	0.192677	0.170000	0.170000																										0				32						c.(370-372)Tct>Gct		ENTH domain containing 1							50.0	44.0	46.0					22																	40257992		2203	4300	6503	SO:0001583	missense	150350	0	0					g.chr22:40257992A>C	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.370T>G	chr22.hg19:g.40257992A>C	ENSP00000317431:p.Ser124Ala	1						p.S124A	NM_152512.3	NP_689725.2	0	1	1	1.658663	Q8IYW4	ENTD1_HUMAN		3	620	-	Melanoma(58;0.0749)		B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	1	1	hg19	c.370T>G	CCDS13998.1	0	.	.	.	.	.	.	.	.	.	.	A	12.61	1.990702	0.35131	.	.	ENSG00000176177	ENST00000325157	T	0.37058	1.22	6.17	5.12	0.69794	6.17	5.12	0.69794	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.175744	0.40385	N	0.001101	T	0.17152	0.0412	N	0.01410	-0.885	0.28314	N	0.92253	B	0.30870	0.298	B	0.43728	0.429	T	0.43261	-0.9402	10	0.06099	T	0.92	-9.4664	9.6484	0.39881	0.845:0.0:0.0:0.155	.	124	Q8IYW4	ENTD1_HUMAN	A	124	ENSP00000317431:S124A	ENSP00000317431:S124A	S	-	1	0	0	ENTHD1	38587938	38587938	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	3.170000	0.50816	1.105000	0.41606	0.533000	0.62120	TCT	0.250000		TCGA-HZ-7919-01A-11D-2154-08	0.353	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	1	0	1		2	2	2	0		0	0	31		31	31	1	1.870000	-10.173050	1	0.400000	NM_152512			7	7		154	152	0		1	0		0	0	31	0		0.980479	0	0	0	0	1	0	7	154
GREB1	9687	broad.mit.edu	37	2	11742547	11742547	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr2:11742547C>T	ENST00000381486.2	+	17	2845	c.2545C>T	c.(2545-2547)Cat>Tat	p.H849Y	GREB1_ENST00000234142.5_Missense_Mutation_p.H849Y	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	849						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGACTTATATCATGAAAATAA	0.507																																					Ovarian(39;850 945 2785 23371 33093)	ENST00000381486.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				30						c.(2545-2547)Cat>Tat		growth regulation by estrogen in breast cancer 1							152.0	152.0	152.0					2																	11742547		1901	4137	6038	SO:0001583	missense	9687	0	0					g.chr2:11742547C>T		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2545C>T	chr2.hg19:g.11742547C>T	ENSP00000370896:p.His849Tyr	1					GREB1_ENST00000234142.5_Missense_Mutation_p.H849Y	p.H849Y	NM_014668.3	NP_055483.2	0	2	2	2.071645	Q4ZG55	GREB1_HUMAN		17	2845	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	1	1	hg19	c.2545C>T	CCDS42655.1	1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984251	0.53827	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000432985	T;T;T	0.47869	0.83;0.83;0.83	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.252735	0.39020	N	0.001498	T	0.45155	0.1328	L	0.50333	1.59	0.80722	D	1	B;P	0.40875	0.429;0.731	B;B	0.37091	0.241;0.241	T	0.33777	-0.9855	10	0.29301	T	0.29	-41.315	19.6906	0.95999	0.0:1.0:0.0:0.0	.	483;849	C9JIG0;Q4ZG55	.;GREB1_HUMAN	Y	849;849;483	ENSP00000370896:H849Y;ENSP00000234142:H849Y;ENSP00000403886:H483Y	ENSP00000234142:H849Y	H	+	1	0	0	GREB1	11659998	11659998	1.000000	0.71417	0.113000	0.21522	0.687000	0.40016	5.669000	0.68081	2.649000	0.89929	0.655000	0.94253	CAT	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.507	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	1	0	1		2	2	2	0		0	0	118		118	117	1	1.870000	-20.000000	1	0.400000	NM_014668			343	341		585	581	1		1	0		0	0	118	0		1.000000	0	0	0	0	1	0	343	585
PLEKHH2	130271	broad.mit.edu	37	2	43965587	43965587	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr2:43965587G>C	ENST00000282406.4	+	20	3161	c.3051G>C	c.(3049-3051)caG>caC	p.Q1017H		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1017	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTGAGCTGCAGAATGAAATTT	0.393																																						ENST00000282406.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				56						c.(3049-3051)caG>caC		pleckstrin homology domain containing, family H (with MyTH4 domain) member 2							92.0	94.0	94.0					2																	43965587		2203	4300	6503	SO:0001583	missense	130271	0	0					g.chr2:43965587G>C	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3051G>C	chr2.hg19:g.43965587G>C	ENSP00000282406:p.Gln1017His	1						p.Q1017H	NM_172069.3	NP_742066.2	0	2	2	2.071645	Q8IVE3	PKHH2_HUMAN		20	3161	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	1	1	hg19	c.3051G>C	CCDS1812.1	1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516918	0.64634	.	.	ENSG00000152527	ENST00000282406	D	0.91792	-2.91	5.53	3.74	0.42951	5.53	3.74	0.42951	MyTH4 domain (3);	0.000000	0.85682	D	0.000000	D	0.95503	0.8539	M	0.82517	2.595	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.94785	0.7957	10	0.87932	D	0	-15.4565	9.9364	0.41554	0.2346:0.0:0.7654:0.0	.	1017;454	Q8IVE3;Q8IVE3-2	PKHH2_HUMAN;.	H	1017	ENSP00000282406:Q1017H	ENSP00000282406:Q1017H	Q	+	3	2	2	PLEKHH2	43819091	43819091	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.416000	0.52707	0.707000	0.31934	0.561000	0.74099	CAG	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.393	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	1	0	1		2	2	2	0		0	0	96		96	96	1	1.870000	-20.000000	1	0.400000	NM_172069			270	267		418	413	1		1	1		0	0	96	0		1.000000	8.831917e-01	0	4	0	4	0	270	418
ARHGAP15	55843	broad.mit.edu	37	2	143913143	143913143	+	Silent	SNP	C	C	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr2:143913143C>A	ENST00000295095.6	+	2	251	c.84C>A	c.(82-84)atC>atA	p.I28I	ARHGAP15_ENST00000409869.1_Silent_p.I28I	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	28					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AAATGAGAATCAAAAATGCCA	0.448																																						ENST00000295095.6	0.260000	0.070000	0.200000	0.100000	0.140000	0.157346	0.140000	0.140000																										0				34						c.(82-84)atC>atA		Rho GTPase activating protein 15							96.0	84.0	88.0					2																	143913143		2203	4300	6503	SO:0001819	synonymous_variant	55843	0	0					g.chr2:143913143C>A	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.84C>A	chr2.hg19:g.143913143C>A		1					ARHGAP15_ENST00000409869.1_Silent_p.I28I	p.I28I	NM_018460.3	NP_060930.3	0	2	2	2.071645	Q53QZ3	RHG15_HUMAN		2	251	+			Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	1	1	hg19	c.84C>A	CCDS2184.1	0																																																																																								0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.448	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	0	0	1		2	2	2	0		0	0	39		39	39	1	1.870000	-3.103658	1	0.400000	NM_018460			10	10		336	322	0		1	0		0	0	39	0		0.996288	9.291647e-02	0	0	0	16	0	10	336
ANKRD28	23243	broad.mit.edu	37	3	15718557	15718557	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr3:15718557C>T	ENST00000399451.2	-	26	3074	c.2707G>A	c.(2707-2709)Gaa>Aaa	p.E903K	ANKRD28_ENST00000383777.1_Missense_Mutation_p.E936K|ANKRD28_ENST00000497037.1_5'UTR	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	903						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						GCACTAGTTTCATGACCCTAT	0.358																																						ENST00000399451.2	1.000000	0.770000	1.000000	0.860000	0.960000	0.943102	0.960000	1.000000																										0				6						c.(2707-2709)Gaa>Aaa		ankyrin repeat domain 28							146.0	138.0	141.0					3																	15718557		1878	4121	5999	SO:0001583	missense	23243	0	0					g.chr3:15718557C>T	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.2707G>A	chr3.hg19:g.15718557C>T	ENSP00000382379:p.Glu903Lys	0					ANKRD28_ENST00000497037.1_5'UTR|ANKRD28_ENST00000383777.1_Missense_Mutation_p.E936K	p.E903K	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	1	2	3	2.060951	O15084	ANR28_HUMAN		26	3074	-			B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	ENST00000399451.2	1	1	hg19	c.2707G>A	CCDS46769.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.496535	0.96355	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.64991	-0.13;-0.13;-0.13	5.38	5.38	0.77491	5.38	5.38	0.77491	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.63674	0.2531	L	0.35341	1.055	0.80722	D	1	P	0.51791	0.948	P	0.56343	0.796	T	0.55347	-0.8155	10	0.06365	T	0.9	.	19.4958	0.95072	0.0:1.0:0.0:0.0	.	903	O15084	ANR28_HUMAN	K	903;936;903	ENSP00000382379:E903K;ENSP00000373287:E936K;ENSP00000397341:E903K	ENSP00000373287:E936K	E	-	1	0	0	ANKRD28	15693561	15693561	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.647000	0.83462	2.681000	0.91329	0.650000	0.86243	GAA	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.358	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339758.1	1	0	1		2	2	2	0		0	0	49		49	49	1	1.870000	-20.000000	1	0.400000	NM_015199			78	74		327	321	1		1	1		0	0	49	0		1.000000	9.999794e-01	0	25	0	43	0	78	327
FBXO40	51725	broad.mit.edu	37	3	121345596	121345596	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr3:121345596G>A	ENST00000338040.4	+	4	2383	c.1969G>A	c.(1969-1971)Gtc>Atc	p.V657I		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	657					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		GTTTAATGAAGTCACCTCCAT	0.458																																						ENST00000338040.4	0.170000	0.060000	0.140000	0.080000	0.100000	0.122420	0.100000	0.110000																										0				46						c.(1969-1971)Gtc>Atc		F-box protein 40							151.0	151.0	151.0					3																	121345596		2203	4300	6503	SO:0001583	missense	51725	0	0					g.chr3:121345596G>A	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1969G>A	chr3.hg19:g.121345596G>A	ENSP00000337510:p.Val657Ile	0						p.V657I	NM_016298.3	NP_057382.2	1	2	3	2.069617	Q9UH90	FBX40_HUMAN		4	2383	+			B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	1	1	hg19	c.1969G>A	CCDS33835.1	0	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451162	0.43531	.	.	ENSG00000163833	ENST00000338040	T	0.30714	1.52	6.17	5.3	0.74995	6.17	5.3	0.74995	F-box domain, Skp2-like (1);	0.244440	0.40144	N	0.001170	T	0.20333	0.0489	L	0.28608	0.87	0.37080	D	0.898954	B	0.31318	0.319	B	0.30105	0.111	T	0.07046	-1.0793	10	0.06494	T	0.89	-14.5867	13.5664	0.61822	0.0747:0.0:0.9253:0.0	.	657	Q9UH90	FBX40_HUMAN	I	657	ENSP00000337510:V657I	ENSP00000337510:V657I	V	+	1	0	0	FBXO40	122828286	122828286	0.692000	0.27719	0.985000	0.45067	0.990000	0.78478	1.954000	0.40362	1.626000	0.50381	0.655000	0.94253	GTC	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.458	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	0	0	1		2	2	2	0		0	0	139		139	138	1	1.870000	-16.720990	1	0.400000	NM_016298			25	25		1119	1109	0		1			0	0	139	0		1.000000	0	0	0	0	0	0	25	1119
FBXO45	200933	broad.mit.edu	37	3	196311085	196311085	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr3:196311085G>A	ENST00000311630.6	+	3	1054	c.757G>A	c.(757-759)Gct>Act	p.A253T	FBXO45_ENST00000440469.1_Missense_Mutation_p.A74T	NM_001105573.1	NP_001099043.1	P0C2W1	FBSP1_HUMAN	F-box protein 45	253	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				anterior commissure morphogenesis (GO:0021960)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|corticospinal tract morphogenesis (GO:0021957)|neuron migration (GO:0001764)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|synapse assembly involved in innervation (GO:0060386)	cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	7	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		CCTGGGGGTTGCTTTTAGAGG	0.418																																						ENST00000311630.6	1.000000	0.830000	1.000000	0.930000	0.990000	0.977236	0.990000	1.000000																										0				7						c.(757-759)Gct>Act		F-box protein 45							123.0	121.0	121.0					3																	196311085		1860	4087	5947	SO:0001583	missense	200933	0	0					g.chr3:196311085G>A	AK025697	CCDS46985.1	3q29	2008-02-05			ENSG00000174013	ENSG00000174013		"""F-boxes /  ""other"""""	29148	protein-coding gene	gene with protein product		609112					Standard	NM_001105573		Approved	Fbx45	uc010iai.3	P0C2W1	OTTHUMG00000155571	ENST00000311630.6:c.757G>A	chr3.hg19:g.196311085G>A	ENSP00000310332:p.Ala253Thr	0					FBXO45_ENST00000440469.1_Missense_Mutation_p.A74T	p.A253T	NM_001105573.1	NP_001099043.1	1	2	3	2.069617	P0C2W1	FBSP1_HUMAN	Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	3	1054	+	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		A6NF90|D3DXB5	Missense_Mutation	SNP	ENST00000311630.6	1	1	hg19	c.757G>A	CCDS46985.1	1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629998	0.87660	.	.	ENSG00000174013	ENST00000440469;ENST00000311630	T;T	0.60548	0.18;0.18	4.97	4.97	0.65823	4.97	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.79592	0.4472	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82756	-0.0300	10	0.87932	D	0	-10.3492	18.7709	0.91892	0.0:0.0:1.0:0.0	.	253	P0C2W1	FBSP1_HUMAN	T	74;253	ENSP00000389868:A74T;ENSP00000310332:A253T	ENSP00000310332:A253T	A	+	1	0	0	FBXO45	197795482	197795482	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.985000	0.93487	2.740000	0.93945	0.563000	0.77884	GCT	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.418	FBXO45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340687.2	1	0	1		2	2	2	0		0	0	55		55	55	1	1.870000	-3.792750	1	0.400000				73	73		278	274	1		1	1		0	0	55	0		1.000000	9.703978e-01	0	8	0	16	0	73	278
SLC2A9	56606	broad.mit.edu	37	4	9998478	9998478	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr4:9998478T>C	ENST00000264784.3	-	3	390	c.337A>G	c.(337-339)Act>Gct	p.T113A	SLC2A9_ENST00000506583.1_Missense_Mutation_p.T84A|SLC2A9_ENST00000309065.3_Missense_Mutation_p.T84A	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	113					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	ATGGACACAGTCACAGACCAG	0.468																																						ENST00000264784.3	1.000000	0.900000	1.000000	0.980000	0.990000	0.990887	0.990000	1.000000																										0				35						c.(337-339)Act>Gct		solute carrier family 2 (facilitated glucose transporter), member 9	Losartan(DB00678)|Probenecid(DB01032)						145.0	124.0	131.0					4																	9998478		2203	4300	6503	SO:0001583	missense	56606	0	0					g.chr4:9998478T>C	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.337A>G	chr4.hg19:g.9998478T>C	ENSP00000264784:p.Thr113Ala	0					SLC2A9_ENST00000309065.3_Missense_Mutation_p.T84A|SLC2A9_ENST00000506583.1_Missense_Mutation_p.T84A	p.T113A	NM_020041.2	NP_064425.2	1	2	3	2.075646	Q9NRM0	GTR9_HUMAN		3	390	-			Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	ENST00000264784.3	1	1	hg19	c.337A>G	CCDS3407.1	1	.	.	.	.	.	.	.	.	.	.	T	19.24	3.790410	0.70337	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065;ENST00000513129	T;T;T;T	0.79845	0.4;-0.84;0.4;-1.31	5.21	5.21	0.72293	5.21	5.21	0.72293	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.107675	0.64402	D	0.000007	T	0.81517	0.4839	L	0.33485	1.01	0.40360	D	0.979237	P;P	0.47191	0.891;0.846	P;P	0.59546	0.72;0.859	T	0.80339	-0.1424	9	.	.	.	.	11.9036	0.52697	0.0:0.0:0.0:1.0	.	84;113	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	A	84;113;84;84	ENSP00000422209:T84A;ENSP00000264784:T113A;ENSP00000311383:T84A;ENSP00000426800:T84A	.	T	-	1	0	0	SLC2A9	9607576	9607576	1.000000	0.71417	0.990000	0.47175	0.946000	0.59487	4.346000	0.59367	2.136000	0.66102	0.524000	0.50904	ACT	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.468	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1	1	0	1		2	2	2	0		0	0	82		82	82	1	1.870000	-20.000000	1	0.400000				108	107		395	390	1		1	0		0	0	82	0		1.000000	6.081524e-01	0	1	0	8	0	108	395
YIPF7	285525	broad.mit.edu	37	4	44638040	44638040	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr4:44638040G>A	ENST00000332990.5	-	3	267	c.251C>T	c.(250-252)tCg>tTg	p.S84L	YIPF7_ENST00000415895.4_Missense_Mutation_p.S60L	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	84						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						TGCGTAACCCGATGACATGAG	0.408																																						ENST00000332990.5	0.240000	0.040000	0.170000	0.070000	0.110000	0.132720	0.110000	0.110000																										0				12						c.(250-252)tCg>tTg		Yip1 domain family, member 7							89.0	88.0	88.0					4																	44638040		1916	4145	6061	SO:0001583	missense	285525	1	120846	33				g.chr4:44638040G>A	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.251C>T	chr4.hg19:g.44638040G>A	ENSP00000332772:p.Ser84Leu	0					YIPF7_ENST00000415895.4_Missense_Mutation_p.S60L	p.S84L	NM_182592.2	NP_872398.2	1	2	3	2.075646	Q8N8F6	YIPF7_HUMAN		3	267	-			Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	0	1	hg19	c.251C>T	CCDS54766.1	0	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207679	0.39003	.	.	ENSG00000177752	ENST00000332990	T	0.32023	1.47	5.02	5.02	0.67125	5.02	5.02	0.67125	.	0.477948	0.20853	N	0.084492	T	0.33381	0.0861	L	0.60455	1.87	0.09310	N	1	P;B	0.43750	0.816;0.326	B;B	0.40134	0.32;0.069	T	0.26677	-1.0096	10	0.30078	T	0.28	-9.5458	17.5826	0.87972	0.0:0.0:1.0:0.0	.	84;84	Q8N8F6-4;Q8N8F6	.;YIPF7_HUMAN	L	84	ENSP00000332772:S84L	ENSP00000332772:S84L	S	-	2	0	0	YIPF7	44332797	44332797	0.978000	0.34361	0.165000	0.22776	0.058000	0.15608	2.196000	0.42686	2.636000	0.89361	0.650000	0.86243	TCG	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.408	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	29		29	29	1	1.870000	-3.180670	1	0.400000	NM_182592			7	7		313	310	0		1	0		0	0	29	0		0.980248	0	0	0	0	1	0	7	313
DMP1	1758	broad.mit.edu	37	4	88583249	88583249	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr4:88583249G>T	ENST00000339673.6	+	6	418	c.319G>T	c.(319-321)Gat>Tat	p.D107Y	RP11-742B18.1_ENST00000507894.1_RNA|RP11-742B18.1_ENST00000506814.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.D91Y|RP11-742B18.1_ENST00000506480.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	107					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		TGACGATGAAGATGACAGTGG	0.507																																						ENST00000339673.6	0.240000	0.060000	0.180000	0.090000	0.120000	0.144638	0.120000	0.120000																										0				32						c.(319-321)Gat>Tat		dentin matrix acidic phosphoprotein 1							90.0	86.0	88.0					4																	88583249		2203	4300	6503	SO:0001583	missense	1758	0	0					g.chr4:88583249G>T	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.319G>T	chr4.hg19:g.88583249G>T	ENSP00000340935:p.Asp107Tyr	0					RP11-742B18.1_ENST00000507894.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.D91Y|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA	p.D107Y	NM_004407.3	NP_004398.1	1	2	3	2.075646	Q13316	DMP1_HUMAN		6	418	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)	A1L4L3|O43265	Missense_Mutation	SNP	ENST00000339673.6	0	1	hg19	c.319G>T	CCDS3623.1	0	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677163	0.47886	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	T;T	0.60171	0.21;0.21	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.000000	0.56097	D	0.000023	T	0.72479	0.3465	L	0.54323	1.7	0.47862	D	0.99953	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75071	-0.3447	10	0.87932	D	0	-12.8053	16.6154	0.84909	0.0:0.0:1.0:0.0	.	91;107	Q13316-2;Q13316	.;DMP1_HUMAN	Y	107;91	ENSP00000340935:D107Y;ENSP00000282479:D91Y	ENSP00000282479:D91Y	D	+	1	0	0	DMP1	88802273	88802273	1.000000	0.71417	1.000000	0.80357	0.205000	0.24178	6.210000	0.72176	2.457000	0.83068	0.455000	0.32223	GAT	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.507	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1	0	0	1		2	2	2	0		0	0	40		40	40	1	1.870000	-9.761817	1	0.400000				10	9		392	390	0		1			0	0	40	0		0.996847	0	0	0	0	0	0	10	392
TRIML1	339976	broad.mit.edu	37	4	189060986	189060986	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr4:189060986C>A	ENST00000332517.3	+	1	414	c.274C>A	c.(274-276)Cag>Aag	p.Q92K	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	92					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CGAGGATGAGCAGGGCAGCTA	0.647																																					Melanoma(31;213 1036 16579 23968 32372)	ENST00000332517.3	0.270000	0.080000	0.210000	0.110000	0.150000	0.170745	0.150000	0.150000																										0				60						c.(274-276)Cag>Aag		tripartite motif family-like 1							44.0	43.0	43.0					4																	189060986		2203	4300	6503	SO:0001583	missense	339976	0	0					g.chr4:189060986C>A	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.274C>A	chr4.hg19:g.189060986C>A	ENSP00000327738:p.Gln92Lys	0					RP11-366H4.3_ENST00000501322.2_RNA	p.Q92K	NM_178556.3	NP_848651.2	1	2	3	2.075646	Q8N9V2	TRIML_HUMAN		1	414	+		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)	Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	0	1	hg19	c.274C>A	CCDS3851.1	0	.	.	.	.	.	.	.	.	.	.	C	3.439	-0.114406	0.06881	.	.	ENSG00000184108	ENST00000332517	T	0.61274	0.12	5.19	3.32	0.38043	5.19	3.32	0.38043	.	0.645692	0.13834	N	0.359532	T	0.41465	0.1160	L	0.47716	1.5	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.35822	-0.9773	10	0.05959	T	0.93	-6.5751	5.7084	0.17921	0.1928:0.7101:0.0:0.0971	.	92	Q8N9V2	TRIML_HUMAN	K	92	ENSP00000327738:Q92K	ENSP00000327738:Q92K	Q	+	1	0	0	TRIML1	189297980	189297980	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	-0.461000	0.06712	1.512000	0.48834	0.655000	0.94253	CAG	0.402390		TCGA-HZ-7919-01A-11D-2154-08	0.647	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	0	0	1		2	2	2	0		0	0	47		47	46	1	1.870000	-11.973240	1	0.400000	NM_178556			12	11		386	384	0		1			0	0	47	0		0.999106	0	0	0	0	0	0	12	386
MAST4	375449	broad.mit.edu	37	5	66461307	66461307	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr5:66461307G>C	ENST00000403625.2	+	29	6595	c.6300G>C	c.(6298-6300)gaG>gaC	p.E2100D	MAST4_ENST00000261569.7_Missense_Mutation_p.E1906D|MAST4_ENST00000405643.1_Missense_Mutation_p.E1921D|MAST4_ENST00000403666.1_Missense_Mutation_p.E1911D|MAST4_ENST00000404260.3_Missense_Mutation_p.E2103D	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2103						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTGAGAGTGAGAAGAGTGAAA	0.562																																						ENST00000403625.2	1.000000	0.760000	1.000000	0.850000	0.940000	0.935484	0.940000	1.000000																										0				13						c.(6298-6300)gaG>gaC		microtubule associated serine/threonine kinase family member 4							43.0	53.0	50.0					5																	66461307		1994	4164	6158	SO:0001583	missense	375449	0	0					g.chr5:66461307G>C	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.6300G>C	chr5.hg19:g.66461307G>C	ENSP00000385727:p.Glu2100Asp	0					MAST4_ENST00000403666.1_Missense_Mutation_p.E1911D|MAST4_ENST00000405643.1_Missense_Mutation_p.E1921D|MAST4_ENST00000404260.3_Missense_Mutation_p.E2103D|MAST4_ENST00000261569.7_Missense_Mutation_p.E1906D	p.E2100D	NM_001164664.1	NP_001158136.1	0	0	0	1.978057	O15021	MAST4_HUMAN		29	6595	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	1	1	hg19	c.6300G>C	CCDS54861.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.68|10.68	1.417754|1.417754	0.25552|0.25552	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569|ENST00000443808	T;T;T;T;T|T	0.65732|0.04360	-0.15;-0.15;-0.17;-0.17;-0.15|3.64	4.58|4.58	0.327|0.327	0.15913|0.15913	4.58|4.58	0.327|0.327	0.15913|0.15913	.|.	1.030320|1.030320	0.07702|0.07702	N|N	0.940481|0.940481	T|T	0.03477|0.03477	0.0100|0.0100	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.47911|0.47911	-0.9080|-0.9080	10|8	0.06099|0.30078	T|T	0.92|0.28	-0.9085|-0.9085	3.6607|3.6607	0.08237|0.08237	0.0968:0.4337:0.2813:0.1881|0.0968:0.4337:0.2813:0.1881	.|.	2103;1911|.	O15021;O15021-3|.	MAST4_HUMAN;.|.	D|Q	2103;2100;1911;1921;1921;1906|1157	ENSP00000385048:E2103D;ENSP00000385727:E2100D;ENSP00000384313:E1911D;ENSP00000384099:E1921D;ENSP00000261569:E1906D|ENSP00000400551:E1157Q	ENSP00000261569:E1906D|ENSP00000400551:E1157Q	E|E	+|+	3|1	2|0	2|0	MAST4|MAST4	66497063|66497063	66497063|66497063	0.000000|0.000000	0.05858|0.05858	0.017000|0.017000	0.16124|0.16124	0.605000|0.605000	0.37080|0.37080	-0.771000|-0.771000	0.04699|0.04699	0.151000|0.151000	0.19162|0.19162	-0.145000|-0.145000	0.13849|0.13849	GAG|GAA	0.375000		TCGA-HZ-7919-01A-11D-2154-08	0.562	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2	1	0	1		2	2	2	0		0	0	43		43	43	1	1.870000	-20.000000	1	0.400000				79	78		319	314	1		1	1		0	0	43	0		1.000000	9.561666e-01	0	2	0	21	0	79	319
PCDHGA6	56109	broad.mit.edu	37	5	140754472	140754472	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr5:140754472C>T	ENST00000517434.1	+	1	822	c.822C>T	c.(820-822)caC>caT	p.H274H	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	274	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGAGTCCACGGGGAAGTAA	0.433																																						ENST00000517434.1	1.000000	0.710000	1.000000	0.820000	0.940000	0.924625	0.940000	1.000000																										0				2						c.(820-822)caC>caT		protocadherin gamma subfamily A, 6							53.0	54.0	54.0					5																	140754472		1890	4116	6006	SO:0001819	synonymous_variant	56109	1	120808	25				g.chr5:140754472C>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.822C>T	chr5.hg19:g.140754472C>T		0					PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	p.H274H	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	0	0	0	2.010940	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	822	+			A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	1	1	hg19	c.822C>T	CCDS54926.1	1																																																																																								0.385246		TCGA-HZ-7919-01A-11D-2154-08	0.433	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	1	0	1		2	2	2	0		0	0	40		40	40	1	1.870000	-3.576604	1	0.400000	NM_018919			45	44		186	186	1		1	0		0	0	40	0		1.000000	0	0	0	0	1	0	45	186
C6orf195	154386	broad.mit.edu	37	6	2624100	2624100	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr6:2624100G>C	ENST00000296847.3	-	0	480					NM_152554.2	NP_689767.2	Q96MT4	CF195_HUMAN	chromosome 6 open reading frame 195											cervix(1)|endometrium(1)|lung(2)|skin(1)	5	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				TTCTTATGTTGATTCTTCTAT	0.418																																						ENST00000296847.3	1.000000	0.700000	0.970000	0.800000	0.900000	0.892432	0.900000	0.990000																										0				5								chromosome 6 open reading frame 195							26.0	25.0	25.0					6																	2624100		1824	4027	5851			154386	0	0					g.chr6:2624100G>C	AK056496	CCDS43416.1	6p25.2	2008-10-21			ENSG00000164385	ENSG00000164385			21600	protein-coding gene	gene with protein product							Standard	NM_152554		Approved	FLJ31934, bA145H9.2	uc003mtw.2	Q96MT4	OTTHUMG00000014122	ENST00000296847.3:c.-44C>G	chr6.hg19:g.2624100G>C		1							NM_152554.2	NP_689767.2	0	1	1	1.579168	Q96MT4	CF195_HUMAN		0	480	-	Ovarian(93;0.0412)	all_hematologic(90;0.0895)	Q3SY08|Q3SY09|Q3SY10|Q5TAW4	Translation_Start_Site	SNP	ENST00000296847.3	0	1	hg19		CCDS43416.1	1																																																																																								0.250000		TCGA-HZ-7919-01A-11D-2154-08	0.418	C6orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039633.1	0	0	1		2	2	2	0		0	0	27		27	27	1	1.870000	-20.000000	1	0.400000	NM_152554			36	36		107	107	0		1	0		0	0	27	0		1.000000	0	0	0	0	1	0	36	107
DEK	7913	broad.mit.edu	37	6	18258216	18258216	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr6:18258216G>C	ENST00000397239.3	-	4	772	c.325C>G	c.(325-327)Cta>Gta	p.L109V	DEK_ENST00000244776.7_Missense_Mutation_p.L75V	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	109					chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			AGTTTGTGTAGATTTCTAAGT	0.333			T	NUP214	AML																																	ENST00000397239.3	0.960000	0.570000	0.890000	0.660000	0.770000	0.780847	0.770000	0.780000				Dom	yes			Dom	yes		6	6p23	6p23	7913	T	DEK oncogene (DNA binding)				L	L	NUP214		AML		0				7						c.(325-327)Cta>Gta		DEK proto-oncogene							124.0	118.0	120.0					6																	18258216		2202	4299	6501	SO:0001583	missense	7913	0	0					g.chr6:18258216G>C	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.325C>G	chr6.hg19:g.18258216G>C	ENSP00000380414:p.Leu109Val	1					DEK_ENST00000244776.7_Missense_Mutation_p.L75V	p.L109V	NM_003472.3	NP_003463.1	0	1	1	1.579168	P35659	DEK_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)	4	772	-	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	1	1	hg19	c.325C>G	CCDS34344.1	0	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732566	0.69189	.	.	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000503715;ENST00000515742	T;T;T;T	0.75938	-0.98;-0.85;-0.19;-0.5	6.17	5.31	0.75309	6.17	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.77498	0.4139	L	0.59436	1.845	0.44000	D	0.996703	D;D	0.54772	0.968;0.968	D;D	0.70716	0.97;0.97	T	0.79976	-0.1576	10	0.52906	T	0.07	-12.7977	11.3849	0.49778	0.1365:0.0:0.8635:0.0	.	75;109	B4DN37;P35659	.;DEK_HUMAN	V	109;75;42;114	ENSP00000380414:L109V;ENSP00000244776:L75V;ENSP00000425399:L42V;ENSP00000423553:L114V	ENSP00000244776:L75V	L	-	1	2	2	DEK	18366195	18366195	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.999000	0.57031	1.631000	0.50456	0.655000	0.94253	CTA	0.250000		TCGA-HZ-7919-01A-11D-2154-08	0.333	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4	1	0	1		2	2	2	0		0	0	41		41	41	1	1.870000	-20.000000	1	0.400000				37	37		150	150	1		1	1		0	0	41	0		1.000000	1	0	83	0	78	0	37	150
UBR2	23304	broad.mit.edu	37	6	42541728	42541728	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr6:42541728G>C	ENST00000372899.1	+	2	593	c.335G>C	c.(334-336)tGc>tCc	p.C112S	UBR2_ENST00000372901.1_Missense_Mutation_p.C112S|UBR2_ENST00000372903.2_Missense_Mutation_p.C112S	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	112					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			ACATATTCTTGCAGGTAAAAT	0.328																																						ENST00000372899.1	0.280000	0.090000	0.230000	0.130000	0.170000	0.185399	0.170000	0.170000																										0				64						c.(334-336)tGc>tCc		ubiquitin protein ligase E3 component n-recognin 2							64.0	68.0	67.0					6																	42541728		2203	4300	6503	SO:0001583	missense	23304	0	0					g.chr6:42541728G>C	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.335G>C	chr6.hg19:g.42541728G>C	ENSP00000361990:p.Cys112Ser	1					UBR2_ENST00000372903.2_Missense_Mutation_p.C112S|UBR2_ENST00000372901.1_Missense_Mutation_p.C112S	p.C112S	NM_015255.2	NP_056070.1	0	1	1	1.627988	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)	2	593	+	Colorectal(47;0.196)		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	1	1	hg19	c.335G>C	CCDS4870.1	0	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843827	0.91197	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	D;D;D	0.97553	-4.43;-4.43;-4.43	5.68	5.68	0.88126	5.68	5.68	0.88126	Zinc finger, N-recognin, metazoa (1);Zinc finger, N-recognin (2);	0.045834	0.85682	D	0.000000	D	0.99233	0.9733	H	0.97962	4.115	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.996;0.995	D	0.98951	1.0794	10	0.87932	D	0	-3.8635	19.7873	0.96444	0.0:0.0:1.0:0.0	.	112;112	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	S	112	ENSP00000361994:C112S;ENSP00000361990:C112S;ENSP00000361992:C112S	ENSP00000361990:C112S	C	+	2	0	0	UBR2	42649706	42649706	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.476000	0.97823	2.673000	0.90976	0.655000	0.94253	TGC	0.250000		TCGA-HZ-7919-01A-11D-2154-08	0.328	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	1	0	1		2	2	2	0		0	0	55		55	55	1	1.870000	-14.531040	1	0.400000	NM_015255			13	12		284	283	0		1	0		0	0	55	0		0.999544	3.080939e-01	0	1	0	23	0	13	284
TAAR9	134860	broad.mit.edu	37	6	132859638	132859638	+	RNA	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr6:132859638G>C	ENST00000434551.1	+	0	210					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		CAAACTTTCTGATTGCGTCGC	0.512																																					Colon(10;433 445 15992 45047 47213)	ENST00000434551.1	1.000000	0.760000	0.980000	0.830000	0.910000	0.909626	0.910000	0.950000																										0												trace amine associated receptor 9 (gene/pseudogene)							167.0	162.0	164.0					6																	132859638		2168	4283	6451			134860	0	0					g.chr6:132859638G>C	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		chr6.hg19:g.132859638G>C		1							NM_175057.3	NP_778227.3	0	1	1	1.627988	Q96RI9	TAAR9_HUMAN		0	210	+	Breast(56;0.112)			RNA	SNP	ENST00000434551.1	1	1	hg19			1																																																																																								0.250000		TCGA-HZ-7919-01A-11D-2154-08	0.512	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000042254.2	0	0	1		2	2	2	0		0	0	51		51	51	1	1.870000	-4.772349	1	0.400000	NM_175057			76	75		240	238	0		1			0	0	51	0		1.000000	0	0	0	0	0	0	76	240
PKD1L1	168507	broad.mit.edu	37	7	47869028	47869028	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr7:47869028C>G	ENST00000289672.2	-	44	6780	c.6730G>C	c.(6730-6732)Gaa>Caa	p.E2244Q		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2244					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TTTACTTTTTCAACCTCGCCT	0.408																																						ENST00000289672.2	1.000000	0.910000	1.000000	0.990000	0.990000	0.993129	0.990000	1.000000																									BBS9/PKD1L1(2)	0				142						c.(6730-6732)Gaa>Caa		polycystic kidney disease 1 like 1							69.0	76.0	73.0					7																	47869028		2203	4300	6503	SO:0001583	missense	168507	0	0					g.chr7:47869028C>G	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6730G>C	chr7.hg19:g.47869028C>G	ENSP00000289672:p.Glu2244Gln	0						p.E2244Q	NM_138295.3	NP_612152.1	0	0	0	2.052918	Q8TDX9	PK1L1_HUMAN		44	6780	-			Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	1	1	hg19	c.6730G>C	CCDS34633.1	1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247339	0.39697	.	.	ENSG00000158683	ENST00000289672	T	0.20200	2.09	4.11	3.2	0.36748	4.11	3.2	0.36748	.	1.614660	0.03691	N	0.247120	T	0.27933	0.0688	L	0.59436	1.845	0.09310	N	1	P	0.51933	0.949	B	0.43331	0.416	T	0.24584	-1.0156	10	0.44086	T	0.13	-3.216	9.4856	0.38928	0.0:0.7832:0.2168:0.0	.	2244	Q8TDX9	PK1L1_HUMAN	Q	2244	ENSP00000289672:E2244Q	ENSP00000289672:E2244Q	E	-	1	0	0	PKD1L1	47835553	47835553	0.006000	0.16342	0.026000	0.17262	0.179000	0.23085	1.491000	0.35583	0.905000	0.36596	0.563000	0.77884	GAA	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.408	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	1	0	1		2	2	2	0		0	0	68		68	68	1	1.870000	-20.000000	1	0.400000	NM_138295			108	107		386	383	0		1	0		0	0	68	0		1.000000	0	0	0	0	1	0	108	386
ZNF789	285989	broad.mit.edu	37	7	99084963	99084963	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr7:99084963C>T	ENST00000331410.5	+	5	1400	c.1130C>T	c.(1129-1131)aCg>aTg	p.T377M	ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TGTGGGAAAACGTTTAGTTTT	0.403																																						ENST00000331410.5	0.140000	0.040000	0.120000	0.060000	0.080000	0.094383	0.080000	0.090000																										0				11						c.(1129-1131)aCg>aTg		zinc finger protein 789							139.0	137.0	138.0					7																	99084963		2203	4300	6503	SO:0001583	missense	285989	2	121412	35				g.chr7:99084963C>T	AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.1130C>T	chr7.hg19:g.99084963C>T	ENSP00000331927:p.Thr377Met	0					ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron	p.T377M	NM_213603.2	NP_998768.2	1	2	3	2.064848	Q5FWF6	ZN789_HUMAN		5	1400	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		A4D282|A6NH61|Q6ZMZ9	Missense_Mutation	SNP	ENST00000331410.5	0	1	hg19	c.1130C>T	CCDS34693.1	0	.	.	.	.	.	.	.	.	.	.	C	2.833	-0.242182	0.05906	.	.	ENSG00000198556	ENST00000331410	T	0.21031	2.03	2.89	1.98	0.26296	2.89	1.98	0.26296	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29684	0.0741	L	0.60455	1.87	0.19300	N	0.99998	D	0.76494	0.999	P	0.54815	0.761	T	0.09250	-1.0683	9	0.66056	D	0.02	.	5.4818	0.16727	0.2327:0.5406:0.2266:0.0	.	377	Q5FWF6	ZN789_HUMAN	M	377	ENSP00000331927:T377M	ENSP00000331927:T377M	T	+	2	0	0	ZNF789	98922899	98922899	0.000000	0.05858	0.232000	0.24009	0.029000	0.11900	0.055000	0.14229	0.774000	0.33427	-0.188000	0.12872	ACG	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.403	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336266.1	0	0	1		2	2	2	1		1	0	125		125	122	1	1.870000	-2.926437	1	0.400000	NM_213603			17	17		935	930	0		1	0		1	0	125	0		0.999962	2.499246e-02	0	1	0	12	0	17	935
EPHB4	2050	broad.mit.edu	37	7	100414848	100414848	+	Silent	SNP	G	G	A	rs148818692		TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr7:100414848G>A	ENST00000358173.3	-	8	2022	c.1554C>T	c.(1552-1554)ttC>ttT	p.F518F	EPHB4_ENST00000477446.1_Intron|EPHB4_ENST00000360620.3_Silent_p.F518F	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	518	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GTTCCTGGCCGAAGGGCCCGT	0.652																																					GBM(200;2113 3072 25865 52728)	ENST00000358173.3	1.000000	0.870000	1.000000	0.990000	0.990000	0.991735	0.990000	1.000000																										0				47						c.(1552-1554)ttC>ttT		EPH receptor B4		G		0,4404		0,0,2202	18.0	19.0	18.0		1554	-6.7	0.5	7	dbSNP_134	18	1,8597		0,1,4298	no	coding-synonymous	EPHB4	NM_004444.4		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		518/988	100414848	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	2050	7	121354	35				g.chr7:100414848G>A	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1554C>T	chr7.hg19:g.100414848G>A		0					EPHB4_ENST00000360620.3_Silent_p.F518F|EPHB4_ENST00000477446.1_Intron	p.F518F	NM_004444.4	NP_004435.3	1	2	3	2.064848	P54760	EPHB4_HUMAN		8	2022	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	1	0	hg19	c.1554C>T	CCDS5706.1	1																																																																																								0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.652	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	1	0	0		2	2	2	0		0	0	15		15	14	1	1.870000	-20.000000	1	0.400000	NM_004444			33	33		103	103	0		1	1		0	0	15	0		1.000000	9.996739e-01	0	16	0	27	0	33	103
FAM135B	51059	broad.mit.edu	37	8	139180258	139180258	+	Missense_Mutation	SNP	G	G	A	rs370662790		TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr8:139180258G>A	ENST00000395297.1	-	12	1308	c.1138C>T	c.(1138-1140)Cgg>Tgg	p.R380W		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	380										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TCCGAGTTCCGGATATCCAGG	0.597										HNSCC(54;0.14)																												ENST00000395297.1	0.220000	0.080000	0.180000	0.110000	0.140000	0.147846	0.140000	0.140000																										0				238						c.(1138-1140)Cgg>Tgg		family with sequence similarity 135, member B							102.0	110.0	107.0					8																	139180258		2112	4226	6338	SO:0001583	missense	51059	2	121082	35				g.chr8:139180258G>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1138C>T	chr8.hg19:g.139180258G>A	ENSP00000378710:p.Arg380Trp	0	HNSCC(54;0.14)					p.R380W	NM_015912.3	NP_056996.2	1	2	3	2.062111	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)	12	1308	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	1	1	hg19	c.1138C>T	CCDS6375.2	0	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644994	0.67358	.	.	ENSG00000147724	ENST00000395297	D	0.90676	-2.71	5.66	4.77	0.60923	5.66	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.95169	0.8434	M	0.80982	2.52	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.95690	0.8739	10	0.87932	D	0	-19.8469	14.775	0.69724	0.0:0.0:0.8544:0.1456	.	380	Q49AJ0	F135B_HUMAN	W	380	ENSP00000378710:R380W	ENSP00000276737:R380W	R	-	1	2	2	FAM135B	139249440	139249440	1.000000	0.71417	0.858000	0.33744	0.238000	0.25445	3.644000	0.54381	1.460000	0.47911	0.655000	0.94253	CGG	0.401198		TCGA-HZ-7919-01A-11D-2154-08	0.597	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	0	0	1		2	2	2	0		0	0	93		93	93	1	1.870000	-2.527257	1	0.400000	NM_015912			21	21		721	710	0		1			0	0	93	0		0.999997	0	0	0	0	0	0	21	721
SPTAN1	6709	broad.mit.edu	37	9	131386635	131386635	+	Nonsense_Mutation	SNP	C	C	G			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr9:131386635C>G	ENST00000372731.4	+	45	5956	c.5846C>G	c.(5845-5847)tCa>tGa	p.S1949*	SPTAN1_ENST00000372739.3_Nonsense_Mutation_p.S1954*|SPTAN1_ENST00000358161.5_Nonsense_Mutation_p.S1954*	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1949					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AACATCTCTTCAAAGATGAAG	0.527																																					NSCLC(120;833 1744 2558 35612 37579)	ENST00000372731.4	1.000000	0.820000	1.000000	0.940000	0.990000	0.978371	0.990000	1.000000																										0				87						c.(5845-5847)tCa>tGa		spectrin, alpha, non-erythrocytic 1							70.0	62.0	65.0					9																	131386635		2203	4300	6503	SO:0001587	stop_gained	6709	0	0					g.chr9:131386635C>G	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5846C>G	chr9.hg19:g.131386635C>G	ENSP00000361816:p.Ser1949*	0					SPTAN1_ENST00000358161.5_Nonsense_Mutation_p.S1954*|SPTAN1_ENST00000372739.3_Nonsense_Mutation_p.S1954*	p.S1949*	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	0	1	1	2.052461	Q13813	SPTN1_HUMAN		45	5956	+			Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Nonsense_Mutation	SNP	ENST00000372731.4	0	1	hg19	c.5846C>G	CCDS6905.1	1	.	.	.	.	.	.	.	.	.	.	C	46	12.783765	0.99696	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	.	.	.	5.23	4.32	0.51571	5.23	4.32	0.51571	.	0.166830	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	14.3956	0.67007	0.0:0.9275:0.0:0.0725	.	.	.	.	X	1954;1949;1954;1929;198	.	ENSP00000350882:S1954X	S	+	2	0	0	SPTAN1	130426456	130426456	1.000000	0.71417	0.563000	0.28383	0.993000	0.82548	5.710000	0.68392	1.317000	0.45149	0.655000	0.94253	TCA	0.398798		TCGA-HZ-7919-01A-11D-2154-08	0.527	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	1	0	1		2	2	2	0		0	0	43		43	43	1	1.870000	-20.000000	1	0.400000	NM_003127			55	55		202	201	1		1	1		0	0	43	0		1.000000	1	0	14	0	367	0	55	202
ZER1	10444	broad.mit.edu	37	9	131513437	131513437	+	Silent	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr9:131513437G>A	ENST00000291900.2	-	7	1555	c.1149C>T	c.(1147-1149)cgC>cgT	p.R383R	ZER1_ENST00000494461.1_5'Flank|snoU13_ENST00000459043.1_RNA	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	383					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						AACGCTCGATGCGGGCGATGT	0.627																																						ENST00000291900.2	1.000000	0.760000	1.000000	0.900000	0.990000	0.967116	0.990000	1.000000																										0				15						c.(1147-1149)cgC>cgT		zyg-11 related, cell cycle regulator							60.0	51.0	54.0					9																	131513437		2203	4300	6503	SO:0001819	synonymous_variant	10444	0	0					g.chr9:131513437G>A	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1149C>T	chr9.hg19:g.131513437G>A		0					snoU13_ENST00000459043.1_RNA|ZER1_ENST00000494461.1_5'Flank	p.R383R	NM_006336.2	NP_006327.2	0	1	1	2.052461	Q7Z7L7	ZER1_HUMAN		7	1555	-			O00156|Q5T272|Q5T273	Silent	SNP	ENST00000291900.2	0	1	hg19	c.1149C>T	CCDS6910.1	1																																																																																								0.398798		TCGA-HZ-7919-01A-11D-2154-08	0.627	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	1	0	1		2	2	2	0		0	0	11		11	11	1	1.870000	-20.000000	1	0.400000	NM_006336			30	30		109	109	1		1	1		0	0	11	0		1.000000	9.999989e-01	0	23	0	64	0	30	109
MRPS2	51116	broad.mit.edu	37	9	138393703	138393703	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chr9:138393703G>C	ENST00000371785.1	+	4	392	c.183G>C	c.(181-183)aaG>aaC	p.K61N	C9orf116_ENST00000429260.2_5'Flank|C9orf116_ENST00000371791.1_5'Flank|MRPS2_ENST00000488610.1_3'UTR|MRPS2_ENST00000241600.5_Missense_Mutation_p.K61N|C9orf116_ENST00000371789.3_5'Flank|RP11-426A6.5_ENST00000415062.1_RNA			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	61					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		TCAACGACAAGATTTTGAATG	0.572																																						ENST00000371785.1	1.000000	0.780000	1.000000	0.850000	0.930000	0.928163	0.930000	1.000000																										0				6						c.(181-183)aaG>aaC		mitochondrial ribosomal protein S2							109.0	100.0	103.0					9																	138393703		2203	4300	6503	SO:0001583	missense	51116	0	0					g.chr9:138393703G>C	AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.183G>C	chr9.hg19:g.138393703G>C	ENSP00000360850:p.Lys61Asn	0					MRPS2_ENST00000241600.5_Missense_Mutation_p.K61N|C9orf116_ENST00000371789.3_5'Flank|RP11-426A6.5_ENST00000415062.1_RNA|MRPS2_ENST00000488610.1_3'UTR|C9orf116_ENST00000429260.2_5'Flank|C9orf116_ENST00000371791.1_5'Flank	p.K61N			0	1	1	2.052461	Q9Y399	RT02_HUMAN		4	392	+			Q5T899|Q9BSQ4	Missense_Mutation	SNP	ENST00000371785.1	1	1	hg19	c.183G>C	CCDS6990.1	1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266862	0.40095	.	.	ENSG00000122140	ENST00000371785;ENST00000241600;ENST00000453385	T;T;T	0.35236	1.81;1.81;1.32	4.7	0.553	0.17235	4.7	0.553	0.17235	.	0.218719	0.45361	D	0.000376	T	0.26011	0.0634	L	0.57536	1.79	0.09310	N	1	P	0.44429	0.835	B	0.38378	0.272	T	0.18429	-1.0337	10	0.49607	T	0.09	-5.9199	2.9054	0.05719	0.2189:0.1206:0.5366:0.1239	.	61	Q9Y399	RT02_HUMAN	N	61;61;75	ENSP00000360850:K61N;ENSP00000241600:K61N;ENSP00000400082:K75N	ENSP00000241600:K61N	K	+	3	2	2	MRPS2	137533524	137533524	0.901000	0.30685	0.000000	0.03702	0.160000	0.22226	1.674000	0.37544	-0.203000	0.10251	0.655000	0.94253	AAG	0.398798		TCGA-HZ-7919-01A-11D-2154-08	0.572	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054998.1	1	0	1		2	2	2	0		0	0	89		89	89	1	1.870000	-20.000000	1	0.400000				114	112		494	486	1		1	1		0	0	89	0		1.000000	9.999944e-01	0	17	0	57	0	114	494
SLC25A6	293	broad.mit.edu	37	X	1508186	1508186	+	Silent	SNP	C	C	T			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chrX:1508186C>T	ENST00000381401.5	-	2	1260	c.546G>A	c.(544-546)caG>caA	p.Q182Q	SLC25A6_ENST00000475167.1_5'UTR	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	182					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	TGATGATGCCCTGCACGGAGA	0.627																																						ENST00000381401.5	1.000000	0.750000	0.950000	0.810000	0.880000	0.886738	0.880000	1.000000																										0				11						c.(544-546)caG>caA		solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	Clodronate(DB00720)						113.0	112.0	112.0					X																	1508186		2203	4296	6499	SO:0001819	synonymous_variant	293	0	0					g.chrX:1508186C>T	AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.546G>A	chrX.hg19:g.1508186C>T							SLC25A6_ENST00000475167.1_5'UTR	p.Q182Q	NM_001636.3	NP_001627.2	0	1	1		P12236	ADT3_HUMAN		2	1260	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	Q96C49	Silent	SNP	ENST00000381401.5	1	1	hg19	c.546G>A	CCDS14114.1	1																																																																																								0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.627	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055596.1	1	0	1		2	2	2	0		0	0	95		95	93	1	1.870000	-3.246038	1	0.400000	NM_001636			143	143		664	655	0		1	1		0	0	95	0		1.000000	1	0	232	0	1049	0	143	664
BRWD3	254065	broad.mit.edu	37	X	79985487	79985487	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chrX:79985487G>A	ENST00000373275.4	-	13	1376	c.1160C>T	c.(1159-1161)aCg>aTg	p.T387M		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	387					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AATTCTTGCCGTTCCATCTCG	0.299																																						ENST00000373275.4	1.000000	0.740000	1.000000	0.830000	0.920000	0.919170	0.920000	1.000000																										0				87						c.(1159-1161)aCg>aTg		bromodomain and WD repeat domain containing 3							157.0	132.0	140.0					X																	79985487		2203	4299	6502	SO:0001583	missense	254065	0	0					g.chrX:79985487G>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1160C>T	chrX.hg19:g.79985487G>A	ENSP00000362372:p.Thr387Met							p.T387M	NM_153252.4	NP_694984	0	1	1		Q6RI45	BRWD3_HUMAN		13	1376	-			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	1	1	hg19	c.1160C>T	CCDS14447.1	1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237206	0.79800	.	.	ENSG00000165288	ENST00000373275	T	0.69561	-0.41	4.37	4.37	0.52481	4.37	4.37	0.52481	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82655	0.5084	M	0.83953	2.67	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.85220	0.1026	9	.	.	.	-2.364	16.3826	0.83473	0.0:0.0:1.0:0.0	.	387	Q6RI45	BRWD3_HUMAN	M	387	ENSP00000362372:T387M	.	T	-	2	0	0	BRWD3	79872143	79872143	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.207000	0.77899	2.035000	0.60131	0.513000	0.50165	ACG	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.299	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	0	0	1		25	2	2	1		1	1	43		43	43	1	1.870000	-3.356559	1	0.400000	NM_153252			70	69		306	303	1		1	0		1	0	43	0		1.000000	4.591915e-01	0	0	0	8	0	70	306
FLNA	2316	broad.mit.edu	37	X	153583275	153583275	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-7919-01A-11D-2154-08	TCGA-HZ-7919-10A-01D-2154-08			T	C	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	079bd60d-6112-4dc3-a9f8-d81ae2525b56	38e63aa2-a48f-464b-b927-ab6524cb5cc1	g.chrX:153583275T>C	ENST00000369850.3	-	31	5371	c.5135A>G	c.(5134-5136)tAc>tGc	p.Y1712C	FLNA_ENST00000369856.3_5'UTR|FLNA_ENST00000360319.4_Missense_Mutation_p.Y1704C|FLNA_ENST00000344736.4_Missense_Mutation_p.Y1704C|FLNA_ENST00000422373.1_Missense_Mutation_p.Y1704C	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1712					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGGGCCGTGTAGAAGATGTC	0.617											OREG0003595	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										ENST00000369850.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999759	0.990000	1.000000																										0				6						c.(5134-5136)tAc>tGc		filamin A, alpha							50.0	53.0	52.0					X																	153583275		2176	4244	6420	SO:0001583	missense	2316	0	0					g.chrX:153583275T>C	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.5135A>G	chrX.hg19:g.153583275T>C	ENSP00000358866:p.Tyr1712Cys			OREG0003595	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1756	FLNA_ENST00000369856.3_5'UTR|FLNA_ENST00000422373.1_Missense_Mutation_p.Y1704C|FLNA_ENST00000344736.4_Missense_Mutation_p.Y1704C|FLNA_ENST00000360319.4_Missense_Mutation_p.Y1704C	p.Y1712C	NM_001110556.1	NP_001104026.1	0	1	1		P21333	FLNA_HUMAN		31	5371	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	1	1	hg19	c.5135A>G	CCDS48194.1	1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.057671	0.55325	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.95412	-3.7;-3.7;-3.7;-3.7	5.12	5.12	0.69794	5.12	5.12	0.69794	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.98485	0.9495	H	0.96748	3.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99605	1.0979	10	0.87932	D	0	.	14.2282	0.65873	0.0:0.0:0.0:1.0	.	1704;1712	P21333-2;P21333	.;FLNA_HUMAN	C	1704;1685;1704;1712;1704	ENSP00000353467:Y1704C;ENSP00000416926:Y1704C;ENSP00000358866:Y1712C;ENSP00000358863:Y1704C	ENSP00000358863:Y1704C	Y	-	2	0	0	FLNA	153236469	153236469	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	6.061000	0.71148	1.806000	0.52798	0.486000	0.48141	TAC	0.400000		TCGA-HZ-7919-01A-11D-2154-08	0.617	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3	1	0	1		2	2	2	0		0	0	65		65	65	1	1.870000	-20.000000	1	0.400000				109	107		332	330	1		1	0		0	0	65	0		1.000000	1	0	0	0	603	0	109	332
