#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SLC22A8	9376	broad.mit.edu	37	11	62760741	62760741	+	Nonsense_Mutation	SNP	G	G	A	rs201498461		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:62760741G>A	ENST00000336232.2	-	11	1732	c.1597C>T	c.(1597-1599)Cag>Tag	p.Q533*	SLC22A8_ENST00000311438.8_3'UTR|SLC22A8_ENST00000545207.1_Nonsense_Mutation_p.Q442*|SLC22A8_ENST00000542795.1_5'Flank|SLC22A8_ENST00000535878.1_Nonsense_Mutation_p.Q410*|SLC22A8_ENST00000430500.2_Nonsense_Mutation_p.Q533*	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	533					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCGTGAGGCTGTAGAGGGATC	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18926	0.0		0.001	False		,,,				2504	0.0					ENST00000336232.2	1.000000	0.130000	0.610000	0.220000	0.360000	0.431721	0.360000	0.320000																										0				28						c.(1597-1599)Cag>Tag		solute carrier family 22 (organic anion transporter), member 8	Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)						55.0	54.0	54.0					11																	62760741		2201	4298	6499	SO:0001587	stop_gained	9376	3	121412	29				g.chr11:62760741G>A	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.1597C>T	chr11.hg19:g.62760741G>A	ENSP00000337335:p.Gln533*	0					SLC22A8_ENST00000535878.1_Nonsense_Mutation_p.Q410*|SLC22A8_ENST00000545207.1_Nonsense_Mutation_p.Q442*|SLC22A8_ENST00000430500.2_Nonsense_Mutation_p.Q533*|SLC22A8_ENST00000311438.8_3'UTR|SLC22A8_ENST00000542795.1_5'Flank	p.Q533*	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	1	2	3	2.021625	Q8TCC7	S22A8_HUMAN		11	1732	-			B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Nonsense_Mutation	SNP	ENST00000336232.2	0	1	hg19	c.1597C>T	CCDS8042.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	20.2	3.942501	0.73672	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000430500	.	.	.	5.26	3.29	0.37713	5.260000	3.290000	0.377130	.	0.598101	0.15881	N	0.240067	.	.	.	.	.	.	0.36702	D	0.880157	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	10.4632	0.44592	0.0:0.0:0.5628:0.4372	.	.	.	.	X	533;519;442;410;533	.	ENSP00000337335:Q533X	Q	-	1	0	0	SLC22A8	62517317	62517317	0.970000	0.33590	0.889000	0.34880	0.520000	0.34377	1.273000	0.33121	0.615000	0.30124	0.561000	0.74099	CAG	0.167987		TCGA-HZ-8003-01A-21D-2201-08	0.607	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	0	0	1	2	2	2	2	0	0	0	0	35	35	35	34	1	2	-3.483756	1	0.160000	NM_004254		0	5	5	0	192	187	0		1			0	0	35	0	0	9.340468e-01	0	0	0	0	0	0	5	192
KDM2A	22992	broad.mit.edu	37	11	67018096	67018096	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:67018096G>A	ENST00000529006.2	+	17	3041	c.2595G>A	c.(2593-2595)gaG>gaA	p.E865E	KDM2A_ENST00000398645.2_Intron|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_Silent_p.E323E|KDM2A_ENST00000530342.1_Silent_p.E426E	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	865					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						aggaggaggaggaagaTGACA	0.667																																						ENST00000529006.2	1.000000	0.120000	0.550000	0.200000	0.330000	0.401878	0.330000	0.280000																										0				36						c.(2593-2595)gaG>gaA		lysine (K)-specific demethylase 2A							29.0	36.0	34.0					11																	67018096		2135	4228	6363	SO:0001819	synonymous_variant	22992	0	0					g.chr11:67018096G>A	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2595G>A	chr11.hg19:g.67018096G>A		0					KDM2A_ENST00000308783.5_Silent_p.E323E|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000530342.1_Silent_p.E426E|KDM2A_ENST00000398645.2_Intron	p.E865E	NM_012308.2	NP_036440.1	1	2	3	2.021625	Q9Y2K7	KDM2A_HUMAN		17	3041	+			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	ENST00000529006.2	0	1	hg19	c.2595G>A	CCDS44657.1	0																																																																																								0.167987		TCGA-HZ-8003-01A-21D-2201-08	0.667	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	0	0	0	2	2	2	2	0	0	0	0	46	46	46	46	1	2	-6.527559	1	0.160000	NM_012308		0	5	2	0	212	215	0		1	0		0	0	46	0	0	9.382630e-01	1.927217e-01	0	0	0	29	0	5	212
SHANK2	22941	broad.mit.edu	37	11	70332827	70332827	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:70332827C>T	ENST00000423696.2	-	15	2470	c.2434G>A	c.(2434-2436)Gcg>Acg	p.A812T	SHANK2_ENST00000449833.2_Missense_Mutation_p.A596T|SHANK2_ENST00000409161.1_Missense_Mutation_p.A595T|SHANK2_ENST00000338508.4_Missense_Mutation_p.A1192T			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	812					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCGCTGCTCGCGGAGGGCACT	0.706																																						ENST00000423696.2	1.000000	0.140000	1.000000	0.210000	0.320000	0.464717	0.320000	0.260000																										0				62						c.(2434-2436)Gcg>Acg		SH3 and multiple ankyrin repeat domains 2							20.0	26.0	24.0					11																	70332827		2192	4290	6482	SO:0001583	missense	22941	0	0					g.chr11:70332827C>T	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2434G>A	chr11.hg19:g.70332827C>T	ENSP00000394536:p.Ala812Thr	1					SHANK2_ENST00000338508.4_Missense_Mutation_p.A1192T|SHANK2_ENST00000449833.2_Missense_Mutation_p.A596T|SHANK2_ENST00000409161.1_Missense_Mutation_p.A595T	p.A812T			2	3	5	2.257427	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)	15	2470	-			C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	0	1	hg19	c.2434G>A		0	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.777281	0.00640	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	3.62	1.14	0.20703	3.620000	1.140000	0.207030	.	1.993000	0.03565	N	0.227639	T	0.30293	0.0760	L	0.29908	0.895	0.27447	N	0.953541	B;B;B	0.17667	0.008;0.023;0.023	B;B;B	0.08055	0.001;0.002;0.003	T	0.13791	-1.0496	10	0.20046	T	0.44	.	5.831	0.18581	0.0:0.0901:0.3193:0.5906	.	812;1191;596	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	T	596;595;470;1192;812;830;815	ENSP00000399423:A596T;ENSP00000386491:A595T;ENSP00000402944:A470T;ENSP00000345193:A1192T;ENSP00000394536:A812T;ENSP00000294018:A815T	ENSP00000294018:A815T	A	-	1	0	0	SHANK2	70010475	70010475	1.000000	0.71417	0.001000	0.08648	0.000000	0.00434	1.432000	0.34936	-0.061000	0.13110	-0.340000	0.08031	GCG	0.259520		TCGA-HZ-8003-01A-21D-2201-08	0.706	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	71	71	71	70	1	2	-8.063042	1	0.160000	NM_012309		0	9	9	0	464	457	0		1	0		0	0	71	0	0	9.939081e-01	4.844705e-04	0	0	0	2	0	9	464
OR10G4	390264	broad.mit.edu	37	11	123886737	123886737	+	Silent	SNP	T	T	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr11:123886737T>C	ENST00000320891.4	+	1	456	c.456T>C	c.(454-456)tcT>tcC	p.S152S		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCAGTGGCTCTCTGCACTCTG	0.562																																						ENST00000320891.4	0.490000	0.260000	0.430000	0.310000	0.360000	0.375724	0.360000	0.370000																										0				48						c.(454-456)tcT>tcC		olfactory receptor, family 10, subfamily G, member 4							126.0	124.0	125.0					11																	123886737		2201	4299	6500	SO:0001819	synonymous_variant	390264	0	0					g.chr11:123886737T>C	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.456T>C	chr11.hg19:g.123886737T>C		0						p.S152S	NM_001004462.1	NP_001004462.1	0	0	0	1.950642	Q8NGN3	O10G4_HUMAN		1	456	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	Q6IEW0	Silent	SNP	ENST00000320891.4	1	1	hg19	c.456T>C	CCDS31702.1	0																																																																																								0.135091		TCGA-HZ-8003-01A-21D-2201-08	0.562	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	0	0	1	2	2	2	2	0	0	0	0	191	191	191	295	1	2	-3.589987	1	0.160000	NM_001004462		0	39	35	0	1245	1130	0		1			0	0	191	0	0	1	0	0	0	0	0	0	39	1245
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.920000	0.250000	0.720000	0.370000	0.520000	0.553278	0.520000	0.500000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	0	1	1	1.992052	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.34G>C	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	17	1	2	-4.093351	1	0.160000	NM_033360		331	8	8	7683	186	181	0	1	1	1	1	0	0	18	434	1	9.886745e-01	3.309613e-01	9.999589e-01	4	18	22	530	8	186
RPH3A	22895	broad.mit.edu	37	12	113303278	113303278	+	Missense_Mutation	SNP	G	G	A	rs199724124		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr12:113303278G>A	ENST00000389385.4	+	6	787	c.290G>A	c.(289-291)cGc>cAc	p.R97H	RPH3A_ENST00000420983.2_Missense_Mutation_p.R97H|RPH3A_ENST00000415485.3_Missense_Mutation_p.R97H|RPH3A_ENST00000447659.2_Missense_Mutation_p.R48H|RPH3A_ENST00000543106.2_Missense_Mutation_p.R97H|RPH3A_ENST00000551052.1_Missense_Mutation_p.R93H|RPH3A_ENST00000548866.1_Missense_Mutation_p.R48H	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	97	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GGGGTGAACCGCTGCATACTG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		21421	0.0		0.001	False		,,,				2504	0.0					ENST00000389385.4	0.840000	0.440000	0.740000	0.530000	0.620000	0.641146	0.620000	0.620000																										0				47						c.(289-291)cGc>cAc		rabphilin 3A							199.0	173.0	182.0					12																	113303278		2203	4300	6503	SO:0001583	missense	22895	1	121412	33				g.chr12:113303278G>A	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.290G>A	chr12.hg19:g.113303278G>A	ENSP00000374036:p.Arg97His	0					RPH3A_ENST00000543106.2_Missense_Mutation_p.R97H|RPH3A_ENST00000551052.1_Missense_Mutation_p.R93H|RPH3A_ENST00000415485.3_Missense_Mutation_p.R97H|RPH3A_ENST00000548866.1_Missense_Mutation_p.R48H|RPH3A_ENST00000447659.2_Missense_Mutation_p.R48H|RPH3A_ENST00000420983.2_Missense_Mutation_p.R97H	p.R97H	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	0	1	1	1.992052	Q9Y2J0	RP3A_HUMAN		6	787	+			B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	1	1	hg19	c.290G>A	CCDS44979.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	25.2	4.613988	0.87359	.	.	ENSG00000089169	ENST00000548197;ENST00000543106;ENST00000551593;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000447659;ENST00000550901;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	5.61	5.61	0.85477	5.610000	5.610000	0.854770	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000006	T	0.78811	0.4342	L	0.35487	1.065	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	P;P;P;P	0.60173	0.87;0.605;0.605;0.778	T	0.79293	-0.1863	10	0.51188	T	0.08	.	18.4097	0.90548	0.0:0.0:1.0:0.0	.	48;97;97;93	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	H	97;97;97;97;97;97;97;97;48;30;97;93;97;97;48;97	ENSP00000446570:R97H;ENSP00000440384:R97H;ENSP00000446780:R97H;ENSP00000450382:R97H;ENSP00000449613:R97H;ENSP00000447505:R97H;ENSP00000449650:R97H;ENSP00000374036:R97H;ENSP00000413254:R48H;ENSP00000448100:R30H;ENSP00000447083:R97H;ENSP00000448297:R93H;ENSP00000405357:R97H;ENSP00000450216:R97H;ENSP00000450347:R48H;ENSP00000408889:R97H	ENSP00000374036:R97H	R	+	2	0	0	RPH3A	111787661	111787661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.191000	0.77763	2.631000	0.89168	0.655000	0.94253	CGC	0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.522	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	1	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	2	-3.141877	1	0.160000	NM_014954		0	34	29	0	637	627	0		1			0	0	105	0	0	1	0	0	0	0	0	0	34	637
HNRNPC	3183	broad.mit.edu	37	14	21680019	21680019	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr14:21680019G>T	ENST00000320084.7	-	6	865	c.626C>A	c.(625-627)tCt>tAt	p.S209Y	HNRNPC_ENST00000553753.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000555914.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000554455.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000336053.6_Missense_Mutation_p.S196Y|HNRNPC_ENST00000556628.1_Missense_Mutation_p.S129Y|HNRNPC_ENST00000449098.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000420743.2_Missense_Mutation_p.S209Y|HNRNPC_ENST00000556897.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000430246.2_Missense_Mutation_p.S196Y|HNRNPC_ENST00000556513.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000554969.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000555309.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000553300.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000557201.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000555883.1_Missense_Mutation_p.S153Y|HNRNPC_ENST00000556142.1_Missense_Mutation_p.S209Y	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	209	Asp/Glu-rich (acidic).				3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		TTCCAGGAGAGAATCCACTTT	0.363																																					NSCLC(108;607 2244 12726 38757)	ENST00000320084.7	1.000000	0.190000	0.380000	0.240000	0.290000	0.356875	0.290000	0.290000																										0				9						c.(625-627)tCt>tAt		heterogeneous nuclear ribonucleoprotein C (C1/C2)							134.0	138.0	137.0					14																	21680019		1999	4190	6189	SO:0001583	missense	3183	1	120962	29				g.chr14:21680019G>T		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.626C>A	chr14.hg19:g.21680019G>T	ENSP00000319690:p.Ser209Tyr	0					HNRNPC_ENST00000420743.2_Missense_Mutation_p.S209Y|HNRNPC_ENST00000556142.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000554455.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000556628.1_Missense_Mutation_p.S129Y|HNRNPC_ENST00000336053.6_Missense_Mutation_p.S196Y|HNRNPC_ENST00000555309.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000553300.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000557201.1_Missense_Mutation_p.S209Y|HNRNPC_ENST00000554969.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000555883.1_Missense_Mutation_p.S153Y|HNRNPC_ENST00000555914.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000556897.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000553753.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000449098.1_Missense_Mutation_p.S196Y|HNRNPC_ENST00000430246.2_Missense_Mutation_p.S196Y|HNRNPC_ENST00000556513.1_Missense_Mutation_p.S209Y	p.S209Y	NM_001077442.1	NP_001070910.1	1	2	3	2.016841	P07910	HNRPC_HUMAN	Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	6	865	-	all_cancers(95;0.00176)		D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Missense_Mutation	SNP	ENST00000320084.7	1	1	hg19	c.626C>A	CCDS41915.1	0	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282988	0.23392	.	.	ENSG00000092199	ENST00000336053;ENST00000320084;ENST00000449098;ENST00000554969;ENST00000556142;ENST00000554455;ENST00000430246;ENST00000553753;ENST00000555914;ENST00000555309;ENST00000556628;ENST00000555883;ENST00000556513;ENST00000557201;ENST00000553300;ENST00000216296;ENST00000556897;ENST00000420743;ENST00000557157;ENST00000445284;ENST00000554539;ENST00000554383	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.15603	2.79;2.97;2.82;2.82;2.81;2.97;2.82;2.79;2.82;2.99;2.41;2.59;2.81;2.97;2.82;2.82;2.97;2.63;2.41;2.8	5.34	4.43	0.53597	5.340000	4.430000	0.535970	.	0.215683	0.29565	U	0.011792	T	0.17066	0.0410	L	0.44542	1.39	0.35600	D	0.807759	B;B;B;B;B;B;B	0.30482	0.182;0.101;0.039;0.001;0.281;0.185;0.162	B;B;B;B;B;B;B	0.29524	0.045;0.026;0.057;0.005;0.103;0.032;0.094	T	0.14062	-1.0486	10	0.48119	T	0.1	.	14.5545	0.68091	0.0:0.0:0.8522:0.1478	.	104;196;129;153;196;209;196	B4DQQ2;B4DY08;P07910-3;P07910-4;G3V4C1;P07910;P07910-2	.;.;.;.;.;HNRPC_HUMAN;.	Y	196;209;196;196;209;209;196;196;196;209;129;153;209;209;196;104;196;209;117;209;93;196	ENSP00000338095:S196Y;ENSP00000319690:S209Y;ENSP00000404559:S196Y;ENSP00000450725:S196Y;ENSP00000451187:S209Y;ENSP00000451291:S209Y;ENSP00000442816:S196Y;ENSP00000450548:S196Y;ENSP00000451708:S196Y;ENSP00000450790:S209Y;ENSP00000451652:S129Y;ENSP00000450629:S153Y;ENSP00000452214:S209Y;ENSP00000452276:S209Y;ENSP00000450544:S196Y;ENSP00000451176:S196Y;ENSP00000404848:S209Y;ENSP00000450601:S117Y;ENSP00000452545:S93Y;ENSP00000452021:S196Y	ENSP00000216296:S104Y	S	-	2	0	0	HNRNPC	20749859	20749859	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.949000	0.63596	1.358000	0.45922	0.655000	0.94253	TCT	0.166667		TCGA-HZ-8003-01A-21D-2201-08	0.363	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1	0	0	1	2	2	31	2	1	1	1	0	119	119	119	119	1	2	-2.624841	1	0.160000			0	25	25	0	1059	1028	1		1	1		1	0	119	0	0	9.999997e-01	4.110100e-01	0	127	0	1097	0	25	1059
SYNE2	23224	broad.mit.edu	37	14	64580216	64580216	+	Missense_Mutation	SNP	A	A	G	rs552966507		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr14:64580216A>G	ENST00000344113.4	+	66	12979	c.12767A>G	c.(12766-12768)aAc>aGc	p.N4256S	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.N890S|SYNE2_ENST00000358025.3_Missense_Mutation_p.N4256S|SYNE2_ENST00000357395.3_Missense_Mutation_p.N641S|SYNE2_ENST00000554584.1_Missense_Mutation_p.N4271S|SYNE2_ENST00000394768.2_Missense_Mutation_p.N641S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4256					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAACAAGCCAACGTGGCAGTT	0.577																																						ENST00000344113.4	1.000000	0.310000	0.870000	0.440000	0.610000	0.647840	0.610000	1.000000																										0				224						c.(12766-12768)aAc>aGc		spectrin repeat containing, nuclear envelope 2							36.0	34.0	35.0					14																	64580216		2203	4300	6503	SO:0001583	missense	23224	0	0					g.chr14:64580216A>G	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.12767A>G	chr14.hg19:g.64580216A>G	ENSP00000341781:p.Asn4256Ser	0					SYNE2_ENST00000357395.3_Missense_Mutation_p.N641S|SYNE2_ENST00000358025.3_Missense_Mutation_p.N4256S|SYNE2_ENST00000555002.1_Missense_Mutation_p.N890S|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Missense_Mutation_p.N4271S|SYNE2_ENST00000394768.2_Missense_Mutation_p.N641S	p.N4256S	NM_015180.4	NP_055995.4	1	2	3	2.014147	Q8WXH0	SYNE2_HUMAN		66	12979	+			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	1	1	hg19	c.12767A>G	CCDS41963.1	0	.	.	.	.	.	.	.	.	.	.	A	12.33	1.904349	0.33628	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000553308	T;T;T;T;T;T	0.56611	0.84;4.14;0.84;0.45;4.19;4.14	5.73	0.724	0.18236	5.730000	0.724000	0.182360	.	0.494042	0.20205	N	0.097004	T	0.37758	0.1015	L	0.32530	0.975	0.80722	D	1	B;B;B	0.23377	0.004;0.051;0.084	B;B;B	0.18561	0.008;0.01;0.022	T	0.10989	-1.0606	10	0.46703	T	0.11	.	9.7131	0.40258	0.7534:0.0:0.2466:0.0	.	641;4256;4256	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	S	4256;641;4256;4271;4271;890;641;148	ENSP00000350719:N4256S;ENSP00000349969:N641S;ENSP00000341781:N4256S;ENSP00000452570:N4271S;ENSP00000450831:N890S;ENSP00000378249:N641S	ENSP00000261678:N4271S	N	+	2	0	0	SYNE2	63649969	63649969	0.765000	0.28485	0.998000	0.56505	0.999000	0.98932	0.068000	0.14531	-0.097000	0.12307	0.533000	0.62120	AAC	0.166005		TCGA-HZ-8003-01A-21D-2201-08	0.577	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	2	-13.252750	1	0.160000	NM_182914		0	10	9	0	205	197	0		1	1		0	0	53	0	0	9.963774e-01	5.328914e-01	0	5	0	31	0	10	205
WDR90	197335	broad.mit.edu	37	16	716059	716059	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr16:716059C>T	ENST00000293879.4	+	36	4544	c.4544C>T	c.(4543-4545)aCg>aTg	p.T1515M	WDR90_ENST00000547543.1_3'UTR|RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000549091.1_Missense_Mutation_p.T1517M|WDR90_ENST00000315764.4_Missense_Mutation_p.T114M|WDR90_ENST00000547944.1_Missense_Mutation_p.T114M			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1515										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTCTCCCGCACGGCCATGGAG	0.677																																						ENST00000293879.4	1.000000	0.150000	0.390000	0.210000	0.280000	0.346492	0.280000	0.270000																										0				37						c.(4543-4545)aCg>aTg		WD repeat domain 90							49.0	53.0	52.0					16																	716059		2132	4228	6360	SO:0001583	missense	197335	4	120706	37				g.chr16:716059C>T	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4544C>T	chr16.hg19:g.716059C>T	ENSP00000293879:p.Thr1515Met	0					WDR90_ENST00000547543.1_3'UTR|WDR90_ENST00000549091.1_Missense_Mutation_p.T1517M|WDR90_ENST00000547944.1_Missense_Mutation_p.T114M|RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000315764.4_Missense_Mutation_p.T114M	p.T1515M			1	2	3	2.016491	Q96KV7	WDR90_HUMAN		36	4544	+		Hepatocellular(780;0.0218)	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	0	1	hg19	c.4544C>T	CCDS42092.1	0	.	.	.	.	.	.	.	.	.	.	C	5.658	0.306009	0.10733	.	.	ENSG00000161996	ENST00000549091;ENST00000293879;ENST00000547944;ENST00000315764	T;T;T;T	0.65549	3.43;1.56;-0.16;1.62	4.45	1.23	0.21249	4.450000	1.230000	0.212490	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	1.085630	0.06926	N	0.810310	T	0.47173	0.1431	L	0.41027	1.25	0.09310	N	1	P;P;P;P	0.45428	0.858;0.823;0.621;0.729	B;B;B;B	0.33042	0.133;0.157;0.05;0.121	T	0.28618	-1.0038	10	0.33940	T	0.23	.	8.6721	0.34156	0.0:0.8547:0.0:0.1453	.	114;114;114;1515	Q96KV7-10;Q96KV7-7;G3V201;Q96KV7	.;.;.;WDR90_HUMAN	M	1517;1515;114;114	ENSP00000448122:T1517M;ENSP00000293879:T1515M;ENSP00000449576:T114M;ENSP00000322808:T114M	ENSP00000293879:T1515M	T	+	2	0	0	WDR90	656060	656060	0.364000	0.24997	0.000000	0.03702	0.097000	0.18754	2.238000	0.43070	-0.005000	0.14395	0.561000	0.74099	ACG	0.166667		TCGA-HZ-8003-01A-21D-2201-08	0.677	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	0	0	1	2	2	2	2	0	0	0	0	117	117	117	116	1	2	-3.024447	1	0.160000	NM_145294		0	14	14	0	633	622	0		1	0		0	0	117	0	0	9.997215e-01	2.654613e-02	0	0	0	11	0	14	633
SRCAP	10847	broad.mit.edu	37	16	30723229	30723229	+	Silent	SNP	A	A	G	rs527648472		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr16:30723229A>G	ENST00000262518.4	+	12	1951	c.1566A>G	c.(1564-1566)gcA>gcG	p.A522A	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Silent_p.A522A|SRCAP_ENST00000344771.4_Silent_p.A522A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	522	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GAAGTTCAGCATCAGAGGAAT	0.483																																						ENST00000262518.4	1.000000	0.210000	0.570000	0.290000	0.390000	0.459368	0.390000	0.360000																										0				136						c.(1564-1566)gcA>gcG		Snf2-related CREBBP activator protein							79.0	77.0	78.0					16																	30723229		2197	4300	6497	SO:0001819	synonymous_variant	10847	2	121412	40				g.chr16:30723229A>G	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1566A>G	chr16.hg19:g.30723229A>G		0					SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000344771.4_Silent_p.A522A|SRCAP_ENST00000395059.2_Silent_p.A522A	p.A522A	NM_006662.2	NP_006653.2	1	2	3	2.025899	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)	12	1951	+			B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	1	1	hg19	c.1566A>G	CCDS10689.2	0																																																																																								0.168646		TCGA-HZ-8003-01A-21D-2201-08	0.483	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	2	-12.781280	1	0.160000	NM_006662		0	13	12	0	426	417	1		1	1		0	0	76	0	0	9.994734e-01	5.296234e-01	0	10	0	46	0	13	426
ANKRD11	29123	broad.mit.edu	37	16	89346134	89346134	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr16:89346134G>A	ENST00000301030.4	-	9	7276	c.6816C>T	c.(6814-6816)gaC>gaT	p.D2272D	ANKRD11_ENST00000378330.2_Silent_p.D2272D	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2272	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GGGCGGGGCCGTCAGGGGCAC	0.756																																						ENST00000301030.4	1.000000	0.290000	1.000000	0.560000	0.990000	0.839727	0.990000	1.000000																										0				83						c.(6814-6816)gaC>gaT		ankyrin repeat domain 11							3.0	4.0	4.0					16																	89346134		1365	3065	4430	SO:0001819	synonymous_variant	29123	1	111222	22				g.chr16:89346134G>A	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6816C>T	chr16.hg19:g.89346134G>A		0					ANKRD11_ENST00000378330.2_Silent_p.D2272D	p.D2272D	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	1	2	3	2.061087	Q6UB99	ANR11_HUMAN		9	7276	-		all_hematologic(23;0.00824)|Colorectal(91;0.0475)	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	0	1	hg19	c.6816C>T	CCDS32513.1	1																																																																																								0.175824		TCGA-HZ-8003-01A-21D-2201-08	0.756	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	0	0	1	2	2	2	2	0	0	0	0	21	21	21	22	1	2	-8.793342	1	0.160000	NM_013275		0	3	3	0	42	38	0		1			0	0	21	0	0	7.818303e-01	0	0	0	0	0	0	3	42
DHX58	79132	broad.mit.edu	37	17	40262918	40262918	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:40262918G>A	ENST00000251642.3	-	5	606	c.384C>T	c.(382-384)atC>atT	p.I128I		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	128	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CATCCACCACGATCAGGGAGA	0.542																																						ENST00000251642.3	1.000000	0.270000	0.520000	0.340000	0.410000	0.448292	0.410000	0.410000																										0				16						c.(382-384)atC>atT		DEXH (Asp-Glu-X-His) box polypeptide 58							136.0	117.0	123.0					17																	40262918		2203	4300	6503	SO:0001819	synonymous_variant	79132	0	0					g.chr17:40262918G>A	BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.384C>T	chr17.hg19:g.40262918G>A		0						p.I128I	NM_024119.2	NP_077024.2	1	2	3	2.004222	Q96C10	DHX58_HUMAN		5	606	-		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)	Q9HAM6	Silent	SNP	ENST00000251642.3	1	1	hg19	c.384C>T	CCDS11416.1	0																																																																																								0.164013		TCGA-HZ-8003-01A-21D-2201-08	0.542	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	0	0	1	2	2	2	2	0	0	0	0	110	110	110	110	1	2	-2.998511	1	0.160000	NM_024119		0	27	26	0	801	785	0		1	1		0	0	110	0	0	9.999999e-01	3.424598e-01	0	10	0	26	0	27	801
TP53	7157	broad.mit.edu	37	17	7579317	7579317	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:7579317A>G	ENST00000269305.4	-	4	559	c.370T>C	c.(370-372)Tgc>Cgc	p.C124R	TP53_ENST00000445888.2_Missense_Mutation_p.C124R|TP53_ENST00000359597.4_Missense_Mutation_p.C124R|TP53_ENST00000413465.2_Missense_Mutation_p.C124R|TP53_ENST00000455263.2_Missense_Mutation_p.C124R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C124R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C124G(4)|p.C124R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.C124fs*46(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.C124fs*48(1)|p.C124fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGACCGTGCAAGTCACAGAC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.110000	0.300000	0.150000	0.210000	0.259408	0.210000	0.210000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		28	Deletion - Frameshift(9)|Substitution - Missense(8)|Whole gene deletion(8)|Insertion - Frameshift(2)|Deletion - In frame(1)	p.0?(8)|p.C124G(4)|p.C124R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.C124fs*46(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.C124fs*48(1)|p.C124fs*25(1)	ovary(5)|upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(3)|breast(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)	24185						c.(370-372)Tgc>Cgc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						66.0	62.0	63.0					17																	7579317		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7579317A>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.370T>C	chr17.hg19:g.7579317A>G	ENSP00000269305:p.Cys124Arg	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.C124R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C124R|TP53_ENST00000420246.2_Missense_Mutation_p.C124R|TP53_ENST00000359597.4_Missense_Mutation_p.C124R|TP53_ENST00000413465.2_Missense_Mutation_p.C124R	p.C124R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	1	2	3	2.004222	P04637	P53_HUMAN		4	559	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.370T>C	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075353	0.76415	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99751	-6.63;-6.63;-6.63;-6.63;-6.63;-6.63;-6.63;-6.63	4.75	4.75	0.60458	4.750000	4.750000	0.604580	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.099990	0.64402	D	0.000002	D	0.99674	0.9878	M	0.78049	2.395	0.80722	D	1	D;P;D;P;D;D;D	0.89917	0.988;0.934;1.0;0.923;0.999;1.0;0.986	P;P;D;P;D;D;D	0.91635	0.883;0.806;0.997;0.63;0.995;0.999;0.918	D	0.97415	1.0005	10	0.72032	D	0.01	-11.7577	12.5363	0.56144	1.0:0.0:0.0:0.0	.	85;124;124;124;124;124;124	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	124;124;124;124;124;124;113;124;124	ENSP00000410739:C124R;ENSP00000352610:C124R;ENSP00000269305:C124R;ENSP00000398846:C124R;ENSP00000391127:C124R;ENSP00000391478:C124R;ENSP00000424104:C124R;ENSP00000426252:C124R	ENSP00000269305:C124R	C	-	1	0	0	TP53	7520042	7520042	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	5.673000	0.68109	2.125000	0.65367	0.533000	0.62120	TGC	0.164013		TCGA-HZ-8003-01A-21D-2201-08	0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	0	0	1	2	2	2	2	0	0	0	0	140	140	140	139	1	2	-8.451235	1	0.160000	NM_000546		0	11	11	0	658	643	0		1	1	1	0	0	140	69	0	9.981255e-01	4.569220e-01	5.898037e-01	15	6	73	109	11	658
PDK2	5164	broad.mit.edu	37	17	48187345	48187345	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:48187345C>A	ENST00000503176.1	+	11	1269	c.1108C>A	c.(1108-1110)Cgc>Agc	p.R370S	PDK2_ENST00000007708.3_Missense_Mutation_p.R306S	NM_002611.4	NP_002602.2	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase, isozyme 2	370					cellular metabolic process (GO:0044237)|cellular response to nutrient (GO:0031670)|cellular response to reactive oxygen species (GO:0034614)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of gluconeogenesis (GO:0006111)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	20						CTCGGTGGAGCGCCTGCCTGT	0.662									Autosomal Dominant Polycystic Kidney Disease																													ENST00000503176.1	1.000000	0.210000	1.000000	0.420000	0.740000	0.721220	0.740000	1.000000																										0				20						c.(1108-1110)Cgc>Agc		pyruvate dehydrogenase kinase, isozyme 2							28.0	25.0	26.0					17																	48187345		2193	4287	6480	SO:0001583	missense	5164	0	0		Autosomal Dominant Polycystic Kidney Disease	Familial Cancer Database	ADPKD	g.chr17:48187345C>A	L42451	CCDS11559.1, CCDS56039.1	17q21.33	2012-07-18	2005-11-16		ENSG00000005882	ENSG00000005882			8810	protein-coding gene	gene with protein product		602525	"""pyruvate dehydrogenase kinase, isoenzyme 2"""			7499431	Standard	NM_001199898		Approved	PDHK2	uc002iqc.3	Q15119	OTTHUMG00000161948	ENST00000503176.1:c.1108C>A	chr17.hg19:g.48187345C>A	ENSP00000420927:p.Arg370Ser	0					PDK2_ENST00000007708.3_Missense_Mutation_p.R306S	p.R370S	NM_002611.4	NP_002602.2	1	2	3	2.004222	Q15119	PDK2_HUMAN		11	1269	+			A8K3A7|B3KNW0|Q6P515|Q9BS05	Missense_Mutation	SNP	ENST00000503176.1	0	1	hg19	c.1108C>A	CCDS11559.1	0	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654518	0.47467	.	.	ENSG00000005882	ENST00000007708;ENST00000503176	T;T	0.42513	0.98;0.97	4.31	4.31	0.51392	4.310000	4.310000	0.513920	ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.41811	0.1175	M	0.79475	2.455	0.53005	D	0.99996	P	0.41929	0.765	B	0.38327	0.271	T	0.41233	-0.9520	10	0.35671	T	0.21	-19.2597	10.1095	0.42555	0.3243:0.6757:0.0:0.0	.	370	Q15119	PDK2_HUMAN	S	306;370	ENSP00000007708:R306S;ENSP00000420927:R370S	ENSP00000007708:R306S	R	+	1	0	0	PDK2	45542344	45542344	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.365000	0.52335	2.121000	0.65114	0.462000	0.41574	CGC	0.164013		TCGA-HZ-8003-01A-21D-2201-08	0.662	PDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366492.2	0	0	0	2	2	2	2	0	0	0	0	17	17	17	17	1	2	-7.402529	1	0.160000	NM_002611		0	3	3	0	54	53	0		1	0		0	0	17	0	0	8.069441e-01	9.588789e-01	0	0	0	118	0	3	54
NOTUM	147111	broad.mit.edu	37	17	79910974	79910974	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr17:79910974C>T	ENST00000409678.3	-	11	1737	c.1354G>A	c.(1354-1356)Gtc>Atc	p.V452I		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	452						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TGGTCTCGGACGGTGGGGCAT	0.662																																						ENST00000409678.3	1.000000	0.080000	0.310000	0.130000	0.200000	0.253273	0.200000	0.190000																										0				15						c.(1354-1356)Gtc>Atc		notum pectinacetylesterase homolog (Drosophila)							53.0	45.0	48.0					17																	79910974		2203	4299	6502	SO:0001583	missense	147111	1	121412	28				g.chr17:79910974C>T	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.1354G>A	chr17.hg19:g.79910974C>T	ENSP00000387310:p.Val452Ile	0						p.V452I	NM_178493.5	NP_848588.3	1	2	3	2.004222	Q6P988	NOTUM_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)	11	1737	-	all_neural(118;0.0878)|Ovarian(332;0.12)		Q8N410|Q8NI82	Missense_Mutation	SNP	ENST00000409678.3	0	1	hg19	c.1354G>A	CCDS32771.2	0	.	.	.	.	.	.	.	.	.	.	C	5.424	0.263310	0.10294	.	.	ENSG00000185269	ENST00000409678	.	.	.	4.84	1.17	0.20885	4.840000	1.170000	0.208850	.	0.216848	0.47852	N	0.000211	T	0.07188	0.0182	N	0.01352	-0.895	0.21473	N	0.999676	B	0.02656	0.0	B	0.01281	0.0	T	0.38045	-0.9679	9	0.02654	T	1	.	5.2505	0.15519	0.0:0.1662:0.1503:0.6835	.	452	Q6P988	NOTUM_HUMAN	I	452	.	ENSP00000387310:V452I	V	-	1	0	0	NOTUM	77504264	77504264	1.000000	0.71417	0.999000	0.59377	0.882000	0.50991	1.932000	0.40143	0.228000	0.21019	-0.402000	0.06365	GTC	0.164013		TCGA-HZ-8003-01A-21D-2201-08	0.662	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335123.2	0	0	0	2	2	2	2	0	0	0	0	76	76	76	76	1	2	-6.312783	1	0.160000	NM_178493		0	7	7	0	450	437	0		1	0		0	0	76	0	0	9.786830e-01	0	0	0	0	1	0	7	450
SPC24	147841	broad.mit.edu	37	19	11258504	11258504	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:11258504C>A	ENST00000592540.1	-	4	508	c.477G>T	c.(475-477)atG>atT	p.M159I		NM_182513.2	NP_872319.1	Q8NBT2	SPC24_HUMAN	SPC24, NDC80 kinetochore complex component	159	Interaction with the C-terminus of SPBC25.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleolus (GO:0005730)|nucleus (GO:0005634)				autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	5						TGCCTTTGACCATCCCTGGCT	0.413																																						ENST00000592540.1	1.000000	0.200000	0.950000	0.350000	0.550000	0.601977	0.550000	1.000000																										0				5						c.(475-477)atG>atT		SPC24, NDC80 kinetochore complex component							57.0	59.0	58.0					19																	11258504		1911	4119	6030	SO:0001583	missense	147841	0	0					g.chr19:11258504C>A	AK075287	CCDS45974.1	19p13.2	2013-06-05	2013-06-05	2007-03-02		ENSG00000161888			26913	protein-coding gene	gene with protein product		609394	"""spindle pole body component 24 homolog (S. cerevisiae)"", ""SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC24			Standard	NM_182513		Approved	FLJ90806	uc002mql.2	Q8NBT2		ENST00000592540.1:c.477G>T	chr19.hg19:g.11258504C>A	ENSP00000465075:p.Met159Ile	0						p.M159I	NM_182513.2	NP_872319.1	1	2	3	2.029693	Q8NBT2	SPC24_HUMAN		4	508	-			B4DZZ7|C9JGC4	Missense_Mutation	SNP	ENST00000592540.1	0	1	hg19	c.477G>T	CCDS45974.1	0	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.267896	0.00259	.	.	ENSG00000161888	ENST00000429831;ENST00000423327	.	.	.	5.09	-3.27	0.05048	5.090000	-3.270000	0.050480	.	0.808315	0.11282	N	0.580210	T	0.20901	0.0503	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26744	-1.0094	9	0.19590	T	0.45	-10.8297	8.142	0.31089	0.1205:0.2107:0.5919:0.077	.	159	Q8NBT2	SPC24_HUMAN	I	113;159	.	ENSP00000397131:M159I	M	-	3	0	0	SPC24	11119504	11119504	0.000000	0.05858	0.007000	0.13788	0.124000	0.20399	-0.899000	0.04101	-0.105000	0.12132	-0.150000	0.13652	ATG	0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.413	SPC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453059.1	0	0	0	2	2	2	2	0	0	0	0	11	11	11	11	1	2	-8.036516	1	0.160000	NM_182513		0	5	2	0	124	120	0		1	0		0	0	11	0	0	9.292268e-01	1.343387e-02	0	0	0	4	0	5	124
CCDC159	126075	broad.mit.edu	37	19	11464523	11464523	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:11464523G>T	ENST00000588790.1	+	11	1192	c.745G>T	c.(745-747)Gcc>Tcc	p.A249S	DKFZP761J1410_ENST00000251473.5_5'Flank|CCDC159_ENST00000458408.1_Missense_Mutation_p.A249S|DKFZP761J1410_ENST00000591608.1_5'Flank			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	364										endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						GTGCTCGGGGGCCTGTCCCAA	0.587																																						ENST00000588790.1	1.000000	0.600000	1.000000	0.910000	0.990000	0.957623	0.990000	1.000000																										0				5						c.(745-747)Gcc>Tcc		coiled-coil domain containing 159							19.0	21.0	20.0					19																	11464523		1911	4137	6048	SO:0001583	missense	126075	0	0					g.chr19:11464523G>T	BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.745G>T	chr19.hg19:g.11464523G>T	ENSP00000468232:p.Ala249Ser	0					DKFZP761J1410_ENST00000591608.1_5'Flank|CCDC159_ENST00000458408.1_Missense_Mutation_p.A249S|DKFZP761J1410_ENST00000251473.5_5'Flank	p.A249S			1	2	3	2.029693	P0C7I6	CC159_HUMAN		11	1192	+			B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	ENST00000588790.1	0	1	hg19	c.745G>T	CCDS45976.1	1	.	.	.	.	.	.	.	.	.	.	G	6.981	0.551134	0.13374	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.44881	0.91	4.03	-1.86	0.07760	4.030000	-1.860000	0.077600	.	.	.	.	.	T	0.20618	0.0496	N	0.22421	0.69	0.09310	N	1	B;B	0.19200	0.034;0.003	B;B	0.21151	0.033;0.01	T	0.28933	-1.0028	9	0.10377	T	0.69	.	3.2836	0.06924	0.4716:0.0:0.3389:0.1894	.	364;249	P0C7I6;P0C7I6-2	CC159_HUMAN;.	S	249;364	ENSP00000402239:A249S	ENSP00000390400:A364S	A	+	1	0	0	CCDC159	11325523	11325523	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.226000	0.17776	-0.209000	0.10156	0.313000	0.20887	GCC	0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.587	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458761.1	0	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	2	-2.607937	1	0.160000	NM_001080503		0	7	6	0	62	61	0		1	0		0	0	8	0	0	9.805284e-01	8.287214e-01	0	0	0	30	0	7	62
ZNF442	79973	broad.mit.edu	37	19	12462842	12462842	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:12462842T>C	ENST00000242804.4	-	5	830	c.248A>G	c.(247-249)aAt>aGt	p.N83S	ZNF442_ENST00000438182.1_Missense_Mutation_p.N14S	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	83	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						CCTCCTGGGATTTCTGTGCTG	0.358																																						ENST00000242804.4	1.000000	0.200000	0.520000	0.270000	0.360000	0.437705	0.360000	0.350000																										0				31						c.(247-249)aAt>aGt		zinc finger protein 442							133.0	122.0	126.0					19																	12462842		2203	4300	6503	SO:0001583	missense	79973	0	0					g.chr19:12462842T>C	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.248A>G	chr19.hg19:g.12462842T>C	ENSP00000242804:p.Asn83Ser	0					ZNF442_ENST00000438182.1_Missense_Mutation_p.N14S	p.N83S	NM_030824.2	NP_110451.1	1	2	3	2.029693	Q9H7R0	ZN442_HUMAN		5	830	-			B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	1	1	hg19	c.248A>G	CCDS12271.1	0	.	.	.	.	.	.	.	.	.	.	T	11.22	1.573187	0.28092	.	.	ENSG00000198342	ENST00000242804;ENST00000438182;ENST00000424168	T;T;T	0.06371	3.41;3.31;3.99	1.51	1.51	0.23008	1.510000	1.510000	0.230080	Krueppel-associated box (3);	.	.	.	.	T	0.02970	0.0088	N	0.13327	0.33	0.09310	N	1	P	0.36616	0.561	B	0.32864	0.154	T	0.43589	-0.9382	9	0.14656	T	0.56	.	5.4007	0.16295	0.0:0.0:0.0:1.0	.	83	Q9H7R0	ZN442_HUMAN	S	83;14;14	ENSP00000242804:N83S;ENSP00000388634:N14S;ENSP00000404935:N14S	ENSP00000242804:N83S	N	-	2	0	0	ZNF442	12323842	12323842	0.003000	0.15002	0.232000	0.24009	0.613000	0.37349	0.306000	0.19279	0.617000	0.30160	0.260000	0.18958	AAT	0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.358	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	0	0	1	2	2	2	2	0	0	0	0	51	51	51	51	1	2	-3.563255	1	0.160000	NM_030824		0	15	13	0	529	508	0		1	0		0	0	51	0	0	9.998278e-01	1.251004e-02	0	0	0	6	0	15	529
AP3D1	8943	broad.mit.edu	37	19	2110781	2110781	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:2110781G>A	ENST00000345016.5	-	25	3145	c.2914C>T	c.(2914-2916)Ctc>Ttc	p.L972F	AP3D1_ENST00000350812.6_Missense_Mutation_p.L803F|AP3D1_ENST00000355272.6_Missense_Mutation_p.L1034F|AP3D1_ENST00000356926.4_Missense_Mutation_p.L931F	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	972					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGCATTGAGTGAGTCCAGC	0.667																																						ENST00000345016.5	1.000000	0.310000	0.850000	0.430000	0.580000	0.628511	0.580000	0.550000																										0				37						c.(2914-2916)Ctc>Ttc		adaptor-related protein complex 3, delta 1 subunit							35.0	40.0	38.0					19																	2110781		2202	4298	6500	SO:0001583	missense	8943	0	0					g.chr19:2110781G>A	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2914C>T	chr19.hg19:g.2110781G>A	ENSP00000344055:p.Leu972Phe	0					AP3D1_ENST00000356926.4_Missense_Mutation_p.L931F|AP3D1_ENST00000350812.6_Missense_Mutation_p.L803F|AP3D1_ENST00000355272.6_Missense_Mutation_p.L1034F	p.L972F	NM_003938.6	NP_003929.4	1	2	3	2.029693	O14617	AP3D1_HUMAN		25	3145	-		Hepatocellular(1079;0.137)	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	0	1	hg19	c.2914C>T	CCDS42459.1	0	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297458	0.81025	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	4.81	3.76	0.43208	4.810000	3.760000	0.432080	.	0.000000	0.64402	D	0.000001	T	0.68357	0.2992	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.994;0.992	D;D;D;P	0.85130	0.958;0.997;0.924;0.876	T	0.69007	-0.5259	10	0.44086	T	0.13	-39.004	12.0641	0.53578	0.0879:0.0:0.9121:0.0	.	803;1034;972;931	E7EMM2;O14617-5;O14617;G5E988	.;.;AP3D1_HUMAN;.	F	931;972;1034;840;803	ENSP00000349398:L931F;ENSP00000344055:L972F;ENSP00000347416:L1034F;ENSP00000342321:L803F	ENSP00000341579:L840F	L	-	1	0	0	AP3D1	2061781	2061781	1.000000	0.71417	0.960000	0.40013	0.959000	0.62525	6.290000	0.72712	2.214000	0.71695	0.491000	0.48974	CTC	0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.667	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1	0	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	2	-14.320280	1	0.160000			0	12	11	0	263	256	1		1	1		0	0	36	0	0	9.990102e-01	9.806551e-01	0	16	0	131	0	12	263
CYP4F11	57834	broad.mit.edu	37	19	16024638	16024638	+	Silent	SNP	C	C	T	rs143714626		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:16024638C>T	ENST00000402119.4	-	12	1905	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P	CYP4F11_ENST00000326742.8_3'UTR|CYP4F11_ENST00000591841.1_Silent_p.P168P|CYP4F11_ENST00000248041.8_Silent_p.P493P	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						CAGTGTGGGTCGGCAGGATGC	0.627													.|||	1	0.000199681	0.0008	0.0	5008	,	,		15878	0.0		0.0	False		,,,				2504	0.0					ENST00000402119.4	1.000000	0.110000	0.490000	0.190000	0.290000	0.376260	0.290000	0.250000																										0				25						c.(1477-1479)ccG>ccA		cytochrome P450, family 4, subfamily F, polypeptide 11		C	,	6,4400	11.4+/-27.6	0,6,2197	66.0	59.0	62.0		1479,1479	-5.5	0.0	19	dbSNP_134	62	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CYP4F11	NM_001128932.1,NM_021187.3	,	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	,	493/525,493/525	16024638	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	57834	7	121412	39				g.chr19:16024638C>T	AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.1479G>A	chr19.hg19:g.16024638C>T		0					CYP4F11_ENST00000248041.8_Silent_p.P493P|CYP4F11_ENST00000591841.1_Silent_p.P168P|CYP4F11_ENST00000326742.8_3'UTR	p.P493P	NM_021187.3	NP_067010.3	1	2	3	2.029693				12	1905	-				Silent	SNP	ENST00000402119.4	0	1	hg19	c.1479G>A	CCDS12337.1	0																																																																																								0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.627	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460385.2	0	0	1	2	2	2	2	0	0	0	0	46	46	46	46	1	2	-6.868998	1	0.160000	NM_021187		0	6	6	0	284	271	0		1	1		0	0	46	0	0	9.601589e-01	7.994487e-02	0	2	0	17	0	6	284
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																						ENST00000397910.4	1.000000	0.080000	0.300000	0.120000	0.180000	0.280620	0.180000	0.170000																										0				590						c.(982-984)ccT>ccC		mucin 16, cell surface associated							96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9090831A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	chr19.hg19:g.9090831A>G		0						p.P328P	NM_024690.2	NP_078966.2	1	2	3	2.029693	Q8WXI7	MUC16_HUMAN		1	1187	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.984T>C	CCDS54212.1	0																																																																																								0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	2	-2.340643	0	0.160000	NM_024690		0	8	7	0	583	571	0		1			0	0	67	0	0	9.884413e-01	0	0	0	0	0	0	8	583
ZNF134	7693	broad.mit.edu	37	19	58131705	58131705	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr19:58131705A>G	ENST00000396161.5	+	3	528	c.218A>G	c.(217-219)cAt>cGt	p.H73R	ZNF134_ENST00000597975.1_3'UTR	NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	73					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GGTACACACCATGGACTGAAA	0.488																																						ENST00000396161.5	0.320000	0.100000	0.260000	0.140000	0.190000	0.207953	0.190000	0.190000																										0				11						c.(217-219)cAt>cGt		zinc finger protein 134							107.0	104.0	105.0					19																	58131705		2043	4224	6267	SO:0001583	missense	7693	0	0					g.chr19:58131705A>G	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.218A>G	chr19.hg19:g.58131705A>G	ENSP00000379464:p.His73Arg	0					ZNF134_ENST00000597975.1_3'UTR	p.H73R	NM_003435.3	NP_003426.3	0	0	0	1.944917	P52741	ZN134_HUMAN		3	528	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	Q9Y4B2	Missense_Mutation	SNP	ENST00000396161.5	0	1	hg19	c.218A>G	CCDS42638.1	0	.	.	.	.	.	.	.	.	.	.	A	9.039	0.989204	0.18966	.	.	ENSG00000213762	ENST00000418193;ENST00000396161	T	0.19394	2.15	4.05	-1.24	0.09435	4.050000	-1.240000	0.094350	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11024	0.0269	N	0.21583	0.68	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.34403	-0.9830	9	0.87932	D	0	.	0.8496	0.01169	0.3547:0.262:0.0975:0.2858	.	73	P52741	ZN134_HUMAN	R	140;73	ENSP00000379464:H73R	ENSP00000379464:H73R	H	+	2	0	0	ZNF134	62823517	62823517	0.000000	0.05858	0.000000	0.03702	0.969000	0.65631	-1.220000	0.02971	-0.103000	0.12175	0.533000	0.62120	CAT	0.132231		TCGA-HZ-8003-01A-21D-2201-08	0.488	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	0	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	2	-3.322656	1	0.160000	NM_003435		0	13	13	0	793	769	0		1	0		0	0	112	0	0	9.994290e-01	8.698892e-02	0	1	0	27	0	13	793
TXNIP	10628	broad.mit.edu	37	1	145440118	145440118	+	Silent	SNP	T	T	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:145440118T>A	ENST00000369317.4	+	4	886	c.552T>A	c.(550-552)atT>atA	p.I184I	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	184					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGCTCGAATTGACAGAAAAG	0.448																																						ENST00000369317.4	1.000000	0.360000	0.620000	0.420000	0.500000	0.556546	0.500000	0.490000																										0				21						c.(550-552)atT>atA		thioredoxin interacting protein							148.0	162.0	157.0					1																	145440118		2203	4300	6503	SO:0001819	synonymous_variant	10628	0	0					g.chr1:145440118T>A	S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.552T>A	chr1.hg19:g.145440118T>A		0					TXNIP_ENST00000475171.1_Intron	p.I184I	NM_006472.3	NP_006463.3	1	2	3	2.028002	Q9H3M7	TXNIP_HUMAN		4	886	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		B4E3D3|Q16226|Q6PML0|Q9BXG9	Silent	SNP	ENST00000369317.4	1	1	hg19	c.552T>A	CCDS913.1	0																																																																																								0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.448	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	1	0	1	2	2	2	2	0	0	0	0	186	186	186	185	1	2	-20.000000	1	0.160000	NM_006472		0	45	45	0	1109	1085	0		1	1		0	0	186	0	0	1	1	0	136	0	2573	0	45	1109
SPTA1	6708	broad.mit.edu	37	1	158631116	158631116	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:158631116G>C	ENST00000368147.4	-	18	2728	c.2548C>G	c.(2548-2550)Caa>Gaa	p.Q850E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	850					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTTATCTCTTGAATGCGTGGT	0.443																																						ENST00000368147.4	1.000000	0.190000	0.420000	0.240000	0.310000	0.387959	0.310000	0.300000																										0				307						c.(2548-2550)Caa>Gaa		spectrin, alpha, erythrocytic 1							262.0	255.0	258.0					1																	158631116		1934	4151	6085	SO:0001583	missense	6708	0	0					g.chr1:158631116G>C	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2548C>G	chr1.hg19:g.158631116G>C	ENSP00000357129:p.Gln850Glu	0						p.Q850E	NM_003126.2	NP_003117.2	1	2	3	2.028002	P02549	SPTA1_HUMAN		18	2728	-	all_hematologic(112;0.0378)		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	1	1	hg19	c.2548C>G	CCDS41423.1	0	.	.	.	.	.	.	.	.	.	.	G	0.767	-0.767128	0.02974	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.30448	1.53;1.53	4.81	3.88	0.44766	4.810000	3.880000	0.447660	.	.	.	.	.	T	0.08223	0.0205	L	0.36672	1.1	0.09310	N	1	B	0.11235	0.004	B	0.15052	0.012	T	0.32561	-0.9902	9	0.09590	T	0.72	.	10.6579	0.45686	0.0:0.0:0.5318:0.4682	.	850	P02549	SPTA1_HUMAN	E	850	ENSP00000357130:Q850E;ENSP00000357129:Q850E	ENSP00000357129:Q850E	Q	-	1	0	0	SPTA1	156897740	156897740	0.819000	0.29175	0.012000	0.15200	0.057000	0.15508	2.290000	0.43531	1.197000	0.43143	0.650000	0.86243	CAA	0.169304		TCGA-HZ-8003-01A-21D-2201-08	0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	0	0	1	2	2	2	2	0	0	0	0	100	100	100	100	1	2	-2.596286	1	0.160000	NM_003126		0	21	21	0	866	849	0		1			0	0	100	0	0	9.999969e-01	0	0	0	0	0	0	21	866
ASPM	259266	broad.mit.edu	37	1	197062202	197062202	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:197062202C>T	ENST00000367409.4	-	21	9530	c.9274G>A	c.(9274-9276)Ggt>Agt	p.G3092S	ASPM_ENST00000294732.7_Missense_Mutation_p.G1507S|ASPM_ENST00000367408.1_Missense_Mutation_p.G757S	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3092	IQ 37. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACTAGCCAACCACGCACCAGT	0.323																																						ENST00000367409.4	1.000000	0.120000	0.370000	0.180000	0.250000	0.323779	0.250000	0.230000																										0				165						c.(9274-9276)Ggt>Agt		asp (abnormal spindle) homolog, microcephaly associated (Drosophila)							76.0	76.0	76.0					1																	197062202		2203	4299	6502	SO:0001583	missense	259266	1	121404	28				g.chr1:197062202C>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9274G>A	chr1.hg19:g.197062202C>T	ENSP00000356379:p.Gly3092Ser	0					ASPM_ENST00000294732.7_Missense_Mutation_p.G1507S|ASPM_ENST00000367408.1_Missense_Mutation_p.G757S	p.G3092S	NM_018136.4	NP_060606.3	1	2	3	2.018291	Q8IZT6	ASPM_HUMAN		21	9530	-			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	0	1	hg19	c.9274G>A	CCDS1389.1	0	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887516	0.91814	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.42513	0.97;0.97;0.97	5.28	5.28	0.74379	5.280000	5.280000	0.743790	.	0.059343	0.64402	D	0.000004	T	0.65417	0.2689	M	0.77103	2.36	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;0.988	D;D;P	0.79108	0.992;0.987;0.893	T	0.66787	-0.5835	10	0.46703	T	0.11	.	16.0593	0.80830	0.0:1.0:0.0:0.0	.	1078;1507;3092	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	S	3092;1507;757;1078	ENSP00000356379:G3092S;ENSP00000294732:G1507S;ENSP00000356378:G757S	ENSP00000294732:G1507S	G	-	1	0	0	ASPM	195328825	195328825	0.938000	0.31826	1.000000	0.80357	0.988000	0.76386	1.931000	0.40134	2.447000	0.82792	0.655000	0.94253	GGT	0.167328		TCGA-HZ-8003-01A-21D-2201-08	0.323	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	0	0	1	2	2	2	2	0	0	0	0	51	51	51	50	1	2	-2.891575	1	0.160000	NM_018136		0	10	10	0	521	510	0		1	0		0	0	51	0	0	9.965885e-01	1.174157e-02	0	1	0	7	0	10	521
KDM1A	23028	broad.mit.edu	37	1	23376993	23376993	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:23376993C>G	ENST00000356634.3	+	3	780	c.631C>G	c.(631-633)Ctt>Gtt	p.L211V	KDM1A_ENST00000400181.4_Missense_Mutation_p.L231V|RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000542151.1_Missense_Mutation_p.L231V	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	211	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GAAGGTTTTTCTTTTCATTAG	0.383																																						ENST00000356634.3	1.000000	0.170000	0.410000	0.230000	0.300000	0.369537	0.300000	0.290000																										0				23						c.(631-633)Ctt>Gtt		lysine (K)-specific demethylase 1A							116.0	112.0	113.0					1																	23376993		2203	4300	6503	SO:0001583	missense	23028	0	0					g.chr1:23376993C>G	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.631C>G	chr1.hg19:g.23376993C>G	ENSP00000349049:p.Leu211Val	0					KDM1A_ENST00000542151.1_Missense_Mutation_p.L231V|KDM1A_ENST00000400181.4_Missense_Mutation_p.L231V|RP1-184J9.2_ENST00000427154.1_RNA	p.L211V	NM_015013.3	NP_055828.2	1	2	3	2.022242	O60341	KDM1A_HUMAN		3	780	+			A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	ENST00000356634.3	1	1	hg19	c.631C>G	CCDS30627.1	0	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478654	0.63849	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	T;T;T	0.60920	0.24;0.16;0.15	5.82	4.91	0.64330	5.820000	4.910000	0.643300	Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);SWIRM (2);	0.000000	0.64402	D	0.000001	T	0.76212	0.3956	M	0.86178	2.8	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.79315	-0.1854	10	0.87932	D	0	-15.4498	9.9819	0.41819	0.0:0.8483:0.0:0.1517	.	231;211	O60341-2;O60341	.;KDM1A_HUMAN	V	211;231;231	ENSP00000349049:L211V;ENSP00000383042:L231V;ENSP00000439072:L231V	ENSP00000349049:L211V	L	+	1	0	0	KDM1A	23249580	23249580	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.695000	0.37763	1.462000	0.47948	0.655000	0.94253	CTT	0.167987		TCGA-HZ-8003-01A-21D-2201-08	0.383	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	0	0	0	2	2	2	2	0	0	0	0	65	65	65	65	1	2	-2.909329	1	0.160000	NM_015013		0	17	16	0	728	708	0		1	1		0	0	65	0	0	9.999551e-01	6.112976e-01	0	10	0	78	0	17	728
LPAR3	23566	broad.mit.edu	37	1	85279808	85279808	+	Silent	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:85279808G>A	ENST00000440886.1	-	2	821	c.783C>T	c.(781-783)ctC>ctT	p.L261L	LPAR3_ENST00000491034.1_5'UTR|LPAR3_ENST00000370611.3_Silent_p.L261L			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	261					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TCAGGCCGTCGAGGAGCAGAA	0.582																																						ENST00000440886.1	1.000000	0.250000	0.550000	0.320000	0.420000	0.465258	0.420000	0.400000																										0				24						c.(781-783)ctC>ctT		lysophosphatidic acid receptor 3							64.0	60.0	62.0					1																	85279808		2203	4300	6503	SO:0001819	synonymous_variant	23566	3	121412	34				g.chr1:85279808G>A	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.783C>T	chr1.hg19:g.85279808G>A		0					LPAR3_ENST00000370611.3_Silent_p.L261L|LPAR3_ENST00000491034.1_5'UTR	p.L261L			1	2	3	2.014679	Q9UBY5	LPAR3_HUMAN		2	821	-			A0AVA3	Silent	SNP	ENST00000440886.1	1	1	hg19	c.783C>T	CCDS700.1	0																																																																																								0.166005		TCGA-HZ-8003-01A-21D-2201-08	0.582	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	0	0	1	2	2	2	2	0	0	0	0	94	94	94	94	1	2	-2.852309	1	0.160000	NM_012152		0	18	17	0	540	529	0		1	0		0	0	94	0	0	9.999784e-01	1.599338e-01	0	0	0	21	0	18	540
AVPR1B	553	broad.mit.edu	37	1	206230924	206230924	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr1:206230924C>A	ENST00000367126.4	+	2	1522	c.1057C>A	c.(1057-1059)Ctt>Att	p.L353I		NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	353					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CCTGCGTCACCTTGCCTGCTG	0.652																																						ENST00000367126.4	1.000000	0.150000	0.790000	0.270000	0.460000	0.521298	0.460000	0.390000																										0				20						c.(1057-1059)Ctt>Att		arginine vasopressin receptor 1B	Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)						35.0	31.0	32.0					1																	206230924		2203	4300	6503	SO:0001583	missense	553	0	0					g.chr1:206230924C>A	D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.1057C>A	chr1.hg19:g.206230924C>A	ENSP00000356094:p.Leu353Ile	0						p.L353I	NM_000707.3	NP_000698.1	1	2	3	2.018291	P47901	V1BR_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0312)	2	1522	+			B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	0	1	hg19	c.1057C>A	CCDS30994.1	0	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917594	0.52546	.	.	ENSG00000198049	ENST00000367126	T	0.47177	0.85	5.6	3.68	0.42216	5.600000	3.680000	0.422160	.	0.625252	0.13928	N	0.353117	T	0.40119	0.1104	L	0.50333	1.59	0.09310	N	1	B	0.16396	0.017	B	0.19946	0.027	T	0.32798	-0.9893	10	0.49607	T	0.09	-0.6355	6.3659	0.21455	0.1629:0.6944:0.0:0.1426	.	353	P47901	V1BR_HUMAN	I	353	ENSP00000356094:L353I	ENSP00000356094:L353I	L	+	1	0	0	AVPR1B	204397547	204397547	0.000000	0.05858	0.017000	0.16124	0.528000	0.34623	0.400000	0.20932	1.310000	0.45006	0.563000	0.77884	CTT	0.167328		TCGA-HZ-8003-01A-21D-2201-08	0.652	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	0	0	1	2	2	2	2	0	0	0	0	19	19	19	17	1	2	-7.244197	1	0.160000	NM_000707		0	4	4	0	121	112	0		1	0		0	0	19	0	0	8.731115e-01	1.654263e-02	0	0	0	5	0	4	121
ZNF831	128611	broad.mit.edu	37	20	57768617	57768617	+	Missense_Mutation	SNP	C	C	T	rs375167639		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr20:57768617C>T	ENST00000371030.2	+	1	2543	c.2543C>T	c.(2542-2544)aCg>aTg	p.T848M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	848							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGTGGGCCCACGCAGCCTGCC	0.637																																						ENST00000371030.2	1.000000	0.100000	0.340000	0.160000	0.230000	0.272566	0.230000	0.220000																										0				125						c.(2542-2544)aCg>aTg		zinc finger protein 831		C	MET/THR	1,4017		0,1,2008	27.0	34.0	32.0		2543	-9.8	0.0	20		32	0,8370		0,0,4185	no	missense	ZNF831	NM_178457.1	81	0,1,6193	TT,TC,CC		0.0,0.0249,0.0081	benign	848/1678	57768617	1,12387	2009	4185	6194	SO:0001583	missense	128611	2	120910	37				g.chr20:57768617C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2543C>T	chr20.hg19:g.57768617C>T	ENSP00000360069:p.Thr848Met	0						p.T848M	NM_178457.1	NP_848552.1	1	2	3	2.000935	Q5JPB2	ZN831_HUMAN		1	2543	+	all_lung(29;0.0085)		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	0	1	hg19	c.2543C>T	CCDS42894.1	0	.	.	.	.	.	.	.	.	.	.	C	6.842	0.524657	0.13066	2.49E-4	0.0	ENSG00000124203	ENST00000371030	T	0.04654	3.58	4.91	-9.81	0.00487	4.910000	-9.810000	0.004870	.	2.099750	0.01863	N	0.036738	T	0.01835	0.0058	N	0.02539	-0.55	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.39941	-0.9589	10	0.31617	T	0.26	2.2937	6.1548	0.20332	0.0856:0.6705:0.0859:0.1581	.	848	Q5JPB2	ZN831_HUMAN	M	848	ENSP00000360069:T848M	ENSP00000360069:T848M	T	+	2	0	0	ZNF831	57202012	57202012	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.016000	0.00313	-2.912000	0.00307	-2.815000	0.00110	ACG	0.163347		TCGA-HZ-8003-01A-21D-2201-08	0.637	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	0	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	2	-7.212852	1	0.160000	NM_178457		0	8	8	0	448	439	0		1	0		0	0	76	0	0	9.886075e-01	1.263881e-03	0	0	0	3	0	8	448
CACNA1I	8911	broad.mit.edu	37	22	40075752	40075752	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr22:40075752C>G	ENST00000402142.3	+	33	5420	c.5420C>G	c.(5419-5421)tCt>tGt	p.S1807C	CACNA1I_ENST00000404898.1_Missense_Mutation_p.S1772C|CACNA1I_ENST00000401624.1_Missense_Mutation_p.S1807C|CACNA1I_ENST00000407673.1_Missense_Mutation_p.S1772C|CACNA1I_ENST00000400164.3_Missense_Mutation_p.S1772C|CACNA1I_ENST00000336649.4_Missense_Mutation_p.S1813C	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1807					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GACAGCGTCTCTTTAATCATC	0.632																																						ENST00000402142.3	1.000000	0.170000	0.760000	0.290000	0.470000	0.524391	0.470000	0.400000																										0				60						c.(5419-5421)tCt>tGt		calcium channel, voltage-dependent, T type, alpha 1I subunit	Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)						38.0	41.0	40.0					22																	40075752		1942	4143	6085	SO:0001583	missense	8911	0	0					g.chr22:40075752C>G	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5420C>G	chr22.hg19:g.40075752C>G	ENSP00000385019:p.Ser1807Cys	0					CACNA1I_ENST00000400164.3_Missense_Mutation_p.S1772C|CACNA1I_ENST00000404898.1_Missense_Mutation_p.S1772C|CACNA1I_ENST00000401624.1_Missense_Mutation_p.S1807C|CACNA1I_ENST00000336649.4_Missense_Mutation_p.S1813C|CACNA1I_ENST00000407673.1_Missense_Mutation_p.S1772C	p.S1807C	NM_021096.3	NP_066919.2	1	2	3	2.016038	Q9P0X4	CAC1I_HUMAN		33	5420	+	Melanoma(58;0.0749)		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	1	1	hg19	c.5420C>G	CCDS46710.1	0	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169998	0.78452	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98968	-5.26;-5.23;-5.14;-5.09;-5.28;-5.19	4.3	4.3	0.51218	4.300000	4.300000	0.512180	.	5.708610	0.00397	N	0.000043	D	0.99211	0.9726	M	0.68952	2.095	0.52501	D	0.999956	D;D;D;D	0.89917	0.999;0.969;1.0;1.0	D;P;D;D	0.87578	0.995;0.708;0.998;0.996	D	0.94094	0.7356	10	0.72032	D	0.01	.	17.1233	0.86707	0.0:1.0:0.0:0.0	.	1772;1807;1772;1807	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	C	1807;1772;1807;1772;1813;1772	ENSP00000385019:S1807C;ENSP00000384093:S1772C;ENSP00000383887:S1807C;ENSP00000385680:S1772C;ENSP00000337829:S1813C;ENSP00000383028:S1772C	ENSP00000337829:S1813C	S	+	2	0	0	CACNA1I	38405698	38405698	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	7.347000	0.79356	2.087000	0.62958	0.462000	0.41574	TCT	0.166667		TCGA-HZ-8003-01A-21D-2201-08	0.632	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	2	-7.910604	1	0.160000	NM_001003406		0	5	5	0	144	141	0		1			0	0	24	0	0	9.352450e-01	0	0	0	0	0	0	5	144
TUBGCP6	85378	broad.mit.edu	37	22	50664531	50664531	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr22:50664531T>C	ENST00000248846.5	-	9	1885	c.1781A>G	c.(1780-1782)gAc>gGc	p.D594G	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.D594G|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	594					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GACGTATATGTCGTGGGCAAT	0.557																																						ENST00000248846.5	1.000000	0.250000	0.450000	0.300000	0.360000	0.414531	0.360000	0.360000																										0				45						c.(1780-1782)gAc>gGc		tubulin, gamma complex associated protein 6							249.0	236.0	241.0					22																	50664531		2203	4300	6503	SO:0001583	missense	85378	0	0					g.chr22:50664531T>C	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1781A>G	chr22.hg19:g.50664531T>C	ENSP00000248846:p.Asp594Gly	0					TUBGCP6_ENST00000439308.2_Missense_Mutation_p.D594G|TUBGCP6_ENST00000491449.1_5'UTR	p.D594G			1	2	3	2.016038	Q96RT7	GCP6_HUMAN		9	1885	-		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	1	1	hg19	c.1781A>G	CCDS14087.1	0	.	.	.	.	.	.	.	.	.	.	T	20.6	4.010753	0.75046	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.08807	3.05;3.05	5.04	5.04	0.67666	5.040000	5.040000	0.676660	.	0.109872	0.64402	N	0.000010	T	0.26122	0.0637	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.00802	-1.1560	10	0.62326	D	0.03	.	14.7674	0.69648	0.0:0.0:0.0:1.0	.	594;594	B2RWN4;Q96RT7	.;GCP6_HUMAN	G	594	ENSP00000248846:D594G;ENSP00000397387:D594G	ENSP00000248846:D594G	D	-	2	0	0	TUBGCP6	49006658	49006658	1.000000	0.71417	0.991000	0.47740	0.435000	0.31806	7.905000	0.87416	1.906000	0.55180	0.379000	0.24179	GAC	0.166667		TCGA-HZ-8003-01A-21D-2201-08	0.557	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	0	0	1	2	2	2	2	0	0	0	0	188	188	188	185	1	2	-3.356496	1	0.160000	NM_020461		0	37	37	0	1275	1245	0		1	0		0	0	188	0	0	1	3.103281e-01	0	0	0	39	0	37	1275
FAM179A	165186	broad.mit.edu	37	2	29274886	29274886	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr2:29274886G>A	ENST00000379558.4	+	20	3338	c.2987G>A	c.(2986-2988)cGc>cAc	p.R996H	FAM179A_ENST00000403861.2_Missense_Mutation_p.R941H|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	996										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGAGGCAGCCGCAAGGCCACT	0.557																																						ENST00000379558.4	1.000000	0.140000	0.550000	0.230000	0.360000	0.411699	0.360000	0.330000																										0				26						c.(2986-2988)cGc>cAc		family with sequence similarity 179, member A							23.0	25.0	24.0					2																	29274886		1906	4125	6031	SO:0001583	missense	165186	2	120824	34				g.chr2:29274886G>A	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2987G>A	chr2.hg19:g.29274886G>A	ENSP00000368876:p.Arg996His	0					FAM179A_ENST00000403861.2_Missense_Mutation_p.R941H|FAM179A_ENST00000465300.1_3'UTR	p.R996H	NM_199280.2	NP_954974.2	1	2	3	2.011563	Q6ZUX3	F179A_HUMAN		20	3338	+			Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	0	1	hg19	c.2987G>A	CCDS1769.2	0	.	.	.	.	.	.	.	.	.	.	G	8.471	0.857506	0.17106	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.09817	3.12;2.94	5.68	-11.4	0.00090	5.680000	-11.400000	0.000900	.	3.053280	0.00954	N	0.003001	T	0.02929	0.0087	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36065	-0.9763	10	0.30078	T	0.28	.	4.172	0.10334	0.1668:0.2241:0.4866:0.1225	.	941;996	F8W8E4;Q6ZUX3	.;F179A_HUMAN	H	996;941	ENSP00000368876:R996H;ENSP00000384699:R941H	ENSP00000368876:R996H	R	+	2	0	0	FAM179A	29128390	29128390	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.423000	0.02450	-2.378000	0.00596	-1.904000	0.00526	CGC	0.165342		TCGA-HZ-8003-01A-21D-2201-08	0.557	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	0	0	1	2	2	2	2	0	0	0	0	25	25	25	24	1	2	-3.560838	1	0.160000	NM_199280		0	6	6	0	224	217	0		1	0		0	0	25	0	0	9.620967e-01	1.035963e-03	0	0	0	2	0	6	224
TOMM70A	9868	broad.mit.edu	37	3	100092471	100092471	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr3:100092471G>C	ENST00000284320.5	-	8	1694	c.1246C>G	c.(1246-1248)Caa>Gaa	p.Q416E		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	416					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						TCTTCAACTTGATCAAGGAGT	0.358																																						ENST00000284320.5	0.380000	0.100000	0.300000	0.150000	0.210000	0.228924	0.210000	0.210000																										0				32						c.(1246-1248)Caa>Gaa		translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)							117.0	113.0	114.0					3																	100092471		2203	4300	6503	SO:0001583	missense	9868	0	0					g.chr3:100092471G>C	AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1246C>G	chr3.hg19:g.100092471G>C	ENSP00000284320:p.Gln416Glu	0						p.Q416E	NM_014820.4	NP_055635.3	0	1	1	1.990029	O94826	TOM70_HUMAN		8	1694	-			D3DN48	Missense_Mutation	SNP	ENST00000284320.5	0	1	hg19	c.1246C>G	CCDS33807.1	0	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509968	0.85282	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	T	0.53423	0.62	5.89	5.89	0.94794	5.890000	5.890000	0.947940	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.049763	0.85682	D	0.000000	T	0.29223	0.0727	N	0.10645	0.015	0.80722	D	1	B	0.26258	0.145	B	0.26693	0.072	T	0.20338	-1.0278	10	0.05620	T	0.96	-6.0465	20.2576	0.98430	0.0:0.0:1.0:0.0	.	416	O94826	TOM70_HUMAN	E	416;309	ENSP00000284320:Q416E	ENSP00000284320:Q416E	Q	-	1	0	0	TOMM70A	101575161	101575161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.907000	0.92634	2.783000	0.95769	0.655000	0.94253	CAA	0.154589		TCGA-HZ-8003-01A-21D-2201-08	0.358	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	2	-4.721776	1	0.160000			0	9	9	0	526	511	0		1	1		0	0	45	0	0	9.934438e-01	5.258431e-01	0	4	0	94	0	9	526
SLC12A8	84561	broad.mit.edu	37	3	124826478	124826478	+	Missense_Mutation	SNP	C	C	T	rs201509993	byFrequency	TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr3:124826478C>T	ENST00000393469.4	-	9	1601	c.1552G>A	c.(1552-1554)Gag>Aag	p.E518K	SLC12A8_ENST00000465475.1_5'UTR|SLC12A8_ENST00000469902.1_Missense_Mutation_p.E518K|SLC12A8_ENST00000430155.2_Missense_Mutation_p.E319K|SLC12A8_ENST00000314584.7_Missense_Mutation_p.E271K|SLC12A8_ENST00000423114.2_Missense_Mutation_p.E547K	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	518					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						TCAGAGATCTCGACAGGGAAA	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		20621	0.0		0.002	False		,,,				2504	0.0					ENST00000393469.4	0.410000	0.140000	0.330000	0.190000	0.250000	0.269017	0.250000	0.250000																										0				16						c.(1552-1554)Gag>Aag		solute carrier family 12, member 8		C	LYS/GLU,LYS/GLU	0,4142		0,0,2071	107.0	124.0	118.0		1552,1552	0.9	0.0	3		118	8,8424		0,8,4208	yes	missense,missense	SLC12A8	NM_001195483.1,NM_024628.5	56,56	0,8,6279	TT,TC,CC		0.0949,0.0,0.0636	benign,benign	518/715,518/715	124826478	8,12566	2071	4216	6287	SO:0001583	missense	84561	189	120994	56				g.chr3:124826478C>T		CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.1552G>A	chr3.hg19:g.124826478C>T	ENSP00000377112:p.Glu518Lys	0					SLC12A8_ENST00000430155.2_Missense_Mutation_p.E319K|SLC12A8_ENST00000314584.7_Missense_Mutation_p.E271K|SLC12A8_ENST00000423114.2_Missense_Mutation_p.E547K|SLC12A8_ENST00000469902.1_Missense_Mutation_p.E518K|SLC12A8_ENST00000465475.1_5'UTR	p.E518K	NM_001195483.1	NP_001182412	0	1	1	1.990029	A0AV02	S12A8_HUMAN		9	1601	-			C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	0	1	hg19	c.1552G>A	CCDS43143.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.97	1.501163	0.26861	0.0	9.49E-4	ENSG00000221955	ENST00000430155;ENST00000393469;ENST00000423114;ENST00000469902;ENST00000314584	D;D;D;D;T	0.88509	-1.89;-2.37;-2.39;-2.37;-1.45	4.85	0.905	0.19307	4.850000	0.905000	0.193070	.	.	.	.	.	T	0.79747	0.4499	L	0.50333	1.59	0.09310	N	1	P;B;B;P	0.44521	0.837;0.051;0.05;0.466	B;B;B;B	0.34418	0.182;0.007;0.003;0.029	T	0.68269	-0.5453	9	0.32370	T	0.25	.	3.2098	0.06678	0.1205:0.5474:0.1174:0.2147	.	271;547;518;319	A0AV02-4;A0AV02-2;A0AV02;A0AV02-3	.;.;S12A8_HUMAN;.	K	319;518;547;518;271	ENSP00000415713:E319K;ENSP00000377112:E518K;ENSP00000404243:E547K;ENSP00000418783:E518K;ENSP00000323632:E271K	ENSP00000323632:E271K	E	-	1	0	0	SLC12A8	126309168	126309168	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.118000	0.15605	0.234000	0.21139	-0.181000	0.13052	GAG	0.154589		TCGA-HZ-8003-01A-21D-2201-08	0.552	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	0	0	1	2	2	2	2	0	0	0	0	99	99	99	98	1	2	-2.617480	1	0.160000	NM_024628		0	14	14	0	671	654	0		1	0		0	0	99	0	0	9.996984e-01	4.080279e-01	0	1	0	64	0	14	671
IFT122	55764	broad.mit.edu	37	3	129214429	129214429	+	Silent	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr3:129214429C>T	ENST00000348417.2	+	18	2264	c.2187C>T	c.(2185-2187)ctC>ctT	p.L729L	IFT122_ENST00000347300.2_Silent_p.L670L|IFT122_ENST00000440957.2_Silent_p.L520L|IFT122_ENST00000504021.1_Silent_p.L605L|IFT122_ENST00000296266.3_Silent_p.L780L|IFT122_ENST00000349441.2_Silent_p.L618L|IFT122_ENST00000431818.2_Silent_p.L579L|IFT122_ENST00000513932.1_3'UTR|IFT122_ENST00000507564.1_Silent_p.L721L	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	729					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						ACACCGACCTCTGCATGTTTG	0.537																																						ENST00000348417.2	0.620000	0.240000	0.520000	0.310000	0.400000	0.422668	0.400000	0.400000																										0				52						c.(2185-2187)ctC>ctT		intraflagellar transport 122							123.0	110.0	114.0					3																	129214429		2203	4300	6503	SO:0001819	synonymous_variant	55764	0	0					g.chr3:129214429C>T	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2187C>T	chr3.hg19:g.129214429C>T		0					IFT122_ENST00000440957.2_Silent_p.L520L|IFT122_ENST00000349441.2_Silent_p.L618L|IFT122_ENST00000431818.2_Silent_p.L579L|IFT122_ENST00000347300.2_Silent_p.L670L|IFT122_ENST00000507564.1_Silent_p.L721L|IFT122_ENST00000504021.1_Silent_p.L605L|IFT122_ENST00000296266.3_Silent_p.L780L|IFT122_ENST00000513932.1_3'UTR	p.L729L	NM_052989.1	NP_443715.1	0	1	1	1.990029	Q9HBG6	IF122_HUMAN		18	2264	+			B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	ENST00000348417.2	1	1	hg19	c.2187C>T	CCDS3061.1	0																																																																																								0.154589		TCGA-HZ-8003-01A-21D-2201-08	0.537	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	0	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	2	-14.589920	1	0.160000	NM_018262		0	16	15	0	476	464	0		1	0		0	0	77	0	0	9.999179e-01	2.005059e-01	0	0	0	24	0	16	476
FAM13A	10144	broad.mit.edu	37	4	89950680	89950680	+	Missense_Mutation	SNP	G	G	A	rs114435452	byFrequency	TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr4:89950680G>A	ENST00000264344.5	-	2	355	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	FAM13A_ENST00000511976.1_De_novo_Start_InFrame|FAM13A_ENST00000502459.1_5'UTR|FAM13A_ENST00000515600.1_Missense_Mutation_p.R50W|FAM13A_ENST00000509094.1_Missense_Mutation_p.R50W	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	50	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						AGCCCCTGCCGTTCAAGTTCT	0.418													G|||	3	0.000599042	0.0008	0.0014	5008	,	,		18748	0.0		0.0	False		,,,				2504	0.001					ENST00000264344.5	1.000000	0.200000	0.400000	0.240000	0.300000	0.371148	0.300000	0.300000																										0				55						c.(148-150)Cgg>Tgg		family with sequence similarity 13, member A		G	TRP/ARG	12,4394	19.1+/-41.9	0,12,2191	161.0	163.0	162.0		148	3.3	0.2	4	dbSNP_132	162	0,8600		0,0,4300	yes	missense	FAM13A	NM_014883.2	101	0,12,6491	AA,AG,GG		0.0,0.2724,0.0923	benign	50/1024	89950680	12,12994	2203	4300	6503	SO:0001583	missense	10144	28	121412	49				g.chr4:89950680G>A	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.148C>T	chr4.hg19:g.89950680G>A	ENSP00000264344:p.Arg50Trp	0					FAM13A_ENST00000509094.1_Missense_Mutation_p.R50W|FAM13A_ENST00000511976.1_De_novo_Start_InFrame|FAM13A_ENST00000515600.1_Missense_Mutation_p.R50W|FAM13A_ENST00000502459.1_5'UTR	p.R50W	NM_014883.3	NP_055698.2	1	2	3	2.019137	O94988	FA13A_HUMAN		2	355	-			B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	1	1	hg19	c.148C>T	CCDS34029.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	15.85	2.955573	0.53293	0.002724	0.0	ENSG00000138640	ENST00000264344;ENST00000509094;ENST00000515600;ENST00000506913	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.12	3.28	0.37604	4.120000	3.280000	0.376040	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.769691	0.11970	N	0.511820	T	0.42765	0.1217	M	0.68317	2.08	0.27130	N	0.961917	D;P	0.62365	0.991;0.482	P;B	0.44860	0.462;0.007	T	0.35943	-0.9768	9	.	.	.	.	7.72	0.28727	0.085:0.0:0.7527:0.1623	.	50;50	Q6P521;O94988	.;FA13A_HUMAN	W	50;50;50;60	ENSP00000264344:R50W;ENSP00000426517:R50W;ENSP00000422345:R50W;ENSP00000421269:R60W	.	R	-	1	2	2	FAM13A	90169703	90169703	0.953000	0.32496	0.250000	0.24296	0.018000	0.09664	2.839000	0.48207	1.323000	0.45263	0.655000	0.94253	CGG	0.167328		TCGA-HZ-8003-01A-21D-2201-08	0.418	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	123	1	2	-2.338131	0	0.160000			0	26	26	0	1066	1024	0		1	1		0	0	127	0	0	9.999998e-01	1.874882e-01	0	4	0	28	0	26	1066
SLC45A2	51151	broad.mit.edu	37	5	33947401	33947401	+	Missense_Mutation	SNP	G	G	A	rs149980670		TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr5:33947401G>A	ENST00000296589.4	-	6	1381	c.1235C>T	c.(1234-1236)aCg>aTg	p.T412M	SLC45A2_ENST00000382102.3_Missense_Mutation_p.T412M|SLC45A2_ENST00000342059.3_Missense_Mutation_p.T353M	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	412					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.T412M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						AATAAATCCCGTCCCCAGGCC	0.488																																					Ovarian(31;380 859 8490 22203 49048)	ENST00000296589.4	0.660000	0.360000	0.580000	0.420000	0.490000	0.508898	0.490000	0.500000																										1	Substitution - Missense(1)	p.T412M(1)	haematopoietic_and_lymphoid_tissue(1)	48						c.(1234-1236)aCg>aTg		solute carrier family 45, member 2		G	MET/THR,MET/THR	0,4406		0,0,2203	146.0	147.0	147.0		1235,1235	5.6	1.0	5	dbSNP_134	147	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC45A2	NM_001012509.2,NM_016180.3	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	412/461,412/531	33947401	1,13005	2203	4300	6503	SO:0001583	missense	51151	6	121412	41				g.chr5:33947401G>A	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1235C>T	chr5.hg19:g.33947401G>A	ENSP00000296589:p.Thr412Met	0					SLC45A2_ENST00000342059.3_Missense_Mutation_p.T353M|SLC45A2_ENST00000382102.3_Missense_Mutation_p.T412M	p.T412M	NM_016180.3	NP_057264	0	0	0	1.965978	Q9UMX9	S45A2_HUMAN		6	1381	-			Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	1	1	hg19	c.1235C>T	CCDS3901.1	0	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988904	0.93106	0.0	1.16E-4	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	5.62	5.62	0.85841	5.620000	5.620000	0.858410	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.91872	0.7427	L	0.39020	1.185	0.80722	D	1	D;P	0.89917	1.0;0.622	D;P	0.85130	0.997;0.466	D	0.86327	0.1696	10	0.02654	T	1	-12.7534	19.6445	0.95771	0.0:0.0:1.0:0.0	.	412;412	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	M	412;353;412;237	ENSP00000296589:T412M;ENSP00000341014:T353M;ENSP00000371534:T412M;ENSP00000424010:T237M	ENSP00000296589:T412M	T	-	2	0	0	SLC45A2	33983158	33983158	1.000000	0.71417	0.958000	0.39756	0.964000	0.63967	9.519000	0.98025	2.646000	0.89796	0.655000	0.94253	ACG	0.142157		TCGA-HZ-8003-01A-21D-2201-08	0.488	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	1	0	1	2	2	2	2	0	0	0	0	168	168	168	167	1	2	-4.197817	1	0.160000	NM_016180		0	39	37	0	915	878	0		1			0	0	168	0	0	1	0	0	0	0	0	0	39	915
TNFAIP8	25816	broad.mit.edu	37	5	118728611	118728611	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr5:118728611C>A	ENST00000503646.1	+	3	820	c.132C>A	c.(130-132)gaC>gaA	p.D44E	TNFAIP8_ENST00000274456.6_Missense_Mutation_p.D34E|TNFAIP8_ENST00000415806.2_3'UTR|TNFAIP8_ENST00000513374.1_Missense_Mutation_p.D56E|TNFAIP8_ENST00000504771.2_Missense_Mutation_p.D44E|TNFAIP8_ENST00000504642.1_Missense_Mutation_p.D46E			O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	44					defense response to Gram-positive bacterium (GO:0050830)|interleukin-1 beta production (GO:0032611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)	p.D44D(1)		ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		CCTTAATAGACGACACAAGTA	0.463																																						ENST00000503646.1	0.910000	0.120000	0.650000	0.230000	0.410000	0.448704	0.410000	1.000000																										1	Substitution - coding silent(1)	p.D44D(1)	breast(1)	1						c.(130-132)gaC>gaA		tumor necrosis factor, alpha-induced protein 8																																				SO:0001583	missense	25816	0	0					g.chr5:118728611C>A	AF070671	CCDS47257.1, CCDS47258.1, CCDS68933.1	5q23.1	2008-02-05			ENSG00000145779	ENSG00000145779			17260	protein-coding gene	gene with protein product		612111				10233894, 10644768	Standard	NM_001286813		Approved	GG2-1, MDC-3.13, SCC-S2	uc003ksi.3	O95379	OTTHUMG00000162949	ENST00000503646.1:c.132C>A	chr5.hg19:g.118728611C>A	ENSP00000421848:p.Asp44Glu	0					TNFAIP8_ENST00000504771.2_Missense_Mutation_p.D44E|TNFAIP8_ENST00000274456.6_Missense_Mutation_p.D34E|TNFAIP8_ENST00000513374.1_Missense_Mutation_p.D56E|TNFAIP8_ENST00000504642.1_Missense_Mutation_p.D46E|TNFAIP8_ENST00000415806.2_3'UTR	p.D44E			0	0	0	1.965978	O95379	TFIP8_HUMAN		3	820	+		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)	B3KMH1|B3KMI2|B7Z713|Q9P1Q1|Q9UER5|Q9UP47	Missense_Mutation	SNP	ENST00000503646.1	0	1	hg19	c.132C>A	CCDS47258.1	0	.	.	.	.	.	.	.	.	.	.	C	19.81	3.895834	0.72639	.	.	ENSG00000145779	ENST00000274456;ENST00000388882;ENST00000513374;ENST00000504771;ENST00000503646;ENST00000504642	T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74	5.8	-11.6	0.00059	5.800000	-11.600000	0.000590	.	0.000000	0.64402	D	0.000001	T	0.65302	0.2678	M	0.84846	2.72	0.80722	D	1	D;D;P;D	0.71674	0.998;0.998;0.916;0.998	D;D;P;D	0.74674	0.983;0.984;0.86;0.984	D	0.87529	0.2451	10	0.87932	D	0	-7.2509	21.1111	0.99946	0.0:0.6774:0.0:0.3226	.	56;44;34;44	B7Z713;O95379;O95379-3;B3KUI2	.;TFIP8_HUMAN;.;.	E	34;12;56;44;44;46	ENSP00000274456:D34E;ENSP00000429432:D12E;ENSP00000427424:D56E;ENSP00000422245:D44E;ENSP00000421848:D44E;ENSP00000427160:D46E	ENSP00000274456:D34E	D	+	3	2	2	TNFAIP8	118756510	118756510	0.038000	0.19896	0.058000	0.19502	0.951000	0.60555	-0.645000	0.05409	-2.668000	0.00415	-1.021000	0.02439	GAC	0.142157		TCGA-HZ-8003-01A-21D-2201-08	0.463	TNFAIP8-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000371134.2	0	0	0	2	2	2	2	0	0	0	0	15	15	15	0	1	2	-6.074774	1	0.160000	NM_014350		0	3	0	0	97	0	0			0		0	0	15	0	0	0	5.869944e-01	0	0	0	56	0	3	97
LAMA4	3910	broad.mit.edu	37	6	112486440	112486440	+	Silent	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:112486440C>T	ENST00000230538.7	-	13	1987	c.1590G>A	c.(1588-1590)gtG>gtA	p.V530V	RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000522006.1_Silent_p.V523V|LAMA4_ENST00000389463.4_Silent_p.V523V|LAMA4_ENST00000424408.2_Silent_p.V523V	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	530	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GAGACATGTTCACCACTTCCA	0.453																																						ENST00000230538.7	0.430000	0.140000	0.350000	0.190000	0.260000	0.280293	0.260000	0.260000																										0				100						c.(1588-1590)gtG>gtA		laminin, alpha 4							194.0	167.0	176.0					6																	112486440		2203	4300	6503	SO:0001819	synonymous_variant	3910	0	0					g.chr6:112486440C>T		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1590G>A	chr6.hg19:g.112486440C>T		0					RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000522006.1_Silent_p.V523V|LAMA4_ENST00000424408.2_Silent_p.V523V|LAMA4_ENST00000389463.4_Silent_p.V523V	p.V530V	NM_001105206.2	NP_001098676.2	0	1	1	1.994194	Q16363	LAMA4_HUMAN		13	1987	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	0	1	hg19	c.1590G>A	CCDS43491.1	0																																																																																								0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.453	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	0	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	2	-2.979484	1	0.160000	NM_001105206		0	12	12	0	557	542	0		1	1		0	0	59	0	0	9.989747e-01	4.917015e-01	0	2	0	72	0	12	557
TULP4	56995	broad.mit.edu	37	6	158924700	158924700	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:158924700G>C	ENST00000367097.3	+	13	5362	c.4005G>C	c.(4003-4005)aaG>aaC	p.K1335N	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1335					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AATTTGGAAAGAAGAACCGGA	0.537																																						ENST00000367097.3	0.640000	0.220000	0.520000	0.300000	0.400000	0.418791	0.400000	0.390000																										0				49						c.(4003-4005)aaG>aaC		tubby like protein 4							43.0	47.0	46.0					6																	158924700		2203	4300	6503	SO:0001583	missense	56995	0	0					g.chr6:158924700G>C		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.4005G>C	chr6.hg19:g.158924700G>C	ENSP00000356064:p.Lys1335Asn	0					TULP4_ENST00000367094.2_Intron	p.K1335N	NM_020245.4	NP_064630.2	0	1	1	1.994194	Q9NRJ4	TULP4_HUMAN		13	5362	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	1	1	hg19	c.4005G>C	CCDS34561.1	0	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440322	0.63067	.	.	ENSG00000130338	ENST00000367097	T	0.70869	-0.52	5.7	4.84	0.62591	5.700000	4.840000	0.625910	.	0.000000	0.85682	D	0.000000	T	0.76492	0.3995	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80020	-0.1557	10	0.66056	D	0.02	-27.8828	11.6899	0.51510	0.1417:0.0:0.8583:0.0	.	1335	Q9NRJ4	TULP4_HUMAN	N	1335	ENSP00000356064:K1335N	ENSP00000356064:K1335N	K	+	3	2	2	TULP4	158844688	158844688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.612000	0.54142	1.425000	0.47237	0.561000	0.74099	AAG	0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.537	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	66	1	2	-12.964460	1	0.160000	NM_020245		0	13	13	0	395	389	0		1	1		0	0	68	0	0	9.995039e-01	1.273413e-01	0	2	0	16	0	13	395
TAP2	6891	broad.mit.edu	37	6	32800563	32800563	+	Silent	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:32800563C>T	ENST00000452392.2	-	6	1157	c.984G>A	c.(982-984)gcG>gcA	p.A328A	TAP2_ENST00000485701.1_5'Flank|TAP2_ENST00000374897.2_Silent_p.A328A|TAP2_ENST00000374899.4_Silent_p.A328A			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.A328A(1)								Vitamin E(DB00163)	CCACCTGCCCCGCCCTGGCCA	0.592																																						ENST00000452392.2	0.410000	0.100000	0.320000	0.150000	0.220000	0.242730	0.220000	0.210000																										1	Substitution - coding silent(1)	p.A328A(1)	large_intestine(1)							c.(982-984)gcG>gcA		transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	Vitamin E(DB00163)						60.0	62.0	61.0					6																	32800563		1509	2709	4218	SO:0001819	synonymous_variant	6891	2	117964	35				g.chr6:32800563C>T	M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.984G>A	chr6.hg19:g.32800563C>T		1					TAP2_ENST00000374899.4_Silent_p.A328A|TAP2_ENST00000374897.2_Silent_p.A328A|TAP2_ENST00000485701.1_5'Flank	p.A328A			0	4	4	1.939375	Q9UDX4	S14L3_HUMAN		6	1157	-			E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000452392.2	0	1	hg19	c.984G>A		0																																																																																								0.275862		TCGA-HZ-8003-01A-21D-2201-08	0.592	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000361828.1	0	0	0	2	2	2	2	0	0	0	0	85	85	85	85	1	2	-2.909339	1	0.160000	NM_000544		0	8	8	0	525	504	1		1	1		0	0	85	0	0	9.875971e-01	6.131055e-01	0	32	0	97	0	8	525
MDN1	23195	broad.mit.edu	37	6	90448153	90448153	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:90448153G>A	ENST00000369393.3	-	33	4730	c.4615C>T	c.(4615-4617)Cgg>Tgg	p.R1539W	MDN1_ENST00000428876.1_Missense_Mutation_p.R1539W			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1539					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCTGTAAACCGGTTTCTTAAG	0.378																																						ENST00000369393.3	0.510000	0.170000	0.420000	0.240000	0.310000	0.333047	0.310000	0.310000																										0				218						c.(4615-4617)Cgg>Tgg		MDN1, midasin homolog (yeast)							81.0	80.0	81.0					6																	90448153		2203	4300	6503	SO:0001583	missense	23195	0	0					g.chr6:90448153G>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4615C>T	chr6.hg19:g.90448153G>A	ENSP00000358400:p.Arg1539Trp	0					MDN1_ENST00000428876.1_Missense_Mutation_p.R1539W	p.R1539W			0	1	1	1.994194	Q9NU22	MDN1_HUMAN		33	4730	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	1	1	hg19	c.4615C>T	CCDS5024.1	0	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138698	0.56936	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.73897	-0.79;-0.79	5.62	3.62	0.41486	5.620000	3.620000	0.414860	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.063133	0.64402	D	0.000010	D	0.89238	0.6658	H	0.99573	4.635	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.90061	0.4156	10	0.87932	D	0	.	7.7774	0.29046	0.0:0.1127:0.487:0.4003	.	1539	Q9NU22	MDN1_HUMAN	W	1539	ENSP00000358400:R1539W;ENSP00000413970:R1539W	ENSP00000358400:R1539W	R	-	1	2	2	MDN1	90504874	90504874	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.095000	0.50235	1.340000	0.45581	0.557000	0.71058	CGG	0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.378	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2	0	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	2	-2.911896	1	0.160000			0	13	13	0	502	488	0		1	0		0	0	75	0	0	9.994447e-01	7.042861e-02	0	0	0	16	0	13	502
POU3F2	5454	broad.mit.edu	37	6	99283224	99283224	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:99283224G>A	ENST00000328345.5	+	1	645	c.475G>A	c.(475-477)Gct>Act	p.A159T		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	159					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GCACCACGCCGCTAACCACCA	0.682																																						ENST00000328345.5	1.000000	0.360000	1.000000	0.680000	0.990000	0.890399	0.990000	1.000000																										0				10						c.(475-477)Gct>Act		POU class 3 homeobox 2							4.0	5.0	5.0					6																	99283224		2015	3971	5986	SO:0001583	missense	5454	0	0					g.chr6:99283224G>A	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.475G>A	chr6.hg19:g.99283224G>A	ENSP00000329170:p.Ala159Thr	0						p.A159T	NM_005604.3	NP_005595.2	0	1	1	1.994194	P20265	PO3F2_HUMAN		1	645	+		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)	Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	ENST00000328345.5	0	1	hg19	c.475G>A	CCDS5040.1	1	.	.	.	.	.	.	.	.	.	.	G	7.400	0.632659	0.14322	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	T	0.41400	1.0	3.24	2.36	0.29203	3.240000	2.360000	0.292030	.	1.037200	0.07655	U	0.932722	T	0.04407	0.0121	N	0.02539	-0.55	0.30999	N	0.720528	B	0.10296	0.003	B	0.04013	0.001	T	0.37407	-0.9707	10	0.07030	T	0.85	.	4.6516	0.12598	0.1309:0.227:0.6422:0.0	.	159	P20265	PO3F2_HUMAN	T	159;140	ENSP00000329170:A159T	ENSP00000329170:A159T	A	+	1	0	0	POU3F2	99389945	99389945	1.000000	0.71417	0.999000	0.59377	0.683000	0.39861	1.454000	0.35178	0.707000	0.31934	0.184000	0.17185	GCT	0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.682	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2	0	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	2	-9.626226	1	0.160000			0	3	3	0	27	24	0		1		0	0	0	8	0	0	7.775120e-01	0	0	0	0	0	1	3	27
EZR	7430	broad.mit.edu	37	6	159197482	159197482	+	Silent	SNP	A	A	G			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr6:159197482A>G	ENST00000367075.3	-	8	921	c.753T>C	c.(751-753)aaT>aaC	p.N251N	EZR_ENST00000392177.4_Silent_p.N219N|EZR_ENST00000337147.7_Silent_p.N251N	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	251	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		ACTTTTTGTCATTGAAAGAGA	0.378			T	ROS1	NSCLC																																	ENST00000367075.3	0.620000	0.270000	0.530000	0.340000	0.420000	0.442135	0.420000	0.420000				Dom	yes			Dom	yes		6	6q25.3	6q25.3	7430	T	ezrin				E	E	ROS1		NSCLC	EZR/ROS1(4)	0				15						c.(751-753)aaT>aaC		ezrin							129.0	128.0	129.0					6																	159197482		2203	4300	6503	SO:0001819	synonymous_variant	7430	0	0					g.chr6:159197482A>G	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.753T>C	chr6.hg19:g.159197482A>G		0					EZR_ENST00000337147.7_Silent_p.N251N|EZR_ENST00000392177.4_Silent_p.N219N	p.N251N	NM_001111077.1	NP_001104547.1	0	1	1	1.994194	P15311	EZRI_HUMAN		8	921	-		Breast(66;0.000776)|Ovarian(120;0.0303)	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	1	1	hg19	c.753T>C	CCDS5258.1	0																																																																																								0.155270		TCGA-HZ-8003-01A-21D-2201-08	0.378	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	0	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	2	-3.969924	1	0.160000	NM_003379		0	21	21	0	590	586	0		1	1		0	0	73	0	0	9.999974e-01	9.999879e-01	0	143	0	379	0	21	590
SUGCT	79783	broad.mit.edu	37	7	40899974	40899974	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr7:40899974G>A	ENST00000335693.4	+	14	1257	c.1234G>A	c.(1234-1236)Ggg>Agg	p.G412R	C7orf10_ENST00000309930.5_Missense_Mutation_p.G438R|C7orf10_ENST00000401647.2_Missense_Mutation_p.G364R|C7orf10_ENST00000464028.1_3'UTR	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		412					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						CCCGCTGCTCGGGCAGCACAC	0.567																																						ENST00000335693.4	1.000000	0.200000	0.390000	0.250000	0.300000	0.355818	0.300000	0.310000																										0				18						c.(1234-1236)Ggg>Agg									99.0	110.0	106.0					7																	40899974		2104	4227	6331	SO:0001583	missense	0	1	121084	34				g.chr7:40899974G>A																												ENST00000335693.4:c.1234G>A	chr7.hg19:g.40899974G>A	ENSP00000338475:p.Gly412Arg	0					C7orf10_ENST00000401647.2_Missense_Mutation_p.G364R|C7orf10_ENST00000309930.5_Missense_Mutation_p.G438R|C7orf10_ENST00000464028.1_3'UTR	p.G412R	NM_001193313.1	NP_001180242.1	1	2	3	2.011485	Q9HAC7	SUCHY_HUMAN		14	1257	+			A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	ENST00000335693.4	1	1	hg19	c.1234G>A	CCDS55105.1	0	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637058	0.87760	.	.	ENSG00000175600	ENST00000309930;ENST00000401647;ENST00000335693	D;T;T	0.96396	-4.0;-1.11;-1.11	5.51	5.51	0.81932	5.510000	5.510000	0.819320	CoA-transferase family III domain (1);	0.275863	0.34484	N	0.003935	D	0.98689	0.9560	M	0.93594	3.435	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.994;0.997	D	0.99593	1.0976	10	0.87932	D	0	-10.9205	18.9884	0.92782	0.0:0.0:1.0:0.0	.	364;412;401	Q4KMW8;Q9HAC7;Q9HAC7-2	.;CG010_HUMAN;.	R	438;364;412	ENSP00000312054:G438R;ENSP00000385222:G364R;ENSP00000338475:G412R	ENSP00000312054:G438R	G	+	1	0	0	C7orf10	40866499	40866499	1.000000	0.71417	0.988000	0.46212	0.858000	0.48976	6.455000	0.73497	2.575000	0.86900	0.655000	0.94253	GGG	0.165342		TCGA-HZ-8003-01A-21D-2201-08	0.567	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1	0	0	1	2	2	2	2	0	0	0	0	154	154	154	152	1	2	-2.107909	0	0.160000			0	28	28	0	1136	1109	0		1	0		0	0	154	0	0	1	5.587676e-01	0	1	0	75	0	28	1136
IMPAD1	54928	broad.mit.edu	37	8	57905955	57905955	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr8:57905955G>C	ENST00000262644.4	-	1	448	c.190C>G	c.(190-192)Cgc>Ggc	p.R64G		NM_017813.4	NP_060283.3	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	64					chondrocyte development (GO:0002063)|chondroitin sulfate metabolic process (GO:0030204)|embryonic digit morphogenesis (GO:0042733)|endochondral ossification (GO:0001958)|inositol biosynthetic process (GO:0006021)|phosphatidylinositol phosphorylation (GO:0046854)|post-embryonic development (GO:0009791)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|3'-nucleotidase activity (GO:0008254)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				AGCATCTCGCGCAAGTCCACG	0.741																																						ENST00000262644.4	1.000000	0.220000	0.770000	0.330000	0.500000	0.549666	0.500000	0.450000																										0				7						c.(190-192)Cgc>Ggc		inositol monophosphatase domain containing 1							19.0	19.0	19.0					8																	57905955		2194	4291	6485	SO:0001583	missense	54928	1	119742	30				g.chr8:57905955G>C		CCDS6169.1	8q12.1	2013-05-16			ENSG00000104331	ENSG00000104331			26019	protein-coding gene	gene with protein product		614010				21549340	Standard	NM_017813		Approved	FLJ20421, IMPA3, gPAPP	uc003xte.4	Q9NX62	OTTHUMG00000164415	ENST00000262644.4:c.190C>G	chr8.hg19:g.57905955G>C	ENSP00000262644:p.Arg64Gly	0						p.R64G	NM_017813.4	NP_060283.3	1	2	3	2.019161	Q9NX62	IMPA3_HUMAN		1	448	-		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)	Q6NVY7	Missense_Mutation	SNP	ENST00000262644.4	1	1	hg19	c.190C>G	CCDS6169.1	0	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819807	0.50633	.	.	ENSG00000104331	ENST00000262644	T	0.52983	0.64	5.05	4.12	0.48240	5.050000	4.120000	0.482400	.	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.79011	2.435	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.61898	-0.6968	10	0.37606	T	0.19	-0.0018	6.9727	0.24658	0.0931:0.0:0.7402:0.1667	.	64	Q9NX62	IMPA3_HUMAN	G	64	ENSP00000262644:R64G	ENSP00000262644:R64G	R	-	1	0	0	IMPAD1	58068509	58068509	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	3.892000	0.56235	1.023000	0.39654	-0.378000	0.06908	CGC	0.167328		TCGA-HZ-8003-01A-21D-2201-08	0.741	IMPAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378665.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	2	-9.020743	1	0.160000	NM_017813		0	7	7	0	185	177	0		1			0	0	36	0	0	9.781028e-01	0	0	0	0	0	0	7	185
TRPA1	8989	broad.mit.edu	37	8	72969219	72969219	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr8:72969219C>T	ENST00000262209.4	-	10	1334	c.1127G>A	c.(1126-1128)cGt>cAt	p.R376H		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	376					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CAGAAAATTACGTCCAAAATT	0.299																																						ENST00000262209.4	1.000000	0.160000	0.590000	0.250000	0.380000	0.439551	0.380000	0.340000																										0				98						c.(1126-1128)cGt>cAt		transient receptor potential cation channel, subfamily A, member 1	Menthol(DB00825)						39.0	39.0	39.0					8																	72969219		2200	4295	6495	SO:0001583	missense	8989	2	121318	35				g.chr8:72969219C>T	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1127G>A	chr8.hg19:g.72969219C>T	ENSP00000262209:p.Arg376His	0						p.R376H	NM_007332.2	NP_015628.2	1	2	3	2.019161	O75762	TRPA1_HUMAN	Epithelial(68;0.223)	10	1334	-			A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	0	1	hg19	c.1127G>A	CCDS34908.1	0	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860578	0.71834	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.54479	0.57;2.37	5.69	5.69	0.88448	5.690000	5.690000	0.884480	Ankyrin repeat-containing domain (3);	0.048019	0.85682	D	0.000000	T	0.53126	0.1777	M	0.62723	1.935	0.58432	D	0.999997	B	0.18310	0.027	B	0.17098	0.017	T	0.47983	-0.9074	10	0.21014	T	0.42	-18.244	19.8051	0.96529	0.0:1.0:0.0:0.0	.	376	O75762	TRPA1_HUMAN	H	228;376	ENSP00000428151:R228H;ENSP00000262209:R376H	ENSP00000262209:R376H	R	-	2	0	0	TRPA1	73131773	73131773	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.639000	0.74314	2.691000	0.91804	0.585000	0.79938	CGT	0.167328		TCGA-HZ-8003-01A-21D-2201-08	0.299	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	2	-3.316146	1	0.160000	NM_007332		0	7	7	0	248	243	0		1	0		0	0	18	0	0	9.796174e-01	0	0	0	0	1	0	7	248
TRPS1	7227	broad.mit.edu	37	8	116430660	116430660	+	Silent	SNP	A	A	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr8:116430660A>T	ENST00000220888.5	-	5	2841	c.2682T>A	c.(2680-2682)gtT>gtA	p.V894V	TRPS1_ENST00000395715.3_Silent_p.V907V|TRPS1_ENST00000519076.1_Silent_p.V648V|TRPS1_ENST00000520276.1_Silent_p.V898V			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	894			V -> D (in TRPS3; in heterozygous status has a milder effect causing TRPS1). {ECO:0000269|PubMed:11112658}.		chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGGCACAAAAAACACCGGAGC	0.488									Langer-Giedion syndrome																													ENST00000220888.5	1.000000	0.300000	0.570000	0.360000	0.440000	0.497316	0.440000	0.440000																										0				111						c.(2680-2682)gtT>gtA		trichorhinophalangeal syndrome I							112.0	113.0	113.0					8																	116430660		1914	4128	6042	SO:0001819	synonymous_variant	7227	0	0		Langer-Giedion syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	g.chr8:116430660A>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2682T>A	chr8.hg19:g.116430660A>T		0					TRPS1_ENST00000520276.1_Silent_p.V898V|TRPS1_ENST00000519076.1_Silent_p.V648V|TRPS1_ENST00000395715.3_Silent_p.V907V	p.V894V			1	2	3	2.019161	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)	5	2841	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	1	1	hg19	c.2682T>A		0	.	.	.	.	.	.	.	.	.	.	A	5.146	0.212445	0.09757	.	.	ENSG00000104447	ENST00000518018	.	.	.	5.81	3.3	0.37823	5.810000	3.300000	0.378230	.	.	.	.	.	T	0.56217	0.1970	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51529	-0.8694	4	.	.	.	.	7.5919	0.28025	0.8057:0.0:0.0684:0.1259	.	.	.	.	I	19	.	.	F	-	1	0	0	TRPS1	116499836	116499836	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.219000	0.32479	1.027000	0.39758	0.528000	0.53228	TTT	0.167328		TCGA-HZ-8003-01A-21D-2201-08	0.488	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	0	0	1	2	2	2	2	0	0	0	0	129	129	129	128	1	2	-20.000000	1	0.160000	NM_014112		0	30	29	0	835	822	0		1	0		0	0	129	0	0	1	2.437657e-02	0	0	0	7	0	30	835
WDR34	89891	broad.mit.edu	37	9	131403176	131403176	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chr9:131403176C>T	ENST00000372715.2	-	2	289	c.229G>A	c.(229-231)Gcc>Acc	p.A77T		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	77						axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						CTGGCCTGGGCGGATGCACTG	0.652																																						ENST00000372715.2	0.550000	0.180000	0.450000	0.250000	0.340000	0.355993	0.340000	0.330000																										0				9						c.(229-231)Gcc>Acc		WD repeat domain 34							37.0	40.0	39.0					9																	131403176		2203	4299	6502	SO:0001583	missense	89891	1	121404	28				g.chr9:131403176C>T	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.229G>A	chr9.hg19:g.131403176C>T	ENSP00000361800:p.Ala77Thr	0						p.A77T	NM_052844.3	NP_443076.2	0	1	1	1.989337	Q96EX3	WDR34_HUMAN		2	289	-			Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	1	1	hg19	c.229G>A	CCDS6906.2	0	.	.	.	.	.	.	.	.	.	.	C	6.909	0.537276	0.13188	.	.	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T	0.61980	0.06	5.4	-3.5	0.04710	5.400000	-3.500000	0.047100	.	1.250360	0.05511	N	0.560229	T	0.42653	0.1212	L	0.37630	1.12	0.09310	N	1	B;B	0.13594	0.003;0.008	B;B	0.06405	0.002;0.002	T	0.28650	-1.0037	10	0.06365	T	0.9	.	5.4964	0.16805	0.2163:0.3838:0.0:0.3999	.	62;77	A2A3F8;Q96EX3	.;WDR34_HUMAN	T	77;68;62	ENSP00000361800:A77T	ENSP00000361800:A77T	A	-	1	0	0	WDR34	130442997	130442997	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.250000	0.08830	-0.472000	0.06881	-0.140000	0.14226	GCC	0.154589		TCGA-HZ-8003-01A-21D-2201-08	0.652	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	2	-3.065521	1	0.160000	NM_052844		0	12	12	0	434	427	0		1	1		0	0	80	0	0	9.990527e-01	5.253209e-01	0	3	0	59	0	12	434
TFE3	7030	broad.mit.edu	37	X	48887764	48887764	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chrX:48887764G>A	ENST00000315869.7	-	10	1892	c.1633C>T	c.(1633-1635)Cgg>Tgg	p.R545W	TFE3_ENST00000487451.1_5'Flank	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	545					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GAGGCAGCCCGCAGTGGGGAC	0.662			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																	ENST00000315869.7	0.490000	0.090000	0.360000	0.150000	0.240000	0.264656	0.240000	0.220000				Dom	yes			Dom	yes		X	Xp11.22	Xp11.22	7030	T	transcription factor binding to IGHM enhancer 3				E	E	SFPQ, ASPSCR1, PRCC, NONO, CLTC		papillary renal, alveolar soft part sarcoma, renal	NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	0				1						c.(1633-1635)Cgg>Tgg		transcription factor binding to IGHM enhancer 3							21.0	19.0	20.0					X																	48887764		2203	4294	6497	SO:0001583	missense	7030	0	0					g.chrX:48887764G>A	X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1633C>T	chrX.hg19:g.48887764G>A	ENSP00000314129:p.Arg545Trp						TFE3_ENST00000487451.1_5'Flank	p.R545W	NM_006521.4	NP_006512.2	0	1	1		P19532	TFE3_HUMAN		10	1892	-			A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Missense_Mutation	SNP	ENST00000315869.7	0	1	hg19	c.1633C>T	CCDS14315.3	0	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952187	0.53293	.	.	ENSG00000068323	ENST00000315869	T	0.16073	2.37	5.41	3.53	0.40419	5.410000	3.530000	0.404190	.	0.217637	0.23213	U	0.050656	T	0.09818	0.0241	N	0.14661	0.345	0.41478	D	0.988141	B	0.18310	0.027	B	0.13407	0.009	T	0.09952	-1.0651	10	0.66056	D	0.02	-17.8225	7.7685	0.28993	0.0904:0.2819:0.6277:0.0	.	545	P19532	TFE3_HUMAN	W	545	ENSP00000314129:R545W	ENSP00000314129:R545W	R	-	1	2	2	TFE3	48774708	48774708	0.999000	0.42202	0.999000	0.59377	0.683000	0.39861	3.116000	0.50399	1.058000	0.40530	0.509000	0.49947	CGG	0.160000		TCGA-HZ-8003-01A-21D-2201-08	0.662	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	0	0	0	2	2	2	2	0	0	0	0	53	53	53	52	1	2	-4.012331	1	0.160000	NM_006521		0	5	5	0	271	247	0		1	0		0	0	53	0	0	9.212167e-01	3.525805e-01	0	0	0	58	0	5	271
MAP7D3	79649	broad.mit.edu	37	X	135313711	135313711	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8003-01A-21D-2201-08	TCGA-HZ-8003-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f024977e-2d5d-4205-937d-3c832da05272	7601f464-a2b6-4fda-9887-9419efd30388	g.chrX:135313711C>T	ENST00000316077.9	-	8	1625	c.1405G>A	c.(1405-1407)Gct>Act	p.A469T	MAP7D3_ENST00000370663.5_Missense_Mutation_p.A451T|MAP7D3_ENST00000370661.1_Missense_Mutation_p.A434T|MAP7D3_ENST00000495432.1_5'Flank	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	469					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					ACCTTTGGAGCGTCTCTCGCT	0.428																																						ENST00000316077.9	0.530000	0.280000	0.470000	0.330000	0.390000	0.405947	0.390000	0.400000																										0				44						c.(1405-1407)Gct>Act		MAP7 domain containing 3							130.0	115.0	120.0					X																	135313711		1887	4107	5994	SO:0001583	missense	79649	0	0					g.chrX:135313711C>T	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1405G>A	chrX.hg19:g.135313711C>T	ENSP00000318086:p.Ala469Thr						MAP7D3_ENST00000370663.5_Missense_Mutation_p.A451T|MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370661.1_Missense_Mutation_p.A434T	p.A469T	NM_024597.3	NP_078873.2	0	1	1		Q8IWC1	MA7D3_HUMAN		8	1625	-	Acute lymphoblastic leukemia(192;0.000127)		A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	1	1	hg19	c.1405G>A	CCDS44004.1	0	.	.	.	.	.	.	.	.	.	.	C	3.209	-0.161936	0.06502	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.04194	4.42;3.85;3.85;3.68	4.33	-7.09	0.01553	4.330000	-7.090000	0.015530	.	1.863520	0.03468	N	0.213251	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.28971	0.079;0.128;0.079;0.229	B;B;B;B	0.15870	0.011;0.011;0.011;0.014	T	0.35968	-0.9767	10	0.35671	T	0.21	-3.1947	1.1109	0.01704	0.2367:0.3632:0.1659:0.2342	.	451;428;469;434	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	T	434;469;451;428	ENSP00000359695:A434T;ENSP00000318086:A469T;ENSP00000359697:A451T;ENSP00000359694:A428T	ENSP00000318086:A469T	A	-	1	0	0	MAP7D3	135141377	135141377	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.359000	0.07632	-1.469000	0.01890	-1.699000	0.00722	GCT	0.160000		TCGA-HZ-8003-01A-21D-2201-08	0.428	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2	0	0	1	2	2	2	2	0	0	0	0	133	133	133	132	1	2	-2.823140	1	0.160000			0	36	34	0	1096	1087	0		1	0		0	0	133	0	0	1	1.059057e-01	0	0	0	17	0	36	1096
