#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
COPS7B	64708	broad.mit.edu	37	2	232672287	232672288	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr2:232672287_232672288insA	ENST00000350033.3	+	7	868_869	c.727_728insA	c.(727-729)cacfs	p.H243fs	COPS7B_ENST00000409295.1_Frame_Shift_Ins_p.H209fs|COPS7B_ENST00000373608.3_Frame_Shift_Ins_p.T261fs|COPS7B_ENST00000409091.1_Frame_Shift_Ins_p.H136fs|RP11-690I21.2_ENST00000563949.1_RNA|COPS7B_ENST00000410024.1_Frame_Shift_Ins_p.H243fs|COPS7B_ENST00000410017.1_Frame_Shift_Ins_p.T266fs	NM_001282949.1|NM_022730.1	NP_001269878.1|NP_073567.1	Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B	243					cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTGTCCCCCTCACGCTGAGCAG	0.614																																						ENST00000350033.3	1.000000	0.600000	1	8.500000e-01	0.990000	0.945801	0.990000	1.000000																										0				8						c.(727-729)cacfs		COP9 signalosome subunit 7B																																				SO:0001589	frameshift_variant	64708	0	0					g.chr2:232672287_232672288insA	AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000350033.3:c.728dupA	chr2.hg19:g.232672288_232672288dupA	ENSP00000272995:p.His243fs	0					COPS7B_ENST00000409091.1_Frame_Shift_Ins_p.H136fs|COPS7B_ENST00000373608.3_Frame_Shift_Ins_p.T261fs|COPS7B_ENST00000409295.1_Frame_Shift_Ins_p.H209fs|COPS7B_ENST00000410024.1_Frame_Shift_Ins_p.H243fs|RP11-690I21.2_ENST00000563949.1_RNA|COPS7B_ENST00000410017.1_Frame_Shift_Ins_p.T266fs	p.H243fs	NM_001282949.1|NM_022730.1	NP_001269878.1|NP_073567.1	0	1	1	2.007643	Q9H9Q2	CSN7B_HUMAN		7	868_869	+		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)	Q53S22|Q5BJG3|Q9H7V6	Frame_Shift_Ins	INS	ENST00000350033.3	0	1	hg19	c.727_728insA	CCDS2488.1	1																																																																																								0.145514		TCGA-HZ-8001-01A-11D-2201-08	0.614	COPS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256964.2	1	0	1		2	2		0	0	0	0	19	0	19	20	1	1.920000	-15.830590	1	0.150000	NM_022730		0	10	13	0	104	106	0	0	1	0	0	0	0	19	0	0	0.997849	9.885156e-01	0	0	0	84	0	10	104
MTUS1	57509	broad.mit.edu	37	8	17612188	17612192	+	Frame_Shift_Del	DEL	TGTCT	TGTCT	-	rs377257691		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr8:17612188_17612192delTGTCT	ENST00000262102.6	-	2	1349_1353	c.1125_1129delAGACA	c.(1123-1131)gaagacacafs	p.EDT375fs	MTUS1_ENST00000381862.3_Frame_Shift_Del_p.EDT375fs|MTUS1_ENST00000519263.1_Frame_Shift_Del_p.EDT375fs|MTUS1_ENST00000381869.3_Frame_Shift_Del_p.EDT375fs	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	375					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		ACCATTTGTGTGTCTTCAGTCTCAG	0.444																																						ENST00000262102.6	1.000000	0.450000	1	5.900000e-01	0.770000	0.782545	0.770000	1.000000																										0				36						c.(1123-1131)gaagacacafs		microtubule associated tumor suppressor 1																																				SO:0001589	frameshift_variant	57509	0	0					g.chr8:17612188_17612192delTGTCT	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.1125_1129delAGACA	chr8.hg19:g.17612188_17612192delTGTCT	ENSP00000262102:p.Glu375fs	0					MTUS1_ENST00000519263.1_Frame_Shift_Del_p.EDT375fs|MTUS1_ENST00000381862.3_Frame_Shift_Del_p.EDT375fs|MTUS1_ENST00000381869.3_Frame_Shift_Del_p.EDT375fs	p.EDT375fs	NM_001001924.2	NP_001001924.1	1	2	3	2.045816	Q9ULD2	MTUS1_HUMAN		2	1349_1353	-			A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Frame_Shift_Del	DEL	ENST00000262102.6	0	1	hg19	c.1125_1129delAGACA	CCDS43717.1	0																																																																																								0.160701		TCGA-HZ-8001-01A-11D-2201-08	0.444	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	1	0	1		22	2		0	0	0	2	61	0	61	63	1	1.920000	-18.354210	1	0.150000	XM_372031		0	16	19	0	279	277	0	0	0	0	0	0	0	61	0	0	0.201038	1.903069e-02	0	0	0	4	0	16	279
COL13A1	1305	broad.mit.edu	37	10	71683572	71683572	+	Silent	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr10:71683572C>T	ENST00000398978.3	+	23	1704	c.1212C>T	c.(1210-1212)gtC>gtT	p.V404V	COL13A1_ENST00000520267.1_Silent_p.V347V|COL13A1_ENST00000398972.3_Silent_p.V404V|COL13A1_ENST00000398964.3_Silent_p.V375V|COL13A1_ENST00000398971.3_Silent_p.V404V|COL13A1_ENST00000398968.3_Silent_p.V385V|COL13A1_ENST00000398973.3_Silent_p.V404V|COL13A1_ENST00000520133.1_Silent_p.V353V|COL13A1_ENST00000356340.3_Silent_p.V404V|COL13A1_ENST00000398969.3_Silent_p.V347V|COL13A1_ENST00000398974.3_Silent_p.V392V|COL13A1_ENST00000354547.3_Silent_p.V382V|COL13A1_ENST00000398966.3_Silent_p.V382V|COL13A1_ENST00000357811.3_Silent_p.V382V|COL13A1_ENST00000522165.1_Silent_p.V385V|COL13A1_ENST00000517713.1_Silent_p.V382V	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						AAGCAGGTGTCGATGGCCAGG	0.592																																						ENST00000398978.3	1.000000	0.380000	1	5.800000e-01	0.830000	0.805576	0.830000	1.000000																										0				28						c.(1210-1212)gtC>gtT		collagen, type XIII, alpha 1							33.0	38.0	37.0					10																	71683572		2013	4188	6201	SO:0001819	synonymous_variant	1305	2	120912	21				g.chr10:71683572C>T	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1212C>T	chr10.hg19:g.71683572C>T		0					COL13A1_ENST00000398969.3_Silent_p.V347V|COL13A1_ENST00000357811.3_Silent_p.V382V|COL13A1_ENST00000520267.1_Silent_p.V347V|COL13A1_ENST00000398966.3_Silent_p.V382V|COL13A1_ENST00000398974.3_Silent_p.V392V|COL13A1_ENST00000398968.3_Silent_p.V385V|COL13A1_ENST00000354547.3_Silent_p.V382V|COL13A1_ENST00000522165.1_Silent_p.V385V|COL13A1_ENST00000398964.3_Silent_p.V375V|COL13A1_ENST00000398973.3_Silent_p.V404V|COL13A1_ENST00000398972.3_Silent_p.V404V|COL13A1_ENST00000398971.3_Silent_p.V404V|COL13A1_ENST00000517713.1_Silent_p.V382V|COL13A1_ENST00000356340.3_Silent_p.V404V|COL13A1_ENST00000520133.1_Silent_p.V353V	p.V404V	NM_001130103.1	NP_001123575.1	0	0	0	1.965170				23	1704	+				Silent	SNP	ENST00000398978.3	0	1	hg19	c.1212C>T	CCDS44419.1	0																																																																																								0.126413		TCGA-HZ-8001-01A-11D-2201-08	0.592	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.920000	-11.104030	1	0.150000	NM_005203		0	7	6	0	102	100	0		1	0		0	0	17	0	0	0.979820	4.396492e-01	0	0	0	20	0	7	102
ABCC8	6833	broad.mit.edu	37	11	17415843	17415843	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr11:17415843G>A	ENST00000389817.3	-	37	4583	c.4515C>T	c.(4513-4515)gaC>gaT	p.D1505D	ABCC8_ENST00000302539.4_Silent_p.D1506D			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1505	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CCGTGGCCTCGTCCATGATGA	0.577																																						ENST00000389817.3	1.000000	0.350000	7.400000e-01	4.400000e-01	0.550000	0.602299	0.550000	0.530000																										0				67						c.(4513-4515)gaC>gaT		ATP-binding cassette, sub-family C (CFTR/MRP), member 8	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)						74.0	72.0	73.0					11																	17415843		2200	4293	6493	SO:0001819	synonymous_variant	6833	5	121412	41				g.chr11:17415843G>A	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4515C>T	chr11.hg19:g.17415843G>A		0					ABCC8_ENST00000302539.4_Silent_p.D1506D	p.D1505D			1	2	3	2.041610	Q09428	ABCC8_HUMAN		37	4583	-			A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	ENST00000389817.3	1	1	hg19	c.4515C>T	CCDS31437.1	0																																																																																								0.159456		TCGA-HZ-8001-01A-11D-2201-08	0.577	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	0	0	1	2	2	2	2	0	0	0	0	104	104	104	103	1	1.920000	-4.356419	1	0.150000	NM_000352		0	24	23	0	583	577	0		1	0		0	0	104	0	0	1.000000	9.999999e-01	0	0	0	691	0	24	583
IRF7	3665	broad.mit.edu	37	11	613476	613476	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr11:613476C>T	ENST00000397574.2	-	9	1336	c.967G>A	c.(967-969)Gcc>Acc	p.A323T	IRF7_ENST00000397562.3_Missense_Mutation_p.A30T|IRF7_ENST00000330243.5_Missense_Mutation_p.A336T|IRF7_ENST00000525445.1_Missense_Mutation_p.A217T|IRF7_ENST00000348655.6_Missense_Mutation_p.A294T|IRF7_ENST00000397566.1_Missense_Mutation_p.A336T|IRF7_ENST00000397570.1_Missense_Mutation_p.A294T	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	323					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGTCTGTGGCCCGGACAGCT	0.672																																						ENST00000397574.2	1.000000	0.530000	1	6.400000e-01	0.780000	0.797124	0.780000	1.000000																										0				8						c.(967-969)Gcc>Acc		interferon regulatory factor 7							27.0	34.0	32.0					11																	613476		2200	4288	6488	SO:0001583	missense	3665	0	0					g.chr11:613476C>T	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.967G>A	chr11.hg19:g.613476C>T	ENSP00000380704:p.Ala323Thr	0					IRF7_ENST00000525445.1_Missense_Mutation_p.A217T|IRF7_ENST00000397570.1_Missense_Mutation_p.A294T|IRF7_ENST00000397562.3_Missense_Mutation_p.A30T|IRF7_ENST00000348655.6_Missense_Mutation_p.A294T|IRF7_ENST00000397566.1_Missense_Mutation_p.A336T|IRF7_ENST00000330243.5_Missense_Mutation_p.A336T	p.A323T	NM_001572.3	NP_001563.2	1	2	3	2.041610	Q92985	IRF7_HUMAN		9	1336	-		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Missense_Mutation	SNP	ENST00000397574.2	1	1	hg19	c.967G>A	CCDS7703.1	0	.	.	.	.	.	.	.	.	.	.	C	6.185	0.402214	0.11696	.	.	ENSG00000185507	ENST00000525445;ENST00000348655;ENST00000397570;ENST00000397566;ENST00000397574;ENST00000397562;ENST00000330243	T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5	3.84	-0.911	0.10507	3.84	-0.911	0.10507	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	1.324750	0.05437	N	0.547019	T	0.31482	0.0798	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.29955	0.263;0.029;0.248;0.208	B;B;B;B	0.31614	0.133;0.02;0.112;0.068	T	0.12218	-1.0556	10	0.16420	T	0.52	-2.4318	1.6157	0.02703	0.1576:0.3487:0.3081:0.1857	.	217;294;323;336	E9PSE3;Q92985-2;Q92985;Q92985-4	.;.;IRF7_HUMAN;.	T	217;294;294;336;323;30;336	ENSP00000434009:A217T;ENSP00000331803:A294T;ENSP00000380700:A294T;ENSP00000380697:A336T;ENSP00000380704:A323T;ENSP00000380693:A30T;ENSP00000329411:A336T	ENSP00000329411:A336T	A	-	1	0	0	IRF7	603476	603476	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	1.084000	0.30828	-0.269000	0.09298	0.561000	0.74099	GCC	0.159456		TCGA-HZ-8001-01A-11D-2201-08	0.672	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.920000	-3.318794	1	0.150000	NM_001572		0	30	30	0	503	492	0		1	1		0	0	96	0	0	1.000000	8.131308e-01	0	4	0	50	0	30	503
OR5L2	26338	broad.mit.edu	37	11	55595169	55595169	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr11:55595169C>A	ENST00000378397.1	+	1	475	c.475C>A	c.(475-477)Cac>Aac	p.H159N		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TTCTCTGATTCACTCGTCCTT	0.483										HNSCC(27;0.073)																												ENST00000378397.1	1.000000	0.890000	1	9.900000e-01	0.990000	0.991695	0.990000	1.000000																										0				59						c.(475-477)Cac>Aac		olfactory receptor, family 5, subfamily L, member 2							217.0	189.0	198.0					11																	55595169		2200	4296	6496	SO:0001583	missense	26338	0	0					g.chr11:55595169C>A	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.475C>A	chr11.hg19:g.55595169C>A	ENSP00000367650:p.His159Asn	0	HNSCC(27;0.073)					p.H159N	NM_001004739.1	NP_001004739.1	1	2	3	2.041610	Q8NGL0	OR5L2_HUMAN		1	475	+		all_epithelial(135;0.208)	Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	1	1	hg19	c.475C>A	CCDS31511.1	1	.	.	.	.	.	.	.	.	.	.	.	10.30	1.310982	0.23821	.	.	ENSG00000205030	ENST00000378397	T	0.00262	8.4	5.18	5.18	0.71444	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000039	T	0.00496	0.0016	M	0.68593	2.085	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56062	-0.8041	10	0.59425	D	0.04	-34.9027	12.8637	0.57928	0.163:0.837:0.0:0.0	.	159	Q8NGL0	OR5L2_HUMAN	N	159	ENSP00000367650:H159N	ENSP00000367650:H159N	H	+	1	0	0	OR5L2	55351745	55351745	0.000000	0.05858	0.124000	0.21820	0.008000	0.06430	0.901000	0.28445	2.613000	0.88420	0.626000	0.83405	CAC	0.159456		TCGA-HZ-8001-01A-11D-2201-08	0.483	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	0	0	1	2	20	2	2	1	1	1	1	202	202	202	200	1	1.920000	-19.893610	1	0.150000	NM_001004739		0	95	94	0	1074	1065	0		1			1	0	202	0	0	1.000000	0	0	0	0	0	0	95	1074
LHX5	64211	broad.mit.edu	37	12	113905137	113905137	+	Silent	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr12:113905137C>T	ENST00000261731.3	-	4	1338	c.765G>A	c.(763-765)ccG>ccA	p.P255P		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	255					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						GCATGCGCCGCGGACTCCGGA	0.657																																						ENST00000261731.3	1.000000	0.280000	1	5.000000e-01	0.800000	0.769019	0.800000	1.000000																										0				10						c.(763-765)ccG>ccA		LIM homeobox 5							16.0	17.0	16.0					12																	113905137		2198	4292	6490	SO:0001819	synonymous_variant	64211	0	0					g.chr12:113905137C>T	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.765G>A	chr12.hg19:g.113905137C>T		0						p.P255P	NM_022363.2	NP_071758.1	0	0	0	1.987763	Q9H2C1	LHX5_HUMAN		4	1338	-			Q32MA4	Silent	SNP	ENST00000261731.3	0	1	hg19	c.765G>A	CCDS9171.1	0																																																																																								0.135740		TCGA-HZ-8001-01A-11D-2201-08	0.657	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	0	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.920000	-8.450150	1	0.150000	NM_022363		0	4	4	0	63	59	0		1			0	0	19	0	0	0.877405	0	0	0	0	0	0	4	63
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.490000	1	6.900000e-01	0.940000	0.878741	0.940000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	0	0	1.987763	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.135740		TCGA-HZ-8001-01A-11D-2201-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.920000	-5.801681	1	0.150000	NM_033360		1063	10	10	6927	128	126	0	1	1	0	1	0	0	30	341	1	0.997007	3.540391e-02	9.999985e-01	1	30	3	393	10	128
CNPY2	10330	broad.mit.edu	37	12	56705037	56705037	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr12:56705037G>A	ENST00000273308.4	-	4	906	c.366C>T	c.(364-366)ggC>ggT	p.G122G	RP11-977G19.12_ENST00000546789.1_RNA|RP11-977G19.10_ENST00000549318.1_Silent_p.G122G|CNPY2_ENST00000551720.1_5'Flank|RP11-977G19.11_ENST00000549860.1_RNA|RP11-977G19.11_ENST00000549565.1_RNA	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	122	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						CGATTCGGATGCCTTGTAGGT	0.502																																						ENST00000273308.4	0.990000	0.630000	9.000000e-01	7.100000e-01	0.800000	0.810471	0.800000	0.800000																										0				4						c.(364-366)ggC>ggT		canopy FGF signaling regulator 2							240.0	224.0	230.0					12																	56705037		2203	4300	6503	SO:0001819	synonymous_variant	10330	0	0					g.chr12:56705037G>A	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.366C>T	chr12.hg19:g.56705037G>A		0					RP11-977G19.10_ENST00000549318.1_Silent_p.G122G|RP11-977G19.11_ENST00000549860.1_RNA|CNPY2_ENST00000551720.1_5'Flank|RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.12_ENST00000546789.1_RNA	p.G122G	NM_014255.5	NP_055070.1	0	0	0	1.987763	Q9Y2B0	CNPY2_HUMAN		4	906	-			B2R7B9|Q9UHE9	Silent	SNP	ENST00000273308.4	1	1	hg19	c.366C>T	CCDS8914.1	0																																																																																								0.135740		TCGA-HZ-8001-01A-11D-2201-08	0.502	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	1	0	1	2	2	2	2	0	0	0	0	199	199	199	198	1	1.920000	-10.675380	1	0.150000	NM_014255		0	71	71	0	1084	1069	0		1	1		0	0	199	0	0	1.000000	1	0	50	0	747	0	71	1084
DNAH10	196385	broad.mit.edu	37	12	124352474	124352474	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr12:124352474G>T	ENST00000409039.3	+	42	6998	c.6973G>T	c.(6973-6975)Gat>Tat	p.D2325Y		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2325					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAAGATGTTGGATGCGTTGCT	0.512																																						ENST00000409039.3	1.000000	0.360000	1	5.300000e-01	0.750000	0.755217	0.750000	1.000000																										0				52						c.(6973-6975)Gat>Tat		dynein, axonemal, heavy chain 10							76.0	76.0	76.0					12																	124352474		1948	4140	6088	SO:0001583	missense	196385	0	0					g.chr12:124352474G>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6973G>T	chr12.hg19:g.124352474G>T	ENSP00000386770:p.Asp2325Tyr	0						p.D2325Y	NM_207437.3	NP_997320.2	0	0	0	1.987763	Q8IVF4	DYH10_HUMAN		42	6998	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	1	1	hg19	c.6973G>T	CCDS9255.2	0	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797647	0.70567	.	.	ENSG00000197653	ENST00000409039	D	0.92595	-3.07	5.34	5.34	0.76211	5.34	5.34	0.76211	.	0.168199	0.39687	U	0.001293	D	0.96836	0.8967	M	0.91972	3.26	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	D	0.97569	1.0103	10	0.87932	D	0	.	19.0351	0.92974	0.0:0.0:1.0:0.0	.	2325	Q8IVF4	DYH10_HUMAN	Y	2325	ENSP00000386770:D2325Y	ENSP00000386770:D2325Y	D	+	1	0	0	DNAH10	122918427	122918427	1.000000	0.71417	0.963000	0.40424	0.510000	0.34073	7.974000	0.88039	2.495000	0.84180	0.467000	0.42956	GAT	0.135740		TCGA-HZ-8001-01A-11D-2201-08	0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.920000	-11.540010	1	0.150000			0	8	8	0	133	130	0		1			0	0	28	0	0	0.989108	0	0	0	0	0	0	8	133
SLC10A2	6555	broad.mit.edu	37	13	103718456	103718456	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr13:103718456G>A	ENST00000245312.3	-	1	740	c.144C>T	c.(142-144)tcC>tcT	p.S48S		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	48					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TGCATCCCATGGAGAACATCA	0.493																																						ENST00000245312.3	1.000000	0.350000	6.800000e-01	4.200000e-01	0.510000	0.574602	0.510000	0.500000																										0				34						c.(142-144)tcC>tcT		solute carrier family 10 (sodium/bile acid cotransporter), member 2	Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)						198.0	188.0	191.0					13																	103718456		2203	4300	6503	SO:0001819	synonymous_variant	6555	0	0					g.chr13:103718456G>A	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.144C>T	chr13.hg19:g.103718456G>A		0						p.S48S	NM_000452.2	NP_000443	1	2	3	2.043056	Q12908	NTCP2_HUMAN		1	740	-	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		A1L4F4|Q13839	Silent	SNP	ENST00000245312.3	1	1	hg19	c.144C>T	CCDS9506.1	0																																																																																								0.160079		TCGA-HZ-8001-01A-11D-2201-08	0.493	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	131	1	1.920000	-2.817278	1	0.150000			0	32	32	0	828	820	0		1			0	0	131	0	0	1.000000	0	0	0	0	0	0	32	828
MDGA2	161357	broad.mit.edu	37	14	47343307	47343307	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr14:47343307C>T	ENST00000399232.2	-	13	2691	c.2327G>A	c.(2326-2328)aGa>aAa	p.R776K	MDGA2_ENST00000357362.3_Missense_Mutation_p.R547K|MDGA2_ENST00000426342.1_Missense_Mutation_p.R547K|MDGA2_ENST00000439988.3_Missense_Mutation_p.R845K|MDGA2_ENST00000399222.3_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	776	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTTTGTATTTCTTGTTGCTGT	0.373																																						ENST00000399232.2	1.000000	0.360000	7.800000e-01	4.500000e-01	0.570000	0.620421	0.570000	0.550000																										0				76						c.(2326-2328)aGa>aAa		MAM domain containing glycosylphosphatidylinositol anchor 2							172.0	163.0	166.0					14																	47343307		1844	4098	5942	SO:0001583	missense	161357	0	0					g.chr14:47343307C>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2327G>A	chr14.hg19:g.47343307C>T	ENSP00000382178:p.Arg776Lys	0					MDGA2_ENST00000357362.3_Missense_Mutation_p.R547K|MDGA2_ENST00000399222.3_5'UTR|MDGA2_ENST00000426342.1_Missense_Mutation_p.R547K|MDGA2_ENST00000439988.3_Missense_Mutation_p.R845K	p.R776K	NM_001113498.2	NP_001106970.3	1	2	3	2.043118	Q7Z553	MDGA2_HUMAN		13	2691	-			F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	1	1	hg19	c.2327G>A		0	.	.	.	.	.	.	.	.	.	.	C	29.8	5.041051	0.93685	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.02032	4.49;4.49;4.49;4.49	5.37	5.37	0.77165	5.37	5.37	0.77165	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.50627	U	0.000107	T	0.07863	0.0197	L	0.52011	1.625	0.80722	D	1	P;P	0.44877	0.845;0.804	P;P	0.55222	0.458;0.771	T	0.17653	-1.0362	10	0.44086	T	0.13	.	17.6763	0.88232	0.0:1.0:0.0:0.0	.	547;776	F6W3S7;Q7Z553	.;MDGA2_HUMAN	K	776;547;845;547	ENSP00000400011:R776K;ENSP00000405456:R547K;ENSP00000382178:R845K;ENSP00000349925:R547K	ENSP00000349925:R547K	R	-	2	0	0	MDGA2	46413057	46413057	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.501000	0.84356	0.467000	0.42956	AGA	0.160079		TCGA-HZ-8001-01A-11D-2201-08	0.373	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	0	0	1	2	2	2	2	0	0	0	0	71	71	71	71	1	1.920000	-4.065207	1	0.150000	NM_182830		0	23	23	0	542	535	0		1			0	0	71	0	0	0.999999	0	0	0	0	0	0	23	542
BTBD6	90135	broad.mit.edu	37	14	105716868	105716868	+	Silent	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr14:105716868C>T	ENST00000392554.3	+	4	1614	c.1317C>T	c.(1315-1317)agC>agT	p.S439S	BTBD6_ENST00000463376.2_Silent_p.S364S|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000546474.1_Intron|BTBD6_ENST00000327471.3_Silent_p.S364S|BRF1_ENST00000446501.2_5'Flank|BRF1_ENST00000440513.3_Intron|BTBD6_ENST00000536364.1_Silent_p.S439S|BRF1_ENST00000327359.3_Intron			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	439						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		TGGACGGCAGCGAACTCAGCT	0.592																																						ENST00000392554.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.998672	0.990000	1.000000																										0				4						c.(1315-1317)agC>agT		BTB (POZ) domain containing 6							95.0	85.0	88.0					14																	105716868		2203	4300	6503	SO:0001819	synonymous_variant	90135	0	0					g.chr14:105716868C>T	AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.1317C>T	chr14.hg19:g.105716868C>T		0					BRF1_ENST00000440513.3_Intron|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000327359.3_Intron|BRF1_ENST00000546474.1_Intron|BTBD6_ENST00000327471.3_Silent_p.S364S|BRF1_ENST00000446501.2_5'Flank|BTBD6_ENST00000463376.2_Silent_p.S364S|BTBD6_ENST00000536364.1_Silent_p.S439S	p.S439S			1	2	3	2.043118	Q96KE9	BTBD6_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	4	1614	+		Melanoma(154;0.226)	Q8IVQ7|Q9BR94	Silent	SNP	ENST00000392554.3	1	1	hg19	c.1317C>T	CCDS10002.2	1																																																																																								0.160079		TCGA-HZ-8001-01A-11D-2201-08	0.592	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074556.4	0	0	1	2	22	12	2	1	1	1	1	100	100	100	100	1	1.920000	-3.142702	1	0.150000			0	64	62	0	622	610	0		1	0		1	0	100	0	0	0.999999	9.995860e-01	0	0	0	313	0	64	622
CASC5	57082	broad.mit.edu	37	15	40898600	40898600	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr15:40898600C>G	ENST00000346991.5	+	4	475	c.85C>G	c.(85-87)Ccc>Gcc	p.P29A	CASC5_ENST00000399668.2_Missense_Mutation_p.P29A|CASC5_ENST00000527044.1_Missense_Mutation_p.P29A|snoU13_ENST00000459027.1_RNA			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	29	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		GATATTGAAACCCCCAAGGAG	0.318																																						ENST00000346991.5	0.730000	0.190000	5.700000e-01	2.900000e-01	0.410000	0.437015	0.410000	0.400000																										0				57						c.(85-87)Ccc>Gcc		cancer susceptibility candidate 5							62.0	61.0	61.0					15																	40898600		1795	4056	5851	SO:0001583	missense	57082	0	0					g.chr15:40898600C>G	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.85C>G	chr15.hg19:g.40898600C>G	ENSP00000335463:p.Pro29Ala	0					CASC5_ENST00000527044.1_Missense_Mutation_p.P29A|CASC5_ENST00000399668.2_Missense_Mutation_p.P29A|snoU13_ENST00000459027.1_RNA	p.P29A			0	0	0	1.958945	Q8NG31	CASC5_HUMAN		4	475	+		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	1	1	hg19	c.85C>G	CCDS42023.1	0	.	.	.	.	.	.	.	.	.	.	C	12.01	1.810592	0.32053	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000527044;ENST00000399668	T;T;T	0.22945	1.93;1.93;1.93	4.53	4.53	0.55603	4.53	4.53	0.55603	.	0.240709	0.28241	N	0.016077	T	0.33498	0.0865	L	0.42245	1.32	0.27413	N	0.954519	D;D;D	0.60160	0.987;0.987;0.987	P;P;P	0.60236	0.871;0.871;0.871	T	0.08106	-1.0738	10	0.17369	T	0.5	.	10.6218	0.45484	0.0:0.8052:0.1948:0.0	.	29;29;29	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	A	29	ENSP00000335463:P29A;ENSP00000432654:P29A;ENSP00000382576:P29A	ENSP00000260369:P29A	P	+	1	0	0	CASC5	38685892	38685892	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	2.404000	0.44539	2.362000	0.80069	0.467000	0.42956	CCC	0.123711		TCGA-HZ-8001-01A-11D-2201-08	0.318	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	0	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.920000	-3.199974	1	0.150000	NM_144508		0	8	8	0	249	245	0		1			0	0	43	0	0	0.988998	0	0	0	0	0	0	8	249
HS3ST2	9956	broad.mit.edu	37	16	22926868	22926868	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr16:22926868C>A	ENST00000261374.3	+	2	1523	c.1089C>A	c.(1087-1089)gaC>gaA	p.D363E		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	363					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		TTGGGCAGGACTTCAGGTGGG	0.463																																						ENST00000261374.3	1.000000	0.320000	6.900000e-01	4.100000e-01	0.510000	0.569752	0.510000	0.500000																										0				19						c.(1087-1089)gaC>gaA		heparan sulfate (glucosamine) 3-O-sulfotransferase 2							91.0	102.0	98.0					16																	22926868		2195	4300	6495	SO:0001583	missense	9956	0	0					g.chr16:22926868C>A	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.1089C>A	chr16.hg19:g.22926868C>A	ENSP00000261374:p.Asp363Glu	0						p.D363E	NM_006043.1	NP_006034.1	1	2	3	2.039274	Q9Y278	HS3S2_HUMAN		2	1523	+			Q52LZ1	Missense_Mutation	SNP	ENST00000261374.3	1	1	hg19	c.1089C>A	CCDS10606.1	0	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101853	0.56183	.	.	ENSG00000122254	ENST00000261374	T	0.48522	0.81	5.11	3.15	0.36227	5.11	3.15	0.36227	.	0.049322	0.85682	D	0.000000	T	0.47284	0.1437	M	0.66297	2.02	0.58432	D	0.999999	P	0.39748	0.686	B	0.41764	0.366	T	0.49000	-0.8984	10	0.49607	T	0.09	.	9.9236	0.41478	0.0:0.8365:0.0:0.1635	.	363	Q9Y278	HS3S2_HUMAN	E	363	ENSP00000261374:D363E	ENSP00000261374:D363E	D	+	3	2	2	HS3ST2	22834369	22834369	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.179000	0.42528	1.149000	0.42402	0.561000	0.74099	GAC	0.159456		TCGA-HZ-8001-01A-11D-2201-08	0.463	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	1.920000	-19.911270	1	0.150000	NM_006043		0	23	23	0	602	592	0		1	0		0	0	115	0	0	0.999999	7.569960e-01	0	0	0	73	0	23	602
SNX20	124460	broad.mit.edu	37	16	50711341	50711341	+	Missense_Mutation	SNP	C	C	T	rs34428900	byFrequency	TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr16:50711341C>T	ENST00000330943.4	-	2	268	c.97G>A	c.(97-99)Gac>Aac	p.D33N	SNX20_ENST00000423026.2_Missense_Mutation_p.D33N|SNX20_ENST00000300590.3_Missense_Mutation_p.D33N	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	33					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						TGCGGGAGGTCGGGGCCAGTG	0.617													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18032	0.0		0.0	False		,,,				2504	0.0					ENST00000330943.4	1.000000	0.920000	1	9.900000e-01	0.990000	0.995852	0.990000	1.000000																										0				15						c.(97-99)Gac>Aac		sorting nexin 20		C	ASN/ASP,ASN/ASP,ASN/ASP	1,4395	2.1+/-5.4	0,1,2197	82.0	83.0	83.0		97,97,97	2.2	0.0	16	dbSNP_126	83	0,8600		0,0,4300	no	missense,missense,missense	SNX20	NM_001144972.1,NM_153337.2,NM_182854.2	23,23,23	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	33/103,33/130,33/317	50711341	1,12995	2198	4300	6498	SO:0001583	missense	124460	12	121412	44				g.chr16:50711341C>T	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.97G>A	chr16.hg19:g.50711341C>T	ENSP00000332062:p.Asp33Asn	0					SNX20_ENST00000300590.3_Missense_Mutation_p.D33N|SNX20_ENST00000423026.2_Missense_Mutation_p.D33N	p.D33N	NM_182854.2	NP_878274.1	1	2	3	2.039274	Q7Z614	SNX20_HUMAN		2	268	-			A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	1	1	hg19	c.97G>A	CCDS10745.1	1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918679	0.33908	2.27E-4	0.0	ENSG00000167208	ENST00000300590;ENST00000423026;ENST00000330943;ENST00000413750	T;T;T	0.52295	0.67;0.72;1.34	4.2	2.21	0.28008	4.2	2.21	0.28008	.	1.051240	0.07436	N	0.896485	T	0.48840	0.1522	L	0.27053	0.805	0.09310	N	1	D;P;D	0.71674	0.998;0.553;0.989	P;B;P	0.59948	0.866;0.059;0.727	T	0.35076	-0.9803	10	0.45353	T	0.12	-29.3821	6.0059	0.19547	0.0:0.7056:0.1911:0.1033	rs34428900	33;33;33	Q7Z614-3;Q7Z614;Q7Z614-4	.;SNX20_HUMAN;.	N	33	ENSP00000300590:D33N;ENSP00000388875:D33N;ENSP00000332062:D33N	ENSP00000300590:D33N	D	-	1	0	0	SNX20	49268842	49268842	0.114000	0.22134	0.008000	0.14137	0.008000	0.06430	0.376000	0.20535	0.692000	0.31613	-0.369000	0.07265	GAC	0.159456		TCGA-HZ-8001-01A-11D-2201-08	0.617	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	1	0	1	2	2	2	2	0	0	0	0	97	97	97	90	1	1.920000	-15.256040	1	0.150000	NM_153337		0	54	49	0	549	505	0		1	0		0	0	97	0	0	1.000000	3.986477e-01	0	0	0	14	0	54	549
TMEM231	79583	broad.mit.edu	37	16	75579249	75579249	+	Splice_Site	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr16:75579249C>T	ENST00000258173.6	-	4	659		c.e4+1		TMEM231_ENST00000568377.1_Splice_Site|TMEM231_ENST00000569294.1_Splice_Site|RP11-77K12.8_ENST00000564489.1_RNA|TMEM231_ENST00000565067.1_Intron|RP11-77K12.7_ENST00000460606.1_Splice_Site	NM_001077418.1	NP_001070886.1	Q9H6L2	TM231_HUMAN	transmembrane protein 231						cilium assembly (GO:0042384)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						AGCGCTCTTACGTTGTATCGG	0.507																																						ENST00000258173.6	1.000000	0.180000	4.100000e-01	2.300000e-01	0.290000	0.381116	0.290000	0.280000																										0				5						c.e4+1		transmembrane protein 231							125.0	125.0	125.0					16																	75579249		1992	4157	6149	SO:0001630	splice_region_variant	79583	2	120914	37				g.chr16:75579249C>T		CCDS45530.1	16q23.1	2014-01-28			ENSG00000205084	ENSG00000205084			37234	protein-coding gene	gene with protein product		614949				23012439	Standard	NM_001077416		Approved	FLJ22167, ALYE870, PRO1886, JBTS20, MKS11	uc002fek.4	Q9H6L2		ENST00000258173.6:c.582+1G>A	chr16.hg19:g.75579249C>T		0					TMEM231_ENST00000568377.1_Splice_Site|RP11-77K12.7_ENST00000460606.1_Splice_Site|TMEM231_ENST00000569294.1_Splice_Site|RP11-77K12.8_ENST00000564489.1_RNA|TMEM231_ENST00000565067.1_Intron		NM_001077418.1	NP_001070886.1	1	2	3	2.043611	Q9H6L2	TM231_HUMAN		4	659	-			A0JLU1|A6NDZ6|B3KU85|G5E9E3|Q6P450|Q6UWW5	Splice_Site	SNP	ENST00000258173.6	1	1	hg19		CCDS45530.1	0	.	.	.	.	.	.	.	.	.	.	C	7.772	0.707761	0.15239	.	.	ENSG00000205084	ENST00000258173;ENST00000398114	.	.	.	4.19	3.23	0.37069	4.19	3.23	0.37069	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3979	0.49854	0.0:0.9078:0.0:0.0922	.	.	.	.	.	-1	.	.	.	-	.	.	.	TMEM231	74136750	74136750	1.000000	0.71417	0.962000	0.40283	0.003000	0.03518	7.478000	0.81082	1.072000	0.40860	-0.384000	0.06662	.	0.160079		TCGA-HZ-8001-01A-11D-2201-08	0.507	TMEM231-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435481.2	0	0	1	2	2	2	2	0	0	0	0	170	170	170	171	1	1.920000	-2.819521	1	0.150000	NM_001077416	Intron	0	21	21	0	988	971	0		1			0	0	170	0	0	0.999997	0	0	0	0	0	0	21	988
GPR179	440435	broad.mit.edu	37	17	36499508	36499508	+	Silent	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr17:36499508C>T	ENST00000342292.4	-	1	185	c.165G>A	c.(163-165)ggG>ggA	p.G55G		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	55					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CGGCCTCGGCCCCCTCTAGGG	0.637																																						ENST00000342292.4	1.000000	0.250000	6.200000e-01	3.400000e-01	0.450000	0.496573	0.450000	0.440000																										0				60						c.(163-165)ggG>ggA		G protein-coupled receptor 179							35.0	39.0	37.0					17																	36499508		1923	4102	6025	SO:0001819	synonymous_variant	440435	0	0					g.chr17:36499508C>T		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.165G>A	chr17.hg19:g.36499508C>T		0						p.G55G	NM_001004334.2	NP_001004334.2	1	2	3	2.019752	Q6PRD1	GP179_HUMAN		1	185	-	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)		Silent	SNP	ENST00000342292.4	1	1	hg19	c.165G>A	CCDS42308.1	0																																																																																								0.155070		TCGA-HZ-8001-01A-11D-2201-08	0.637	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2	0	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	1.920000	-13.383130	1	0.150000			0	14	14	0	414	407	0		1			0	0	92	0	0	0.999734	0	0	0	0	0	0	14	414
SMARCE1	6605	broad.mit.edu	37	17	38792702	38792702	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr17:38792702C>T	ENST00000348513.6	-	6	1094	c.314G>A	c.(313-315)cGa>cAa	p.R105Q	SMARCE1_ENST00000377808.4_Missense_Mutation_p.R70Q|SMARCE1_ENST00000431889.2_Missense_Mutation_p.R87Q|SMARCE1_ENST00000544009.1_Missense_Mutation_p.R35Q|SMARCE1_ENST00000400122.3_Missense_Mutation_p.R35Q|KRT222_ENST00000476049.1_3'UTR|SMARCE1_ENST00000580419.1_Missense_Mutation_p.R70Q|SMARCE1_ENST00000578044.1_Missense_Mutation_p.R35Q	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	105					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)			large_intestine(1)	1		Breast(137;0.000812)				AGTGAGATCTCGCCACATGCC	0.408																																						ENST00000348513.6	1.000000	0.840000	1	9.700000e-01	0.990000	0.984929	0.990000	1.000000																										0				1						c.(313-315)cGa>cAa		SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1							194.0	177.0	183.0					17																	38792702		2203	4300	6503	SO:0001583	missense	6605	0	0					g.chr17:38792702C>T	AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.314G>A	chr17.hg19:g.38792702C>T	ENSP00000323967:p.Arg105Gln	0					SMARCE1_ENST00000578044.1_Missense_Mutation_p.R35Q|SMARCE1_ENST00000544009.1_Missense_Mutation_p.R35Q|SMARCE1_ENST00000377808.4_Missense_Mutation_p.R70Q|KRT222_ENST00000476049.1_3'UTR|SMARCE1_ENST00000580419.1_Missense_Mutation_p.R70Q|SMARCE1_ENST00000400122.3_Missense_Mutation_p.R35Q|SMARCE1_ENST00000431889.2_Missense_Mutation_p.R87Q	p.R105Q	NM_003079.4	NP_003070.3	1	2	3	2.019752	Q969G3	SMCE1_HUMAN		6	1094	-		Breast(137;0.000812)	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Missense_Mutation	SNP	ENST00000348513.6	1	1	hg19	c.314G>A	CCDS11370.1	1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929060	0.73327	.	.	ENSG00000073584	ENST00000348513;ENST00000544009;ENST00000431889;ENST00000377808	D;D;D;D	0.98164	-4.76;-4.76;-4.76;-4.76	5.74	5.74	0.90152	5.74	5.74	0.90152	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.96639	0.8903	L	0.49640	1.575	0.80722	D	1	P;B;P;B	0.39157	0.662;0.279;0.662;0.279	B;B;B;B	0.33620	0.167;0.027;0.098;0.027	D	0.96341	0.9251	10	0.54805	T	0.06	.	20.2825	0.98528	0.0:1.0:0.0:0.0	.	70;87;70;105	C0IMW5;B4DGM3;C0IMW4;Q969G3	.;.;.;SMCE1_HUMAN	Q	105;35;87;70	ENSP00000323967:R105Q;ENSP00000441857:R35Q;ENSP00000445370:R87Q;ENSP00000367039:R70Q	ENSP00000323967:R105Q	R	-	2	0	0	SMARCE1	36046228	36046228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.701000	0.84566	2.873000	0.98535	0.561000	0.74099	CGA	0.155070		TCGA-HZ-8001-01A-11D-2201-08	0.408	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257203.1	1	0	1	2	2	2	2	0	0	0	0	133	133	133	133	1	1.920000	-3.318794	1	0.150000	NM_003079		0	50	48	0	552	543	0		1	1		0	0	133	0	0	1.000000	1	0	22	0	271	0	50	552
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.680000	9.800000e-01	8.000000e-01	0.900000	0.892024	0.900000	0.990000	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	24185	GRCh37	CM920675	TP53	M	rs11540652	c.(742-744)cGg>cAg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	7157	7	121412	38	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577538C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	chr17.hg19:g.7577538C>T	ENSP00000269305:p.Arg248Gln	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q	p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.870738	P04637	P53_HUMAN		7	932	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.743G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	0	TP53	7518263	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	0.081081		TCGA-HZ-8001-01A-11D-2201-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	1.920000	-2.578431	1	0.150000	NM_000546		0	33	33	0	351	346	0		1	1	1	0	0	67	813	0	1.000000	9.987399e-01	1	20	68	90	740	33	351
TRIM37	4591	broad.mit.edu	37	17	57093064	57093064	+	Missense_Mutation	SNP	C	C	T	rs371137363		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr17:57093064C>T	ENST00000262294.7	-	21	2742	c.2483G>A	c.(2482-2484)cGg>cAg	p.R828Q	TRIM37_ENST00000393065.2_Missense_Mutation_p.R794Q|TRIM37_ENST00000376149.3_Missense_Mutation_p.R706Q|TRIM37_ENST00000393066.3_Missense_Mutation_p.R828Q	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	828					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTACACTGCCGGTCTTCAGT	0.502									Mulibrey Nanism																													ENST00000262294.7	1.000000	0.360000	6.700000e-01	4.400000e-01	0.530000	0.570060	0.530000	0.520000																										0				37						c.(2482-2484)cGg>cAg		tripartite motif containing 37		C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	127.0	129.0	129.0		2483,2483	2.9	1.0	17		129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TRIM37	NM_001005207.2,NM_015294.3	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	828/965,828/965	57093064	1,13005	2203	4300	6503	SO:0001583	missense	4591	2	121412	36	Mulibrey Nanism	Familial Cancer Database	Perheentupa syndrome	g.chr17:57093064C>T	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.2483G>A	chr17.hg19:g.57093064C>T	ENSP00000262294:p.Arg828Gln	0					TRIM37_ENST00000376149.3_Missense_Mutation_p.R706Q|TRIM37_ENST00000393065.2_Missense_Mutation_p.R794Q|TRIM37_ENST00000393066.3_Missense_Mutation_p.R828Q	p.R828Q	NM_015294.3	NP_056109.1	1	2	3	2.019752	O94972	TRI37_HUMAN		21	2742	-	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	1	1	hg19	c.2483G>A	CCDS32694.1	0	.	.	.	.	.	.	.	.	.	.	C	17.02	3.280964	0.59758	0.0	1.16E-4	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	4.93	2.91	0.33838	4.93	2.91	0.33838	.	0.162035	0.41500	N	0.000869	T	0.18002	0.0432	L	0.29908	0.895	0.39748	D	0.971849	P;P;P	0.50819	0.939;0.622;0.488	B;B;B	0.37508	0.252;0.186;0.091	T	0.03981	-1.0987	10	0.66056	D	0.02	-1.8697	7.1336	0.25515	0.1695:0.7407:0.0:0.0897	.	794;706;828	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	Q	828;828;706;794	ENSP00000376785:R828Q;ENSP00000262294:R828Q;ENSP00000365319:R706Q;ENSP00000376784:R794Q	ENSP00000262294:R828Q	R	-	2	0	0	TRIM37	54447846	54447846	0.717000	0.27966	1.000000	0.80357	0.931000	0.56810	0.594000	0.24014	0.476000	0.27440	0.313000	0.20887	CGG	0.155070		TCGA-HZ-8001-01A-11D-2201-08	0.502	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	124	1	1.920000	-2.576094	1	0.150000	NM_015294		0	29	30	0	708	683	0		1	0		0	0	131	0	0	1.000000	3.146748e-01	0	1	0	27	0	29	708
GPI	2821	broad.mit.edu	37	19	34868485	34868485	+	Silent	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr19:34868485C>T	ENST00000356487.5	+	5	721	c.480C>T	c.(478-480)tcC>tcT	p.S160S	GPI_ENST00000586425.1_Silent_p.S160S|GPI_ENST00000415930.3_Intron	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	160					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					TTGGCGGCTCCGACCTGGTGA	0.597																																						ENST00000356487.5	1.000000	0.480000	8.900000e-01	5.900000e-01	0.730000	0.744463	0.730000	1.000000																										0				25						c.(478-480)tcC>tcT		glucose-6-phosphate isomerase							88.0	76.0	80.0					19																	34868485		2203	4300	6503	SO:0001819	synonymous_variant	2821	1	121412	27				g.chr19:34868485C>T	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.480C>T	chr19.hg19:g.34868485C>T		1					GPI_ENST00000415930.3_Intron|GPI_ENST00000586425.1_Silent_p.S160S	p.S160S	NM_000175.3	NP_000166.2	1	2	3	2.177207	P06744	G6PI_HUMAN		5	721	+	Esophageal squamous(110;0.162)		B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Silent	SNP	ENST00000356487.5	1	1	hg19	c.480C>T	CCDS12437.1	0																																																																																								0.209302		TCGA-HZ-8001-01A-11D-2201-08	0.597	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3	1	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.920000	-2.600954	1	0.150000			0	24	23	0	449	443	0		1	1		0	0	79	0	0	1.000000	1	0	50	0	971	0	24	449
MAP3K10	4294	broad.mit.edu	37	19	40711866	40711866	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr19:40711866C>T	ENST00000253055.3	+	5	1525	c.1237C>T	c.(1237-1239)Cgc>Tgc	p.R413C	AC118344.1_ENST00000408124.1_RNA	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	413					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						ACAGGAGCAGCGCTTCCAGGA	0.672																																						ENST00000253055.3	1.000000	0.350000	1	6.100000e-01	0.980000	0.852075	0.980000	1.000000																										0				24						c.(1237-1239)Cgc>Tgc		mitogen-activated protein kinase kinase kinase 10							15.0	17.0	16.0					19																	40711866		2201	4296	6497	SO:0001583	missense	4294	0	0					g.chr19:40711866C>T	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1237C>T	chr19.hg19:g.40711866C>T	ENSP00000253055:p.Arg413Cys	1					AC118344.1_ENST00000408124.1_RNA	p.R413C	NM_002446.3	NP_002437.2	1	2	3	2.177207	Q02779	M3K10_HUMAN		5	1525	+			Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	0	1	hg19	c.1237C>T	CCDS12549.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287897	0.80803	.	.	ENSG00000130758	ENST00000253055	T	0.75477	-0.94	4.43	3.26	0.37387	4.43	3.26	0.37387	.	0.117141	0.52532	D	0.000071	T	0.77545	0.4146	M	0.64404	1.975	0.80722	D	1	D	0.69078	0.997	P	0.55455	0.776	T	0.79193	-0.1904	10	0.72032	D	0.01	.	8.8376	0.35121	0.3823:0.6177:0.0:0.0	.	413	Q02779	M3K10_HUMAN	C	413	ENSP00000253055:R413C	ENSP00000253055:R413C	R	+	1	0	0	MAP3K10	45403706	45403706	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.598000	0.67585	2.143000	0.66587	0.491000	0.48974	CGC	0.209302		TCGA-HZ-8001-01A-11D-2201-08	0.672	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	0	0	1	2	2	2	2	0	0	0	0	24	24	24	21	1	1.920000	-8.612478	1	0.150000	NM_002446		0	4	4	0	58	54	0		1	0		0	0	24	0	0	0.876248	5.860611e-01	0	1	0	26	0	4	58
NLRP5	126206	broad.mit.edu	37	19	56545008	56545008	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr19:56545008A>C	ENST00000390649.3	+	9	2548	c.2548A>C	c.(2548-2550)Aag>Cag	p.K850Q		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	850					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CACCCACCTGAAGGAAGAGGA	0.478																																						ENST00000390649.3	1.000000	0.920000	1	9.900000e-01	0.990000	0.995308	0.990000	1.000000																										0				25						c.(2548-2550)Aag>Cag		NLR family, pyrin domain containing 5							251.0	243.0	246.0					19																	56545008		1938	4149	6087	SO:0001583	missense	126206	0	0					g.chr19:56545008A>C	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2548A>C	chr19.hg19:g.56545008A>C	ENSP00000375063:p.Lys850Gln	1						p.K850Q	NM_153447.4	NP_703148.4	1	2	3	2.161279	P59047	NALP5_HUMAN		9	2548	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	1	1	hg19	c.2548A>C	CCDS12938.1	1	.	.	.	.	.	.	.	.	.	.	A	5.972	0.363331	0.11296	.	.	ENSG00000171487	ENST00000390649	T	0.52754	0.65	3.07	-2.48	0.06423	3.07	-2.48	0.06423	.	1.303020	0.05712	N	0.596209	T	0.28067	0.0692	N	0.21240	0.645	0.09310	N	1	B	0.33345	0.409	B	0.27715	0.082	T	0.12863	-1.0531	10	0.33141	T	0.24	.	5.8888	0.18896	0.2931:0.5327:0.0:0.1741	.	850	P59047	NALP5_HUMAN	Q	850	ENSP00000375063:K850Q	ENSP00000375063:K850Q	K	+	1	0	0	NLRP5	61236820	61236820	0.003000	0.15002	0.000000	0.03702	0.018000	0.09664	0.359000	0.20233	-0.645000	0.05458	0.454000	0.30748	AAG	0.209302		TCGA-HZ-8001-01A-11D-2201-08	0.478	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	1	0	1	2	2	2	2	0	0	0	0	230	230	230	229	1	1.920000	-19.698570	1	0.150000	NM_153447		0	96	93	0	1116	1104	0		1			0	0	230	0	0	1.000000	0	0	0	0	0	0	96	1116
LAMC1	3915	broad.mit.edu	37	1	182992997	182992997	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:182992997G>T	ENST00000258341.4	+	1	403	c.146G>T	c.(145-147)cGc>cTc	p.R49L		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	49	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CGGCCGCAGCGCTGCATGCCC	0.721																																						ENST00000258341.4	1.000000	0.640000	1	8.500000e-01	0.990000	0.949271	0.990000	1.000000																										0				76						c.(145-147)cGc>cTc		laminin, gamma 1 (formerly LAMB2)							26.0	28.0	27.0					1																	182992997		2203	4300	6503	SO:0001583	missense	3915	0	0					g.chr1:182992997G>T	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.146G>T	chr1.hg19:g.182992997G>T	ENSP00000258341:p.Arg49Leu	0						p.R49L	NM_002293.3	NP_002284.3	1	2	3	2.061797	P11047	LAMC1_HUMAN		1	403	+			Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	1	1	hg19	c.146G>T	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.096975	0.94197	.	.	ENSG00000135862	ENST00000258341	T	0.32988	1.43	4.23	4.23	0.50019	4.23	4.23	0.50019	Laminin, N-terminal (2);	0.142328	0.47093	U	0.000252	T	0.45175	0.1329	M	0.78456	2.415	0.80722	D	1	P;P	0.46784	0.515;0.884	B;P	0.47573	0.141;0.55	T	0.55198	-0.8178	10	0.56958	D	0.05	.	16.6058	0.84828	0.0:0.0:1.0:0.0	.	49;49	P11047;Q6NVY8	LAMC1_HUMAN;.	L	49	ENSP00000258341:R49L	ENSP00000258341:R49L	R	+	2	0	0	LAMC1	181259620	181259620	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.254000	0.65457	1.857000	0.53885	0.591000	0.81541	CGC	0.163797		TCGA-HZ-8001-01A-11D-2201-08	0.721	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	1	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	1.920000	-19.711590	1	0.150000	NM_002293		0	15	14	0	176	174	0		1	0		0	0	38	0	0	0.999879	2.045256e-02	0	0	0	3	0	15	176
LRRN2	10446	broad.mit.edu	37	1	204588995	204588995	+	Silent	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:204588995C>T	ENST00000367175.1	-	1	2338	c.126G>A	c.(124-126)acG>acA	p.T42T	LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Silent_p.T42T|LRRN2_ENST00000367176.3_Silent_p.T42T			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	42	LRRNT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ACGAGCGGGGCGTATACCAGG	0.667																																						ENST00000367175.1	1.000000	0.420000	1	5.800000e-01	0.780000	0.788469	0.780000	1.000000																										0				38						c.(124-126)acG>acA		leucine rich repeat neuronal 2							31.0	33.0	32.0					1																	204588995		2203	4300	6503	SO:0001819	synonymous_variant	10446	3	121408	31				g.chr1:204588995C>T	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.126G>A	chr1.hg19:g.204588995C>T		0					LRRN2_ENST00000367177.3_Silent_p.T42T|LRRN2_ENST00000367176.3_Silent_p.T42T|LRRN2_ENST00000496057.1_5'Flank	p.T42T			1	2	3	2.061797	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)	1	2338	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Silent	SNP	ENST00000367175.1	1	1	hg19	c.126G>A	CCDS1448.1	0																																																																																								0.163797		TCGA-HZ-8001-01A-11D-2201-08	0.667	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	1.920000	-15.735880	1	0.150000	NM_006338		0	13	13	0	229	224	0		1	0		0	0	48	0	0	0.999512	5.716737e-01	0	0	0	34	0	13	229
ARID1A	8289	broad.mit.edu	37	1	27106228	27106228	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:27106228C>T	ENST00000324856.7	+	20	6210	c.5839C>T	c.(5839-5841)Cag>Tag	p.Q1947*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q1564*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1730*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.Q275*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1947					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TAGCCCAGCACAGAGCCACCG	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	ENST00000324856.7	0.680000	0.370000	6.000000e-01	4.300000e-01	0.510000	0.524837	0.510000	0.520000				Rec	yes			Rec	yes		1	1p35.3	1p35.3	8289	Mis, N, F, S, D	AT rich interactive domain 1A (SWI-like)				E	E			clear cell ovarian carcinoma, RCC	ARID1A/MAST2_ENST00000361297(2)	0				411						c.(5839-5841)Cag>Tag		AT rich interactive domain 1A (SWI-like)							165.0	147.0	153.0					1																	27106228		2203	4300	6503	SO:0001587	stop_gained	8289	0	0					g.chr1:27106228C>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5839C>T	chr1.hg19:g.27106228C>T	ENSP00000320485:p.Gln1947*	0					ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q1564*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.Q275*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1730*	p.Q1947*	NM_006015.4	NP_006006.3	0	0	0	1.972451	O14497	ARI1A_HUMAN		20	6210	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	0	1	hg19	c.5839C>T	CCDS285.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.895876|9.895876	0.99290|0.99290	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	5.02|5.02	5.02|5.02	0.67125|0.67125	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	0.263023|.	0.39687|.	N|.	0.001300|.	.|T	.|0.70527	.|0.3234	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68300	.|-0.5445	.|4	0.02654|.	T|.	1|.	-6.3757|-6.3757	14.6091|14.6091	0.68504|0.68504	0.1463:0.8537:0.0:0.0|0.1463:0.8537:0.0:0.0	.|.	.|.	.|.	.|.	X|I	1947;1730;1564;275|843	.|.	ENSP00000320485:Q1947X|.	Q|T	+|+	1|2	0|0	0|0	ARID1A|ARID1A	26978815|26978815	26978815|26978815	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	3.660000|3.660000	0.54496|0.54496	2.769000|2.769000	0.95229|0.95229	0.491000|0.491000	0.48974|0.48974	CAG|ACA	0.129098		TCGA-HZ-8001-01A-11D-2201-08	0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	0	0	1	2	2	2	2	0	0	0	0	181	181	181	180	1	1.920000	-4.523382	1	0.150000	NM_139135		0	39	38	0	944	935	0		1	1	1	0	0	181	360	0	1.000000	8.347515e-01	9.999763e-01	5	11	76	365	39	944
BAI2	576	broad.mit.edu	37	1	32222194	32222194	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:32222194G>C	ENST00000373658.3	-	4	585	c.244C>G	c.(244-246)Cgc>Ggc	p.R82G	BAI2_ENST00000398547.1_Missense_Mutation_p.R70G|BAI2_ENST00000398542.1_Missense_Mutation_p.R70G|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000527361.1_Missense_Mutation_p.R82G|BAI2_ENST00000398538.1_Missense_Mutation_p.R70G|BAI2_ENST00000398556.3_Missense_Mutation_p.R85G|BAI2_ENST00000373655.2_Missense_Mutation_p.R82G|BAI2_ENST00000257070.4_Missense_Mutation_p.R82G	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	82					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CGGTTGAAGCGCAGGTAGAGG	0.647																																						ENST00000373658.3	1.000000	0.540000	1	7.700000e-01	0.990000	0.917215	0.990000	1.000000																										0				55						c.(244-246)Cgc>Ggc		brain-specific angiogenesis inhibitor 2							47.0	46.0	46.0					1																	32222194		2202	4300	6502	SO:0001583	missense	576	0	0					g.chr1:32222194G>C	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.244C>G	chr1.hg19:g.32222194G>C	ENSP00000362762:p.Arg82Gly	0					BAI2_ENST00000257070.4_Missense_Mutation_p.R82G|BAI2_ENST00000398542.1_Missense_Mutation_p.R70G|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398556.3_Missense_Mutation_p.R85G|BAI2_ENST00000398547.1_Missense_Mutation_p.R70G|BAI2_ENST00000527361.1_Missense_Mutation_p.R82G|BAI2_ENST00000398538.1_Missense_Mutation_p.R70G|BAI2_ENST00000373655.2_Missense_Mutation_p.R82G	p.R82G	NM_001703.2	NP_001694.2	0	0	0	1.972451	O60241	BAI2_HUMAN		4	585	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	1	1	hg19	c.244C>G	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328325	0.60743	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.53857	1.25;1.45;0.65;0.65;1.62;0.6;0.6;0.68;1.22;1.09	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.000000	0.43579	D	0.000544	T	0.61652	0.2364	L	0.43152	1.355	0.80722	D	1	B;D;D;D;P;P	0.71674	0.015;0.998;0.965;0.995;0.831;0.941	B;D;P;P;P;P	0.65874	0.011;0.939;0.777;0.756;0.54;0.501	T	0.63967	-0.6517	10	0.87932	D	0	.	11.3219	0.49428	0.0:0.0:0.7086:0.2914	.	70;82;70;70;82;82	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	G	85;70;82;82;70;82;82;70;75;116	ENSP00000381564:R85G;ENSP00000381555:R70G;ENSP00000362762:R82G;ENSP00000362759:R82G;ENSP00000381550:R70G;ENSP00000257070:R82G;ENSP00000435397:R82G;ENSP00000381548:R70G;ENSP00000410921:R75G;ENSP00000437219:R116G	ENSP00000257070:R82G	R	-	1	0	0	BAI2	31994781	31994781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.598000	0.46223	2.506000	0.84524	0.462000	0.41574	CGC	0.129098		TCGA-HZ-8001-01A-11D-2201-08	0.647	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	31	1	1.920000	-14.118600	1	0.150000	NM_001703		0	9	9	0	99	95	0		1	0		0	0	32	0	0	0.993893	4.666519e-02	0	0	0	4	0	9	99
CCDC28B	79140	broad.mit.edu	37	1	32669888	32669888	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:32669888G>A	ENST00000373602.5	+	4	780	c.433G>A	c.(433-435)Gat>Aat	p.D145N	IQCC_ENST00000537469.1_5'Flank|CCDC28B_ENST00000483009.1_Intron|RP4-622L5.7_ENST00000373604.4_RNA|CCDC28B_ENST00000421922.2_Missense_Mutation_p.D145N|RP4-622L5.7_ENST00000421616.1_RNA|IQCC_ENST00000291358.6_5'Flank	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B	145					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GGAGGAGGACGATGAAGAGGA	0.577																																						ENST00000373602.5	0.960000	0.440000	8.200000e-01	5.400000e-01	0.670000	0.688438	0.670000	0.660000																										0				10						c.(433-435)Gat>Aat		coiled-coil domain containing 28B							107.0	101.0	103.0					1																	32669888		2203	4300	6503	SO:0001583	missense	79140	0	0					g.chr1:32669888G>A	BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.433G>A	chr1.hg19:g.32669888G>A	ENSP00000362704:p.Asp145Asn	0					IQCC_ENST00000291358.6_5'Flank|RP4-622L5.7_ENST00000421616.1_RNA|CCDC28B_ENST00000483009.1_Intron|CCDC28B_ENST00000421922.2_Missense_Mutation_p.D145N|RP4-622L5.7_ENST00000373604.4_RNA|IQCC_ENST00000537469.1_5'Flank	p.D145N	NM_024296.3	NP_077272.2	0	0	0	1.972451	Q9BUN5	CC28B_HUMAN		4	780	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	A8K789|Q8TBV8	Missense_Mutation	SNP	ENST00000373602.5	1	1	hg19	c.433G>A	CCDS354.2	0	.	.	.	.	.	.	.	.	.	.	G	11.04	1.520724	0.27211	.	.	ENSG00000160050	ENST00000373602;ENST00000421922	T;T	0.44881	0.99;0.91	4.5	4.5	0.54988	4.5	4.5	0.54988	.	0.918054	0.09119	N	0.845946	T	0.27241	0.0668	N	0.08118	0	0.26056	N	0.981417	B	0.09022	0.002	B	0.01281	0.0	T	0.08722	-1.0708	10	0.49607	T	0.09	-26.5204	12.8892	0.58061	0.0:0.0:1.0:0.0	.	145	Q9BUN5	CC28B_HUMAN	N	145	ENSP00000362704:D145N;ENSP00000413017:D145N	ENSP00000362704:D145N	D	+	1	0	0	CCDC28B	32442475	32442475	0.999000	0.42202	0.824000	0.32777	0.940000	0.58332	0.923000	0.28757	2.504000	0.84457	0.561000	0.74099	GAT	0.129098		TCGA-HZ-8001-01A-11D-2201-08	0.577	CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015723.4	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	1.920000	-3.318794	1	0.150000	NM_024296		0	23	23	0	421	412	0		1	1		0	0	67	0	0	0.999999	9.774913e-01	0	5	0	109	0	23	421
ATPAF1	64756	broad.mit.edu	37	1	47123857	47123857	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:47123857A>T	ENST00000371937.4	-	4	535	c.431T>A	c.(430-432)cTc>cAc	p.L144H	ATPAF1_ENST00000525633.1_5'Flank|ATPAF1_ENST00000574428.1_Missense_Mutation_p.L144H|ATPAF1_ENST00000542495.1_5'UTR|ATPAF1_ENST00000329231.4_Missense_Mutation_p.L167H|ATPAF1_ENST00000576409.1_Missense_Mutation_p.L167H|ATPAF1_ENST00000532925.1_Missense_Mutation_p.L56H	NM_022745.4	NP_073582.3	Q5TC12	ATPF1_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 1	144					protein complex assembly (GO:0006461)	mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Acute lymphoblastic leukemia(166;0.155)					GATTGAACTGAGAGTCTTGAA	0.323																																					Melanoma(138;107 1777 21672 30337 52312)	ENST00000371937.4	1.000000	0.660000	1	8.400000e-01	0.990000	0.946115	0.990000	1.000000																										0				8						c.(430-432)cTc>cAc		ATP synthase mitochondrial F1 complex assembly factor 1							131.0	123.0	126.0					1																	47123857		2202	4299	6501	SO:0001583	missense	64756	0	0					g.chr1:47123857A>T	AK026004	CCDS541.1, CCDS41327.1, CCDS541.2, CCDS41327.2, CCDS57997.1, CCDS57998.1	1p33-p32.3	2012-10-12			ENSG00000123472	ENSG00000123472		"""Mitochondrial respiratory chain complex assembly factors"""	18803	protein-coding gene	gene with protein product		608917				11410595	Standard	NM_022745		Approved	FLJ22351, Atp11p, ATP11	uc001cqh.4	Q5TC12	OTTHUMG00000007988	ENST00000371937.4:c.431T>A	chr1.hg19:g.47123857A>T	ENSP00000361005:p.Leu144His	0					ATPAF1_ENST00000574428.1_Missense_Mutation_p.L144H|ATPAF1_ENST00000532925.1_Missense_Mutation_p.L56H|ATPAF1_ENST00000542495.1_5'UTR|ATPAF1_ENST00000525633.1_5'Flank|ATPAF1_ENST00000576409.1_Missense_Mutation_p.L167H|ATPAF1_ENST00000329231.4_Missense_Mutation_p.L167H	p.L144H	NM_022745.4	NP_073582.3	0	0	0	1.972451	Q5TC12	ATPF1_HUMAN		4	535	-	Acute lymphoblastic leukemia(166;0.155)		B1AQW7|B7Z7D6|B7Z7I6|Q9H6E3	Missense_Mutation	SNP	ENST00000371937.4	1	1	hg19	c.431T>A		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.7|20.7	4.040846|4.040846	0.75732|0.75732	.|.	.|.	ENSG00000123472|ENSG00000123472	ENST00000371937;ENST00000526821;ENST00000329231;ENST00000532925|ENST00000534216	D|.	0.85258|.	-1.96|.	5.44|5.44	5.44|5.44	0.79542|0.79542	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80297|0.80297	0.4597|0.4597	M|M	0.90082|0.90082	3.085|3.085	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.84033|0.84033	0.0360|0.0360	10|5	0.87932|.	D|.	0|.	-11.4791|-11.4791	13.1214|13.1214	0.59329|0.59329	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	56;144;144|.	B7Z7I6;A8MRA7;Q5TC12|.	.;.;ATPF1_HUMAN|.	H|T	144;58;144;56|16	ENSP00000361005:L144H|.	ENSP00000330685:L144H|.	L|S	-|-	2|1	0|0	0|0	ATPAF1|ATPAF1	46896444|46896444	46896444|46896444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	4.986000|4.986000	0.63851|0.63851	2.285000|2.285000	0.76669|0.76669	0.533000|0.533000	0.62120|0.62120	CTC|TCA	0.129098		TCGA-HZ-8001-01A-11D-2201-08	0.323	ATPAF1-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.920000	-19.999650	1	0.150000	NM_022745		0	17	17	0	187	182	0		1	1		0	0	43	0	0	0.999965	9.897741e-01	0	13	0	72	0	17	187
OBSCN	84033	broad.mit.edu	37	1	228467880	228467880	+	Splice_Site	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr1:228467880C>T	ENST00000422127.1	+	29	7708	c.7664C>T	c.(7663-7665)gCg>gTg	p.A2555V	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Splice_Site_p.A1402V|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Splice_Site_p.A2984V|OBSCN_ENST00000284548.11_Splice_Site_p.A2555V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2555	Ig-like 24.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCTCTTGCAGCGCGGGAGGTG	0.642																																						ENST00000422127.1	1.000000	0.950000	1	9.900000e-01	0.990000	0.997099	0.990000	1.000000																										0				223						c.(7663-7665)gCg>gTg		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							45.0	52.0	49.0					1																	228467880		2146	4248	6394	SO:0001630	splice_region_variant	84033	3	121170	37				g.chr1:228467880C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7664-1C>T	chr1.hg19:g.228467880C>T		0					OBSCN_ENST00000284548.11_Splice_Site_p.A2555V|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000570156.2_Splice_Site_p.A2984V|OBSCN_ENST00000359599.6_Splice_Site_p.A1402V|OBSCN_ENST00000366709.4_5'UTR	p.A2555V	NM_001098623.2	NP_001092093.2	1	2	3	2.061797	Q5VST9	OBSCN_HUMAN		29	7708	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Splice_Site	SNP	ENST00000422127.1	1	0	hg19	c.7664C>T	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	c	7.233	0.599675	0.13939	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706	T;T;T	0.40756	1.02;1.02;1.02	5.35	1.32	0.21799	5.35	1.32	0.21799	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.418879	0.23291	N	0.049783	T	0.44871	0.1314	L	0.37507	1.11	0.80722	D	1	P;B;D	0.89917	0.836;0.023;1.0	B;B;D	0.68765	0.2;0.002;0.96	T	0.26121	-1.0112	9	.	.	.	.	5.3495	0.16028	0.2442:0.5533:0.0:0.2025	.	2555;2555;2555	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	V	2555;2555;1402;254	ENSP00000284548:A2555V;ENSP00000409493:A2555V;ENSP00000352613:A1402V	.	A	+	2	0	0	OBSCN	226534503	226534503	0.040000	0.19996	0.012000	0.15200	0.314000	0.28054	0.351000	0.20096	-0.000000	0.14550	0.550000	0.68814	GCG	0.163797		TCGA-HZ-8001-01A-11D-2201-08	0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	67	67	67	65	1	1.920000	-13.803670	1	0.150000	NM_052843	Missense_Mutation	0	43	43	0	415	407	0		1	0		0	0	67	0	0	1.000000	9.296560e-03	0	0	0	2	0	43	415
PTGIS	5740	broad.mit.edu	37	20	48130848	48130848	+	Missense_Mutation	SNP	C	C	T	rs13306027	byFrequency	TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr20:48130848C>T	ENST00000244043.4	-	7	969	c.940G>A	c.(940-942)Gag>Aag	p.E314K	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	314					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	AGGATACTCTCGAGCTCTCCG	0.587																																						ENST00000244043.4	1.000000	0.970000	1	9.900000e-01	0.990000	0.997941	0.990000	1.000000																										0				27						c.(940-942)Gag>Aag		prostaglandin I2 (prostacyclin) synthase	Epoprostenol(DB01240)|Phenylbutazone(DB00812)						70.0	64.0	66.0					20																	48130848		2203	4300	6503	SO:0001583	missense	5740	9	121412	42				g.chr20:48130848C>T		CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.940G>A	chr20.hg19:g.48130848C>T	ENSP00000244043:p.Glu314Lys	0					PTGIS_ENST00000478971.1_5'UTR	p.E314K	NM_000961.3	NP_000952.1	1	2	3	2.036933	Q16647	PTGIS_HUMAN	BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)	7	969	-			Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	ENST00000244043.4	1	1	hg19	c.940G>A	CCDS13419.1	1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.425967	0.25726	.	.	ENSG00000124212	ENST00000244043	T	0.67698	-0.28	4.1	2.07	0.26955	4.1	2.07	0.26955	.	0.753921	0.12015	N	0.507523	T	0.52741	0.1753	L	0.55213	1.73	0.09310	N	1	B	0.31705	0.336	B	0.30646	0.118	T	0.40194	-0.9576	10	0.05959	T	0.93	-9.1386	6.6996	0.23217	0.0:0.7109:0.1818:0.1073	.	314	Q16647	PTGIS_HUMAN	K	314	ENSP00000244043:E314K	ENSP00000244043:E314K	E	-	1	0	0	PTGIS	47564255	47564255	0.014000	0.17966	0.018000	0.16275	0.060000	0.15804	0.192000	0.17096	0.282000	0.22254	-0.305000	0.09177	GAG	0.158832		TCGA-HZ-8001-01A-11D-2201-08	0.587	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.920000	-3.142702	1	0.150000			0	38	38	0	345	343	1		1	0		0	0	66	0	0	1.000000	9.999358e-01	0	1	0	132	0	38	345
ADAMTS5	11096	broad.mit.edu	37	21	28338459	28338459	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr21:28338459G>A	ENST00000284987.5	-	1	373	c.252C>T	c.(250-252)ggC>ggT	p.G84G		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	84					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CCACCTTGCCGCCGCCGGAGT	0.697																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	ENST00000284987.5	0.790000	0.360000	6.800000e-01	4.500000e-01	0.550000	0.571477	0.550000	0.550000																										0				72						c.(250-252)ggC>ggT		ADAM metallopeptidase with thrombospondin type 1 motif, 5							46.0	45.0	45.0					21																	28338459		2187	4286	6473	SO:0001819	synonymous_variant	11096	0	0					g.chr21:28338459G>A	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.252C>T	chr21.hg19:g.28338459G>A		0						p.G84G	NM_007038.3	NP_008969.2	0	0	0	1.958296	Q9UNA0	ATS5_HUMAN		1	373	-			Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	1	1	hg19	c.252C>T	CCDS13579.1	0																																																																																								0.122354		TCGA-HZ-8001-01A-11D-2201-08	0.697	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	106	1	1.920000	-3.279060	1	0.150000			0	23	21	0	510	503	0		1	0		0	0	109	0	0	0.999999	0	0	0	0	1	0	23	510
TTN	7273	broad.mit.edu	37	2	179574354	179574354	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr2:179574354G>T	ENST00000591111.1	-	97	27965	c.27741C>A	c.(27739-27741)taC>taA	p.Y9247*	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y8320*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y9564*|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13370	Ig-like 75.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTGCATGTGTACAAACCAG	0.438																																						ENST00000591111.1			0	0																														0				1448						c.(27739-27741)taC>taA		titin							162.0	166.0	165.0					2																	179574354		2057	4198	6255	SO:0001587	stop_gained	7273	0	0					g.chr2:179574354G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27741C>A	chr2.hg19:g.179574354G>T	ENSP00000465570:p.Tyr9247*						TTN_ENST00000342992.6_Nonsense_Mutation_p.Y8320*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y9564*|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron	p.Y9247*							Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	97	27965	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.27741C>A			.	.	.	.	.	.	.	.	.	.	G	59	39.972864	0.99985	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.91	3.13	0.36017	5.91	3.13	0.36017	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.527	0.50586	0.2349:0.0:0.7651:0.0	.	.	.	.	X	8320	.	ENSP00000343764:Y8320X	Y	-	3	2	2	TTN	179282599	179282599	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	1.422000	0.34826	1.508000	0.48769	0.655000	0.94253	TAC			TCGA-HZ-8001-01A-11D-2201-08	0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.920000	-7.199919	1	0.150000	NM_133378		0	24	24	0	329	328	0		1			0	0	50	0	0	1.000000	0	0	0	0	0	0	24	329
GALNT14	79623	broad.mit.edu	37	2	31178784	31178784	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr2:31178784G>A	ENST00000349752.5	-	5	1165	c.526C>T	c.(526-528)Cgg>Tgg	p.R176W	GALNT14_ENST00000324589.5_Missense_Mutation_p.R181W|GALNT14_ENST00000486564.1_5'Flank|GALNT14_ENST00000406653.1_Missense_Mutation_p.R156W|GALNT14_ENST00000420311.2_Missense_Mutation_p.R141W|GALNT14_ENST00000356174.3_Missense_Mutation_p.R143W	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	176	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTACCTTGCCGTTCATTATTG	0.522																																						ENST00000349752.5	1.000000	0.960000	1	9.900000e-01	0.990000	0.997812	0.990000	1.000000																										0				43						c.(526-528)Cgg>Tgg		polypeptide N-acetylgalactosaminyltransferase 14							266.0	245.0	252.0					2																	31178784		2203	4300	6503	SO:0001583	missense	79623	1	121412	36				g.chr2:31178784G>A	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.526C>T	chr2.hg19:g.31178784G>A	ENSP00000288988:p.Arg176Trp	0					GALNT14_ENST00000324589.5_Missense_Mutation_p.R181W|GALNT14_ENST00000356174.3_Missense_Mutation_p.R143W|GALNT14_ENST00000420311.2_Missense_Mutation_p.R141W|GALNT14_ENST00000486564.1_5'Flank|GALNT14_ENST00000406653.1_Missense_Mutation_p.R156W	p.R176W	NM_024572.3	NP_078848.2	1	2	3	2.032373	Q96FL9	GLT14_HUMAN		5	1165	-	Acute lymphoblastic leukemia(172;0.155)		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	1	0	hg19	c.526C>T	CCDS1773.2	1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896951	0.72639	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2	5.28	4.38	0.52667	5.28	4.38	0.52667	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.85737	0.5766	H	0.99391	4.545	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0	D	0.90544	0.4504	10	0.87932	D	0	.	12.6946	0.56997	0.0:0.0:0.575:0.425	.	141;141;143;181;176;156	F5H263;B7Z5C5;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;.;GLT14_HUMAN;.	W	176;181;156;143;141;143	ENSP00000288988:R176W;ENSP00000314500:R181W;ENSP00000385435:R156W;ENSP00000348497:R143W;ENSP00000415514:R141W;ENSP00000406399:R143W	ENSP00000314500:R181W	R	-	1	2	2	GALNT14	31032288	31032288	1.000000	0.71417	0.800000	0.32199	0.939000	0.58152	2.181000	0.42547	1.195000	0.43115	0.561000	0.74099	CGG	0.157582		TCGA-HZ-8001-01A-11D-2201-08	0.522	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	1	0	1	2	2	2	2	0	0	0	0	269	269	269	264	1	1.920000	-20.000000	1	0.150000	NM_024572		0	133	132	0	1441	1417	0		1	0		0	0	269	0	0	1.000000	5.914075e-01	0	0	0	23	0	133	1441
FSHR	2492	broad.mit.edu	37	2	49190896	49190896	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr2:49190896G>T	ENST00000406846.2	-	10	1183	c.1064C>A	c.(1063-1065)cCa>cAa	p.P355Q	FSHR_ENST00000304421.4_Missense_Mutation_p.P329Q|FSHR_ENST00000541117.1_Missense_Mutation_p.P91Q|FSHR_ENST00000346173.3_Missense_Mutation_p.P293Q	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	355					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	ATCTTCACATGGGTTGAATGC	0.453									Gonadal Dysgenesis, 46 XX																													ENST00000406846.2	1.000000	0.880000	1	9.900000e-01	0.990000	0.992700	0.990000	1.000000																										0				73						c.(1063-1065)cCa>cAa		follicle stimulating hormone receptor	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)						259.0	217.0	231.0					2																	49190896		2203	4300	6503	SO:0001583	missense	2492	0	0		Gonadal Dysgenesis, 46 XX	Familial Cancer Database		g.chr2:49190896G>T		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1064C>A	chr2.hg19:g.49190896G>T	ENSP00000384708:p.Pro355Gln	0					FSHR_ENST00000304421.4_Missense_Mutation_p.P329Q|FSHR_ENST00000346173.3_Missense_Mutation_p.P293Q|FSHR_ENST00000541117.1_Missense_Mutation_p.P91Q	p.P355Q	NM_000145.3	NP_000136.2	1	2	3	2.032373	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)	10	1183	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	1	1	hg19	c.1064C>A	CCDS1843.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945958	0.73672	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89	5.13	5.13	0.70059	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.97470	0.9172	H	0.96048	3.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98525	1.0625	9	.	.	.	.	17.7464	0.88422	0.0:0.0:1.0:0.0	.	329;293;355	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	Q	355;293;329;91	ENSP00000384708:P355Q;ENSP00000333908:P293Q;ENSP00000306780:P329Q;ENSP00000444172:P91Q	.	P	-	2	0	0	FSHR	49044400	49044400	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.673000	0.90976	0.561000	0.74099	CCA	0.157582		TCGA-HZ-8001-01A-11D-2201-08	0.453	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2	1	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	1.920000	-2.402340	0	0.150000			0	41	41	0	417	412	0		1			0	0	89	0	0	1.000000	0	0	0	0	0	0	41	417
ACTG2	72	broad.mit.edu	37	2	74135852	74135852	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr2:74135852C>T	ENST00000409624.1	+	5	951	c.308C>T	c.(307-309)cCc>cTc	p.P103L	ACTG2_ENST00000345517.3_Missense_Mutation_p.P103L|ACTG2_ENST00000409731.3_Missense_Mutation_p.P60L			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	103					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			large_intestine(3)|lung(14)|skin(1)	18						GAAGAGCACCCCACCCTGCTC	0.527																																						ENST00000409624.1	1.000000	0.260000	7.300000e-01	3.600000e-01	0.500000	0.554462	0.500000	0.470000																										0				18						c.(307-309)cCc>cTc		actin, gamma 2, smooth muscle, enteric							89.0	78.0	82.0					2																	74135852		2203	4300	6503	SO:0001583	missense	72	0	0					g.chr2:74135852C>T		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.308C>T	chr2.hg19:g.74135852C>T	ENSP00000386857:p.Pro103Leu	0					ACTG2_ENST00000345517.3_Missense_Mutation_p.P103L|ACTG2_ENST00000409731.3_Missense_Mutation_p.P60L	p.P103L			1	2	3	2.032373	P63267	ACTH_HUMAN		5	951	+			B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Missense_Mutation	SNP	ENST00000409624.1	1	1	hg19	c.308C>T	CCDS1930.1	0	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932979	0.73442	.	.	ENSG00000163017	ENST00000409731;ENST00000345517;ENST00000442912;ENST00000409624	D;D;D;D	0.97959	-4.63;-4.63;-3.69;-4.63	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.99302	0.9756	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.978;0.999	D	0.98494	1.0611	10	0.87932	D	0	.	17.4422	0.87568	0.0:1.0:0.0:0.0	.	60;103	E9PG30;P63267	.;ACTH_HUMAN	L	60;103;103;103	ENSP00000386929:P60L;ENSP00000295137:P103L;ENSP00000410020:P103L;ENSP00000386857:P103L	ENSP00000295137:P103L	P	+	2	0	0	ACTG2	73989360	73989360	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.651000	0.83577	2.724000	0.93272	0.462000	0.41574	CCC	0.157582		TCGA-HZ-8001-01A-11D-2201-08	0.527	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328086.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	1.920000	-2.722986	1	0.150000	NM_001615		0	11	11	0	300	301	0		1	0		0	0	75	0	0	0.998440	9.999084e-01	0	0	0	488	0	11	300
TRIP12	9320	broad.mit.edu	37	2	230660000	230660000	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr2:230660000G>A	ENST00000283943.5	-	25	3816	c.3638C>T	c.(3637-3639)gCa>gTa	p.A1213V	TRIP12_ENST00000389044.4_Missense_Mutation_p.A1261V|TRIP12_ENST00000389045.3_Missense_Mutation_p.A943V	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1213					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CAACAAAGGTGCATTACCCAC	0.408																																						ENST00000283943.5	1.000000	0.680000	1	8.300000e-01	0.990000	0.940094	0.990000	1.000000																										0				87						c.(3637-3639)gCa>gTa		thyroid hormone receptor interactor 12							108.0	95.0	100.0					2																	230660000		2203	4300	6503	SO:0001583	missense	9320	0	0					g.chr2:230660000G>A	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3638C>T	chr2.hg19:g.230660000G>A	ENSP00000283943:p.Ala1213Val	0					TRIP12_ENST00000389045.3_Missense_Mutation_p.A943V|TRIP12_ENST00000389044.4_Missense_Mutation_p.A1261V	p.A1213V	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	0	1	1	2.007643	Q14669	TRIPC_HUMAN		25	3816	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	1	1	hg19	c.3638C>T	CCDS33391.1	1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.941825	0.53079	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.47177	0.86;1.18;0.85	5.74	5.74	0.90152	5.74	5.74	0.90152	.	0.144194	0.64402	D	0.000009	T	0.39253	0.1071	L	0.29908	0.895	0.80722	D	1	B;B;B	0.23058	0.079;0.003;0.079	B;B;B	0.26517	0.07;0.006;0.07	T	0.13791	-1.0496	10	0.35671	T	0.21	.	15.4109	0.74917	0.0:0.1385:0.8615:0.0	.	943;1261;1213	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	V	1213;943;1261	ENSP00000283943:A1213V;ENSP00000373697:A943V;ENSP00000373696:A1261V	ENSP00000283943:A1213V	A	-	2	0	0	TRIP12	230368244	230368244	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.541000	0.60670	2.712000	0.92718	0.650000	0.86243	GCA	0.145514		TCGA-HZ-8001-01A-11D-2201-08	0.408	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.920000	-3.318794	1	0.150000	NM_004238		0	25	25	0	300	296	0		1	1		0	0	65	0	0	1.000000	9.204537e-01	0	5	0	49	0	25	300
PRR23B	389151	broad.mit.edu	37	3	138738751	138738751	+	Silent	SNP	C	C	T	rs182603479		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr3:138738751C>T	ENST00000329447.5	-	1	1017	c.753G>A	c.(751-753)ccG>ccA	p.P251P	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	251	Pro-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAGGGCGTTCCGGGAGCGGCG	0.667													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14179	0.0		0.0	False		,,,				2504	0.0					ENST00000329447.5	1.000000	0.440000	9.700000e-01	5.800000e-01	0.760000	0.771772	0.760000	1.000000																										0				29						c.(751-753)ccG>ccA		proline rich 23B							19.0	23.0	22.0					3																	138738751		2182	4274	6456	SO:0001819	synonymous_variant	389151	1	121012	36				g.chr3:138738751C>T	BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.753G>A	chr3.hg19:g.138738751C>T		0					MRPS22_ENST00000495075.1_Intron	p.P251P	NM_001013650.2	NP_001013672.1	0	0	0	1.963010	Q6ZRT6	PR23B_HUMAN		1	1017	-			B2RNV9	Silent	SNP	ENST00000329447.5	1	1	hg19	c.753G>A	CCDS33868.1	0																																																																																								0.125064		TCGA-HZ-8001-01A-11D-2201-08	0.667	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361501.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	44	1	1.920000	-3.020362	1	0.150000	NM_001013650		0	14	13	0	223	181	0		1			0	0	56	0	0	0.999150	0	0	0	0	0	0	14	223
ATR	545	broad.mit.edu	37	3	142185227	142185227	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr3:142185227T>G	ENST00000350721.4	-	40	6957	c.6836A>C	c.(6835-6837)aAc>aCc	p.N2279T	ATR_ENST00000383101.3_Missense_Mutation_p.N2215T|RP11-383G6.3_ENST00000460977.1_RNA	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2279					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GCTAGCATGGTTAGCATGGGT	0.368								Other conserved DNA damage response genes																														ENST00000350721.4	1.000000	0.960000	1	9.900000e-01	0.990000	0.997720	0.990000	1.000000																										0				122						c.(6835-6837)aAc>aCc	Other conserved DNA damage response genes	ATR serine/threonine kinase							154.0	141.0	145.0					3																	142185227		2203	4300	6503	SO:0001583	missense	545	0	0					g.chr3:142185227T>G	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6836A>C	chr3.hg19:g.142185227T>G	ENSP00000343741:p.Asn2279Thr	0					RP11-383G6.3_ENST00000460977.1_RNA|ATR_ENST00000383101.3_Missense_Mutation_p.N2215T	p.N2279T	NM_001184.3	NP_001175.2	0	0	0	1.963010	Q13535	ATR_HUMAN		40	6957	-			Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	1	1	hg19	c.6836A>C	CCDS3124.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.29|17.29	3.351061|3.351061	0.61183|0.61183	.|.	.|.	ENSG00000175054|ENSG00000175054	ENST00000350721;ENST00000383101|ENST00000513291	T;T|.	0.80566|.	-1.39;-1.39|.	5.43|5.43	5.43|5.43	0.79202|0.79202	5.43|5.43	5.43|5.43	0.79202|0.79202	Protein kinase-like domain (1);|.	0.188475|.	0.31199|.	U|.	0.008062|.	T|.	0.58652|.	0.2137|.	L|L	0.38175|0.38175	1.15|1.15	0.50039|0.50039	D|D	0.999842|0.999842	B|.	0.19445|.	0.036|.	B|.	0.12837|.	0.008|.	T|.	0.55509|.	-0.8130|.	10|.	0.21540|.	T|.	0.41|.	-3.5943|-3.5943	15.4542|15.4542	0.75299|0.75299	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2279|.	Q13535|.	ATR_HUMAN|.	T|Y	2279;2215|125	ENSP00000343741:N2279T;ENSP00000372581:N2215T|.	ENSP00000343741:N2279T|.	N|X	-|-	2|3	0|2	0|2	ATR|ATR	143667917|143667917	143667917|143667917	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.969000|0.969000	0.65631|0.65631	7.965000|7.965000	0.87945|0.87945	2.055000|2.055000	0.61198|0.61198	0.477000|0.477000	0.44152|0.44152	AAC|TAA	0.125064		TCGA-HZ-8001-01A-11D-2201-08	0.368	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	1	0	1	2	2	2	2	0	0	0	0	81	81	81	80	1	1.920000	-15.411920	1	0.150000	NM_001184		0	45	45	0	401	397	1		1	1		0	0	81	0	0	1.000000	9.303734e-01	0	2	0	40	0	45	401
MED12L	116931	broad.mit.edu	37	3	151129293	151129293	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr3:151129293G>A	ENST00000474524.1	+	39	6071	c.6033G>A	c.(6031-6033)caG>caA	p.Q2011Q	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2011	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGGCTCTCAGAGGTGATACA	0.478																																						ENST00000474524.1	1.000000	0.780000	1	9.300000e-01	0.990000	0.973822	0.990000	1.000000																										0				128						c.(6031-6033)caG>caA		mediator complex subunit 12-like							61.0	62.0	61.0					3																	151129293		2203	4300	6503	SO:0001819	synonymous_variant	116931	0	0					g.chr3:151129293G>A	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6033G>A	chr3.hg19:g.151129293G>A		0					MED12L_ENST00000273432.4_Intron	p.Q2011Q	NM_053002.4	NP_443728.3	0	0	0	1.963010	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)	39	6071	+			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	1	1	hg19	c.6033G>A	CCDS33876.1	1																																																																																								0.125064		TCGA-HZ-8001-01A-11D-2201-08	0.478	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	1	0	1	2	2	2	2	0	0	0	0	69	69	69	65	1	1.920000	-3.318794	1	0.150000	NM_053002		0	37	38	0	399	388	0		1			0	0	69	0	0	1.000000	0	0	0	0	0	0	37	399
ZNF721	170960	broad.mit.edu	37	4	435583	435583	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:435583T>G	ENST00000338977.5	-	2	2685	c.2637A>C	c.(2635-2637)aaA>aaC	p.K879N	ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.K891N|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	879					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ACGTGTAGGGTTTCTCTCCAG	0.383																																						ENST00000338977.5	1.000000	0.290000	1	4.400000e-01	0.640000	0.678668	0.640000	1.000000																										0				33						c.(2635-2637)aaA>aaC		zinc finger protein 721							64.0	68.0	67.0					4																	435583		2029	4210	6239	SO:0001583	missense	170960	0	0					g.chr4:435583T>G	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.2637A>C	chr4.hg19:g.435583T>G	ENSP00000340524:p.Lys879Asn	0					ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.K891N	p.K879N			1	2	3	2.055290	Q8TF20	ZN721_HUMAN		2	2685	-			Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	1	1	hg19	c.2637A>C		0	.	.	.	.	.	.	.	.	.	.	T	9.545	1.114493	0.20795	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.26067	1.76;1.76	0.539	0.539	0.17156	0.539	0.539	0.17156	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44871	0.1314	M	0.85710	2.77	0.24306	N	0.995109	D;D;D	0.67145	0.996;0.996;0.995	P;P;P	0.60541	0.828;0.876;0.804	T	0.21793	-1.0235	9	0.62326	D	0.03	.	5.2995	0.15770	0.0:1.0E-4:0.0:0.9999	.	879;891;891	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	N	879;891	ENSP00000340524:K879N;ENSP00000428878:K891N	ENSP00000340524:K879N	K	-	3	2	2	ZNF721	425583	425583	0.275000	0.24201	0.151000	0.22473	0.126000	0.20510	-0.123000	0.10611	0.440000	0.26502	0.172000	0.16884	AAA	0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.383	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	1.920000	-3.861498	1	0.150000	NM_133474		0	8	8	0	179	175	0		1	0		0	0	33	0	0	0.988901	2.208867e-02	0	0	0	5	0	8	179
PGM2	55276	broad.mit.edu	37	4	37863199	37863199	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:37863199C>A	ENST00000381967.4	+	14	1905	c.1805C>A	c.(1804-1806)cCa>cAa	p.P602Q	PGM2_ENST00000537241.1_Missense_Mutation_p.P442Q	NM_018290.3	NP_060760.2	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	602					carbohydrate metabolic process (GO:0005975)|deoxyribose phosphate catabolic process (GO:0046386)|galactose catabolic process (GO:0019388)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)|phosphopentomutase activity (GO:0008973)			breast(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	19						TTTTTCCAGCCACAGAAGTAC	0.403																																						ENST00000381967.4	1.000000	0.860000	1	9.900000e-01	0.990000	0.989236	0.990000	1.000000																										0				19						c.(1804-1806)cCa>cAa		phosphoglucomutase 2							156.0	166.0	162.0					4																	37863199		2203	4300	6503	SO:0001583	missense	55276	0	0					g.chr4:37863199C>A	BC010087	CCDS3443.1	4p14	2012-10-02			ENSG00000169299	ENSG00000169299	5.4.2.2		8906	protein-coding gene	gene with protein product	"""phosphopentomutase"""	172000				9549096	Standard	NM_018290		Approved	FLJ10983	uc011byb.1	Q96G03	OTTHUMG00000097813	ENST00000381967.4:c.1805C>A	chr4.hg19:g.37863199C>A	ENSP00000371393:p.Pro602Gln	0					PGM2_ENST00000537241.1_Missense_Mutation_p.P442Q	p.P602Q	NM_018290.3	NP_060760.2	1	2	3	2.055290	Q96G03	PGM2_HUMAN		14	1905	+			B4E0G8|Q53FP5|Q5QTR0|Q9H0P9|Q9NV22	Missense_Mutation	SNP	ENST00000381967.4	1	1	hg19	c.1805C>A	CCDS3443.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.182832	0.94885	.	.	ENSG00000169299	ENST00000381967;ENST00000537241	T;T	0.47177	0.85;1.71	6.14	6.14	0.99180	6.14	6.14	0.99180	.	0.047041	0.85682	D	0.000000	T	0.77579	0.4151	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.80692	-0.1269	10	0.87932	D	0	-14.225	20.8597	0.99761	0.0:1.0:0.0:0.0	.	602	Q96G03	PGM2_HUMAN	Q	602;442	ENSP00000371393:P602Q;ENSP00000437342:P442Q	ENSP00000371393:P602Q	P	+	2	0	0	PGM2	37539594	37539594	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.331000	0.79192	2.937000	0.99478	0.650000	0.86243	CCA	0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.403	PGM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215079.2	1	0	1	2	2	2	2	0	0	0	0	146	146	146	145	1	1.920000	-2.920853	1	0.150000	NM_018290		0	56	55	0	619	589	1		1	1		0	0	146	0	0	1.000000	9.971442e-01	0	19	0	79	0	56	619
TLR6	10333	broad.mit.edu	37	4	38830874	38830874	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:38830874A>G	ENST00000381950.1	-	1	286	c.221T>C	c.(220-222)tTt>tCt	p.F74S	TLR6_ENST00000436693.2_Missense_Mutation_p.F74S			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	74					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTCTGATAGAAAGCTCATGTC	0.378																																						ENST00000381950.1	1.000000	0.650000	1	8.200000e-01	0.990000	0.936667	0.990000	1.000000																										0				22						c.(220-222)tTt>tCt		toll-like receptor 6							64.0	59.0	61.0					4																	38830874		2203	4300	6503	SO:0001583	missense	10333	0	0					g.chr4:38830874A>G		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.221T>C	chr4.hg19:g.38830874A>G	ENSP00000371376:p.Phe74Ser	0					TLR6_ENST00000436693.2_Missense_Mutation_p.F74S	p.F74S			1	2	3	2.055290	Q9Y2C9	TLR6_HUMAN		1	286	-			B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	1	1	hg19	c.221T>C	CCDS3446.1	1	.	.	.	.	.	.	.	.	.	.	A	3.403	-0.121850	0.06838	.	.	ENSG00000174130	ENST00000436693;ENST00000381950;ENST00000508542;ENST00000508254;ENST00000514655	T;T;T;T	0.02140	4.43;4.43;4.43;4.43	5.55	-1.15	0.09709	5.55	-1.15	0.09709	.	0.635810	0.15748	N	0.246554	T	0.01061	0.0035	N	0.20483	0.58	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47484	-0.9114	10	0.05620	T	0.96	.	0.4819	0.00549	0.2689:0.1258:0.2356:0.3697	.	74	Q9Y2C9	TLR6_HUMAN	S	74	ENSP00000389600:F74S;ENSP00000371376:F74S;ENSP00000424718:F74S;ENSP00000423326:F74S	ENSP00000371376:F74S	F	-	2	0	0	TLR6	38507269	38507269	0.270000	0.24152	0.480000	0.27341	0.606000	0.37113	0.320000	0.19540	0.034000	0.15491	0.459000	0.35465	TTT	0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.378	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	1.920000	-20.000000	1	0.150000			0	21	21	0	265	260	0		1	0		0	0	74	0	0	0.999998	6.079393e-03	0	0	0	2	0	21	265
PRR27	401137	broad.mit.edu	37	4	71024100	71024100	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:71024100T>C	ENST00000344526.5	+	3	320	c.131T>C	c.(130-132)aTa>aCa	p.I44T	C4orf40_ENST00000502294.1_Missense_Mutation_p.I44T|C4orf40_ENST00000502441.2_Intron	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		44	Ala/Pro-rich.		I -> L (in dbSNP:rs1612460).	I -> V (in Ref. 1; CAE45962). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCTTATGGCATACGGAATTTA	0.438																																						ENST00000344526.5	1.000000	0.550000	1	6.500000e-01	0.760000	0.785400	0.760000	0.740000																										0				12						c.(130-132)aTa>aCa									179.0	160.0	166.0					4																	71024100		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr4:71024100T>C																												ENST00000344526.5:c.131T>C	chr4.hg19:g.71024100T>C	ENSP00000343172:p.Ile44Thr	0					C4orf40_ENST00000502441.2_Intron|C4orf40_ENST00000502294.1_Missense_Mutation_p.I44T	p.I44T	NM_214711.3	NP_999876.2	1	2	3	2.055290	Q6MZM9	PRR27_HUMAN		3	320	+			A8MXP0|Q6MZR6	Missense_Mutation	SNP	ENST00000344526.5	1	1	hg19	c.131T>C	CCDS3535.1	0	.	.	.	.	.	.	.	.	.	.	T	9.190	1.025685	0.19512	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.34472	1.36;1.36	1.85	-2.75	0.05914	1.85	-2.75	0.05914	.	.	.	.	.	T	0.21022	0.0506	N	0.14661	0.345	0.09310	N	1	P	0.41041	0.736	P	0.47251	0.542	T	0.18366	-1.0339	9	0.08837	T	0.75	2.5581	5.9415	0.19196	0.0:0.5263:0.0:0.4737	.	44	Q6MZM9	CD040_HUMAN	T	44	ENSP00000426249:I44T;ENSP00000343172:I44T	ENSP00000343172:I44T	I	+	2	0	0	C4orf40	71058689	71058689	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.906000	0.00701	-0.643000	0.05473	-0.363000	0.07495	ATA	0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.438	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251558.1	1	0	1	2	2	2	2	0	0	0	0	161	161	161	161	1	1.920000	-7.786283	1	0.150000			0	49	48	0	849	832	0		1			0	0	161	0	0	1.000000	0	0	0	0	0	0	49	849
ENAM	10117	broad.mit.edu	37	4	71510452	71510452	+	Silent	SNP	A	A	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:71510452A>G	ENST00000396073.3	+	9	3590	c.3309A>G	c.(3307-3309)gaA>gaG	p.E1103E	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1103					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CTACTGAGGAACAATTTAAGA	0.428																																						ENST00000396073.3	1.000000	0.910000	1	9.900000e-01	0.990000	0.994900	0.990000	1.000000																										0				6						c.(3307-3309)gaA>gaG		enamelin							98.0	94.0	96.0					4																	71510452		2203	4300	6503	SO:0001819	synonymous_variant	10117	0	0					g.chr4:71510452A>G	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3309A>G	chr4.hg19:g.71510452A>G		0					ENAM_ENST00000472903.1_Intron	p.E1103E	NM_031889.2	NP_114095.2	1	2	3	2.055290	Q9NRM1	ENAM_HUMAN	Lung(101;0.235)	9	3590	+			Q17RI5|Q9H3D1	Silent	SNP	ENST00000396073.3	1	1	hg19	c.3309A>G	CCDS3544.2	1																																																																																								0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.428	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	1	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	1.920000	-12.612160	1	0.150000	NM_031889		0	42	41	0	421	415	0		1	0		0	0	82	0	0	1.000000	8.731367e-03	0	0	0	2	0	42	421
HELQ	113510	broad.mit.edu	37	4	84375061	84375061	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:84375061T>C	ENST00000295488.3	-	2	497	c.335A>G	c.(334-336)gAt>gGt	p.D112G	MRPS18C_ENST00000295491.4_5'Flank|MRPS18C_ENST00000507019.1_5'Flank|HELQ_ENST00000440639.2_5'UTR|MRPS18C_ENST00000507349.1_5'Flank|HELQ_ENST00000510985.1_Missense_Mutation_p.D112G	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	112					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						AGTAAAGCTATCATAGTCACC	0.378								Other identified genes with known or suspected DNA repair function																														ENST00000295488.3	1.000000	0.510000	9.700000e-01	6.000000e-01	0.720000	0.750434	0.720000	0.700000																										0				38						c.(334-336)gAt>gGt	Other identified genes with known or suspected DNA repair function	helicase, POLQ-like							167.0	176.0	173.0					4																	84375061		2203	4300	6503	SO:0001583	missense	113510	0	0					g.chr4:84375061T>C	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.335A>G	chr4.hg19:g.84375061T>C	ENSP00000295488:p.Asp112Gly	0					MRPS18C_ENST00000507349.1_5'Flank|MRPS18C_ENST00000295491.4_5'Flank|HELQ_ENST00000510985.1_Missense_Mutation_p.D112G|MRPS18C_ENST00000507019.1_5'Flank|HELQ_ENST00000440639.2_5'UTR	p.D112G	NM_133636.2	NP_598375	1	2	3	2.055290	Q8TDG4	HELQ_HUMAN		2	497	-			Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	1	1	hg19	c.335A>G	CCDS3603.1	0	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634374	0.87660	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.75367	-0.37;-0.93	5.13	5.13	0.70059	5.13	5.13	0.70059	.	0.062767	0.64402	D	0.000015	D	0.83982	0.5372	M	0.61703	1.905	0.47476	D	0.999433	D;D;D;D	0.89917	0.994;0.999;1.0;0.982	P;P;D;P	0.79108	0.759;0.846;0.992;0.661	D	0.85759	0.1348	10	0.72032	D	0.01	-26.4433	15.1068	0.72326	0.0:0.0:0.0:1.0	.	112;112;75;112	E3W980;E3W982;Q8TDG4-2;Q8TDG4	.;.;.;HELQ_HUMAN	G	112	ENSP00000295488:D112G;ENSP00000424539:D112G	ENSP00000295488:D112G	D	-	2	0	0	HELQ	84594085	84594085	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.946000	0.63576	2.149000	0.67028	0.533000	0.62120	GAT	0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.378	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	1	0	1	2	2	2	2	0	0	0	0	193	193	193	192	1	1.920000	-6.502885	1	0.150000	NM_133636		0	42	40	0	775	757	0		1	1		0	0	193	0	0	1.000000	3.791377e-01	0	2	0	23	0	42	775
SFRP2	6423	broad.mit.edu	37	4	154709592	154709592	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr4:154709592G>A	ENST00000274063.4	-	1	680	c.396C>T	c.(394-396)ttC>ttT	p.F132F		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	132	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.			Missing (in Ref. 7; AAB70792). {ECO:0000305}.	bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				AGGGGAAGCCGAAGGCGGACA	0.662																																						ENST00000274063.4	1.000000	0.380000	8.300000e-01	4.700000e-01	0.570000	0.631201	0.570000	0.550000																										0				16						c.(394-396)ttC>ttT		secreted frizzled-related protein 2							84.0	91.0	88.0					4																	154709592		2203	4300	6503	SO:0001819	synonymous_variant	6423	0	0					g.chr4:154709592G>A	AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.396C>T	chr4.hg19:g.154709592G>A		0						p.F132F	NM_003013.2	NP_003004.1	1	2	3	2.055290	Q96HF1	SFRP2_HUMAN		1	680	-	all_hematologic(180;0.093)	Renal(120;0.117)	B3KQR2|O14778|Q9HAP5	Silent	SNP	ENST00000274063.4	1	1	hg19	c.396C>T	CCDS34082.1	0																																																																																								0.162562		TCGA-HZ-8001-01A-11D-2201-08	0.662	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365296.1	0	0	1	2	2	2	2	0	0	0	0	113	113	113	108	1	1.920000	-20.000000	1	0.150000			0	29	29	0	682	671	0		1	1		0	0	113	0	0	1.000000	1	0	3	0	7880	0	29	682
FBN2	2201	broad.mit.edu	37	5	127866347	127866347	+	Missense_Mutation	SNP	C	C	T	rs528614556		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr5:127866347C>T	ENST00000508053.1	-	9	1351	c.377G>A	c.(376-378)cGt>cAt	p.R126H	FBN2_ENST00000262464.4_Missense_Mutation_p.R126H|FBN2_ENST00000508989.1_Intron			P35556	FBN2_HUMAN	fibrillin 2	126	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CATGTTAGGACGGGAACAAAA	0.338																																						ENST00000508053.1	1.000000	0.680000	1	8.500000e-01	0.990000	0.946249	0.990000	1.000000																										0				197						c.(376-378)cGt>cAt		fibrillin 2							116.0	106.0	109.0					5																	127866347		2203	4300	6503	SO:0001583	missense	2201	14	121410	42				g.chr5:127866347C>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.377G>A	chr5.hg19:g.127866347C>T	ENSP00000424571:p.Arg126His	0					FBN2_ENST00000262464.4_Missense_Mutation_p.R126H|FBN2_ENST00000508989.1_Intron	p.R126H			1	2	3	2.051179	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	9	1351	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	1	1	hg19	c.377G>A	CCDS34222.1	1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829221	0.71258	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000502468	D;D;T	0.85773	-2.03;-2.03;0.12	4.59	3.71	0.42584	4.59	3.71	0.42584	.	0.000000	0.64402	D	0.000003	D	0.91102	0.7199	M	0.72118	2.19	0.53005	D	0.999961	D;D	0.89917	1.0;0.995	D;P	0.83275	0.996;0.719	D	0.91917	0.5544	10	0.59425	D	0.04	.	14.6579	0.68847	0.1472:0.8528:0.0:0.0	.	126;126	E9PHW4;P35556	.;FBN2_HUMAN	H	126	ENSP00000262464:R126H;ENSP00000424571:R126H;ENSP00000424753:R126H	ENSP00000262464:R126H	R	-	2	0	0	FBN2	127894246	127894246	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.243000	0.78219	1.511000	0.48818	0.655000	0.94253	CGT	0.161322		TCGA-HZ-8001-01A-11D-2201-08	0.338	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	1	0	1	2	2	2	2	0	0	0	0	58	58	58	58	1	1.920000	-8.106028	1	0.150000	NM_001999		0	25	25	0	309	305	0		1			0	0	58	0	0	1.000000	0	0	0	0	0	0	25	309
MDGA1	266727	broad.mit.edu	37	6	37631799	37631799	+	Missense_Mutation	SNP	G	G	A	rs544453423		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr6:37631799G>A	ENST00000434837.3	-	2	1329	c.151C>T	c.(151-153)Cgg>Tgg	p.R51W	MDGA1_ENST00000297153.7_Missense_Mutation_p.R51W|MDGA1_ENST00000505425.1_Missense_Mutation_p.R51W	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	51	Ig-like 1.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TCCCCCTCCCGGATGGTGTAG	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19882	0.0		0.0	False		,,,				2504	0.0					ENST00000434837.3	1.000000	0.790000	9.900000e-01	8.800000e-01	0.940000	0.940224	0.940000	0.990000																										0				38						c.(151-153)Cgg>Tgg		MAM domain containing glycosylphosphatidylinositol anchor 1							86.0	88.0	87.0					6																	37631799		2104	4234	6338	SO:0001583	missense	266727	2	121096	36				g.chr6:37631799G>A	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.151C>T	chr6.hg19:g.37631799G>A	ENSP00000402584:p.Arg51Trp	1					MDGA1_ENST00000297153.7_Missense_Mutation_p.R51W|MDGA1_ENST00000505425.1_Missense_Mutation_p.R51W	p.R51W	NM_153487.3	NP_705691.1	0	1	1	1.875206	Q8NFP4	MDGA1_HUMAN		2	1329	-			A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	1	1	hg19	c.151C>T	CCDS47417.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935517	0.73442	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.49432	0.78;0.78;0.78	5.25	3.45	0.39498	5.25	3.45	0.39498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.160511	0.28796	N	0.014104	T	0.55273	0.1910	M	0.79258	2.445	0.46725	D	0.999177	D	0.89917	1.0	D	0.73380	0.98	T	0.59279	-0.7484	10	0.56958	D	0.05	.	9.6088	0.39650	0.0745:0.0:0.7847:0.1408	.	51	Q8NFP4	MDGA1_HUMAN	W	51	ENSP00000402584:R51W;ENSP00000297153:R51W;ENSP00000422042:R51W	ENSP00000297153:R51W	R	-	1	2	2	MDGA1	37739777	37739777	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	4.461000	0.60115	0.587000	0.29643	-0.150000	0.13652	CGG	0.081081		TCGA-HZ-8001-01A-11D-2201-08	0.637	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3	1	0	1	2	2	2	2	0	0	0	0	81	81	81	78	1	1.920000	-2.806910	1	0.150000			0	48	48	0	430	423	0		1	0		0	0	81	0	0	1.000000	1.558782e-01	0	1	0	6	0	48	430
SIM1	6492	broad.mit.edu	37	6	100896021	100896021	+	Splice_Site	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr6:100896021C>T	ENST00000369208.3	-	8	1633		c.e8+1		SIM1_ENST00000262901.4_Splice_Site			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TGGCGCCTTACGCAAATGGTG	0.617																																						ENST00000369208.3	0.950000	0.230000	8.100000e-01	3.800000e-01	0.580000	0.599108	0.580000	0.560000																										0				79						c.e8+1		single-minded family bHLH transcription factor 1							95.0	71.0	79.0					6																	100896021		2203	4300	6503	SO:0001630	splice_region_variant	6492	0	0					g.chr6:100896021C>T	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.850+1G>A	chr6.hg19:g.100896021C>T		1					SIM1_ENST00000262901.4_Splice_Site				0	1	1	1.875206	P81133	SIM1_HUMAN		8	1633	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	Q5TDP7	Splice_Site	SNP	ENST00000369208.3	0	1	hg19		CCDS5045.1	0	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640537	0.29157	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	.	.	.	5.19	4.31	0.51392	5.19	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0421	0.71799	0.1433:0.8567:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	SIM1	101002742	101002742	1.000000	0.71417	0.989000	0.46669	0.001000	0.01503	7.487000	0.81328	1.163000	0.42636	-0.181000	0.13052	.	0.081081		TCGA-HZ-8001-01A-11D-2201-08	0.617	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	0	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.920000	-8.754000	1	0.150000	NM_005068	Intron	0	5	5	0	95	94	0		1			0	0	31	0	0	0.937534	0	0	0	0	0	0	5	95
RELN	5649	broad.mit.edu	37	7	103124188	103124188	+	Missense_Mutation	SNP	C	C	T	rs115035120	byFrequency	TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr7:103124188C>T	ENST00000428762.1	-	62	10252	c.10093G>A	c.(10093-10095)Gtc>Atc	p.V3365I	RELN_ENST00000473945.1_5'UTR|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.V3365I|RN7SKP86_ENST00000410454.1_RNA|RELN_ENST00000343529.5_Missense_Mutation_p.V3365I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3365					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.V3365I(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCGTTGTTGACGCTGTATTGC	0.552													C|||	7	0.00139776	0.0008	0.0	5008	,	,		18342	0.0		0.001	False		,,,				2504	0.0051				NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1			0	0																														1	Substitution - Missense(1)	p.V3365I(1)	ovary(1)	227						c.(10093-10095)Gtc>Atc		reelin		C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	230.0	192.0	205.0		10093,10093	3.1	0.8	7	dbSNP_132	205	8,8592	6.4+/-24.3	0,8,4292	yes	missense,missense	RELN	NM_005045.3,NM_173054.2	29,29	0,8,6495	TT,TC,CC		0.093,0.0,0.0615	probably-damaging,probably-damaging	3365/3461,3365/3459	103124188	8,12998	2203	4300	6503	SO:0001583	missense	5649	112	121412	54				g.chr7:103124188C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.10093G>A	chr7.hg19:g.103124188C>T	ENSP00000392423:p.Val3365Ile						RN7SKP86_ENST00000410454.1_RNA|RELN_ENST00000473945.1_5'UTR|RELN_ENST00000424685.2_Missense_Mutation_p.V3365I|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000343529.5_Missense_Mutation_p.V3365I	p.V3365I	NM_005045.3	NP_005036.2					P78509	RELN_HUMAN		62	10252	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	1	1	hg19	c.10093G>A	CCDS47680.1		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.12	2.142400	0.37825	0.0	9.3E-4	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.21932	1.98;1.98;1.98	5.87	3.1	0.35709	5.87	3.1	0.35709	.	0.145479	0.45606	N	0.000351	T	0.28400	0.0702	L	0.43152	1.355	0.39557	D	0.969078	B;D	0.67145	0.347;0.996	B;P	0.60415	0.054;0.874	T	0.03597	-1.1021	10	0.22706	T	0.39	.	8.8648	0.35280	0.1229:0.7486:0.0:0.1285	.	3365;3365	P78509-2;P78509	.;RELN_HUMAN	I	3365;3365;3365;882;3365	ENSP00000392423:V3365I;ENSP00000345694:V3365I;ENSP00000388446:V3365I	ENSP00000345694:V3365I	V	-	1	0	0	RELN	102911424	102911424	0.747000	0.28283	0.782000	0.31804	0.737000	0.42083	1.384000	0.34396	0.393000	0.25203	0.655000	0.94253	GTC			TCGA-HZ-8001-01A-11D-2201-08	0.552	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	1	0	1	2	2	2	2	0	0	0	0	161	161	161	160	1	1.920000	-8.041069	1	0.150000	NM_005045		0	54	52	0	908	893	0		1	0		0	0	161	0	0	1.000000	2.937466e-02	0	0	0	5	0	54	908
NUP205	23165	broad.mit.edu	37	7	135258466	135258466	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr7:135258466G>T	ENST00000285968.6	+	3	262	c.236G>T	c.(235-237)gGt>gTt	p.G79V	NUP205_ENST00000440390.2_5'UTR|NUP205_ENST00000489493.1_3'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	79					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GCCATTCAGGGTCAACAGGGA	0.398																																						ENST00000285968.6	0.710000	0.220000	5.700000e-01	3.100000e-01	0.430000	0.450490	0.430000	0.420000																										0				93						c.(235-237)gGt>gTt		nucleoporin 205kDa							111.0	102.0	105.0					7																	135258466		2203	4300	6503	SO:0001583	missense	23165	0	0					g.chr7:135258466G>T	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.236G>T	chr7.hg19:g.135258466G>T	ENSP00000285968:p.Gly79Val	0					NUP205_ENST00000440390.2_5'UTR|NUP205_ENST00000489493.1_3'UTR	p.G79V	NM_015135.2	NP_055950	0	1	1	2.004344	Q92621	NU205_HUMAN		3	262	+			A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	1	1	hg19	c.236G>T	CCDS34759.1	0	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726728	0.89298	.	.	ENSG00000155561	ENST00000285968	T	0.33438	1.41	5.1	5.1	0.69264	5.1	5.1	0.69264	.	0.096661	0.64402	D	0.000001	T	0.57125	0.2032	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56129	-0.8030	10	0.37606	T	0.19	1.6054	18.4985	0.90874	0.0:0.0:1.0:0.0	.	79	Q92621	NU205_HUMAN	V	79	ENSP00000285968:G79V	ENSP00000285968:G79V	G	+	2	0	0	NUP205	134909006	134909006	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.571000	0.98176	2.373000	0.80994	0.484000	0.47621	GGT	0.144869		TCGA-HZ-8001-01A-11D-2201-08	0.398	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1	0	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.920000	-3.682763	1	0.150000			0	11	11	0	334	330	0		1	0		0	0	69	0	0	0.998292	3.771939e-03	0	0	0	3	0	11	334
RP1L1	94137	broad.mit.edu	37	8	10468915	10468915	+	Missense_Mutation	SNP	G	G	A	rs376508933		TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr8:10468915G>A	ENST00000382483.3	-	4	2916	c.2693C>T	c.(2692-2694)aCg>aTg	p.T898M		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	898					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGGGGACGGCGTGGGGCCTGG	0.701																																						ENST00000382483.3	1.000000	0.270000	1	4.900000e-01	0.820000	0.773359	0.820000	1.000000																										0				148						c.(2692-2694)aCg>aTg		retinitis pigmentosa 1-like 1							7.0	9.0	8.0					8																	10468915		1855	4062	5917	SO:0001583	missense	94137	0	0					g.chr8:10468915G>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2693C>T	chr8.hg19:g.10468915G>A	ENSP00000371923:p.Thr898Met	0						p.T898M	NM_178857.5	NP_849188.4	1	2	3	2.045816	Q8IWN7	RP1L1_HUMAN		4	2916	-			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	0	1	hg19	c.2693C>T	CCDS43708.1	0	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378486	0.42207	.	.	ENSG00000183638	ENST00000382483	T	0.04317	3.65	4.18	-1.81	0.07882	4.18	-1.81	0.07882	.	.	.	.	.	T	0.01905	0.0060	N	0.14661	0.345	0.09310	N	1	P	0.39737	0.685	B	0.28011	0.085	T	0.41556	-0.9502	9	0.44086	T	0.13	4.6758	1.1406	0.01765	0.4403:0.1562:0.245:0.1585	.	898	A6NKC6	.	M	898	ENSP00000371923:T898M	ENSP00000371923:T898M	T	-	2	0	0	RP1L1	10506325	10506325	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.564000	0.05936	-0.265000	0.09352	-0.379000	0.06801	ACG	0.160701		TCGA-HZ-8001-01A-11D-2201-08	0.701	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1	0	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.920000	-8.095815	1	0.150000			0	4	4	0	72	71	0		1			0	0	9	0	0	0.889105	0	0	0	0	0	0	4	72
CRB2	286204	broad.mit.edu	37	9	126129592	126129592	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr9:126129592G>A	ENST00000373631.3	+	5	897	c.896G>A	c.(895-897)cGc>cAc	p.R299H	CRB2_ENST00000373629.2_5'Flank|CRB2_ENST00000359999.3_Missense_Mutation_p.R299H	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	299	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TTCAGCTTCCGCCATGCTGCG	0.687																																						ENST00000373631.3	1.000000	0.360000	8.500000e-01	4.900000e-01	0.650000	0.676120	0.650000	1.000000																										0				23						c.(895-897)cGc>cAc		crumbs family member 2							33.0	33.0	33.0					9																	126129592		2203	4300	6503	SO:0001583	missense	286204	2	121282	35				g.chr9:126129592G>A	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.896G>A	chr9.hg19:g.126129592G>A	ENSP00000362734:p.Arg299His	0					CRB2_ENST00000359999.3_Missense_Mutation_p.R299H|CRB2_ENST00000373629.2_5'Flank	p.R299H	NM_173689.5	NP_775960.4	0	0	0	1.946438	Q5IJ48	CRUM2_HUMAN		5	897	+			A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	1	1	hg19	c.896G>A	CCDS6852.2	0	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777241	0.31411	.	.	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.91843	-2.92;-2.92	5.1	-0.0543	0.13814	5.1	-0.0543	0.13814	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.652576	0.13569	N	0.378198	T	0.81809	0.4901	N	0.19112	0.55	0.09310	N	1	B;B	0.26635	0.096;0.155	B;B	0.19148	0.006;0.024	T	0.69749	-0.5061	10	0.45353	T	0.12	.	5.2636	0.15588	0.3333:0.1413:0.5254:0.0	.	299;299	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	H	299	ENSP00000353092:R299H;ENSP00000362734:R299H	ENSP00000353092:R299H	R	+	2	0	0	CRB2	125169413	125169413	0.000000	0.05858	0.103000	0.21229	0.020000	0.10135	0.113000	0.15499	-0.055000	0.13244	-0.777000	0.03380	CGC	0.116883		TCGA-HZ-8001-01A-11D-2201-08	0.687	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	1	0	1	2	2	2	2	0	0	0	0	67	67	67	65	1	1.920000	-3.330730	1	0.150000	NM_173689		0	12	12	0	223	218	0		1			0	0	67	0	0	0.999073	0	0	0	0	0	0	12	223
STXBP1	6812	broad.mit.edu	37	9	130442473	130442473	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr9:130442473C>G	ENST00000373299.1	+	17	1614	c.1499C>G	c.(1498-1500)cCt>cGt	p.P500R	STXBP1_ENST00000373302.3_Missense_Mutation_p.P500R|STXBP1_ENST00000481942.1_Intron	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	500					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						AAACACTACCCTTATATCTCT	0.488																																						ENST00000373299.1	1.000000	0.820000	1	9.300000e-01	0.990000	0.975945	0.990000	1.000000																										0				23						c.(1498-1500)cCt>cGt		syntaxin binding protein 1							268.0	231.0	243.0					9																	130442473		2203	4300	6503	SO:0001583	missense	6812	0	0					g.chr9:130442473C>G	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1499C>G	chr9.hg19:g.130442473C>G	ENSP00000362396:p.Pro500Arg	0					STXBP1_ENST00000373302.3_Missense_Mutation_p.P500R|STXBP1_ENST00000481942.1_Intron	p.P500R	NM_001032221.3	NP_001027392.1	0	0	0	1.946438	P61764	STXB1_HUMAN		17	1614	+			B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	1	1	hg19	c.1499C>G	CCDS35146.1	1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.601542	0.66445	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.78481	-1.18;-1.18	5.64	5.64	0.86602	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	H	0.96301	3.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.992;0.993	D	0.93931	0.7214	10	0.87932	D	0	-5.0024	17.5557	0.87889	0.0:1.0:0.0:0.0	.	500;500	P61764;P61764-2	STXB1_HUMAN;.	R	454;500;332;500	ENSP00000362399:P500R;ENSP00000362396:P500R	ENSP00000362396:P500R	P	+	2	0	0	STXBP1	129482294	129482294	1.000000	0.71417	0.999000	0.59377	0.217000	0.24651	7.648000	0.83479	2.826000	0.97356	0.561000	0.74099	CCT	0.116883		TCGA-HZ-8001-01A-11D-2201-08	0.488	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	1	0	1	2	2	2	2	0	0	0	0	142	142	142	142	1	1.920000	-3.017764	1	0.150000	NM_003165		0	66	65	0	735	723	0		1	0		0	0	142	0	0	1.000000	9.409564e-01	0	0	0	54	0	66	735
PTPRD	5789	broad.mit.edu	37	9	8492935	8492935	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr9:8492935G>A	ENST00000381196.4	-	24	2937	c.2394C>T	c.(2392-2394)ctC>ctT	p.L798L	PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Silent_p.L785L|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000358503.5_Silent_p.L776L|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000540109.1_Silent_p.L798L|PTPRD_ENST00000356435.5_Silent_p.L798L	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	798	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTGTGACGGTGAGGGAGTAGG	0.493										TSP Lung(15;0.13)																												ENST00000381196.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999965	0.990000	1.000000																										0				168						c.(2392-2394)ctC>ctT		protein tyrosine phosphatase, receptor type, D							222.0	184.0	197.0					9																	8492935		2203	4300	6503	SO:0001819	synonymous_variant	5789	0	0					g.chr9:8492935G>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2394C>T	chr9.hg19:g.8492935G>A		1	TSP Lung(15;0.13)				PTPRD_ENST00000360074.4_Silent_p.L785L|PTPRD_ENST00000358503.5_Silent_p.L776L|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000356435.5_Silent_p.L798L|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000540109.1_Silent_p.L798L|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000486161.1_Intron	p.L798L	NM_002839.3	NP_002830.1	0	2	2	1.956826	P23468	PTPRD_HUMAN		24	2937	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	1	1	hg19	c.2394C>T	CCDS43786.1	1																																																																																								0.150000		TCGA-HZ-8001-01A-11D-2201-08	0.493	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3	1	0	1	2	2	2	2	0	0	0	0	127	127	127	125	1	1.920000	-19.999850	1	0.150000			0	76	75	0	633	623	1		1			0	0	127	0	0	1.000000	0	0	0	0	0	0	76	633
RECK	8434	broad.mit.edu	37	9	36058869	36058869	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr9:36058869C>T	ENST00000377966.3	+	3	771	c.205C>T	c.(205-207)Cga>Tga	p.R69*	RECK_ENST00000479053.1_3'UTR	NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	69	5 X Knot repeats.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TCTGTTGCAGCGAGCCCCAGA	0.333																																						ENST00000377966.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.999972	0.990000	1.000000																										0				32						c.(205-207)Cga>Tga		reversion-inducing-cysteine-rich protein with kazal motifs							73.0	76.0	75.0					9																	36058869		2203	4300	6503	SO:0001587	stop_gained	8434	0	0					g.chr9:36058869C>T	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.205C>T	chr9.hg19:g.36058869C>T	ENSP00000367202:p.Arg69*	1					RECK_ENST00000479053.1_3'UTR	p.R69*	NM_021111.2	NP_066934.1	0	2	2	1.956826	O95980	RECK_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)	3	771	+			B2RNS1|Q5W0K6|Q8WX37	Nonsense_Mutation	SNP	ENST00000377966.3	0	1	hg19	c.205C>T	CCDS6597.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.818781	0.98966	.	.	ENSG00000122707	ENST00000377966	.	.	.	5.75	2.47	0.30058	5.75	2.47	0.30058	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.11	13.1884	0.59695	0.5131:0.4869:0.0:0.0	.	.	.	.	X	69	.	ENSP00000367202:R69X	R	+	1	2	2	RECK	36048869	36048869	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	1.024000	0.30077	0.720000	0.32209	0.491000	0.48974	CGA	0.150000		TCGA-HZ-8001-01A-11D-2201-08	0.333	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.920000	-3.223439	1	0.150000			0	35	34	0	225	217	1		1	0		0	0	52	0	0	1.000000	7.467936e-01	0	0	0	19	0	35	225
PNPLA7	375775	broad.mit.edu	37	9	140357967	140357967	+	Silent	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chr9:140357967G>A	ENST00000277531.4	-	28	3354	c.3168C>T	c.(3166-3168)taC>taT	p.Y1056Y	PNPLA7_ENST00000406427.1_Silent_p.Y1081Y|PNPLA7_ENST00000371457.1_Silent_p.Y662Y|PNPLA7_ENST00000492278.1_5'UTR	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1056	Patatin.				lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TGGCACGCACGTACCACCACA	0.657																																						ENST00000277531.4	1.000000	0.300000	1	5.600000e-01	0.920000	0.824929	0.920000	1.000000																										0				40						c.(3166-3168)taC>taT		patatin-like phospholipase domain containing 7							47.0	34.0	38.0					9																	140357967		2193	4287	6480	SO:0001819	synonymous_variant	375775	5	119426	30				g.chr9:140357967G>A	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3168C>T	chr9.hg19:g.140357967G>A		0					PNPLA7_ENST00000371457.1_Silent_p.Y662Y|PNPLA7_ENST00000406427.1_Silent_p.Y1081Y|PNPLA7_ENST00000492278.1_5'UTR	p.Y1056Y	NM_152286.3	NP_689499.3	0	0	0	1.946438	Q6ZV29	PLPL7_HUMAN		28	3354	-	all_cancers(76;0.126)		B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	ENST00000277531.4	0	1	hg19	c.3168C>T	CCDS7045.1	1																																																																																								0.116883		TCGA-HZ-8001-01A-11D-2201-08	0.657	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	0	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.920000	-7.971221	1	0.150000	NM_152286		0	3	3	0	33	33	0		1	0		0	0	9	0	0	0.812676	6.486631e-01	0	0	0	24	0	3	33
NRK	203447	broad.mit.edu	37	X	105153065	105153065	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chrX:105153065C>T	ENST00000243300.9	+	13	1735	c.1432C>T	c.(1432-1434)Ctc>Ttc	p.L478F	NRK_ENST00000428173.2_Missense_Mutation_p.L479F	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	478	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						AGCCAGGGTGCTCATGCCACT	0.547										HNSCC(51;0.14)																												ENST00000243300.9	1.000000	0.830000	1	9.100000e-01	0.960000	0.956337	0.960000	0.990000																										0				76						c.(1432-1434)Ctc>Ttc		Nik related kinase							45.0	46.0	46.0					X																	105153065		2044	4181	6225	SO:0001583	missense	203447	3	120988	33				g.chrX:105153065C>T	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1432C>T	chrX.hg19:g.105153065C>T	ENSP00000434830:p.Leu478Phe		HNSCC(51;0.14)				NRK_ENST00000428173.2_Missense_Mutation_p.L479F	p.L478F	NM_198465.2	NP_940867.2	0	1	1		Q7Z2Y5	NRK_HUMAN		13	1735	+			Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	1	1	hg19	c.1432C>T		1	.	.	.	.	.	.	.	.	.	.	C	9.268	1.045033	0.19748	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.19105	2.17;2.17	4.49	-1.28	0.09318	4.49	-1.28	0.09318	.	0.656459	0.13499	N	0.383421	T	0.12518	0.0304	L	0.31065	0.9	0.19575	N	0.999962	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.001	T	0.20739	-1.0266	10	0.54805	T	0.06	.	4.6589	0.12632	0.148:0.3881:0.0:0.4639	.	146;478	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	F	478;479	ENSP00000434830:L478F;ENSP00000438378:L479F	ENSP00000434830:L478F	L	+	1	0	0	NRK	105039721	105039721	0.208000	0.23494	0.026000	0.17262	0.093000	0.18481	-0.620000	0.05565	-0.437000	0.07243	-0.380000	0.06706	CTC	0.150000		TCGA-HZ-8001-01A-11D-2201-08	0.547	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.920000	-20.000000	1	0.150000	NM_198465		0	42	42	0	141	141	1		1	0		0	0	25	0	0	1.000000	0	0	0	0	1	0	42	141
P2RY8	286530	broad.mit.edu	37	X	1584907	1584907	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chrX:1584907G>A	ENST00000381297.4	-	2	755	c.545C>T	c.(544-546)aCg>aTg	p.T182M	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGGGAGCATCGTCCACTTGAG	0.632			T	CRLF2	"""B-ALL, Downs associated ALL"""																																	ENST00000381297.4	0.600000	0.230000	5.000000e-01	3.100000e-01	0.390000	0.410908	0.390000	0.390000				Dom	yes			Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	Xp22.3; Yp11.3	286530	T	"""purinergic receptor P2Y, G-protein coupled, 8"""				L	L	CRLF2		B-ALL, Downs associated ALL		0				23						c.(544-546)aCg>aTg		purinergic receptor P2Y, G-protein coupled, 8							128.0	77.0	94.0					X																	1584907		2203	4296	6499	SO:0001583	missense	286530	0	0					g.chrX:1584907G>A	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.545C>T	chrX.hg19:g.1584907G>A	ENSP00000370697:p.Thr182Met						P2RY8_ENST00000460672.1_5'Flank	p.T182M	NM_178129.4	NP_835230.1	0	1	1		Q86VZ1	P2RY8_HUMAN		2	755	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)		Missense_Mutation	SNP	ENST00000381297.4	1	1	hg19	c.545C>T	CCDS14115.1	0	.	.	.	.	.	.	.	.	.	.	g	6.863	0.528508	0.13127	.	.	ENSG00000182162	ENST00000381297	T	0.37235	1.21	2.41	-0.826	0.10805	2.41	-0.826	0.10805	GPCR, rhodopsin-like superfamily (1);	0.698644	0.12787	U	0.439216	T	0.29158	0.0725	L	0.43923	1.385	0.09310	N	1	D	0.53885	0.963	P	0.45138	0.471	T	0.16748	-1.0392	10	0.49607	T	0.09	.	6.573	0.22549	0.0:0.2502:0.5237:0.2261	.	182	Q86VZ1	P2RY8_HUMAN	M	182	ENSP00000370697:T182M	ENSP00000370697:T182M	T	-	2	0	0	P2RY8	1544907	1544907	0.027000	0.19231	0.944000	0.38274	0.013000	0.08279	0.307000	0.19296	-0.018000	0.14079	0.279000	0.19357	ACG	0.150000		TCGA-HZ-8001-01A-11D-2201-08	0.632	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.920000	-3.220975	1	0.150000	NM_178129		0	16	15	0	252	248	0		1	0		0	0	62	0	0	0.999931	2.281943e-02	0	0	0	4	0	16	252
MECP2	4204	broad.mit.edu	37	X	153297998	153297998	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8001-01A-11D-2201-08	TCGA-HZ-8001-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a2dfddac-7a27-4b29-b730-d155fac52da4	b31ec204-dc5d-4b68-9139-6b928429f1e7	g.chrX:153297998A>G	ENST00000303391.6	-	3	286	c.37T>C	c.(37-39)Tca>Cca	p.S13P	MECP2_ENST00000453960.2_Missense_Mutation_p.S25P|MECP2_ENST00000460227.1_5'UTR|MECP2_ENST00000407218.1_Missense_Mutation_p.S13P	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	13					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTCTTCTGACTTTTCTTCC	0.473																																						ENST00000303391.6	0.280000	0.070000	2.200000e-01	1.100000e-01	0.160000	0.172362	0.160000	0.160000																										0				23						c.(37-39)Tca>Cca		methyl CpG binding protein 2							77.0	77.0	77.0					X																	153297998		2195	4285	6480	SO:0001583	missense	4204	0	0					g.chrX:153297998A>G	AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.37T>C	chrX.hg19:g.153297998A>G	ENSP00000301948:p.Ser13Pro						MECP2_ENST00000453960.2_Missense_Mutation_p.S25P|MECP2_ENST00000407218.1_Missense_Mutation_p.S13P|MECP2_ENST00000460227.1_5'UTR	p.S13P	NM_004992.3	NP_004983.1	0	1	1		P51608	MECP2_HUMAN		3	286	-	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	ENST00000303391.6	0	1	hg19	c.37T>C	CCDS14741.1	0	.	.	.	.	.	.	.	.	.	.	A	18.80	3.701581	0.68501	.	.	ENSG00000169057	ENST00000303391;ENST00000545451;ENST00000453960;ENST00000369964;ENST00000407218;ENST00000415944	D;D;D;D	0.98221	-2.86;-2.82;-4.8;-2.33	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.237548	0.35235	N	0.003354	D	0.97414	0.9154	L	0.27053	0.805	0.38439	D	0.946649	D;D	0.69078	0.997;0.995	P;P	0.60949	0.881;0.763	D	0.98968	1.0800	10	0.52906	T	0.07	-7.5146	13.811	0.63264	1.0:0.0:0.0:0.0	.	25;13	P51608-2;P51608	.;MECP2_HUMAN	P	13;13;25;13;13;13	ENSP00000301948:S13P;ENSP00000395535:S25P;ENSP00000384865:S13P;ENSP00000416267:S13P	ENSP00000301948:S13P	S	-	1	0	0	MECP2	152951192	152951192	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	1.596000	0.36718	1.907000	0.55213	0.430000	0.28490	TCA	0.150000		TCGA-HZ-8001-01A-11D-2201-08	0.473	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061144.1	0	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	1.920000	-8.953115	1	0.150000	NM_004992		0	9	8	0	370	361	0		1	0		0	0	58	0	0	0.993618	3.359203e-01	0	0	0	45	0	9	370
