#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CGNL1	84952	broad.mit.edu	37	15	57823890	57823890	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	-	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr15:57823890delC	ENST00000281282.5	+	14	3282	c.3204delC	c.(3202-3204)gacfs	p.D1068fs	CTD-2515H24.4_ENST00000566990.1_lincRNA	NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	1068				D -> A (in Ref. 1; AAT37906). {ECO:0000305}.		myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CTTCTTAGGACAAGGTGTCTC	0.448																																						ENST00000281282.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999986	0.990000	1.000000																										0				60						c.(3202-3204)gacfs		cingulin-like 1							161.0	160.0	160.0					15																	57823890		2192	4292	6484	SO:0001589	frameshift_variant	84952	0	0					g.chr15:57823890delC	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.3204delC	chr15.hg19:g.57823890delC	ENSP00000281282:p.Asp1068fs	1					CTD-2515H24.4_ENST00000566990.1_lincRNA	p.D1068fs	NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	2	2	4	2.323645	Q0VF96	CGNL1_HUMAN		14	3282	+			Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Frame_Shift_Del	DEL	ENST00000281282.5	1	1	hg19	c.3204delC	CCDS10161.1	1																																																																																								0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.448	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	1	0	1		2	2		0		0	0	138		138	136	1	2.950000	-20.000000	1	0.370000	NM_032866			167	165		804	796	0		1	0	0	0	0	138	0		1.000000	9.926001e-01	0	1	0	37	0	167	804
TBC1D12	23232	broad.mit.edu	37	10	96269882	96269882	+	Silent	SNP	A	A	G			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr10:96269882A>G	ENST00000225235.4	+	8	1745	c.1635A>G	c.(1633-1635)gaA>gaG	p.E545E	TBC1D12_ENST00000485048.1_3'UTR	NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	545	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				CCAGTCTGGAATTAATTAAGT	0.353																																						ENST00000225235.4	1.000000	0.870000	1	9.700000e-01	0.990000	0.987911	0.990000	1.000000																										0				20						c.(1633-1635)gaA>gaG		TBC1 domain family, member 12							190.0	175.0	180.0					10																	96269882		1848	4101	5949	SO:0001819	synonymous_variant	23232	0	0					g.chr10:96269882A>G	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1635A>G	chr10.hg19:g.96269882A>G		1					TBC1D12_ENST00000485048.1_3'UTR	p.E545E	NM_015188.1	NP_056003.1	1	2	3	2.038979	O60347	TBC12_HUMAN		8	1745	+		Colorectal(252;0.0429)	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	1	1	hg19	c.1635A>G	CCDS41553.1	1																																																																																								0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.353	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2	1	0	1		2	2	2	0		0	0	40		40	40	1	2.950000	-20.000000	1	0.370000				69	68		334	330	1		1	1		0	0	40	0		1.000000	8.588797e-01	0	3	0	16	0	69	334
OR4D5	219875	broad.mit.edu	37	11	123810383	123810383	+	Silent	SNP	T	T	C			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr11:123810383T>C	ENST00000307033.2	+	1	134	c.60T>C	c.(58-60)gtT>gtC	p.V20V		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCTCTCAGGTTTGGGAGCTTC	0.443																																						ENST00000307033.2	0.680000	0.380000	6.100000e-01	4.500000e-01	0.520000	0.532660	0.520000	0.520000																										0				41						c.(58-60)gtT>gtC		olfactory receptor, family 4, subfamily D, member 5							91.0	88.0	89.0					11																	123810383		2202	4299	6501	SO:0001819	synonymous_variant	219875	0	0					g.chr11:123810383T>C	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.60T>C	chr11.hg19:g.123810383T>C		1						p.V20V	NM_001001965.1	NP_001001965.1	1	2	3	2.025181	Q8NGN0	OR4D5_HUMAN		1	134	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	B9EGZ4|Q6IFE6	Silent	SNP	ENST00000307033.2	1	1	hg19	c.60T>C	CCDS31699.1	0																																																																																								0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.443	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	1	0	1		2	2	2	0		0	0	97		97	97	1	2.950000	-12.187060	1	0.370000	NM_001001965			44	44		494	488	0		1			0	0	97	0		1.000000	0	0	0	0	0	0	44	494
KRAS	3845	broad.mit.edu	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	T	A	rs17851045		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr12:25380275T>A	ENST00000256078.4	-	3	246	c.183A>T	c.(181-183)caA>caT	p.Q61H	AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(153)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTCCTCTTGACCTGCTG	0.423	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4			0	0					Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	153	Substitution - Missense(153)	p.Q61H(153)	large_intestine(74)|lung(26)|pancreas(18)|haematopoietic_and_lymphoid_tissue(9)|endometrium(7)|soft_tissue(3)|biliary_tract(3)|liver(3)|cervix(2)|skin(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)|NS(1)	25349						c.(181-183)caA>caT		Kirsten rat sarcoma viral oncogene homolog							109.0	98.0	102.0					12																	25380275		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25380275T>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.183A>T	chr12.hg19:g.25380275T>A	ENSP00000256078:p.Gln61His		TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H	p.Q61H	NM_033360.2	NP_203524.1					P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	3	246	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.183A>T	CCDS8703.1		.	.	.	.	.	.	.	.	.	.	T	22.1	4.243092	0.79912	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.84146	-1.81;-1.81	5.77	5.77	0.91146	5.770000	5.770000	0.911460	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.87265	0.6134	M	0.91140	3.18	0.80722	D	1	B;B	0.33413	0.411;0.09	B;B	0.32724	0.092;0.151	D	0.87829	0.2643	10	0.72032	D	0.01	.	9.9836	0.41828	0.0:0.0752:0.0:0.9248	rs17851045	61;61	P01116-2;P01116	.;RASK_HUMAN	H	61	ENSP00000308495:Q61H;ENSP00000256078:Q61H	ENSP00000256078:Q61H	Q	-	3	2	2	KRAS	25271542	25271542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.240000	0.43088	2.326000	0.78906	0.533000	0.62120	CAA			TCGA-HZ-7922-01A-11D-2154-08	0.423	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	8	0		0	0	47		47	47	1	2.950000	-20.000000	1	0.370000	NM_033360			185	184		285	284	1		1	1	1	0	1	47	864		1.000000	1	1	56	513	64	1006	185	285
KCNA6	3742	broad.mit.edu	37	12	4920010	4920010	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr12:4920010C>T	ENST00000280684.3	+	1	1669	c.803C>T	c.(802-804)aCg>aTg	p.T268M	KCNA6_ENST00000433855.1_Missense_Mutation_p.T268M|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	268					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CTGGTGGAGACGCTGTGCATT	0.562										HNSCC(72;0.22)																												ENST00000280684.3	1.000000	0.130000	3.200000e-01	1.700000e-01	0.230000	0.317579	0.230000	0.220000																										0				49						c.(802-804)aCg>aTg		potassium voltage-gated channel, shaker-related subfamily, member 6	Dalfampridine(DB06637)						88.0	88.0	88.0					12																	4920010		2203	4300	6503	SO:0001583	missense	3742	0	0					g.chr12:4920010C>T	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.803C>T	chr12.hg19:g.4920010C>T	ENSP00000280684:p.Thr268Met	1	HNSCC(72;0.22)				RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.T268M	p.T268M			2	2	4	2.236184	P17658	KCNA6_HUMAN		1	1669	+				Missense_Mutation	SNP	ENST00000280684.3	1	1	hg19	c.803C>T	CCDS8534.1	0	.	.	.	.	.	.	.	.	.	.	C	18.99	3.738897	0.69304	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.98400	-4.91;-4.91	5.28	4.4	0.53042	5.280000	4.400000	0.530420	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98798	0.9595	M	0.83774	2.66	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	D	0.99694	1.1002	10	0.87932	D	0	.	13.1852	0.59677	0.0:0.924:0.0:0.076	.	268	P17658	KCNA6_HUMAN	M	268	ENSP00000408321:T268M;ENSP00000280684:T268M	ENSP00000280684:T268M	T	+	2	0	0	KCNA6	4790271	4790271	1.000000	0.71417	0.925000	0.36789	0.984000	0.73092	7.592000	0.82676	1.469000	0.48083	0.655000	0.94253	ACG	0.522076		TCGA-HZ-7922-01A-11D-2154-08	0.562	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	0	0	1		2	2	2	0		0	0	90		90	90	1	2.950000	-3.731561	1	0.370000	NM_002235			18	16		563	561	0		1	0		0	0	90	0		0.999981	0	0	0	0	1	0	18	563
ARID2	196528	broad.mit.edu	37	12	46231283	46231283	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr12:46231283A>G	ENST00000334344.6	+	10	1295	c.1123A>G	c.(1123-1125)Atg>Gtg	p.M375V	ARID2_ENST00000422737.1_Missense_Mutation_p.M226V|ARID2_ENST00000444670.1_Missense_Mutation_p.M4V|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	375					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTTTTCAGGCATGGAAATTTT	0.308			"""N, S, F"""		hepatocellular carcinoma																																	ENST00000334344.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000				Rec	yes			Rec	yes		12	12q12	12q12	196528	N, S, F	AT rich interactive domain 2				E	E			hepatocellular carcinoma		0				116						c.(1123-1125)Atg>Gtg		AT rich interactive domain 2 (ARID, RFX-like)							87.0	86.0	86.0					12																	46231283		2203	4300	6503	SO:0001583	missense	196528	0	0					g.chr12:46231283A>G		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1123A>G	chr12.hg19:g.46231283A>G	ENSP00000335044:p.Met375Val	1					ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.M226V|ARID2_ENST00000444670.1_Missense_Mutation_p.M4V	p.M375V	NM_152641.2	NP_689854.2	2	2	4	2.262849	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	10	1295	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	1	1	hg19	c.1123A>G	CCDS31783.1	1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.065763	0.55539	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T;T	0.43294	0.95;0.95	5.33	5.33	0.75918	5.330000	5.330000	0.759180	.	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	L	0.59436	1.845	0.80722	D	1	P;P;P	0.52577	0.954;0.799;0.865	D;P;P	0.66351	0.943;0.468;0.824	T	0.63233	-0.6683	10	0.72032	D	0.01	-9.3805	15.3006	0.73949	1.0:0.0:0.0:0.0	.	375;226;375	Q68CP9-3;F8WCU9;Q68CP9	.;.;ARID2_HUMAN	V	375;226;4	ENSP00000335044:M375V;ENSP00000415650:M226V	ENSP00000335044:M375V	M	+	1	0	0	ARID2	44517550	44517550	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	9.339000	0.96797	2.011000	0.59026	0.260000	0.18958	ATG	0.527382		TCGA-HZ-7922-01A-11D-2154-08	0.308	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	1	0	1		2	2	2	0		0	0	80		80	80	1	2.950000	-20.000000	1	0.370000	XM_350875			149	149		535	529	1		1	1		0	0	80	0		1.000000	9.901846e-01	0	6	0	22	0	149	535
SPRYD3	84926	broad.mit.edu	37	12	53459657	53459657	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr12:53459657C>T	ENST00000301463.4	-	11	1374	c.1288G>A	c.(1288-1290)Ggg>Agg	p.G430R	SPRYD3_ENST00000547837.1_Missense_Mutation_p.G467R	NM_032840.2	NP_116229.1	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	430								p.G430W(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						ACTTTCTCCCCGCAGCTCAGC	0.567											OREG0021856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000301463.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.G430W(1)	lung(1)	17						c.(1288-1290)Ggg>Agg		SPRY domain containing 3							167.0	145.0	152.0					12																	53459657		2203	4300	6503	SO:0001583	missense	84926	0	0					g.chr12:53459657C>T	AK074694	CCDS8845.1	12q13.13	2006-11-29		2006-02-02		ENSG00000167778			25920	protein-coding gene	gene with protein product						14702039	Standard	NM_032840		Approved	FLJ14800	uc001sbt.2	Q8NCJ5	OTTHUMG00000170101	ENST00000301463.4:c.1288G>A	chr12.hg19:g.53459657C>T	ENSP00000301463:p.Gly430Arg	1		OREG0021856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	992	SPRYD3_ENST00000547837.1_Missense_Mutation_p.G467R	p.G430R	NM_032840.2	NP_116229.1	2	2	4	2.238683	Q8NCJ5	SPRY3_HUMAN		11	1374	-			B9EG99|Q96SK5	Missense_Mutation	SNP	ENST00000301463.4	1	1	hg19	c.1288G>A	CCDS8845.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526414	0.85600	.	.	ENSG00000167778	ENST00000301463;ENST00000547837	T;T	0.76839	-1.05;-1.05	5.29	5.29	0.74685	5.290000	5.290000	0.746850	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);	0.063055	0.64402	D	0.000008	D	0.82912	0.5140	L	0.49778	1.585	0.58432	D	0.999999	D	0.69078	0.997	P	0.59056	0.851	T	0.83279	-0.0039	10	0.51188	T	0.08	.	16.8098	0.85716	0.0:1.0:0.0:0.0	.	430	Q8NCJ5	SPRY3_HUMAN	R	430;467	ENSP00000301463:G430R;ENSP00000449452:G467R	ENSP00000301463:G430R	G	-	1	0	0	SPRYD3	51745924	51745924	1.000000	0.71417	0.999000	0.59377	0.926000	0.56050	5.386000	0.66238	2.642000	0.89623	0.563000	0.77884	GGG	0.522076		TCGA-HZ-7922-01A-11D-2154-08	0.567	SPRYD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407264.1	1	0	1		2	2	2	0		0	0	73		73	73	1	2.950000	-3.678004	1	0.370000	NM_032840			136	133		452	444	1		1	1		0	0	73	0		1.000000	1	0	59	0	201	0	136	452
RAB3IP	117177	broad.mit.edu	37	12	70209146	70209146	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr12:70209146G>A	ENST00000247833.7	+	11	1679	c.1303G>A	c.(1303-1305)Gat>Aat	p.D435N	RAB3IP_ENST00000550536.1_Missense_Mutation_p.D451N|RAB3IP_ENST00000550847.1_Missense_Mutation_p.D142N|RAB3IP_ENST00000362025.5_3'UTR|RAB3IP_ENST00000551641.1_Missense_Mutation_p.D229N|RAB3IP_ENST00000325555.9_Missense_Mutation_p.D229N|AC025263.3_ENST00000550437.1_Intron|RAB3IP_ENST00000553099.1_Missense_Mutation_p.D229N|RAB3IP_ENST00000483530.2_3'UTR					RAB3A interacting protein											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			TTGTATAGTTGATCAGATGTT	0.363																																						ENST00000247833.7	1.000000	0.990000	1	9.900000e-01	0.990000	0.999969	0.990000	1.000000																										0				22						c.(1303-1305)Gat>Aat		RAB3A interacting protein							168.0	158.0	161.0					12																	70209146		2203	4300	6503	SO:0001583	missense	117177	0	0					g.chr12:70209146G>A		CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000247833.7:c.1303G>A	chr12.hg19:g.70209146G>A	ENSP00000247833:p.Asp435Asn	1					RAB3IP_ENST00000483530.2_3'UTR|RAB3IP_ENST00000553099.1_Missense_Mutation_p.D229N|RAB3IP_ENST00000550536.1_Missense_Mutation_p.D451N|RAB3IP_ENST00000550847.1_Missense_Mutation_p.D142N|RAB3IP_ENST00000362025.5_3'UTR|RAB3IP_ENST00000551641.1_Missense_Mutation_p.D229N|RAB3IP_ENST00000325555.9_Missense_Mutation_p.D229N|AC025263.3_ENST00000550437.1_Intron	p.D435N			2	2	4	2.238890			Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)	11	1679	+	Esophageal squamous(21;0.187)			Missense_Mutation	SNP	ENST00000247833.7	1	1	hg19	c.1303G>A	CCDS8995.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239138	0.79800	.	.	ENSG00000127328	ENST00000247833;ENST00000325555;ENST00000550536;ENST00000551641;ENST00000553099;ENST00000550847	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.65	5.65	0.86999	5.650000	5.650000	0.869990	.	0.046748	0.85682	D	0.000000	T	0.54598	0.1868	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.48592	-0.9022	10	0.34782	T	0.22	.	19.7308	0.96181	0.0:0.0:1.0:0.0	.	451	Q96QF0	RAB3I_HUMAN	N	435;229;451;229;229;142	ENSP00000247833:D435N;ENSP00000323349:D229N;ENSP00000447300:D451N;ENSP00000448773:D229N;ENSP00000448027:D229N;ENSP00000448102:D142N	ENSP00000247833:D435N	D	+	1	0	0	RAB3IP	68495413	68495413	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.476000	0.97823	2.674000	0.91012	0.591000	0.81541	GAT	0.531285		TCGA-HZ-7922-01A-11D-2154-08	0.363	RAB3IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280671.2	1	0	1		2	2	2	0		0	0	66		66	66	1	2.950000	-20.000000	1	0.370000	NM_022456			96	95		420	418	1		1	0		0	0	66	0		1.000000	9.701868e-01	0	0	0	27	0	96	420
GTF3A	2971	broad.mit.edu	37	13	28001293	28001293	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr13:28001293G>T	ENST00000381140.4	+	2	460	c.266G>T	c.(265-267)cGc>cTc	p.R89L	GTF3A_ENST00000470606.1_3'UTR	NM_002097.2	NP_002088	Q92664	TF3A_HUMAN	general transcription factor IIIA	89					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|lung(1)	2		Lung SC(185;0.0156)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.11)|OV - Ovarian serous cystadenocarcinoma(117;0.158)		CATCTGAGCCGCCACATTCTG	0.453																																						ENST00000381140.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999983	0.990000	1.000000																										0				2						c.(265-267)cGc>cTc		general transcription factor IIIA							73.0	65.0	68.0					13																	28001293		1568	3582	5150	SO:0001583	missense	2971	0	0					g.chr13:28001293G>T		CCDS45019.1	13q12.3-q13.1	2013-01-08			ENSG00000122034	ENSG00000122034		"""General transcription factors"", ""Zinc fingers, C2H2-type"""	4662	protein-coding gene	gene with protein product		600860				7789179	Standard	NM_002097		Approved	TFIIIA, AP2	uc001ure.2	Q92664	OTTHUMG00000016632	ENST00000381140.4:c.266G>T	chr13.hg19:g.28001293G>T	ENSP00000370532:p.Arg89Leu	1					GTF3A_ENST00000470606.1_3'UTR	p.R89L	NM_002097.2	NP_002088	2	2	4	2.330876	Q92664	TF3A_HUMAN	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	2	460	+		Lung SC(185;0.0156)	B7ZBK5|Q12963|Q13097	Missense_Mutation	SNP	ENST00000381140.4	1	1	hg19	c.266G>T	CCDS45019.1	1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343156	0.82022	.	.	ENSG00000122034	ENST00000381140	D	0.96232	-3.95	5.05	5.05	0.67936	5.050000	5.050000	0.679360	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.060233	0.64402	D	0.000003	D	0.96580	0.8884	L	0.38531	1.155	0.47659	D	0.999486	D	0.89917	1.0	D	0.87578	0.998	D	0.95247	0.8356	9	0.23891	T	0.37	-30.5797	16.9456	0.86229	0.0:0.0:1.0:0.0	.	89	Q92664	TF3A_HUMAN	L	89	ENSP00000370532:R89L	ENSP00000370532:R89L	R	+	2	0	0	GTF3A	26899293	26899293	1.000000	0.71417	1.000000	0.80357	0.598000	0.36846	6.197000	0.72100	2.495000	0.84180	0.655000	0.94253	CGC	0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.453	GTF3A-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044281.2	1	0	1		2	2	2	0		0	0	16		16	16	1	2.950000	-4.540687	1	0.370000	NM_002097			27	27		77	75	1		1	1		0	0	16	0		1.000000	1	0	94	0	236	0	27	77
PCDH9	5101	broad.mit.edu	37	13	67802227	67802228	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr13:67802227_67802228CC>AA	ENST00000377865.2	-	1	479_480	c.345_346GG>TT	c.(343-348)gtGGtg>gtTTtg	p.V116L	PCDH9_ENST00000328454.5_Missense_Mutation_p.V116L|PCDH9_ENST00000377861.3_Missense_Mutation_p.V116L|PCDH9_ENST00000544246.1_Missense_Mutation_p.V116L|PCDH9_ENST00000456367.1_Missense_Mutation_p.V116L			Q9HC56	PCDH9_HUMAN	protocadherin 9	116	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GGGAGGATCACCACCTCAAGTT	0.411																																						ENST00000377865.2	0.820000|0.810000	0.480000	7.400000e-01|7.300000e-01	5.600000e-01|5.500000e-01	0.640000|0.630000	0.655403|0.647833	0.640000|0.630000	0.640000																										0				103						c.(346-348)Gtg>Ttg|c.(343-345)gtG>gtT		protocadherin 9																																				SO:0001583	missense	5101	0	0					g.chr13:67802227C>A|g.chr13:67802228C>A	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.345_346delinsAA	chr13.hg19:g.67802227_67802228delinsAA	ENSP00000367096:p.Val116Leu	1					PCDH9_ENST00000456367.1_Missense_Mutation_p.V116L|PCDH9_ENST00000544246.1_Missense_Mutation_p.V116L|PCDH9_ENST00000328454.5_Missense_Mutation_p.V116L|PCDH9_ENST00000377861.3_Missense_Mutation_p.V116L|PCDH9_ENST00000456367.1_Silent_p.V115V|PCDH9_ENST00000544246.1_Silent_p.V115V|PCDH9_ENST00000328454.5_Silent_p.V115V|PCDH9_ENST00000377861.3_Silent_p.V115V	p.V116L|p.V115V			2	2	4	2.330876	Q9HC56	PCDH9_HUMAN		1	480|479	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation|Silent	SNP	ENST00000377865.2	1|0	1	hg19	c.346G>T|c.345G>T	CCDS9444.1	0																									5.940000|	5.940000|	0.961940|																																												0|			66700228|														0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.411	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	1|0	0	1		2|26	2	2	0		0|1	0|1	67		68|67	68|67	1	2.950000	-14.507670|-13.936920	1	0.370000	NM_203487			52	51		544|551	537|544	0		1	0		0|1	0	68|67	0		1.000000|0.999100	6.585001e-02|6.486879e-02	0	0	0	5	0	52	544
C14orf39	317761	broad.mit.edu	37	14	60945081	60945081	+	Missense_Mutation	SNP	C	C	T	rs549495863		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr14:60945081C>T	ENST00000321731.3	-	5	419	c.260G>A	c.(259-261)cGt>cAt	p.R87H		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	87					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTCATGTTTACGAAAAACATC	0.264													C|||	1	0.000199681	0.0	0.0	5008	,	,		15432	0.0		0.0	False		,,,				2504	0.001					ENST00000321731.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999835	0.990000	1.000000																										0				30						c.(259-261)cGt>cAt		chromosome 14 open reading frame 39							69.0	67.0	68.0					14																	60945081		2201	4297	6498	SO:0001583	missense	317761	7	121372	35				g.chr14:60945081C>T	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.260G>A	chr14.hg19:g.60945081C>T	ENSP00000324920:p.Arg87His	1						p.R87H	NM_174978.2	NP_777638	2	2	4	2.298994	Q8N1H7	S6OS1_HUMAN		5	419	-			Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	1	1	hg19	c.260G>A	CCDS9746.1	1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.886518	0.00527	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	T;T	0.41400	2.02;1.0	5.56	1.87	0.25490	5.560000	1.870000	0.254900	.	0.424204	0.24945	N	0.034343	T	0.11580	0.0282	N	0.01109	-1.01	0.19575	N	0.999969	B	0.06786	0.001	B	0.01281	0.0	T	0.36720	-0.9736	10	0.02654	T	1	-3.7283	8.5196	0.33268	0.0:0.2298:0.0:0.7702	.	87	Q8N1H7	S6OS1_HUMAN	H	87;58;87	ENSP00000324920:R87H;ENSP00000451665:R58H	ENSP00000324920:R87H	R	-	2	0	0	C14orf39	60014834	60014834	0.995000	0.38212	0.999000	0.59377	0.003000	0.03518	0.079000	0.14782	0.142000	0.18901	-1.969000	0.00466	CGT	0.535124		TCGA-HZ-7922-01A-11D-2154-08	0.264	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	1	0	1		2	2	2	0		0	0	36		36	36	1	2.950000	-20.000000	1	0.370000	NM_174978			41	41		159	155	1		1			0	0	36	0		1.000000	0	0	0	0	0	0	41	159
MGRN1	23295	broad.mit.edu	37	16	4702743	4702743	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr16:4702743G>T	ENST00000399577.5	+	4	454	c.361G>T	c.(361-363)Gag>Tag	p.E121*	MGRN1_ENST00000588994.1_Nonsense_Mutation_p.E121*|MGRN1_ENST00000586183.1_Nonsense_Mutation_p.E121*|MGRN1_ENST00000262370.7_Nonsense_Mutation_p.E121*|MGRN1_ENST00000415496.1_Nonsense_Mutation_p.E121*	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	121					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						CTACAGCCTGGAGTTCACCTT	0.662																																						ENST00000399577.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				18						c.(361-363)Gag>Tag		mahogunin ring finger 1, E3 ubiquitin protein ligase							35.0	44.0	41.0					16																	4702743		2066	4194	6260	SO:0001587	stop_gained	23295	0	0					g.chr16:4702743G>T	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.361G>T	chr16.hg19:g.4702743G>T	ENSP00000382487:p.Glu121*	1					MGRN1_ENST00000415496.1_Nonsense_Mutation_p.E121*|MGRN1_ENST00000588994.1_Nonsense_Mutation_p.E121*|MGRN1_ENST00000262370.7_Nonsense_Mutation_p.E121*|MGRN1_ENST00000586183.1_Nonsense_Mutation_p.E121*	p.E121*	NM_001142290.2	NP_001135762.1	1	2	3	2.008769	O60291	MGRN1_HUMAN		4	454	+			A4URL3|A4URL4|Q86W76	Nonsense_Mutation	SNP	ENST00000399577.5	0	1	hg19	c.361G>T	CCDS45402.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645878	0.87958	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	.	.	.	5.4	5.4	0.78164	5.400000	5.400000	0.781640	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-33.4513	17.7579	0.88455	0.0:0.0:1.0:0.0	.	.	.	.	X	121	.	ENSP00000262370:E121X	E	+	1	0	0	MGRN1	4642744	4642744	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	9.813000	0.99286	2.537000	0.85549	0.561000	0.74099	GAG	0.465014		TCGA-HZ-7922-01A-11D-2154-08	0.662	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2	1	0	1		2	2	2	0		0	0	21		21	21	1	2.950000	-20.000000	1	0.370000				35	33		70	68	1		1	1		0	0	21	0		1.000000	1	0	12	0	65	0	35	70
RLTPR	146206	broad.mit.edu	37	16	67682073	67682073	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr16:67682073C>T	ENST00000334583.6	+	14	1518	c.1190C>T	c.(1189-1191)gCg>gTg	p.A397V	RLTPR_ENST00000545661.1_Intron	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	397					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		ACCGGCAGGGCGGACTGGAGG	0.692																																						ENST00000334583.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				18						c.(1189-1191)gCg>gTg		RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing							19.0	22.0	21.0					16																	67682073		2002	4127	6129	SO:0001583	missense	146206	0	0					g.chr16:67682073C>T	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1190C>T	chr16.hg19:g.67682073C>T	ENSP00000334958:p.Ala397Val	1					RLTPR_ENST00000545661.1_Intron	p.A397V	NM_001013838.1	NP_001013860.1	1	2	3	2.013105	Q6F5E8	LR16C_HUMAN		14	1518	+		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	1	1	hg19	c.1190C>T	CCDS45513.1	1	.	.	.	.	.	.	.	.	.	.	C	7.612	0.675061	0.14841	.	.	ENSG00000159753	ENST00000334583	T	0.13307	2.6	3.45	-2.7	0.06004	3.450000	-2.700000	0.060040	.	5.763050	0.00786	N	0.001302	T	0.07098	0.0180	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24404	-1.0161	10	0.21014	T	0.42	-19.0545	2.4679	0.04557	0.3865:0.2967:0.0:0.3169	.	397	Q6F5E8	LR16C_HUMAN	V	397	ENSP00000334958:A397V	ENSP00000334958:A397V	A	+	2	0	0	RLTPR	66239574	66239574	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-2.040000	0.01416	-0.255000	0.09486	0.462000	0.41574	GCG	0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.692	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	1	0	1		2	2	2	0		0	0	19		19	19	1	2.950000	-20.000000	1	0.370000	NM_001013838			33	33		62	62	0		1			0	0	19	0		1.000000	0	0	0	0	0	0	33	62
PSKH1	5681	broad.mit.edu	37	16	67961230	67961230	+	Silent	SNP	C	C	G			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr16:67961230C>G	ENST00000291041.5	+	3	1130	c.960C>G	c.(958-960)ccC>ccG	p.P320P		NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1	320	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		GTCTCTAGCCCTGGCCTAGTG	0.587																																						ENST00000291041.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				12						c.(958-960)ccC>ccG		protein serine kinase H1							115.0	93.0	101.0					16																	67961230		2198	4300	6498	SO:0001819	synonymous_variant	5681	0	0					g.chr16:67961230C>G	M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.960C>G	chr16.hg19:g.67961230C>G		1						p.P320P	NM_006742.2	NP_006733.1	1	2	3	2.013105	P11801	KPSH1_HUMAN		3	1130	+		Ovarian(137;0.192)	Q9NY19	Silent	SNP	ENST00000291041.5	1	1	hg19	c.960C>G	CCDS10851.1	1																																																																																								0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.587	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268882.3	1	0	1		2	2	2	0		0	0	78		78	78	1	2.950000	-16.713520	1	0.370000	NM_006742			167	167		311	305	1		1	1		0	0	78	0		1.000000	1	0	18	0	50	0	167	311
NCOR1	9611	broad.mit.edu	37	17	16089977	16089977	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr17:16089977A>G	ENST00000268712.3	-	3	390	c.133T>C	c.(133-135)Tcc>Ccc	p.S45P	NCOR1_ENST00000395848.1_Intron|NCOR1_ENST00000395851.1_Missense_Mutation_p.S45P	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	45	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AGATGAGAGGAACGATAATCA	0.403																																						ENST00000268712.3	0.910000	0.510000	8.100000e-01	6.000000e-01	0.700000	0.713033	0.700000	0.700000																										0				107						c.(133-135)Tcc>Ccc		nuclear receptor corepressor 1							88.0	81.0	83.0					17																	16089977		2203	4300	6503	SO:0001583	missense	9611	0	0					g.chr17:16089977A>G	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.133T>C	chr17.hg19:g.16089977A>G	ENSP00000268712:p.Ser45Pro	1					NCOR1_ENST00000395848.1_Intron|NCOR1_ENST00000395851.1_Missense_Mutation_p.S45P	p.S45P	NM_006311.3	NP_006302.2	0	2	2	1.724001	O75376	NCOR1_HUMAN		3	390	-			B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	1	1	hg19	c.133T>C	CCDS11175.1	0	.	.	.	.	.	.	.	.	.	.	A	11.66	1.703488	0.30232	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000458113;ENST00000411510;ENST00000436828;ENST00000430577	T;T	0.47528	0.84;1.43	5.78	4.7	0.59300	5.780000	4.700000	0.593000	.	0.000000	0.85682	D	0.000000	T	0.57257	0.2041	L	0.46157	1.445	0.80722	D	1	B;P;P;P;D;D	0.69078	0.396;0.94;0.528;0.94;0.995;0.997	B;B;B;B;P;D	0.63793	0.135;0.441;0.244;0.441;0.829;0.918	T	0.56080	-0.8038	10	0.48119	T	0.1	-1.5681	11.1278	0.48328	0.928:0.0:0.072:0.0	.	45;45;45;45;45;45	E7EU93;E7EV02;Q3B773;E7EW50;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	P	45	ENSP00000268712:S45P;ENSP00000379192:S45P	ENSP00000268712:S45P	S	-	1	0	0	NCOR1	16030702	16030702	1.000000	0.71417	0.969000	0.41365	0.777000	0.43975	4.544000	0.60691	1.006000	0.39211	0.460000	0.39030	TCC	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.403	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	1	0	1		2	2	2	0		0	0	39		39	39	1	2.950000	-20.000000	1	0.370000	NM_006311			40	40		267	264	1		1	1		0	0	39	0		1.000000	9.970874e-01	0	5	0	57	0	40	267
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	24185	GRCh37	CM941329	TP53	M		c.(586-588)Cga>Tga	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	7157	1	121412	40	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578263G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	chr17.hg19:g.7578263G>A	ENSP00000269305:p.Arg196*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*	p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.724001	P04637	P53_HUMAN		6	775	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.586C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	5.410000	4.440000	0.537900	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	2	TP53	7518988	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	9	0		0	0	42		42	41	1	2.950000	-13.031110	1	0.370000	NM_000546			83	83		129	129	1		1	0	1	0	2	42	1024		1.000000	9.999989e-01	1	1	458	36	825	83	129
KDM6B	23135	broad.mit.edu	37	17	7752472	7752472	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr17:7752472G>A	ENST00000448097.2	+	11	3197	c.2866G>A	c.(2866-2868)Gca>Aca	p.A956T	KDM6B_ENST00000254846.5_Missense_Mutation_p.A956T			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	956					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						GCTGCCCCCCGCACAGGCCAA	0.692																																						ENST00000448097.2	0.610000	0.100000	4.500000e-01	1.700000e-01	0.290000	0.318837	0.290000	0.260000																										0				37						c.(2866-2868)Gca>Aca		lysine (K)-specific demethylase 6B							10.0	12.0	11.0					17																	7752472		2145	4204	6349	SO:0001583	missense	23135	3	119674	34				g.chr17:7752472G>A	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2866G>A	chr17.hg19:g.7752472G>A	ENSP00000412513:p.Ala956Thr	1					KDM6B_ENST00000254846.5_Missense_Mutation_p.A956T	p.A956T			0	2	2	1.724001	O15054	KDM6B_HUMAN		11	3197	+			C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	0	1	hg19	c.2866G>A		0	.	.	.	.	.	.	.	.	.	.	G	7.985	0.752026	0.15778	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.34072	1.38;1.39	4.39	-1.75	0.08031	4.390000	-1.750000	0.080310	.	1.071470	0.07336	N	0.879937	T	0.14013	0.0339	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.26467	-1.0102	10	0.05833	T	0.94	0.0123	0.7837	0.01045	0.2956:0.1624:0.3758:0.1662	.	956;956	O15054;O15054-1	KDM6B_HUMAN;.	T	956	ENSP00000254846:A956T;ENSP00000412513:A956T	ENSP00000254846:A956T	A	+	1	0	0	KDM6B	7693197	7693197	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	-0.879000	0.04188	-0.031000	0.13781	-0.448000	0.05591	GCA	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.692	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	0	0	1		2	2	2	0		0	0	29		29	29	1	2.950000	-7.630378	1	0.370000	XM_043272			4	4		77	76	0		1	0		0	0	29	0		0.889197	2.314682e-01	0	0	0	15	0	4	77
DNAI2	64446	broad.mit.edu	37	17	72308199	72308199	+	Missense_Mutation	SNP	C	C	T	rs377582813		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr17:72308199C>T	ENST00000311014.6	+	12	1619	c.1552C>T	c.(1552-1554)Cgg>Tgg	p.R518W	RP11-647F2.2_ENST00000585167.1_RNA|DNAI2_ENST00000446837.2_Missense_Mutation_p.R518W|DNAI2_ENST00000582036.1_Missense_Mutation_p.R506W|DNAI2_ENST00000579490.1_Missense_Mutation_p.R575W|DNAI2_ENST00000307504.5_Missense_Mutation_p.R375W			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	518					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CCGGGAGATGCGGCTGAAGGA	0.657									Kartagener syndrome				C|||	1	0.000199681	0.0	0.0	5008	,	,		16566	0.001		0.0	False		,,,				2504	0.0					ENST00000311014.6	0.280000	0.050000	2.100000e-01	8.000000e-02	0.140000	0.153893	0.140000	0.130000																										0				39						c.(1552-1554)Cgg>Tgg		dynein, axonemal, intermediate chain 2							59.0	52.0	54.0					17																	72308199		2203	4300	6503	SO:0001583	missense	64446	11	121396	40	Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr17:72308199C>T	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1552C>T	chr17.hg19:g.72308199C>T	ENSP00000308312:p.Arg518Trp	1					DNAI2_ENST00000579490.1_Missense_Mutation_p.R575W|RP11-647F2.2_ENST00000585167.1_RNA|DNAI2_ENST00000307504.5_Missense_Mutation_p.R375W|DNAI2_ENST00000446837.2_Missense_Mutation_p.R518W|DNAI2_ENST00000582036.1_Missense_Mutation_p.R506W	p.R518W			0	2	2	1.713689	Q9GZS0	DNAI2_HUMAN		12	1619	+			C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	0	1	hg19	c.1552C>T	CCDS11697.1	0	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195638	0.78902	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.34859	1.34;1.34;1.34	4.62	3.64	0.41730	4.620000	3.640000	0.417300	.	0.058074	0.64402	D	0.000001	T	0.64527	0.2606	M	0.90705	3.14	0.58432	D	0.999993	D	0.89917	1.0	D	0.79784	0.993	T	0.71361	-0.4616	10	0.87932	D	0	-34.1547	12.0007	0.53228	0.315:0.685:0.0:0.0	.	518	Q9GZS0	DNAI2_HUMAN	W	518;375;518	ENSP00000308312:R518W;ENSP00000302929:R375W;ENSP00000400252:R518W	ENSP00000302929:R375W	R	+	1	2	2	DNAI2	69819794	69819794	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.401000	0.44513	0.950000	0.37743	0.485000	0.47835	CGG	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.657	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	0	0	1		2	2	2	0		0	0	44		44	44	1	2.950000	-3.004511	1	0.370000	NM_023036			5	5		202	200	0		1			0	0	44	0		0.936704	0	0	0	0	0	0	5	202
CAPNS1	826	broad.mit.edu	37	19	36633201	36633201	+	Splice_Site	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr19:36633201G>A	ENST00000246533.3	+	3	807		c.e3-1		CAPNS1_ENST00000588815.1_Splice_Site|CAPNS1_ENST00000590874.1_Splice_Site|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588780.1_Splice_Site|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000587718.1_Splice_Site	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCTCTTCGCAGCGAGGCGGCT	0.652																																					Esophageal Squamous(129;1541 1691 5780 18353 34150)	ENST00000246533.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				5						c.e3-1		calpain, small subunit 1							55.0	65.0	61.0					19																	36633201		2203	4300	6503	SO:0001630	splice_region_variant	826	0	0					g.chr19:36633201G>A	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.210-1G>A	chr19.hg19:g.36633201G>A		1					CAPNS1_ENST00000588780.1_Splice_Site|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000587718.1_Splice_Site|CAPNS1_ENST00000590874.1_Splice_Site|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000588815.1_Splice_Site		NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	2	2	4	2.258998	P04632	CPNS1_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)	3	807	+	Esophageal squamous(110;0.162)		A8K0P1|Q8WTX3|Q96EW0	Splice_Site	SNP	ENST00000246533.3	1	1	hg19		CCDS12489.1	1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978756	0.53720	.	.	ENSG00000126247	ENST00000246533	.	.	.	5.17	5.17	0.71159	5.170000	5.170000	0.711590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5225	0.67859	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	CAPNS1	41325041	41325041	1.000000	0.71417	0.968000	0.41197	0.522000	0.34438	5.289000	0.65656	2.564000	0.86499	0.561000	0.74099	.	0.526066		TCGA-HZ-7922-01A-11D-2154-08	0.652	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457411.2	1	0	1		2	2	2	0		0	0	88		88	86	1	2.950000	-20.000000	1	0.370000		Intron		165	161		444	434	1		1	1		0	0	88	0		1.000000	9.957494e-01	0	10	0	15	0	165	444
FCGBP	8857	broad.mit.edu	37	19	40368392	40368392	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr19:40368392T>C	ENST00000221347.6	-	28	12963	c.12956A>G	c.(12955-12957)gAc>gGc	p.D4319G		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4319						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCAAAGAATGTCACGGTCCCC	0.622																																						ENST00000221347.6	1.000000	0.410000	6.200000e-01	4.700000e-01	0.530000	0.574331	0.530000	0.530000																										0				165						c.(12955-12957)gAc>gGc		Fc fragment of IgG binding protein							176.0	177.0	176.0					19																	40368392		2203	4300	6503	SO:0001583	missense	8857	0	0					g.chr19:40368392T>C	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12956A>G	chr19.hg19:g.40368392T>C	ENSP00000221347:p.Asp4319Gly	1						p.D4319G	NM_003890.2	NP_003881.2	2	2	4	2.258998	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)	28	12963	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		O95784	Missense_Mutation	SNP	ENST00000221347.6	1	1	hg19	c.12956A>G	CCDS12546.1	0	.	.	.	.	.	.	.	.	.	.	T	3.672	-0.067331	0.07273	.	.	ENSG00000090920	ENST00000221347	T	0.78246	-1.16	4.08	4.08	0.47627	4.080000	4.080000	0.476270	Uncharacterised domain, cysteine-rich (2);	0.412810	0.23912	U	0.043327	T	0.74442	0.3717	M	0.61703	1.905	0.22280	N	0.999235	B	0.21071	0.051	B	0.22386	0.039	T	0.68205	-0.5470	10	0.54805	T	0.06	.	12.4404	0.55621	0.0:0.0:0.0:1.0	.	4319	Q9Y6R7	FCGBP_HUMAN	G	4319	ENSP00000221347:D4319G	ENSP00000221347:D4319G	D	-	2	0	0	FCGBP	45060232	45060232	0.000000	0.05858	0.759000	0.31340	0.040000	0.13550	0.602000	0.24134	1.848000	0.53677	0.254000	0.18369	GAC	0.526066		TCGA-HZ-7922-01A-11D-2154-08	0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	1	0	1		2	2	2	0		0	0	185		185	194	1	2.950000	-15.187380	1	0.370000	NM_003890			77	74		972	893	0		1	0		0	0	185	0		1.000000	3.895057e-01	0	0	0	18	0	77	972
PHLDB3	653583	broad.mit.edu	37	19	44006338	44006338	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr19:44006338T>C	ENST00000292140.5	-	3	671	c.311A>G	c.(310-312)cAg>cGg	p.Q104R	PHLDB3_ENST00000599242.1_Missense_Mutation_p.Q104R	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	104							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				CTCCAGCTGCTGTCCTTGCAG	0.672																																						ENST00000292140.5	1.000000	0.820000	1	9.900000e-01	0.990000	0.989646	0.990000	1.000000																										0				7						c.(310-312)cAg>cGg		pleckstrin homology-like domain, family B, member 3							27.0	25.0	26.0					19																	44006338		2203	4295	6498	SO:0001583	missense	653583	0	0					g.chr19:44006338T>C		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.311A>G	chr19.hg19:g.44006338T>C	ENSP00000292140:p.Gln104Arg	1					PHLDB3_ENST00000599242.1_Missense_Mutation_p.Q104R	p.Q104R	NM_198850.3	NP_942147.3	2	2	4	2.321842	Q6NSJ2	PHLB3_HUMAN		3	671	-		Prostate(69;0.0153)	Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	1	0	hg19	c.311A>G	CCDS12621.2	1	.	.	.	.	.	.	.	.	.	.	T	8.751	0.921249	0.17982	.	.	ENSG00000176531	ENST00000292140	T	0.46063	0.88	4.02	2.95	0.34219	4.020000	2.950000	0.342190	.	0.735759	0.12304	N	0.480900	T	0.26048	0.0635	L	0.29908	0.895	0.22989	N	0.998464	P;B	0.42584	0.784;0.139	B;B	0.36808	0.233;0.039	T	0.06373	-1.0830	10	0.24483	T	0.36	.	6.6992	0.23215	0.211:0.0:0.0:0.789	.	104;104	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	R	104	ENSP00000292140:Q104R	ENSP00000292140:Q104R	Q	-	2	0	0	PHLDB3	48698178	48698178	1.000000	0.71417	0.940000	0.37924	0.172000	0.22775	2.318000	0.43779	0.512000	0.28257	0.254000	0.18369	CAG	0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.672	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2	1	0	1		2	2	2	0		0	0	13		13	12	1	2.950000	-18.768950	1	0.370000				9	9		34	33	1		1	0		0	0	13	0		0.995427	1.322849e-01	0	0	0	3	0	9	34
VRK3	51231	broad.mit.edu	37	19	50504080	50504080	+	Silent	SNP	T	T	C			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr19:50504080T>C	ENST00000599538.1	-	6	1243	c.579A>G	c.(577-579)tcA>tcG	p.S193S	VRK3_ENST00000424804.2_5'UTR|VRK3_ENST00000601912.1_Silent_p.S143S|VRK3_ENST00000594948.1_Silent_p.S193S|VRK3_ENST00000377011.2_Silent_p.S143S|VRK3_ENST00000601341.1_Silent_p.S143S|VRK3_ENST00000593919.1_Silent_p.S193S|VRK3_ENST00000443401.2_Missense_Mutation_p.Q13R|VRK3_ENST00000594092.1_Silent_p.S193S|VRK3_ENST00000316763.3_Silent_p.S193S			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	193	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		TCTGTGGTCCTGAGTCACAGG	0.542																																					Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)	ENST00000599538.1	1.000000	0.890000	1	9.900000e-01	0.990000	0.993801	0.990000	1.000000																										0				23						c.(577-579)tcA>tcG		vaccinia related kinase 3							119.0	99.0	106.0					19																	50504080		2203	4300	6503	SO:0001819	synonymous_variant	51231	0	0					g.chr19:50504080T>C	AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.579A>G	chr19.hg19:g.50504080T>C		1					VRK3_ENST00000593919.1_Silent_p.S193S|VRK3_ENST00000377011.2_Silent_p.S143S|VRK3_ENST00000601912.1_Silent_p.S143S|VRK3_ENST00000601341.1_Silent_p.S143S|VRK3_ENST00000316763.3_Silent_p.S193S|VRK3_ENST00000424804.2_5'UTR|VRK3_ENST00000443401.2_Missense_Mutation_p.Q13R|VRK3_ENST00000594948.1_Silent_p.S193S|VRK3_ENST00000594092.1_Silent_p.S193S	p.S193S			2	5	7	2.904407	Q8IV63	VRK3_HUMAN		6	1243	-		all_neural(266;0.0459)|Ovarian(192;0.0481)	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Silent	SNP	ENST00000599538.1	1	1	hg19	c.579A>G	CCDS12791.1	1	.	.	.	.	.	.	.	.	.	.	T	9.531	1.110884	0.20714	.	.	ENSG00000105053	ENST00000443401	T	0.29397	1.57	3.45	-0.215	0.13157	3.450000	-0.215000	0.131570	.	.	.	.	.	T	0.10937	0.0267	.	.	.	0.09310	N	0.999994	B	0.09022	0.002	B	0.12156	0.007	T	0.35724	-0.9777	8	0.02654	T	1	-1.2996	6.4127	0.21700	0.0:0.5503:0.0:0.4497	.	13	B4DGW1	.	R	13	ENSP00000414907:Q13R	ENSP00000414907:Q13R	Q	-	2	0	0	VRK3	55195892	55195892	0.001000	0.12720	0.011000	0.14972	0.009000	0.06853	-0.829000	0.04415	-0.078000	0.12730	0.533000	0.62120	CAG	0.632063		TCGA-HZ-7922-01A-11D-2154-08	0.542	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464815.1	0	0	1		2	2	2	0		0	0	24		24	24	1	2.950000	-20.000000	1	0.370000	NM_016440			26	25		162	160	1		1	1		0	0	24	0		1.000000	9.999999e-01	0	25	0	153	0	26	162
KLK1	3816	broad.mit.edu	37	19	51322554	51322555	+	Missense_Mutation	DNP	AT	AT	TG			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			A|T	T|G	A|T	A|T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr19:51322554_51322555AT>TG	ENST00000301420.2	-	5	719_720	c.684_685AT>CA	c.(682-687)acATca>acCAca	p.S229T	KLK1_ENST00000448701.2_Missense_Mutation_p.S127T|CTD-2568A17.5_ENST00000326989.5_lincRNA	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	229	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	TAGCCCCATGATGTGACACCTT	0.579																																						ENST00000301420.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				13						c.(685-687)Tca>Aca|c.(682-684)acA>acC		kallikrein 1	Aprotinin(DB06692)																																			SO:0001583	missense	3816	0	0					g.chr19:51322554A>T|g.chr19:51322555T>G	L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.684_685delinsTG	chr19.hg19:g.51322554_51322555delinsTG	ENSP00000301420:p.Ser229Thr	1					KLK1_ENST00000448701.2_Missense_Mutation_p.S127T|CTD-2568A17.5_ENST00000326989.5_lincRNA|KLK1_ENST00000448701.2_Silent_p.T126T|CTD-2568A17.5_ENST00000326989.5_lincRNA	p.S229T|p.T228T	NM_002257.2	NP_002248.1	2	5	7	2.904407	P06870	KLK1_HUMAN		5	720|719	-		all_neural(266;0.0199)	Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Missense_Mutation|Silent	SNP	ENST00000301420.2	1	1	hg19	c.685T>A|c.684A>C	CCDS12804.1	1																									3.660000|	2.640000|	0.314450|																																												0|			56014366|														0.632063		TCGA-HZ-7922-01A-11D-2154-08	0.579	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464135.2	1	0	1		2	2	2	0		0	0	61		61	60	1	2.950000	-20.000000	1	0.370000	NM_002257			175|174	174|173		247|248	242|243	1		1	1		0	0	61	0		1.000000	1	0	4	0	416|409	0	174	247
NLRP4	147945	broad.mit.edu	37	19	56369355	56369355	+	Missense_Mutation	SNP	C	C	T	rs370421219	byFrequency	TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr19:56369355C>T	ENST00000301295.6	+	3	1018	c.596C>T	c.(595-597)aCg>aTg	p.T199M	NLRP4_ENST00000346986.5_Missense_Mutation_p.T199M|NLRP4_ENST00000587891.1_Missense_Mutation_p.T124M	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	199	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.T199M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTGCCGCCAACGAGTTTGGCT	0.517													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19917	0.0		0.0	False		,,,				2504	0.001					ENST00000301295.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.T199M(1)	upper_aerodigestive_tract(1)	42						c.(595-597)aCg>aTg		NLR family, pyrin domain containing 4		C	MET/THR	2,4404	4.2+/-10.8	0,2,2201	101.0	101.0	101.0		596	-0.4	0.0	19		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	NLRP4	NM_134444.4	81	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	199/995	56369355	3,13003	2203	4300	6503	SO:0001583	missense	147945	9	121412	42				g.chr19:56369355C>T	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.596C>T	chr19.hg19:g.56369355C>T	ENSP00000301295:p.Thr199Met	1					NLRP4_ENST00000346986.5_Missense_Mutation_p.T199M|NLRP4_ENST00000587891.1_Missense_Mutation_p.T124M	p.T199M	NM_134444.4	NP_604393.2	2	4	6	2.901888	Q96MN2	NALP4_HUMAN		3	1018	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	1	1	hg19	c.596C>T	CCDS12936.1	1	.	.	.	.	.	.	.	.	.	.	C	8.234	0.805414	0.16467	4.54E-4	1.16E-4	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.78707	-1.2;-1.2	4.11	-0.4	0.12411	4.110000	-0.400000	0.124110	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.60586	0.2280	L	0.33485	1.01	0.09310	N	1	B;B;B	0.32128	0.063;0.051;0.357	B;B;B	0.24394	0.025;0.024;0.053	T	0.45249	-0.9274	9	0.33940	T	0.23	.	6.757	0.23520	0.0:0.4886:0.0:0.5114	.	199;124;199	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	M	199	ENSP00000301295:T199M;ENSP00000344787:T199M	ENSP00000301295:T199M	T	+	2	0	0	NLRP4	61061167	61061167	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.970000	0.03810	0.152000	0.19188	-1.020000	0.02445	ACG	0.631665		TCGA-HZ-7922-01A-11D-2154-08	0.517	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	1	0	1		2	2	2	0		0	0	104		104	103	1	2.950000	-20.000000	1	0.370000	NM_134444			196	195		751	740	1		1			0	0	104	0		1.000000	0	0	0	0	0	0	196	751
CDC14A	8556	broad.mit.edu	37	1	100843110	100843110	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr1:100843110C>A	ENST00000336454.3	+	3	504	c.149C>A	c.(148-150)gCa>gAa	p.A50E	CDC14A_ENST00000361544.6_Missense_Mutation_p.A50E|CDC14A_ENST00000544534.1_Missense_Mutation_p.A50E|AC104457.1_ENST00000401248.1_RNA|CDC14A_ENST00000542213.1_5'UTR|CDC14A_ENST00000370125.2_Missense_Mutation_p.A50E|CDC14A_ENST00000370124.3_Missense_Mutation_p.A50E	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	50	A.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		AGTTTCTATGCAGATTTTGGA	0.279																																						ENST00000336454.3	1.000000	0.540000	9.300000e-01	6.600000e-01	0.790000	0.797519	0.790000	1.000000																										0				31						c.(148-150)gCa>gAa		cell division cycle 14A							83.0	79.0	80.0					1																	100843110		2203	4300	6503	SO:0001583	missense	8556	0	0					g.chr1:100843110C>A	AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.149C>A	chr1.hg19:g.100843110C>A	ENSP00000336739:p.Ala50Glu	1					CDC14A_ENST00000361544.6_Missense_Mutation_p.A50E|CDC14A_ENST00000370125.2_Missense_Mutation_p.A50E|AC104457.1_ENST00000401248.1_RNA|CDC14A_ENST00000370124.3_Missense_Mutation_p.A50E|CDC14A_ENST00000544534.1_Missense_Mutation_p.A50E|CDC14A_ENST00000542213.1_5'UTR	p.A50E	NM_003672.3	NP_003663.2	1	2	3	2.049050	Q9UNH5	CC14A_HUMAN		3	504	+		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	ENST00000336454.3	1	1	hg19	c.149C>A	CCDS769.1	0	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988957	0.53934	.	.	ENSG00000079335	ENST00000455467;ENST00000370125;ENST00000361544;ENST00000370124;ENST00000336454;ENST00000544534	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.64	5.64	0.86602	5.640000	5.640000	0.866020	.	0.000000	0.85682	D	0.000000	T	0.31544	0.0800	M	0.65677	2.01	0.80722	D	1	P;B;P;P;B	0.37708	0.471;0.091;0.471;0.606;0.055	B;B;B;B;B	0.33799	0.082;0.041;0.118;0.17;0.018	T	0.17077	-1.0381	10	0.38643	T	0.18	-14.0376	18.4654	0.90752	0.0:1.0:0.0:0.0	.	50;50;50;50;50	A6MA65;Q9UNH5-3;Q9UNH5;Q9UNH5-2;Q52LH9	.;.;CC14A_HUMAN;.;.	E	51;50;50;50;50;50	ENSP00000388501:A51E;ENSP00000359143:A50E;ENSP00000354916:A50E;ENSP00000359142:A50E;ENSP00000336739:A50E;ENSP00000442543:A50E	ENSP00000336739:A50E	A	+	2	0	0	CDC14A	100615698	100615698	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.228000	0.58619	2.660000	0.90430	0.455000	0.32223	GCA	0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.279	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1	1	0	1		2	2	2	0		0	0	30		30	30	1	2.950000	-13.560680	1	0.370000	NM_033312			29	29		207	205	1		1	0		0	0	30	0		1.000000	3.640681e-01	0	1	0	9	0	29	207
KCNT2	343450	broad.mit.edu	37	1	196227479	196227479	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr1:196227479C>T	ENST00000294725.9	-	26	3971	c.3056G>A	c.(3055-3057)cGa>cAa	p.R1019Q	KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.R953Q|KCNT2_ENST00000367433.5_Missense_Mutation_p.R995Q|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.R952Q			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1019					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.R1019Q(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GCTCAGTCTTCGGGCCCACTG	0.512																																						ENST00000294725.9	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.R1019Q(1)	large_intestine(1)	97						c.(3055-3057)cGa>cAa		potassium channel, subfamily T, member 2							147.0	127.0	134.0					1																	196227479		2203	4300	6503	SO:0001583	missense	343450	1	121408	31				g.chr1:196227479C>T	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3056G>A	chr1.hg19:g.196227479C>T	ENSP00000294725:p.Arg1019Gln	1					KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.R952Q|KCNT2_ENST00000367431.4_Missense_Mutation_p.R953Q|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000367433.5_Missense_Mutation_p.R995Q	p.R1019Q			1	2	3	2.030260	Q6UVM3	KCNT2_HUMAN		26	3971	-			Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	1	1	hg19	c.3056G>A	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.444207	0.83993	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.23950	1.88;1.93;2.23	5.74	4.83	0.62350	5.740000	4.830000	0.623500	.	0.000000	0.49305	D	0.000152	T	0.49847	0.1581	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.76494	0.999;0.99;0.967;0.983	D;P;P;P	0.65443	0.935;0.674;0.556;0.474	T	0.51803	-0.8659	10	0.41790	T	0.15	-7.0387	14.7148	0.69259	0.0:0.9307:0.0:0.0693	.	984;995;952;1019	Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	Q	995;953;1019	ENSP00000356403:R995Q;ENSP00000356401:R953Q;ENSP00000294725:R1019Q	ENSP00000294725:R1019Q	R	-	2	0	0	KCNT2	194494102	194494102	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	7.487000	0.81328	1.437000	0.47472	-0.148000	0.13756	CGA	0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.512	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	1	0	1		2	2	2	0		0	0	37		37	37	1	2.950000	-7.488261	1	0.370000	NM_198503			120	120		312	308	1		1	0		0	0	37	0		1.000000	0	0	0	0	1	0	120	312
ERICH3	127254	broad.mit.edu	37	1	75037471	75037471	+	Missense_Mutation	SNP	G	G	A	rs138615520		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr1:75037471G>A	ENST00000326665.5	-	14	4141	c.3923C>T	c.(3922-3924)gCg>gTg	p.A1308V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1308	Glu-rich.							p.A1308V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTCCTGCATCGCTTCTGTCTC	0.542																																						ENST00000326665.5	1.000000	0.730000	9.600000e-01	8.000000e-01	0.880000	0.887127	0.880000	1.000000																										1	Substitution - Missense(1)	p.A1308V(1)	prostate(1)	184						c.(3922-3924)gCg>gTg									260.0	219.0	233.0					1																	75037471		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr1:75037471G>A																												ENST00000326665.5:c.3923C>T	chr1.hg19:g.75037471G>A	ENSP00000322609:p.Ala1308Val	1					C1orf173_ENST00000433746.2_5'UTR	p.A1308V	NM_001002912.4	NP_001002912.4	1	2	3	2.049050	Q5RHP9	ERIC3_HUMAN		14	4141	-			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	1	1	hg19	c.3923C>T	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	0.460	-0.889610	0.02511	.	.	ENSG00000178965	ENST00000326665	T	0.09723	2.95	3.58	-4.77	0.03219	3.580000	-4.770000	0.032190	.	.	.	.	.	T	0.00967	0.0032	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47598	-0.9105	9	0.28530	T	0.3	-0.0061	3.7935	0.08730	0.4175:0.0:0.3159:0.2666	.	1308	Q5RHP9	CA173_HUMAN	V	1308	ENSP00000322609:A1308V	ENSP00000322609:A1308V	A	-	2	0	0	C1orf173	74810059	74810059	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.543000	0.06084	-0.741000	0.04797	-0.672000	0.03802	GCG	0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.542	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1	1	0	1		2	2	2	0		0	0	126		126	124	1	2.950000	-20.000000	1	0.370000				117	118		729	723	1		1			0	0	126	0		1.000000	0	0	0	0	0	0	117	729
ELTD1	64123	broad.mit.edu	37	1	79392719	79392719	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr1:79392719G>T	ENST00000370742.3	-	8	998	c.935C>A	c.(934-936)tCt>tAt	p.S312Y		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	312					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GAAGTTGTCAGATGATGAAAG	0.318																																						ENST00000370742.3	1.000000	0.630000	9.600000e-01	7.300000e-01	0.840000	0.847207	0.840000	1.000000																										0				69						c.(934-936)tCt>tAt		EGF, latrophilin and seven transmembrane domain containing 1							77.0	72.0	74.0					1																	79392719		1811	4079	5890	SO:0001583	missense	64123	0	0					g.chr1:79392719G>T	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.935C>A	chr1.hg19:g.79392719G>T	ENSP00000359778:p.Ser312Tyr	1						p.S312Y	NM_022159.3	NP_071442.2	1	2	3	2.049050	Q9HBW9	ELTD1_HUMAN		8	998	-			B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	1	1	hg19	c.935C>A	CCDS41352.1	0	.	.	.	.	.	.	.	.	.	.	G	14.92	2.677924	0.47886	.	.	ENSG00000162618	ENST00000370742	T	0.10668	2.85	6.02	5.08	0.68730	6.020000	5.080000	0.687300	Domain of unknown function DUF3497 (1);	0.387514	0.33075	N	0.005305	T	0.13157	0.0319	L	0.47716	1.5	0.35306	D	0.783468	D	0.60160	0.987	D	0.65323	0.934	T	0.03981	-1.0987	9	.	.	.	.	11.9663	0.53038	0.0:0.1317:0.7313:0.137	.	312	Q9HBW9	ELTD1_HUMAN	Y	312	ENSP00000359778:S312Y	.	S	-	2	0	0	ELTD1	79165307	79165307	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	2.927000	0.48900	1.495000	0.48549	0.544000	0.68410	TCT	0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.318	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	1	0	1		2	2	2	0		0	0	52		52	52	1	2.950000	-19.681960	1	0.370000	NM_022159			47	47		310	308	1		1	0		0	0	52	0		1.000000	9.320580e-01	0	0	0	32	0	47	310
TRIM58	25893	broad.mit.edu	37	1	248039221	248039221	+	Silent	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr1:248039221C>T	ENST00000366481.3	+	6	939	c.891C>T	c.(889-891)ccC>ccT	p.P297P	OR2W3_ENST00000537741.1_5'UTR	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	297	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.P297P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGCTGGATCCCGCCACGGCGC	0.537																																						ENST00000366481.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - coding silent(1)	p.P297P(1)	endometrium(1)	63						c.(889-891)ccC>ccT		tripartite motif containing 58							55.0	55.0	55.0					1																	248039221		2203	4300	6503	SO:0001819	synonymous_variant	25893	2	121412	30				g.chr1:248039221C>T	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.891C>T	chr1.hg19:g.248039221C>T		1					OR2W3_ENST00000537741.1_5'UTR	p.P297P	NM_015431.3	NP_056246.3	1	2	3	2.030260	Q8NG06	TRI58_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)	6	939	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	Q6B0H9	Silent	SNP	ENST00000366481.3	1	1	hg19	c.891C>T	CCDS1636.1	1																																																																																								0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.537	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	1	0	1		2	2	2	0		0	0	33		33	32	1	2.950000	-5.515517	1	0.370000	NM_015431			57	57		143	141	1		1	0		0	0	33	0		1.000000	0	0	0	0	1	0	57	143
KRTAP6-1	337966	broad.mit.edu	37	21	31986063	31986063	+	Missense_Mutation	SNP	C	C	T	rs28567421	byFrequency	TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr21:31986063C>T	ENST00000329122.2	-	1	186	c.161G>A	c.(160-162)cGc>cAc	p.R54H	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	54						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						ACAGAGGGAGCGGGAGCCATA	0.587													C|||	8	0.00159744	0.0061	0.0	5008	,	,		15898	0.0		0.0	False		,,,				2504	0.0					ENST00000329122.2	1.000000	0.800000	9.800000e-01	8.700000e-01	0.930000	0.929642	0.930000	0.970000																										0				10						c.(160-162)cGc>cAc		keratin associated protein 6-1		C	HIS/ARG	15,4391	22.3+/-47.3	0,15,2188	110.0	115.0	113.0		161	0.8	0.0	21	dbSNP_125	113	4,8596	3.7+/-12.6	0,4,4296	yes	missense	KRTAP6-1	NM_181602.1	29	0,19,6484	TT,TC,CC		0.0465,0.3404,0.1461	benign	54/72	31986063	19,12987	2203	4300	6503	SO:0001583	missense	337966	87	121408	54				g.chr21:31986063C>T	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.161G>A	chr21.hg19:g.31986063C>T	ENSP00000332690:p.Arg54His	1					KRTAP20-1_ENST00000334664.2_5'Flank	p.R54H	NM_181602.1	NP_853633.1	0	1	1	1.400316	Q3LI64	KRA61_HUMAN		1	186	-				Missense_Mutation	SNP	ENST00000329122.2	1	1	hg19	c.161G>A	CCDS13602.1	1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	4.286	0.052327	0.08291	0.003404	4.65E-4	ENSG00000184724	ENST00000329122	T	0.20069	2.1	4.88	0.801	0.18679	4.880000	0.801000	0.186790	.	0.870871	0.09244	U	0.828807	T	0.09158	0.0226	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.36040	-0.9764	9	0.87932	D	0	.	1.1175	0.01718	0.1567:0.4229:0.1522:0.2683	rs28567421	54	Q3LI64	KRA61_HUMAN	H	54	ENSP00000332690:R54H	ENSP00000332690:R54H	R	-	2	0	0	KRTAP6-1	30907934	30907934	0.001000	0.12720	0.001000	0.08648	0.118000	0.20060	-0.881000	0.04179	0.043000	0.15746	0.643000	0.83706	CGC	0.226994		TCGA-HZ-7922-01A-11D-2154-08	0.587	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128240.2	1	0	1		2	2	2	0		0	0	141		141	140	1	2.950000	-2.755114	1	0.370000	NM_181602			120	120		422	419	1		1			0	0	141	0		1.000000	0	0	0	0	0	0	120	422
AGPAT3	56894	broad.mit.edu	37	21	45389013	45389013	+	Silent	SNP	C	C	A	rs146737372	byFrequency	TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr21:45389013C>A	ENST00000398063.2	+	4	855	c.363C>A	c.(361-363)ctC>ctA	p.L121L	AGPAT3_ENST00000398061.1_Silent_p.L121L|AGPAT3_ENST00000546158.1_Silent_p.L121L|AGPAT3_ENST00000291572.8_Silent_p.L121L|AGPAT3_ENST00000327505.2_Silent_p.L121L|AGPAT3_ENST00000479117.1_3'UTR|AGPAT3_ENST00000398058.1_Silent_p.L121L	NM_001037553.1	NP_001032642.1	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	121					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			large_intestine(4)|lung(5)|ovary(1)|prostate(1)	11				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		CCAAGGTCCTCGCTAAGAAGG	0.637																																					Pancreas(60;623 1650 5574 52796)	ENST00000398063.2	0.340000	0.080000	2.700000e-01	1.300000e-01	0.190000	0.205493	0.190000	0.180000																										0				11						c.(361-363)ctC>ctA		1-acylglycerol-3-phosphate O-acyltransferase 3		C	,	1,4405	2.1+/-5.4	0,1,2202	113.0	88.0	96.0		363,363	-9.0	0.2	21	dbSNP_134	96	11,8589	8.4+/-32.0	0,11,4289	no	coding-synonymous,coding-synonymous	AGPAT3	NM_001037553.1,NM_020132.4	,	0,12,6491	AA,AC,CC		0.1279,0.0227,0.0923	,	121/377,121/377	45389013	12,12994	2203	4300	6503	SO:0001819	synonymous_variant	56894	79	121412	50				g.chr21:45389013C>A	AF156774	CCDS13703.1	21q22.3	2013-02-05			ENSG00000160216	ENSG00000160216	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	326	protein-coding gene	gene with protein product		614794					Standard	XM_005261159		Approved	LPAAT-gamma	uc002zdw.3	Q9NRZ7	OTTHUMG00000086892	ENST00000398063.2:c.363C>A	chr21.hg19:g.45389013C>A		1					AGPAT3_ENST00000327505.2_Silent_p.L121L|AGPAT3_ENST00000398061.1_Silent_p.L121L|AGPAT3_ENST00000398058.1_Silent_p.L121L|AGPAT3_ENST00000291572.8_Silent_p.L121L|AGPAT3_ENST00000479117.1_3'UTR|AGPAT3_ENST00000546158.1_Silent_p.L121L	p.L121L	NM_001037553.1	NP_001032642.1	0	2	2	1.696981	Q9NRZ7	PLCC_HUMAN		4	855	+			D3DSL2|Q3ZCU2|Q6UWP6|Q6ZUC6|Q8N3Q7|Q9NRZ6	Silent	SNP	ENST00000398063.2	0	1	hg19	c.363C>A	CCDS13703.1	0																																																																																								0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.637	AGPAT3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195722.1	0	0	1		2	2	2	0		0	0	47		47	46	1	2.950000	-2.886319	1	0.370000	NM_020132			8	8		225	223	0		1	0		0	0	47	0		0.989357	9.014672e-01	0	0	0	118	0	8	225
COL6A2	1292	broad.mit.edu	37	21	47538549	47538549	+	Missense_Mutation	SNP	C	C	T	rs142880107		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr21:47538549C>T	ENST00000300527.4	+	13	1242	c.1138C>T	c.(1138-1140)Cgc>Tgc	p.R380C	COL6A2_ENST00000357838.4_Missense_Mutation_p.R380C|COL6A2_ENST00000409416.1_Missense_Mutation_p.R380C|COL6A2_ENST00000310645.5_Missense_Mutation_p.R380C|COL6A2_ENST00000397763.1_Missense_Mutation_p.R380C	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	380	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCCCAGGACGCAGAGGGCC	0.682																																						ENST00000300527.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999995	0.990000	1.000000																										0				43						c.(1138-1140)Cgc>Tgc		collagen, type VI, alpha 2		C	CYS/ARG,CYS/ARG,CYS/ARG	1,4397	2.1+/-5.4	0,1,2198	27.0	30.0	29.0		1138,1138,1138	4.7	1.0	21	dbSNP_134	29	0,8590		0,0,4295	no	missense,missense,missense	COL6A2	NM_001849.3,NM_058174.2,NM_058175.2	180,180,180	0,1,6493	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	380/1020,380/919,380/829	47538549	1,12987	2199	4295	6494	SO:0001583	missense	1292	3	120968	34				g.chr21:47538549C>T	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1138C>T	chr21.hg19:g.47538549C>T	ENSP00000300527:p.Arg380Cys	1					COL6A2_ENST00000357838.4_Missense_Mutation_p.R380C|COL6A2_ENST00000397763.1_Missense_Mutation_p.R380C|COL6A2_ENST00000310645.5_Missense_Mutation_p.R380C|COL6A2_ENST00000409416.1_Missense_Mutation_p.R380C	p.R380C	NM_001849.3	NP_001840.3	0	2	2	1.696981	P12110	CO6A2_HUMAN		13	1242	+	Breast(49;0.245)		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	1	0	hg19	c.1138C>T	CCDS13728.1	1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040552	0.55003	2.27E-4	0.0	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.93426	-3.2;-3.2;-3.22;-3.22;-3.2	4.69	4.69	0.59074	4.690000	4.690000	0.590740	.	0.053823	0.64402	D	0.000001	D	0.95987	0.8693	M	0.67517	2.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.987;0.978	D	0.96089	0.9060	10	0.52906	T	0.07	-16.3159	16.6052	0.84826	0.0:1.0:0.0:0.0	.	380;380;380	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	C	380	ENSP00000300527:R380C;ENSP00000350497:R380C;ENSP00000312529:R380C;ENSP00000387115:R380C;ENSP00000380870:R380C	ENSP00000300527:R380C	R	+	1	0	0	COL6A2	46362977	46362977	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.537000	0.60643	2.151000	0.67156	0.591000	0.81541	CGC	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.682	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1	0	0	0		2	2	2	0		0	0	17		17	17	1	2.950000	-20.000000	1	0.370000				34	33		64	63	1		1	1		0	0	17	0		1.000000	1	0	5	0	561	0	34	64
NEFH	4744	broad.mit.edu	37	22	29886317	29886317	+	Silent	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr22:29886317G>A	ENST00000310624.6	+	4	2721	c.2688G>A	c.(2686-2688)gaG>gaA	p.E896E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	902	Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGAAGGAAGAGGCTGAAGATA	0.512																																						ENST00000310624.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				30						c.(2686-2688)gaG>gaA		neurofilament, heavy polypeptide							56.0	61.0	59.0					22																	29886317		2203	4300	6503	SO:0001819	synonymous_variant	4744	0	0					g.chr22:29886317G>A		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2688G>A	chr22.hg19:g.29886317G>A		1						p.E896E	NM_021076.3	NP_066554.2	2	2	4	2.299521	P12036	NFH_HUMAN		4	2721	+			B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	1	1	hg19	c.2688G>A	CCDS13858.1	1																																																																																								0.535124		TCGA-HZ-7922-01A-11D-2154-08	0.512	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	1	0	1		2	2	2	0		0	0	26		26	26	1	2.950000	-20.000000	1	0.370000	NM_021076			43	43		104	102	1		1	0		0	0	26	0		1.000000	9.548104e-01	0	0	0	15	0	43	104
TTN	7273	broad.mit.edu	37	2	179579858	179579858	+	Silent	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr2:179579858G>A	ENST00000591111.1	-	88	25328	c.25104C>T	c.(25102-25104)agC>agT	p.S8368S	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Silent_p.S7441S|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.S8685S|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12542	Ig-like 66.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTCTTGCCGCTCCTAAGTT	0.443																																						ENST00000591111.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				1448						c.(25102-25104)agC>agT		titin							318.0	300.0	306.0					2																	179579858		1923	4120	6043	SO:0001819	synonymous_variant	7273	0	0					g.chr2:179579858G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25104C>T	chr2.hg19:g.179579858G>A		1					TTN_ENST00000342992.6_Silent_p.S7441S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.S8685S|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron	p.S8368S			0	2	2	1.805913	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	88	25328	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	1	1	hg19	c.25104C>T		1																																																																																								0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1		2	2	2	1		1	0	212		212	209	1	2.950000	-20.000000	1	0.370000	NM_133378			327	324		603	599	0		1			1	0	212	0		1.000000	0	0	0	0	0	0	327	603
XDH	7498	broad.mit.edu	37	2	31625970	31625970	+	Silent	SNP	G	G	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr2:31625970G>T	ENST00000379416.3	-	3	189	c.141C>A	c.(139-141)ggC>ggA	p.G47G		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	47	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	AAGCCCCGCAGCCCCCCTCTC	0.577																																					Colon(66;682 1445 30109 40147)	ENST00000379416.3	0.900000	0.530000	8.100000e-01	6.100000e-01	0.700000	0.717638	0.700000	0.720000																										0				74						c.(139-141)ggC>ggA		xanthine dehydrogenase	Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)						96.0	92.0	93.0					2																	31625970		2203	4300	6503	SO:0001819	synonymous_variant	7498	0	0					g.chr2:31625970G>T	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.141C>A	chr2.hg19:g.31625970G>T		1						p.G47G	NM_000379.3	NP_000370.2	1	2	3	2.017034	P47989	XDH_HUMAN		3	189	-	Acute lymphoblastic leukemia(172;0.155)		Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	1	1	hg19	c.141C>A	CCDS1775.1	0																																																																																								0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.577	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	1	0	1		2	2	2	0		0	0	81		81	80	1	2.950000	-1.920854	0	0.370000	NM_000379			50	50		402	400	1		1	1		0	0	81	0		1.000000	6.112028e-01	0	3	0	15	0	50	402
DYSF	8291	broad.mit.edu	37	2	71795377	71795377	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr2:71795377G>A	ENST00000258104.3	+	26	2996	c.2719G>A	c.(2719-2721)Gtc>Atc	p.V907I	DYSF_ENST00000409762.1_Missense_Mutation_p.V924I|DYSF_ENST00000429174.2_Missense_Mutation_p.V907I|DYSF_ENST00000409582.3_Missense_Mutation_p.V924I|DYSF_ENST00000409744.1_Missense_Mutation_p.V894I|DYSF_ENST00000413539.2_Missense_Mutation_p.V938I|DYSF_ENST00000410041.1_Missense_Mutation_p.V925I|DYSF_ENST00000409366.1_Missense_Mutation_p.V908I|DYSF_ENST00000394120.2_Missense_Mutation_p.V908I|DYSF_ENST00000409651.1_Missense_Mutation_p.V939I|DYSF_ENST00000410020.3_Missense_Mutation_p.V925I	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	907					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GTTTTCTGACGTCACGGGCAA	0.592																																						ENST00000258104.3	1.000000	0.860000	1	9.100000e-01	0.960000	0.963006	0.960000	1.000000																										0				111						c.(2719-2721)Gtc>Atc		dysferlin							197.0	202.0	200.0					2																	71795377		2203	4300	6503	SO:0001583	missense	8291	0	0					g.chr2:71795377G>A	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2719G>A	chr2.hg19:g.71795377G>A	ENSP00000258104:p.Val907Ile	1					DYSF_ENST00000429174.2_Missense_Mutation_p.V907I|DYSF_ENST00000410020.3_Missense_Mutation_p.V925I|DYSF_ENST00000413539.2_Missense_Mutation_p.V938I|DYSF_ENST00000409762.1_Missense_Mutation_p.V924I|DYSF_ENST00000409651.1_Missense_Mutation_p.V939I|DYSF_ENST00000409744.1_Missense_Mutation_p.V894I|DYSF_ENST00000409582.3_Missense_Mutation_p.V924I|DYSF_ENST00000409366.1_Missense_Mutation_p.V908I|DYSF_ENST00000394120.2_Missense_Mutation_p.V908I|DYSF_ENST00000410041.1_Missense_Mutation_p.V925I	p.V907I	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	1	2	3	2.017034	O75923	DYSF_HUMAN		26	2996	+			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	1	1	hg19	c.2719G>A	CCDS1918.1	1	.	.	.	.	.	.	.	.	.	.	G	9.616	1.132447	0.21041	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.83075	-1.67;-1.68;-1.68;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.68	4.94	4.06	0.47325	4.940000	4.060000	0.473250	Ferlin/Peroxisome membrane (1);	0.213952	0.40385	N	0.001118	T	0.73040	0.3536	L	0.28344	0.845	0.39564	D	0.969175	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.20261	0.039;0.039;0.039;0.011;0.043;0.005;0.012;0.012;0.011;0.003;0.002;0.011;0.011;0.007	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.23150	0.03;0.03;0.018;0.018;0.03;0.018;0.03;0.044;0.018;0.005;0.007;0.018;0.018;0.008	T	0.69228	-0.5200	10	0.46703	T	0.11	-30.2846	11.1273	0.48325	0.091:0.0:0.909:0.0	.	939;925;908;894;925;894;924;893;938;924;907;893;908;907	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	I	938;924;924;907;907;939;908;894;908;925;925	ENSP00000407046:V938I;ENSP00000387137:V924I;ENSP00000386547:V924I;ENSP00000398305:V907I;ENSP00000258104:V907I;ENSP00000386683:V939I;ENSP00000377678:V908I;ENSP00000386285:V894I;ENSP00000386512:V908I;ENSP00000386881:V925I;ENSP00000386617:V925I	ENSP00000258104:V907I	V	+	1	0	0	DYSF	71648885	71648885	0.896000	0.30565	0.593000	0.28771	0.251000	0.25915	1.328000	0.33758	1.080000	0.41073	0.448000	0.29417	GTC	0.468354		TCGA-HZ-7922-01A-11D-2154-08	0.592	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	1	0	1		2	2	2	0		0	0	319		319	319	1	2.950000	-20.000000	1	0.370000	NM_003494			267	265		1490	1476	1		1	0		0	0	319	0		1.000000	8.296928e-01	0	0	0	20	0	267	1490
ABCA12	26154	broad.mit.edu	37	2	215835096	215835096	+	Missense_Mutation	SNP	G	G	A	rs191670598		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr2:215835096G>A	ENST00000272895.7	-	37	5810	c.5591C>T	c.(5590-5592)cCg>cTg	p.P1864L	ABCA12_ENST00000389661.4_Missense_Mutation_p.P1546L	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1864					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCTTCTGTGCGGTGGGGAATA	0.358													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17474	0.0		0.0	False		,,,				2504	0.0				Ovarian(66;664 1488 5121 34295)	ENST00000272895.7	1.000000	0.910000	1	9.900000e-01	0.990000	0.994112	0.990000	1.000000																										0				139						c.(5590-5592)cCg>cTg		ATP-binding cassette, sub-family A (ABC1), member 12		G	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	94.0	95.0	95.0		4637,5591	5.3	1.0	2		95	0,8600		0,0,4300	no	missense,missense	ABCA12	NM_015657.3,NM_173076.2	98,98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1546/2278,1864/2596	215835096	1,13005	2203	4300	6503	SO:0001583	missense	26154	17	121410	47				g.chr2:215835096G>A	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5591C>T	chr2.hg19:g.215835096G>A	ENSP00000272895:p.Pro1864Leu	1					ABCA12_ENST00000389661.4_Missense_Mutation_p.P1546L	p.P1864L	NM_173076.2	NP_775099.2	1	3	4	2.093159	Q86UK0	ABCAC_HUMAN		37	5810	-		Renal(323;0.127)	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	1	1	hg19	c.5591C>T	CCDS33372.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	25.7	4.669881	0.88348	2.27E-4	0.0	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.96300	-3.97;-3.88	5.29	5.29	0.74685	5.290000	5.290000	0.746850	.	0.000000	0.51477	D	0.000093	D	0.98071	0.9364	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98850	1.0758	10	0.87932	D	0	.	18.9084	0.92472	0.0:0.0:1.0:0.0	.	1864;1546	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	L	1864;1546	ENSP00000272895:P1864L;ENSP00000374312:P1546L	ENSP00000272895:P1864L	P	-	2	0	0	ABCA12	215543341	215543341	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.752000	0.85141	2.640000	0.89533	0.650000	0.86243	CCG	0.479726		TCGA-HZ-7922-01A-11D-2154-08	0.358	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	1	0	1		2	2	2	0		0	0	48		48	48	1	2.950000	-2.610414	1	0.370000	NM_173076			74	74		358	358	1		1	1		0	0	48	0		1.000000	2.088696e-01	0	2	0	3	0	74	358
PLA1A	51365	broad.mit.edu	37	3	119327676	119327676	+	Missense_Mutation	SNP	C	C	T	rs145457987	byFrequency	TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr3:119327676C>T	ENST00000273371.4	+	3	407	c.335C>T	c.(334-336)aCg>aTg	p.T112M	PLA1A_ENST00000488919.1_5'UTR|PLA1A_ENST00000495992.1_Missense_Mutation_p.T112M|PLA1A_ENST00000494440.1_Missense_Mutation_p.T96M	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	112					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTGCGTGCAACGAATGCTAAT	0.438																																						ENST00000273371.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				30						c.(334-336)aCg>aTg		phospholipase A1 member A		C	MET/THR,,MET/THR	6,4400	11.4+/-27.6	0,6,2197	178.0	177.0	177.0		335,,335	2.2	0.0	3	dbSNP_134	177	0,8600		0,0,4300	no	missense,utr-5,missense	PLA1A	NM_001206960.1,NM_001206961.1,NM_015900.3	81,,81	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	possibly-damaging,,possibly-damaging	112/441,,112/457	119327676	6,13000	2203	4300	6503	SO:0001583	missense	51365	3	121412	49				g.chr3:119327676C>T	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.335C>T	chr3.hg19:g.119327676C>T	ENSP00000273371:p.Thr112Met	1					PLA1A_ENST00000495992.1_Missense_Mutation_p.T112M|PLA1A_ENST00000488919.1_5'UTR|PLA1A_ENST00000494440.1_Missense_Mutation_p.T96M	p.T112M	NM_015900.3	NP_056984.1	2	2	4	2.339257	Q53H76	PLA1A_HUMAN		3	407	+			B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	1	1	hg19	c.335C>T	CCDS2991.1	1	.	.	.	.	.	.	.	.	.	.	C	3.694	-0.062843	0.07273	0.001362	0.0	ENSG00000144837	ENST00000273371;ENST00000495992;ENST00000494440	D;D;D	0.90955	-2.68;-2.76;-2.68	5.17	2.19	0.27852	5.170000	2.190000	0.278520	Lipase, N-terminal (1);	0.669254	0.16089	N	0.230123	T	0.79299	0.4422	N	0.16266	0.395	0.09310	N	1	P;B	0.47545	0.897;0.008	B;B	0.40329	0.326;0.005	T	0.72408	-0.4303	10	0.66056	D	0.02	-0.7573	2.9704	0.05920	0.2767:0.4081:0.2293:0.0858	.	112;112	Q53H76-3;Q53H76	.;PLA1A_HUMAN	M	112;112;96	ENSP00000273371:T112M;ENSP00000417326:T112M;ENSP00000418793:T96M	ENSP00000273371:T112M	T	+	2	0	0	PLA1A	120810366	120810366	0.006000	0.16342	0.001000	0.08648	0.014000	0.08584	0.401000	0.20948	0.549000	0.28973	0.462000	0.41574	ACG	0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.438	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2	1	0	1		2	2	2	0		0	0	145		145	144	1	2.950000	-3.142967	1	0.370000				205	204		630	627	1		1	0		0	0	145	0		1.000000	9.121586e-01	0	0	0	15	0	205	630
ATRIP	84126	broad.mit.edu	37	3	48491541	48491541	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr3:48491541G>A	ENST00000320211.3	+	2	459	c.346G>A	c.(346-348)Gta>Ata	p.V116I	ATRIP_ENST00000357105.6_5'UTR|ATRIP_ENST00000412052.1_Missense_Mutation_p.V23I|ATRIP_ENST00000346691.4_Missense_Mutation_p.V116I	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	116					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGAATTAGAGGTACTTCAGGC	0.333								Other conserved DNA damage response genes																														ENST00000320211.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				22						c.(346-348)Gta>Ata	Other conserved DNA damage response genes	ATR interacting protein							83.0	90.0	88.0					3																	48491541		2203	4298	6501	SO:0001583	missense	84126	0	0					g.chr3:48491541G>A	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.346G>A	chr3.hg19:g.48491541G>A	ENSP00000323099:p.Val116Ile	1					ATRIP_ENST00000412052.1_Missense_Mutation_p.V23I|ATRIP_ENST00000357105.6_5'UTR|ATRIP_ENST00000346691.4_Missense_Mutation_p.V116I	p.V116I	NM_130384.2	NP_569055.1	0	2	2	1.715143	Q8WXE1	ATRIP_HUMAN		2	459	+			A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	1	1	hg19	c.346G>A	CCDS2768.1	1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007454	0.35415	.	.	ENSG00000164053	ENST00000421175;ENST00000320211;ENST00000346691;ENST00000412052	T;T;T;T	0.78126	-1.15;1.43;1.43;1.44	5.51	-2.4	0.06583	5.510000	-2.400000	0.065830	.	1.023550	0.07743	N	0.947318	T	0.70159	0.3192	M	0.61703	1.905	0.43953	D	0.996621	B;B	0.12013	0.005;0.005	B;B	0.09377	0.004;0.004	T	0.56739	-0.7929	10	0.42905	T	0.14	-0.3582	5.7328	0.18049	0.1973:0.0:0.3847:0.418	.	116;116	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	I	23;116;116;23	ENSP00000406664:V23I;ENSP00000323099:V116I;ENSP00000302338:V116I;ENSP00000400930:V23I	ENSP00000323099:V116I	V	+	1	0	0	ATRIP	48466545	48466545	0.925000	0.31364	0.646000	0.29493	0.967000	0.64934	0.191000	0.17076	-0.420000	0.07427	0.655000	0.94253	GTA	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.333	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	1	0	1		2	2	2	0		0	0	83		83	82	1	2.950000	-20.000000	1	0.370000	NM_130384			240	239		344	342	1		1	0		0	0	83	0		1.000000	9.588175e-01	0	1	0	9	0	240	344
ROBO1	6091	broad.mit.edu	37	3	78734918	78734918	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr3:78734918C>A	ENST00000464233.1	-	10	1433	c.1320G>T	c.(1318-1320)aaG>aaT	p.K440N	ROBO1_ENST00000495273.1_Missense_Mutation_p.K404N|ROBO1_ENST00000467549.1_Missense_Mutation_p.K404N|ROBO1_ENST00000436010.2_Missense_Mutation_p.K401N	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	440	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CCAAATATGCCTTTGTGATGA	0.383																																						ENST00000464233.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999100	0.990000	1.000000																										0				44						c.(1318-1320)aaG>aaT		roundabout, axon guidance receptor, homolog 1 (Drosophila)							57.0	55.0	56.0					3																	78734918		1885	4095	5980	SO:0001583	missense	6091	0	0					g.chr3:78734918C>A	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1320G>T	chr3.hg19:g.78734918C>A	ENSP00000420321:p.Lys440Asn	1					ROBO1_ENST00000467549.1_Missense_Mutation_p.K404N|ROBO1_ENST00000495273.1_Missense_Mutation_p.K404N|ROBO1_ENST00000436010.2_Missense_Mutation_p.K401N	p.K440N	NM_002941.3	NP_002932.1	0	2	2	1.715143	Q9Y6N7	ROBO1_HUMAN		10	1433	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	1	1	hg19	c.1320G>T	CCDS54611.1	1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730545	0.48939	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.28	-2.11	0.07187	5.280000	-2.110000	0.071870	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.088124	0.85682	D	0.000000	T	0.66915	0.2838	L	0.31845	0.965	0.50313	D	0.999865	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;0.999;1.0;1.0	T	0.61525	-0.7045	9	.	.	.	.	10.4211	0.44350	0.0:0.3686:0.0:0.6314	.	404;440;404;404;401	Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	N	401;404;440;404;404;440	ENSP00000406043:K401N;ENSP00000420321:K440N;ENSP00000420637:K404N;ENSP00000417992:K404N	.	K	-	3	2	2	ROBO1	78817608	78817608	1.000000	0.71417	0.985000	0.45067	0.460000	0.32559	0.961000	0.29267	-0.550000	0.06183	-0.251000	0.11542	AAG	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.383	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	1	0	1		2	2	2	0		0	0	22		22	22	1	2.950000	-20.000000	1	0.370000	NM_002941			24	24		60	60	1		1	0		0	0	22	0		1.000000	9.968346e-01	0	0	0	27	0	24	60
SI	6476	broad.mit.edu	37	3	164764706	164764706	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr3:164764706C>A	ENST00000264382.3	-	16	1872	c.1810G>T	c.(1810-1812)Gac>Tac	p.D604Y		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	604	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GCAGTATTGTCTCCTAACCAA	0.393										HNSCC(35;0.089)																												ENST00000264382.3	0.250000	0.070000	2.000000e-01	1.000000e-01	0.140000	0.157856	0.140000	0.160000																										0				218						c.(1810-1812)Gac>Tac		sucrase-isomaltase (alpha-glucosidase)	Acarbose(DB00284)|Scopolamine(DB00747)						100.0	96.0	97.0					3																	164764706		2203	4300	6503	SO:0001583	missense	6476	0	0					g.chr3:164764706C>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1810G>T	chr3.hg19:g.164764706C>A	ENSP00000264382:p.Asp604Tyr	1	HNSCC(35;0.089)					p.D604Y	NM_001041.3	NP_001032.2	2	2	4	2.344781	P14410	SUIS_HUMAN		16	1872	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	0	1	hg19	c.1810G>T	CCDS3196.1	0	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544210	0.86022	.	.	ENSG00000090402	ENST00000264382	D	0.97906	-4.6	5.36	5.36	0.76844	5.360000	5.360000	0.768440	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99354	0.9773	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98404	1.0569	10	0.87932	D	0	.	18.0712	0.89407	0.0:1.0:0.0:0.0	.	604	P14410	SUIS_HUMAN	Y	604	ENSP00000264382:D604Y	ENSP00000264382:D604Y	D	-	1	0	0	SI	166247400	166247400	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.356000	0.79445	2.519000	0.84933	0.467000	0.42956	GAC	0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.393	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	0	0	1		2	2	2	0		0	0	79		79	79	1	2.950000	-2.986354	1	0.370000	NM_001041			12	12		595	591	0		1			0	0	79	0		0.999089	0	0	0	0	0	0	12	595
MAEA	10296	broad.mit.edu	37	4	1283769	1283769	+	Splice_Site	SNP	A	A	G			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr4:1283769A>G	ENST00000303400.4	+	1	131	c.68A>G	c.(67-69)aAg>aGg	p.K23R	MAEA_ENST00000505177.2_Splice_Site_p.K23R|MAEA_ENST00000264750.6_Splice_Site_p.K23R|MAEA_ENST00000452175.2_Splice_Site_p.K12R|MAEA_ENST00000514708.1_Splice_Site_p.K23R|CTBP1-AS2_ENST00000578730.1_RNA	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	23	Extracellular and involved in cell to cell contact.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	CCGACCCTCAAGGTGGGCGCC	0.716																																						ENST00000303400.4	1.000000	0.420000	1	6.600000e-01	0.970000	0.868335	0.970000	1.000000																										0				18						c.(67-69)aAg>aGg		macrophage erythroblast attacher	WF10(DB05389)						21.0	19.0	20.0					4																	1283769		2190	4294	6484	SO:0001630	splice_region_variant	10296	1	120220	23				g.chr4:1283769A>G	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.69+1A>G	chr4.hg19:g.1283769A>G		1					MAEA_ENST00000505177.2_Splice_Site_p.K23R|MAEA_ENST00000452175.2_Splice_Site_p.K12R|CTBP1-AS2_ENST00000578730.1_RNA|MAEA_ENST00000514708.1_Splice_Site_p.K23R|MAEA_ENST00000264750.6_Splice_Site_p.K23R	p.K23R	NM_001017405.1	NP_001017405.1	2	2	4	2.309022	Q7L5Y9	MAEA_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0201)	1	131	+			O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Splice_Site	SNP	ENST00000303400.4	0	1	hg19	c.68A>G	CCDS33936.1	1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113236	0.56398	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000264750;ENST00000382947;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000514708	T;T;T;T;T;T;T	0.47869	1.11;1.04;0.97;1.11;0.9;0.83;1.05	3.36	3.36	0.38483	3.360000	3.360000	0.384830	.	0.130255	0.49305	D	0.000158	T	0.34279	0.0892	L	0.35542	1.07	0.33919	D	0.640589	B;B;B;P;B	0.39376	0.136;0.286;0.131;0.67;0.024	B;B;B;B;B	0.39119	0.126;0.203;0.084;0.291;0.016	T	0.42899	-0.9424	10	0.14252	T	0.57	.	11.9497	0.52948	1.0:0.0:0.0:0.0	.	23;23;23;23;23	E7ESC7;Q7L5Y9-2;D6RIB6;Q7L5Y9-3;Q7L5Y9	.;.;.;.;MAEA_HUMAN	R	23;23;23;23;23;23;23;12;23	ENSP00000302830:K23R;ENSP00000422215:K23R;ENSP00000421644:K23R;ENSP00000264750:K23R;ENSP00000426903:K23R;ENSP00000411415:K12R;ENSP00000427512:K23R	ENSP00000264750:K23R	K	+	2	0	0	MAEA	1273769	1273769	1.000000	0.71417	0.999000	0.59377	0.896000	0.52359	6.007000	0.70731	1.406000	0.46857	0.528000	0.53228	AAG	0.537649		TCGA-HZ-7922-01A-11D-2154-08	0.716	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	0	0	1		2	2	2	0		0	0	10		10	10	1	2.950000	-12.790620	1	0.370000	NM_005882	Missense_Mutation		6	5		42	42	0		1	1		0	0	10	0		0.966152	9.799068e-01	0	3	0	52	0	6	42
LRBA	987	broad.mit.edu	37	4	151791686	151791686	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr4:151791686G>C	ENST00000357115.3	-	20	2683	c.2440C>G	c.(2440-2442)Caa>Gaa	p.Q814E	LRBA_ENST00000507224.1_Missense_Mutation_p.Q814E|LRBA_ENST00000535741.1_Missense_Mutation_p.Q814E|LRBA_ENST00000510413.1_Missense_Mutation_p.Q814E	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	814						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CGAGGGTTTTGTATCTTCACT	0.313																																						ENST00000357115.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				91						c.(2440-2442)Caa>Gaa		LPS-responsive vesicle trafficking, beach and anchor containing							96.0	96.0	96.0					4																	151791686		2203	4294	6497	SO:0001583	missense	987	0	0					g.chr4:151791686G>C	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.2440C>G	chr4.hg19:g.151791686G>C	ENSP00000349629:p.Gln814Glu	1					LRBA_ENST00000510413.1_Missense_Mutation_p.Q814E|LRBA_ENST00000507224.1_Missense_Mutation_p.Q814E|LRBA_ENST00000535741.1_Missense_Mutation_p.Q814E	p.Q814E	NM_006726.4	NP_006717.2	0	2	2	1.773460	P50851	LRBA_HUMAN		20	2683	-	all_hematologic(180;0.151)		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	1	1	hg19	c.2440C>G	CCDS3773.1	1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375857	0.24857	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.66	5.66	0.87406	5.660000	5.660000	0.874060	Armadillo-type fold (1);	0.413735	0.23682	N	0.045609	T	0.63200	0.2491	L	0.31157	0.91	0.52099	D	0.99994	D;P	0.56968	0.978;0.571	P;B	0.58130	0.833;0.288	T	0.55218	-0.8175	10	0.02654	T	1	.	19.757	0.96298	0.0:0.0:1.0:0.0	.	814;814	P50851;P50851-2	LRBA_HUMAN;.	E	814	ENSP00000446299:Q814E;ENSP00000421552:Q814E;ENSP00000349629:Q814E;ENSP00000422180:Q814E	ENSP00000349629:Q814E	Q	-	1	0	0	LRBA	152011136	152011136	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.464000	0.66719	2.678000	0.91216	0.460000	0.39030	CAA	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.313	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1	1	0	1		2	2	2	0		0	0	82		82	82	1	2.950000	-20.000000	1	0.370000				126	125		200	199	1		1	1		0	0	82	0		1.000000	9.998105e-01	0	15	0	9	0	126	200
GOLPH3	64083	broad.mit.edu	37	5	32126388	32126388	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr5:32126388G>A	ENST00000265070.6	-	4	1142	c.827C>T	c.(826-828)cCt>cTt	p.P276L	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	276					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						TTCCACTTCAGGGTCTAAGTC	0.542																																						ENST00000265070.6	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				11						c.(826-828)cCt>cTt		golgi phosphoprotein 3 (coat-protein)							97.0	85.0	89.0					5																	32126388		2203	4300	6503	SO:0001583	missense	64083	0	0					g.chr5:32126388G>A	AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.827C>T	chr5.hg19:g.32126388G>A	ENSP00000265070:p.Pro276Leu	1					GOLPH3_ENST00000512668.1_5'Flank	p.P276L	NM_022130.3	NP_071413.1	2	2	4	2.353196	Q9H4A6	GOLP3_HUMAN		4	1142	-			Q9UIW5	Missense_Mutation	SNP	ENST00000265070.6	1	1	hg19	c.827C>T	CCDS3896.1	1	.	.	.	.	.	.	.	.	.	.	G	6.769	0.510717	0.12883	.	.	ENSG00000113384	ENST00000265070;ENST00000542582	.	.	.	6.17	6.17	0.99709	6.170000	6.170000	0.997090	.	0.000000	0.85682	D	0.000000	T	0.65101	0.2659	L	0.51422	1.61	0.80722	D	1	B	0.24963	0.115	B	0.31614	0.133	T	0.58803	-0.7572	9	0.11485	T	0.65	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	276	Q9H4A6	GOLP3_HUMAN	L	276;259	.	ENSP00000265070:P276L	P	-	2	0	0	GOLPH3	32162145	32162145	1.000000	0.71417	0.966000	0.40874	0.010000	0.07245	9.414000	0.97362	2.941000	0.99782	0.655000	0.94253	CCT	0.540146		TCGA-HZ-7922-01A-11D-2154-08	0.542	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207363.2	1	0	1		2	2	2	0		0	0	75		75	74	1	2.950000	-8.599169	1	0.370000	NM_022130			172	168		444	439	1		1	1		0	0	75	0		1.000000	1	0	112	0	290	0	172	444
LPA	4018	broad.mit.edu	37	6	161032642	161032642	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr6:161032642G>C	ENST00000316300.5	-	16	2599	c.2555C>G	c.(2554-2556)tCt>tGt	p.S852C	LPA_ENST00000447678.1_Missense_Mutation_p.S852C			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3360	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGGTGTCATAGATGACCAAGC	0.493																																						ENST00000316300.5	0.130000	0.040000	1.100000e-01	6.000000e-02	0.080000	0.089614	0.080000	0.080000																										0				107						c.(2554-2556)tCt>tGt		lipoprotein, Lp(a)	Aminocaproic Acid(DB00513)						199.0	215.0	210.0					6																	161032642		1235	2560	3795	SO:0001583	missense	4018	0	0					g.chr6:161032642G>C	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2555C>G	chr6.hg19:g.161032642G>C	ENSP00000321334:p.Ser852Cys	1					LPA_ENST00000447678.1_Missense_Mutation_p.S852C	p.S852C			0	2	2	1.723553	P08519	APOA_HUMAN		16	2599	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	0	1	hg19	c.2555C>G	CCDS43523.1	0	.	.	.	.	.	.	.	.	.	.	g	10.02	1.236595	0.22711	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.67698	-0.28;-0.28	2.17	2.17	0.27698	2.170000	2.170000	0.276980	Kringle (4);Kringle-like fold (1);	.	.	.	.	D	0.83589	0.5287	H	0.99238	4.48	0.20074	N	0.999939	D	0.61697	0.99	D	0.81914	0.995	T	0.72228	-0.4354	9	0.66056	D	0.02	.	7.8282	0.29328	0.0:0.0:1.0:0.0	.	3360	P08519	APOA_HUMAN	C	852	ENSP00000321334:S852C;ENSP00000395608:S852C	ENSP00000321334:S852C	S	-	2	0	0	LPA	160952632	160952632	0.944000	0.32072	0.268000	0.24571	0.268000	0.26511	4.700000	0.61803	1.217000	0.43442	0.194000	0.17425	TCT	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.493	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	0	0	1		2	2	2	0		0	0	275		275	459	1	2.950000	-3.319111	1	0.370000	NM_005577			21	18		1302	1122	0		1			0	0	275	0		0.999988	0	0	0	0	0	0	21	1302
TNRC18	84629	broad.mit.edu	37	7	5410273	5410273	+	Missense_Mutation	SNP	C	C	T	rs547812685		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr7:5410273C>T	ENST00000430969.1	-	11	4300	c.3952G>A	c.(3952-3954)Ggc>Agc	p.G1318S	TNRC18_ENST00000399537.4_Missense_Mutation_p.G1318S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1318							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CAGGTGCTGCCGAGTACAGGC	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15758	0.0		0.0	False		,,,				2504	0.0					ENST00000430969.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999997	0.990000	1.000000																										0				11						c.(3952-3954)Ggc>Agc		trinucleotide repeat containing 18							15.0	16.0	16.0					7																	5410273		2022	4167	6189	SO:0001583	missense	84629	1	120846	24				g.chr7:5410273C>T	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3952G>A	chr7.hg19:g.5410273C>T	ENSP00000395538:p.Gly1318Ser	1					TNRC18_ENST00000399537.4_Missense_Mutation_p.G1318S	p.G1318S	NM_001080495.2	NP_001073964.2	0	2	2	1.688928	O15417	TNC18_HUMAN		11	4300	-		Ovarian(82;0.142)	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	1	1	hg19	c.3952G>A	CCDS47534.1	1	.	.	.	.	.	.	.	.	.	.	C	4.209	0.037484	0.08148	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000327499	T;T	0.10668	2.85;2.85	4.9	-0.334	0.12666	4.900000	-0.334000	0.126660	.	0.390991	0.18787	N	0.131164	T	0.05686	0.0149	N	0.25144	0.715	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.33343	-0.9872	10	0.32370	T	0.25	.	4.691	0.12781	0.0:0.5034:0.1509:0.3457	.	1318	O15417	TNC18_HUMAN	S	1318;1318;373;373	ENSP00000382452:G1318S;ENSP00000395538:G1318S	ENSP00000330383:G373S	G	-	1	0	0	TNRC18	5376799	5376799	0.000000	0.05858	0.002000	0.10522	0.085000	0.17905	-0.185000	0.09684	0.146000	0.19002	0.313000	0.20887	GGC	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.662	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	26		26	25	1	2.950000	-7.264140	1	0.370000				29	29		46	46	1		1	1		0	0	26	0		1.000000	9.999999e-01	0	34	0	22	0	29	46
FLNC	2318	broad.mit.edu	37	7	128477594	128477594	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr7:128477594A>G	ENST00000325888.8	+	4	1103	c.842A>G	c.(841-843)tAt>tGt	p.Y281C	FLNC_ENST00000346177.6_Missense_Mutation_p.Y281C	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	281					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCCATCGCCTATGGGCCTGGT	0.602																																						ENST00000325888.8	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				128						c.(841-843)tAt>tGt		filamin C, gamma							91.0	101.0	98.0					7																	128477594		2125	4258	6383	SO:0001583	missense	2318	0	0					g.chr7:128477594A>G	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.842A>G	chr7.hg19:g.128477594A>G	ENSP00000327145:p.Tyr281Cys	1					FLNC_ENST00000346177.6_Missense_Mutation_p.Y281C	p.Y281C	NM_001458.4	NP_001449.3	0	2	2	1.717328	Q14315	FLNC_HUMAN		4	1103	+			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	1	1	hg19	c.842A>G	CCDS43644.1	1	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837735	0.71373	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85013	-1.93;-1.93	5.39	5.39	0.77823	5.390000	5.390000	0.778230	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94185	0.8134	H	0.94542	3.55	0.49687	D	0.999814	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	D	0.95461	0.8543	10	0.87932	D	0	.	13.3795	0.60759	1.0:0.0:0.0:0.0	.	281;281	Q14315-2;Q14315	.;FLNC_HUMAN	C	281	ENSP00000327145:Y281C;ENSP00000344002:Y281C	ENSP00000327145:Y281C	Y	+	2	0	0	FLNC	128264830	128264830	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.922000	0.70036	2.043000	0.60533	0.533000	0.62120	TAT	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.602	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3	1	0	1		2	2	2	0		0	0	87		87	87	1	2.950000	-20.000000	1	0.370000				137	135		222	218	1		1	1		0	0	87	0		1.000000	9.996751e-01	0	9	0	14	0	137	222
GDF6	392255	broad.mit.edu	37	8	97156945	97156945	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr8:97156945G>A	ENST00000287020.5	-	2	1313	c.1214C>T	c.(1213-1215)aCg>aTg	p.T405M		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	405					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					GTTCATCAGCGTCTGGATGAT	0.602																																						ENST00000287020.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999261	0.990000	1.000000																										0				27						c.(1213-1215)aCg>aTg		growth differentiation factor 6							108.0	102.0	104.0					8																	97156945		2203	4300	6503	SO:0001583	missense	392255	0	0					g.chr8:97156945G>A		CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1214C>T	chr8.hg19:g.97156945G>A	ENSP00000287020:p.Thr405Met	1						p.T405M	NM_001001557.2	NP_001001557.1	2	4	6	2.947154	Q6KF10	GDF6_HUMAN		2	1313	-	Breast(36;2.67e-05)		Q6PI58	Missense_Mutation	SNP	ENST00000287020.5	1	1	hg19	c.1214C>T	CCDS34926.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526943	0.85706	.	.	ENSG00000156466	ENST00000287020	D	0.89617	-2.54	4.95	4.95	0.65309	4.950000	4.950000	0.653090	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95118	0.8418	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95756	0.8796	10	0.87932	D	0	.	17.1426	0.86758	0.0:0.0:1.0:0.0	.	405	Q6KF10	GDF6_HUMAN	M	405	ENSP00000287020:T405M	ENSP00000287020:T405M	T	-	2	0	0	GDF6	97226121	97226121	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.595000	0.98260	2.567000	0.86603	0.650000	0.86243	ACG	0.636385		TCGA-HZ-7922-01A-11D-2154-08	0.602	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	1	0	1		2	2	2	0		0	0	29		29	28	1	2.950000	-18.159600	1	0.370000	NM_001001557			34	32		185	180	1		1	0		0	0	29	0		1.000000	4.827448e-01	0	0	0	10	0	34	185
SH2D3C	10044	broad.mit.edu	37	9	130507114	130507114	+	Missense_Mutation	SNP	G	G	A	rs142472912		TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chr9:130507114G>A	ENST00000314830.8	-	7	1642	c.1529C>T	c.(1528-1530)gCg>gTg	p.A510V	SH2D3C_ENST00000471939.1_5'UTR|SH2D3C_ENST00000373274.3_Missense_Mutation_p.A350V|SH2D3C_ENST00000429553.1_Missense_Mutation_p.A156V|SH2D3C_ENST00000373277.4_Missense_Mutation_p.A353V|SH2D3C_ENST00000420366.1_Missense_Mutation_p.A352V|SH2D3C_ENST00000373276.3_Missense_Mutation_p.A442V	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	510					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGTCTCAGTCGCTGCCCACTC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		15227	0.0		0.001	False		,,,				2504	0.0					ENST00000314830.8	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				28						c.(1528-1530)gCg>gTg		SH2 domain containing 3C							104.0	113.0	110.0					9																	130507114		2203	4300	6503	SO:0001583	missense	10044	4	121412	42				g.chr9:130507114G>A	AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.1529C>T	chr9.hg19:g.130507114G>A	ENSP00000317817:p.Ala510Val	1					SH2D3C_ENST00000429553.1_Missense_Mutation_p.A156V|SH2D3C_ENST00000471939.1_5'UTR|SH2D3C_ENST00000373274.3_Missense_Mutation_p.A350V|SH2D3C_ENST00000420366.1_Missense_Mutation_p.A352V|SH2D3C_ENST00000373277.4_Missense_Mutation_p.A353V|SH2D3C_ENST00000373276.3_Missense_Mutation_p.A442V	p.A510V	NM_170600.2	NP_733745.1	0	2	2	1.706660	Q8N5H7	SH2D3_HUMAN		7	1642	-			A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	1	1	hg19	c.1529C>T	CCDS6877.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.21	1.288019	0.23478	.	.	ENSG00000095370	ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.5	2.4	0.29515	5.500000	2.400000	0.295150	.	0.589560	0.17839	N	0.160278	T	0.27765	0.0683	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B	0.33494	0.217;0.414;0.059;0.324;0.032	B;B;B;B;B	0.22152	0.038;0.017;0.002;0.038;0.003	T	0.13388	-1.0511	10	0.45353	T	0.12	-3.8094	6.1239	0.20167	0.074:0.134:0.6533:0.1387	.	350;510;442;353;352	E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.;SH2D3_HUMAN;.;.;.	V	353;352;442;350;156;510	ENSP00000362374:A353V;ENSP00000388536:A352V;ENSP00000362373:A442V;ENSP00000362371:A350V;ENSP00000394632:A156V;ENSP00000317817:A510V	ENSP00000317817:A510V	A	-	2	0	0	SH2D3C	129546935	129546935	0.048000	0.20356	0.006000	0.13384	0.504000	0.33889	2.309000	0.43699	0.640000	0.30582	0.462000	0.41574	GCG	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.627	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	1	0	1		2	2	2	0		0	0	209		209	206	1	2.950000	-20.000000	1	0.370000	NM_005489			328	322		609	599	1		1	0		0	0	209	0		1.000000	9.999261e-01	0	0	0	29	0	328	609
ACE2	59272	broad.mit.edu	37	X	15582310	15582310	+	Missense_Mutation	SNP	G	G	A	rs144869363	byFrequency	TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chrX:15582310G>A	ENST00000252519.3	-	17	2248	c.2146C>T	c.(2146-2148)Cgt>Tgt	p.R716C	ACE2_ENST00000427411.1_Missense_Mutation_p.R716C|ACE2_ENST00000471548.1_5'UTR			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	716	Essential for cleavage by TMPRSS11D and TMPRSS2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	TCATTCAGACGGAAAGCATCA	0.428																																						ENST00000252519.3	1.000000	0.830000	1	9.000000e-01	0.980000	0.962861	0.980000	1.000000																										0				32						c.(2146-2148)Cgt>Tgt		angiotensin I converting enzyme 2	Lisinopril(DB00722)|Moexipril(DB00691)	G	CYS/ARG	1,3834		0,0,1,1632,570	167.0	152.0	157.0		2146	0.1	0.0	X	dbSNP_134	157	0,6728		0,0,0,2428,1872	no	missense	ACE2	NM_021804.2	180	0,0,1,4060,2442	AA,AG,A,GG,G		0.0,0.0261,0.0095	possibly-damaging	716/806	15582310	1,10562	2203	4300	6503	SO:0001583	missense	59272	0	0					g.chrX:15582310G>A	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.2146C>T	chrX.hg19:g.15582310G>A	ENSP00000252519:p.Arg716Cys						ACE2_ENST00000427411.1_Missense_Mutation_p.R716C|ACE2_ENST00000471548.1_5'UTR	p.R716C			0	1	1		Q9BYF1	ACE2_HUMAN		17	2248	-	Hepatocellular(33;0.183)		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	1	1	hg19	c.2146C>T	CCDS14169.1	1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320166	0.23994	2.61E-4	0.0	ENSG00000130234	ENST00000252519;ENST00000427411	D;D	0.85484	-1.99;-1.99	6.16	0.0817	0.14425	6.160000	0.081700	0.144250	.	0.653399	0.16598	N	0.207475	D	0.84325	0.5447	M	0.77616	2.38	0.09310	N	1	D	0.56287	0.975	P	0.46339	0.513	T	0.76586	-0.2905	10	0.87932	D	0	1.1293	7.4363	0.27158	0.0666:0.5122:0.2256:0.1956	.	716	Q9BYF1	ACE2_HUMAN	C	716	ENSP00000252519:R716C;ENSP00000389326:R716C	ENSP00000252519:R716C	R	-	1	0	0	ACE2	15492231	15492231	0.293000	0.24371	0.002000	0.10522	0.004000	0.04260	0.501000	0.22578	-0.455000	0.07054	-1.092000	0.02172	CGT	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.428	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1	1	0	1		2	2	2	0		0	0	133		133	131	1	2.950000	-2.902241	1	0.370000				128	129		573	570	1		1	0		0	0	133	0		1.000000	3.388481e-02	0	1	0	1	0	128	573
NLGN3	54413	broad.mit.edu	37	X	70389792	70389792	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chrX:70389792C>T	ENST00000358741.3	+	8	2695	c.2392C>T	c.(2392-2394)Cgc>Tgc	p.R798C	NLGN3_ENST00000536169.1_Missense_Mutation_p.R758C|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_Missense_Mutation_p.R778C	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	798					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.R778C(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GACCCTGCGGCGCTCCCCGGA	0.612																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	ENST00000358741.3	1.000000	0.920000	1	9.900000e-01	0.990000	0.995380	0.990000	1.000000																										1	Substitution - Missense(1)	p.R778C(1)	ovary(1)	37						c.(2392-2394)Cgc>Tgc		neuroligin 3							102.0	70.0	81.0					X																	70389792		2202	4297	6499	SO:0001583	missense	54413	0	0					g.chrX:70389792C>T	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.2392C>T	chrX.hg19:g.70389792C>T	ENSP00000351591:p.Arg798Cys						NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Missense_Mutation_p.R758C|NLGN3_ENST00000374051.3_Missense_Mutation_p.R778C	p.R798C	NM_181303.1	NP_851820.1	0	1	1		Q9NZ94	NLGN3_HUMAN		8	2695	+	Renal(35;0.156)		B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	1	1	hg19	c.2392C>T	CCDS55441.1	1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346340	0.61073	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000358741	T;T;T	0.73258	-0.7;-0.73;-0.73	4.92	4.92	0.64577	4.920000	4.920000	0.645770	.	0.000000	0.85682	D	0.000000	D	0.82907	0.5139	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.76071	0.97;0.97;0.987	D	0.85078	0.0944	10	0.87932	D	0	.	12.5627	0.56291	0.1658:0.8342:0.0:0.0	.	758;798;778	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	C	758;778;798	ENSP00000445298:R758C;ENSP00000363163:R778C;ENSP00000351591:R798C	ENSP00000351591:R798C	R	+	1	0	0	NLGN3	70306517	70306517	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.794000	0.55492	2.310000	0.77875	0.525000	0.51046	CGC	0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.612	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	1	0	1		2	2	2	0		0	0	14		14	14	1	2.950000	-20.000000	1	0.370000	NM_018977			16	16		42	41	1		1	0		0	0	14	0		0.999971	5.357265e-01	0	0	0	6	0	16	42
AMOT	154796	broad.mit.edu	37	X	112048283	112048283	+	Silent	SNP	C	C	T			TCGA-HZ-7922-01A-11D-2154-08	TCGA-HZ-7922-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	4bbc4c64-410c-4e0c-b04f-1e5a4bbc57dd	e7c35b8d-64c7-479b-8b92-8afb9a6d23d0	g.chrX:112048283C>T	ENST00000524145.1	-	6	1742	c.1668G>A	c.(1666-1668)gcG>gcA	p.A556A	AMOT_ENST00000371959.3_Silent_p.A556A|AMOT_ENST00000304758.1_Silent_p.A147A|AMOT_ENST00000371958.1_Silent_p.A324A|AMOT_ENST00000371962.1_Silent_p.A324A			Q4VCS5	AMOT_HUMAN	angiomotin	556					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TGGCCAGCTCCGCTTCCAGCT	0.527																																						ENST00000524145.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				43						c.(1666-1668)gcG>gcA		angiomotin							253.0	218.0	230.0					X																	112048283		2203	4300	6503	SO:0001819	synonymous_variant	154796	8	121410	45				g.chrX:112048283C>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1668G>A	chrX.hg19:g.112048283C>T							AMOT_ENST00000304758.1_Silent_p.A147A|AMOT_ENST00000371962.1_Silent_p.A324A|AMOT_ENST00000371959.3_Silent_p.A556A|AMOT_ENST00000371958.1_Silent_p.A324A	p.A556A			0	1	1		Q4VCS5	AMOT_HUMAN		6	1742	-			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	1	1	hg19	c.1668G>A	CCDS48154.1	1																																																																																								0.370000		TCGA-HZ-7922-01A-11D-2154-08	0.527	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	1	0	1		2	2	2	0		0	0	201		201	200	1	2.950000	-20.000000	1	0.370000	NM_133265			454	452		725	715	1		1	1		0	0	201	0		1.000000	9.991171e-01	0	12	0	8	0	454	725
