#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ROCK1	6093	broad.mit.edu	37	18	18608802	18608802	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr18:18608802delA	ENST00000399799.2	-	10	2086	c.1146delT	c.(1144-1146)cctfs	p.P382fs		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	382	AGC-kinase C-terminal.|Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					CTTTAGGAATAGGGAATGTTT	0.358																																						ENST00000399799.2	0.880000	0.600000	0.810000	0.660000	0.730000	0.745152	0.730000	0.740000																										0				16						c.(1144-1146)cctfs		Rho-associated, coiled-coil containing protein kinase 1							152.0	151.0	151.0					18																	18608802		2203	4300	6503	SO:0001589	frameshift_variant	6093	0	0					g.chr18:18608802delA		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1146delT	chr18.hg19:g.18608802delA	ENSP00000382697:p.Pro382fs	0						p.P382fs	NM_005406.2	NP_005397.1	0	0	0	2.033512	Q13464	ROCK1_HUMAN		10	2086	-	Melanoma(1;0.165)		B0YJ91|Q2KHM4|Q59GZ4	Frame_Shift_Del	DEL	ENST00000399799.2	1	1	hg19	c.1146delT	CCDS11870.2	0																																																																																								0.348269		TCGA-HZ-8005-01A-11D-2201-08	0.358	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	1	0	1		2	2		0	0	0	0	115	0	115	113	1	1.820000	-2.364554	0	0.360000	NM_005406		0	92	91	0	585	578	0	0	1	1		0	0	115	0	0	1.000000	9.742560e-01		2	0	37	0	92	585
MAP1LC3A	84557	broad.mit.edu	37	20	33147601	33147604	+	Frame_Shift_Del	DEL	GTGA	GTGA	-			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			GTGA	-	GTGA	GTGA		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr20:33147601_33147604delGTGA	ENST00000360668.3	+	4	1026_1029	c.265_268delGTGA	c.(265-270)gtgagtfs	p.VS91fs	MAP1LC3A_ENST00000374837.3_Frame_Shift_Del_p.VS95fs|MAP1LC3A_ENST00000476428.1_3'UTR|MAP1LC3A_ENST00000397709.1_Frame_Shift_Del_p.VS91fs			Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3 alpha	91					autophagic vacuole assembly (GO:0000045)|mitochondrion degradation (GO:0000422)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|late endosome (GO:0005770)|microtubule (GO:0005874)|organelle membrane (GO:0031090)	phosphatidylethanolamine binding (GO:0008429)|phospholipid binding (GO:0005543)			cervix(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(2)	5						GCACAGCATGGTGAGTGTGTCCAC	0.618																																						ENST00000360668.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999555	0.990000	1.000000																										0				5						c.(265-270)gtgagtfs		microtubule-associated protein 1 light chain 3 alpha																																				SO:0001589	frameshift_variant	84557	0	0					g.chr20:33147601_33147604delGTGA		CCDS13237.1, CCDS13238.1	20q11.22	2014-02-12			ENSG00000101460	ENSG00000101460			6838	protein-coding gene	gene with protein product		601242				8833088, 17580304	Standard	NM_032514		Approved	MAP1BLC3, MAP1ALC3, LC3, LC3A, ATG8E	uc002xaq.2	Q9H492	OTTHUMG00000032306	ENST00000360668.3:c.265_268delGTGA	chr20.hg19:g.33147601_33147604delGTGA	ENSP00000353886:p.Val91fs	1					MAP1LC3A_ENST00000397709.1_Frame_Shift_Del_p.VS91fs|MAP1LC3A_ENST00000374837.3_Frame_Shift_Del_p.VS95fs|MAP1LC3A_ENST00000476428.1_3'UTR	p.VS91fs			1	2	3	2.302192	Q9H492	MLP3A_HUMAN		4	1026_1029	+			E1P5P4|E1P5P5|Q9BXW5	Frame_Shift_Del	DEL	ENST00000360668.3	1	1	hg19	c.265_268delGTGA	CCDS13238.1	1																																																																																								0.436123		TCGA-HZ-8005-01A-11D-2201-08	0.618	MAP1LC3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078801.2	1	0	1		58	2		0	0	0	6	154	0	154	160	1	1.820000	-2.931444	1	0.360000	NM_181509		0	170	236	0	755	792	0	0	1	1		0	0	154	0	0	1.000000	1		21	0	126	0	170	755
MRPS30	10884	broad.mit.edu	37	5	44815246	44815255	+	Frame_Shift_Del	DEL	TAGTTCACTT	TAGTTCACTT	-			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr5:44815246_44815255delTAGTTCACTT	ENST00000507110.1	+	5	1300_1309	c.1262_1271delTAGTTCACTT	c.(1261-1272)atagttcactttfs	p.IVHF421fs		NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	421					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CTACTTCAGATAGTTCACTTTCTACTGAAT	0.319																																						ENST00000507110.1	0.710000	0.320000	0.610000	0.400000	0.500000	0.512892	0.500000	0.500000																										0				20						c.(1261-1272)atagttcactttfs		mitochondrial ribosomal protein S30																																				SO:0001589	frameshift_variant	10884	0	0					g.chr5:44815246_44815255delTAGTTCACTT	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.1262_1271delTAGTTCACTT	chr5.hg19:g.44815246_44815255delTAGTTCACTT	ENSP00000424328:p.Ile421fs	0						p.IVHF421fs	NM_016640.3	NP_057724.2	0	0	0	2.013809	Q9NP92	RT30_HUMAN		5	1300_1309	+	Lung NSC(6;8.08e-07)		Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Frame_Shift_Del	DEL	ENST00000507110.1	0	1	hg19	c.1262_1271delTAGTTCACTT	CCDS3951.1	0																																																																																								0.341021		TCGA-HZ-8005-01A-11D-2201-08	0.319	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	1	0	1		21	2		0	0	0	2	55	0	55	58	1	1.820000	-20.000000	1	0.360000	NM_016640		0	22	34	0	216	227	0	0	1	0		0	0	55	0	0	0.733022	9.878037e-01		0	0	72	0	22	216
NCOA2	10499	broad.mit.edu	37	8	71071800	71071803	+	Frame_Shift_Del	DEL	AGTT	AGTT	-			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:71071800_71071803delAGTT	ENST00000452400.2	-	10	1242_1245	c.1061_1064delAACT	c.(1060-1065)aaactcfs	p.KL354fs	NCOA2_ENST00000524223.1_5'Flank	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	354					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AGAACGGATGAGTTTGCTCTTCGT	0.402			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	ENST00000452400.2	1.000000	0.690000	0.970000	0.750000	0.820000	0.846575	0.820000	0.810000				Dom	yes			Dom	yes		8	8q13.1	8q13.1	10499	T	nuclear receptor coactivator 2 (TIF2)				L	L	RUNXBP2, HEY1		AML, Chondrosarcoma	PAX3/NCOA2(4)|HEY1/NCOA2(10)	0				60						c.(1060-1065)aaactcfs		nuclear receptor coactivator 2																																				SO:0001589	frameshift_variant	10499	0	0					g.chr8:71071800_71071803delAGTT	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1061_1064delAACT	chr8.hg19:g.71071800_71071803delAGTT	ENSP00000399968:p.Lys354fs	0					NCOA2_ENST00000524223.1_5'Flank	p.KL354fs	NM_006540.2	NP_006531.1	1	2	3	2.149319	Q15596	NCOA2_HUMAN	Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)	10	1242_1245	-	Breast(64;0.201)		Q14CD2	Frame_Shift_Del	DEL	ENST00000452400.2	1	1	hg19	c.1061_1064delAACT	CCDS47872.1	0																																																																																								0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.402	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1	1	0	1		23	2		0	0	0	1	144	0	144	144	1	1.820000	-20.000000	1	0.360000			0	141	174	0	853	847	0	0	1	1		0	0	144	0	0	1.000000	8.193667e-01		3	0	18	0	141	853
CDKN2A	1029	broad.mit.edu	37	9	21971143	21971144	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			-	A	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr9:21971143_21971144insA	ENST00000304494.5	-	2	484_485	c.214_215insT	c.(214-216)tgcfs	p.C72fs	CDKN2A_ENST00000498628.2_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000494262.1_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.C72fs|CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.C72fs|CDKN2A_ENST00000479692.2_Frame_Shift_Ins_p.C21fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000361570.3_Frame_Shift_Ins_p.L127fs|CDKN2A_ENST00000578845.2_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000497750.1_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000530628.2_Frame_Shift_Ins_p.L86fs|CDKN2A_ENST00000579755.1_Frame_Shift_Ins_p.L86fs|CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.C72fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	72			C -> G (in an esophagus tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.E61_L94del(1)|p.0(1)|p.C72S(1)|p.C72Y(1)|p.V59fs*45(1)|p.L65fs*38(1)|p.C72G(1)|p.A68fs*3(1)|p.C72fs*71(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GGGGTCGGCGCAGTTGGGCTCC	0.713		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	0.420000	1.000000	0.570000	0.760000	0.771724	0.760000	1.000000		17																								1368	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(4)|Substitution - Missense(3)|Deletion - In frame(1)	p.0?(1315)|p.?(44)|p.E61_L94del(1)|p.0(1)|p.C72S(1)|p.C72Y(1)|p.V59fs*45(1)|p.L65fs*38(1)|p.C72G(1)|p.A68fs*3(1)|p.C72fs*71(1)	haematopoietic_and_lymphoid_tissue(283)|skin(175)|central_nervous_system(167)|lung(145)|urinary_tract(91)|bone(74)|soft_tissue(57)|oesophagus(56)|pleura(51)|upper_aerodigestive_tract(49)|ovary(37)|kidney(32)|breast(32)|pancreas(30)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	4199						c.(214-216)tgcfs		cyclin-dependent kinase inhibitor 2A																																				SO:0001589	frameshift_variant	1029	0	0					g.chr9:21971143_21971144insA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.215dupT	chr9.hg19:g.21971144_21971144dupA	ENSP00000307101:p.Cys72fs	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Frame_Shift_Ins_p.L86fs|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.C72fs|CDKN2A_ENST00000579755.1_Frame_Shift_Ins_p.L86fs|CDKN2A_ENST00000494262.1_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000497750.1_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000578845.2_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.C72fs|CDKN2A_ENST00000361570.3_Frame_Shift_Ins_p.L127fs|CDKN2A_ENST00000498628.2_Frame_Shift_Ins_p.C21fs|CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.C72fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Frame_Shift_Ins_p.C21fs	p.C72fs	NM_000077.4	NP_000068.1	0	2	2	1.889507	P42771	CD2A1_HUMAN		2	484_485	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Ins	INS	ENST00000304494.5	0	1	hg19	c.214_215insT	CCDS6510.1	0																																																																																								0.360000		TCGA-HZ-8005-01A-11D-2201-08	0.713	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1		2	2	2	0	0	0	0	17	0	17	15	1	1.820000	-19.994250	1	0.360000	NM_000077		0	13	15	0	88	81	0	0	1	1	1	0	0	17	68	0	0.999718	1	9.998923e-01	7	28	516	91	13	88
SEC31B	25956	broad.mit.edu	37	10	102249858	102249858	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr10:102249858G>A	ENST00000370345.3	-	21	2969	c.2872C>T	c.(2872-2874)Cct>Tct	p.P958S		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	958	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		AAGCTTGCAGGAGGGGCTGGG	0.617																																						ENST00000370345.3	1.000000	0.770000	1.000000	0.840000	0.920000	0.925503	0.920000	1.000000																										0				36						c.(2872-2874)Cct>Tct		SEC31 homolog B (S. cerevisiae)							77.0	77.0	77.0					10																	102249858		2203	4300	6503	SO:0001583	missense	25956	0	0					g.chr10:102249858G>A	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2872C>T	chr10.hg19:g.102249858G>A	ENSP00000359370:p.Pro958Ser	0						p.P958S	NM_015490.3	NP_056305.1	0	1	1	1.904045	Q9NQW1	SC31B_HUMAN		21	2969	-		Colorectal(252;0.117)	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	1	1	hg19	c.2872C>T	CCDS7495.1	1	.	.	.	.	.	.	.	.	.	.	G	8.072	0.770537	0.15983	.	.	ENSG00000075826	ENST00000370345	T	0.56275	0.47	5.37	3.44	0.39384	5.37	3.44	0.39384	.	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	M	0.70275	2.135	0.80722	D	1	P;P	0.36412	0.472;0.552	B;B	0.33521	0.165;0.064	T	0.51426	-0.8707	10	0.59425	D	0.04	-6.728	7.5146	0.27593	0.0908:0.1658:0.7435:0.0	.	957;958	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	S	958	ENSP00000359370:P958S	ENSP00000359370:P958S	P	-	1	0	0	SEC31B	102239848	102239848	0.998000	0.40836	0.924000	0.36721	0.048000	0.14542	1.939000	0.40213	1.256000	0.44068	0.561000	0.74099	CCT	0.302224		TCGA-HZ-8005-01A-11D-2201-08	0.617	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	1	0	1	2	2	2	2	0	0	0	0	99	99	99	97	1	1.820000	-3.225289	1	0.360000	NM_015490		0	102	102	0	454	445	1		1	0		0	0	99	0	0	1.000000	1.581886e-01	0	0	0	4	0	102	454
PCDH15	65217	broad.mit.edu	37	10	55566772	55566772	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr10:55566772C>A	ENST00000373965.2	-	36	5016	c.4622G>T	c.(4621-4623)aGt>aTt	p.S1541I	PCDH15_ENST00000414778.1_Missense_Mutation_p.S1538I	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.S1538N(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GTTGATATTACTGTGGATACT	0.453										HNSCC(58;0.16)																												ENST00000373965.2	0.620000	0.280000	0.530000	0.350000	0.430000	0.450706	0.430000	0.430000																										1	Substitution - Missense(1)	p.S1538N(1)	lung(1)	237						c.(4621-4623)aGt>aTt		protocadherin-related 15							74.0	67.0	69.0					10																	55566772		1568	3581	5149	SO:0001583	missense	65217	0	0					g.chr10:55566772C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000373965.2:c.4622G>T	chr10.hg19:g.55566772C>A	ENSP00000363076:p.Ser1541Ile	0	HNSCC(58;0.16)				PCDH15_ENST00000414778.1_Missense_Mutation_p.S1538I	p.S1541I	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	0	1	1	1.904045	Q96QU1	PCD15_HUMAN		36	5016	-		Melanoma(3;0.117)|Lung SC(717;0.238)	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000373965.2	1	1	hg19	c.4622G>T		0	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759997	0.49468	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746	T;T	0.65364	-0.15;-0.15	5.6	4.59	0.56863	5.6	4.59	0.56863	.	.	.	.	.	T	0.44644	0.1303	L	0.47716	1.5	0.80722	D	1	P;P	0.39216	0.664;0.664	B;B	0.27500	0.08;0.08	T	0.54886	-0.8226	9	0.87932	D	0	.	3.092	0.06297	0.0:0.5059:0.2678:0.2263	.	1532;1538	C6ZEF7;C9J4F3	.;.	I	1541;1538;1534	ENSP00000363076:S1541I;ENSP00000410304:S1538I	ENSP00000363076:S1541I	S	-	2	0	0	PCDH15	55236778	55236778	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	1.394000	0.34509	2.627000	0.88993	0.655000	0.94253	AGT	0.302224		TCGA-HZ-8005-01A-11D-2201-08	0.453	PCDH15-008	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291336.1	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.820000	-20.000000	1	0.360000	NM_033056		0	23	23	0	244	240	0		1			0	0	64	0	0	0.999999	0	0	0	0	0	0	23	244
PSD	5662	broad.mit.edu	37	10	104163099	104163099	+	Missense_Mutation	SNP	G	G	A	rs572223815		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr10:104163099G>A	ENST00000020673.5	-	17	3459	c.2933C>T	c.(2932-2934)gCc>gTc	p.A978V	PSD_ENST00000406432.1_Missense_Mutation_p.A978V	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	978					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCCGGCCTGGGCCAGTGCTGC	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16420	0.0		0.0	False		,,,				2504	0.0					ENST00000020673.5	0.480000	0.220000	0.410000	0.270000	0.340000	0.349784	0.340000	0.340000																										0				34						c.(2932-2934)gCc>gTc		pleckstrin and Sec7 domain containing							76.0	56.0	62.0					10																	104163099		2203	4300	6503	SO:0001583	missense	5662	1	121410	32				g.chr10:104163099G>A	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.2933C>T	chr10.hg19:g.104163099G>A	ENSP00000020673:p.Ala978Val	0					PSD_ENST00000406432.1_Missense_Mutation_p.A978V	p.A978V	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	0	1	1	1.904045	A5PKW4	PSD1_HUMAN		17	3459	-			B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	1	1	hg19	c.2933C>T	CCDS31272.1	0	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350837	0.24512	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.17854	2.25;2.25	4.62	3.67	0.42095	4.62	3.67	0.42095	.	0.179711	0.40554	N	0.001066	T	0.11281	0.0275	L	0.38175	1.15	0.28948	N	0.890587	B;B;B	0.32051	0.354;0.227;0.125	B;B;B	0.32465	0.071;0.146;0.096	T	0.07966	-1.0745	10	0.45353	T	0.12	.	2.9344	0.05810	0.1017:0.1876:0.54:0.1708	.	978;881;599	A5PKW4;Q86YI3;A5PKW4-2	PSD1_HUMAN;.;.	V	978;881;978	ENSP00000020673:A978V;ENSP00000384830:A978V	ENSP00000020673:A978V	A	-	2	0	0	PSD	104153089	104153089	0.998000	0.40836	1.000000	0.80357	0.160000	0.22226	1.737000	0.38197	2.403000	0.81681	0.313000	0.20887	GCC	0.302224		TCGA-HZ-8005-01A-11D-2201-08	0.642	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.820000	-7.500543	1	0.360000			0	26	26	0	363	352	0		1	1		0	0	60	0	0	1.000000	9.184895e-01	0	2	0	60	0	26	363
PPP2R1B	5519	broad.mit.edu	37	11	111624222	111624222	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:111624222T>C	ENST00000527614.1	-	9	1174	c.1109A>G	c.(1108-1110)aAa>aGa	p.K370R	PPP2R1B_ENST00000341980.6_Intron|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.K306R|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.K370R|PPP2R1B_ENST00000427203.2_Missense_Mutation_p.K209R|PPP2R1B_ENST00000393055.2_Missense_Mutation_p.K243R	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	370					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GGTATTTTCTTTGCCCAAAAT	0.338																																						ENST00000527614.1	1.000000	0.660000	1.000000	0.770000	0.900000	0.893788	0.900000	1.000000																										0				22						c.(1108-1110)aAa>aGa		protein phosphatase 2, regulatory subunit A, beta							95.0	91.0	92.0					11																	111624222		2201	4297	6498	SO:0001583	missense	5519	0	0					g.chr11:111624222T>C	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.1109A>G	chr11.hg19:g.111624222T>C	ENSP00000437193:p.Lys370Arg	0					PPP2R1B_ENST00000393055.2_Missense_Mutation_p.K243R|PPP2R1B_ENST00000427203.2_Missense_Mutation_p.K209R|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.K306R|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.K370R|PPP2R1B_ENST00000341980.6_Intron	p.K370R	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	0	0	0	2.060589	P30154	2AAB_HUMAN		9	1174	-		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	ENST00000527614.1	1	1	hg19	c.1109A>G	CCDS8349.1	1	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193625	0.58017	.	.	ENSG00000137713	ENST00000311129;ENST00000412902;ENST00000426998;ENST00000527614;ENST00000427203;ENST00000393055	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.73	5.73	0.89815	5.73	5.73	0.89815	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25791	0.0628	L	0.33137	0.985	0.52501	D	0.999952	B;B;B;B;B	0.18013	0.025;0.0;0.001;0.0;0.003	B;B;B;B;B	0.18871	0.01;0.001;0.006;0.001;0.023	T	0.03095	-1.1073	10	0.39692	T	0.17	-18.4605	13.9672	0.64216	0.0:0.0:0.0:1.0	.	243;209;306;370;370	A8MY67;B7Z1G3;B4DWW5;P30154;P30154-2	.;.;.;2AAB_HUMAN;.	R	370;243;306;370;209;243	ENSP00000311344:K370R;ENSP00000410671:K306R;ENSP00000437193:K370R;ENSP00000415759:K209R;ENSP00000376775:K243R	ENSP00000311344:K370R	K	-	2	0	0	PPP2R1B	111129432	111129432	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.509000	0.81698	2.180000	0.69256	0.533000	0.62120	AAA	0.357688		TCGA-HZ-8005-01A-11D-2201-08	0.338	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.820000	-20.000000	1	0.360000	NM_002716		0	39	39	0	199	195	1		1	1		0	0	53	0	0	1.000000	7.315343e-01	0	5	0	10	0	39	199
DSCAML1	57453	broad.mit.edu	37	11	117299205	117299205	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:117299205C>T	ENST00000321322.6	-	33	6182	c.6181G>A	c.(6181-6183)Gct>Act	p.A2061T	DSCAML1_ENST00000527706.1_Missense_Mutation_p.A1791T	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	2001					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGAGGGGCAGCGCTGGGGGCG	0.731																																						ENST00000321322.6	0.980000	0.330000	0.800000	0.460000	0.610000	0.637149	0.610000	1.000000																										0				110						c.(6181-6183)Gct>Act		Down syndrome cell adhesion molecule like 1							6.0	6.0	6.0					11																	117299205		1667	3670	5337	SO:0001583	missense	57453	5	115846	31				g.chr11:117299205C>T		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.6181G>A	chr11.hg19:g.117299205C>T	ENSP00000315465:p.Ala2061Thr	0					DSCAML1_ENST00000527706.1_Missense_Mutation_p.A1791T	p.A2061T	NM_020693.2	NP_065744.2	0	0	0	2.060589	Q8TD84	DSCL1_HUMAN		33	6182	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	0	1	hg19	c.6181G>A	CCDS8384.1	0	.	.	.	.	.	.	.	.	.	.	C	3.405	-0.121412	0.06838	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.60920	0.19;0.15	4.8	-1.8	0.07907	4.8	-1.8	0.07907	.	.	.	.	.	T	0.27900	0.0687	N	0.08118	0	0.22446	N	0.999099	B	0.28880	0.226	B	0.20184	0.028	T	0.16748	-1.0392	9	0.16896	T	0.51	.	6.3973	0.21618	0.0:0.3772:0.1962:0.4265	.	2001	Q8TD84	DSCL1_HUMAN	T	1791;2061;1768	ENSP00000434335:A1791T;ENSP00000315465:A2061T	ENSP00000315465:A2061T	A	-	1	0	0	DSCAML1	116804415	116804415	0.004000	0.15560	0.004000	0.12327	0.046000	0.14306	0.286000	0.18902	-0.373000	0.07979	0.313000	0.20887	GCT	0.357688		TCGA-HZ-8005-01A-11D-2201-08	0.731	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.820000	-18.512830	1	0.360000	NM_020693		0	11	11	0	89	87	0		1	1		0	0	17	0	0	0.998487	1.484866e-02	0	2	0	0	0	11	89
CNGA4	1262	broad.mit.edu	37	11	6265298	6265298	+	Missense_Mutation	SNP	A	A	G	rs202038469		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:6265298A>G	ENST00000379936.2	+	6	1502	c.1387A>G	c.(1387-1389)Atc>Gtc	p.I463V		NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	463					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCACAGACCATCATGGAGGA	0.552													A|||	1	0.000199681	0.0	0.0	5008	,	,		23102	0.001		0.0	False		,,,				2504	0.0					ENST00000379936.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				40						c.(1387-1389)Atc>Gtc		cyclic nucleotide gated channel alpha 4							115.0	95.0	102.0					11																	6265298		2201	4296	6497	SO:0001583	missense	1262	2	121412	38				g.chr11:6265298A>G	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1387A>G	chr11.hg19:g.6265298A>G	ENSP00000369268:p.Ile463Val	1						p.I463V	NM_001037329.3	NP_001032406.1	1	2	3	2.226276	Q8IV77	CNGA4_HUMAN		6	1502	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Missense_Mutation	SNP	ENST00000379936.2	1	1	hg19	c.1387A>G	CCDS31408.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	0.009	-1.801041	0.00611	.	.	ENSG00000132259	ENST00000379936	D	0.96651	-4.08	5.19	2.34	0.29019	5.19	2.34	0.29019	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.302345	0.31507	N	0.007531	D	0.84101	0.5398	N	0.02751	-0.505	0.20821	N	0.999842	B	0.02656	0.0	B	0.01281	0.0	T	0.73503	-0.3962	10	0.05620	T	0.96	.	4.5823	0.12264	0.3302:0.1519:0.5179:0.0	.	463	Q8IV77	CNGA4_HUMAN	V	463	ENSP00000369268:I463V	ENSP00000369268:I463V	I	+	1	0	0	CNGA4	6221874	6221874	0.000000	0.05858	0.384000	0.26145	0.471000	0.32888	0.124000	0.15728	0.369000	0.24510	-0.804000	0.03201	ATC	0.404983		TCGA-HZ-8005-01A-11D-2201-08	0.552	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	1	0	1	2	2	2	2	0	0	0	0	94	94	94	92	1	1.820000	-20.000000	1	0.360000	NM_001037329		0	150	140	0	406	396	1		1			0	0	94	0	0	1.000000	0	0	0	0	0	0	150	406
DENND5A	23258	broad.mit.edu	37	11	9166560	9166560	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:9166560A>G	ENST00000328194.3	-	18	3424	c.3104T>C	c.(3103-3105)aTc>aCc	p.I1035T	DENND5A_ENST00000530044.1_Missense_Mutation_p.I1035T|DENND5A_ENST00000527700.1_Missense_Mutation_p.I378T	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	1035	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ATGTCCTGTGATCTCATTCCT	0.493																																						ENST00000328194.3	1.000000	0.810000	1.000000	0.880000	0.970000	0.955642	0.970000	1.000000																										0				39						c.(3103-3105)aTc>aCc		DENN/MADD domain containing 5A							178.0	152.0	161.0					11																	9166560		2201	4296	6497	SO:0001583	missense	23258	0	0					g.chr11:9166560A>G	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.3104T>C	chr11.hg19:g.9166560A>G	ENSP00000328524:p.Ile1035Thr	1					DENND5A_ENST00000527700.1_Missense_Mutation_p.I378T|DENND5A_ENST00000530044.1_Missense_Mutation_p.I1035T	p.I1035T	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	1	2	3	2.226276	Q6IQ26	DEN5A_HUMAN		18	3424	-			B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	1	1	hg19	c.3104T>C	CCDS31423.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.5|23.5	4.429149|4.429149	0.83776|0.83776	.|.	.|.	ENSG00000184014|ENSG00000184014	ENST00000328194;ENST00000530044;ENST00000527700|ENST00000525784	T;T;T|.	0.64260|.	-0.09;-0.09;-0.09|.	5.59|5.59	5.59|5.59	0.84812|0.84812	5.59|5.59	5.59|5.59	0.84812|0.84812	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);|.	0.044753|.	0.85682|.	D|.	0.000000|.	T|T	0.52208|0.52208	0.1720|0.1720	N|N	0.21373|0.21373	0.66|0.66	0.80722|0.80722	D|D	1|1	P;B|.	0.48503|.	0.911;0.43|.	P;P|.	0.56216|.	0.794;0.697|.	T|T	0.49428|0.49428	-0.8941|-0.8941	10|5	0.42905|.	T|.	0.14|.	.|.	14.9507|14.9507	0.71071|0.71071	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1035;1035|.	E9PS91;Q6IQ26|.	.;DEN5A_HUMAN|.	T|P	1035;1035;378|83	ENSP00000328524:I1035T;ENSP00000435866:I1035T;ENSP00000432549:I378T|.	ENSP00000328524:I1035T|.	I|S	-|-	2|1	0|0	0|0	DENND5A|DENND5A	9123136|9123136	9123136|9123136	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.325000|6.325000	0.72901|0.72901	2.122000|2.122000	0.65172|0.65172	0.528000|0.528000	0.53228|0.53228	ATC|TCA	0.404983		TCGA-HZ-8005-01A-11D-2201-08	0.493	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	0	0	1	2	2	2	2	0	0	0	0	143	143	143	141	1	1.820000	-20.000000	1	0.360000	NM_015213		0	142	139	0	750	735	1		1	0		0	0	143	0	0	1.000000	9.994289e-01	0	1	0	58	0	142	750
OR4S1	256148	broad.mit.edu	37	11	48328426	48328426	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:48328426A>G	ENST00000319988.1	+	1	652	c.652A>G	c.(652-654)Atc>Gtc	p.I218V		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						TTCCTATGTTATCATCTTACT	0.468																																						ENST00000319988.1	0.730000	0.450000	0.650000	0.510000	0.570000	0.586219	0.570000	0.580000																										0				21						c.(652-654)Atc>Gtc		olfactory receptor, family 4, subfamily S, member 1							182.0	158.0	166.0					11																	48328426		2201	4298	6499	SO:0001583	missense	256148	0	0					g.chr11:48328426A>G	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.652A>G	chr11.hg19:g.48328426A>G	ENSP00000321447:p.Ile218Val	0						p.I218V	NM_001004725.1	NP_001004725.1	1	2	3	2.077687	Q8NGB4	OR4S1_HUMAN		1	652	+			Q6IFB4	Missense_Mutation	SNP	ENST00000319988.1	1	1	hg19	c.652A>G	CCDS31488.1	0	.	.	.	.	.	.	.	.	.	.	A	0	-2.812081	0.00073	.	.	ENSG00000176555	ENST00000319988	T	0.00076	8.76	5.02	-0.0613	0.13785	5.02	-0.0613	0.13785	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.00652	-1.29	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.14699	-1.0463	9	0.02654	T	1	.	8.1535	0.31154	0.4876:0.0:0.5124:0.0	.	218	Q8NGB4	OR4S1_HUMAN	V	218	ENSP00000321447:I218V	ENSP00000321447:I218V	I	+	1	0	0	OR4S1	48285002	48285002	0.000000	0.05858	0.132000	0.22025	0.008000	0.06430	-0.029000	0.12329	0.061000	0.16311	-0.177000	0.13119	ATC	0.362296		TCGA-HZ-8005-01A-11D-2201-08	0.468	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390556.1	1	0	1	2	2	2	2	0	0	0	0	134	134	134	134	1	1.820000	-20.000000	1	0.360000	NM_001004725		0	73	71	0	632	613	1		1			0	0	134	0	0	1.000000	0	0	0	0	0	0	73	632
OR5I1	10798	broad.mit.edu	37	11	55703122	55703122	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:55703122A>T	ENST00000301532.3	-	1	754	c.755T>A	c.(754-756)aTc>aAc	p.I252N		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	252					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CCCTTGGTAGATCGTCACTGA	0.428																																						ENST00000301532.3	0.510000	0.140000	0.410000	0.210000	0.290000	0.314834	0.290000	0.280000																										0				52						c.(754-756)aTc>aAc		olfactory receptor, family 5, subfamily I, member 1							76.0	75.0	76.0					11																	55703122		2201	4296	6497	SO:0001583	missense	10798	0	0					g.chr11:55703122A>T	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.755T>A	chr11.hg19:g.55703122A>T	ENSP00000301532:p.Ile252Asn	0						p.I252N	NM_006637.1	NP_006628.1	0	0	0	2.060589	Q13606	OR5I1_HUMAN		1	754	-			Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	1	1	hg19	c.755T>A	CCDS7949.1	0	.	.	.	.	.	.	.	.	.	.	A	12.20	1.867312	0.32977	.	.	ENSG00000167825	ENST00000301532	T	0.00211	8.54	5.16	4.02	0.46733	5.16	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000192	T	0.00552	0.0018	M	0.87456	2.885	0.25640	N	0.986215	D	0.76494	0.999	D	0.87578	0.998	T	0.33111	-0.9881	10	0.87932	D	0	.	7.0082	0.24848	0.8205:0.0:0.1795:0.0	.	252	Q13606	OR5I1_HUMAN	N	252	ENSP00000301532:I252N	ENSP00000301532:I252N	I	-	2	0	0	OR5I1	55459698	55459698	0.411000	0.25384	0.428000	0.26697	0.111000	0.19643	5.207000	0.65197	0.893000	0.36288	0.523000	0.50628	ATC	0.357688		TCGA-HZ-8005-01A-11D-2201-08	0.428	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.820000	-12.314750	1	0.360000	NM_006637		0	9	9	0	163	160	0		1			0	0	31	0	0	0.994146	0	0	0	0	0	0	9	163
OR10G9	219870	broad.mit.edu	37	11	123894473	123894473	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr11:123894473G>A	ENST00000375024.1	+	1	754	c.754G>A	c.(754-756)Gtt>Att	p.V252I		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTGCTTTTTTGTTCCCTGTGT	0.542																																						ENST00000375024.1	1.000000	0.790000	1.000000	0.860000	0.940000	0.935431	0.940000	1.000000																										0				61						c.(754-756)Gtt>Att		olfactory receptor, family 10, subfamily G, member 9							162.0	145.0	151.0					11																	123894473		2201	4299	6500	SO:0001583	missense	219870	0	0					g.chr11:123894473G>A	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.754G>A	chr11.hg19:g.123894473G>A	ENSP00000364164:p.Val252Ile	0						p.V252I	NM_001001953.1	NP_001001953.1	0	0	0	2.060589	Q8NGN4	O10G9_HUMAN		1	754	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		Missense_Mutation	SNP	ENST00000375024.1	1	1	hg19	c.754G>A	CCDS31703.1	1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.619019	0.00828	.	.	ENSG00000236981	ENST00000375024	T	0.37915	1.17	3.35	1.38	0.22167	3.35	1.38	0.22167	GPCR, rhodopsin-like superfamily (1);	0.666360	0.12267	N	0.484157	T	0.23611	0.0571	L	0.43152	1.355	0.20307	N	0.999916	B	0.06786	0.001	B	0.15052	0.012	T	0.36187	-0.9758	10	0.02654	T	1	.	7.4128	0.27027	0.1005:0.1691:0.7304:0.0	.	252	Q8NGN4	O10G9_HUMAN	I	252	ENSP00000364164:V252I	ENSP00000364164:V252I	V	+	1	0	0	OR10G9	123399683	123399683	0.000000	0.05858	0.733000	0.30861	0.764000	0.43329	0.040000	0.13905	0.234000	0.21139	-1.247000	0.01520	GTT	0.357688		TCGA-HZ-8005-01A-11D-2201-08	0.542	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	1	0	1	2	2	2	2	0	0	0	0	114	114	114	110	1	1.820000	-20.000000	1	0.360000	NM_001001953		0	119	118	0	578	567	1		1			0	0	114	0	0	1.000000	0	0	0	0	0	0	119	578
KRAS	3845	broad.mit.edu	37	12	25380275	25380275	+	Missense_Mutation	SNP	T	T	G	rs17851045		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr12:25380275T>G	ENST00000256078.4	-	3	246	c.183A>C	c.(181-183)caA>caC	p.Q61H	KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(153)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTCCTCTTGACCTGCTG	0.423	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000	Q61H(CL11_LARGE_INTESTINE)|Q61H(HS766T_PANCREAS)|Q61H(NCIH1155_LUNG)|Q61H(NCIH460_LUNG)|Q61H(T3M4_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	153	Substitution - Missense(153)	p.Q61H(153)	large_intestine(74)|lung(26)|pancreas(18)|haematopoietic_and_lymphoid_tissue(9)|endometrium(7)|soft_tissue(3)|biliary_tract(3)|liver(3)|cervix(2)|skin(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)|NS(1)	25349						c.(181-183)caA>caC		Kirsten rat sarcoma viral oncogene homolog							109.0	98.0	102.0					12																	25380275		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25380275T>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.183A>C	chr12.hg19:g.25380275T>G	ENSP00000256078:p.Gln61His	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.Q61H	p.Q61H	NM_033360.2	NP_203524.1	0	1	1	2.016122	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	3	246	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.183A>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133750	0.77662	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.84146	-1.81;-1.81	5.77	5.77	0.91146	5.77	5.77	0.91146	Small GTP-binding protein domain (1);	0.049057	0.85682	D	0.000000	D	0.87265	0.6134	M	0.91140	3.18	0.80722	D	1	B;B	0.33413	0.411;0.09	B;B	0.32724	0.092;0.151	D	0.87829	0.2643	10	0.72032	D	0.01	.	9.9836	0.41828	0.0:0.0752:0.0:0.9248	.	61;61	P01116-2;P01116	.;RASK_HUMAN	H	61	ENSP00000308495:Q61H;ENSP00000256078:Q61H	ENSP00000256078:Q61H	Q	-	3	2	2	KRAS	25271542	25271542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.240000	0.43088	2.326000	0.78906	0.533000	0.62120	CAA	0.327307		TCGA-HZ-8005-01A-11D-2201-08	0.423	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	1.820000	-20.000000	1	0.360000	NM_033360		2222	103	103	5800	283	282	1	1	1	1	1	0	0	77	915	1	1.000000	9.999519e-01	1	28	332	15	1001	103	283
KRT84	3890	broad.mit.edu	37	12	52779007	52779007	+	Silent	SNP	G	G	C			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr12:52779007G>C	ENST00000257951.3	-	1	429	c.363C>G	c.(361-363)ggC>ggG	p.G121G	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	121	Head.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TGTAACCAAAGCCAGGGCCAC	0.577																																						ENST00000257951.3	0.460000	0.300000	0.430000	0.340000	0.380000	0.389071	0.380000	0.380000																										0				27						c.(361-363)ggC>ggG		keratin 84							172.0	165.0	167.0					12																	52779007		2203	4300	6503	SO:0001819	synonymous_variant	3890	0	0					g.chr12:52779007G>C	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.363C>G	chr12.hg19:g.52779007G>C		0					RP3-416H24.4_ENST00000547174.1_RNA	p.G121G	NM_033045.3	NP_149034.2	0	1	1	2.016122	Q9NSB2	KRT84_HUMAN		1	429	-	all_hematologic(5;0.12)		B2RA43|Q6ISB0|Q701L6	Silent	SNP	ENST00000257951.3	1	1	hg19	c.363C>G	CCDS8825.1	0																																																																																								0.327307		TCGA-HZ-8005-01A-11D-2201-08	0.577	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	1	0	1	2	2	2	2	0	0	0	0	204	204	204	199	1	1.820000	-16.603180	1	0.360000	NM_033045		0	88	88	0	1117	1094	0		1			0	0	204	0	0	1.000000	0	0	0	0	0	0	88	1117
NACA	4666	broad.mit.edu	37	12	57110765	57110765	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr12:57110765G>C	ENST00000454682.1	-	3	4830	c.4549C>G	c.(4549-4551)Cca>Gca	p.P1517A	NACA_ENST00000546392.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000552540.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1517	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GGGGTAGCTGGGACCTCTTTG	0.587			T	BCL6	NHL																																	ENST00000454682.1	0.400000	0.210000	0.350000	0.250000	0.290000	0.304579	0.290000	0.300000				Dom	yes			Dom	yes		12	12q23-q24.1	12q23-q24.1	4666	T	nascent-polypeptide-associated complex alpha polypeptide				L	L	BCL6		NHL		0				10						c.(4549-4551)Cca>Gca		nascent polypeptide-associated complex alpha subunit							46.0	52.0	50.0					12																	57110765		1559	3555	5114	SO:0001583	missense	4666	0	0					g.chr12:57110765G>C	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.4549C>G	chr12.hg19:g.57110765G>C	ENSP00000403817:p.Pro1517Ala	0					NACA_ENST00000356769.3_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000548563.1_Intron	p.P1517A	NM_001113203.2	NP_001106674.2	0	1	1	2.016122	E9PAV3	NACAM_HUMAN		3	4830	-				Missense_Mutation	SNP	ENST00000454682.1	1	1	hg19	c.4549C>G		0	.	.	.	.	.	.	.	.	.	.	G	9.906	1.208201	0.22205	.	.	ENSG00000196531	ENST00000454682	T	0.55234	0.53	2.96	-0.127	0.13510	2.96	-0.127	0.13510	.	.	.	.	.	T	0.28699	0.0711	.	.	.	0.09310	N	1	B	0.22080	0.064	B	0.18263	0.021	T	0.16041	-1.0416	7	.	.	.	.	1.6713	0.02812	0.114:0.1778:0.3461:0.3622	.	1517	E9PAV3	.	A	1517	ENSP00000403817:P1517A	.	P	-	1	0	0	NACA	55397032	55397032	0.005000	0.15991	0.000000	0.03702	0.236000	0.25371	0.396000	0.20867	-0.025000	0.13918	0.298000	0.19748	CCA	0.327307		TCGA-HZ-8005-01A-11D-2201-08	0.587	NACA-201	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	86	86	86	84	1	1.820000	-7.045672	1	0.360000	NM_005594		0	36	36	0	602	593	0		1	0		0	0	86	0	0	1.000000	0	0	1	0	0	0	36	602
DAAM1	23002	broad.mit.edu	37	14	59820665	59820665	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr14:59820665T>C	ENST00000395125.1	+	19	2392	c.2369T>C	c.(2368-2370)gTg>gCg	p.V790A	DAAM1_ENST00000351081.1_Missense_Mutation_p.V790A|DAAM1_ENST00000553966.1_Intron|DAAM1_ENST00000360909.3_Missense_Mutation_p.V780A	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	790	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GTGGCAGAAGTGAAACCTAAA	0.363																																						ENST00000395125.1	1.000000	0.780000	1.000000	0.900000	0.990000	0.966279	0.990000	1.000000																										0				37						c.(2368-2370)gTg>gCg		dishevelled associated activator of morphogenesis 1							98.0	87.0	91.0					14																	59820665		2203	4300	6503	SO:0001583	missense	23002	0	0					g.chr14:59820665T>C	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.2369T>C	chr14.hg19:g.59820665T>C	ENSP00000378557:p.Val790Ala	1					DAAM1_ENST00000360909.3_Missense_Mutation_p.V780A|DAAM1_ENST00000351081.1_Missense_Mutation_p.V790A|DAAM1_ENST00000553966.1_Intron	p.V790A	NM_014992.2	NP_055807.1	0	1	1	1.871888	Q9Y4D1	DAAM1_HUMAN		19	2392	+			Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	1	1	hg19	c.2369T>C	CCDS9737.1	1	.	.	.	.	.	.	.	.	.	.	t	14.69	2.610615	0.46527	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000395125	T;T;T	0.18810	2.19;2.19;2.19	6.03	6.03	0.97812	6.03	6.03	0.97812	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.050329	0.85682	D	0.000000	T	0.19406	0.0466	N	0.20304	0.555	0.51012	D	0.999904	B;B	0.29341	0.242;0.213	B;B	0.37091	0.162;0.241	T	0.09250	-1.0683	10	0.30854	T	0.27	.	16.5808	0.84714	0.0:0.0:0.0:1.0	.	780;790	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	A	780;790;790	ENSP00000354162:V780A;ENSP00000247170:V790A;ENSP00000378557:V790A	ENSP00000247170:V790A	V	+	2	0	0	DAAM1	58890418	58890418	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.183000	0.72002	2.317000	0.78254	0.524000	0.50904	GTG	0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.363	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	1.820000	-20.000000	1	0.360000	NM_014992		0	44	44	0	169	167	1		1	1		0	0	22	0	0	1.000000	9.889714e-01	0	16	0	14	0	44	169
EXD2	55218	broad.mit.edu	37	14	69704529	69704529	+	Silent	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr14:69704529C>T	ENST00000409018.3	+	8	1658	c.1530C>T	c.(1528-1530)ctC>ctT	p.L510L	EXD2_ENST00000312994.5_Silent_p.L510L|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409675.1_Silent_p.L385L|EXD2_ENST00000409949.1_Silent_p.L385L|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409014.1_Silent_p.L385L|EXD2_ENST00000449989.1_Silent_p.L385L|EXD2_ENST00000409242.1_Silent_p.L385L	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	510							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						GGGCCCTGCTCAACGCGGAGA	0.612																																						ENST00000409018.3	0.540000	0.170000	0.440000	0.240000	0.330000	0.346558	0.330000	0.320000																										0				14						c.(1528-1530)ctC>ctT		exonuclease 3'-5' domain containing 2							21.0	22.0	22.0					14																	69704529		2203	4300	6503	SO:0001819	synonymous_variant	55218	0	0					g.chr14:69704529C>T	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1530C>T	chr14.hg19:g.69704529C>T		1					EXD2_ENST00000409014.1_Silent_p.L385L|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000449989.1_Silent_p.L385L|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409242.1_Silent_p.L385L|EXD2_ENST00000409949.1_Silent_p.L385L|EXD2_ENST00000312994.5_Silent_p.L510L|EXD2_ENST00000409675.1_Silent_p.L385L	p.L510L	NM_001193361.1	NP_001180290.1	0	1	1	1.871888	Q9NVH0	EXD2_HUMAN		8	1658	+			B4DIH6|G5E947|Q6AWB6|Q8N3D3	Silent	SNP	ENST00000409018.3	1	1	hg19	c.1530C>T	CCDS53902.1	0																																																																																								0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.612	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.820000	-15.298350	1	0.360000			0	11	11	0	160	158	1		1	1		0	0	31	0	0	0.998404	8.350760e-01	0	8	0	42	0	11	160
PRIMA1	145270	broad.mit.edu	37	14	94245551	94245551	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr14:94245551G>A	ENST00000393140.1	-	3	302	c.200C>T	c.(199-201)cCg>cTg	p.P67L	PRIMA1_ENST00000316227.3_Missense_Mutation_p.P67L|PRIMA1_ENST00000393143.1_Missense_Mutation_p.P67L	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	67	PRAD.				establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		gggaggtggcgggggtggggg	0.632																																						ENST00000393140.1	0.920000	0.310000	0.750000	0.430000	0.570000	0.598242	0.570000	0.570000																										0				7						c.(199-201)cCg>cTg		proline rich membrane anchor 1							4.0	4.0	4.0					14																	94245551		1890	3736	5626	SO:0001583	missense	145270	0	0					g.chr14:94245551G>A		CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.200C>T	chr14.hg19:g.94245551G>A	ENSP00000376848:p.Pro67Leu	1					PRIMA1_ENST00000316227.3_Missense_Mutation_p.P67L|PRIMA1_ENST00000393143.1_Missense_Mutation_p.P67L	p.P67L	NM_178013.3	NP_821092.1	0	1	1	1.871888	Q86XR5	PRIMA_HUMAN		3	302	-		all_cancers(154;0.127)	Q86XR6	Missense_Mutation	SNP	ENST00000393140.1	0	1	hg19	c.200C>T	CCDS9912.1	0	.	.	.	.	.	.	.	.	.	.	g	10.84	1.462747	0.26248	.	.	ENSG00000175785	ENST00000393140;ENST00000393143;ENST00000316227	.	.	.	4.63	4.63	0.57726	4.63	4.63	0.57726	.	0.000000	0.64402	D	0.000004	T	0.64283	0.2584	L	0.29908	0.895	0.52501	D	0.999955	D	0.89917	1.0	D	0.79108	0.992	T	0.67894	-0.5552	9	0.72032	D	0.01	-5.5528	13.0054	0.58701	0.0:0.0:1.0:0.0	.	67	Q86XR5	PRIMA_HUMAN	L	67	.	ENSP00000320948:P67L	P	-	2	0	0	PRIMA1	93315304	93315304	0.999000	0.42202	0.957000	0.39632	0.086000	0.17979	4.484000	0.60271	2.140000	0.66376	0.556000	0.70494	CCG	0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.632	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280658.1	1	0	1	2	2	2	2	0	0	0	0	10	10	10	9	1	1.820000	-18.206020	1	0.360000	NM_178013		0	11	12	0	86	70	0		1	0		0	0	10	0	0	0.996645	0	0	0	0	1	0	11	86
HSP90AA1	3320	broad.mit.edu	37	14	102552342	102552342	+	Silent	SNP	A	A	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr14:102552342A>T	ENST00000216281.8	-	3	487	c.282T>A	c.(280-282)acT>acA	p.T94T	HSP90AA1_ENST00000441629.2_Intron|HSP90AA1_ENST00000334701.7_Silent_p.T216T	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	94					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TTCCAATTCCAGTATCCACAA	0.433																																						ENST00000216281.8	0.880000	0.560000	0.810000	0.640000	0.710000	0.727699	0.710000	0.720000																										0				28						c.(280-282)acT>acA		heat shock protein 90kDa alpha (cytosolic), class A member 1	Nedocromil(DB00716)|Rifabutin(DB00615)						84.0	84.0	84.0					14																	102552342		2203	4300	6503	SO:0001819	synonymous_variant	3320	0	0					g.chr14:102552342A>T	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.282T>A	chr14.hg19:g.102552342A>T		1					HSP90AA1_ENST00000334701.7_Silent_p.T216T|HSP90AA1_ENST00000441629.2_Intron	p.T94T	NM_005348.3	NP_005339.3	0	1	1	1.871888	P07900	HS90A_HUMAN		3	487	-			A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Silent	SNP	ENST00000216281.8	1	1	hg19	c.282T>A	CCDS9967.1	0																																																																																								0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.433	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	1	0	1	2	2	2	2	0	0	0	0	86	86	86	90	1	1.820000	-20.000000	1	0.360000	NM_005348		0	66	62	0	396	371	1		1	1		0	0	86	0	0	1.000000	1	0	608	0	523	0	66	396
GABRA5	2558	broad.mit.edu	37	15	27182336	27182336	+	Silent	SNP	G	G	A	rs149156018	byFrequency	TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr15:27182336G>A	ENST00000335625.5	+	8	1473	c.585G>A	c.(583-585)gcG>gcA	p.A195A	GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Silent_p.A195A|GABRA5_ENST00000355395.5_Silent_p.A195A	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	195					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	ATACAGATGCGTACCCTAATT	0.493													G|||	29	0.00579073	0.0219	0.0	5008	,	,		20372	0.0		0.0	False		,,,				2504	0.0					ENST00000335625.5	0.940000	0.620000	0.870000	0.700000	0.780000	0.789220	0.780000	0.780000																										0				49						c.(583-585)gcG>gcA		gamma-aminobutyric acid (GABA) A receptor, alpha 5	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	G	,	45,3911		0,45,1933	154.0	149.0	151.0		585,585	-7.3	0.9	15	dbSNP_134	151	0,8336		0,0,4168	no	coding-synonymous,coding-synonymous	GABRA5	NM_000810.3,NM_001165037.1	,	0,45,6101	AA,AG,GG		0.0,1.1375,0.3661	,	195/463,195/463	27182336	45,12247	1978	4168	6146	SO:0001819	synonymous_variant	2558	144	120914	55				g.chr15:27182336G>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.585G>A	chr15.hg19:g.27182336G>A		1					GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Silent_p.A195A|GABRA5_ENST00000355395.5_Silent_p.A195A	p.A195A	NM_000810.3	NP_000801.1	0	1	1	1.703365	P31644	GBRA5_HUMAN		8	1473	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Silent	SNP	ENST00000335625.5	1	0	hg19	c.585G>A	CCDS45194.1	0																																																																																								0.219512		TCGA-HZ-8005-01A-11D-2201-08	0.493	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.820000	-3.082832	1	0.360000			0	70	70	0	333	327	1		1			0	0	96	0	0	1.000000	0	0	0	0	0	0	70	333
CDH8	1006	broad.mit.edu	37	16	61935231	61935231	+	Silent	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr16:61935231G>A	ENST00000577390.1	-	3	1353	c.399C>T	c.(397-399)acC>acT	p.T133T	CDH8_ENST00000299345.6_Silent_p.T133T|CDH8_ENST00000577730.1_Silent_p.T133T|CDH8_ENST00000584337.1_Silent_p.T133T	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	133	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GAGCTGTTAGGGTATACTCAG	0.418																																						ENST00000577390.1	1.000000	0.740000	1.000000	0.820000	0.910000	0.912194	0.910000	1.000000																										0				112						c.(397-399)acC>acT		cadherin 8, type 2							135.0	132.0	133.0					16																	61935231		2203	4300	6503	SO:0001819	synonymous_variant	1006	0	0					g.chr16:61935231G>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.399C>T	chr16.hg19:g.61935231G>A		1					CDH8_ENST00000577730.1_Silent_p.T133T|CDH8_ENST00000299345.6_Silent_p.T133T|CDH8_ENST00000584337.1_Silent_p.T133T	p.T133T	NM_001796.4	NP_001787.2	1	2	3	2.398782	P55286	CADH8_HUMAN		3	1353	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	1	1	hg19	c.399C>T	CCDS10802.1	1																																																																																								0.450927		TCGA-HZ-8005-01A-11D-2201-08	0.418	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	1	0	1	2	2	2	2	0	0	0	0	107	107	107	105	1	1.820000	-2.690417	1	0.360000	NM_001796		0	96	95	0	588	578	1		1			0	0	107	0	0	1.000000	0	0	0	0	0	0	96	588
ZFHX3	463	broad.mit.edu	37	16	72923765	72923765	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr16:72923765G>A	ENST00000268489.5	-	4	3985	c.3313C>T	c.(3313-3315)Cag>Tag	p.Q1105*	ZFHX3_ENST00000397992.5_Nonsense_Mutation_p.Q191*	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1105					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CGCACATGCTGGATGAGGTTG	0.592																																						ENST00000268489.5	1.000000	0.620000	1.000000	0.720000	0.840000	0.850469	0.840000	1.000000																										0				153						c.(3313-3315)Cag>Tag		zinc finger homeobox 3							108.0	77.0	87.0					16																	72923765		2198	4300	6498	SO:0001587	stop_gained	463	0	0					g.chr16:72923765G>A	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.3313C>T	chr16.hg19:g.72923765G>A	ENSP00000268489:p.Gln1105*	1					ZFHX3_ENST00000397992.5_Nonsense_Mutation_p.Q191*	p.Q1105*	NM_006885.3	NP_008816.3	1	2	3	2.398782	Q15911	ZFHX3_HUMAN		4	3985	-		Ovarian(137;0.13)	D3DWS8|O15101|Q13719	Nonsense_Mutation	SNP	ENST00000268489.5	0	1	hg19	c.3313C>T	CCDS10908.1	0	.	.	.	.	.	.	.	.	.	.	G	50	16.503353	0.99865	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	.	.	.	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.000000	0.47852	D	0.000219	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.8299	0.96631	0.0:0.0:1.0:0.0	.	.	.	.	X	1105;191	.	ENSP00000268489:Q1105X	Q	-	1	0	0	ZFHX3	71481266	71481266	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.852000	0.99516	2.698000	0.92095	0.511000	0.50034	CAG	0.450927		TCGA-HZ-8005-01A-11D-2201-08	0.592	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.820000	-2.921007	1	0.360000	NM_006885		0	44	43	0	297	291	1		1	1		0	0	52	0	0	1.000000	4.316719e-01	0	2	0	9	0	44	297
MYH4	4622	broad.mit.edu	37	17	10358056	10358056	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr17:10358056A>G	ENST00000255381.2	-	22	2617	c.2507T>C	c.(2506-2508)cTg>cCg	p.L836P	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	836					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTTGAAATACAGCTTCATCCA	0.438																																						ENST00000255381.2	0.980000	0.710000	0.930000	0.780000	0.850000	0.862012	0.850000	0.870000																										0				149						c.(2506-2508)cTg>cCg		myosin, heavy chain 4, skeletal muscle							145.0	131.0	136.0					17																	10358056		2203	4300	6503	SO:0001583	missense	4622	0	0					g.chr17:10358056A>G		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2507T>C	chr17.hg19:g.10358056A>G	ENSP00000255381:p.Leu836Pro	1					RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	p.L836P	NM_017533.2	NP_060003.2	0	1	1	1.730727	Q9Y623	MYH4_HUMAN		22	2617	-				Missense_Mutation	SNP	ENST00000255381.2	1	1	hg19	c.2507T>C	CCDS11154.1	1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.966711	0.74131	.	.	ENSG00000141048	ENST00000255381	D	0.93426	-3.22	5.17	5.17	0.71159	5.17	5.17	0.71159	.	0.000000	0.30101	U	0.010414	D	0.98166	0.9394	H	0.98980	4.39	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.99758	1.1020	10	0.87932	D	0	.	15.3039	0.73976	1.0:0.0:0.0:0.0	.	836	Q9Y623	MYH4_HUMAN	P	836	ENSP00000255381:L836P	ENSP00000255381:L836P	L	-	2	0	0	MYH4	10298781	10298781	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.182000	0.94881	2.075000	0.62263	0.383000	0.25322	CTG	0.219512		TCGA-HZ-8005-01A-11D-2201-08	0.438	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	1	0	1	2	2	2	2	0	0	0	0	111	111	111	111	1	1.820000	-20.000000	1	0.360000	NM_017533		0	101	99	0	427	421	1		1			0	0	111	0	0	1.000000	0	0	0	0	0	0	101	427
KCNJ12	3768	broad.mit.edu	37	17	21318768	21318768	+	Silent	SNP	G	G	A	rs139060766	byFrequency	TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr17:21318768G>A	ENST00000583088.1	+	3	1009	c.114G>A	c.(112-114)acG>acA	p.T38T	KCNJ12_ENST00000331718.5_Silent_p.T38T	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	38					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	AGGTGCACACGCGGCGCAGGT	0.622										Prostate(3;0.18)			.|||	3	0.000599042	0.0	0.0	5008	,	,		37161	0.002		0.0	False		,,,				2504	0.001					ENST00000583088.1	0.480000	0.220000	0.420000	0.270000	0.340000	0.351933	0.340000	0.340000																										0				70						c.(112-114)acG>acA		potassium inwardly-rectifying channel, subfamily J, member 12	Dofetilide(DB00204)|Yohimbine(DB01392)	G		1,4405	2.1+/-5.4	0,1,2202	109.0	84.0	93.0		114	-10.7	0.4	17	dbSNP_134	93	0,8600		0,0,4300	no	coding-synonymous	KCNJ12	NM_021012.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		38/434	21318768	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3768	19	121412	36				g.chr17:21318768G>A	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.114G>A	chr17.hg19:g.21318768G>A		1	Prostate(3;0.18)				KCNJ12_ENST00000331718.5_Silent_p.T38T	p.T38T	NM_021012.4	NP_066292.2	0	1	1	1.730727	Q14500	KCJ12_HUMAN		3	1009	+			O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	1	1	hg19	c.114G>A	CCDS11219.1	0																																																																																								0.219512		TCGA-HZ-8005-01A-11D-2201-08	0.622	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	0	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	1.820000	-20.000000	1	0.360000	NM_021012		0	24	24	0	294	286	0		1	0		0	0	60	0	0	1.000000	2.116742e-01	0	0	0	11	0	24	294
WNK4	65266	broad.mit.edu	37	17	40940393	40940393	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr17:40940393C>T	ENST00000246914.5	+	10	2029	c.2008C>T	c.(2008-2010)Cgc>Tgc	p.R670C	WNK4_ENST00000587705.1_3'UTR	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	670					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GAATCTCCGGCGCAGACCCCG	0.577																																					Esophageal Squamous(6;201 374 4964 23855 42828)	ENST00000246914.5	1.000000	0.800000	1.000000	0.910000	0.990000	0.971287	0.990000	1.000000																										0				35						c.(2008-2010)Cgc>Tgc		WNK lysine deficient protein kinase 4							40.0	42.0	41.0					17																	40940393		2203	4300	6503	SO:0001583	missense	65266	3	121412	31				g.chr17:40940393C>T	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.2008C>T	chr17.hg19:g.40940393C>T	ENSP00000246914:p.Arg670Cys	0					WNK4_ENST00000587705.1_3'UTR	p.R670C	NM_032387.4	NP_115763.2	1	2	3	2.106500	Q96J92	WNK4_HUMAN		10	2029	+		Breast(137;0.000143)	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	1	1	hg19	c.2008C>T	CCDS11439.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358468	0.82243	.	.	ENSG00000126562	ENST00000246914;ENST00000316085;ENST00000442804	T	0.34072	1.38	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.49305	D	0.000150	T	0.59459	0.2195	M	0.61703	1.905	0.49798	D	0.999823	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.994;0.997;0.988;0.988	T	0.61959	-0.6955	10	0.87932	D	0	-15.3513	17.8301	0.88679	0.0:1.0:0.0:0.0	.	14;670;670;670	B4DXG4;Q96J92-3;B0LPI0;Q96J92	.;.;.;WNK4_HUMAN	C	670;442;14	ENSP00000246914:R670C	ENSP00000246914:R670C	R	+	1	0	0	WNK4	38193919	38193919	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.092000	0.50207	2.520000	0.84964	0.549000	0.68633	CGC	0.366838		TCGA-HZ-8005-01A-11D-2201-08	0.577	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.820000	-20.000000	1	0.360000			0	55	55	0	242	238	1		1	1		0	0	43	0	0	1.000000	9.304192e-02	0	2	0	1	0	55	242
TP53	7157	broad.mit.edu	37	17	7576852	7576852	+	Splice_Site	SNP	C	C	T	rs11575997		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr17:7576852C>T	ENST00000269305.4	-	9	1183		c.e9+1		TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(24)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGACTTAGTACCTGAAGGGTG	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.900000	0.560000	0.820000	0.630000	0.720000	0.732052	0.720000	0.720000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		33	Unknown(24)|Whole gene deletion(8)|Insertion - Frameshift(1)	p.?(24)|p.0?(8)|p.I332fs*49(1)	ovary(8)|lung(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|NS(2)|pancreas(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|skin(1)	24185	GRCh37	CD002536	TP53	D	rs11575997	c.e9+1	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						115.0	108.0	111.0					17																	7576852		2203	4300	6503	SO:0001630	splice_region_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7576852C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1G>A	chr17.hg19:g.7576852C>T		1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Intron		NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.730727	P04637	P53_HUMAN		9	1183	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	1	1	hg19		CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361474	0.41801	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000419024	.	.	.	4.41	4.41	0.53225	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6932	0.56988	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	TP53	7517577	7517577	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	2.315000	0.43752	2.462000	0.83206	0.561000	0.74099	.	0.219512		TCGA-HZ-8005-01A-11D-2201-08	0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.820000	-20.000000	1	0.360000	NM_000546	Intron	0	57	54	0	298	293	1		1	1	1	0	0	55	945	0	1.000000	2.537366e-01	1	6	298	0	916	57	298
ACE	1636	broad.mit.edu	37	17	61561229	61561229	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr17:61561229C>G	ENST00000290866.4	+	11	1630	c.1606C>G	c.(1606-1608)Ctg>Gtg	p.L536V	ACE_ENST00000290863.6_5'Flank|ACE_ENST00000577647.1_5'Flank|ACE_ENST00000413513.3_5'Flank|ACE_ENST00000490216.2_5'Flank|ACE_ENST00000428043.1_Missense_Mutation_p.L536V|ACE_ENST00000421982.2_5'Flank	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	536	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GAGTTTTGTCCTGCAGTTCCA	0.592																																						ENST00000290866.4	1.000000	0.970000	1.000000	0.990000	0.990000	0.998412	0.990000	1.000000																										0				51						c.(1606-1608)Ctg>Gtg		angiotensin I converting enzyme	Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)						108.0	93.0	98.0					17																	61561229		2203	4300	6503	SO:0001583	missense	1636	0	0					g.chr17:61561229C>G	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1606C>G	chr17.hg19:g.61561229C>G	ENSP00000290866:p.Leu536Val	0					ACE_ENST00000421982.2_5'Flank|ACE_ENST00000428043.1_Missense_Mutation_p.L536V|ACE_ENST00000490216.2_5'Flank|ACE_ENST00000577647.1_5'Flank|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000413513.3_5'Flank	p.L536V	NM_000789.3	NP_000780.1	1	2	3	2.072958	P12821	ACE_HUMAN		11	1630	+			B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	1	1	hg19	c.1606C>G	CCDS11637.1	1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523209	0.44866	.	.	ENSG00000159640	ENST00000290866;ENST00000428043	T;T	0.37058	1.22;1.22	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.070737	0.64402	D	0.000016	T	0.51329	0.1668	M	0.64404	1.975	0.80722	D	1	B;B	0.33212	0.242;0.402	B;P	0.52481	0.077;0.7	T	0.52881	-0.8516	10	0.49607	T	0.09	-19.1735	8.9337	0.35686	0.1493:0.7772:0.0:0.0736	.	536;536	P12821-2;P12821	.;ACE_HUMAN	V	536	ENSP00000290866:L536V;ENSP00000397593:L536V	ENSP00000290866:L536V	L	+	1	2	2	ACE	58914961	58914961	0.937000	0.31787	0.990000	0.47175	0.945000	0.59286	1.512000	0.35812	2.695000	0.91970	0.462000	0.41574	CTG	0.361150		TCGA-HZ-8005-01A-11D-2201-08	0.592	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2	1	0	1	2	2	2	2	0	0	0	0	128	128	128	127	1	1.820000	-3.173795	1	0.360000			0	151	149	0	592	586	1		1	1		0	0	128	0	0	1.000000	9.999882e-01	0	10	0	55	0	151	592
AZU1	566	broad.mit.edu	37	19	829611	829611	+	Missense_Mutation	SNP	C	C	T	rs370082761		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr19:829611C>T	ENST00000233997.2	+	3	286	c.265C>T	c.(265-267)Cgg>Tgg	p.R89W		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	89	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGAGGCGGCGGGAGAGGCA	0.632																																						ENST00000233997.2	0.220000	0.070000	0.180000	0.100000	0.130000	0.143537	0.130000	0.140000																										0				10						c.(265-267)Cgg>Tgg		azurocidin 1		C	TRP/ARG	0,4406		0,0,2203	69.0	66.0	67.0		265	1.1	0.2	19		67	1,8599	1.2+/-3.3	0,1,4299	no	missense	AZU1	NM_001700.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	89/252	829611	1,13005	2203	4300	6503	SO:0001583	missense	566	3	121408	41				g.chr19:829611C>T	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.265C>T	chr19.hg19:g.829611C>T	ENSP00000233997:p.Arg89Trp	0						p.R89W	NM_001700.3	NP_001691.1	0	0	0	2.053054	P20160	CAP7_HUMAN		3	286	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	ENST00000233997.2	1	1	hg19	c.265C>T	CCDS12044.1	0	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671754	0.47781	0.0	1.16E-4	ENSG00000172232	ENST00000334630;ENST00000233997	D	0.89270	-2.49	1.14	1.14	0.20703	1.14	1.14	0.20703	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.90700	0.7082	L	0.50333	1.59	0.26930	N	0.966493	D	0.89917	1.0	D	0.69142	0.962	T	0.81048	-0.1109	9	0.62326	D	0.03	.	8.1582	0.31183	0.0:1.0:0.0:0.0	.	89	P20160	CAP7_HUMAN	W	103;89	ENSP00000233997:R89W	ENSP00000233997:R89W	R	+	1	2	2	AZU1	780611	780611	0.000000	0.05858	0.212000	0.23672	0.359000	0.29487	0.008000	0.13197	0.941000	0.37499	0.491000	0.48974	CGG	0.355359		TCGA-HZ-8005-01A-11D-2201-08	0.632	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457472.2	0	0	1	2	2	2	2	0	0	0	0	155	155	155	153	1	1.820000	-2.784101	1	0.360000	NM_001700		0	15	15	0	596	587	0		1	0		0	0	155	0	0	0.999857	7.226701e-04	0	0	0	2	0	15	596
PTPRS	5802	broad.mit.edu	37	19	5219432	5219432	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr19:5219432G>A	ENST00000587303.1	-	22	3911	c.3812C>T	c.(3811-3813)cCg>cTg	p.P1271L	PTPRS_ENST00000592099.1_Missense_Mutation_p.P840L|PTPRS_ENST00000588012.1_Missense_Mutation_p.P1249L|PTPRS_ENST00000372412.4_Missense_Mutation_p.P1272L|PTPRS_ENST00000348075.2_Missense_Mutation_p.P1249L|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000357368.4_Missense_Mutation_p.P1271L|PTPRS_ENST00000353284.2_Missense_Mutation_p.P840L|PTPRS_ENST00000262963.6_Missense_Mutation_p.P1267L			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1271					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CTGGGGGTCCGGGTTATCCAG	0.592																																						ENST00000587303.1	1.000000	0.770000	1.000000	0.860000	0.950000	0.940568	0.950000	1.000000																										0				61						c.(3811-3813)cCg>cTg		protein tyrosine phosphatase, receptor type, S	Alendronate(DB00630)|Etidronic acid(DB01077)						47.0	48.0	48.0					19																	5219432		2203	4300	6503	SO:0001583	missense	5802	0	0					g.chr19:5219432G>A	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.3812C>T	chr19.hg19:g.5219432G>A	ENSP00000467537:p.Pro1271Leu	0					PTPRS_ENST00000348075.2_Missense_Mutation_p.P1249L|PTPRS_ENST00000372412.4_Missense_Mutation_p.P1272L|PTPRS_ENST00000592099.1_Missense_Mutation_p.P840L|PTPRS_ENST00000357368.4_Missense_Mutation_p.P1271L|PTPRS_ENST00000353284.2_Missense_Mutation_p.P840L|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000588012.1_Missense_Mutation_p.P1249L|PTPRS_ENST00000262963.6_Missense_Mutation_p.P1267L	p.P1271L			0	0	0	2.053054	Q13332	PTPRS_HUMAN		22	3911	-			O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	1	1	hg19	c.3812C>T	CCDS45930.1	1	.	.	.	.	.	.	.	.	.	.	G	4.622	0.115594	0.08831	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.54675	0.67;0.66;0.67;0.56;0.64	3.76	3.76	0.43208	3.76	3.76	0.43208	.	0.180124	0.36628	U	0.002495	T	0.25044	0.0608	N	0.02960	-0.455	0.46499	D	0.999074	B;B;B;B;B;B	0.17268	0.003;0.003;0.021;0.004;0.012;0.021	B;B;B;B;B;B	0.20767	0.003;0.003;0.031;0.003;0.008;0.006	T	0.10245	-1.0638	10	0.11485	T	0.65	.	11.0988	0.48161	0.0:0.0:0.815:0.185	.	853;840;844;1249;1271;866	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	L	866;1272;1271;1271;1262;1267;1249;853;844;840	ENSP00000361489:P1272L;ENSP00000349932:P1271L;ENSP00000262963:P1267L;ENSP00000269907:P1249L;ENSP00000327313:P840L	ENSP00000262963:P1267L	P	-	2	0	0	PTPRS	5170432	5170432	1.000000	0.71417	0.942000	0.38095	0.861000	0.49209	4.323000	0.59221	1.956000	0.56807	0.557000	0.71058	CCG	0.355359		TCGA-HZ-8005-01A-11D-2201-08	0.592	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2	1	0	1	2	22	2	2	0	0	0	1	68	68	68	67	1	1.820000	-2.559837	1	0.360000			0	83	82	0	394	384	1		1	1		0	0	68	0	0	1.000000	9.953672e-01	0	2	0	39	0	83	394
RANBP3	8498	broad.mit.edu	37	19	5978075	5978075	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr19:5978075C>G	ENST00000340578.6	-	1	76	c.19G>C	c.(19-21)Gaa>Caa	p.E7Q	RANBP3_ENST00000591092.1_Missense_Mutation_p.E7Q|RANBP3_ENST00000541471.1_Missense_Mutation_p.E7Q|RANBP3_ENST00000439268.2_Missense_Mutation_p.E7Q|CTC-232P5.1_ENST00000587836.1_RNA|RANBP3_ENST00000034275.8_Missense_Mutation_p.E7Q|RANBP3_ENST00000591124.1_5'UTR	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	7					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CCCCTACCTTCGTTCGCCAGG	0.701																																						ENST00000340578.6	0.590000	0.230000	0.500000	0.310000	0.390000	0.407159	0.390000	0.390000																										0				18						c.(19-21)Gaa>Caa		RAN binding protein 3							34.0	38.0	37.0					19																	5978075		1851	4091	5942	SO:0001583	missense	8498	0	0					g.chr19:5978075C>G	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.19G>C	chr19.hg19:g.5978075C>G	ENSP00000341483:p.Glu7Gln	0					RANBP3_ENST00000034275.8_Missense_Mutation_p.E7Q|RANBP3_ENST00000439268.2_Missense_Mutation_p.E7Q|RANBP3_ENST00000541471.1_Missense_Mutation_p.E7Q|RANBP3_ENST00000591124.1_5'UTR|CTC-232P5.1_ENST00000587836.1_RNA|RANBP3_ENST00000591092.1_Missense_Mutation_p.E7Q	p.E7Q	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	0	0	0	2.053054	Q9H6Z4	RANB3_HUMAN		1	76	-			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	1	1	hg19	c.19G>C	CCDS42478.1	0	.	.	.	.	.	.	.	.	.	.	C	18.48	3.634073	0.67130	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000541471	T;T;T;T	0.36878	1.23;1.24;2.08;1.53	5.02	5.02	0.67125	5.02	5.02	0.67125	.	0.634518	0.15243	U	0.272773	T	0.41465	0.1160	N	0.24115	0.695	0.18873	N	0.999988	D;D;D;D;D;D	0.71674	0.998;0.997;0.997;0.998;0.998;0.997	D;D;D;D;D;D	0.79108	0.992;0.983;0.983;0.992;0.992;0.983	T	0.18713	-1.0328	10	0.07030	T	0.85	.	13.8316	0.63384	0.0:1.0:0.0:0.0	.	7;7;7;7;7;7	F5H4C2;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;RANB3_HUMAN	Q	7	ENSP00000341483:E7Q;ENSP00000404837:E7Q;ENSP00000034275:E7Q;ENSP00000445071:E7Q	ENSP00000034275:E7Q	E	-	1	0	0	RANBP3	5929075	5929075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.697000	0.54764	2.318000	0.78349	0.655000	0.94253	GAA	0.355359		TCGA-HZ-8005-01A-11D-2201-08	0.701	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	1.820000	-19.975130	1	0.360000	NM_007322		0	17	17	0	223	209	0		1	1		0	0	61	0	0	0.999951	9.758851e-01	0	14	0	69	0	17	223
ACTL9	284382	broad.mit.edu	37	19	8808115	8808115	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr19:8808115C>T	ENST00000324436.3	-	1	1057	c.937G>A	c.(937-939)Gtc>Atc	p.V313I		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	313						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						GAGAGGCCGACGGGTGACAGC	0.647																																						ENST00000324436.3	0.990000	0.660000	0.910000	0.740000	0.820000	0.831604	0.820000	0.820000																										0				36						c.(937-939)Gtc>Atc		actin-like 9							37.0	39.0	38.0					19																	8808115		2200	4295	6495	SO:0001583	missense	284382	0	0					g.chr19:8808115C>T		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.937G>A	chr19.hg19:g.8808115C>T	ENSP00000316674:p.Val313Ile	0						p.V313I	NM_178525.3	NP_848620.3	0	0	0	2.053054	Q8TC94	ACTL9_HUMAN		1	1057	-			A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	1	1	hg19	c.937G>A	CCDS12207.1	0	.	.	.	.	.	.	.	.	.	.	c	1.890	-0.455680	0.04540	.	.	ENSG00000181786	ENST00000324436	D	0.94650	-3.48	4.63	-2.91	0.05631	4.63	-2.91	0.05631	.	1.123610	0.06989	N	0.821237	D	0.83575	0.5284	N	0.03608	-0.345	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.73263	-0.4038	10	0.87932	D	0	.	4.8829	0.13688	0.3641:0.4335:0.0:0.2024	.	313	Q8TC94	ACTL9_HUMAN	I	313	ENSP00000316674:V313I	ENSP00000316674:V313I	V	-	1	0	0	ACTL9	8669115	8669115	0.000000	0.05858	0.007000	0.13788	0.046000	0.14306	-0.972000	0.03802	-0.140000	0.11394	-0.851000	0.03033	GTC	0.355359		TCGA-HZ-8005-01A-11D-2201-08	0.647	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.820000	-20.000000	1	0.360000	NM_178525		0	82	79	0	464	457	1		1			0	0	69	0	0	1.000000	0	0	0	0	0	0	82	464
ZNF491	126069	broad.mit.edu	37	19	11917498	11917498	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr19:11917498G>T	ENST00000323169.5	+	3	1061	c.730G>T	c.(730-732)Gaa>Taa	p.E244*	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						AAAACCCTATGAATGTAAACT	0.418																																						ENST00000323169.5	0.310000	0.090000	0.250000	0.130000	0.180000	0.197084	0.180000	0.180000																										0				26						c.(730-732)Gaa>Taa		zinc finger protein 491							52.0	54.0	53.0					19																	11917498		2203	4300	6503	SO:0001587	stop_gained	126069	0	0					g.chr19:11917498G>T	AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.730G>T	chr19.hg19:g.11917498G>T	ENSP00000313443:p.Glu244*	0					ZNF491_ENST00000492230.1_Intron	p.E244*	NM_152356.3	NP_689569.2	0	0	0	2.053054	Q8N8L2	ZN491_HUMAN		3	1061	+			Q3MJ35|Q8NAT8	Nonsense_Mutation	SNP	ENST00000323169.5	0	1	hg19	c.730G>T	CCDS12267.1	0	.	.	.	.	.	.	.	.	.	.	g	20.5	4.005864	0.74932	.	.	ENSG00000177599	ENST00000323169;ENST00000455048	.	.	.	0.981	-0.104	0.13605	0.981	-0.104	0.13605	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	2.8933	0.05682	0.191:0.0:0.5452:0.2638	.	.	.	.	X	244;216	.	ENSP00000313443:E244X	E	+	1	0	0	ZNF491	11778498	11778498	0.000000	0.05858	0.031000	0.17742	0.285000	0.27093	-3.284000	0.00527	0.010000	0.14839	0.505000	0.49811	GAA	0.355359		TCGA-HZ-8005-01A-11D-2201-08	0.418	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	1.820000	-11.397770	1	0.360000	NM_152356		0	11	11	0	321	314	0		1			0	0	45	0	0	0.998202	0	0	0	0	0	0	11	321
MIB2	142678	broad.mit.edu	37	1	1565062	1565062	+	Silent	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:1565062C>T	ENST00000357210.4	+	19	2997	c.2781C>T	c.(2779-2781)gtC>gtT	p.V927V	MMP23B_ENST00000356026.5_5'Flank|MIB2_ENST00000378708.1_Silent_p.V833V|MIB2_ENST00000520777.1_Silent_p.V980V|MIB2_ENST00000355826.5_Silent_p.V970V|MIB2_ENST00000504599.1_Silent_p.V883V|MMP23B_ENST00000378675.3_5'Flank|MIB2_ENST00000505820.2_Silent_p.V984V|MIB2_ENST00000518681.1_Silent_p.V919V|MIB2_ENST00000378712.1_Missense_Mutation_p.R744C|MIB2_ENST00000360522.4_Silent_p.V892V|MIB2_ENST00000378710.3_Silent_p.V891V	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	927					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCCAGGTGGTCGTCAGCAAGA	0.697																																						ENST00000357210.4	1.000000	0.630000	1.000000	0.750000	0.900000	0.886058	0.900000	1.000000																										0				18						c.(2779-2781)gtC>gtT		mindbomb E3 ubiquitin protein ligase 2							36.0	43.0	40.0					1																	1565062		2099	4214	6313	SO:0001819	synonymous_variant	142678	0	0					g.chr1:1565062C>T	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.2781C>T	chr1.hg19:g.1565062C>T		0					MIB2_ENST00000378712.1_Missense_Mutation_p.R744C|MMP23B_ENST00000356026.5_5'Flank|MIB2_ENST00000520777.1_Silent_p.V980V|MIB2_ENST00000504599.1_Silent_p.V883V|MIB2_ENST00000378708.1_Silent_p.V833V|MIB2_ENST00000378710.3_Silent_p.V891V|MIB2_ENST00000518681.1_Silent_p.V919V|MIB2_ENST00000505820.2_Silent_p.V984V|MIB2_ENST00000360522.4_Silent_p.V892V|MIB2_ENST00000355826.5_Silent_p.V970V|MMP23B_ENST00000378675.3_5'Flank	p.V927V	NM_080875.2	NP_543151.2	0	1	1	1.937435	Q96AX9	MIB2_HUMAN		19	2997	+	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Silent	SNP	ENST00000357210.4	1	1	hg19	c.2781C>T		1	.	.	.	.	.	.	.	.	.	.	c	12.92	2.083742	0.36758	.	.	ENSG00000197530	ENST00000378712;ENST00000514234	T	0.68624	-0.34	3.31	1.06	0.20224	3.31	1.06	0.20224	.	.	.	.	.	T	0.52885	0.1762	.	.	.	0.80722	D	1	B	0.33904	0.431	B	0.26969	0.075	T	0.55673	-0.8104	8	0.66056	D	0.02	-3.8927	10.1675	0.42888	0.4171:0.5829:0.0:0.0	.	744	B3KXY1	.	C	744;743	ENSP00000367984:R744C	ENSP00000367984:R744C	R	+	1	0	0	MIB2	1554925	1554925	0.438000	0.25602	0.866000	0.34008	0.451000	0.32288	0.089000	0.15002	0.662000	0.31006	0.450000	0.29827	CGT	0.306308		TCGA-HZ-8005-01A-11D-2201-08	0.697	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	33	33	33	32	1	1.820000	-20.000000	1	0.360000	NM_080875		0	29	29	0	135	133	0		1	1		0	0	33	0	0	1.000000	9.570284e-01	0	11	0	16	0	29	135
SPTA1	6708	broad.mit.edu	37	1	158618345	158618345	+	Missense_Mutation	SNP	C	C	T	rs148714399		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:158618345C>T	ENST00000368147.4	-	26	3848	c.3668G>A	c.(3667-3669)cGa>cAa	p.R1223Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1223					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1223Q(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTCATGCCGTCGCTGAAGAGC	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		13940	0.001		0.0	False		,,,				2504	0.0					ENST00000368147.4	0.700000	0.440000	0.630000	0.490000	0.560000	0.570035	0.560000	0.560000																										1	Substitution - Missense(1)	p.R1223Q(1)	kidney(1)	307						c.(3667-3669)cGa>cAa		spectrin, alpha, erythrocytic 1		C	GLN/ARG	1,3899		0,1,1949	121.0	120.0	121.0		3668	5.5	1.0	1	dbSNP_134	121	0,8280		0,0,4140	no	missense	SPTA1	NM_003126.2	43	0,1,6089	TT,TC,CC		0.0,0.0256,0.0082	probably-damaging	1223/2420	158618345	1,12179	1950	4140	6090	SO:0001583	missense	6708	8	120874	42				g.chr1:158618345C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3668G>A	chr1.hg19:g.158618345C>T	ENSP00000357129:p.Arg1223Gln	0						p.R1223Q	NM_003126.2	NP_003117.2	0	1	1	1.901516	P02549	SPTA1_HUMAN		26	3848	-	all_hematologic(112;0.0378)		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	1	1	hg19	c.3668G>A	CCDS41423.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	36	5.794612	0.96952	2.56E-4	0.0	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48201	0.82;0.82	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.28560	N	0.014914	T	0.68044	0.2958	M	0.84082	2.675	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.70193	-0.4939	10	0.62326	D	0.03	.	18.1469	0.89661	0.0:1.0:0.0:0.0	.	1223	P02549	SPTA1_HUMAN	Q	1223	ENSP00000357130:R1223Q;ENSP00000357129:R1223Q	ENSP00000357129:R1223Q	R	-	2	0	0	SPTA1	156884969	156884969	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.130000	0.77235	2.861000	0.98227	0.655000	0.94253	CGA	0.304952		TCGA-HZ-8005-01A-11D-2201-08	0.507	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	1	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	1.820000	-19.994300	1	0.360000	NM_003126		0	65	64	0	523	515	1		1			0	0	105	0	0	1.000000	0	0	0	0	0	0	65	523
ASTN1	460	broad.mit.edu	37	1	177001821	177001821	+	Silent	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:177001821G>A	ENST00000367654.3	-	3	847	c.636C>T	c.(634-636)caC>caT	p.H212H	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Silent_p.H212H|ASTN1_ENST00000424564.2_Silent_p.H212H|ASTN1_ENST00000361833.2_Silent_p.H212H	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	212					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCTCCCGTCCGTGCCCGCCGA	0.627																																						ENST00000367654.3	0.650000	0.370000	0.590000	0.430000	0.500000	0.516239	0.500000	0.510000																										0				153						c.(634-636)caC>caT		astrotactin 1							64.0	53.0	57.0					1																	177001821		2203	4300	6503	SO:0001819	synonymous_variant	460	0	0					g.chr1:177001821G>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.636C>T	chr1.hg19:g.177001821G>A		1					ASTN1_ENST00000367657.3_Silent_p.H212H|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Silent_p.H212H|ASTN1_ENST00000424564.2_Silent_p.H212H	p.H212H	NM_004319.1	NP_004310.1	0	1	1	1.892748	O14525	ASTN1_HUMAN		3	847	-			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	1	1	hg19	c.636C>T		0																																																																																								0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.627	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	67	67	67	64	1	1.820000	-20.000000	1	0.360000	NM_004319		0	45	44	0	402	388	0		1			0	0	67	0	0	1.000000	0	0	0	0	0	0	45	402
TOR1AIP1	26092	broad.mit.edu	37	1	179887348	179887348	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:179887348G>A	ENST00000606911.2	+	10	1917	c.1726G>A	c.(1726-1728)Gcc>Acc	p.A576T	TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.A455T|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.A592T|TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.A577T			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	576	Interaction with TOR1A.				positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						ACCTGAAAATGCCCTGAAAAG	0.428																																						ENST00000606911.2	1.000000	0.770000	1.000000	0.860000	0.970000	0.947159	0.970000	1.000000																										0				18						c.(1726-1728)Gcc>Acc		torsin A interacting protein 1							43.0	46.0	45.0					1																	179887348		2202	4299	6501	SO:0001583	missense	26092	0	0					g.chr1:179887348G>A		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1726G>A	chr1.hg19:g.179887348G>A	ENSP00000476687:p.Ala576Thr	1					TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.A577T|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.A592T|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.A455T	p.A576T			0	1	1	1.892748	Q5JTV8	TOIP1_HUMAN		10	1917	+			A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	1	1	hg19	c.1726G>A	CCDS1335.1	1	.	.	.	.	.	.	.	.	.	.	G	7.262	0.605348	0.14002	.	.	ENSG00000143337	ENST00000325993;ENST00000271583;ENST00000435319	T;T	0.27720	1.65;1.65	5.85	1.27	0.21489	5.85	1.27	0.21489	.	0.561061	0.19308	N	0.117477	T	0.18882	0.0453	L	0.35723	1.085	0.09310	N	1	B	0.25904	0.137	B	0.23018	0.043	T	0.15867	-1.0422	9	.	.	.	-0.0438	5.7073	0.17915	0.2627:0.0:0.5051:0.2322	.	576	Q5JTV8	TOIP1_HUMAN	T	371;592;576	ENSP00000271583:A592T;ENSP00000393292:A576T	.	A	+	1	0	0	TOR1AIP1	178153971	178153971	0.983000	0.35010	0.011000	0.14972	0.435000	0.31806	1.398000	0.34554	0.355000	0.24131	-0.140000	0.14226	GCC	0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.428	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	1	0	1	2	2	2	2	0	0	0	0	43	43	43	41	1	1.820000	-20.000000	1	0.360000	NM_015602		0	65	63	0	271	269	1		1	1		0	0	43	0	0	1.000000	9.999985e-01	0	21	0	62	0	65	271
TNFRSF9	3604	broad.mit.edu	37	1	8000140	8000140	+	Splice_Site	SNP	T	T	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:8000140T>G	ENST00000377507.3	-	2	83		c.e2-2			NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9						apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		AATGTCACTCTGCAAAAGATA	0.348																																						ENST00000377507.3	1.000000	0.300000	0.900000	0.460000	0.660000	0.678007	0.660000	1.000000																										0				19						c.e2-2		tumor necrosis factor receptor superfamily, member 9																																				SO:0001630	splice_region_variant	3604	0	0					g.chr1:8000140T>G	L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.84-2A>C	chr1.hg19:g.8000140T>G		0							NM_001561.5	NP_001552.2	0	1	1	1.937435	Q07011	TNR9_HUMAN		2	83	-	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		Splice_Site	SNP	ENST00000377507.3	0	1	hg19		CCDS92.1	0																																																																																								0.306308		TCGA-HZ-8005-01A-11D-2201-08	0.348	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003622.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.820000	-14.403200	1	0.360000		Intron	0	7	7	0	48	47	1		1			0	0	18	0	0	0.981849	0	0	0	0	0	0	7	48
KIF17	57576	broad.mit.edu	37	1	21031222	21031222	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:21031222G>A	ENST00000247986.2	-	5	1151	c.841C>T	c.(841-843)Cgc>Tgc	p.R281C	KIF17_ENST00000375044.1_Missense_Mutation_p.R181C|KIF17_ENST00000400463.3_Missense_Mutation_p.R281C			Q9P2E2	KIF17_HUMAN	kinesin family member 17	281	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGCTTACAGCGCCCGTCCACC	0.662																																						ENST00000247986.2	0.640000	0.400000	0.580000	0.450000	0.510000	0.524540	0.510000	0.520000																										0				50						c.(841-843)Cgc>Tgc		kinesin family member 17							80.0	78.0	79.0					1																	21031222		2203	4300	6503	SO:0001583	missense	57576	3	121398	34				g.chr1:21031222G>A	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.841C>T	chr1.hg19:g.21031222G>A	ENSP00000247986:p.Arg281Cys	0					KIF17_ENST00000400463.3_Missense_Mutation_p.R281C|KIF17_ENST00000375044.1_Missense_Mutation_p.R181C	p.R281C			0	1	1	1.945867	Q9P2E2	KIF17_HUMAN		5	1151	-		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	1	1	hg19	c.841C>T	CCDS213.1	0	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735323	0.69189	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.73469	-0.75;-0.75;-0.75	5.11	4.13	0.48395	5.11	4.13	0.48395	Kinesin, motor domain (3);	0.000000	0.33161	U	0.005212	D	0.83308	0.5226	M	0.71871	2.18	0.53005	D	0.999962	D;D	0.89917	1.0;1.0	D;D	0.81914	0.988;0.995	D	0.84525	0.0630	10	0.87932	D	0	.	11.0585	0.47933	0.0:0.0:0.67:0.33	.	281;281	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	C	181;281;281	ENSP00000364184:R181C;ENSP00000383311:R281C;ENSP00000247986:R281C	ENSP00000247986:R281C	R	-	1	0	0	KIF17	20903809	20903809	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	3.315000	0.51951	2.554000	0.86153	0.462000	0.41574	CGC	0.309005		TCGA-HZ-8005-01A-11D-2201-08	0.662	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	107	1	1.820000	-3.075755	1	0.360000	NM_020816		0	66	64	0	587	573	1		1	0		0	0	109	0	0	1.000000	1.060324e-02	0	0	0	2	0	66	587
PTCH2	8643	broad.mit.edu	37	1	45294923	45294923	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:45294923C>T	ENST00000372192.3	-	10	1407	c.1277G>A	c.(1276-1278)gGc>gAc	p.G426D	PTCH2_ENST00000447098.2_Missense_Mutation_p.G426D	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	426	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					CCCGGCAAGGCCCACGGAACC	0.677									Basal Cell Nevus syndrome																													ENST00000372192.3	1.000000	0.880000	1.000000	0.990000	0.990000	0.990749	0.990000	1.000000																										0				50						c.(1276-1278)gGc>gAc		patched 2							27.0	29.0	29.0					1																	45294923		2202	4299	6501	SO:0001583	missense	8643	0	0		Basal Cell Nevus syndrome	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	g.chr1:45294923C>T	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.1277G>A	chr1.hg19:g.45294923C>T	ENSP00000361266:p.Gly426Asp	0					PTCH2_ENST00000447098.2_Missense_Mutation_p.G426D	p.G426D	NM_003738.4	NP_003729.3	0	1	1	1.917152	Q9Y6C5	PTC2_HUMAN		10	1407	-	Acute lymphoblastic leukemia(166;0.155)		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	1	1	hg19	c.1277G>A	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353281	0.82132	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.92446	-3.04;-3.04	5.13	4.16	0.48862	5.13	4.16	0.48862	Sterol-sensing domain (1);	0.140689	0.45126	D	0.000382	D	0.97164	0.9073	H	0.96015	3.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.97955	1.0334	10	0.87932	D	0	-18.3065	14.0316	0.64619	0.1518:0.8482:0.0:0.0	.	426;426	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	D	426	ENSP00000389703:G426D;ENSP00000361266:G426D	ENSP00000361266:G426D	G	-	2	0	0	PTCH2	45067510	45067510	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.634000	0.67833	2.397000	0.81536	0.561000	0.74099	GGC	0.303591		TCGA-HZ-8005-01A-11D-2201-08	0.677	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	1	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.820000	-20.000000	1	0.360000	NM_003738		0	64	62	0	227	224	1		1			0	0	43	0	0	1.000000	0	0	0	0	0	0	64	227
ELTD1	64123	broad.mit.edu	37	1	79387314	79387314	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:79387314G>T	ENST00000370742.3	-	9	1304	c.1241C>A	c.(1240-1242)tCc>tAc	p.S414Y		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	414	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AGGACCAGAGGACATCAAAAT	0.383																																						ENST00000370742.3	0.660000	0.410000	0.600000	0.470000	0.530000	0.541609	0.530000	0.530000																										0				69						c.(1240-1242)tCc>tAc		EGF, latrophilin and seven transmembrane domain containing 1							147.0	138.0	141.0					1																	79387314		1945	4143	6088	SO:0001583	missense	64123	0	0					g.chr1:79387314G>T	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1241C>A	chr1.hg19:g.79387314G>T	ENSP00000359778:p.Ser414Tyr	0						p.S414Y	NM_022159.3	NP_071442.2	0	1	1	1.917152	Q9HBW9	ELTD1_HUMAN		9	1304	-			B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	1	1	hg19	c.1241C>A	CCDS41352.1	0	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620175	0.66787	.	.	ENSG00000162618	ENST00000370742	T	0.38887	1.11	5.32	5.32	0.75619	5.32	5.32	0.75619	GPS domain (2);	0.000000	0.85682	D	0.000000	T	0.66117	0.2757	M	0.89030	3	0.80722	D	1	D	0.65815	0.995	D	0.69307	0.963	T	0.71265	-0.4644	9	.	.	.	.	19.3656	0.94460	0.0:0.0:1.0:0.0	.	414	Q9HBW9	ELTD1_HUMAN	Y	414	ENSP00000359778:S414Y	.	S	-	2	0	0	ELTD1	79159902	79159902	1.000000	0.71417	0.989000	0.46669	0.372000	0.29890	9.568000	0.98166	2.637000	0.89404	0.585000	0.79938	TCC	0.303591		TCGA-HZ-8005-01A-11D-2201-08	0.383	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	96	1	1.820000	-19.692770	1	0.360000	NM_022159		0	63	62	0	536	529	1		1	0		0	0	97	0	0	1.000000	5.810603e-01	0	0	0	18	0	63	536
LGR6	59352	broad.mit.edu	37	1	202273709	202273709	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr1:202273709C>T	ENST00000367278.3	+	11	1110	c.1021C>T	c.(1021-1023)Cgg>Tgg	p.R341W	LGR6_ENST00000255432.7_Missense_Mutation_p.R289W|LGR6_ENST00000308543.3_3'UTR|LGR6_ENST00000439764.2_Missense_Mutation_p.R202W	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	341					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						CGCAGGCATCCGGCTGCTCCC	0.642																																						ENST00000367278.3	0.510000	0.240000	0.440000	0.290000	0.360000	0.373760	0.360000	0.360000																										0				36						c.(1021-1023)Cgg>Tgg		leucine-rich repeat containing G protein-coupled receptor 6							46.0	49.0	48.0					1																	202273709		2203	4300	6503	SO:0001583	missense	59352	1	121412	32				g.chr1:202273709C>T	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.1021C>T	chr1.hg19:g.202273709C>T	ENSP00000356247:p.Arg341Trp	1					LGR6_ENST00000255432.7_Missense_Mutation_p.R289W|LGR6_ENST00000308543.3_3'UTR|LGR6_ENST00000439764.2_Missense_Mutation_p.R202W	p.R341W	NM_001017403.1	NP_001017403.1	0	1	1	1.892748	Q9HBX8	LGR6_HUMAN		11	1110	+			Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	1	1	hg19	c.1021C>T	CCDS30971.1	0	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486753	0.84854	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000367277;ENST00000423542;ENST00000439764	T;T;T;T	0.59502	0.86;0.86;0.26;0.86	5.22	4.29	0.51040	5.22	4.29	0.51040	.	0.382828	0.27052	N	0.021162	T	0.68723	0.3032	M	0.65677	2.01	0.32304	N	0.564591	D;D;D	0.76494	0.999;0.989;0.996	P;P;P	0.58970	0.799;0.764;0.849	T	0.77247	-0.2658	10	0.72032	D	0.01	.	11.9806	0.53117	0.1802:0.8198:0.0:0.0	.	202;289;341	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	W	341;289;195;195;202	ENSP00000356247:R341W;ENSP00000255432:R289W;ENSP00000402284:R195W;ENSP00000387869:R202W	ENSP00000255432:R289W	R	+	1	2	2	LGR6	200540332	200540332	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.719000	0.47244	1.129000	0.42072	0.655000	0.94253	CGG	0.298092		TCGA-HZ-8005-01A-11D-2201-08	0.642	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	1.820000	-3.017769	1	0.360000	NM_021636		0	25	25	0	323	313	0		1	1		0	0	59	0	0	1.000000	3.073188e-01	0	5	0	10	0	25	323
DYRK1A	1859	broad.mit.edu	37	21	38868512	38868512	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr21:38868512G>T	ENST00000398960.2	+	8	1266	c.1191G>T	c.(1189-1191)aaG>aaT	p.K397N	DYRK1A_ENST00000455387.2_Missense_Mutation_p.K169N|DYRK1A_ENST00000451934.1_Missense_Mutation_p.K397N|DYRK1A_ENST00000398956.2_Missense_Mutation_p.K397N|DYRK1A_ENST00000338785.3_Missense_Mutation_p.K397N|DYRK1A_ENST00000321219.8_Missense_Mutation_p.K397N|DYRK1A_ENST00000339659.4_Missense_Mutation_p.K388N	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	397	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			K -> N (in Ref. 1; AAC50939). {ECO:0000305}.	circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TCTTTGAGAAGTTGCCAGATG	0.353																																					Melanoma(114;464 1602 31203 43785 45765)	ENST00000398960.2	0.790000	0.410000	0.690000	0.490000	0.580000	0.598281	0.580000	0.580000																										0				42						c.(1189-1191)aaG>aaT		dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A							65.0	68.0	67.0					21																	38868512		2203	4300	6503	SO:0001583	missense	1859	0	0					g.chr21:38868512G>T	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1191G>T	chr21.hg19:g.38868512G>T	ENSP00000381932:p.Lys397Asn	1					DYRK1A_ENST00000339659.4_Missense_Mutation_p.K388N|DYRK1A_ENST00000398956.2_Missense_Mutation_p.K397N|DYRK1A_ENST00000455387.2_Missense_Mutation_p.K169N|DYRK1A_ENST00000338785.3_Missense_Mutation_p.K397N|DYRK1A_ENST00000451934.1_Missense_Mutation_p.K397N|DYRK1A_ENST00000321219.8_Missense_Mutation_p.K397N	p.K397N	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	0	1	1	1.869517	Q13627	DYR1A_HUMAN		8	1266	+			O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	1	1	hg19	c.1191G>T	CCDS42925.1	0	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170311	0.78452	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	T;T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08;2.08	4.97	4.97	0.65823	4.97	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.27629	0.0679	N	0.16037	0.36	0.80722	D	1	B;P;D;D;P	0.54772	0.447;0.704;0.968;0.96;0.704	B;B;P;P;B	0.57720	0.235;0.235;0.826;0.734;0.235	T	0.17167	-1.0378	10	0.72032	D	0.01	.	18.614	0.91296	0.0:0.0:1.0:0.0	.	397;397;397;388;397	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	N	397;388;397;397;397;397;169	ENSP00000342690:K397N;ENSP00000340373:K388N;ENSP00000319032:K397N;ENSP00000416089:K397N;ENSP00000381932:K397N;ENSP00000381929:K397N;ENSP00000407854:K169N	ENSP00000319032:K397N	K	+	3	2	2	DYRK1A	37790382	37790382	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.700000	0.74619	2.446000	0.82766	0.655000	0.94253	AAG	0.296703		TCGA-HZ-8005-01A-11D-2201-08	0.353	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.820000	-20.000000	1	0.360000	NM_001396		0	31	31	0	235	232	1		1	1		0	0	50	0	0	1.000000	7.844275e-01	0	4	0	20	0	31	235
SREBF2	6721	broad.mit.edu	37	22	42300961	42300961	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr22:42300961C>T	ENST00000361204.4	+	18	3354	c.3188C>T	c.(3187-3189)aCg>aTg	p.T1063M	SREBF2_ENST00000491541.1_3'UTR	NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	1063					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CGGCGCACCACGCAGAGCACC	0.697																																						ENST00000361204.4	0.800000	0.200000	0.630000	0.310000	0.450000	0.474487	0.450000	0.420000																										0				38						c.(3187-3189)aCg>aTg		sterol regulatory element binding transcription factor 2							25.0	30.0	28.0					22																	42300961		2190	4292	6482	SO:0001583	missense	6721	2	120706	28				g.chr22:42300961C>T	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.3188C>T	chr22.hg19:g.42300961C>T	ENSP00000354476:p.Thr1063Met	0					SREBF2_ENST00000491541.1_3'UTR	p.T1063M	NM_004599.2	NP_004590.2	0	0	0	2.030572	Q12772	SRBP2_HUMAN		18	3354	+			Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	0	1	hg19	c.3188C>T	CCDS14023.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.37|15.37	2.813359|2.813359	0.50527|0.50527	.|.	.|.	ENSG00000198911|ENSG00000198911	ENST00000435061|ENST00000361204;ENST00000457567;ENST00000543221	.|T	.|0.19806	.|2.12	5.48|5.48	4.46|4.46	0.54185|0.54185	5.48|5.48	4.46|4.46	0.54185|0.54185	.|.	.|0.538200	.|0.22119	.|N	.|0.064371	T|T	0.14657|0.14657	0.0354|0.0354	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	0.999998|0.999998	.|P	.|0.40332	.|0.713	.|B	.|0.29353	.|0.101	T|T	0.19976|0.19976	-1.0289|-1.0289	5|10	.|0.44086	.|T	.|0.13	-3.268|-3.268	13.6689|13.6689	0.62412|0.62412	0.0:0.9258:0.0:0.0742|0.0:0.9258:0.0:0.0742	.|.	.|1063	.|Q12772	.|SRBP2_HUMAN	C|M	252|1063;1063;137	.|ENSP00000354476:T1063M	.|ENSP00000354476:T1063M	R|T	+|+	1|2	0|0	0|0	SREBF2|SREBF2	40630907|40630907	40630907|40630907	0.006000|0.006000	0.16342|0.16342	0.006000|0.006000	0.13384|0.13384	0.089000|0.089000	0.18198|0.18198	2.261000|2.261000	0.43276|0.43276	2.572000|2.572000	0.86782|0.86782	0.491000|0.491000	0.48974|0.48974	CGC|ACG	0.348269		TCGA-HZ-8005-01A-11D-2201-08	0.697	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	1	0	1	2	2	2	2	0	0	0	0	13	13	13	13	1	1.820000	-12.202200	1	0.360000	NM_004599		0	7	6	0	81	80	0		1	1		0	0	13	0	0	0.980505	9.242609e-01	0	14	0	42	0	7	81
NFAM1	150372	broad.mit.edu	37	22	42781196	42781196	+	Missense_Mutation	SNP	C	C	T	rs145224229		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr22:42781196C>T	ENST00000329021.5	-	6	821	c.784G>A	c.(784-786)Gaa>Aaa	p.E262K		NM_145912.5	NP_666017.1	Q8NET5	NFAM1_HUMAN	NFAT activating protein with ITAM motif 1	262					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cytokine production (GO:0001819)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of B cell differentiation (GO:0045577)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(1)|lung(3)	4						AGGTTAAGTTCGCCATCATCT	0.502																																						ENST00000329021.5	1.000000	0.250000	0.400000	0.290000	0.330000	0.389474	0.330000	0.340000																										0				4						c.(784-786)Gaa>Aaa		NFAT activating protein with ITAM motif 1		C	LYS/GLU	0,4406		0,0,2203	135.0	140.0	138.0		784	2.1	0.0	22	dbSNP_134	138	1,8599	1.2+/-3.3	0,1,4299	no	missense	NFAM1	NM_145912.5	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	262/271	42781196	1,13005	2203	4300	6503	SO:0001583	missense	150372	2	121412	38				g.chr22:42781196C>T	BC038241	CCDS14034.1	22q13.2	2005-02-01			ENSG00000235568	ENSG00000235568			29872	protein-coding gene	gene with protein product		608740				12615919	Standard	NM_145912		Approved	CNAIP	uc003bcn.4	Q8NET5	OTTHUMG00000150923	ENST00000329021.5:c.784G>A	chr22.hg19:g.42781196C>T	ENSP00000333680:p.Glu262Lys	1						p.E262K	NM_145912.5	NP_666017.1	2	2	4	2.724429	Q8NET5	NFAM1_HUMAN		6	821	-			B0QYD0|Q20WL2|Q5JZ96|Q8IUY8|Q8TEM8	Missense_Mutation	SNP	ENST00000329021.5	1	1	hg19	c.784G>A	CCDS14034.1	0	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297461	0.60086	0.0	1.16E-4	ENSG00000235568	ENST00000329021	T	0.40476	1.03	4.22	2.1	0.27182	4.22	2.1	0.27182	.	0.200535	0.22657	U	0.057244	T	0.33323	0.0859	L	0.56769	1.78	0.09310	N	1	B	0.31989	0.35	B	0.23419	0.046	T	0.29058	-1.0024	10	0.87932	D	0	-8.6668	7.32	0.26521	0.0:0.785:0.0:0.215	.	262	Q8NET5	NFAM1_HUMAN	K	262	ENSP00000333680:E262K	ENSP00000333680:E262K	E	-	1	0	0	NFAM1	41111140	41111140	0.194000	0.23325	0.004000	0.12327	0.002000	0.02628	1.355000	0.34068	0.504000	0.28082	-0.254000	0.11334	GAA	0.517927		TCGA-HZ-8005-01A-11D-2201-08	0.502	NFAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320541.1	1	0	1	2	2	2	2	0	0	0	0	184	184	184	183	1	1.820000	-3.142395	1	0.360000	NM_145912		0	75	75	0	1563	1545	0		1	0		0	0	184	0	0	1.000000	3.737260e-01	0	0	0	28	0	75	1563
APOB	338	broad.mit.edu	37	2	21238344	21238344	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr2:21238344C>A	ENST00000233242.1	-	22	3533	c.3406G>T	c.(3406-3408)Gag>Tag	p.E1136*		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1136					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGAGGATCTCACTTCTGGCT	0.473																																						ENST00000233242.1	0.490000	0.260000	0.440000	0.310000	0.360000	0.377002	0.360000	0.370000																										0				305						c.(3406-3408)Gag>Tag		apolipoprotein B							148.0	136.0	140.0					2																	21238344		2203	4300	6503	SO:0001587	stop_gained	338	0	0					g.chr2:21238344C>A	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3406G>T	chr2.hg19:g.21238344C>A	ENSP00000233242:p.Glu1136*	0						p.E1136*	NM_000384.2	NP_000375	0	0	0	2.037542	P04114	APOB_HUMAN		22	3533	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	ENST00000233242.1	0	1	hg19	c.3406G>T	CCDS1703.1	0	.	.	.	.	.	.	.	.	.	.	C	43	9.881007	0.99286	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	.	.	.	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	17.9432	0.89031	0.0:1.0:0.0:0.0	.	.	.	.	X	1136	.	ENSP00000233242:E1136X	E	-	1	0	0	APOB	21091849	21091849	1.000000	0.71417	0.999000	0.59377	0.846000	0.48090	4.931000	0.63469	2.767000	0.95098	0.655000	0.94253	GAG	0.350649		TCGA-HZ-8005-01A-11D-2201-08	0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1	0	0	1	2	21	2	2	1	1	1	1	79	79	79	78	1	1.820000	-7.657893	1	0.360000			0	35	35	0	484	478	0		1			1	0	79	0	0	0.978212	0	0	0	0	0	0	35	484
ERBB4	2066	broad.mit.edu	37	2	212578361	212578361	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr2:212578361A>T	ENST00000342788.4	-	8	1206	c.896T>A	c.(895-897)gTa>gAa	p.V299E	ERBB4_ENST00000436443.1_Missense_Mutation_p.V299E|ERBB4_ENST00000402597.1_Missense_Mutation_p.V299E	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	299	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ACTGGAATCTACCACAAAGTT	0.328										TSP Lung(8;0.080)																												ENST00000342788.4	1.000000	0.620000	0.970000	0.720000	0.840000	0.847350	0.840000	1.000000																										0				179						c.(895-897)gTa>gAa		v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	Afatinib(DB08916)						82.0	79.0	80.0					2																	212578361		2203	4300	6503	SO:0001583	missense	2066	0	0					g.chr2:212578361A>T	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.896T>A	chr2.hg19:g.212578361A>T	ENSP00000342235:p.Val299Glu	0	TSP Lung(8;0.080)				ERBB4_ENST00000402597.1_Missense_Mutation_p.V299E|ERBB4_ENST00000436443.1_Missense_Mutation_p.V299E	p.V299E	NM_005235.2	NP_005226.1	0	0	0	2.037542	Q15303	ERBB4_HUMAN		8	1206	-		Renal(323;0.06)|Lung NSC(271;0.197)	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	1	1	hg19	c.896T>A	CCDS2394.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.9|26.9	4.779881|4.779881	0.90195|0.90195	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.30448|.	1.53;1.53;1.53|.	5.61|5.61	5.61|5.61	0.85477|0.85477	5.61|5.61	5.61|5.61	0.85477|0.85477	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76328|.	0.3972|.	M|M	0.78916|0.78916	2.43|2.43	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;0.983;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;0.967;0.999;0.999;1.0|.	T|.	0.77389|.	-0.2606|.	10|.	0.87932|.	D|.	0|.	.|.	15.7982|15.7982	0.78428|0.78428	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	299;299;158;299;299|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	E|K	299|299	ENSP00000342235:V299E;ENSP00000403204:V299E;ENSP00000385565:V299E|.	ENSP00000342235:V299E|.	V|X	-|-	2|1	0|0	0|0	ERBB4|ERBB4	212286606|212286606	212286606|212286606	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.987000|0.987000	0.75469|0.75469	9.339000|9.339000	0.96797|0.96797	2.132000|2.132000	0.65825|0.65825	0.533000|0.533000	0.62120|0.62120	GTA|TAG	0.350649		TCGA-HZ-8005-01A-11D-2201-08	0.328	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	1	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	1.820000	-20.000000	1	0.360000	NM_001042599		0	39	39	0	213	207	1		1			0	0	35	0	0	1.000000	0	0	0	0	0	0	39	213
CXCR1	3577	broad.mit.edu	37	2	219029412	219029412	+	Missense_Mutation	SNP	G	G	A	rs575757254		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr2:219029412G>A	ENST00000295683.2	-	2	643	c.523C>T	c.(523-525)Cgc>Tgc	p.R175C		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	175					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)	p.R175C(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	TAAGCCTGGCGGAAAAGGAAG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		23277	0.0		0.0	False		,,,				2504	0.001					ENST00000295683.2	0.610000	0.280000	0.520000	0.350000	0.430000	0.445071	0.430000	0.430000																										1	Substitution - Missense(1)	p.R175C(1)	lung(1)	13						c.(523-525)Cgc>Tgc		chemokine (C-X-C motif) receptor 1	Ketoprofen(DB01009)						84.0	74.0	77.0					2																	219029412		2203	4300	6503	SO:0001583	missense	3577	34	121412	44				g.chr2:219029412G>A	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.523C>T	chr2.hg19:g.219029412G>A	ENSP00000295683:p.Arg175Cys	0						p.R175C	NM_000634.2	NP_000625.1	0	0	0	2.037542	P25024	CXCR1_HUMAN		2	643	-			B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	ENST00000295683.2	1	1	hg19	c.523C>T	CCDS2409.1	0	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109016	0.37242	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.38401	1.14	4.94	4.94	0.65067	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.179362	0.45361	D	0.000370	T	0.70945	0.3282	H	0.96861	3.895	0.53688	D	0.999976	D	0.89917	1.0	D	0.75020	0.985	T	0.80587	-0.1316	10	0.72032	D	0.01	.	13.0936	0.59178	0.0:0.1617:0.8382:0.0	.	175	P25024	CXCR1_HUMAN	C	175;119	ENSP00000295683:R175C	ENSP00000295683:R175C	R	-	1	0	0	CXCR1	218737657	218737657	0.998000	0.40836	0.144000	0.22314	0.162000	0.22319	2.998000	0.49465	2.432000	0.82394	0.655000	0.94253	CGC	0.350649		TCGA-HZ-8005-01A-11D-2201-08	0.522	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256773.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	39	1	1.820000	-2.966612	1	0.360000	NM_000634		0	25	25	0	291	286	0		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	25	291
MCM2	4171	broad.mit.edu	37	3	127325137	127325137	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr3:127325137C>T	ENST00000265056.7	+	5	1094	c.850C>T	c.(850-852)Cgc>Tgc	p.R284C		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	284					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						CATCCATGTCCGCATCTCCCA	0.632																																						ENST00000265056.7	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				6						c.(850-852)Cgc>Tgc		minichromosome maintenance complex component 2							161.0	130.0	140.0					3																	127325137		2203	4300	6503	SO:0001583	missense	4171	4	121410	36				g.chr3:127325137C>T	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.850C>T	chr3.hg19:g.127325137C>T	ENSP00000265056:p.Arg284Cys	1						p.R284C	NM_004526.2	NP_004517.2	1	2	3	2.382272	P49736	MCM2_HUMAN		5	1094	+			Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	1	1	hg19	c.850C>T	CCDS3043.1	1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552420	0.65311	.	.	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142	T	0.15017	2.46	5.1	5.1	0.69264	5.1	5.1	0.69264	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.55909	0.1950	H	0.94503	3.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;1.0;1.0	T	0.70741	-0.4789	10	0.87932	D	0	-27.6015	18.5426	0.91035	0.0:1.0:0.0:0.0	.	265;154;284	F5H1E9;B4DSV5;P49736	.;.;MCM2_HUMAN	C	284;188;265	ENSP00000265056:R284C	ENSP00000265056:R284C	R	+	1	0	0	MCM2	128807827	128807827	1.000000	0.71417	0.965000	0.40720	0.262000	0.26303	5.925000	0.70062	2.363000	0.80096	0.591000	0.81541	CGC	0.451773		TCGA-HZ-8005-01A-11D-2201-08	0.632	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1	1	0	1	2	2	2	2	0	0	0	0	157	157	157	155	1	1.820000	-13.038990	1	0.360000			0	315	300	0	815	804	1		1	1		0	0	157	0	0	1.000000	1	0	60	0	29	0	315	815
ZIC1	7545	broad.mit.edu	37	3	147128364	147128364	+	Silent	SNP	G	G	A	rs376476564		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr3:147128364G>A	ENST00000282928.4	+	1	1194	c.465G>A	c.(463-465)tcG>tcA	p.S155S		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	155					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GCCACGCGTCGCCTAACGTGG	0.716																																						ENST00000282928.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				63						c.(463-465)tcG>tcA		Zic family member 1							17.0	21.0	19.0					3																	147128364		2196	4296	6492	SO:0001819	synonymous_variant	7545	0	0					g.chr3:147128364G>A	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.465G>A	chr3.hg19:g.147128364G>A		1						p.S155S	NM_003412.3	NP_003403.2	1	2	3	2.382272	Q15915	ZIC1_HUMAN		1	1194	+			Q2M3N1	Silent	SNP	ENST00000282928.4	1	1	hg19	c.465G>A	CCDS3136.1	1																																																																																								0.451773		TCGA-HZ-8005-01A-11D-2201-08	0.716	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	1	0	1	2	2	2	2	0	0	0	0	27	27	27	26	1	1.820000	-20.000000	1	0.360000	NM_003412		0	56	55	0	106	102	0		1			0	0	27	0	0	1.000000	0	0	0	0	0	0	56	106
NPY5R	4889	broad.mit.edu	37	4	164272416	164272416	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr4:164272416C>A	ENST00000515560.1	+	4	2513	c.991C>A	c.(991-993)Cca>Aca	p.P331T	NPY5R_ENST00000506953.1_Missense_Mutation_p.P331T|NPY5R_ENST00000338566.3_Missense_Mutation_p.P331T			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	331					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				TAAGTTCATACCAGGGGTCCC	0.403																																					Melanoma(139;1287 1774 9781 19750 25599)	ENST00000515560.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999965	0.990000	1.000000																										0				42						c.(991-993)Cca>Aca		neuropeptide Y receptor Y5							70.0	72.0	71.0					4																	164272416		2203	4300	6503	SO:0001583	missense	4889	0	0					g.chr4:164272416C>A	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.991C>A	chr4.hg19:g.164272416C>A	ENSP00000423917:p.Pro331Thr	1					NPY5R_ENST00000506953.1_Missense_Mutation_p.P331T|NPY5R_ENST00000338566.3_Missense_Mutation_p.P331T	p.P331T			0	2	2	2.057327	Q15761	NPY5R_HUMAN		4	2513	+	all_hematologic(180;0.166)	Prostate(90;0.109)	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	1	1	hg19	c.991C>A	CCDS3804.1	1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321968	0.60634	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.71222	-0.55;-0.55;-0.55	4.49	4.49	0.54785	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40302	N	0.001140	T	0.81522	0.4840	M	0.68952	2.095	0.48696	D	0.999694	D	0.89917	1.0	D	0.81914	0.995	T	0.77571	-0.2538	10	0.18276	T	0.48	.	18.061	0.89377	0.0:1.0:0.0:0.0	.	331	Q15761	NPY5R_HUMAN	T	331	ENSP00000339377:P331T;ENSP00000423917:P331T;ENSP00000423474:P331T	ENSP00000339377:P331T	P	+	1	0	0	NPY5R	164491866	164491866	0.995000	0.38212	0.998000	0.56505	0.970000	0.65996	3.986000	0.56937	2.433000	0.82419	0.467000	0.42956	CCA	0.360000		TCGA-HZ-8005-01A-11D-2201-08	0.403	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	64	1	1.820000	-20.000000	1	0.360000	NM_006174		0	80	79	0	245	238	1		1			0	0	66	0	0	1.000000	0	0	0	0	0	0	80	245
LHFPL2	10184	broad.mit.edu	37	5	77805805	77805805	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr5:77805805G>A	ENST00000515007.2	-	2	542	c.232C>T	c.(232-234)Cgg>Tgg	p.R78W	LHFPL2_ENST00000380345.2_Missense_Mutation_p.R78W			Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	78						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	6		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		AGCGTGTCCCGCTGGAAGTGC	0.687																																						ENST00000515007.2	1.000000	0.660000	1.000000	0.800000	0.950000	0.919804	0.950000	1.000000																										0				6						c.(232-234)Cgg>Tgg		lipoma HMGIC fusion partner-like 2							19.0	21.0	21.0					5																	77805805		2203	4297	6500	SO:0001583	missense	10184	0	0					g.chr5:77805805G>A	D86961	CCDS4042.1	5q13	2008-02-05			ENSG00000145685	ENSG00000145685			6588	protein-coding gene	gene with protein product		609718				10329012	Standard	NM_005779		Approved	KIAA0206	uc003kfo.3	Q6ZUX7	OTTHUMG00000107579	ENST00000515007.2:c.232C>T	chr5.hg19:g.77805805G>A	ENSP00000425906:p.Arg78Trp	0					LHFPL2_ENST00000380345.2_Missense_Mutation_p.R78W	p.R78W			0	0	0	2.013809	Q6ZUX7	LHPL2_HUMAN		2	542	-		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)	B2RMQ6|Q7Z5P0|Q92605	Missense_Mutation	SNP	ENST00000515007.2	1	1	hg19	c.232C>T	CCDS4042.1	1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889280	0.72524	.	.	ENSG00000145685	ENST00000380345;ENST00000515007	T;T	0.72725	-0.68;-0.68	5.52	3.7	0.42460	5.52	3.7	0.42460	.	0.175378	0.49305	D	0.000158	T	0.63780	0.2540	L	0.47716	1.5	0.45390	D	0.998379	B	0.11235	0.004	B	0.10450	0.005	T	0.57631	-0.7778	10	0.37606	T	0.19	-26.9083	13.8039	0.63218	0.0:0.0:0.4853:0.5147	.	78	Q6ZUX7	LHPL2_HUMAN	W	78	ENSP00000369702:R78W;ENSP00000425906:R78W	ENSP00000369702:R78W	R	-	1	2	2	LHFPL2	77841561	77841561	0.002000	0.14202	0.906000	0.35671	0.907000	0.53573	0.772000	0.26647	0.675000	0.31264	-0.122000	0.15005	CGG	0.341021		TCGA-HZ-8005-01A-11D-2201-08	0.687	LHFPL2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369098.2	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.820000	-20.000000	1	0.360000	NM_005779		0	28	26	0	129	127	1		1	1		0	0	32	0	0	1.000000	9.968698e-01	0	10	0	35	0	28	129
RNF182	221687	broad.mit.edu	37	6	13977539	13977539	+	Silent	SNP	C	C	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr6:13977539C>G	ENST00000488300.1	+	3	712	c.189C>G	c.(187-189)gtC>gtG	p.V63V	RNF182_ENST00000537388.1_Silent_p.V63V|RNF182_ENST00000537663.1_Silent_p.V63V|RNF182_ENST00000544682.1_Silent_p.V63V	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	63					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			GTGTCATTGTCTGTCCTTTCT	0.478																																						ENST00000488300.1	1.000000	0.900000	1.000000	0.970000	0.990000	0.989885	0.990000	1.000000																										0				15						c.(187-189)gtC>gtG		ring finger protein 182							154.0	145.0	148.0					6																	13977539		2203	4300	6503	SO:0001819	synonymous_variant	221687	0	0					g.chr6:13977539C>G	AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.189C>G	chr6.hg19:g.13977539C>G		1					RNF182_ENST00000544682.1_Silent_p.V63V|RNF182_ENST00000537388.1_Silent_p.V63V|RNF182_ENST00000537663.1_Silent_p.V63V	p.V63V	NM_152737.3	NP_689950.1	2	2	4	2.340783	Q8N6D2	RN182_HUMAN	Epithelial(50;0.195)	3	712	+	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	B2RDG2|Q8NBG3	Silent	SNP	ENST00000488300.1	1	1	hg19	c.189C>G	CCDS4531.1	1																																																																																								0.435228		TCGA-HZ-8005-01A-11D-2201-08	0.478	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039911.2	1	0	1	2	2	2	2	0	0	0	0	122	122	122	121	1	1.820000	-20.000000	1	0.360000	NM_152737		0	160	160	0	808	801	1		1	0		0	0	122	0	0	1.000000	0	0	0	0	1	0	160	808
DEK	7913	broad.mit.edu	37	6	18264096	18264096	+	Missense_Mutation	SNP	C	C	G	rs147127829	byFrequency	TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr6:18264096C>G	ENST00000397239.3	-	2	570	c.123G>C	c.(121-123)gaG>gaC	p.E41D	DEK_ENST00000244776.7_Missense_Mutation_p.E41D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	41	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			cctcctcctcctcgtcgtcct	0.562			T	NUP214	AML								C|||	10	0.00199681	0.0068	0.0	5008	,	,		14423	0.0		0.0	False		,,,				2504	0.001					ENST00000397239.3	1.000000	0.180000	1.000000	0.240000	0.310000	0.460678	0.310000	0.290000				Dom	yes			Dom	yes		6	6p23	6p23	7913	T	DEK oncogene (DNA binding)				L	L	NUP214		AML		0				7						c.(121-123)gaG>gaC		DEK proto-oncogene		-	ASP/GLU,ASP/GLU	8,4398	14.3+/-33.2	0,8,2195	43.0	47.0	45.0		123,123	-3.7	0.1	6	dbSNP_134	45	0,8600		0,0,4300	yes	missense,missense	DEK	NM_001134709.1,NM_003472.3	45,45	0,8,6495	GG,GC,CC		0.0,0.1816,0.0615	benign,benign	41/342,41/376	18264096	8,12998	2203	4300	6503	SO:0001583	missense	7913	68	121406	45				g.chr6:18264096C>G	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.123G>C	chr6.hg19:g.18264096C>G	ENSP00000380414:p.Glu41Asp	1					DEK_ENST00000244776.7_Missense_Mutation_p.E41D	p.E41D	NM_003472.3	NP_003463.1	2	2	4	2.340783	P35659	DEK_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)	2	570	-	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	1	0	hg19	c.123G>C	CCDS34344.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.267	0.417416	0.11870	0.001816	0.0	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.51817	0.76;0.85;0.69	4.57	-3.65	0.04502	4.57	-3.65	0.04502	.	0.440668	0.20131	N	0.098587	T	0.09598	0.0236	L	0.48642	1.525	0.22880	N	0.998611	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38585	-0.9654	10	0.12766	T	0.61	-5.206	1.3254	0.02124	0.2162:0.3697:0.1081:0.306	.	41;41	B4DN37;P35659	.;DEK_HUMAN	D	41;41;46	ENSP00000380414:E41D;ENSP00000244776:E41D;ENSP00000423553:E46D	ENSP00000244776:E41D	E	-	3	2	2	DEK	18372075	18372075	0.003000	0.15002	0.050000	0.19076	0.529000	0.34654	-2.192000	0.01245	-1.460000	0.01911	-2.294000	0.00264	GAG	0.435228		TCGA-HZ-8005-01A-11D-2201-08	0.562	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4	1	0	0	2	2	2	2	0	0	0	0	56	56	56	58	1	1.820000	-1.187281	0	0.360000			0	20	12	0	412	425	0		1	1		0	0	56	0	0	0.999996	9.991461e-01	0	7	0	226	0	20	412
MAPK13	5603	broad.mit.edu	37	6	36098379	36098379	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr6:36098379A>G	ENST00000211287.4	+	1	282	c.20A>G	c.(19-21)aAg>aGg	p.K7R	MAPK13_ENST00000373761.6_Missense_Mutation_p.K7R|MAPK13_ENST00000373759.1_5'Flank|MAPK13_ENST00000373766.5_Missense_Mutation_p.K7R	NM_002754.4	NP_002745.1	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	7					cell cycle (GO:0007049)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 production (GO:0032755)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|prostate(2)|skin(1)	12						ATCCGGAAAAAGGGCTTCTAC	0.697																																						ENST00000211287.4	1.000000	0.060000	1.000000	0.120000	0.250000	0.404741	0.250000	0.170000																										0				12						c.(19-21)aAg>aGg		mitogen-activated protein kinase 13							28.0	27.0	27.0					6																	36098379		2199	4298	6497	SO:0001583	missense	5603	10	120424	17				g.chr6:36098379A>G	Y10488	CCDS4818.1	6p21	2011-06-09			ENSG00000156711	ENSG00000156711	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6875	protein-coding gene	gene with protein product		602899		PRKM13		9295308, 9218798	Standard	NM_002754		Approved	SAPK4, p38delta	uc003ols.4	O15264	OTTHUMG00000014587	ENST00000211287.4:c.20A>G	chr6.hg19:g.36098379A>G	ENSP00000211287:p.Lys7Arg	1					MAPK13_ENST00000373766.5_Missense_Mutation_p.K7R|MAPK13_ENST00000373759.1_5'Flank|MAPK13_ENST00000373761.6_Missense_Mutation_p.K7R	p.K7R	NM_002754.4	NP_002745.1	2	2	4	2.348148	O15264	MK13_HUMAN		1	282	+			O14739|O15124|Q5U4A5|Q6FI46|Q9UNU0	Missense_Mutation	SNP	ENST00000211287.4	1	0	hg19	c.20A>G	CCDS4818.1	0	.	.	.	.	.	.	.	.	.	.	A	6.131	0.392389	0.11638	.	.	ENSG00000156711	ENST00000373761;ENST00000211287;ENST00000373770;ENST00000373766	T;T;T	0.70869	-0.34;-0.52;-0.18	4.3	-1.34	0.09143	4.3	-1.34	0.09143	Protein kinase-like domain (1);	0.667620	0.13434	N	0.388180	T	0.26268	0.0641	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29366	-1.0014	10	0.26408	T	0.33	-6.0464	10.1854	0.42995	0.3399:0.0:0.6601:0.0	.	7	O15264	MK13_HUMAN	R	7	ENSP00000362866:K7R;ENSP00000211287:K7R;ENSP00000362871:K7R	ENSP00000211287:K7R	K	+	2	0	0	MAPK13	36206357	36206357	0.996000	0.38824	0.761000	0.31378	0.527000	0.34593	0.909000	0.28558	-0.146000	0.11274	-0.415000	0.06103	AAG	0.437016		TCGA-HZ-8005-01A-11D-2201-08	0.697	MAPK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040328.1	1	0	0	2	2	2	2	0	0	0	0	26	26	26	25	1	1.820000	-5.646289	1	0.360000			0	3	3	0	104	101	0		1	0		0	0	26	0	0	0.803465	9.388648e-01	0	0	0	188	0	3	104
PPIL1	51645	broad.mit.edu	37	6	36824364	36824364	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr6:36824364G>A	ENST00000373699.5	-	3	529	c.278C>T	c.(277-279)aCg>aTg	p.T93M	PPIL1_ENST00000483552.1_5'UTR	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1	93	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			lung(1)|ovary(1)	2						ACACTTACCCGTGAATTTCAA	0.463																																						ENST00000373699.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999969	0.990000	1.000000																										0				2						c.(277-279)aCg>aTg		peptidylprolyl isomerase (cyclophilin)-like 1							111.0	101.0	105.0					6																	36824364		2203	4300	6503	SO:0001583	missense	51645	1	121412	30				g.chr6:36824364G>A	AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.278C>T	chr6.hg19:g.36824364G>A	ENSP00000362803:p.Thr93Met	1					PPIL1_ENST00000483552.1_5'UTR	p.T93M	NM_016059.4	NP_057143.1	2	2	4	2.348148	Q9Y3C6	PPIL1_HUMAN		3	529	-			O15001|Q5TDC9	Missense_Mutation	SNP	ENST00000373699.5	1	1	hg19	c.278C>T	CCDS4826.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.079101	0.94050	.	.	ENSG00000137168	ENST00000373699	T	0.22539	1.95	5.73	5.73	0.89815	5.73	5.73	0.89815	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.44623	0.1302	M	0.84846	2.72	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	T	0.47394	-0.9121	10	0.66056	D	0.02	.	17.4578	0.87612	0.0:0.0:1.0:0.0	.	93	Q9Y3C6	PPIL1_HUMAN	M	93	ENSP00000362803:T93M	ENSP00000362803:T93M	T	-	2	0	0	PPIL1	36932342	36932342	1.000000	0.71417	0.982000	0.44146	0.989000	0.77384	9.640000	0.98453	2.719000	0.93026	0.650000	0.86243	ACG	0.437016		TCGA-HZ-8005-01A-11D-2201-08	0.463	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040382.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.820000	-3.993573	1	0.360000			0	71	70	0	247	245	1		1	1		0	0	37	0	0	1.000000	1	0	39	0	71	0	71	247
TCTE1	202500	broad.mit.edu	37	6	44255545	44255545	+	Silent	SNP	C	C	A	rs548726189		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr6:44255545C>A	ENST00000371505.4	-	2	140	c.18G>T	c.(16-18)acG>acT	p.T6T	TCTE1_ENST00000371504.1_5'Flank|TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron|TCTE1_ENST00000371503.3_5'UTR	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	6										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATGCTGATGTCGTTACGGTAT	0.562																																						ENST00000371505.4	1.000000	0.120000	1.000000	0.190000	0.270000	0.428610	0.270000	0.240000																										0				34						c.(16-18)acG>acT		t-complex-associated-testis-expressed 1							127.0	88.0	101.0					6																	44255545		2203	4300	6503	SO:0001819	synonymous_variant	202500	0	0					g.chr6:44255545C>A	BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.18G>T	chr6.hg19:g.44255545C>A		1					RP11-444E17.6_ENST00000505802.1_Intron|TCTE1_ENST00000371503.3_5'UTR|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371504.1_5'Flank	p.T6T	NM_182539.3	NP_872345.2	2	2	4	2.348148	Q5JU00	TCTE1_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)	2	140	-	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		B4DX59|Q8IYS6	Silent	SNP	ENST00000371505.4	0	1	hg19	c.18G>T	CCDS4910.1	0																																																																																								0.437016		TCGA-HZ-8005-01A-11D-2201-08	0.562	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	42	1	1.820000	-3.772004	1	0.360000	NM_182539		0	10	10	0	254	245	0		1			0	0	45	0	0	0.996468	0	0	0	0	0	0	10	254
AHR	196	broad.mit.edu	37	7	17378954	17378954	+	Missense_Mutation	SNP	C	C	A	rs533269895		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr7:17378954C>A	ENST00000242057.4	+	10	2148	c.1505C>A	c.(1504-1506)cCg>cAg	p.P502Q	AHR_ENST00000492120.1_3'UTR	NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	502					apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P502L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AATACTGCACCGATGGGAAAT	0.403																																						ENST00000242057.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999995	0.990000	1.000000																										1	Substitution - Missense(1)	p.P502L(1)	large_intestine(1)	33						c.(1504-1506)cCg>cAg		aryl hydrocarbon receptor	Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)						86.0	85.0	86.0					7																	17378954		2203	4300	6503	SO:0001583	missense	196	0	0					g.chr7:17378954C>A	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.1505C>A	chr7.hg19:g.17378954C>A	ENSP00000242057:p.Pro502Gln	1					AHR_ENST00000492120.1_3'UTR	p.P502Q	NM_001621.4	NP_001612.1	2	4	6	2.491136	P35869	AHR_HUMAN		10	2148	+	Lung NSC(10;0.0392)|all_lung(11;0.0754)		A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	1	1	hg19	c.1505C>A	CCDS5366.1	1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514694	0.27123	.	.	ENSG00000106546	ENST00000242057	T	0.05786	3.39	5.7	4.82	0.62117	5.7	4.82	0.62117	.	0.398744	0.27836	N	0.017645	T	0.25901	0.0631	M	0.86953	2.85	0.19575	N	0.999967	P	0.42556	0.783	P	0.55577	0.779	T	0.05241	-1.0897	10	0.54805	T	0.06	.	15.2134	0.73244	0.0:0.9322:0.0:0.0678	.	502	P35869	AHR_HUMAN	Q	502	ENSP00000242057:P502Q	ENSP00000242057:P502Q	P	+	2	0	0	AHR	17345479	17345479	0.480000	0.25933	0.002000	0.10522	0.004000	0.04260	6.452000	0.73485	1.548000	0.49413	0.650000	0.86243	CCG	0.473684		TCGA-HZ-8005-01A-11D-2201-08	0.403	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	1	0	1	2	24	6	2	1	1	1	1	101	101	101	101	1	1.820000	-2.612242	1	0.360000	NM_001621		0	153	150	0	640	633	1		1	1		1	0	101	0	0	1.000000	9.999977e-01	0	41	0	82	0	153	640
CALN1	83698	broad.mit.edu	37	7	71252834	71252834	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr7:71252834C>T	ENST00000329008.5	-	6	884	c.586G>A	c.(586-588)Gcc>Acc	p.A196T	CALN1_ENST00000395275.2_Missense_Mutation_p.A238T|CALN1_ENST00000431984.1_Missense_Mutation_p.A196T|CALN1_ENST00000405452.2_Missense_Mutation_p.A196T|CALN1_ENST00000395276.2_Missense_Mutation_p.A196T|CALN1_ENST00000412588.1_Missense_Mutation_p.A238T	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				ATAGCAAAGGCGCATATGAGG	0.567																																						ENST00000329008.5	1.000000	0.240000	1.000000	0.290000	0.370000	0.514755	0.370000	0.350000																										0				32						c.(586-588)Gcc>Acc		calneuron 1							128.0	100.0	109.0					7																	71252834		2203	4300	6503	SO:0001583	missense	83698	0	0					g.chr7:71252834C>T	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.586G>A	chr7.hg19:g.71252834C>T	ENSP00000332498:p.Ala196Thr	1					CALN1_ENST00000405452.2_Missense_Mutation_p.A196T|CALN1_ENST00000412588.1_Missense_Mutation_p.A238T|CALN1_ENST00000431984.1_Missense_Mutation_p.A196T|CALN1_ENST00000395275.2_Missense_Mutation_p.A238T|CALN1_ENST00000395276.2_Missense_Mutation_p.A196T	p.A196T	NM_001017440.2	NP_001017440.1	0	3	3	2.227974	Q9BXU9	CABP8_HUMAN		6	884	-		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)	J3KQA7	Missense_Mutation	SNP	ENST00000329008.5	1	1	hg19	c.586G>A	CCDS5541.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.176133	0.94846	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452	T;T;T;T;T;T	0.80123	-1.1;-1.34;-1.1;-1.1;-1.34;-1.1	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.84800	0.5552	L	0.29908	0.895	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86975	0.2100	10	0.87932	D	0	-25.7589	17.5493	0.87872	0.0:1.0:0.0:0.0	.	196;196	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	T	196;238;196;196;238;196	ENSP00000332498:A196T;ENSP00000378690:A238T;ENSP00000378691:A196T;ENSP00000410704:A196T;ENSP00000391882:A238T;ENSP00000384354:A196T	ENSP00000332498:A196T	A	-	1	0	0	CALN1	70890770	70890770	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.724000	0.84798	2.372000	0.80975	0.561000	0.74099	GCC	0.413812		TCGA-HZ-8005-01A-11D-2201-08	0.567	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320044.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.820000	-6.464724	1	0.360000	NM_031468		0	27	26	0	442	432	0		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	27	442
GJC3	349149	broad.mit.edu	37	7	99527179	99527179	+	Missense_Mutation	SNP	C	C	T	rs200074250		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr7:99527179C>T	ENST00000312891.2	-	1	64	c.65G>A	c.(64-66)cGc>cAc	p.R22H	RP4-604G5.1_ENST00000456499.1_RNA	NM_181538.2	NP_853516.1	Q8NFK1	CXG3_HUMAN	gap junction protein, gamma 3, 30.2kDa	22					cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					AAGCAAGAGGCGCCCCACGGG	0.622																																						ENST00000312891.2	1.000000	0.210000	1.000000	0.290000	0.400000	0.527307	0.400000	0.360000																										0				9						c.(64-66)cGc>cAc		gap junction protein, gamma 3, 30.2kDa		C	HIS/ARG	0,4302		0,0,2151	13.0	15.0	14.0		65	0.8	0.9	7		14	5,8459		0,5,4227	yes	missense	GJC3	NM_181538.2	29	0,5,6378	TT,TC,CC		0.0591,0.0,0.0392	benign	22/280	99527179	5,12761	2151	4232	6383	SO:0001583	missense	349149	69	120252	47				g.chr7:99527179C>T	AF503615	CCDS34697.1	7q22.1	2008-09-04	2007-11-06	2007-11-06	ENSG00000176402	ENSG00000176402		"""Ion channels / Gap junction proteins (connexins)"""	17495	protein-coding gene	gene with protein product	"""connexin 30.2"""	611925	"""gap junction protein, epsilon 1, 29kDa"""	GJE1			Standard	NM_181538		Approved	CX30.2	uc011kjd.2	Q8NFK1	OTTHUMG00000156649	ENST00000312891.2:c.65G>A	chr7.hg19:g.99527179C>T	ENSP00000325775:p.Arg22His	1					RP4-604G5.1_ENST00000456499.1_RNA	p.R22H	NM_181538.2	NP_853516.1	0	3	3	2.260329	Q8NFK1	CXG3_HUMAN		1	64	-	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)		A4D296|Q86XI9	Missense_Mutation	SNP	ENST00000312891.2	1	1	hg19	c.65G>A	CCDS34697.1	0	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179225	0.38511	0.0	5.91E-4	ENSG00000176402	ENST00000312891	D	0.99252	-5.63	4.63	0.835	0.18886	4.63	0.835	0.18886	Connexin, N-terminal (1);	0.744172	0.11452	N	0.562693	D	0.97648	0.9229	M	0.64080	1.96	0.28916	N	0.892435	B	0.26081	0.141	B	0.20184	0.028	D	0.96749	0.9552	10	0.66056	D	0.02	.	6.7104	0.23274	0.0:0.5183:0.0:0.4817	.	22	Q8NFK1	CXG3_HUMAN	H	22	ENSP00000325775:R22H	ENSP00000325775:R22H	R	-	2	0	0	GJC3	99365115	99365115	1.000000	0.71417	0.885000	0.34714	0.163000	0.22366	2.491000	0.45303	0.298000	0.22638	0.655000	0.94253	CGC	0.420500		TCGA-HZ-8005-01A-11D-2201-08	0.622	GJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345052.1	0	0	1	2	2	2	2	0	0	0	0	33	33	33	31	1	1.820000	-12.248010	1	0.360000	NM_181538		0	14	13	0	224	219	0		1			0	0	33	0	0	0.999737	0	0	0	0	0	0	14	224
ODF1	4956	broad.mit.edu	37	8	103564103	103564103	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:103564103C>A	ENST00000285402.3	+	1	304	c.148C>A	c.(148-150)Cac>Aac	p.H50N		NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	50	2 X 5 AA repeats of [RC]-C-L-C-D.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			CTGTGACTTGCACCCATATCC	0.493																																						ENST00000285402.3	1.000000	0.330000	0.500000	0.370000	0.410000	0.500891	0.410000	0.410000																										0				20						c.(148-150)Cac>Aac		outer dense fiber of sperm tails 1							401.0	312.0	342.0					8																	103564103		2203	4300	6503	SO:0001583	missense	4956	0	0					g.chr8:103564103C>A	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.148C>A	chr8.hg19:g.103564103C>A	ENSP00000285402:p.His50Asn	0						p.H50N	NM_024410.3	NP_077721.2	1	2	3	2.149319	Q14990	ODFP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)	1	304	+	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	1	1	hg19	c.148C>A	CCDS6293.1	0	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275978	0.80580	.	.	ENSG00000155087	ENST00000285402	T	0.39406	1.08	5.83	5.83	0.93111	5.83	5.83	0.93111	.	0.000000	0.56097	D	0.000022	T	0.44052	0.1275	N	0.08118	0	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	T	0.53464	-0.8435	10	0.87932	D	0	-42.5575	15.6153	0.76760	0.0:1.0:0.0:0.0	.	50	Q14990	ODFP1_HUMAN	N	50	ENSP00000285402:H50N	ENSP00000285402:H50N	H	+	1	0	0	ODF1	103633279	103633279	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.754000	0.55189	2.750000	0.94351	0.655000	0.94253	CAC	0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.493	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1	1	0	1	2	2	2	2	0	0	0	0	225	225	225	220	1	1.820000	-19.273470	1	0.360000			0	117	115	0	1529	1507	0		1			0	0	225	0	0	1.000000	0	0	0	0	0	0	117	1529
ENY2	56943	broad.mit.edu	37	8	110348356	110348356	+	Splice_Site	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:110348356G>A	ENST00000520147.1	+	2	63		c.e2-1		ENY2_ENST00000522407.1_Intron|ENY2_ENST00000521662.1_Splice_Site|NUDCD1_ENST00000239690.4_5'Flank|ENY2_ENST00000521688.1_Splice_Site					enhancer of yellow 2 homolog (Drosophila)											endometrium(2)|large_intestine(1)|lung(1)	4	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;9.05e-13)			TTGATGTCCAGGTTAGCAAGA	0.363																																						ENST00000520147.1	1.000000	0.630000	1.000000	0.760000	0.920000	0.898633	0.920000	1.000000																										0				4						c.e2-1		enhancer of yellow 2 homolog (Drosophila)							98.0	95.0	96.0					8																	110348356		1925	4125	6050	SO:0001630	splice_region_variant	56943	0	0					g.chr8:110348356G>A		CCDS43762.1, CCDS55270.1	8q23.1	2005-08-16			ENSG00000120533	ENSG00000120533			24449	protein-coding gene	gene with protein product						11438676	Standard	NM_020189		Approved	DC6, FLJ20480	uc003ynd.3	Q9NPA8	OTTHUMG00000164933	ENST00000520147.1:c.-9-1G>A	chr8.hg19:g.110348356G>A		0					ENY2_ENST00000521662.1_Splice_Site|ENY2_ENST00000522407.1_Intron|NUDCD1_ENST00000239690.4_5'Flank|ENY2_ENST00000521688.1_Splice_Site				1	2	3	2.149319			OV - Ovarian serous cystadenocarcinoma(57;9.05e-13)	2	63	+	all_neural(195;0.219)			Splice_Site	SNP	ENST00000520147.1	1	1	hg19			1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400636	0.62177	.	.	ENSG00000120533	ENST00000521688	.	.	.	5.34	4.41	0.53225	5.34	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2373	0.65934	0.0:0.15:0.85:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ENY2	110417532	110417532	0.999000	0.42202	1.000000	0.80357	0.976000	0.68499	0.882000	0.28186	2.473000	0.83533	0.655000	0.94253	.	0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.363	ENY2-012	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000381006.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.820000	-20.000000	1	0.360000	NM_020189	Intron	0	31	31	0	169	168	1		1	1		0	0	18	0	0	1.000000	7.642597e-01	0	12	0	5	0	31	169
DLGAP2	9228	broad.mit.edu	37	8	1497636	1497636	+	Silent	SNP	C	C	T	rs374818528		TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:1497636C>T	ENST00000421627.2	+	2	911	c.777C>T	c.(775-777)tcC>tcT	p.S259S		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	338					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GGGACCTGTCCCTCAAGACCT	0.662																																						ENST00000421627.2	0.190000	0.060000	0.150000	0.080000	0.110000	0.122081	0.110000	0.110000																										0				41						c.(775-777)tcC>tcT		discs, large (Drosophila) homolog-associated protein 2		C		1,4223		0,1,2111	50.0	58.0	55.0		777	-8.7	0.1	8		55	8,8492		0,8,4242	no	coding-synonymous	DLGAP2	NM_004745.3		0,9,6353	TT,TC,CC		0.0941,0.0237,0.0707		259/976	1497636	9,12715	2112	4250	6362	SO:0001819	synonymous_variant	9228	33	121092	49				g.chr8:1497636C>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.777C>T	chr8.hg19:g.1497636C>T		1						p.S259S	NM_004745.3	NP_004736.2	0	1	1	1.705796	Q9P1A6	DLGP2_HUMAN		2	911	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	0	1	hg19	c.777C>T	CCDS47760.1	0	.	.	.	.	.	.	.	.	.	.	C	6.784	0.513698	0.12944	2.37E-4	9.41E-4	ENSG00000198010	ENST00000520901	.	.	.	5.3	-8.73	0.00841	5.3	-8.73	0.00841	.	.	.	.	.	T	0.51890	0.1701	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61720	-0.7005	4	.	.	.	-9.8398	12.3303	0.55035	0.6041:0.1817:0.2142:0.0	.	.	.	.	L	276	.	.	P	+	2	0	0	DLGAP2	1485043	1485043	0.000000	0.05858	0.113000	0.21522	0.613000	0.37349	-1.696000	0.01912	-1.352000	0.02194	-0.152000	0.13540	CCC	0.221222		TCGA-HZ-8005-01A-11D-2201-08	0.662	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.820000	-2.974017	1	0.360000	NM_004745		0	13	14	0	505	499	0		1			0	0	107	0	0	0.999512	0	0	0	0	0	0	13	505
RP1	6101	broad.mit.edu	37	8	55541791	55541791	+	Silent	SNP	A	A	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:55541791A>G	ENST00000220676.1	+	4	5497	c.5349A>G	c.(5347-5349)gtA>gtG	p.V1783V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1783					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCAGTGAGGTACCATATTCAC	0.443																																					Colon(91;1014 1389 7634 14542 40420)	ENST00000220676.1	1.000000	0.140000	0.470000	0.190000	0.270000	0.379424	0.270000	0.250000																										0				169						c.(5347-5349)gtA>gtG		retinitis pigmentosa 1 (autosomal dominant)							83.0	82.0	82.0					8																	55541791		2203	4300	6503	SO:0001819	synonymous_variant	6101	0	0					g.chr8:55541791A>G	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5349A>G	chr8.hg19:g.55541791A>G		0						p.V1783V	NM_006269.1	NP_006260.1	1	2	3	2.149319	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)	4	5497	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)		Silent	SNP	ENST00000220676.1	1	1	hg19	c.5349A>G	CCDS6160.1	0																																																																																								0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.443	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	1	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	1.820000	-13.861650	1	0.360000	NM_006269		0	12	12	0	263	257	0		1			0	0	35	0	0	0.999054	0	0	0	0	0	0	12	263
STAU2	27067	broad.mit.edu	37	8	74516052	74516052	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:74516052G>A	ENST00000521451.1	-	5	654	c.278C>T	c.(277-279)gCg>gTg	p.A93V	STAU2_ENST00000522509.1_Missense_Mutation_p.A281V|STAU2_ENST00000523558.1_Missense_Mutation_p.A141V|STAU2_ENST00000517542.1_Missense_Mutation_p.A275V|STAU2_ENST00000524300.1_Missense_Mutation_p.A313V|STAU2_ENST00000355780.5_Missense_Mutation_p.A281V|STAU2_ENST00000521727.1_Missense_Mutation_p.A293V|STAU2_ENST00000521210.1_Missense_Mutation_p.A209V|STAU2_ENST00000522695.1_Missense_Mutation_p.A281V|STAU2_ENST00000519961.1_Missense_Mutation_p.A313V			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	313					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TTGAATTTGCGCCAGGCGGCT	0.403																																						ENST00000521451.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999987	0.990000	1.000000																										0				19						c.(277-279)gCg>gTg		staufen double-stranded RNA binding protein 2							58.0	57.0	57.0					8																	74516052		2203	4300	6503	SO:0001583	missense	27067	3	121412	36				g.chr8:74516052G>A	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521451.1:c.278C>T	chr8.hg19:g.74516052G>A	ENSP00000428476:p.Ala93Val	0					STAU2_ENST00000355780.5_Missense_Mutation_p.A281V|STAU2_ENST00000523558.1_Missense_Mutation_p.A141V|STAU2_ENST00000522695.1_Missense_Mutation_p.A281V|STAU2_ENST00000524300.1_Missense_Mutation_p.A313V|STAU2_ENST00000519961.1_Missense_Mutation_p.A313V|STAU2_ENST00000517542.1_Missense_Mutation_p.A275V|STAU2_ENST00000521210.1_Missense_Mutation_p.A209V|STAU2_ENST00000522509.1_Missense_Mutation_p.A281V|STAU2_ENST00000521727.1_Missense_Mutation_p.A293V	p.A93V			1	2	3	2.149319	Q9NUL3	STAU2_HUMAN	Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)	5	654	-	Breast(64;0.0138)		B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	ENST00000521451.1	1	1	hg19	c.278C>T		1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732859	0.89482	.	.	ENSG00000040341	ENST00000522695;ENST00000524300;ENST00000523558;ENST00000521210;ENST00000355780;ENST00000519961;ENST00000521727;ENST00000521451;ENST00000522509;ENST00000517542;ENST00000518767	T;T;T;T;T;T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	5.73	5.73	0.89815	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.80757	0.4684	N	0.17674	0.51	0.80722	D	1	P;D;D;D;P;D;D;D	0.89917	0.951;0.968;1.0;0.968;0.842;0.999;1.0;0.995	B;P;D;P;B;D;D;D	0.91635	0.32;0.63;0.999;0.503;0.214;0.995;0.996;0.932	T	0.76694	-0.2865	10	0.20519	T	0.43	-21.0875	19.8791	0.96888	0.0:0.0:1.0:0.0	.	293;209;141;209;281;313;281;313	E7EPX0;E9PEI3;E7ER74;B7Z8B4;F8VPI7;E7EVJ4;E9PH62;E9PF26	.;.;.;.;.;.;.;.	V	281;313;141;209;281;313;293;93;281;275;141	ENSP00000428456:A281V;ENSP00000428756:A313V;ENSP00000428741:A141V;ENSP00000429173:A209V;ENSP00000348026:A281V;ENSP00000430907:A313V;ENSP00000429973:A293V;ENSP00000428476:A93V;ENSP00000427977:A281V;ENSP00000431111:A275V;ENSP00000429005:A141V	ENSP00000344030:A141V	A	-	2	0	0	STAU2	74678606	74678606	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.218000	0.95166	2.706000	0.92434	0.585000	0.79938	GCG	0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.403	STAU2-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000379006.4	1	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.820000	-4.790735	1	0.360000	NM_001164380		0	87	85	0	272	271	1		1	1		0	0	57	0	0	1.000000	9.999992e-01	0	24	0	43	0	87	272
FABP12	646486	broad.mit.edu	37	8	82439272	82439272	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:82439272C>T	ENST00000360464.4	-	3	393	c.331G>A	c.(331-333)Gat>Aat	p.D111N	RP11-257P3.3_ENST00000523380.1_RNA|RP11-257P3.3_ENST00000518637.1_RNA	NM_001105281.1	NP_001098751.1	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12	111							lipid binding (GO:0008289)|transporter activity (GO:0005215)			large_intestine(1)|lung(3)	4						ATTTTCCCATCCACCAGCTTT	0.413																																						ENST00000360464.4	1.000000	0.210000	0.850000	0.320000	0.460000	0.538200	0.460000	0.410000																										0				4						c.(331-333)Gat>Aat		fatty acid binding protein 12							89.0	84.0	86.0					8																	82439272		1917	4140	6057	SO:0001583	missense	646486	0	0					g.chr8:82439272C>T		CCDS47882.1	8q21.13	2013-03-01			ENSG00000197416	ENSG00000197416		"""Fatty acid binding protein family"""	34524	protein-coding gene	gene with protein product						18786628	Standard	NM_001105281		Approved		uc011lfp.2	A6NFH5	OTTHUMG00000164679	ENST00000360464.4:c.331G>A	chr8.hg19:g.82439272C>T	ENSP00000353650:p.Asp111Asn	0					RP11-257P3.3_ENST00000523380.1_RNA|RP11-257P3.3_ENST00000518637.1_RNA	p.D111N	NM_001105281.1	NP_001098751.1	1	2	3	2.149319	A6NFH5	FBP12_HUMAN		3	393	-			B7SUN0	Missense_Mutation	SNP	ENST00000360464.4	1	1	hg19	c.331G>A	CCDS47882.1	0	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385251	0.61956	.	.	ENSG00000197416	ENST00000360464	T	0.08282	3.11	5.18	5.18	0.71444	5.18	5.18	0.71444	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.154736	0.56097	D	0.000026	T	0.11495	0.0280	L	0.52823	1.66	0.50467	D	0.999878	B	0.10296	0.003	B	0.17979	0.02	T	0.02417	-1.1162	10	0.54805	T	0.06	.	14.592	0.68373	0.1464:0.8536:0.0:0.0	.	111	A6NFH5	FBP12_HUMAN	N	111	ENSP00000353650:D111N	ENSP00000353650:D111N	D	-	1	0	0	FABP12	82601827	82601827	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.114000	0.64648	2.679000	0.91253	0.655000	0.94253	GAT	0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.413	FABP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379720.1	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	1.820000	-5.416659	1	0.360000	NM_001105281		0	8	8	0	102	99	0		1			0	0	26	0	0	0.989069	0	0	0	0	0	0	8	102
LRRCC1	85444	broad.mit.edu	37	8	86038981	86038981	+	Missense_Mutation	SNP	G	G	A	rs201242609	byFrequency	TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:86038981G>A	ENST00000360375.3	+	9	1479	c.1330G>A	c.(1330-1332)Gaa>Aaa	p.E444K	LRRCC1_ENST00000414626.2_Missense_Mutation_p.E424K	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	444					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						TGAGCAAGCCGAAAATAAACT	0.373													G|||	16	0.00319489	0.0113	0.0014	5008	,	,		18373	0.0		0.0	False		,,,				2504	0.0					ENST00000360375.3	1.000000	0.780000	1.000000	0.880000	0.990000	0.958901	0.990000	1.000000																										0				43						c.(1330-1332)Gaa>Aaa		leucine rich repeat and coiled-coil centrosomal protein 1		G	LYS/GLU	22,3698		0,22,1838	78.0	76.0	76.0		1330	5.6	1.0	8		76	2,8204		0,2,4101	yes	missense	LRRCC1	NM_033402.4	56	0,24,5939	AA,AG,GG		0.0244,0.5914,0.2012	possibly-damaging	444/1033	86038981	24,11902	1860	4103	5963	SO:0001583	missense	85444	112	120822	51				g.chr8:86038981G>A	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1330G>A	chr8.hg19:g.86038981G>A	ENSP00000353538:p.Glu444Lys	0					LRRCC1_ENST00000414626.2_Missense_Mutation_p.E424K	p.E444K	NM_033402.4	NP_208325.3	1	2	3	2.149319	Q9C099	LRCC1_HUMAN		9	1479	+			B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	1	0	hg19	c.1330G>A	CCDS43750.1	1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	26.0	4.693391	0.88735	0.005914	2.44E-4	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.32272	1.46;1.47	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.000000	0.36893	N	0.002360	T	0.41026	0.1141	M	0.66939	2.045	0.43003	D	0.994525	D;D;D;D	0.89917	0.999;0.999;1.0;0.99	D;D;D;P	0.65010	0.915;0.931;0.915;0.596	T	0.39742	-0.9599	10	0.05721	T	0.95	-23.8999	19.1212	0.93364	0.0:0.0:1.0:0.0	.	351;424;351;444	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	K	444;424	ENSP00000353538:E444K;ENSP00000394695:E424K	ENSP00000353538:E444K	E	+	1	0	0	LRRCC1	86226233	86226233	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.892000	0.69790	2.632000	0.89209	0.655000	0.94253	GAA	0.382239		TCGA-HZ-8005-01A-11D-2201-08	0.373	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.820000	-3.065198	1	0.360000	NM_033402		0	61	58	0	294	278	1		1	1		0	0	76	0	0	1.000000	9.818066e-01	0	8	0	25	0	61	294
ZFAT	57623	broad.mit.edu	37	8	135545161	135545161	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr8:135545161G>A	ENST00000377838.3	-	12	3205	c.3031C>T	c.(3031-3033)Cgg>Tgg	p.R1011W	ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000429442.2_Missense_Mutation_p.R999W|ZFAT_ENST00000523399.1_Missense_Mutation_p.R949W|ZFAT_ENST00000520727.1_Missense_Mutation_p.R999W|ZFAT_ENST00000520214.1_Missense_Mutation_p.R999W|ZFAT_ENST00000520356.1_Missense_Mutation_p.R999W	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1011					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TTGTAGTGCCGCTTCAGAGAG	0.592																																						ENST00000377838.3	0.550000	0.070000	0.390000	0.140000	0.240000	0.272615	0.240000	0.210000																										0				54						c.(3031-3033)Cgg>Tgg		zinc finger and AT hook domain containing							62.0	64.0	63.0					8																	135545161		2064	4173	6237	SO:0001583	missense	57623	2	120956	24				g.chr8:135545161G>A	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3031C>T	chr8.hg19:g.135545161G>A	ENSP00000367069:p.Arg1011Trp	1					ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000520214.1_Missense_Mutation_p.R999W|ZFAT_ENST00000429442.2_Missense_Mutation_p.R999W|ZFAT_ENST00000523399.1_Missense_Mutation_p.R949W|ZFAT_ENST00000520356.1_Missense_Mutation_p.R999W|ZFAT_ENST00000520727.1_Missense_Mutation_p.R999W	p.R1011W	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	0	1	1	1.700728	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)	12	3205	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	0	1	hg19	c.3031C>T	CCDS47924.1	0	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827545	0.71143	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.38	0.744	0.18353	5.38	0.744	0.18353	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	M	0.80847	2.515	0.51233	D	0.999912	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;1.0	T	0.63014	-0.6731	10	0.72032	D	0.01	-26.6419	14.7157	0.69265	0.0:0.0:0.3889:0.6111	.	130;949;999;1011	B7Z741;E9PER3;E9PBN4;Q9P243	.;.;.;ZFAT_HUMAN	W	999;999;999;1011;999;898;949	ENSP00000427879:R999W;ENSP00000427831:R999W;ENSP00000394501:R999W;ENSP00000367069:R1011W;ENSP00000428483:R999W;ENSP00000429091:R949W	ENSP00000326997:R898W	R	-	1	2	2	ZFAT	135614343	135614343	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	1.461000	0.35255	0.203000	0.20529	0.585000	0.79938	CGG	0.219512		TCGA-HZ-8005-01A-11D-2201-08	0.592	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	0	0	0	2	2	2	2	0	0	0	0	18	18	18	18	1	1.820000	-4.012111	1	0.360000	NM_001029939		0	3	3	0	58	57	0		1	0		0	0	18	0	0	0.807313	1.388047e-01	0	0	0	10	0	3	58
TLR4	7099	broad.mit.edu	37	9	120475078	120475078	+	Silent	SNP	A	A	G			TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chr9:120475078A>G	ENST00000355622.6	+	3	773	c.672A>G	c.(670-672)aaA>aaG	p.K224K	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Silent_p.K184K	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	224					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GTGCATTTAAAGAAATTAGGC	0.373																																						ENST00000355622.6	0.580000	0.310000	0.520000	0.370000	0.440000	0.450108	0.440000	0.440000																										0				103						c.(670-672)aaA>aaG		toll-like receptor 4	Naloxone(DB01183)						51.0	56.0	54.0					9																	120475078		2186	4296	6482	SO:0001819	synonymous_variant	7099	0	0					g.chr9:120475078A>G	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.672A>G	chr9.hg19:g.120475078A>G		1					TLR4_ENST00000394487.4_Silent_p.K184K|TLR4_ENST00000472304.1_3'UTR	p.K224K	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	0	1	1	1.683078	O00206	TLR4_HUMAN		3	773	+			A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Silent	SNP	ENST00000355622.6	1	1	hg19	c.672A>G	CCDS6818.1	0																																																																																								0.219512		TCGA-HZ-8005-01A-11D-2201-08	0.373	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	1	0	1	2	2	2	2	0	0	0	0	81	81	81	81	1	1.820000	-20.000000	1	0.360000	NM_138554		0	37	37	0	342	337	0		1	0		0	0	81	0	0	1.000000	4.454561e-01	0	0	0	15	0	37	342
GPRASP1	9737	broad.mit.edu	37	X	101910080	101910080	+	Silent	SNP	C	C	T	rs144058687	byFrequency	TCGA-HZ-8005-01A-11D-2201-08	TCGA-HZ-8005-10A-01D-2201-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d5e58f9b-f9f5-4dea-a34a-bb940edba3cc	fe7724ac-a5b6-4031-85fb-6ae0cde16caf	g.chrX:101910080C>T	ENST00000361600.5	+	5	2040	c.1239C>T	c.(1237-1239)gaC>gaT	p.D413D	GPRASP1_ENST00000415986.1_Silent_p.D413D|GPRASP1_ENST00000444152.1_Silent_p.D413D|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Silent_p.D413D	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	413					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGGCTACAGACGAGTCCAGCA	0.542													c|||	1	0.000264901	0.0008	0.0	3775	,	,		13334	0.0		0.0	False		,,,				2504	0.0					ENST00000361600.5	0.990000	0.740000	0.940000	0.810000	0.870000	0.879308	0.870000	0.880000																										0				60						c.(1237-1239)gaC>gaT		G protein-coupled receptor associated sorting protein 1			,,,,	3,3832		0,2,1,1630,570	64.0	65.0	65.0		1239,1239,1239,,1239	-4.9	0.0	X	dbSNP_134	65	0,6728		0,0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous	GPRASP1,ARMCX5-GPRASP2	NM_001099410.1,NM_001099411.1,NM_001184727.1,NM_001199818.1,NM_014710.4	,,,,	0,2,1,4058,2442	TT,TC,T,CC,C		0.0,0.0782,0.0284	,,,,	413/1396,413/1396,413/1396,,413/1396	101910080	3,10560	2203	4300	6503	SO:0001819	synonymous_variant	9737	6	121410	38				g.chrX:101910080C>T	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1239C>T	chrX.hg19:g.101910080C>T							GPRASP1_ENST00000415986.1_Silent_p.D413D|GPRASP1_ENST00000444152.1_Silent_p.D413D|GPRASP1_ENST00000537097.1_Silent_p.D413D|RP4-769N13.7_ENST00000602441.1_RNA	p.D413D	NM_014710.4	NP_055525.3	0	1	1		Q5JY77	GASP1_HUMAN		5	2040	+			O43168|Q96LA1	Silent	SNP	ENST00000361600.5	1	1	hg19	c.1239C>T	CCDS35352.1	1																																																																																								0.360000		TCGA-HZ-8005-01A-11D-2201-08	0.542	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	1	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	1.820000	-20.000000	1	0.360000	NM_014710		0	112	111	0	238	234	1		1	0		0	0	53	0	0	1.000000	7.107674e-01	0	0	0	7	0	112	238
