#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
HIST1H4E	8367	broad.mit.edu	37	6	26204947	26204948	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr6:26204947_26204948insA	ENST00000360441.4	+	1	90_91	c.75_76insA	c.(76-78)aacfs	p.N26fs		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	26					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				TCCTGCGAGATAACATCCAGGG	0.584																																						ENST00000360441.4	0.910000	0.440000	7.900000e-01	5.400000e-01	0.650000	0.671506	0.650000	0.660000																										0				18						c.(76-78)aacfs		histone cluster 1, H4e																																				SO:0001589	frameshift_variant	8367	0	0					g.chr6:26204947_26204948insA	Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.77dupA	chr6.hg19:g.26204949_26204949dupA	ENSP00000353624:p.Asn26fs	0						p.N26fs	NM_003545.3	NP_003536.1	0	1	1	2.009768	P62805	H4_HUMAN		1	90_91	+		all_hematologic(11;0.196)	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Frame_Shift_Ins	INS	ENST00000360441.4	0	1	hg19	c.75_76insA	CCDS4593.1	0																																																																																								0.154589		TCGA-HZ-7926-01A-11D-2154-08	0.584	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	1	0	1		2			0	0	0	0	103	0	103	102	1	1.880000	-20.000000	1	0.160000	NM_003545		0	27	27	0	483	481	0	0	1			0	0	103	0	0	1.000000			0	0	0	0	27	483
NKAPL	222698	broad.mit.edu	37	6	28227796	28227797	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr6:28227796_28227797insT	ENST00000343684.3	+	1	699_700	c.647_648insT	c.(646-651)tctgatfs	p.D217fs	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	217	Lys-rich.									breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						AATTCTGACTCTGATGATGATA	0.302																																						ENST00000343684.3	1.000000	0.570000	1	7.100000e-01	0.870000	0.860767	0.870000	1.000000																										0				31						c.(646-651)tctgatfs		NFKB activating protein-like																																				SO:0001589	frameshift_variant	222698	0	0					g.chr6:28227796_28227797insT	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.648dupT	chr6.hg19:g.28227797_28227797dupT	ENSP00000345716:p.Asp217fs	0					ZKSCAN4_ENST00000423974.2_5'Flank	p.D217fs	NM_001007531.1	NP_001007532.1	0	1	1	2.009768	Q5M9Q1	NKAPL_HUMAN		1	699_700	+			Q3MIV1|Q9H4Q7	Frame_Shift_Ins	INS	ENST00000343684.3	0	1	hg19	c.647_648insT	CCDS34353.1	1																																																																																								0.154589		TCGA-HZ-7926-01A-11D-2154-08	0.302	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1	1	0	1		2	2		0	0	0	0	38	0	38	38	1	1.880000	-2.598650	1	0.160000			0	23	23	0	304	301	0	0	1	0		0	0	38	0	0	0.999999	5.526389e-03		0	0	2	0	23	304
RBM28	55131	broad.mit.edu	37	7	127963635	127963642	+	Frame_Shift_Del	DEL	GCACGAAT	GCACGAAT	-	rs535443818		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr7:127963635_127963642delGCACGAAT	ENST00000223073.2	-	13	1456_1463	c.1342_1349delATTCGTGC	c.(1342-1350)attcgtgctfs	p.IRA448fs	RBM28_ENST00000481788.1_5'Flank|RBM28_ENST00000415472.2_Frame_Shift_Del_p.IRA307fs	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	448					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						CTTCGTCCCAGCACGAATCACTGCAGAA	0.471																																						ENST00000223073.2	1.000000	0.360000	1	4.600000e-01	0.590000	0.658494	0.590000	0.540000																										0				21						c.(1342-1350)attcgtgctfs		RNA binding motif protein 28																																				SO:0001589	frameshift_variant	55131	0	0					g.chr7:127963635_127963642delGCACGAAT	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1342_1349delATTCGTGC	chr7.hg19:g.127963635_127963642delGCACGAAT	ENSP00000223073:p.Ile448fs	1					RBM28_ENST00000415472.2_Frame_Shift_Del_p.IRA307fs|RBM28_ENST00000481788.1_5'Flank	p.IRA448fs	NM_018077.2	NP_060547.2	2	2	4	2.126997	Q9NW13	RBM28_HUMAN		13	1456_1463	-			A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Frame_Shift_Del	DEL	ENST00000223073.2	1	1	hg19	c.1342_1349delATTCGTGC	CCDS5801.1	0																																																																																								0.205749		TCGA-HZ-7926-01A-11D-2154-08	0.471	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	0	0	1		2	2		0	0	0	0	91	0	91	90	1	1.880000	-3.974658	1	0.160000	NM_018077		0	23	29	0	537	539	0	0	1	0		0	0	91	0	0	1.000000	6.728583e-01		0	0	55	0	23	537
CDKN2A	1029	broad.mit.edu	37	9	21971003	21971004	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			-	A	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr9:21971003_21971004insA	ENST00000304494.5	-	2	624_625	c.354_355insT	c.(352-357)gctgagfs	p.E119fs	CDKN2A_ENST00000530628.2_Stop_Codon_Ins|CDKN2A_ENST00000479692.2_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.E119fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000498628.2_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.E119fs|CDKN2A_ENST00000579755.1_Stop_Codon_Ins|CDKN2A_ENST00000497750.1_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000361570.3_Stop_Codon_Ins|CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.E119fs|CDKN2A_ENST00000578845.2_Frame_Shift_Ins_p.E68fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	119			E -> Q (in a biliary tract tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.E119*(4)|p.E119Q(2)|p.0(1)|p.A118fs*10(1)|p.A118fs*27(1)|p.*174L(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCAGCTCCTCAGCCAGGTCCA	0.728		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	0.700000	9.800000e-01	8.200000e-01	0.920000	0.906810	0.920000	0.990000		17																								1369	Whole gene deletion(1316)|Unknown(44)|Substitution - Nonsense(4)|Substitution - Missense(2)|Deletion - Frameshift(1)|Complex - frameshift(1)|Nonstop extension(1)	p.0?(1315)|p.?(44)|p.E119*(4)|p.E119Q(2)|p.0(1)|p.A118fs*10(1)|p.A118fs*27(1)|p.*174L(1)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(74)|soft_tissue(57)|pleura(51)|oesophagus(51)|upper_aerodigestive_tract(49)|ovary(36)|kidney(32)|breast(32)|pancreas(30)|biliary_tract(14)|thyroid(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	4199						c.(352-357)gctgagfs		cyclin-dependent kinase inhibitor 2A																																				SO:0001589	frameshift_variant	1029	0	0					g.chr9:21971003_21971004insA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.355dupT	chr9.hg19:g.21971004_21971004dupA	ENSP00000307101:p.Glu119fs	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Stop_Codon_Ins|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.E119fs|CDKN2A_ENST00000579755.1_Stop_Codon_Ins|CDKN2A_ENST00000494262.1_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000497750.1_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000578845.2_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.E119fs|CDKN2A_ENST00000361570.3_Stop_Codon_Ins|CDKN2A_ENST00000498628.2_Frame_Shift_Ins_p.E68fs|CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.E119fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Frame_Shift_Ins_p.E68fs	p.E119fs	NM_000077.4	NP_000068.1	0	1	1	1.875499	P42771	CD2A1_HUMAN		2	624_625	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Ins	INS	ENST00000304494.5	0	1	hg19	c.354_355insT	CCDS6510.1	1																																																																																								0.086957		TCGA-HZ-7926-01A-11D-2154-08	0.728	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1		2	2	2	0	0	0	0	23	0	23	22	1	1.880000	-10.824280	1	0.160000	NM_000077		0	24	29	0	191	184	0	0	1	1	1	0	0	23	514	0	1.000000	9.999995e-01	1	3	67	197	585	24	191
MYO3A	53904	broad.mit.edu	37	10	26243817	26243817	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr10:26243817G>T	ENST00000265944.5	+	4	349	c.183G>T	c.(181-183)gaG>gaT	p.E61D	MYO3A_ENST00000376301.1_Missense_Mutation_p.E61D|MYO3A_ENST00000376302.1_Missense_Mutation_p.E61D|MYO3A_ENST00000543632.1_Missense_Mutation_p.E61D	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	61	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TTGACGAAGAGATTGAAGCAG	0.323																																						ENST00000265944.5	1.000000	0.690000	9.700000e-01	8.000000e-01	0.890000	0.889672	0.890000	0.980000																										0				146						c.(181-183)gaG>gaT		myosin IIIA							109.0	112.0	111.0					10																	26243817		2203	4300	6503	SO:0001583	missense	53904	0	0					g.chr10:26243817G>T	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.183G>T	chr10.hg19:g.26243817G>T	ENSP00000265944:p.Glu61Asp	1					MYO3A_ENST00000543632.1_Missense_Mutation_p.E61D|MYO3A_ENST00000376302.1_Missense_Mutation_p.E61D|MYO3A_ENST00000376301.1_Missense_Mutation_p.E61D	p.E61D	NM_017433.4	NP_059129.3	0	1	1	1.894654	Q8NEV4	MYO3A_HUMAN		4	349	+			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	1	1	hg19	c.183G>T	CCDS7148.1	1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918823	0.73098	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632;ENST00000376301	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	6.0	3.15	0.36227	6.0	3.15	0.36227	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67692	0.2920	N	0.20401	0.57	0.58432	D	0.999992	D;D;D;D	0.89917	0.957;0.965;1.0;0.978	P;D;D;D	0.97110	0.904;0.942;1.0;0.979	T	0.71122	-0.4684	10	0.72032	D	0.01	.	10.9035	0.47067	0.2392:0.0:0.7608:0.0	.	61;61;61;61	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	D	61	ENSP00000265944:E61D;ENSP00000365479:E61D;ENSP00000445909:E61D;ENSP00000365478:E61D	ENSP00000265944:E61D	E	+	3	2	2	MYO3A	26283823	26283823	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.128000	0.42045	1.558000	0.49541	0.643000	0.83706	GAG	0.086957		TCGA-HZ-7926-01A-11D-2154-08	0.323	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	92	1	1.880000	-12.591220	1	0.160000	NM_017433		0	43	43	0	454	447	0		1	0		0	0	93	0	0	1.000000	0	0	0	0	1	0	43	454
UBQLN3	50613	broad.mit.edu	37	11	5529285	5529285	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr11:5529285G>T	ENST00000311659.4	-	2	1651	c.1504C>A	c.(1504-1506)Caa>Aaa	p.Q502K	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	502										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCTGTGGTTGTATCTCATCC	0.587																																					Ovarian(72;684 1260 12332 41642 52180)	ENST00000311659.4	0.950000	0.440000	8.200000e-01	5.400000e-01	0.670000	0.687317	0.670000	0.660000																										0				39						c.(1504-1506)Caa>Aaa		ubiquilin 3							55.0	57.0	56.0					11																	5529285		2201	4297	6498	SO:0001583	missense	50613	0	0					g.chr11:5529285G>T	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1504C>A	chr11.hg19:g.5529285G>T	ENSP00000347997:p.Gln502Lys	1					HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380252.1_5'Flank	p.Q502K	NM_017481.2	NP_059509.1	0	0	0	1.885132	Q9H347	UBQL3_HUMAN		2	1651	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	1	1	hg19	c.1504C>A	CCDS7758.1	0	.	.	.	.	.	.	.	.	.	.	G	8.831	0.939872	0.18281	.	.	ENSG00000175520	ENST00000311659	T	0.35048	1.33	4.53	4.53	0.55603	4.53	4.53	0.55603	.	0.461817	0.18254	N	0.146844	T	0.33089	0.0851	L	0.43152	1.355	0.21762	N	0.999559	B	0.15930	0.015	B	0.09377	0.004	T	0.20974	-1.0259	10	0.51188	T	0.08	.	15.1489	0.72681	0.0:0.0:1.0:0.0	.	502	Q9H347	UBQL3_HUMAN	K	502	ENSP00000347997:Q502K	ENSP00000347997:Q502K	Q	-	1	0	0	UBQLN3	5485861	5485861	0.387000	0.25188	0.402000	0.26371	0.171000	0.22731	2.771000	0.47670	2.499000	0.84300	0.655000	0.94253	CAA	0.096386		TCGA-HZ-7926-01A-11D-2154-08	0.587	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	68	1	1.880000	-20.000000	1	0.160000	NM_017481		0	23	23	0	370	360	0		1			0	0	69	0	0	0.999999	0	0	0	0	0	0	23	370
GIF	2694	broad.mit.edu	37	11	59596985	59596985	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr11:59596985T>C	ENST00000257248.2	-	9	1273	c.1226A>G	c.(1225-1227)cAc>cGc	p.H409R	GIF_ENST00000541311.1_Missense_Mutation_p.H384R	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	409					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	GGCTGTGATGTGCTCGTGGTT	0.443																																					NSCLC(53;1139 1245 16872 38474 42853)	ENST00000257248.2	1.000000	0.440000	9.800000e-01	5.900000e-01	0.760000	0.773338	0.760000	1.000000																										0				17						c.(1225-1227)cAc>cGc		gastric intrinsic factor (vitamin B synthesis)	Cyanocobalamin(DB00115)						224.0	175.0	192.0					11																	59596985		2201	4295	6496	SO:0001583	missense	2694	0	0					g.chr11:59596985T>C	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.1226A>G	chr11.hg19:g.59596985T>C	ENSP00000257248:p.His409Arg	0					GIF_ENST00000541311.1_Missense_Mutation_p.H384R	p.H409R	NM_005142.2	NP_005133.2	0	1	1	2.014243	P27352	IF_HUMAN		9	1273	-			B2RAN8|B4DVZ1	Missense_Mutation	SNP	ENST00000257248.2	1	1	hg19	c.1226A>G	CCDS7977.1	0	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182767	0.78677	.	.	ENSG00000134812	ENST00000257248;ENST00000541311	T;T	0.41065	1.1;1.01	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000001	T	0.52435	0.1734	L	0.50333	1.59	0.44439	D	0.997368	D	0.71674	0.998	P	0.57283	0.817	T	0.51631	-0.8681	10	0.48119	T	0.1	-27.71	13.0268	0.58819	0.0:0.0:0.0:1.0	.	409	P27352	IF_HUMAN	R	409;384	ENSP00000257248:H409R;ENSP00000440427:H384R	ENSP00000257248:H409R	H	-	2	0	0	GIF	59353561	59353561	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.670000	0.54569	2.330000	0.79161	0.477000	0.44152	CAC	0.151858		TCGA-HZ-7926-01A-11D-2154-08	0.443	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.880000	-17.797300	1	0.160000	NM_005142		0	14	14	0	213	210	0		1	0		0	0	36	0	0	0.999761	0	0	0	0	1	0	14	213
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.920000	1	9.900000e-01	0.990000	0.995235	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.049554	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.169304		TCGA-HZ-7926-01A-11D-2154-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.880000	-9.284926	1	0.160000	NM_033360		1284	15	15	6745	108	107	1	1	1	1	1	0	0	27	353	1	0.999901	9.879750e-01	1	10	55	46	498	15	108
CHST11	50515	broad.mit.edu	37	12	105150940	105150940	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr12:105150940G>A	ENST00000303694.5	+	3	857	c.418G>A	c.(418-420)Ggg>Agg	p.G140R	CHST11_ENST00000549260.1_Missense_Mutation_p.G135R	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	140					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						GGTCCTGACCGGGCGGGGGAA	0.597																																						ENST00000303694.5	1.000000	0.510000	9.700000e-01	6.400000e-01	0.790000	0.802775	0.790000	1.000000																										0				18						c.(418-420)Ggg>Agg		carbohydrate (chondroitin 4) sulfotransferase 11							64.0	65.0	64.0					12																	105150940		2203	4300	6503	SO:0001583	missense	50515	2	121412	34				g.chr12:105150940G>A	AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.418G>A	chr12.hg19:g.105150940G>A	ENSP00000305725:p.Gly140Arg	0					CHST11_ENST00000549260.1_Missense_Mutation_p.G135R	p.G140R	NM_018413.5	NP_060883.1	0	0	0	1.983561	Q9NPF2	CHSTB_HUMAN		3	857	+			A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	ENST00000303694.5	1	1	hg19	c.418G>A	CCDS9099.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834370	0.91036	.	.	ENSG00000171310	ENST00000549260;ENST00000303694;ENST00000549016	T;T;T	0.73789	-0.78;-0.78;-0.78	5.51	5.51	0.81932	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89259	0.6664	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.91028	0.4862	10	0.87932	D	0	-15.1321	19.4315	0.94772	0.0:0.0:1.0:0.0	.	135;140	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	R	135;140;100	ENSP00000450004:G135R;ENSP00000305725:G140R;ENSP00000449095:G100R	ENSP00000305725:G140R	G	+	1	0	0	CHST11	103675070	103675070	1.000000	0.71417	0.928000	0.36995	0.997000	0.91878	9.869000	0.99810	2.600000	0.87896	0.655000	0.94253	GGG	0.142157		TCGA-HZ-7926-01A-11D-2154-08	0.597	CHST11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405960.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.880000	-2.774760	1	0.160000	NM_018413		0	22	20	0	315	310	1		1	1		0	0	55	0	0	0.999999	9.649329e-01	0	20	0	61	0	22	315
PABPC3	5042	broad.mit.edu	37	13	25671664	25671664	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr13:25671664A>C	ENST00000281589.3	+	1	1365	c.1328A>C	c.(1327-1329)aAt>aCt	p.N443T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	443					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CCATTCCAAAATAAGCCCAGT	0.507																																						ENST00000281589.3	0.880000	0.510000	7.900000e-01	5.900000e-01	0.680000	0.697811	0.680000	0.690000																										0				47						c.(1327-1329)aAt>aCt		poly(A) binding protein, cytoplasmic 3							140.0	138.0	139.0					13																	25671664		2203	4300	6503	SO:0001583	missense	5042	0	0					g.chr13:25671664A>C	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1328A>C	chr13.hg19:g.25671664A>C	ENSP00000281589:p.Asn443Thr	1						p.N443T	NM_030979.2	NP_112241.2	0	1	1	1.876293	Q9H361	PABP3_HUMAN		1	1365	+		Lung SC(185;0.0225)|Breast(139;0.0602)	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	1	1	hg19	c.1328A>C	CCDS9311.1	0	.	.	.	.	.	.	.	.	.	.	A	3.856	-0.030769	0.07543	.	.	ENSG00000151846	ENST00000281589	T	0.27557	1.66	0.875	0.875	0.19130	0.875	0.875	0.19130	.	0.000000	0.50627	U	0.000110	T	0.21841	0.0526	L	0.52011	1.625	0.44899	D	0.997918	B	0.02656	0.0	B	0.10450	0.005	T	0.05500	-1.0881	10	0.22706	T	0.39	.	5.8995	0.18957	1.0:0.0:0.0:0.0	.	443	Q9H361	PABP3_HUMAN	T	443	ENSP00000281589:N443T	ENSP00000281589:N443T	N	+	2	0	0	PABPC3	24569664	24569664	1.000000	0.71417	0.963000	0.40424	0.160000	0.22226	3.947000	0.56652	0.632000	0.30432	0.260000	0.18958	AAT	0.086957		TCGA-HZ-7926-01A-11D-2154-08	0.507	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	1	0	1	2	2	2	2	0	0	0	0	143	143	143	143	1	1.880000	-20.000000	1	0.160000	NM_030979		0	48	47	0	746	645	0		1	0		0	0	143	0	0	1.000000	0	0	0	0	1	0	48	746
FLT3	2322	broad.mit.edu	37	13	28622533	28622533	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr13:28622533C>T	ENST00000241453.7	-	9	1165	c.1084G>A	c.(1084-1086)Gac>Aac	p.D362N	FLT3_ENST00000380982.4_Missense_Mutation_p.D362N|FLT3_ENST00000537084.1_Missense_Mutation_p.D362N	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	362					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCATATTGGTCAATTTCATAA	0.323			"""Mis, O"""		"""AML, ALL"""																																	ENST00000241453.7	1.000000	0.780000	9.900000e-01	8.800000e-01	0.950000	0.939454	0.950000	0.990000				Dom	yes			Dom	yes		13	13q12	13q12	2322	Mis, O	fms-related tyrosine kinase 3				L	L			AML, ALL		0				12390						c.(1084-1086)Gac>Aac		fms-related tyrosine kinase 3	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)						97.0	96.0	96.0					13																	28622533		2203	4300	6503	SO:0001583	missense	2322	2	121412	31				g.chr13:28622533C>T	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1084G>A	chr13.hg19:g.28622533C>T	ENSP00000241453:p.Asp362Asn	1					FLT3_ENST00000380982.4_Missense_Mutation_p.D362N|FLT3_ENST00000537084.1_Missense_Mutation_p.D362N	p.D362N	NM_004119.2	NP_004110.2	0	1	1	1.876293	P36888	FLT3_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	9	1165	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	1	1	hg19	c.1084G>A	CCDS31953.1	1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896911	0.52121	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.76060	-0.92;-0.99;-0.7	5.45	5.45	0.79879	5.45	5.45	0.79879	Immunoglobulin-like fold (1);	0.263771	0.32901	N	0.005511	T	0.69931	0.3166	L	0.27053	0.805	0.34801	D	0.736766	D;D	0.58620	0.966;0.983	P;P	0.51742	0.678;0.58	T	0.69412	-0.5152	10	0.10111	T	0.7	.	17.4634	0.87626	0.0:1.0:0.0:0.0	.	362;362	P36888-2;P36888	.;FLT3_HUMAN	N	362	ENSP00000241453:D362N;ENSP00000370369:D362N;ENSP00000438139:D362N	ENSP00000241453:D362N	D	-	1	0	0	FLT3	27520533	27520533	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	3.429000	0.52800	2.572000	0.86782	0.462000	0.41574	GAC	0.086957		TCGA-HZ-7926-01A-11D-2154-08	0.323	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.880000	-20.000000	1	0.160000			0	32	31	0	214	212	1		1	0		0	0	55	0	0	1.000000	8.976144e-02	0	0	0	4	0	32	214
ATL1	51062	broad.mit.edu	37	14	51094836	51094836	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr14:51094836C>T	ENST00000358385.6	+	12	1448	c.1207C>T	c.(1207-1209)Cga>Tga	p.R403*	ATL1_ENST00000441560.2_Nonsense_Mutation_p.R403*|ATL1_ENST00000357032.3_Nonsense_Mutation_p.R403*|ATL1_ENST00000354525.4_Nonsense_Mutation_p.R403*	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	403					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						GAAGCTATTCCGAGGGGTGAA	0.443																																						ENST00000358385.6	1.000000	0.490000	9.400000e-01	6.100000e-01	0.760000	0.774580	0.760000	1.000000																										0				18						c.(1207-1209)Cga>Tga		atlastin GTPase 1							90.0	90.0	90.0					14																	51094836		2203	4300	6503	SO:0001587	stop_gained	51062	0	0					g.chr14:51094836C>T	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.1207C>T	chr14.hg19:g.51094836C>T	ENSP00000351155:p.Arg403*	0					ATL1_ENST00000354525.4_Nonsense_Mutation_p.R403*|ATL1_ENST00000357032.3_Nonsense_Mutation_p.R403*|ATL1_ENST00000441560.2_Nonsense_Mutation_p.R403*	p.R403*	NM_015915.4	NP_056999.2	0	1	1	2.000627	Q8WXF7	ATLA1_HUMAN		12	1448	+			A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Nonsense_Mutation	SNP	ENST00000358385.6	0	1	hg19	c.1207C>T	CCDS9700.1	0	.	.	.	.	.	.	.	.	.	.	C	40	8.204160	0.98704	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525	.	.	.	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-6.6736	19.2865	0.94077	0.0:1.0:0.0:0.0	.	.	.	.	X	403	.	ENSP00000346522:R403X	R	+	1	2	2	ATL1	50164586	50164586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.936000	0.63506	2.802000	0.96397	0.655000	0.94253	CGA	0.151858		TCGA-HZ-7926-01A-11D-2154-08	0.443	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2	1	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	1.880000	-2.598117	1	0.160000			0	21	19	0	319	315	0		1	0		0	0	71	0	0	0.999997	7.427205e-01	0	1	0	41	0	21	319
KCNK13	56659	broad.mit.edu	37	14	90650874	90650874	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr14:90650874G>T	ENST00000282146.4	+	2	1195	c.754G>T	c.(754-756)Gag>Tag	p.E252*		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	252					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				CGCCCACTATGAGAGCCAAGG	0.493																																						ENST00000282146.4	1.000000	0.530000	9.100000e-01	6.400000e-01	0.760000	0.775898	0.760000	1.000000																										0				25						c.(754-756)Gag>Tag		potassium channel, subfamily K, member 13							116.0	104.0	108.0					14																	90650874		2203	4300	6503	SO:0001587	stop_gained	56659	0	0					g.chr14:90650874G>T	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.754G>T	chr14.hg19:g.90650874G>T	ENSP00000282146:p.Glu252*	0						p.E252*	NM_022054.2	NP_071337.2	0	1	1	2.015903	Q9HB14	KCNKD_HUMAN		2	1195	+		all_cancers(154;0.186)	B5TJL8|Q96E79	Nonsense_Mutation	SNP	ENST00000282146.4	0	1	hg19	c.754G>T	CCDS9889.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.158982	0.94686	.	.	ENSG00000152315	ENST00000282146	.	.	.	5.42	2.49	0.30216	5.42	2.49	0.30216	.	0.955768	0.08571	N	0.926120	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	8.8689	0.35303	0.1376:0.1231:0.7393:0.0	.	.	.	.	X	252	.	ENSP00000282146:E252X	E	+	1	0	0	KCNK13	89720627	89720627	0.999000	0.42202	0.003000	0.11579	0.127000	0.20565	4.148000	0.58085	0.655000	0.30866	-0.137000	0.14449	GAG	0.155949		TCGA-HZ-7926-01A-11D-2154-08	0.493	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	1	0	1	2	2	2	2	0	0	0	0	67	67	67	66	1	1.880000	-20.000000	1	0.160000	NM_022054		0	31	30	0	472	465	0		1	0		0	0	67	0	0	1.000000	1.184349e-02	0	0	0	3	0	31	472
CSK	1445	broad.mit.edu	37	15	75091650	75091650	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr15:75091650C>T	ENST00000220003.9	+	5	1009	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W	CSK_ENST00000439220.2_Missense_Mutation_p.R94W|CSK_ENST00000567571.1_Missense_Mutation_p.R94W|CSK_ENST00000309470.9_Missense_Mutation_p.R94W	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	94	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						GCAGGCTGAGCGGCTTCTGTA	0.637																																						ENST00000220003.9	1.000000	0.440000	9.600000e-01	5.800000e-01	0.750000	0.758259	0.750000	1.000000																										0				3						c.(280-282)Cgg>Tgg		c-src tyrosine kinase							53.0	51.0	52.0					15																	75091650		2197	4296	6493	SO:0001583	missense	1445	0	0					g.chr15:75091650C>T		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.280C>T	chr15.hg19:g.75091650C>T	ENSP00000220003:p.Arg94Trp	0					CSK_ENST00000567571.1_Missense_Mutation_p.R94W|CSK_ENST00000309470.9_Missense_Mutation_p.R94W|CSK_ENST00000439220.2_Missense_Mutation_p.R94W	p.R94W	NM_004383.2	NP_004374.1	0	2	2	1.918771	P41240	CSK_HUMAN		5	1009	+			Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	1	1	hg19	c.280C>T	CCDS10269.1	0	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086457	0.76642	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000309470	D;D;D	0.89875	-2.58;-2.58;-2.58	4.63	2.6	0.31112	4.63	2.6	0.31112	SH2 motif (5);	0.068217	0.64402	D	0.000020	D	0.93148	0.7818	M	0.85373	2.75	0.80722	D	1	D	0.69078	0.997	P	0.58928	0.848	D	0.93959	0.7239	10	0.87932	D	0	-21.5651	13.0337	0.58859	0.3937:0.6063:0.0:0.0	.	94	P41240	CSK_HUMAN	W	94	ENSP00000220003:R94W;ENSP00000414764:R94W;ENSP00000438808:R94W	ENSP00000220003:R94W	R	+	1	2	2	CSK	72878703	72878703	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	1.164000	0.31810	1.148000	0.42385	-0.500000	0.04577	CGG	0.160000		TCGA-HZ-7926-01A-11D-2154-08	0.637	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	1	0	1	2	2	2	2	0	0	0	0	37	37	37	36	1	1.880000	-17.928910	1	0.160000	NM_004383		0	15	15	0	238	232	0		1	1		0	0	37	0	0	0.999863	9.996585e-01	0	10	0	207	0	15	238
TSC2	7249	broad.mit.edu	37	16	2137908	2137908	+	Silent	SNP	C	C	T	rs45467993|rs137854198		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr16:2137908C>T	ENST00000219476.3	+	39	5664	c.5034C>T	c.(5032-5034)taC>taT	p.Y1678Y	TSC2_ENST00000439673.2_Silent_p.Y1575Y|TSC2_ENST00000382538.6_Silent_p.Y1563Y|TSC2_ENST00000401874.2_Silent_p.Y1611Y|TSC2_ENST00000353929.4_Silent_p.Y1635Y|MIR1225_ENST00000408729.1_RNA|TSC2_ENST00000568454.1_Silent_p.Y1622Y|TSC2_ENST00000350773.4_Silent_p.Y1655Y	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1678	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CGCTGGACTACGAGTGCAACC	0.642			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													ENST00000219476.3	1.000000	0.310000	8.100000e-01	4.300000e-01	0.590000	0.622124	0.590000	0.560000			yes	Rec		Tuberous sclerosis 2	yes	Rec		Tuberous sclerosis 2	16	16p13.3	16p13.3	7249	D, Mis, N, F, S	tuberous sclerosis 2 gene				"""E, O"""	E, O		hamartoma, renal cell			0				56	GRCh37	CM054870	TSC2	M	rs45467993	c.(5032-5034)taC>taT		tuberous sclerosis 2		C	,,	1,4393	2.1+/-5.4	0,1,2196	65.0	50.0	55.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	5034,4833,4965	-7.7	0.8	16	dbSNP_127	55	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TSC2	NM_000548.3,NM_001077183.1,NM_001114382.1	,,	0,1,6495	TT,TC,CC		0.0,0.0228,0.0077	,,	1678/1808,1611/1741,1655/1785	2137908	1,12991	2197	4299	6496	SO:0001819	synonymous_variant	7249	4	121206	37	Tuberous Sclerosis	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	g.chr16:2137908C>T	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.5034C>T	chr16.hg19:g.2137908C>T		0					TSC2_ENST00000353929.4_Silent_p.Y1635Y|MIR1225_ENST00000408729.1_RNA|TSC2_ENST00000439673.2_Silent_p.Y1575Y|TSC2_ENST00000401874.2_Silent_p.Y1611Y|TSC2_ENST00000350773.4_Silent_p.Y1655Y|TSC2_ENST00000382538.6_Silent_p.Y1563Y|TSC2_ENST00000568454.1_Silent_p.Y1622Y	p.Y1678Y	NM_000548.3	NP_000539.2	1	2	3	2.020720	P49815	TSC2_HUMAN		39	5664	+		Hepatocellular(780;0.0202)	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	1	1	hg19	c.5034C>T	CCDS10458.1	0																																																																																								0.163347		TCGA-HZ-7926-01A-11D-2154-08	0.642	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.880000	-13.034440	1	0.160000	NM_000548		0	11	10	0	229	227	0		1	1		0	0	54	0	0	0.998332	9.701751e-01	0	12	0	115	0	11	229
ZNF75A	7627	broad.mit.edu	37	16	3367798	3367798	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr16:3367798A>G	ENST00000574298.1	+	6	1293	c.820A>G	c.(820-822)Act>Gct	p.T274A	ZNF75A_ENST00000498240.2_3'UTR	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						GCAGCCATATACTTGTAGCAT	0.463																																						ENST00000574298.1	1.000000	0.440000	8.000000e-01	5.400000e-01	0.650000	0.676459	0.650000	0.640000																										0				12						c.(820-822)Act>Gct		zinc finger protein 75a							65.0	68.0	67.0					16																	3367798		2197	4300	6497	SO:0001583	missense	7627	0	0					g.chr16:3367798A>G	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.820A>G	chr16.hg19:g.3367798A>G	ENSP00000459566:p.Thr274Ala	0					ZNF75A_ENST00000498240.2_3'UTR	p.T274A	NM_153028.2	NP_694573.1	1	2	3	2.020720	Q96N20	ZN75A_HUMAN		6	1293	+			Q0VDI8|Q92669	Missense_Mutation	SNP	ENST00000574298.1	1	1	hg19	c.820A>G	CCDS10501.1	0	.	.	.	.	.	.	.	.	.	.	A	3.920	-0.018269	0.07681	.	.	ENSG00000162086	ENST00000293995	.	.	.	4.46	-2.76	0.05896	4.46	-2.76	0.05896	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.109970	0.06937	N	0.812053	T	0.16385	0.0394	N	0.04297	-0.235	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.25847	-1.0120	9	0.51188	T	0.08	.	6.3677	0.21463	0.2835:0.0:0.0837:0.6328	.	274	Q96N20	ZN75A_HUMAN	A	274	.	ENSP00000293995:T274A	T	+	1	0	0	ZNF75A	3307799	3307799	0.000000	0.05858	0.000000	0.03702	0.771000	0.43674	-2.209000	0.01228	-0.674000	0.05253	0.455000	0.32223	ACT	0.163347		TCGA-HZ-7926-01A-11D-2154-08	0.463	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251506.2	1	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	1.880000	-20.000000	1	0.160000	NM_153028		0	27	27	0	495	488	1		1	1		0	0	92	0	0	1.000000	6.519972e-01	0	8	0	34	0	27	495
MED1	5469	broad.mit.edu	37	17	37565585	37565585	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr17:37565585T>G	ENST00000300651.6	-	17	3112	c.2889A>C	c.(2887-2889)ttA>ttC	p.L963F	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TTTCTTTCCCTAAGTCCCCAG	0.483										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	ENST00000300651.6	1.000000	0.330000	8.500000e-01	4.600000e-01	0.630000	0.653078	0.630000	1.000000																										0				59						c.(2887-2889)ttA>ttC		mediator complex subunit 1							78.0	77.0	77.0					17																	37565585		2203	4300	6503	SO:0001583	missense	5469	0	0					g.chr17:37565585T>G	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2889A>C	chr17.hg19:g.37565585T>G	ENSP00000300651:p.Leu963Phe	0	HNSCC(31;0.082)				MED1_ENST00000394287.3_Intron	p.L963F	NM_004774.3	NP_004765.2	1	2	3	2.020617	O95243	MBD4_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	17	3112	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	1	1	hg19	c.2889A>C	CCDS11336.1	0	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941018	0.34283	.	.	ENSG00000125686	ENST00000300651	T	0.33865	1.39	5.65	3.4	0.38934	5.65	3.4	0.38934	.	.	.	.	.	T	0.16685	0.0401	N	0.12182	0.205	0.53688	D	0.999973	B	0.06786	0.001	B	0.06405	0.002	T	0.05971	-1.0853	9	0.09590	T	0.72	-0.6855	7.2644	0.26222	0.0:0.2903:0.0:0.7097	.	963	Q15648	MED1_HUMAN	F	963	ENSP00000300651:L963F	ENSP00000300651:L963F	L	-	3	2	2	MED1	34819111	34819111	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.767000	0.26575	1.165000	0.42670	0.533000	0.62120	TTA	0.163347		TCGA-HZ-7926-01A-11D-2154-08	0.483	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.880000	-4.324474	1	0.160000	NM_004774		0	11	11	0	216	211	0		1	1		0	0	53	0	0	0.998249	7.047300e-01	0	4	0	45	0	11	216
TRMT1	55621	broad.mit.edu	37	19	13227177	13227177	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr19:13227177G>A	ENST00000592062.1	-	3	607	c.37C>T	c.(37-39)Cgc>Tgc	p.R13C	NACC1_ENST00000292431.4_5'Flank|TRMT1_ENST00000357720.4_Missense_Mutation_p.R13C|TRMT1_ENST00000592892.1_5'UTR|TRMT1_ENST00000221504.8_Missense_Mutation_p.R13C|TRMT1_ENST00000437766.1_Missense_Mutation_p.R13C			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	13							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		CGGGCGGAGCGGAAAGTGAGG	0.657																																						ENST00000592062.1	0.890000	0.360000	7.500000e-01	4.700000e-01	0.590000	0.615449	0.590000	0.580000																										0				14						c.(37-39)Cgc>Tgc		tRNA methyltransferase 1 homolog (S. cerevisiae)							40.0	46.0	44.0					19																	13227177		2202	4300	6502	SO:0001583	missense	55621	0	0					g.chr19:13227177G>A	AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.37C>T	chr19.hg19:g.13227177G>A	ENSP00000466967:p.Arg13Cys	0					TRMT1_ENST00000592892.1_5'UTR|TRMT1_ENST00000357720.4_Missense_Mutation_p.R13C|NACC1_ENST00000292431.4_5'Flank|TRMT1_ENST00000437766.1_Missense_Mutation_p.R13C|TRMT1_ENST00000221504.8_Missense_Mutation_p.R13C	p.R13C			0	1	1	2.016097	Q9NXH9	TRM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	3	607	-			O76103|Q548Y5|Q8WVA6	Missense_Mutation	SNP	ENST00000592062.1	1	1	hg19	c.37C>T	CCDS12293.1	0	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396554	0.42512	.	.	ENSG00000104907	ENST00000357720;ENST00000437766;ENST00000221504	.	.	.	5.28	3.15	0.36227	5.28	3.15	0.36227	.	0.180442	0.31772	N	0.007085	T	0.34366	0.0895	L	0.27053	0.805	0.19300	N	0.999976	D;D	0.71674	0.998;0.997	P;P	0.53861	0.736;0.548	T	0.10064	-1.0646	9	0.72032	D	0.01	-15.9499	8.3666	0.32391	0.1833:0.0:0.8167:0.0	.	13;13	Q9NXH9-2;Q9NXH9	.;TRM1_HUMAN	C	13	.	ENSP00000221504:R13C	R	-	1	0	0	TRMT1	13088177	13088177	0.973000	0.33851	0.106000	0.21319	0.003000	0.03518	2.511000	0.45476	0.728000	0.32382	-0.140000	0.14226	CGC	0.155949		TCGA-HZ-7926-01A-11D-2154-08	0.657	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452780.2	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.880000	-18.077450	1	0.160000	NM_017722		0	17	17	0	339	331	0		1	0		0	0	58	0	0	0.999961	6.507543e-01	0	0	0	45	0	17	339
CABP5	56344	broad.mit.edu	37	19	48537514	48537514	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr19:48537514G>A	ENST00000293255.2	-	5	584	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W		NM_019855.4	NP_062829.1	Q9NP86	CABP5_HUMAN	calcium binding protein 5	152	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	11		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		TCAGCCTCCCGGACAACCTCA	0.617																																						ENST00000293255.2	1.000000	0.900000	1	9.900000e-01	0.990000	0.994568	0.990000	1.000000																										0				11						c.(454-456)Cgg>Tgg		calcium binding protein 5							47.0	41.0	43.0					19																	48537514		2203	4300	6503	SO:0001583	missense	56344	1	121410	33				g.chr19:48537514G>A	AF169159	CCDS12709.1	19q13.33	2014-08-12			ENSG00000105507	ENSG00000105507		"""EF-hand domain containing"""	13714	protein-coding gene	gene with protein product		607315	"""calcium binding protein 3"""	CABP3		10625670	Standard	NM_019855		Approved	CaBP3	uc002phu.2	Q9NP86	OTTHUMG00000183139	ENST00000293255.2:c.454C>T	chr19.hg19:g.48537514G>A	ENSP00000293255:p.Arg152Trp	0						p.R152W	NM_019855.4	NP_062829.1	0	1	1	2.010911	Q9NP86	CABP5_HUMAN		5	584	-		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)	A0AUY4	Missense_Mutation	SNP	ENST00000293255.2	1	1	hg19	c.454C>T	CCDS12709.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197685	0.79015	.	.	ENSG00000105507	ENST00000293255	T	0.73469	-0.75	5.01	5.01	0.66863	5.01	5.01	0.66863	EF-hand-like domain (1);	0.424187	0.24642	N	0.036784	D	0.82393	0.5027	M	0.79926	2.475	0.42202	D	0.991774	D	0.54207	0.965	P	0.51777	0.679	D	0.85894	0.1430	10	0.87932	D	0	-0.4457	16.1949	0.82021	0.0:0.0:1.0:0.0	.	152	Q9NP86	CABP5_HUMAN	W	152	ENSP00000293255:R152W	ENSP00000293255:R152W	R	-	1	2	2	CABP5	53229326	53229326	0.002000	0.14202	0.723000	0.30687	0.981000	0.71138	0.819000	0.27308	2.509000	0.84616	0.561000	0.74099	CGG	0.154589		TCGA-HZ-7926-01A-11D-2154-08	0.617	CABP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465212.1	1	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	1.880000	-3.318835	1	0.160000	NM_019855		0	26	24	0	214	209	1		1			0	0	46	0	0	1.000000	0	0	0	0	0	0	26	214
CLEC4M	10332	broad.mit.edu	37	19	7833838	7833838	+	Silent	SNP	C	C	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr19:7833838C>A	ENST00000327325.5	+	7	1282	c.1164C>A	c.(1162-1164)atC>atA	p.I388I	CLEC4M_ENST00000359059.5_Silent_p.I321I|CLEC4M_ENST00000596363.1_3'UTR|CLEC4M_ENST00000334806.5_Silent_p.I337I|CLEC4M_ENST00000597522.1_3'UTR|CLEC4M_ENST00000595496.1_Silent_p.I252I|CLEC4M_ENST00000248228.4_Silent_p.I366I|CLEC4M_ENST00000596707.1_Silent_p.I321I|CLEC4M_ENST00000394122.2_Silent_p.I376I|CLEC4M_ENST00000357361.2_3'UTR	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	388	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						ATTACTGGATCTGCAAAAAGC	0.498																																						ENST00000327325.5	1.000000	0.470000	8.800000e-01	5.900000e-01	0.720000	0.737314	0.720000	1.000000																										0				26						c.(1162-1164)atC>atA		C-type lectin domain family 4, member M							179.0	146.0	157.0					19																	7833838		2203	4300	6503	SO:0001819	synonymous_variant	10332	0	0					g.chr19:7833838C>A	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.1164C>A	chr19.hg19:g.7833838C>A		0					CLEC4M_ENST00000597522.1_3'UTR|CLEC4M_ENST00000248228.4_Silent_p.I366I|CLEC4M_ENST00000595496.1_Silent_p.I252I|CLEC4M_ENST00000596363.1_3'UTR|CLEC4M_ENST00000596707.1_Silent_p.I321I|CLEC4M_ENST00000357361.2_3'UTR|CLEC4M_ENST00000359059.5_Silent_p.I321I|CLEC4M_ENST00000334806.5_Silent_p.I337I|CLEC4M_ENST00000394122.2_Silent_p.I376I	p.I388I	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	0	1	1	2.012408	Q9H2X3	CLC4M_HUMAN		7	1282	+			A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Silent	SNP	ENST00000327325.5	1	1	hg19	c.1164C>A	CCDS12187.1	0																																																																																								0.153226		TCGA-HZ-7926-01A-11D-2154-08	0.498	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.880000	-20.000000	1	0.160000	NM_014257		0	24	24	0	387	380	0		1			0	0	68	0	0	1.000000	0	0	0	0	0	0	24	387
ZSCAN1	284312	broad.mit.edu	37	19	58549468	58549468	+	Silent	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr19:58549468C>T	ENST00000282326.1	+	3	511	c.264C>T	c.(262-264)ggC>ggT	p.G88G	ZSCAN1_ENST00000601162.1_Silent_p.G88G|ZSCAN1_ENST00000391700.1_Silent_p.G88G	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	88	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AGTTCCTGGGCGCGCTGCCCA	0.697																																						ENST00000282326.1	1.000000	0.470000	1	6.900000e-01	0.980000	0.880941	0.980000	1.000000																										0				48						c.(262-264)ggC>ggT		zinc finger and SCAN domain containing 1							17.0	18.0	18.0					19																	58549468		2197	4294	6491	SO:0001819	synonymous_variant	284312	2	120990	30				g.chr19:58549468C>T	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.264C>T	chr19.hg19:g.58549468C>T		0					ZSCAN1_ENST00000391700.1_Silent_p.G88G|ZSCAN1_ENST00000601162.1_Silent_p.G88G	p.G88G	NM_182572.3	NP_872378.3	1	2	3	2.047905	Q8NBB4	ZSCA1_HUMAN		3	511	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	Q3B798|Q6WLH8|Q86WS8	Silent	SNP	ENST00000282326.1	1	1	hg19	c.264C>T	CCDS12969.1	1																																																																																								0.171271		TCGA-HZ-7926-01A-11D-2154-08	0.697	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.880000	-13.570830	1	0.160000	NM_182572		0	9	9	0	116	114	0		1			0	0	30	0	0	0.994366	0	0	0	0	0	0	9	116
MUC1	4582	broad.mit.edu	37	1	155160807	155160807	+	Silent	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:155160807G>A	ENST00000368395.1	-	3	791	c.720C>T	c.(718-720)agC>agT	p.S240S	MUC1_ENST00000337604.5_Intron|MUC1_ENST00000368398.3_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000462215.1_5'UTR|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000368392.3_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000368390.3_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	1020	42 X 20 AA approximate tandem repeats of P-A-P-G-S-T-A-P-P-A-H-G-V-T-S-A-P-D-T-R.				cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGGTACCGTGCTATGGTGAG	0.507			T	IGH@	B-NHL																																	ENST00000368395.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999867	0.990000	1.000000				Dom	yes			Dom	yes		1	1q21	1q21	4582	T	"""mucin 1, transmembrane"""				L	L	IGH@		B-NHL		0				10						c.(718-720)agC>agT		mucin 1, cell surface associated							38.0	43.0	42.0					1																	155160807		2197	4296	6493	SO:0001819	synonymous_variant	4582	0	0					g.chr1:155160807G>A	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.720C>T	chr1.hg19:g.155160807G>A		1					RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000462215.1_5'UTR|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000368390.3_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000368398.3_Intron	p.S240S	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	1	2	3	2.111113	P15941	MUC1_HUMAN	Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)	3	791	-	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Silent	SNP	ENST00000368395.1	1	1	hg19	c.720C>T	CCDS55640.1	1																																																																																								0.181606		TCGA-HZ-7926-01A-11D-2154-08	0.507	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086735.1	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.880000	-15.324850	1	0.160000	NM_002456		0	34	33	0	236	232	0		1	1		0	0	45	0	0	1.000000	1	0	624	0	5067	0	34	236
OR10K1	391109	broad.mit.edu	37	1	158435756	158435756	+	Silent	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:158435756C>T	ENST00000289451.2	+	1	485	c.405C>T	c.(403-405)ctC>ctT	p.L135L		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					ACTCAGTGCTCATGGGACATG	0.547																																						ENST00000289451.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999997	0.990000	1.000000																										0				27						c.(403-405)ctC>ctT		olfactory receptor, family 10, subfamily K, member 1							214.0	201.0	206.0					1																	158435756		2203	4300	6503	SO:0001819	synonymous_variant	391109	0	0					g.chr1:158435756C>T	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.405C>T	chr1.hg19:g.158435756C>T		1						p.L135L	NM_001004473.1	NP_001004473.1	1	2	3	2.111113	Q8NGX5	O10K1_HUMAN		1	485	+	all_hematologic(112;0.0378)		Q6IFS2	Silent	SNP	ENST00000289451.2	1	1	hg19	c.405C>T	CCDS30897.1	1																																																																																								0.181606		TCGA-HZ-7926-01A-11D-2154-08	0.547	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1	1	0	1	2	2	2	2	0	0	0	0	131	131	131	124	1	1.880000	-3.318794	1	0.160000			0	97	94	0	758	724	1		1			0	0	131	0	0	1.000000	0	0	0	0	0	0	97	758
NBPF1	55672	broad.mit.edu	37	1	16918794	16918794	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:16918794G>A	ENST00000430580.2	-	0	712					NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGTGGCCAGCGTGCCAGGTAA	0.502																																						ENST00000430580.2			0	0																														0												neuroblastoma breakpoint family, member 1																																						55672	0	0					g.chr1:16918794G>A	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487		chr1.hg19:g.16918794G>A									NM_017940.3	NP_060410.2					Q3BBV0	NBPF1_HUMAN		0	712	-			Q8N4E8|Q9C0H0	Translation_Start_Site	SNP	ENST00000430580.2	0	1	hg19																																																																																													TCGA-HZ-7926-01A-11D-2154-08	0.502	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	0	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.880000	-2.356422	0	0.160000	NM_017940		0	7	6	0	69	56	0		1	1		0	0	10	0	0	0.964224	8.157118e-01	0	2	0	31	0	7	69
DDR2	4921	broad.mit.edu	37	1	162688902	162688902	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:162688902A>G	ENST00000367922.3	+	4	487	c.49A>G	c.(49-51)Atc>Gtc	p.I17V	DDR2_ENST00000367921.3_Missense_Mutation_p.I17V	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	17					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	GCTGCTGCCTATCTTGAGTTC	0.438																																					NSCLC(161;314 2006 8283 19651 23192)	ENST00000367922.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999591	0.990000	1.000000																										0				7						c.(49-51)Atc>Gtc		discoidin domain receptor tyrosine kinase 2	Regorafenib(DB08896)						193.0	166.0	175.0					1																	162688902		2203	4300	6503	SO:0001583	missense	4921	0	0					g.chr1:162688902A>G	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.49A>G	chr1.hg19:g.162688902A>G	ENSP00000356899:p.Ile17Val	1					DDR2_ENST00000367921.3_Missense_Mutation_p.I17V	p.I17V	NM_001014796.1	NP_001014796.1	1	2	3	2.111113	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)	4	487	+	all_hematologic(112;0.115)		Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	1	1	hg19	c.49A>G	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	A	2.456	-0.325175	0.05350	.	.	ENSG00000162733	ENST00000446985;ENST00000415555;ENST00000542391;ENST00000367922;ENST00000367921	D;D;D;D	0.97642	-4.2;-4.47;-1.68;-1.68	4.25	-2.92	0.05615	4.25	-2.92	0.05615	.	0.491466	0.19764	N	0.106619	T	0.82226	0.4991	N	0.25647	0.755	0.26350	N	0.977213	B	0.06786	0.001	B	0.04013	0.001	T	0.68622	-0.5360	9	0.19590	T	0.45	.	2.942	0.05834	0.3119:0.45:0.0921:0.146	.	17	Q16832	DDR2_HUMAN	V	17	ENSP00000400309:I17V;ENSP00000391310:I17V;ENSP00000356899:I17V;ENSP00000356898:I17V	ENSP00000356898:I17V	I	+	1	0	0	DDR2	160955526	160955526	0.076000	0.21285	0.303000	0.25071	0.931000	0.56810	-0.197000	0.09518	-0.682000	0.05197	-0.605000	0.04089	ATC	0.181606		TCGA-HZ-7926-01A-11D-2154-08	0.438	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	1	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	1.880000	-20.000000	1	0.160000	NM_006182		0	48	48	0	393	387	1		1	0		0	0	82	0	0	1.000000	7.319722e-01	0	0	0	23	0	48	393
MIA3	375056	broad.mit.edu	37	1	222835427	222835427	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:222835427C>T	ENST00000344922.5	+	25	5168	c.5143C>T	c.(5143-5145)Cga>Tga	p.R1715*	MIA3_ENST00000340535.7_Nonsense_Mutation_p.R593*|MIA3_ENST00000344507.1_Intron|RP11-378J18.8_ENST00000608771.1_RNA|MIA3_ENST00000344441.6_Nonsense_Mutation_p.R1715*	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1715	Pro-rich.				chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		ACCTCATCCTCGATGGTCAGC	0.443																																						ENST00000344922.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999903	0.990000	1.000000																										0				80						c.(5143-5145)Cga>Tga		melanoma inhibitory activity family, member 3							72.0	73.0	73.0					1																	222835427		1887	4103	5990	SO:0001587	stop_gained	375056	0	0					g.chr1:222835427C>T		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.5143C>T	chr1.hg19:g.222835427C>T	ENSP00000340900:p.Arg1715*	0					RP11-378J18.8_ENST00000608771.1_RNA|MIA3_ENST00000340535.7_Nonsense_Mutation_p.R593*|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Nonsense_Mutation_p.R1715*	p.R1715*	NM_198551.2	NP_940953.2	1	2	3	2.072648	Q5JRA6	MIA3_HUMAN		25	5168	+			A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Nonsense_Mutation	SNP	ENST00000344922.5	0	1	hg19	c.5143C>T	CCDS41470.1	1	.	.	.	.	.	.	.	.	.	.	C	42	9.607272	0.99217	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	.	.	.	5.14	1.59	0.23543	5.14	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.457	0.61204	0.5192:0.4808:0.0:0.0	.	.	.	.	X	1715;1715;1656;593;593	.	ENSP00000284471:R593X	R	+	1	2	2	MIA3	220902050	220902050	0.006000	0.16342	0.004000	0.12327	0.130000	0.20726	0.825000	0.27393	0.624000	0.30286	-0.181000	0.13052	CGA	0.173879		TCGA-HZ-7926-01A-11D-2154-08	0.443	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	1	0	1	2	2	2	2	0	0	0	0	63	63	63	62	1	1.880000	-3.017792	1	0.160000	NM_198551		0	43	43	0	310	308	1		1	1		0	0	63	0	0	1.000000	9.999948e-01	0	5	0	128	0	43	310
CCDC18	343099	broad.mit.edu	37	1	93672842	93672842	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:93672842G>T	ENST00000343253.7	+	9	1598	c.1096G>T	c.(1096-1098)Gaa>Taa	p.E366*	CCDC18_ENST00000557479.1_Nonsense_Mutation_p.E484*|CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000338949.4_Nonsense_Mutation_p.E165*|CCDC18_ENST00000401026.3_Nonsense_Mutation_p.E366*			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	366										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGAAAACCGAGAATTAAAGGT	0.333																																						ENST00000343253.7	1.000000	0.380000	8.400000e-01	5.000000e-01	0.650000	0.673774	0.650000	1.000000																										0				42						c.(1096-1098)Gaa>Taa		coiled-coil domain containing 18							74.0	70.0	71.0					1																	93672842		1835	4091	5926	SO:0001587	stop_gained	343099	0	0					g.chr1:93672842G>T			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1096G>T	chr1.hg19:g.93672842G>T	ENSP00000343377:p.Glu366*	0					CCDC18_ENST00000401026.3_Nonsense_Mutation_p.E366*|CCDC18_ENST00000557479.1_Nonsense_Mutation_p.E484*|CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000338949.4_Nonsense_Mutation_p.E165*	p.E366*			0	0	0	1.903721	Q5T9S5	CCD18_HUMAN		9	1598	+		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)	Q6ZU17	Nonsense_Mutation	SNP	ENST00000343253.7	0	1	hg19	c.1096G>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	5.984821|5.984821	0.97173|0.97173	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000370276|ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.164121|0.164121	0.52532|0.52532	D|D	0.000077|0.000077	T|.	0.59783|.	0.2219|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.53085|.	-0.8488|.	5|.	.|0.22109	.|T	.|0.4	.|.	18.2995|18.2995	0.90158|0.90158	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	419|366;366;484;165;86	.|.	.|ENSP00000344380:E165X	E|E	+|+	3|1	2|0	2|0	CCDC18|CCDC18	93445430|93445430	93445430|93445430	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.263000|4.263000	0.58853|0.58853	2.763000|2.763000	0.94921|0.94921	0.555000|0.555000	0.69702|0.69702	GAG|GAA	0.105622		TCGA-HZ-7926-01A-11D-2154-08	0.333	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.880000	-17.022350	1	0.160000	NM_206886		0	14	14	0	235	230	0		1	0		0	0	41	0	0	0.999745	2.062390e-02	0	0	0	3	0	14	235
NLRP3	114548	broad.mit.edu	37	1	247592989	247592989	+	Silent	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr1:247592989G>A	ENST00000336119.3	+	4	3005	c.2259G>A	c.(2257-2259)ctG>ctA	p.L753L	NLRP3_ENST00000391827.2_Intron|NLRP3_ENST00000366496.2_Silent_p.L753L|NLRP3_ENST00000366497.2_Silent_p.L753L|NLRP3_ENST00000391828.3_Silent_p.L753L|NLRP3_ENST00000348069.2_Intron	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	753					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			ACAATTCTCTGGGGGACCCAG	0.527																																						ENST00000336119.3	1.000000	0.450000	1	5.700000e-01	0.720000	0.749587	0.720000	1.000000																										0				142						c.(2257-2259)ctG>ctA		NLR family, pyrin domain containing 3							99.0	94.0	96.0					1																	247592989		2203	4300	6503	SO:0001819	synonymous_variant	114548	0	0					g.chr1:247592989G>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2259G>A	chr1.hg19:g.247592989G>A		0					NLRP3_ENST00000391827.2_Intron|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000391828.3_Silent_p.L753L|NLRP3_ENST00000366496.2_Silent_p.L753L|NLRP3_ENST00000366497.2_Silent_p.L753L	p.L753L	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	1	2	3	2.072648	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)	4	3005	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	1	1	hg19	c.2259G>A	CCDS1632.1	0																																																																																								0.173879		TCGA-HZ-7926-01A-11D-2154-08	0.527	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.880000	-2.804967	1	0.160000	NM_004895		0	22	22	0	386	383	0		1	0		0	0	65	0	0	0.999999	2.896669e-02	0	0	0	5	0	22	386
FOXS1	2307	broad.mit.edu	37	20	30432695	30432695	+	Silent	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr20:30432695C>T	ENST00000375978.3	-	1	725	c.651G>A	c.(649-651)gcG>gcA	p.A217A		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	217					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						GAAAGCCAAACGCTGGGCATG	0.617																																						ENST00000375978.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.998743	0.990000	1.000000																										0				9						c.(649-651)gcG>gcA		forkhead box S1							45.0	45.0	45.0					20																	30432695		2203	4300	6503	SO:0001819	synonymous_variant	2307	0	0					g.chr20:30432695C>T	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.651G>A	chr20.hg19:g.30432695C>T		0						p.A217A	NM_004118.3	NP_004109.1	1	2	3	2.027936	O43638	FOXS1_HUMAN		1	725	-			Q96D28	Silent	SNP	ENST00000375978.3	1	1	hg19	c.651G>A	CCDS13192.1	1																																																																																								0.164678		TCGA-HZ-7926-01A-11D-2154-08	0.617	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	1.880000	-20.000000	1	0.160000	NM_004118		0	34	33	0	267	263	1		1	1		0	0	48	0	0	1.000000	9.605592e-01	0	8	0	36	0	34	267
MATN4	8785	broad.mit.edu	37	20	43926857	43926857	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr20:43926857C>T	ENST00000372754.1	-	7	1510	c.1502G>A	c.(1501-1503)cGc>cAc	p.R501H	MATN4_ENST00000342716.4_Missense_Mutation_p.R460H|MATN4_ENST00000360607.6_Missense_Mutation_p.R419H|MATN4_ENST00000372756.1_Missense_Mutation_p.R460H|MATN4_ENST00000353917.5_Missense_Mutation_p.R378H|MATN4_ENST00000537548.1_Missense_Mutation_p.R460H|MATN4_ENST00000372751.4_Missense_Mutation_p.R311H			O95460	MATN4_HUMAN	matrilin 4	501	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				ATCCTGGGAGCGGCCATCCGT	0.672																																						ENST00000372754.1	1.000000	0.680000	1	8.200000e-01	0.980000	0.931718	0.980000	1.000000																										0				27						c.(1501-1503)cGc>cAc		matrilin 4							61.0	53.0	56.0					20																	43926857		2203	4300	6503	SO:0001583	missense	8785	0	0					g.chr20:43926857C>T	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1502G>A	chr20.hg19:g.43926857C>T	ENSP00000361840:p.Arg501His	0					MATN4_ENST00000537548.1_Missense_Mutation_p.R460H|MATN4_ENST00000353917.5_Missense_Mutation_p.R378H|MATN4_ENST00000372751.4_Missense_Mutation_p.R311H|MATN4_ENST00000372756.1_Missense_Mutation_p.R460H|MATN4_ENST00000342716.4_Missense_Mutation_p.R460H|MATN4_ENST00000360607.6_Missense_Mutation_p.R419H	p.R501H			1	2	3	2.027936	O95460	MATN4_HUMAN		7	1510	-		Myeloproliferative disorder(115;0.0122)	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	1	1	hg19	c.1502G>A		1	.	.	.	.	.	.	.	.	.	.	C	33	5.239741	0.95240	.	.	ENSG00000124159	ENST00000372753;ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132;ENST00000372751	D;D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.000000	0.44902	D	0.000411	D	0.92456	0.7605	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.97;0.999	D	0.93464	0.6813	10	0.87932	D	0	.	18.3439	0.90314	0.0:1.0:0.0:0.0	.	378;419;460	A6NNA4;O95460-4;O95460-2	.;.;.	H	311;501;460;378;419;460;460;501;311	ENSP00000361839:R311H;ENSP00000361840:R501H;ENSP00000361842:R460H;ENSP00000243983:R378H;ENSP00000353819:R419H;ENSP00000343164:R460H;ENSP00000440328:R460H;ENSP00000361837:R311H	ENSP00000255132:R501H	R	-	2	0	0	MATN4	43360271	43360271	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.759000	0.85235	2.559000	0.86315	0.644000	0.83932	CGC	0.164678		TCGA-HZ-7926-01A-11D-2154-08	0.672	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	72	1	1.880000	-9.181191	1	0.160000			0	32	32	0	381	375	0		1			0	0	73	0	0	1.000000	0	0	0	0	0	0	32	381
MAP2	4133	broad.mit.edu	37	2	210559008	210559008	+	Missense_Mutation	SNP	C	C	T	rs146432517		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr2:210559008C>T	ENST00000360351.4	+	7	2620	c.2114C>T	c.(2113-2115)cCg>cTg	p.P705L	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.P701L|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	705			P -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.P705L(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	ATCAATTTGCCGATGTCTTGC	0.438																																					Pancreas(27;423 979 28787 29963)	ENST00000360351.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										1	Substitution - Missense(1)	p.P705L(1)	large_intestine(1)	124						c.(2113-2115)cCg>cTg		microtubule-associated protein 2	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	C	,LEU/PRO,,	0,4406		0,0,2203	241.0	231.0	234.0		,2114,,	6.1	1.0	2	dbSNP_134	234	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,intron,intron	MAP2	NM_001039538.1,NM_002374.3,NM_031845.2,NM_031847.2	,98,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,probably-damaging,,	,705/1828,,	210559008	1,13005	2203	4300	6503	SO:0001583	missense	4133	0	0					g.chr2:210559008C>T		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2114C>T	chr2.hg19:g.210559008C>T	ENSP00000353508:p.Pro705Leu	1					MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.P701L|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	p.P705L	NM_002374.3	NP_002365.3	1	2	3	2.102214	P11137	MTAP2_HUMAN		7	2620	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	1	1	hg19	c.2114C>T	CCDS2384.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342024	0.81911	0.0	1.16E-4	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.28666	1.6;1.6	6.06	6.06	0.98353	6.06	6.06	0.98353	MAP2/Tau projection (1);	0.000000	0.64402	D	0.000006	T	0.55832	0.1945	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.977;0.987	T	0.52682	-0.8543	10	0.87932	D	0	-13.3508	20.6244	0.99512	0.0:1.0:0.0:0.0	.	701;705	P11137-3;P11137	.;MAP2_HUMAN	L	705;701	ENSP00000353508:P705L;ENSP00000392164:P701L	ENSP00000353508:P705L	P	+	2	0	0	MAP2	210267253	210267253	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.238000	0.78173	2.879000	0.98667	0.650000	0.86243	CCG	0.179688		TCGA-HZ-7926-01A-11D-2154-08	0.438	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	1	0	1	2	2	2	2	0	0	0	0	164	164	164	163	1	1.880000	-2.966611	1	0.160000	NM_001039538		0	117	116	0	930	909	1		1			0	0	164	0	0	1.000000	0	0	0	0	0	0	117	930
ERBB4	2066	broad.mit.edu	37	2	212589903	212589903	+	Silent	SNP	A	A	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr2:212589903A>G	ENST00000342788.4	-	6	949	c.639T>C	c.(637-639)tgT>tgC	p.C213C	ERBB4_ENST00000402597.1_Silent_p.C213C|ERBB4_ENST00000436443.1_Silent_p.C213C|ERBB4_ENST00000484474.1_5'UTR	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	213	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ATTGTTCTGCACACACCGTCC	0.507										TSP Lung(8;0.080)																												ENST00000342788.4	1.000000	0.250000	1	3.400000e-01	0.470000	0.563728	0.470000	0.420000																										0				179						c.(637-639)tgT>tgC		v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	Afatinib(DB08916)						139.0	121.0	127.0					2																	212589903		2203	4300	6503	SO:0001819	synonymous_variant	2066	0	0					g.chr2:212589903A>G	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.639T>C	chr2.hg19:g.212589903A>G		1	TSP Lung(8;0.080)				ERBB4_ENST00000484474.1_5'UTR|ERBB4_ENST00000402597.1_Silent_p.C213C|ERBB4_ENST00000436443.1_Silent_p.C213C	p.C213C	NM_005235.2	NP_005226.1	1	2	3	2.102214	Q15303	ERBB4_HUMAN		6	949	-		Renal(323;0.06)|Lung NSC(271;0.197)	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	1	1	hg19	c.639T>C	CCDS2394.1	0	.	.	.	.	.	.	.	.	.	.	A	11.01	1.513447	0.27123	.	.	ENSG00000178568	ENST00000260943	.	.	.	5.73	3.36	0.38483	5.73	3.36	0.38483	.	.	.	.	.	T	0.57873	0.2083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53365	-0.8449	4	.	.	.	.	8.2245	0.31560	0.7842:0.0:0.2158:0.0	.	.	.	.	A	213	.	.	V	-	2	0	0	ERBB4	212298148	212298148	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.777000	0.38604	0.983000	0.38602	0.528000	0.53228	GTG	0.179688		TCGA-HZ-7926-01A-11D-2154-08	0.507	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.880000	-13.822640	1	0.160000	NM_001042599		0	14	14	0	403	398	0		1			0	0	55	0	0	0.999743	0	0	0	0	0	0	14	403
UGP2	7360	broad.mit.edu	37	2	64117306	64117306	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr2:64117306A>G	ENST00000337130.5	+	9	1882	c.1406A>G	c.(1405-1407)aAt>aGt	p.N469S	UGP2_ENST00000394417.2_Missense_Mutation_p.N458S|UGP2_ENST00000467648.2_Missense_Mutation_p.N458S|UGP2_ENST00000445915.2_Missense_Mutation_p.N478S	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	469	Oligomerization.				carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						TTTGGAAAAAATGTTTCATTA	0.289																																						ENST00000337130.5	1.000000	0.950000	1	9.900000e-01	0.990000	0.997101	0.990000	1.000000																										0				18						c.(1405-1407)aAt>aGt		UDP-glucose pyrophosphorylase 2							80.0	85.0	83.0					2																	64117306		2202	4298	6500	SO:0001583	missense	7360	3	121374	32				g.chr2:64117306A>G		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.1406A>G	chr2.hg19:g.64117306A>G	ENSP00000338703:p.Asn469Ser	1					UGP2_ENST00000394417.2_Missense_Mutation_p.N458S|UGP2_ENST00000467648.2_Missense_Mutation_p.N458S|UGP2_ENST00000445915.2_Missense_Mutation_p.N478S	p.N469S	NM_006759.3	NP_006750.3	2	2	4	2.129790	Q16851	UGPA_HUMAN		9	1882	+			Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	1	1	hg19	c.1406A>G	CCDS1875.1	1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.421711	0.62622	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000445915	T;T;T;T	0.20463	2.07;2.07;2.07;2.07	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.129339	0.64402	D	0.000001	T	0.22205	0.0535	L	0.45051	1.395	0.80722	D	1	P;P	0.42337	0.776;0.494	B;B	0.39935	0.314;0.314	T	0.01152	-1.1435	10	0.45353	T	0.12	-6.9138	16.1814	0.81903	1.0:0.0:0.0:0.0	.	478;469	E7EUC7;Q16851	.;UGPA_HUMAN	S	458;458;469;478	ENSP00000377939:N458S;ENSP00000420793:N458S;ENSP00000338703:N469S;ENSP00000411803:N478S	ENSP00000338703:N469S	N	+	2	0	0	UGP2	63970810	63970810	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.339000	0.96797	2.234000	0.73211	0.533000	0.62120	AAT	0.206949		TCGA-HZ-7926-01A-11D-2154-08	0.289	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	1	0	1	2	2	2	2	0	0	0	0	25	25	25	24	1	1.880000	-20.000000	1	0.160000	NM_006759		0	29	28	0	255	253	1		1	1		0	0	25	0	0	1.000000	1	0	79	0	398	0	29	255
PAIP2B	400961	broad.mit.edu	37	2	71417026	71417026	+	Silent	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr2:71417026C>T	ENST00000244221.8	-	3	430	c.264G>A	c.(262-264)caG>caA	p.Q88Q		NM_020459.1	NP_065192.1	Q9ULR5	PAI2B_HUMAN	poly(A) binding protein interacting protein 2B	88					negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)	translation repressor activity, nucleic acid binding (GO:0000900)			large_intestine(1)|lung(1)	2						CATTTAACTGCTGTTGCAACT	0.453																																						ENST00000244221.8	1.000000	0.470000	1	8.300000e-01	0.990000	0.934796	0.990000	1.000000																										0				2						c.(262-264)caG>caA		poly(A) binding protein interacting protein 2B							61.0	58.0	59.0					2																	71417026		1952	4158	6110	SO:0001819	synonymous_variant	400961	0	0					g.chr2:71417026C>T		CCDS46322.1	2p13.3	2007-07-16			ENSG00000124374	ENSG00000124374			29200	protein-coding gene	gene with protein product		611018				16804161	Standard	NM_020459		Approved	KIAA1155	uc002shu.2	Q9ULR5	OTTHUMG00000153284	ENST00000244221.8:c.264G>A	chr2.hg19:g.71417026C>T		1						p.Q88Q	NM_020459.1	NP_065192.1	2	2	4	2.129790	Q9ULR5	PAI2B_HUMAN		3	430	-				Silent	SNP	ENST00000244221.8	0	1	hg19	c.264G>A	CCDS46322.1	1																																																																																								0.206949		TCGA-HZ-7926-01A-11D-2154-08	0.453	PAIP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330547.2	0	0	0	2	2	2	2	0	0	0	0	11	11	11	11	1	1.880000	-9.351660	1	0.160000	XM_376062		0	4	0	0	41	41	0		0	0		0	0	11	0	0	0.870158	4.295810e-01	0	0	0	14	0	4	41
OBSL1	23363	broad.mit.edu	37	2	220420834	220420834	+	Missense_Mutation	SNP	C	C	T	rs138086602		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr2:220420834C>T	ENST00000404537.1	-	14	4573	c.4517G>A	c.(4516-4518)cGc>cAc	p.R1506H	OBSL1_ENST00000603926.1_Missense_Mutation_p.R1506H|OBSL1_ENST00000373876.1_Missense_Mutation_p.R1414H|OBSL1_ENST00000265317.5_Missense_Mutation_p.R405H|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000265318.4_Missense_Mutation_p.A1373T	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1506	Ig-like 12.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)	p.R1506H(1)					Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GATGAAGAGGCGGTGGATGTG	0.697																																						ENST00000404537.1	1.000000	0.900000	1	9.900000e-01	0.990000	0.994524	0.990000	1.000000																										1	Substitution - Missense(1)	p.R1506H(1)	central_nervous_system(1)							c.(4516-4518)cGc>cAc		obscurin-like 1							31.0	37.0	35.0					2																	220420834		2101	4216	6317	SO:0001583	missense	23363	3	121020	34				g.chr2:220420834C>T	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.4517G>A	chr2.hg19:g.220420834C>T	ENSP00000385636:p.Arg1506His	1					OBSL1_ENST00000265318.4_Missense_Mutation_p.A1373T|OBSL1_ENST00000603926.1_Missense_Mutation_p.R1506H|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000265317.5_Missense_Mutation_p.R405H|OBSL1_ENST00000373876.1_Missense_Mutation_p.R1414H	p.R1506H	NM_015311.2	NP_056126.1	1	2	3	2.102214	O75147	OBSL1_HUMAN		14	4573	-		Renal(207;0.0376)	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	1	1	hg19	c.4517G>A	CCDS46520.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.478052|4.478052	0.84747|0.84747	.|.	.|.	ENSG00000124006|ENSG00000124006	ENST00000265318;ENST00000456147|ENST00000404537;ENST00000373876;ENST00000265317	T|T;T;T	0.57273|0.67865	0.41|-0.29;-0.29;-0.29	4.49|4.49	4.49|4.49	0.54785|0.54785	4.49|4.49	4.49|4.49	0.54785|0.54785	.|Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.73458|0.73458	0.3589|0.3589	L|L	0.39147|0.39147	1.195|1.195	0.22940|0.22940	N|N	0.998532|0.998532	.|D;D;D;D	.|0.89917	.|1.0;0.999;1.0;0.999	.|D;D;D;D	.|0.74674	.|0.964;0.977;0.982;0.984	T|T	0.62642|0.62642	-0.6811|-0.6811	7|9	0.06099|0.45353	T|T	0.92|0.12	.|.	11.9214|11.9214	0.52793|0.52793	0.0:0.6679:0.3321:0.0|0.0:0.6679:0.3321:0.0	.|.	.|313;1507;1506;405	.|B7Z5P5;A4KVA4;O75147;E7ER99	.|.;.;OBSL1_HUMAN;.	T|H	1373;408|1506;1414;405	ENSP00000265318:A1373T|ENSP00000385636:R1506H;ENSP00000362983:R1414H;ENSP00000265317:R405H	ENSP00000265318:A1373T|ENSP00000265317:R405H	A|R	-|-	1|2	0|0	0|0	OBSL1|OBSL1	220129078|220129078	220129078|220129078	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	2.024000|2.024000	0.41049|0.41049	2.327000|2.327000	0.79052|0.79052	0.491000|0.491000	0.48974|0.48974	GCC|CGC	0.179688		TCGA-HZ-7926-01A-11D-2154-08	0.697	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1	1	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	1.880000	-2.578509	1	0.160000			0	22	19	0	186	182	1		1	1		0	0	35	0	0	0.999999	9.375234e-01	0	7	0	34	0	22	186
IP6K2	51447	broad.mit.edu	37	3	48726088	48726088	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr3:48726088C>T	ENST00000328631.5	-	6	1122	c.899G>A	c.(898-900)cGc>cAc	p.R300H	NCKIPSD_ENST00000416649.2_5'Flank|NCKIPSD_ENST00000294129.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	300					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						GAGTTCACGGCGCAGGTACCG	0.567																																						ENST00000328631.5	0.860000	0.370000	7.300000e-01	4.700000e-01	0.590000	0.609012	0.590000	0.580000																										0				15						c.(898-900)cGc>cAc		inositol hexakisphosphate kinase 2							108.0	97.0	101.0					3																	48726088		2203	4300	6503	SO:0001583	missense	51447	0	0					g.chr3:48726088C>T	AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.899G>A	chr3.hg19:g.48726088C>T	ENSP00000331103:p.Arg300His	0					NCKIPSD_ENST00000416649.2_5'Flank|NCKIPSD_ENST00000294129.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank	p.R300H	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	0	0	0	1.981432	Q9UHH9	IP6K2_HUMAN		6	1122	-			A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	ENST00000328631.5	1	1	hg19	c.899G>A	CCDS2777.1	0	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867840	0.91587	.	.	ENSG00000068745	ENST00000328631	T	0.19105	2.17	5.75	4.88	0.63580	5.75	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61657	-0.7018	10	0.72032	D	0.01	-3.6578	14.8375	0.70194	0.0:0.9314:0.0:0.0686	.	300	Q9UHH9	IP6K2_HUMAN	H	300	ENSP00000331103:R300H	ENSP00000331103:R300H	R	-	2	0	0	IP6K2	48701092	48701092	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.818000	0.86416	1.451000	0.47736	0.655000	0.94253	CGC	0.140753		TCGA-HZ-7926-01A-11D-2154-08	0.567	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	1.880000	-19.879780	1	0.160000	NM_016291		0	20	19	0	393	384	1		1	1		0	0	61	0	0	0.999994	9.952526e-01	0	17	0	151	0	20	393
ATP8A1	10396	broad.mit.edu	37	4	42627669	42627669	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr4:42627669C>T	ENST00000381668.5	-	3	457	c.226G>A	c.(226-228)Gct>Act	p.A76T	ATP8A1_ENST00000510289.1_3'UTR|ATP8A1_ENST00000264449.10_Missense_Mutation_p.A76T	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	76					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	GAATTAGCAGCTCTTCTGAAC	0.353																																						ENST00000381668.5	1.000000	0.580000	1	7.400000e-01	0.920000	0.887851	0.920000	1.000000																										0				51						c.(226-228)Gct>Act		ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	Phosphatidylserine(DB00144)						96.0	97.0	97.0					4																	42627669		2203	4300	6503	SO:0001583	missense	10396	0	0					g.chr4:42627669C>T	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.226G>A	chr4.hg19:g.42627669C>T	ENSP00000371084:p.Ala76Thr	0					ATP8A1_ENST00000264449.10_Missense_Mutation_p.A76T|ATP8A1_ENST00000510289.1_3'UTR	p.A76T	NM_006095.2	NP_006086.1	1	2	3	2.025198	Q9Y2Q0	AT8A1_HUMAN		3	457	-			Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	1	1	hg19	c.226G>A	CCDS3466.1	1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644594	0.67358	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.54479	0.57;0.57	5.8	5.8	0.92144	5.8	5.8	0.92144	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	T	0.66137	0.2759	L	0.39467	1.215	0.80722	D	1	D;B;B	0.63880	0.993;0.35;0.209	D;B;B	0.68192	0.956;0.299;0.097	T	0.61377	-0.7075	10	0.41790	T	0.15	.	20.418	0.99029	0.0:1.0:0.0:0.0	.	76;76;76	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	T	76	ENSP00000371084:A76T;ENSP00000264449:A76T	ENSP00000264449:A76T	A	-	1	0	0	ATP8A1	42322426	42322426	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	7.370000	0.79589	2.902000	0.99343	0.650000	0.86243	GCT	0.164678		TCGA-HZ-7926-01A-11D-2154-08	0.353	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.880000	-20.000000	1	0.160000	NM_006095		0	21	21	0	270	267	0		1	0		0	0	42	0	0	0.999998	3.154213e-02	0	0	0	4	0	21	270
HELQ	113510	broad.mit.edu	37	4	84353360	84353360	+	Silent	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr4:84353360C>T	ENST00000295488.3	-	10	2271	c.2109G>A	c.(2107-2109)caG>caA	p.Q703Q	HELQ_ENST00000510985.1_Silent_p.Q636Q	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	703	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TGCCAATCATCTGTTTATATT	0.358								Other identified genes with known or suspected DNA repair function																														ENST00000295488.3	1.000000	0.440000	9.400000e-01	5.700000e-01	0.730000	0.748025	0.730000	1.000000																										0				38						c.(2107-2109)caG>caA	Other identified genes with known or suspected DNA repair function	helicase, POLQ-like							103.0	101.0	101.0					4																	84353360		2203	4300	6503	SO:0001819	synonymous_variant	113510	0	0					g.chr4:84353360C>T	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.2109G>A	chr4.hg19:g.84353360C>T		0					HELQ_ENST00000510985.1_Silent_p.Q636Q	p.Q703Q	NM_133636.2	NP_598375	1	2	3	2.025198	Q8TDG4	HELQ_HUMAN		10	2271	-			Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Silent	SNP	ENST00000295488.3	1	1	hg19	c.2109G>A	CCDS3603.1	0																																																																																								0.164678		TCGA-HZ-7926-01A-11D-2154-08	0.358	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.880000	-3.317573	1	0.160000	NM_133636		0	18	18	0	298	294	0		1	0		0	0	66	0	0	0.999982	3.360513e-01	0	1	0	19	0	18	298
MTTP	4547	broad.mit.edu	37	4	100512445	100512445	+	Silent	SNP	G	G	C	rs267599962		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr4:100512445G>C	ENST00000265517.5	+	5	758	c.555G>C	c.(553-555)gtG>gtC	p.V185V	MTTP_ENST00000511045.1_Silent_p.V212V|MTTP_ENST00000457717.1_Silent_p.V185V			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	185	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AAGACAAAGTGATCAAAATTA	0.403																																						ENST00000265517.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.998994	0.990000	1.000000																										0				57						c.(553-555)gtG>gtC		microsomal triglyceride transfer protein	Hesperetin(DB01094)|Lomitapide(DB08827)						105.0	103.0	103.0					4																	100512445		2203	4300	6503	SO:0001819	synonymous_variant	4547	0	0					g.chr4:100512445G>C		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.555G>C	chr4.hg19:g.100512445G>C		0					MTTP_ENST00000511045.1_Silent_p.V212V|MTTP_ENST00000457717.1_Silent_p.V185V	p.V185V			1	2	3	2.025198	P55157	MTP_HUMAN		5	758	+			A8K428|Q08AM4|Q6P5T3	Silent	SNP	ENST00000265517.5	1	1	hg19	c.555G>C	CCDS3651.1	1																																																																																								0.164678		TCGA-HZ-7926-01A-11D-2154-08	0.403	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3	1	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	1.880000	-3.318794	1	0.160000			0	47	46	0	391	386	1		1			0	0	63	0	0	1.000000	0	0	0	0	0	0	47	391
SLCO4C1	353189	broad.mit.edu	37	5	101576431	101576431	+	Nonsense_Mutation	SNP	G	G	A	rs202120876		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr5:101576431G>A	ENST00000310954.6	-	11	2153	c.1867C>T	c.(1867-1869)Cga>Tga	p.R623*		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		CCTAATAATCGAAGGACCATA	0.323																																						ENST00000310954.6	1.000000	0.990000	1	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				50						c.(1867-1869)Cga>Tga		solute carrier organic anion transporter family, member 4C1		G	stop/ARG	0,4406		0,0,2203	131.0	139.0	136.0		1867	6.0	1.0	5		136	1,8597	1.2+/-3.3	0,1,4298	yes	stop-gained	SLCO4C1	NM_180991.4		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		623/725	101576431	1,13003	2203	4299	6502	SO:0001587	stop_gained	353189	6	121404	43				g.chr5:101576431G>A	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1867C>T	chr5.hg19:g.101576431G>A	ENSP00000309741:p.Arg623*	0						p.R623*	NM_180991.4	NP_851322.3	0	1	1	2.007109				11	2153	-		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Nonsense_Mutation	SNP	ENST00000310954.6	0	1	hg19	c.1867C>T	CCDS34205.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.187990	0.98696	0.0	1.16E-4	ENSG00000173930	ENST00000310954	.	.	.	5.96	5.96	0.96718	5.96	5.96	0.96718	.	0.000000	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9858	0.92769	0.0:0.0:1.0:0.0	.	.	.	.	X	623	.	ENSP00000309741:R623X	R	-	1	2	2	SLCO4C1	101604330	101604330	1.000000	0.71417	0.998000	0.56505	0.488000	0.33401	4.086000	0.57664	2.832000	0.97577	0.655000	0.94253	CGA	0.153908		TCGA-HZ-7926-01A-11D-2154-08	0.323	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	0	0	1	2	2	2	2	0	0	0	0	118	118	118	116	1	1.880000	-20.000000	1	0.160000	NM_180991		0	84	82	0	588	576	1		1	0		0	0	118	0	0	1.000000	8.910057e-01	0	0	0	29	0	84	588
SLCO6A1	133482	broad.mit.edu	37	5	101834438	101834438	+	Silent	SNP	T	T	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr5:101834438T>G	ENST00000506729.1	-	1	282	c.111A>C	c.(109-111)ggA>ggC	p.G37G	RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000513675.1_Silent_p.G37G|SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000379807.3_Silent_p.G37G|SLCO6A1_ENST00000389019.3_Silent_p.G37G|SLCO6A1_ENST00000379810.1_Silent_p.G37G			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ACTTCGGGGTTCCCTTGGCCC	0.602																																						ENST00000506729.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999994	0.990000	1.000000																										0				60						c.(109-111)ggA>ggC		solute carrier organic anion transporter family, member 6A1							111.0	126.0	121.0					5																	101834438		2203	4300	6503	SO:0001819	synonymous_variant	133482	0	0					g.chr5:101834438T>G	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.111A>C	chr5.hg19:g.101834438T>G		0					SLCO6A1_ENST00000379807.3_Silent_p.G37G|RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000379810.1_Silent_p.G37G|SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000513675.1_Silent_p.G37G|SLCO6A1_ENST00000389019.3_Silent_p.G37G	p.G37G			0	1	1	2.007109	Q86UG4	SO6A1_HUMAN		1	282	-		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	1	1	hg19	c.111A>C	CCDS34206.1	1																																																																																								0.153908		TCGA-HZ-7926-01A-11D-2154-08	0.602	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	1	0	1	2	2	2	2	0	0	0	0	178	178	178	175	1	1.880000	-20.000000	1	0.160000	NM_173488		0	125	122	0	1012	1000	1		1			0	0	178	0	0	1.000000	0	0	0	0	0	0	125	1012
CDH10	1008	broad.mit.edu	37	5	24535262	24535262	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr5:24535262G>A	ENST00000264463.4	-	5	1280	c.773C>T	c.(772-774)aCg>aTg	p.T258M		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	258	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		ATCTGTCAGCGTGATGTTCAC	0.483										HNSCC(23;0.051)																												ENST00000264463.4	0.980000	0.390000	8.200000e-01	5.100000e-01	0.650000	0.671584	0.650000	1.000000																										0				185						c.(772-774)aCg>aTg		cadherin 10, type 2 (T2-cadherin)							199.0	158.0	172.0					5																	24535262		2203	4300	6503	SO:0001583	missense	1008	1	121406	36				g.chr5:24535262G>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.773C>T	chr5.hg19:g.24535262G>A	ENSP00000264463:p.Thr258Met	0	HNSCC(23;0.051)					p.T258M	NM_006727.3	NP_006718.2	0	1	1	2.007109	Q9Y6N8	CAD10_HUMAN		5	1280	-			Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	1	1	hg19	c.773C>T	CCDS3892.1	0	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319154	0.60524	.	.	ENSG00000040731	ENST00000264463	T	0.03004	4.08	5.67	5.67	0.87782	5.67	5.67	0.87782	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.14917	0.0360	L	0.52011	1.625	0.46478	D	0.99906	D	0.89917	1.0	D	0.71184	0.972	T	0.00062	-1.2157	10	0.66056	D	0.02	.	18.738	0.91763	0.0:0.0:1.0:0.0	.	258	Q9Y6N8	CAD10_HUMAN	M	258	ENSP00000264463:T258M	ENSP00000264463:T258M	T	-	2	0	0	CDH10	24571019	24571019	1.000000	0.71417	0.996000	0.52242	0.246000	0.25737	7.884000	0.87274	2.674000	0.91012	0.591000	0.81541	ACG	0.153908		TCGA-HZ-7926-01A-11D-2154-08	0.483	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.880000	-3.317686	1	0.160000	NM_006727		0	17	17	0	307	303	0		1			0	0	54	0	0	0.999965	0	0	0	0	0	0	17	307
DDX4	54514	broad.mit.edu	37	5	55059848	55059848	+	Nonsense_Mutation	SNP	C	C	G			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr5:55059848C>G	ENST00000505374.1	+	6	382	c.290C>G	c.(289-291)tCa>tGa	p.S97*	DDX4_ENST00000514278.2_Nonsense_Mutation_p.S97*|DDX4_ENST00000511853.1_5'Flank|SLC38A9_ENST00000504880.1_Intron|DDX4_ENST00000354991.5_Nonsense_Mutation_p.S97*|DDX4_ENST00000508580.1_3'UTR|DDX4_ENST00000353507.5_Nonsense_Mutation_p.S97*	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	97	Gly-rich.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				ATAGGTTTTTCAAACAGCAGG	0.318																																						ENST00000505374.1	0.710000	0.260000	5.900000e-01	3.400000e-01	0.450000	0.472941	0.450000	0.440000																										0				24						c.(289-291)tCa>tGa		DEAD (Asp-Glu-Ala-Asp) box polypeptide 4							131.0	134.0	133.0					5																	55059848		2203	4300	6503	SO:0001587	stop_gained	54514	0	0					g.chr5:55059848C>G	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.290C>G	chr5.hg19:g.55059848C>G	ENSP00000424838:p.Ser97*	0					DDX4_ENST00000514278.2_Nonsense_Mutation_p.S97*|DDX4_ENST00000508580.1_3'UTR|DDX4_ENST00000353507.5_Nonsense_Mutation_p.S97*|SLC38A9_ENST00000504880.1_Intron|DDX4_ENST00000511853.1_5'Flank|DDX4_ENST00000354991.5_Nonsense_Mutation_p.S97*	p.S97*	NM_024415.2	NP_077726.1	0	1	1	2.007109	Q9NQI0	DDX4_HUMAN		6	382	+		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Nonsense_Mutation	SNP	ENST00000505374.1	0	1	hg19	c.290C>G	CCDS3969.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.473344	0.96274	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000515709;ENST00000506848;ENST00000514679;ENST00000354991;ENST00000511491	.	.	.	4.82	2.93	0.34026	4.82	2.93	0.34026	.	1.124900	0.06856	N	0.798125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-22.8246	5.4174	0.16382	0.0:0.7133:0.0:0.2867	.	.	.	.	X	97;97;97;97;71;97;97;97;97	.	ENSP00000334167:S97X	S	+	2	0	0	DDX4	55095605	55095605	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.097000	0.30988	0.534000	0.28695	0.591000	0.81541	TCA	0.153908		TCGA-HZ-7926-01A-11D-2154-08	0.318	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	0	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.880000	-3.339229	1	0.160000	NM_024415		0	14	14	0	372	367	0		1		0	0	0	48	0	0	0.999743	0	0	0	0	0	1	14	372
VCAN	1462	broad.mit.edu	37	5	82835841	82835841	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr5:82835841G>A	ENST00000265077.3	+	8	7584	c.7019G>A	c.(7018-7020)gGa>gAa	p.G2340E	VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.G1353E|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2340	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGTGACACTGGAGCAGAAGGA	0.468																																						ENST00000265077.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999521	0.990000	1.000000																										0				190						c.(7018-7020)gGa>gAa		versican	Hyaluronan(DB08818)						94.0	89.0	90.0					5																	82835841		2203	4300	6503	SO:0001583	missense	1462	0	0					g.chr5:82835841G>A	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7019G>A	chr5.hg19:g.82835841G>A	ENSP00000265077:p.Gly2340Glu	0					VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.G1353E|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron	p.G2340E	NM_004385.4	NP_004376.2	0	1	1	2.007109	P13611	CSPG2_HUMAN		8	7584	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	1	1	hg19	c.7019G>A	CCDS4060.1	1	.	.	.	.	.	.	.	.	.	.	G	4.418	0.077349	0.08485	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.13089	2.62;2.62	6.07	2.27	0.28462	6.07	2.27	0.28462	.	0.514767	0.19096	N	0.122838	T	0.12050	0.0293	L	0.38175	1.15	0.09310	N	1	P;B	0.40515	0.719;0.1	B;B	0.44085	0.44;0.036	T	0.16748	-1.0392	10	0.24483	T	0.36	.	7.4303	0.27124	0.1416:0.2539:0.6045:0.0	.	1353;2340	P13611-2;P13611	.;CSPG2_HUMAN	E	2340;1353	ENSP00000265077:G2340E;ENSP00000340062:G1353E	ENSP00000265077:G2340E	G	+	2	0	0	VCAN	82871597	82871597	0.033000	0.19621	0.000000	0.03702	0.040000	0.13550	0.946000	0.29069	0.445000	0.26639	0.650000	0.86243	GGA	0.153908		TCGA-HZ-7926-01A-11D-2154-08	0.468	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	1	0	1	2	2	2	2	0	0	0	0	73	73	73	72	1	1.880000	-20.000000	1	0.160000	NM_004385		0	48	49	0	376	371	0		1	1		0	0	73	0	0	1.000000	1	0	53	0	236	0	48	376
PCDHB3	56132	broad.mit.edu	37	5	140482066	140482066	+	Silent	SNP	G	G	A			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr5:140482066G>A	ENST00000231130.2	+	1	1833	c.1833G>A	c.(1831-1833)gaG>gaA	p.E611E	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	611	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E611D(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCCACGGAGCCCGGGCTGT	0.706																																						ENST00000231130.2	0.760000	0.360000	6.600000e-01	4.400000e-01	0.540000	0.558853	0.540000	0.540000																										1	Substitution - Missense(1)	p.E611D(1)	lung(1)	72						c.(1831-1833)gaG>gaA		protocadherin beta 3							20.0	22.0	21.0					5																	140482066		1965	3899	5864	SO:0001819	synonymous_variant	56132	4	117574	35				g.chr5:140482066G>A	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1833G>A	chr5.hg19:g.140482066G>A		0					AC005754.7_ENST00000607216.1_RNA	p.E611E	NM_018937.2	NP_061760.1	0	1	1	2.007109	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1833	+			B2R8P2	Silent	SNP	ENST00000231130.2	1	1	hg19	c.1833G>A	CCDS4245.1	0																																																																																								0.153908		TCGA-HZ-7926-01A-11D-2154-08	0.706	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	0	0	0	2	2	2	2	0	0	0	0	106	106	106	149	1	1.880000	-4.954673	1	0.160000	NM_018937		0	26	14	0	566	350	0		1			0	0	106	0	0	0.999978	0	0	0	0	0	0	26	566
CUL9	23113	broad.mit.edu	37	6	43155033	43155033	+	Silent	SNP	G	G	A	rs148427416		TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr6:43155033G>A	ENST00000252050.4	+	6	1521	c.1437G>A	c.(1435-1437)ccG>ccA	p.P479P	CUL9_ENST00000372647.2_Silent_p.P479P|CUL9_ENST00000354495.3_Intron	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	479					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ACCCTTTGCCGTACCTCCAGC	0.532																																						ENST00000252050.4	0.890000	0.490000	7.900000e-01	5.800000e-01	0.670000	0.689762	0.670000	0.670000																										0				92						c.(1435-1437)ccG>ccA		cullin 9		G		0,4406		0,0,2203	163.0	155.0	157.0		1437	-2.6	1.0	6	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CUL9	NM_015089.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		479/2518	43155033	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23113	2	121412	30				g.chr6:43155033G>A	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1437G>A	chr6.hg19:g.43155033G>A		0					CUL9_ENST00000354495.3_Intron|CUL9_ENST00000372647.2_Silent_p.P479P	p.P479P	NM_015089.2	NP_055904.1	0	0	0	1.963456	Q8IWT3	CUL9_HUMAN		6	1521	+			O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	1	1	hg19	c.1437G>A	CCDS4890.1	0																																																																																								0.132231		TCGA-HZ-7926-01A-11D-2154-08	0.532	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	1	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	1.880000	-6.279674	1	0.160000	NM_015089		0	41	41	0	687	678	0		1	0		0	0	132	0	0	1.000000	1.300348e-01	0	0	0	11	0	41	687
PRDM13	59336	broad.mit.edu	37	6	100061823	100061823	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr6:100061823C>T	ENST00000369215.4	+	4	1617	c.1312C>T	c.(1312-1314)Ccc>Tcc	p.P438S		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	438					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CGCGCTGCCGCCCCTCGACCC	0.731																																						ENST00000369215.4	1.000000	0.530000	1	7.100000e-01	0.920000	0.878961	0.920000	1.000000																										0				17						c.(1312-1314)Ccc>Tcc		PR domain containing 13							13.0	16.0	15.0					6																	100061823		1673	3640	5313	SO:0001583	missense	59336	0	0					g.chr6:100061823C>T	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.1312C>T	chr6.hg19:g.100061823C>T	ENSP00000358217:p.Pro438Ser	0						p.P438S	NM_021620.3	NP_067633.2	0	0	0	1.963456	Q9H4Q3	PRD13_HUMAN		4	1617	+		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)	Q5TGC1|Q5TGC2	Missense_Mutation	SNP	ENST00000369215.4	1	1	hg19	c.1312C>T	CCDS43487.1	1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.237088	0.22711	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	T;T	0.05717	3.4;3.4	3.59	0.61	0.17580	3.59	0.61	0.17580	.	0.394677	0.18533	N	0.138435	T	0.01730	0.0055	L	0.29908	0.895	0.32681	N	0.515456	B	0.20052	0.041	B	0.21917	0.037	T	0.44298	-0.9337	10	0.22109	T	0.4	-3.4988	13.5999	0.62013	0.0:0.6342:0.3658:0.0	.	438	Q9H4Q3	PRD13_HUMAN	S	438;448	ENSP00000358217:P438S;ENSP00000358216:P448S	ENSP00000358216:P448S	P	+	1	0	0	PRDM13	100168544	100168544	0.056000	0.20664	0.437000	0.26809	0.095000	0.18619	1.172000	0.31908	-0.104000	0.12154	0.561000	0.74099	CCC	0.132231		TCGA-HZ-7926-01A-11D-2154-08	0.731	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2	1	0	1	2	2	2	2	0	0	0	0	32	32	32	31	1	1.880000	-18.208850	1	0.160000			0	13	13	0	155	152	0		1			0	0	32	0	0	0.999551	0	0	0	0	0	0	13	155
ASTN2	23245	broad.mit.edu	37	9	119903693	119903693	+	Silent	SNP	G	G	A	rs115011238	byFrequency	TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chr9:119903693G>A	ENST00000313400.4	-	4	1180	c.1080C>T	c.(1078-1080)cgC>cgT	p.R360R	ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000373996.3_Silent_p.R360R|ASTN2_ENST00000361477.3_Intron			O75129	ASTN2_HUMAN	astrotactin 2	360					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GCGTGTTAGCGCGGAAACTCT	0.587													G|||	7	0.00139776	0.0053	0.0	5008	,	,		20221	0.0		0.0	False		,,,				2504	0.0					ENST00000313400.4	1.000000	0.530000	1	6.700000e-01	0.840000	0.839046	0.840000	1.000000																										0				102						c.(1078-1080)cgC>cgT		astrotactin 2		G		16,4390	22.3+/-47.3	0,16,2187	103.0	85.0	91.0			-8.2	0.7	9	dbSNP_132	91	0,8600		0,0,4300	no	intron	ASTN2	NM_014010.4		0,16,6487	AA,AG,GG		0.0,0.3631,0.123			119903693	16,12990	2203	4300	6503	SO:0001819	synonymous_variant	23245	41	121408	48				g.chr9:119903693G>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1080C>T	chr9.hg19:g.119903693G>A		0					ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000373996.3_Silent_p.R360R|ASTN2_ENST00000361477.3_Intron	p.R360R			0	1	1	2.012137	O75129	ASTN2_HUMAN		4	1180	-			A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	1	1	hg19	c.1080C>T		0																																																																																								0.155270		TCGA-HZ-7926-01A-11D-2154-08	0.587	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.880000	-12.608130	1	0.160000	NM_014010		0	19	19	0	260	255	0		1			0	0	69	0	0	0.999991	0	0	0	0	0	0	19	260
SHROOM2	357	broad.mit.edu	37	X	9907312	9907312	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-7926-01A-11D-2154-08	TCGA-HZ-7926-10A-01D-2154-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	52a320eb-4f2e-435f-911d-75790f855b96	65e65329-48f3-452a-aa5c-f9c26692b9f4	g.chrX:9907312C>T	ENST00000380913.3	+	8	4307	c.4217C>T	c.(4216-4218)gCg>gTg	p.A1406V	SHROOM2_ENST00000418909.2_Missense_Mutation_p.A241V	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1406	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GCCCCCAAGGCGGAGCTGCTG	0.597																																						ENST00000380913.3	0.980000	0.390000	9.000000e-01	5.500000e-01	0.740000	0.733505	0.740000	0.780000																										0				57						c.(4216-4218)gCg>gTg		shroom family member 2							58.0	43.0	48.0					X																	9907312		2203	4300	6503	SO:0001583	missense	357	0	0					g.chrX:9907312C>T	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.4217C>T	chrX.hg19:g.9907312C>T	ENSP00000370299:p.Ala1406Val						SHROOM2_ENST00000418909.2_Missense_Mutation_p.A241V	p.A1406V	NM_001649.2	NP_001640.1	0	1	1		Q13796	SHRM2_HUMAN		8	4307	+		Hepatocellular(5;0.000888)	B9EIQ7	Missense_Mutation	SNP	ENST00000380913.3	0	1	hg19	c.4217C>T	CCDS14135.1	0	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166693	0.78339	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.37235	1.21;1.21;1.21	5.44	5.44	0.79542	5.44	5.44	0.79542	Apx/shroom, ASD2 (2);	0.058670	0.64402	N	0.000002	T	0.39733	0.1089	L	0.52206	1.635	0.58432	D	0.999999	B;B	0.33755	0.424;0.194	B;B	0.35727	0.209;0.041	T	0.35500	-0.9786	10	0.72032	D	0.01	-12.7128	18.4668	0.90758	0.0:1.0:0.0:0.0	.	241;1406	Q68DU3;Q13796	.;SHRM2_HUMAN	V	1406;241;241;241	ENSP00000370299:A1406V;ENSP00000415229:A241V;ENSP00000406724:A241V	ENSP00000370299:A1406V	A	+	2	0	0	SHROOM2	9867312	9867312	1.000000	0.71417	0.928000	0.36995	0.789000	0.44602	7.339000	0.79282	2.301000	0.77427	0.596000	0.82720	GCG	0.160000		TCGA-HZ-7926-01A-11D-2154-08	0.597	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	1.880000	-16.075190	1	0.160000	NM_001649		0	9	9	0	59	58	1		1	1		0	0	14	0	0	0.994946	5.540650e-01	0	5	0	8	0	9	59
