#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SLC4A1	6521	broad.mit.edu	37	17	42330701	42330701	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr17:42330701delC	ENST00000262418.6	-	17	2251	c.2096delG	c.(2095-2097)ggcfs	p.G699fs		NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	699	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GAAGCCGGAGCCCTTGACCAT	0.637																																						ENST00000262418.6	1.000000	0.650000	1	7.600000e-01	0.890000	0.884479	0.890000	1.000000																										0				40						c.(2095-2097)ggcfs		solute carrier family 4 (anion exchanger), member 1 (Diego blood group)							88.0	82.0	84.0					17																	42330701		2203	4300	6503	SO:0001589	frameshift_variant	6521	0	0					g.chr17:42330701delC		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2096delG	chr17.hg19:g.42330701delC	ENSP00000262418:p.Gly699fs	0						p.G699fs	NM_000342.3	NP_000333.1	1	2	3	2.028634	P02730	B3AT_HUMAN		17	2251	-		Breast(137;0.014)|Prostate(33;0.0181)	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Frame_Shift_Del	DEL	ENST00000262418.6	1	0	hg19	c.2096delG	CCDS11481.1	1																																																																																								0.273921		TCGA-HZ-8315-01A-11D-2396-08	0.637	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	1	0	1		30			0	0	0	3	63	0	63	65	1	1.940000	-20.000000	1	0.270000	NM_000342		0	40	49	0	295	293	0	0	1			0	0	63	0	0	0.928932			0	0	0	0	40	295
ARID1A	8289	broad.mit.edu	37	1	27058070	27058070	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:27058070delC	ENST00000324856.7	+	3	2149	c.1778delC	c.(1777-1779)tccfs	p.S593fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.S593fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.S210fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	593					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACTGCCTATTCCCAGCAGCGC	0.587			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	ENST00000324856.7	1.000000	0.650000	8.800000e-01	7.200000e-01	0.790000	0.804669	0.790000	0.790000				Rec	yes			Rec	yes		1	1p35.3	1p35.3	8289	Mis, N, F, S, D	AT rich interactive domain 1A (SWI-like)				E	E			clear cell ovarian carcinoma, RCC	ARID1A/MAST2_ENST00000361297(2)	0				411						c.(1777-1779)tccfs		AT rich interactive domain 1A (SWI-like)							117.0	113.0	114.0					1																	27058070		2203	4300	6503	SO:0001589	frameshift_variant	8289	0	0					g.chr1:27058070delC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1778delC	chr1.hg19:g.27058070delC	ENSP00000320485:p.Ser593fs	0					ARID1A_ENST00000374152.2_Frame_Shift_Del_p.S210fs|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.S593fs	p.S593fs	NM_006015.4	NP_006006.3	1	2	3	2.037843	O14497	ARI1A_HUMAN		3	2149	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	1	0	hg19	c.1778delC	CCDS285.1	0																																																																																								0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.587	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	1	0	1		62	2	2	0	0	0	6	160	0	160	156	1	1.940000	-3.318794	1	0.270000	NM_139135		0	113	143	0	953	946	0	0	1	1	1	0	0	160	539	0	0.999990	9.953671e-01	1	4	85	65	643	113	953
ACVR2A	92	broad.mit.edu	37	2	148657137	148657138	+	Splice_Site	INS	-	-	T	rs367638423		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			-	T	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr2:148657137_148657138insT	ENST00000241416.7	+	3	1009		c.e3+1		ACVR2A_ENST00000404590.1_Splice_Site|ACVR2A_ENST00000535787.1_Splice_Site|AC009480.3_ENST00000402410.2_RNA	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA						activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GTCACACAGCGTAAGTTCACAG	0.366																																						ENST00000241416.7	0.950000	0.700000	8.900000e-01	7.500000e-01	0.810000	0.825991	0.810000	0.820000																										0				45						c.e3+1		activin A receptor, type IIA																																				SO:0001630	splice_region_variant	92	0	0					g.chr2:148657137_148657138insT		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.373+1->T	chr2.hg19:g.148657138_148657138dupT		0					ACVR2A_ENST00000404590.1_Splice_Site|AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000535787.1_Splice_Site		NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	1	2	3	2.018485	P27037	AVR2A_HUMAN		3	1009	+			B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Splice_Site	INS	ENST00000241416.7	0	1	hg19		CCDS33301.1	0																																																																																								0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.366	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	1	0	1		2	2	2	0	0	0	0	227	0	227	222	1	1.940000	-20.000000	1	0.270000	NM_001616	Intron	0	157	158	0	1257	1241	0	0	1	0	1	0	0	227	272	0	1.000000	8.722748e-01	1	0	51	31	388	157	1257
SLC22A7	10864	broad.mit.edu	37	6	43269953	43269955	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr6:43269953_43269955delCTC	ENST00000372585.5	+	8	1172_1174	c.1077_1079delCTC	c.(1075-1080)ttctcc>ttc	p.S360del	SLC22A7_ENST00000372589.3_In_Frame_Del_p.S358del|SLC22A7_ENST00000372574.3_In_Frame_Del_p.S358del	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	360					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GAGTGAACTTCTCCTATTACGGC	0.562																																						ENST00000372585.5	0.840000	0.450000	7.400000e-01	5.400000e-01	0.630000	0.648278	0.630000	0.640000																										0				26						c.(1075-1080)ttctcc>ttc		solute carrier family 22 (organic anion transporter), member 7	Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)																																			SO:0001651	inframe_deletion	10864	0	0					g.chr6:43269953_43269955delCTC	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1077_1079delCTC	chr6.hg19:g.43269953_43269955delCTC	ENSP00000361666:p.Ser360del	1					SLC22A7_ENST00000372589.3_In_Frame_Del_p.S358del|SLC22A7_ENST00000372574.3_In_Frame_Del_p.S358del	p.S360del	NM_153320.2	NP_696961.2	0	1	1	1.758375	Q9Y694	S22A7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)	8	1172_1174	+			B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	In_Frame_Del	DEL	ENST00000372585.5	0	1	hg19	c.1077_1079delCTC	CCDS4893.2	0																																																																																								0.156069		TCGA-HZ-8315-01A-11D-2396-08	0.562	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1	1	0	1		18			0	0	0	1	69	0	69	71	1	1.940000	-13.052940	1	0.270000			0	36	48	0	322	332	0	0	1			0	0	69	0	0	0.998276			0	0	0	0	36	322
DCHS1	8642	broad.mit.edu	37	11	6661892	6661892	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr11:6661892C>T	ENST00000299441.3	-	2	1364	c.953G>A	c.(952-954)cGg>cAg	p.R318Q		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	318	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCCAGTGGCCGCTCTAACTG	0.612																																						ENST00000299441.3	1.000000	0.790000	1	8.900000e-01	0.990000	0.960785	0.990000	1.000000																										0				103						c.(952-954)cGg>cAg		dachsous cadherin-related 1							99.0	93.0	95.0					11																	6661892		2201	4296	6497	SO:0001583	missense	8642	0	0					g.chr11:6661892C>T	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.953G>A	chr11.hg19:g.6661892C>T	ENSP00000299441:p.Arg318Gln	0						p.R318Q	NM_003737.2	NP_003728.1	1	2	3	2.022644	Q96JQ0	PCD16_HUMAN		2	1364	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	O15098	Missense_Mutation	SNP	ENST00000299441.3	1	1	hg19	c.953G>A	CCDS7771.1	1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.498727	0.64298	.	.	ENSG00000166341	ENST00000299441	T	0.52295	0.67	5.14	5.14	0.70334	5.14	5.14	0.70334	Cadherin (4);Cadherin-like (1);	0.000000	0.42964	D	0.000628	T	0.35098	0.0920	L	0.28649	0.875	0.31682	N	0.643017	P	0.47545	0.897	P	0.45343	0.477	T	0.32107	-0.9919	10	0.17832	T	0.49	.	7.5326	0.27691	0.0:0.8152:0.0:0.1848	.	318	Q96JQ0	PCD16_HUMAN	Q	318	ENSP00000299441:R318Q	ENSP00000299441:R318Q	R	-	2	0	0	DCHS1	6618468	6618468	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	2.706000	0.47135	2.381000	0.81170	0.637000	0.83480	CGG	0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.612	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	76	1	1.940000	-3.221907	1	0.270000	NM_003737		0	72	64	0	461	408	1		1	0		0	0	93	0	0	1.000000	6.911029e-01	0	0	0	17	0	72	461
PTPN6	5777	broad.mit.edu	37	12	7061156	7061156	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:7061156C>G	ENST00000318974.9	+	3	386	c.142C>G	c.(142-144)Cag>Gag	p.Q48E	PTPN6_ENST00000456013.1_Missense_Mutation_p.Q48E|PTPN6_ENST00000399448.1_Missense_Mutation_p.Q50E|PTPN6_ENST00000447931.2_Missense_Mutation_p.Q9E	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	48	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						GGTGGGGGATCAGGTGACCCA	0.597																																						ENST00000318974.9	0.910000	0.370000	7.700000e-01	4.800000e-01	0.610000	0.630208	0.610000	0.600000																										0				18						c.(142-144)Cag>Gag		protein tyrosine phosphatase, non-receptor type 6							55.0	63.0	60.0					12																	7061156		2149	4276	6425	SO:0001583	missense	5777	0	0					g.chr12:7061156C>G		CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.142C>G	chr12.hg19:g.7061156C>G	ENSP00000326010:p.Gln48Glu	0					PTPN6_ENST00000447931.2_Missense_Mutation_p.Q9E|PTPN6_ENST00000399448.1_Missense_Mutation_p.Q50E|PTPN6_ENST00000456013.1_Missense_Mutation_p.Q48E	p.Q48E	NM_002831.5	NP_002822.2	0	1	1	2.010562	P29350	PTN6_HUMAN		3	386	+			A8K306|G3V0F8|Q969V8|Q9UK67	Missense_Mutation	SNP	ENST00000318974.9	0	1	hg19	c.142C>G	CCDS44820.1	0	.	.	.	.	.	.	.	.	.	.	C	1.112	-0.657924	0.03454	.	.	ENSG00000111679	ENST00000543115;ENST00000399448;ENST00000447931;ENST00000538715;ENST00000318974;ENST00000456013;ENST00000536521;ENST00000541698;ENST00000542462	D;D;D;D;D;D;D;D;D	0.96365	-2.33;-2.33;-3.99;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	4.75	3.85	0.44370	4.75	3.85	0.44370	SH2 motif (5);	0.577535	0.17289	N	0.179712	T	0.82125	0.4969	N	0.00560	-1.38	0.09310	N	0.999992	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.001;0.001	T	0.72994	-0.4122	10	0.02654	T	1	.	8.6522	0.34042	0.0:0.766:0.1536:0.0804	.	36;9;48;48;50	B4DPS0;P29350-2;G3V0F8;P29350;Q53XS4	.;.;.;PTN6_HUMAN;.	E	69;50;9;48;48;48;48;48;7	ENSP00000443393:Q69E;ENSP00000382376:Q50E;ENSP00000415979:Q9E;ENSP00000438740:Q48E;ENSP00000326010:Q48E;ENSP00000391592:Q48E;ENSP00000444337:Q48E;ENSP00000445646:Q48E;ENSP00000440114:Q7E	ENSP00000326010:Q48E	Q	+	1	0	0	PTPN6	6931417	6931417	0.632000	0.27172	0.990000	0.47175	0.986000	0.74619	1.392000	0.34486	0.981000	0.38548	0.561000	0.74099	CAG	0.268024		TCGA-HZ-8315-01A-11D-2396-08	0.597	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400023.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.940000	-19.998700	1	0.270000	NM_002831		0	17	17	0	189	188	0		1	1		0	0	30	0	0	0.999971	9.959320e-01	0	21	0	82	0	17	189
PTPN6	5777	broad.mit.edu	37	12	7061302	7061302	+	Silent	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:7061302C>T	ENST00000318974.9	+	3	532	c.288C>T	c.(286-288)ctC>ctT	p.L96L	PTPN6_ENST00000456013.1_Silent_p.L96L|PTPN6_ENST00000399448.1_Silent_p.L98L|PTPN6_ENST00000447931.2_Silent_p.L57L	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	96	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						TCATCCACCTCAAGTACCCGC	0.612																																						ENST00000318974.9	1.000000	0.750000	1	8.600000e-01	0.970000	0.945024	0.970000	1.000000																										0				18						c.(286-288)ctC>ctT		protein tyrosine phosphatase, non-receptor type 6							98.0	112.0	107.0					12																	7061302		2193	4285	6478	SO:0001819	synonymous_variant	5777	0	0					g.chr12:7061302C>T		CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.288C>T	chr12.hg19:g.7061302C>T		0					PTPN6_ENST00000447931.2_Silent_p.L57L|PTPN6_ENST00000399448.1_Silent_p.L98L|PTPN6_ENST00000456013.1_Silent_p.L96L	p.L96L	NM_002831.5	NP_002822.2	0	1	1	2.010562	P29350	PTN6_HUMAN		3	532	+			A8K306|G3V0F8|Q969V8|Q9UK67	Silent	SNP	ENST00000318974.9	1	1	hg19	c.288C>T	CCDS44820.1	1																																																																																								0.268024		TCGA-HZ-8315-01A-11D-2396-08	0.612	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400023.1	1	0	1	2	2	2	2	0	0	0	0	102	102	102	101	1	1.940000	-2.966662	1	0.270000	NM_002831		0	59	59	0	386	384	1		1	1		0	0	102	0	0	1.000000	9.999031e-01	0	11	0	79	0	59	386
C1S	716	broad.mit.edu	37	12	7173836	7173836	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:7173836A>G	ENST00000406697.1	+	11	1514	c.886A>G	c.(886-888)Aag>Gag	p.K296E	C1S_ENST00000360817.5_Missense_Mutation_p.K296E|C1S_ENST00000402681.3_Missense_Mutation_p.K129E|C1S_ENST00000328916.3_Missense_Mutation_p.K296E			P09871	C1S_HUMAN	complement component 1, s subcomponent	296	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GCCCTGCCCTAAGGAAGACAC	0.418																																					GBM(156;750 1943 12971 24779 31015)	ENST00000406697.1	1.000000	0.680000	1	8.100000e-01	0.960000	0.926014	0.960000	1.000000																										0				33						c.(886-888)Aag>Gag		complement component 1, s subcomponent	Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)						95.0	97.0	96.0					12																	7173836		2203	4300	6503	SO:0001583	missense	716	0	0					g.chr12:7173836A>G		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.886A>G	chr12.hg19:g.7173836A>G	ENSP00000385035:p.Lys296Glu	0					C1S_ENST00000328916.3_Missense_Mutation_p.K296E|C1S_ENST00000360817.5_Missense_Mutation_p.K296E|C1S_ENST00000402681.3_Missense_Mutation_p.K129E	p.K296E			0	1	1	2.010562	P09871	C1S_HUMAN		11	1514	+			D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	ENST00000406697.1	1	1	hg19	c.886A>G	CCDS31735.1	1	.	.	.	.	.	.	.	.	.	.	A	3.314	-0.140144	0.06669	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000382222;ENST00000402681;ENST00000542978	D;D;D;D;T	0.84298	-1.78;-1.78;-1.78;-1.83;2.22	5.6	5.6	0.85130	5.6	5.6	0.85130	Complement control module (2);Sushi/SCR/CCP (2);	0.000000	0.45361	D	0.000367	T	0.79046	0.4380	M	0.62266	1.93	0.09310	N	1	B	0.23249	0.082	B	0.25987	0.065	T	0.62544	-0.6832	10	0.06757	T	0.87	.	6.8762	0.24149	0.7708:0.1521:0.0771:0.0	.	296	P09871	C1S_HUMAN	E	296;296;296;284;129;129	ENSP00000385035:K296E;ENSP00000328173:K296E;ENSP00000354057:K296E;ENSP00000384171:K129E;ENSP00000442298:K129E	ENSP00000328173:K296E	K	+	1	0	0	C1S	7044097	7044097	0.010000	0.17322	0.152000	0.22495	0.176000	0.22953	1.798000	0.38814	2.124000	0.65301	0.460000	0.39030	AAG	0.268024		TCGA-HZ-8315-01A-11D-2396-08	0.418	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.940000	-20.000000	1	0.270000	NM_001734		0	31	30	0	205	205	1		1	1		0	0	32	0	0	1.000000	1	0	2	0	1270	0	31	205
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.530000	1	7.200000e-01	0.960000	0.892294	0.960000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.005592	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.940000	-8.358520	1	0.270000	NM_033360		1433	11	11	6444	73	73	1	1	1	1	1	0	0	15	373	1	0.998710	8.437386e-01	1	8	61	17	485	11	73
TM7SF3	51768	broad.mit.edu	37	12	27149763	27149763	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:27149763C>T	ENST00000343028.4	-	4	655	c.430G>A	c.(430-432)Gat>Aat	p.D144N	TM7SF3_ENST00000542667.1_5'UTR	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	144						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					ATATCTAAATCGAACTCCAAA	0.383																																						ENST00000343028.4	1.000000	0.510000	9.200000e-01	6.300000e-01	0.760000	0.776813	0.760000	1.000000																										0				18						c.(430-432)Gat>Aat		transmembrane 7 superfamily member 3							62.0	60.0	61.0					12																	27149763		2203	4300	6503	SO:0001583	missense	51768	0	0					g.chr12:27149763C>T	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.430G>A	chr12.hg19:g.27149763C>T	ENSP00000342322:p.Asp144Asn	0					TM7SF3_ENST00000542667.1_5'UTR	p.D144N	NM_016551.2	NP_057635.1	0	0	0	2.005592	Q9NS93	TM7S3_HUMAN		4	655	-	Colorectal(261;0.0847)		B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	1	1	hg19	c.430G>A	CCDS8710.1	0	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453206	0.26161	.	.	ENSG00000064115	ENST00000343028;ENST00000543803;ENST00000539741;ENST00000543088;ENST00000535423	T;T;T;T	0.47177	1.47;0.94;0.93;0.85	4.4	3.5	0.40072	4.4	3.5	0.40072	.	0.265132	0.37669	N	0.001996	T	0.34164	0.0888	L	0.52266	1.64	0.34122	D	0.664214	B	0.30021	0.265	B	0.12837	0.008	T	0.42799	-0.9430	10	0.28530	T	0.3	-22.7313	7.8384	0.29384	0.0:0.7662:0.0:0.2338	.	144	Q9NS93	TM7S3_HUMAN	N	144;42;22;22;22	ENSP00000342322:D144N;ENSP00000442617:D42N;ENSP00000441027:D22N;ENSP00000444632:D22N	ENSP00000342322:D144N	D	-	1	0	0	TM7SF3	27041030	27041030	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.019000	0.30014	2.448000	0.82819	0.563000	0.77884	GAT	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.383	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.940000	-20.000000	1	0.270000	NM_016551		0	25	24	0	215	215	1		1	1		0	0	34	0	0	1.000000	9.999121e-01	0	37	0	93	0	25	215
CSAD	51380	broad.mit.edu	37	12	53552313	53552313	+	Silent	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:53552313C>T	ENST00000444623.1	-	17	1731	c.1464G>A	c.(1462-1464)cgG>cgA	p.R488R	CSAD_ENST00000379843.3_Silent_p.R341R|CSAD_ENST00000379846.1_Silent_p.R341R|CSAD_ENST00000267085.4_Silent_p.R515R|RP11-1136G11.8_ENST00000550908.1_lincRNA|CSAD_ENST00000453446.2_Silent_p.R488R	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	488					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	CCTGGCCTAGCCGCTCCAGCT	0.622																																					Ovarian(109;252 1546 16882 28524 44645)	ENST00000444623.1	1.000000	0.710000	1	8.400000e-01	0.990000	0.943670	0.990000	1.000000																										0				14						c.(1462-1464)cgG>cgA		cysteine sulfinic acid decarboxylase	L-Cysteine(DB00151)						79.0	65.0	70.0					12																	53552313		2203	4300	6503	SO:0001819	synonymous_variant	51380	0	0					g.chr12:53552313C>T	AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1464G>A	chr12.hg19:g.53552313C>T		0					CSAD_ENST00000379846.1_Silent_p.R341R|CSAD_ENST00000453446.2_Silent_p.R488R|CSAD_ENST00000379843.3_Silent_p.R341R|CSAD_ENST00000267085.4_Silent_p.R515R|RP11-1136G11.8_ENST00000550908.1_lincRNA	p.R488R	NM_001244705.1	NP_001231634.1	0	0	0	2.005592	Q9Y600	CSAD_HUMAN		17	1731	-			A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Silent	SNP	ENST00000444623.1	1	1	hg19	c.1464G>A	CCDS58235.1	1	.	.	.	.	.	.	.	.	.	.	C	7.110	0.575840	0.13623	.	.	ENSG00000139631	ENST00000379850	.	.	.	4.49	0.356	0.16074	4.49	0.356	0.16074	.	.	.	.	.	T	0.45196	0.1330	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21075	-1.0256	4	.	.	.	-13.2112	3.9686	0.09443	0.1186:0.5019:0.2319:0.1476	.	.	.	.	T	514	.	.	A	-	1	0	0	CSAD	51838580	51838580	0.762000	0.28451	0.473000	0.27253	0.771000	0.43674	0.028000	0.13644	-0.247000	0.09597	-1.744000	0.00683	GCT	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.622	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	1	0	1	2	2	2	2	0	0	0	0	40	40	40	40	1	1.940000	-3.321871	1	0.270000	NM_015989		0	32	32	0	202	201	1		1	1		0	0	40	0	0	1.000000	7.789648e-01	0	4	0	16	0	32	202
NCKAP1L	3071	broad.mit.edu	37	12	54929924	54929924	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:54929924C>T	ENST00000293373.6	+	28	3047	c.2968C>T	c.(2968-2970)Cct>Tct	p.P990S	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.P940S	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	990					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TACTTCATCTCCTGAGGAGGA	0.443																																						ENST00000293373.6	1.000000	0.600000	9.400000e-01	7.000000e-01	0.810000	0.822718	0.810000	1.000000																										0				80						c.(2968-2970)Cct>Tct		NCK-associated protein 1-like							147.0	125.0	132.0					12																	54929924		2203	4300	6503	SO:0001583	missense	3071	0	0					g.chr12:54929924C>T	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.2968C>T	chr12.hg19:g.54929924C>T	ENSP00000293373:p.Pro990Ser	0					NCKAP1L_ENST00000545638.2_Missense_Mutation_p.P940S	p.P990S	NM_005337.4	NP_005328.2	0	0	0	2.005592	P55160	NCKPL_HUMAN		28	3047	+			B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	1	1	hg19	c.2968C>T	CCDS31813.1	0	.	.	.	.	.	.	.	.	.	.	C	11.95	1.791160	0.31685	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.30981	1.51;1.51	4.31	0.435	0.16544	4.31	0.435	0.16544	.	0.299519	0.32343	N	0.006238	T	0.15825	0.0381	N	0.17631	0.505	0.33491	D	0.58865	B	0.06786	0.001	B	0.10450	0.005	T	0.20338	-1.0278	10	0.21540	T	0.41	-4.5611	7.885	0.29644	0.0:0.6346:0.0:0.3654	.	990	P55160	NCKPL_HUMAN	S	990;940	ENSP00000293373:P990S;ENSP00000445596:P940S	ENSP00000293373:P990S	P	+	1	0	0	NCKAP1L	53216191	53216191	0.001000	0.12720	0.960000	0.40013	0.751000	0.42716	0.442000	0.21628	-0.017000	0.14103	0.655000	0.94253	CCT	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.443	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.940000	-15.836590	1	0.270000	NM_005337		0	41	40	0	328	325	1		1	0		0	0	41	0	0	1.000000	9.849181e-01	0	0	0	55	0	41	328
SLC26A10	65012	broad.mit.edu	37	12	58019519	58019519	+	Silent	SNP	C	C	T	rs145592443		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:58019519C>T	ENST00000320442.4	+	14	1994	c.1683C>T	c.(1681-1683)tgC>tgT	p.C561C	SLC26A10_ENST00000379218.2_3'UTR|SLC26A10_ENST00000490243.1_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	561						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CACTGGGCTGCGGCAAGTGAG	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19412	0.001		0.0	False		,,,				2504	0.0					ENST00000320442.4	1.000000	0.790000	1	9.200000e-01	0.990000	0.972912	0.990000	1.000000																										0				19						c.(1681-1683)tgC>tgT		solute carrier family 26, member 10		C		0,4406		0,0,2203	33.0	36.0	35.0		1683	-2.1	0.0	12	dbSNP_134	35	2,8598		0,2,4298	no	coding-synonymous	SLC26A10	NM_133489.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		561/564	58019519	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	65012	14	120168	42				g.chr12:58019519C>T		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1683C>T	chr12.hg19:g.58019519C>T		0					SLC26A10_ENST00000379218.2_3'UTR|SLC26A10_ENST00000490243.1_3'UTR	p.C561C	NM_133489.2	NP_597996.2	0	0	0	2.005592	Q8NG04	S2610_HUMAN		14	1994	+	Melanoma(17;0.122)		A6NMJ2|B6ZDQ3|Q6ZWI7	Silent	SNP	ENST00000320442.4	1	1	hg19	c.1683C>T	CCDS8949.2	1																																																																																								0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.582	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.940000	-3.323239	1	0.270000			0	42	41	0	246	244	1		1	0		0	0	42	0	0	1.000000	8.935166e-01	0	0	0	25	0	42	246
LIN7A	8825	broad.mit.edu	37	12	81242056	81242056	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:81242056C>T	ENST00000552864.1	-	3	449	c.247G>A	c.(247-249)Gaa>Aaa	p.E83K		NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)	83					exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						GCACGGAATTCGGGACAGCCA	0.358																																						ENST00000552864.1	1.000000	0.390000	8.500000e-01	5.200000e-01	0.670000	0.686750	0.670000	1.000000																										0				15						c.(247-249)Gaa>Aaa		lin-7 homolog A (C. elegans)							87.0	82.0	84.0					12																	81242056		2203	4300	6503	SO:0001583	missense	8825	2	121408	27				g.chr12:81242056C>T	AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.247G>A	chr12.hg19:g.81242056C>T	ENSP00000447488:p.Glu83Lys	0						p.E83K	NM_004664.2	NP_004655.1	0	0	0	2.005592	O14910	LIN7A_HUMAN		3	449	-			A4FTY3|Q147W1|Q6LES3|Q7LDS4	Missense_Mutation	SNP	ENST00000552864.1	0	1	hg19	c.247G>A	CCDS9021.1	0	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762707	0.89932	.	.	ENSG00000111052	ENST00000552864;ENST00000549417	T;T	0.27557	2.18;1.66	5.8	5.8	0.92144	5.8	5.8	0.92144	L27, C-terminal (1);PDZ/DHR/GLGF (1);L27 (1);	0.000000	0.85682	D	0.000000	T	0.49389	0.1554	L	0.57536	1.79	0.80722	D	1	D	0.61697	0.99	P	0.55965	0.788	T	0.46289	-0.9202	10	0.87932	D	0	-17.324	20.0637	0.97700	0.0:1.0:0.0:0.0	.	83	O14910	LIN7A_HUMAN	K	83;77	ENSP00000447488:E83K;ENSP00000448975:E77K	ENSP00000261203:E83K	E	-	1	0	0	LIN7A	79766187	79766187	1.000000	0.71417	0.967000	0.41034	0.934000	0.57294	7.487000	0.81328	2.751000	0.94390	0.650000	0.86243	GAA	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.358	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407760.1	1	0	1	2	2	2	2	0	0	0	0	22	22	22	20	1	1.940000	-2.879519	1	0.270000			0	15	15	0	151	149	1		1	0		0	0	22	0	0	0.999887	2.671175e-02	0	0	0	3	0	15	151
MYBPC1	4604	broad.mit.edu	37	12	102056180	102056180	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr12:102056180A>G	ENST00000550270.1	+	19	2002	c.2002A>G	c.(2002-2004)Agg>Ggg	p.R668G	MYBPC1_ENST00000441232.1_Missense_Mutation_p.R668G|MYBPC1_ENST00000360610.2_Missense_Mutation_p.R668G|MYBPC1_ENST00000361685.2_Missense_Mutation_p.R693G|MYBPC1_ENST00000536007.1_Missense_Mutation_p.R649G|MYBPC1_ENST00000547405.1_Missense_Mutation_p.R642G|MYBPC1_ENST00000551300.1_Missense_Mutation_p.R569G|MYBPC1_ENST00000553190.1_Missense_Mutation_p.R668G|MYBPC1_ENST00000392934.3_Missense_Mutation_p.R655G|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000547509.1_Missense_Mutation_p.R654G|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000452455.2_Missense_Mutation_p.R668G|MYBPC1_ENST00000545503.2_Missense_Mutation_p.R668G|MYBPC1_ENST00000549145.1_Missense_Mutation_p.R681G|MYBPC1_ENST00000541119.1_Missense_Mutation_p.R656G|MYBPC1_ENST00000361466.2_Missense_Mutation_p.R693G			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	668	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						CAGGTGGATGAGGCTGAATTT	0.403																																						ENST00000550270.1	1.000000	0.590000	9.900000e-01	7.000000e-01	0.840000	0.842021	0.840000	1.000000																										0				57						c.(2002-2004)Agg>Ggg		myosin binding protein C, slow type							89.0	86.0	87.0					12																	102056180		2203	4300	6503	SO:0001583	missense	4604	0	0					g.chr12:102056180A>G		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.2002A>G	chr12.hg19:g.102056180A>G	ENSP00000449702:p.Arg668Gly	0					RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000549145.1_Missense_Mutation_p.R681G|MYBPC1_ENST00000360610.2_Missense_Mutation_p.R668G|MYBPC1_ENST00000441232.1_Missense_Mutation_p.R668G|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000392934.3_Missense_Mutation_p.R655G|MYBPC1_ENST00000547509.1_Missense_Mutation_p.R654G|MYBPC1_ENST00000361685.2_Missense_Mutation_p.R693G|MYBPC1_ENST00000452455.2_Missense_Mutation_p.R668G|MYBPC1_ENST00000361466.2_Missense_Mutation_p.R693G|MYBPC1_ENST00000553190.1_Missense_Mutation_p.R668G|MYBPC1_ENST00000536007.1_Missense_Mutation_p.R649G|MYBPC1_ENST00000545503.2_Missense_Mutation_p.R668G|MYBPC1_ENST00000547405.1_Missense_Mutation_p.R642G|MYBPC1_ENST00000551300.1_Missense_Mutation_p.R569G|MYBPC1_ENST00000541119.1_Missense_Mutation_p.R656G	p.R668G			0	0	0	2.005592	Q00872	MYPC1_HUMAN		19	2002	+			B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	1	1	hg19	c.2002A>G	CCDS9085.1	0	.	.	.	.	.	.	.	.	.	.	A	19.45	3.829492	0.71258	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38	5.86	3.41	0.39046	5.86	3.41	0.39046	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000027	T	0.71341	0.3328	M	0.78223	2.4	0.54753	D	0.999987	D;D;D;D;D;P;D;D;D;D	0.89917	0.991;1.0;0.973;0.996;0.999;0.745;0.995;0.996;0.974;0.995	D;D;D;D;D;P;D;D;D;D	0.91635	0.975;0.999;0.95;0.997;0.997;0.62;0.995;0.998;0.962;0.996	T	0.73707	-0.3898	10	0.87932	D	0	.	12.8782	0.58001	0.6074:0.3926:0.0:0.0	.	649;656;668;668;655;642;668;668;693;693	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.	G	642;668;668;668;655;654;693;681;668;693;668;649;656;693;569;668	ENSP00000448175:R642G;ENSP00000400908:R668G;ENSP00000388989:R668G;ENSP00000353822:R668G;ENSP00000376665:R655G;ENSP00000447362:R654G;ENSP00000354845:R693G;ENSP00000447660:R681G;ENSP00000447900:R668G;ENSP00000440034:R668G;ENSP00000446128:R649G;ENSP00000442847:R656G;ENSP00000354849:R693G;ENSP00000447116:R569G;ENSP00000449702:R668G	ENSP00000353822:R668G	R	+	1	2	2	MYBPC1	100580311	100580311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.892000	0.56235	0.509000	0.28195	0.528000	0.53228	AGG	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.403	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.940000	-13.153570	1	0.270000			0	31	31	0	240	239	1		1	0		0	0	52	0	0	1.000000	0	0	0	0	1	0	31	240
TRPC4	7223	broad.mit.edu	37	13	38225420	38225420	+	Silent	SNP	T	T	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr13:38225420T>C	ENST00000379705.3	-	8	2918	c.2061A>G	c.(2059-2061)gaA>gaG	p.E687E	TRPC4_ENST00000379681.3_Silent_p.E687E|TRPC4_ENST00000379679.1_Silent_p.E514E|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000447043.1_Silent_p.E687E|TRPC4_ENST00000358477.2_Silent_p.E687E|TRPC4_ENST00000355779.2_Silent_p.E687E|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000338947.5_Silent_p.E514E			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	687	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTCCAAAACTTTCTGGCTTTC	0.368																																						ENST00000379705.3	1.000000	0.820000	1	9.300000e-01	0.990000	0.975081	0.990000	1.000000																										0				83						c.(2059-2061)gaA>gaG		transient receptor potential cation channel, subfamily C, member 4							143.0	138.0	140.0					13																	38225420		2203	4300	6503	SO:0001819	synonymous_variant	7223	0	0					g.chr13:38225420T>C	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2061A>G	chr13.hg19:g.38225420T>C		0					TRPC4_ENST00000447043.1_Silent_p.E687E|TRPC4_ENST00000355779.2_Silent_p.E687E|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000338947.5_Silent_p.E514E|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000379681.3_Silent_p.E687E|TRPC4_ENST00000379679.1_Silent_p.E514E|TRPC4_ENST00000358477.2_Silent_p.E687E	p.E687E			1	2	3	2.019451	Q9UBN4	TRPC4_HUMAN		8	2918	-			B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	1	1	hg19	c.2061A>G	CCDS9365.1	1																																																																																								0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.368	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	1	0	0	2	2	2	2	0	0	0	0	59	59	59	59	1	1.940000	-20.000000	1	0.270000	NM_003306		0	60	60	0	363	361	0		1	0		0	0	59	0	0	1.000000	1.532782e-01	0	0	0	5	0	60	363
RASA3	22821	broad.mit.edu	37	13	114795342	114795342	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr13:114795342G>A	ENST00000334062.7	-	5	515	c.394C>T	c.(394-396)Cgg>Tgg	p.R132W	RASA3_ENST00000389544.4_Missense_Mutation_p.R100W|RASA3_ENST00000542651.1_Missense_Mutation_p.A100V	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	132	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCGCTCAGCCGCAGCTCCAGG	0.642																																						ENST00000334062.7	1.000000	0.690000	1	9.900000e-01	0.990000	0.976766	0.990000	1.000000																										0				47						c.(394-396)Cgg>Tgg		RAS p21 protein activator 3							97.0	58.0	71.0					13																	114795342		2202	4293	6495	SO:0001583	missense	22821	12	118804	32				g.chr13:114795342G>A		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.394C>T	chr13.hg19:g.114795342G>A	ENSP00000335029:p.Arg132Trp	0					RASA3_ENST00000542651.1_Missense_Mutation_p.A100V|RASA3_ENST00000389544.4_Missense_Mutation_p.R100W	p.R132W	NM_007368.2	NP_031394.2	1	2	3	2.019451	Q14644	RASA3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.128)	5	515	-	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	0	1	hg19	c.394C>T	CCDS32016.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.6|21.6	4.176924|4.176924	0.78564|0.78564	.|.	.|.	ENSG00000185989|ENSG00000185989	ENST00000542651|ENST00000334062;ENST00000389544	T|T;T	0.18502|0.71934	2.21|-0.61;-0.61	4.5|4.5	-9.0|-9.0	0.00747|0.00747	4.5|4.5	-9.0|-9.0	0.00747|0.00747	.|C2 calcium/lipid-binding domain, CaLB (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71281|0.71281	0.3321|0.3321	L|L	0.47716|0.47716	1.5|1.5	0.22305|0.22305	N|N	0.99922|0.99922	.|D	.|0.89917	.|1.0	.|P	.|0.60236	.|0.871	T|T	0.75150|0.75150	-0.3419|-0.3419	6|9	.|.	.|.	.|.	.|.	19.117|19.117	0.93344|0.93344	0.0:0.0:0.7474:0.2526|0.0:0.0:0.7474:0.2526	.|.	.|132	.|Q14644	.|RASA3_HUMAN	V|W	100|132;100	ENSP00000439008:A100V|ENSP00000335029:R132W;ENSP00000374195:R100W	.|.	A|R	-|-	2|1	0|2	0|2	RASA3|RASA3	113813444|113813444	113813444|113813444	1.000000|1.000000	0.71417|0.71417	0.423000|0.423000	0.26634|0.26634	0.966000|0.966000	0.64601|0.64601	1.343000|1.343000	0.33930|0.33930	-2.187000|-2.187000	0.00759|0.00759	-0.314000|-0.314000	0.08810|0.08810	GCG|CGG	0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.642	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.940000	-14.208020	1	0.270000	NM_007368		0	6	6	0	21	21	0		1	1		0	0	9	0	0	0.971191	9.953876e-01	0	7	0	37	0	6	21
PTGR2	145482	broad.mit.edu	37	14	74345810	74345810	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr14:74345810C>G	ENST00000555661.1	+	6	676	c.531C>G	c.(529-531)ttC>ttG	p.F177L	RP5-1021I20.4_ENST00000556551.2_Intron|PTGR2_ENST00000553813.1_Missense_Mutation_p.F43L|PTGR2_ENST00000267568.4_Missense_Mutation_p.F177L|PTGR2_ENST00000555228.1_Missense_Mutation_p.F177L			Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	177					prostaglandin metabolic process (GO:0006693)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)			NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(2)	9					Indomethacin(DB00328)	TTGGCCATTTCTTAGGTTGTT	0.353																																					Esophageal Squamous(98;1155 1417 16452 47043 47872)	ENST00000555661.1	1.000000	0.720000	1	8.100000e-01	0.910000	0.909464	0.910000	1.000000																										0				9						c.(529-531)ttC>ttG		prostaglandin reductase 2	Indomethacin(DB00328)						121.0	116.0	118.0					14																	74345810		2203	4300	6503	SO:0001583	missense	145482	0	0					g.chr14:74345810C>G	AK096410	CCDS9820.1	14q24.1-q24.2	2008-06-04	2008-06-02	2008-06-03		ENSG00000140043			20149	protein-coding gene	gene with protein product		608642	"""zinc binding alcohol dehydrogenase domain containing 1"""	ZADH1		17449869	Standard	NM_152444		Approved	FLJ39091	uc001xow.3	Q8N8N7		ENST00000555661.1:c.531C>G	chr14.hg19:g.74345810C>G	ENSP00000452280:p.Phe177Leu	0					PTGR2_ENST00000267568.4_Missense_Mutation_p.F177L|PTGR2_ENST00000553813.1_Missense_Mutation_p.F43L|RP5-1021I20.4_ENST00000556551.2_Intron|PTGR2_ENST00000555228.1_Missense_Mutation_p.F177L	p.F177L			0	1	1	2.014250	Q8N8N7	PTGR2_HUMAN		6	676	+			Q3L8A4|Q6MZH8	Missense_Mutation	SNP	ENST00000555661.1	1	1	hg19	c.531C>G	CCDS9820.1	1	.	.	.	.	.	.	.	.	.	.	C	5.605	0.296449	0.10622	.	.	ENSG00000140043;ENSG00000140043;ENSG00000140043;ENSG00000140043;ENSG00000258653	ENST00000555228;ENST00000555661;ENST00000267568;ENST00000554885;ENST00000553813	T;T;T;T;T	0.03745	3.82;3.82;3.82;3.82;3.82	5.52	2.76	0.32466	5.52	2.76	0.32466	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.256361	0.35870	N	0.002939	T	0.00468	0.0015	N	0.00006	-3.25	0.25447	N	0.988045	B	0.02656	0.0	B	0.01281	0.0	T	0.42666	-0.9438	10	0.02654	T	1	-0.5166	4.2981	0.10911	0.1348:0.1253:0.611:0.1289	.	177	Q8N8N7	PTGR2_HUMAN	L	177;177;177;128;43	ENSP00000450975:F177L;ENSP00000452280:F177L;ENSP00000267568:F177L;ENSP00000451158:F128L;ENSP00000450824:F43L	ENSP00000267568:F177L	F	+	3	2	2	RP5-1021I20.4;PTGR2	73415563	73415563	1.000000	0.71417	0.870000	0.34147	0.622000	0.37654	2.944000	0.49034	0.311000	0.23014	-0.759000	0.03464	TTC	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.353	PTGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412575.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.940000	-20.000000	1	0.270000			0	71	71	0	501	499	1		1	1		0	0	91	0	0	1.000000	6.438429e-01	0	5	0	12	0	71	501
MVP	9961	broad.mit.edu	37	16	29852959	29852959	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr16:29852959G>A	ENST00000357402.5	+	9	1372	c.1234G>A	c.(1234-1236)Gaa>Aaa	p.E412K	MVP_ENST00000452209.2_3'UTR|MVP_ENST00000395353.1_Missense_Mutation_p.E412K	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	412					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						GACCCAGGACGAAGTCCTGTG	0.617																																						ENST00000357402.5	1.000000	0.680000	1	8.900000e-01	0.990000	0.960655	0.990000	1.000000																										0				27						c.(1234-1236)Gaa>Aaa		major vault protein							27.0	24.0	25.0					16																	29852959		2197	4300	6497	SO:0001583	missense	9961	0	0					g.chr16:29852959G>A	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.1234G>A	chr16.hg19:g.29852959G>A	ENSP00000349977:p.Glu412Lys	0					MVP_ENST00000452209.2_3'UTR|MVP_ENST00000395353.1_Missense_Mutation_p.E412K	p.E412K	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	1	2	3	2.025407	Q14764	MVP_HUMAN		9	1372	+			Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	1	1	hg19	c.1234G>A	CCDS10656.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241347	0.79912	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.14893	2.47;2.47	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.148857	0.64402	D	0.000015	T	0.51500	0.1678	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.67548	0.952	T	0.61855	-0.6977	10	0.59425	D	0.04	-11.9549	17.1387	0.86747	0.0:0.0:1.0:0.0	.	412	Q14764	MVP_HUMAN	K	412	ENSP00000349977:E412K;ENSP00000378760:E412K	ENSP00000349977:E412K	E	+	1	0	0	MVP	29760460	29760460	1.000000	0.71417	0.731000	0.30826	0.944000	0.59088	7.739000	0.84976	2.627000	0.88993	0.563000	0.77884	GAA	0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.617	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	1.940000	-19.999920	1	0.270000	NM_005115		0	14	14	0	76	75	1		1	1		0	0	23	0	0	0.999824	1	0	118	0	376	0	14	76
NOD2	64127	broad.mit.edu	37	16	50745886	50745886	+	Silent	SNP	C	C	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr16:50745886C>A	ENST00000300589.2	+	4	2169	c.2064C>A	c.(2062-2064)ggC>ggA	p.G688G	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	688					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				AGCACTGGGGCCTGCTGGCTG	0.662																																						ENST00000300589.2	1.000000	0.710000	1	8.500000e-01	0.990000	0.943951	0.990000	1.000000																										0				52						c.(2062-2064)ggC>ggA		nucleotide-binding oligomerization domain containing 2							31.0	34.0	33.0					16																	50745886		2197	4300	6497	SO:0001819	synonymous_variant	64127	0	0					g.chr16:50745886C>A	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2064C>A	chr16.hg19:g.50745886C>A		0					RP11-327F22.6_ENST00000602304.1_RNA	p.G688G	NM_022162.1	NP_071445.1	1	2	3	2.025407	Q9HC29	NOD2_HUMAN		4	2169	+		all_cancers(37;0.0156)	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Silent	SNP	ENST00000300589.2	1	1	hg19	c.2064C>A	CCDS10746.1	1																																																																																								0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.662	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	40	1	1.940000	-20.000000	1	0.270000	NM_022162		0	33	33	0	211	210	1		1	0		0	0	41	0	0	1.000000	0	0	0	0	1	0	33	211
TMEM208	29100	broad.mit.edu	37	16	67262758	67262758	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr16:67262758C>G	ENST00000304800.9	+	5	464	c.358C>G	c.(358-360)Ctc>Gtc	p.L120V	TMEM208_ENST00000563426.1_Intron|TMEM208_ENST00000563953.1_Missense_Mutation_p.L50V|LRRC29_ENST00000462169.1_5'Flank|LRRC29_ENST00000393992.1_5'Flank|AC040160.1_ENST00000454102.2_5'Flank|LRRC29_ENST00000341546.3_5'Flank|LRRC29_ENST00000409509.1_5'Flank|TMEM208_ENST00000565201.1_Missense_Mutation_p.L120V	NM_014187.3	NP_054906.2	Q9BTX3	TM208_HUMAN	transmembrane protein 208	120					autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(2)|lung(1)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		CTGCTTCTCTCTCTATGTCTG	0.522																																						ENST00000304800.9	1.000000	0.760000	1	8.500000e-01	0.950000	0.934984	0.950000	1.000000																										0				5						c.(358-360)Ctc>Gtc		transmembrane protein 208							111.0	116.0	115.0					16																	67262758		2021	4180	6201	SO:0001583	missense	29100	0	0					g.chr16:67262758C>G		CCDS45511.1	16q22.1	2008-05-02			ENSG00000168701	ENSG00000168701			25015	protein-coding gene	gene with protein product						11042152	Standard	NM_014187		Approved	HSPC171	uc002esi.2	Q9BTX3		ENST00000304800.9:c.358C>G	chr16.hg19:g.67262758C>G	ENSP00000305892:p.Leu120Val	0					LRRC29_ENST00000462169.1_5'Flank|LRRC29_ENST00000409509.1_5'Flank|TMEM208_ENST00000565201.1_Missense_Mutation_p.L120V|AC040160.1_ENST00000454102.2_5'Flank|LRRC29_ENST00000341546.3_5'Flank|LRRC29_ENST00000393992.1_5'Flank|TMEM208_ENST00000563953.1_Missense_Mutation_p.L50V|TMEM208_ENST00000563426.1_Intron	p.L120V	NM_014187.3	NP_054906.2	1	2	3	2.017088	Q9BTX3	TM208_HUMAN		5	464	+		Ovarian(137;0.0563)	Q05CT0|Q96D25|Q9NZZ7	Missense_Mutation	SNP	ENST00000304800.9	1	1	hg19	c.358C>G	CCDS45511.1	1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813010	0.32053	.	.	ENSG00000168701	ENST00000304800	T	0.28666	1.6	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.745366	0.11021	N	0.608350	T	0.34745	0.0908	L	0.59436	1.845	0.35503	D	0.799939	P	0.35656	0.514	B	0.31812	0.136	T	0.42783	-0.9431	10	0.33940	T	0.23	.	18.2269	0.89920	0.0:1.0:0.0:0.0	.	120	Q9BTX3	TM208_HUMAN	V	120	ENSP00000305892:L120V	ENSP00000305892:L120V	L	+	1	0	0	TMEM208	65820259	65820259	0.961000	0.32948	1.000000	0.80357	0.957000	0.61999	2.027000	0.41078	2.637000	0.89404	0.561000	0.74099	CTC	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.522	TMEM208-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421976.2	1	0	1	2	2	2	2	0	0	0	0	94	94	94	91	1	1.940000	-3.221885	1	0.270000	NM_014187		0	75	72	0	508	500	1		1	1		0	0	94	0	0	1.000000	1	0	46	0	251	0	75	508
CLEC18A	348174	broad.mit.edu	37	16	69988323	69988323	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr16:69988323G>T	ENST00000288040.6	+	3	490	c.303G>T	c.(301-303)tgG>tgT	p.W101C	CLEC18A_ENST00000449317.2_Missense_Mutation_p.W101C|CLEC18A_ENST00000568461.1_Missense_Mutation_p.W101C|CLEC18A_ENST00000393701.2_Missense_Mutation_p.W101C	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	101	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						CCGGCCTGTGGCGCACCCTGC	0.657																																						ENST00000288040.6	0.880000	0.330000	7.200000e-01	4.300000e-01	0.560000	0.582210	0.560000	0.550000																										0				5						c.(301-303)tgG>tgT		C-type lectin domain family 18, member A							58.0	54.0	56.0					16																	69988323		2198	4300	6498	SO:0001583	missense	348174	0	0					g.chr16:69988323G>T	AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.303G>T	chr16.hg19:g.69988323G>T	ENSP00000288040:p.Trp101Cys	0					CLEC18A_ENST00000449317.2_Missense_Mutation_p.W101C|CLEC18A_ENST00000393701.2_Missense_Mutation_p.W101C|CLEC18A_ENST00000568461.1_Missense_Mutation_p.W101C	p.W101C	NM_001136214.2	NP_001129686.1	1	2	3	2.017088	A5D8T8	CL18A_HUMAN		3	490	+			A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Missense_Mutation	SNP	ENST00000288040.6	1	1	hg19	c.303G>T	CCDS10886.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.308|9.308	1.054888|1.054888	0.19907|0.19907	.|.	.|.	ENSG00000157322|ENSG00000157322	ENST00000545150|ENST00000393701;ENST00000539957;ENST00000449317;ENST00000288040	.|T;T;T	.|0.07444	.|3.19;3.19;3.19	1.76|1.76	-1.94|-1.94	0.07571|0.07571	1.76|1.76	-1.94|-1.94	0.07571|0.07571	.|CAP domain (3);	.|1.776390	.|0.02581	.|N	.|0.098870	T|T	0.05731|0.05731	0.0150|0.0150	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.50943	.|0.94;0.873;0.846	.|P;P;P	.|0.51701	.|0.677;0.579;0.517	T|T	0.05666|0.05666	-1.0871|-1.0871	5|9	.|.	.|.	.|.	.|.	2.0146|2.0146	0.03495|0.03495	0.3592:0.0:0.3832:0.2576|0.3592:0.0:0.3832:0.2576	.|.	.|101;101;101	.|B4DPF2;A5D8T8;F8W692	.|.;CL18A_HUMAN;.	S|C	100|101	.|ENSP00000377304:W101C;ENSP00000413990:W101C;ENSP00000288040:W101C	.|.	A|W	+|+	1|3	0|0	0|0	CLEC18A|CLEC18A	68545824|68545824	68545824|68545824	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.021000|0.021000	0.10359|0.10359	0.075000|0.075000	0.14686|0.14686	-0.471000|-0.471000	0.06891|0.06891	0.184000|0.184000	0.17185|0.17185	GCG|TGG	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.657	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268955.2	1	0	1	2	2	2	2	0	0	0	0	39	39	39	42	1	1.940000	-6.476399	1	0.270000	NM_182619		0	15	14	0	184	172	0		1			0	0	39	0	0	0.999819	0	0	0	0	0	0	15	184
SPOP	8405	broad.mit.edu	37	17	47677787	47677787	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr17:47677787G>A	ENST00000393328.2	-	11	1443	c.1078C>T	c.(1078-1080)Cag>Tag	p.Q360*	SPOP_ENST00000503676.1_Nonsense_Mutation_p.Q360*|SPOP_ENST00000393331.3_Nonsense_Mutation_p.Q360*|SPOP_ENST00000504102.1_Nonsense_Mutation_p.Q360*|SPOP_ENST00000347630.2_Nonsense_Mutation_p.Q360*	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	360					glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						AAAGGGCACTGTGCTGAAGCC	0.527										Prostate(2;0.17)																												ENST00000393328.2	1.000000	0.900000	1	9.700000e-01	0.990000	0.989518	0.990000	1.000000																										0				63						c.(1078-1080)Cag>Tag		speckle-type POZ protein							163.0	165.0	164.0					17																	47677787		2203	4300	6503	SO:0001587	stop_gained	8405	0	0					g.chr17:47677787G>A	AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.1078C>T	chr17.hg19:g.47677787G>A	ENSP00000377001:p.Gln360*	0	Prostate(2;0.17)				SPOP_ENST00000347630.2_Nonsense_Mutation_p.Q360*|SPOP_ENST00000504102.1_Nonsense_Mutation_p.Q360*|SPOP_ENST00000393331.3_Nonsense_Mutation_p.Q360*|SPOP_ENST00000503676.1_Nonsense_Mutation_p.Q360*	p.Q360*	NM_003563.3	NP_003554.1	1	2	3	2.027700	O43791	SPOP_HUMAN		11	1443	-			B2R6S3|D3DTW7|Q53HJ1	Nonsense_Mutation	SNP	ENST00000393328.2	0	1	hg19	c.1078C>T	CCDS11551.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.243401	0.98722	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872	.	.	.	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-1.4971	19.5069	0.95121	0.0:0.0:1.0:0.0	.	.	.	.	X	360;360;360;360;244;360;313	.	ENSP00000240327:Q360X	Q	-	1	0	0	SPOP	45032786	45032786	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.621000	0.83083	2.941000	0.99782	0.655000	0.94253	CAG	0.273921		TCGA-HZ-8315-01A-11D-2396-08	0.527	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365154.2	1	0	1	2	2	2	2	0	0	0	0	153	153	153	152	1	1.940000	-20.000000	1	0.270000	NM_003563		0	152	151	0	922	911	0		1	1		0	0	153	0	0	1.000000	9.999995e-01	0	21	0	98	0	152	922
TP53	7157	broad.mit.edu	37	17	7578394	7578394	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr17:7578394T>C	ENST00000269305.4	-	5	725	c.536A>G	c.(535-537)cAt>cGt	p.H179R	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.H179R|TP53_ENST00000359597.4_Missense_Mutation_p.H179R|TP53_ENST00000445888.2_Missense_Mutation_p.H179R|TP53_ENST00000420246.2_Missense_Mutation_p.H179R|TP53_ENST00000455263.2_Missense_Mutation_p.H179R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179R(108)|p.H179L(43)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47L(4)|p.H86L(4)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.H86R(2)|p.H47R(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.E171fs*1(1)|p.R174fs*3(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGCGCTCATGGTGGGGGCA	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.990000	0.640000	9.600000e-01	7.500000e-01	0.860000	0.855573	0.860000	0.910000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		217	Substitution - Missense(166)|Deletion - In frame(24)|Deletion - Frameshift(18)|Whole gene deletion(8)|Complex - deletion inframe(1)	p.H179R(108)|p.H179L(43)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47L(4)|p.H86L(4)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.H86R(2)|p.H47R(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.E171fs*1(1)|p.R174fs*3(1)|p.E171fs*61(1)	lung(35)|breast(32)|large_intestine(29)|upper_aerodigestive_tract(26)|oesophagus(21)|ovary(21)|central_nervous_system(16)|haematopoietic_and_lymphoid_tissue(8)|urinary_tract(6)|pancreas(6)|liver(5)|bone(4)|biliary_tract(3)|cervix(1)|stomach(1)|endometrium(1)|salivary_gland(1)|skin(1)	24185						c.(535-537)cAt>cGt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						47.0	47.0	47.0					17																	7578394		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578394T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.536A>G	chr17.hg19:g.7578394T>C	ENSP00000269305:p.His179Arg	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.H179R|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.H179R|TP53_ENST00000420246.2_Missense_Mutation_p.H179R|TP53_ENST00000359597.4_Missense_Mutation_p.H179R|TP53_ENST00000413465.2_Missense_Mutation_p.H179R	p.H179R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.753571	P04637	P53_HUMAN		5	725	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.536A>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.694391	0.88830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.47	5.47	0.80525	5.47	5.47	0.80525	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	D	0.000000	D	0.99917	0.9961	M	0.92507	3.315	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.989;1.0;0.985;1.0;0.995;1.0;0.996	D;D;D;D;D;D;D	0.97110	0.929;0.996;0.912;1.0;0.985;0.995;0.937	D	0.95874	0.8893	10	0.87932	D	0	-15.4889	13.8032	0.63214	0.0:0.0:0.0:1.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179R;ENSP00000352610:H179R;ENSP00000269305:H179R;ENSP00000398846:H179R;ENSP00000391127:H179R;ENSP00000391478:H179R;ENSP00000425104:H47R;ENSP00000423862:H86R	ENSP00000269305:H179R	H	-	2	0	0	TP53	7519119	7519119	1.000000	0.71417	0.945000	0.38365	0.856000	0.48823	6.263000	0.72521	2.208000	0.71279	0.460000	0.39030	CAT	0.156069		TCGA-HZ-8315-01A-11D-2396-08	0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.940000	-20.000000	1	0.270000	NM_000546		0	34	33	0	201	199	1		1	1	1	0	0	52	894	0	1.000000	9.925617e-01	1	15	149	33	657	34	201
APOH	350	broad.mit.edu	37	17	64225477	64225477	+	Silent	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr17:64225477G>A	ENST00000205948.6	-	1	58	c.21C>T	c.(19-21)atC>atT	p.I7I		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	7					blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			TCGAGAACAAGATGAGCACTG	0.388																																					Melanoma(155;624 1882 16869 48804 51309)	ENST00000205948.6	1.000000	0.630000	1	7.800000e-01	0.950000	0.909698	0.950000	1.000000																										0				17						c.(19-21)atC>atT		apolipoprotein H (beta-2-glycoprotein I)							69.0	63.0	65.0					17																	64225477		2203	4300	6503	SO:0001819	synonymous_variant	350	0	0					g.chr17:64225477G>A		CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.21C>T	chr17.hg19:g.64225477G>A		0						p.I7I	NM_000042.2	NP_000033.2	1	2	3	2.027700	P02749	APOH_HUMAN	BRCA - Breast invasive adenocarcinoma(6;9.74e-08)	1	58	-			B2R9M3|Q9UCN7	Silent	SNP	ENST00000205948.6	1	1	hg19	c.21C>T	CCDS11663.1	1																																																																																								0.273921		TCGA-HZ-8315-01A-11D-2396-08	0.388	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.940000	-20.000000	1	0.270000	NM_000042		0	24	21	0	165	163	1		1	0		0	0	30	0	0	1.000000	4.738468e-01	0	0	0	12	0	24	165
DNMT1	1786	broad.mit.edu	37	19	10257056	10257056	+	Silent	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:10257056C>T	ENST00000340748.4	-	27	3052	c.2817G>A	c.(2815-2817)gtG>gtA	p.V939V	DNMT1_ENST00000589538.1_5'Flank|DNMT1_ENST00000359526.4_Silent_p.V955V|DNMT1_ENST00000540357.1_Silent_p.V939V			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	939					cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GGGGCAGGTACACACCATCAC	0.632																																						ENST00000340748.4			0	0																														0				70						c.(2815-2817)gtG>gtA		DNA (cytosine-5-)-methyltransferase 1	Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)						74.0	61.0	66.0					19																	10257056		2203	4300	6503	SO:0001819	synonymous_variant	1786	0	0					g.chr19:10257056C>T	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2817G>A	chr19.hg19:g.10257056C>T							DNMT1_ENST00000359526.4_Silent_p.V955V|DNMT1_ENST00000540357.1_Silent_p.V939V|DNMT1_ENST00000589538.1_5'Flank	p.V939V							P26358	DNMT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)	27	3052	-			A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	1	1	hg19	c.2817G>A	CCDS12228.1																																																																																											TCGA-HZ-8315-01A-11D-2396-08	0.632	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	1	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	1.940000	-20.000000	1	0.270000	NM_001379		0	22	23	0	209	209	0		1	0		0	0	43	0	0	0.999999	8.542056e-01	0	0	0	35	0	22	209
LSM4	25804	broad.mit.edu	37	19	18420597	18420597	+	Silent	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:18420597G>A	ENST00000593829.1	-	4	472	c.219C>T	c.(217-219)gaC>gaT	p.D73D	LSM4_ENST00000252816.6_Silent_p.D59D	NM_001252129.1|NM_012321.4	NP_001239058.1|NP_036453.1	Q9Y4Z0	LSM4_HUMAN	LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)	73					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U6 snRNP (GO:0005688)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|lung(3)	6						CGATGATCTCGTCGGGGATGC	0.652																																						ENST00000593829.1	1.000000	0.910000	1	9.900000e-01	0.990000	0.995276	0.990000	1.000000																										0				6						c.(217-219)gaC>gaT		LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)							59.0	49.0	52.0					19																	18420597		2203	4300	6503	SO:0001819	synonymous_variant	25804	1	121406	26				g.chr19:18420597G>A	AF117235	CCDS12374.1, CCDS62601.1	19p13.1	2008-02-05				ENSG00000130520			17259	protein-coding gene	gene with protein product		607284				10369684, 10523320	Standard	NM_012321		Approved	YER112W	uc002niq.3	Q9Y4Z0		ENST00000593829.1:c.219C>T	chr19.hg19:g.18420597G>A		0					LSM4_ENST00000252816.6_Silent_p.D59D	p.D73D	NM_001252129.1|NM_012321.4	NP_001239058.1|NP_036453.1	0	0	0	1.968727	Q9Y4Z0	LSM4_HUMAN		4	472	-				Silent	SNP	ENST00000593829.1	1	1	hg19	c.219C>T	CCDS12374.1	1																																																																																								0.249743		TCGA-HZ-8315-01A-11D-2396-08	0.652	LSM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466321.1	1	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	1.940000	-20.000000	1	0.270000			0	37	37	0	174	172	1		1	1		0	0	33	0	0	1.000000	1	0	56	0	141	0	37	174
ZNF43	7594	broad.mit.edu	37	19	21990677	21990677	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:21990677A>G	ENST00000354959.4	-	4	2331	c.2162T>C	c.(2161-2163)cTt>cCt	p.L721P	ZNF43_ENST00000595461.1_Missense_Mutation_p.L715P|ZNF43_ENST00000598381.1_Missense_Mutation_p.L715P|ZNF43_ENST00000594012.1_Missense_Mutation_p.L715P	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	721					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		ATGTTCAATAAGGTTTGAGGA	0.358																																						ENST00000354959.4	1.000000	0.830000	1	9.500000e-01	0.990000	0.981239	0.990000	1.000000																										0				51						c.(2161-2163)cTt>cCt		zinc finger protein 43							55.0	59.0	57.0					19																	21990677		2203	4300	6503	SO:0001583	missense	7594	0	0					g.chr19:21990677A>G	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2162T>C	chr19.hg19:g.21990677A>G	ENSP00000347045:p.Leu721Pro	0					ZNF43_ENST00000594012.1_Missense_Mutation_p.L715P|ZNF43_ENST00000598381.1_Missense_Mutation_p.L715P|ZNF43_ENST00000595461.1_Missense_Mutation_p.L715P	p.L721P	NM_003423.3	NP_003414.2	0	0	0	1.968727	P17038	ZNF43_HUMAN		4	2331	-		Renal(1328;0.000219)|Hepatocellular(1079;0.121)	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	1	1	hg19	c.2162T>C	CCDS12413.2	1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159953	0.38119	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.53857	0.6	1.76	1.76	0.24704	1.76	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.76033	0.3931	M	0.93808	3.46	0.23572	N	0.99739	D	0.89917	1.0	D	0.97110	1.0	T	0.62539	-0.6833	9	0.87932	D	0	.	8.2856	0.31926	1.0:0.0:0.0:0.0	.	721	P17038	ZNF43_HUMAN	P	720;721	ENSP00000347045:L721P	ENSP00000347045:L721P	L	-	2	0	0	ZNF43	21782517	21782517	0.247000	0.23920	0.003000	0.11579	0.850000	0.48378	2.617000	0.46385	0.808000	0.34231	0.254000	0.18369	CTT	0.249743		TCGA-HZ-8315-01A-11D-2396-08	0.358	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.940000	-20.000000	1	0.270000	NM_003423		0	56	56	0	316	310	1		1	0		0	0	52	0	0	1.000000	5.143540e-01	0	0	0	11	0	56	316
CHST8	64377	broad.mit.edu	37	19	34180278	34180278	+	Silent	SNP	C	C	T	rs150945646		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:34180278C>T	ENST00000262622.4	+	2	869	c.111C>T	c.(109-111)ctC>ctT	p.L37L	CHST8_ENST00000604556.1_3'UTR|CHST8_ENST00000438847.3_Silent_p.L37L|CHST8_ENST00000434302.1_Silent_p.L37L	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	37					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					CTACGGAGCTCGCCCCCCAGC	0.632																																						ENST00000262622.4	0.870000	0.530000	7.900000e-01	6.100000e-01	0.690000	0.705811	0.690000	0.700000																										0				27						c.(109-111)ctC>ctT		carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8		C	,,	0,4406		0,0,2203	81.0	82.0	82.0		111,111,111	0.5	0.8	19	dbSNP_134	82	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	CHST8	NM_001127895.1,NM_001127896.1,NM_022467.3	,,	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	,,	37/425,37/425,37/425	34180278	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	64377	11	121406	44				g.chr19:34180278C>T	AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.111C>T	chr19.hg19:g.34180278C>T		0					CHST8_ENST00000438847.3_Silent_p.L37L|CHST8_ENST00000434302.1_Silent_p.L37L|CHST8_ENST00000604556.1_3'UTR	p.L37L	NM_022467.3	NP_071912.2	0	0	0	1.968727	Q9H2A9	CHST8_HUMAN		2	869	+	Esophageal squamous(110;0.162)		Q9H3N2	Silent	SNP	ENST00000262622.4	1	1	hg19	c.111C>T	CCDS12433.1	0																																																																																								0.249743		TCGA-HZ-8315-01A-11D-2396-08	0.632	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.940000	-2.920853	1	0.270000	NM_022467		0	56	55	0	521	514	0		1			0	0	96	0	0	1.000000	0	0	0	0	0	0	56	521
PSG9	5678	broad.mit.edu	37	19	43766196	43766196	+	Silent	SNP	G	G	A	rs150952802		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:43766196G>A	ENST00000270077.3	-	3	621	c.525C>T	c.(523-525)gaC>gaT	p.D175D	PSG9_ENST00000593948.1_Silent_p.D175D|PSG9_ENST00000443718.3_Intron|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000244293.7_Silent_p.D175D|PSG9_ENST00000418820.2_Intron	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	175	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GGTAGCTTGCGTCCAGAGTCT	0.532																																						ENST00000270077.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				41						c.(523-525)gaC>gaT		pregnancy specific beta-1-glycoprotein 9							246.0	238.0	241.0					19																	43766196		2203	4300	6503	SO:0001819	synonymous_variant	5678	1	121412	43				g.chr19:43766196G>A	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.525C>T	chr19.hg19:g.43766196G>A		1					PSG9_ENST00000418820.2_Intron|PSG9_ENST00000593948.1_Silent_p.D175D|PSG9_ENST00000244293.7_Silent_p.D175D|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000443718.3_Intron	p.D175D	NM_002784.3	NP_002775.3	1	4	5	2.702820	Q00887	PSG9_HUMAN		3	621	-		Prostate(69;0.00682)	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Silent	SNP	ENST00000270077.3	1	1	hg19	c.525C>T	CCDS12618.1	1																																																																																								0.460199		TCGA-HZ-8315-01A-11D-2396-08	0.532	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	0	0	1	2	2	2	2	0	0	0	0	247	247	247	246	1	1.940000	-20.000000	1	0.270000	NM_002784		0	777	773	0	1352	1339	1		1			0	0	247	0	0	1.000000	0	0	0	0	0	0	777	1352
KCNC3	3748	broad.mit.edu	37	19	50823922	50823922	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:50823922G>A	ENST00000477616.1	-	3	2392	c.2098C>T	c.(2098-2100)Cgc>Tgc	p.R700C	KCNC3_ENST00000474951.1_Missense_Mutation_p.R16C|KCNC3_ENST00000391818.2_Silent_p.A36A|KCNC3_ENST00000376959.2_Missense_Mutation_p.R700C	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	700					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	CGGCTATAGCGGCCACGGCTT	0.652																																					Melanoma(91;1496 2324 50908)	ENST00000477616.1	1.000000	0.690000	1	8.400000e-01	0.990000	0.942602	0.990000	1.000000																										0				13						c.(2098-2100)Cgc>Tgc		potassium voltage-gated channel, Shaw-related subfamily, member 3	Dalfampridine(DB06637)						51.0	45.0	47.0					19																	50823922		2203	4300	6503	SO:0001583	missense	3748	6	121400	35				g.chr19:50823922G>A	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.2098C>T	chr19.hg19:g.50823922G>A	ENSP00000434241:p.Arg700Cys	0					KCNC3_ENST00000474951.1_Missense_Mutation_p.R16C|KCNC3_ENST00000391818.2_Silent_p.A36A|KCNC3_ENST00000376959.2_Missense_Mutation_p.R700C	p.R700C	NM_004977.2	NP_004968.2	1	2	3	2.051604	Q14003	KCNC3_HUMAN		3	2392	-		all_neural(266;0.057)|Ovarian(192;0.208)		Missense_Mutation	SNP	ENST00000477616.1	1	1	hg19	c.2098C>T	CCDS12793.1	1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399766	0.42512	.	.	ENSG00000131398	ENST00000376959;ENST00000474951;ENST00000477616;ENST00000443843	D;D	0.99032	-5.29;-5.35	2.72	2.72	0.32119	2.72	2.72	0.32119	.	1.188930	0.06896	U	0.805029	D	0.98454	0.9485	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.71414	0.973;0.876	D	0.95938	0.8944	10	0.87932	D	0	.	9.0178	0.36182	0.0:0.0:1.0:0.0	.	700;700	Q14003;E7ETH1	KCNC3_HUMAN;.	C	700;16;700;514	ENSP00000366158:R700C;ENSP00000434241:R700C	ENSP00000366158:R700C	R	-	1	0	0	KCNC3	55515734	55515734	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	3.340000	0.52143	1.540000	0.49301	0.460000	0.39030	CGC	0.277800		TCGA-HZ-8315-01A-11D-2396-08	0.652	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314288.2	1	0	1	2	2	2	2	0	0	0	0	33	33	33	32	1	1.940000	-13.862510	1	0.270000	NM_004977		0	27	27	0	174	170	1		1	1		0	0	33	0	0	1.000000	1.972223e-01	0	3	0	3	0	27	174
MUC16	94025	broad.mit.edu	37	19	9026241	9026241	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:9026241G>A	ENST00000397910.4	-	14	36948	c.36745C>T	c.(36745-36747)Cgc>Tgc	p.R12249C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12251	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCCAGTGCGACGCATGTCC	0.552																																						ENST00000397910.4	1.000000	0.790000	9.800000e-01	8.600000e-01	0.930000	0.929411	0.930000	0.990000																										0				590						c.(36745-36747)Cgc>Tgc		mucin 16, cell surface associated							244.0	223.0	230.0					19																	9026241		2076	4214	6290	SO:0001583	missense	94025	2	121040	36				g.chr19:9026241G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36745C>T	chr19.hg19:g.9026241G>A	ENSP00000381008:p.Arg12249Cys	1						p.R12249C	NM_024690.2	NP_078966.2	0	1	1	1.750363	Q8WXI7	MUC16_HUMAN		14	36948	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.36745C>T	CCDS54212.1	1	.	.	.	.	.	.	.	.	.	.	g	6.444	0.450006	0.12223	.	.	ENSG00000181143	ENST00000397910	T	0.39056	1.1	2.58	0.112	0.14623	2.58	0.112	0.14623	.	.	.	.	.	T	0.29524	0.0736	M	0.71581	2.175	.	.	.	P	0.46277	0.875	B	0.28553	0.091	T	0.39121	-0.9629	8	0.87932	D	0	.	3.3118	0.07020	0.1519:0.0:0.5975:0.2506	.	12249	B5ME49	.	C	12249	ENSP00000381008:R12249C	ENSP00000381008:R12249C	R	-	1	0	0	MUC16	8887241	8887241	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.995000	0.01472	0.109000	0.17891	0.195000	0.17529	CGC	0.156069		TCGA-HZ-8315-01A-11D-2396-08	0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	152	152	152	151	1	1.940000	-20.000000	1	0.270000	NM_024690		0	102	101	0	555	550	1		1	1		0	0	152	0	0	1.000000	8.170057e-01	0	19	0	0	0	102	555
MUC16	94025	broad.mit.edu	37	19	9047967	9047967	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:9047967A>G	ENST00000397910.4	-	5	33867	c.33664T>C	c.(33664-33666)Ttt>Ctt	p.F11222L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11224	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGATTTGAAAACGCACTGGTC	0.478																																						ENST00000397910.4	0.920000	0.360000	7.900000e-01	4.800000e-01	0.620000	0.640900	0.620000	0.620000																										0				590						c.(33664-33666)Ttt>Ctt		mucin 16, cell surface associated							66.0	57.0	60.0					19																	9047967		1906	4106	6012	SO:0001583	missense	94025	0	0					g.chr19:9047967A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33664T>C	chr19.hg19:g.9047967A>G	ENSP00000381008:p.Phe11222Leu	1						p.F11222L	NM_024690.2	NP_078966.2	0	1	1	1.750363	Q8WXI7	MUC16_HUMAN		5	33867	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	0	1	hg19	c.33664T>C	CCDS54212.1	0	.	.	.	.	.	.	.	.	.	.	a	8.449	0.852667	0.17106	.	.	ENSG00000181143	ENST00000397910	T	0.02446	4.29	3.15	-6.29	0.02013	3.15	-6.29	0.02013	.	.	.	.	.	T	0.02533	0.0077	L	0.34521	1.04	.	.	.	B	0.23735	0.09	B	0.30029	0.11	T	0.41752	-0.9491	8	0.87932	D	0	.	5.9379	0.19175	0.2189:0.4934:0.0:0.2877	.	11222	B5ME49	.	L	11222	ENSP00000381008:F11222L	ENSP00000381008:F11222L	F	-	1	0	0	MUC16	8908967	8908967	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.762000	0.04745	-2.422000	0.00563	0.398000	0.26397	TTT	0.156069		TCGA-HZ-8315-01A-11D-2396-08	0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	1.940000	-19.718750	1	0.270000	NM_024690		0	13	12	0	117	117	1		1	1		0	0	24	0	0	0.999606	4.738197e-01	0	14	0	1	0	13	117
ZNF320	162967	broad.mit.edu	37	19	53384748	53384748	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr19:53384748G>A	ENST00000595635.1	-	8	1132	c.631C>T	c.(631-633)Cac>Tac	p.H211Y	ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.H211Y|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TCTCCCCTGTGAATTCTAGTA	0.378																																						ENST00000595635.1	1.000000	0.800000	1	9.100000e-01	0.990000	0.968927	0.990000	1.000000																										0				24						c.(631-633)Cac>Tac		zinc finger protein 320							108.0	98.0	101.0					19																	53384748		2203	4300	6503	SO:0001583	missense	162967	0	0					g.chr19:53384748G>A	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.631C>T	chr19.hg19:g.53384748G>A	ENSP00000473091:p.His211Tyr	0					ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.H211Y|ZNF320_ENST00000600930.1_Intron	p.H211Y	NM_207333.2	NP_997216.2	1	2	3	2.051604	A2RRD8	ZN320_HUMAN		8	1132	-			Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	1	1	hg19	c.631C>T	CCDS33095.1	1	.	.	.	.	.	.	.	.	.	.	-	18.41	3.616954	0.66672	.	.	ENSG00000182986	ENST00000391781	T	0.67523	-0.27	1.75	1.75	0.24633	1.75	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84602	0.5508	H	0.94698	3.57	0.32028	N	0.599881	D	0.89917	1.0	D	0.87578	0.998	D	0.85343	0.1097	9	0.72032	D	0.01	.	10.504	0.44823	0.0:0.0:1.0:0.0	.	211	A2RRD8	ZN320_HUMAN	Y	211	ENSP00000375660:H211Y	ENSP00000375660:H211Y	H	-	1	0	0	ZNF320	58076560	58076560	0.994000	0.37717	0.002000	0.10522	0.509000	0.34042	2.912000	0.48782	0.960000	0.38005	0.194000	0.17425	CAC	0.277800		TCGA-HZ-8315-01A-11D-2396-08	0.378	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	1	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	1.940000	-20.000000	1	0.270000	NM_207333		0	66	65	0	417	414	1		1	1		0	0	80	0	0	1.000000	9.634747e-01	0	4	0	32	0	66	417
ATAD3C	219293	broad.mit.edu	37	1	1389850	1389850	+	Silent	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:1389850G>A	ENST00000378785.2	+	4	1343	c.348G>A	c.(346-348)acG>acA	p.T116T		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	116							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCCGCATCACGGTGCTTGAGG	0.667																																						ENST00000378785.2	1.000000	0.120000	6.100000e-01	2.300000e-01	0.380000	0.426281	0.380000	0.330000																										0				7						c.(346-348)acG>acA		ATPase family, AAA domain containing 3C							23.0	39.0	34.0					1																	1389850		692	1591	2283	SO:0001819	synonymous_variant	219293	0	0					g.chr1:1389850G>A	AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.348G>A	chr1.hg19:g.1389850G>A		0						p.T116T	NM_001039211.2	NP_001034300.2	1	2	3	2.037207	Q5T2N8	ATD3C_HUMAN		4	1343	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	Q8N1Z5	Silent	SNP	ENST00000378785.2	0	1	hg19	c.348G>A	CCDS44039.1	0																																																																																								0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.667	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001279.3	1	0	0	2	2	2	2	0	0	0	0	19	19	19	19	1	1.940000	-7.442292	1	0.270000	NM_001039211		0	4	4	0	85	85	0		1	0		0	0	19	0	0	0.891987	3.583373e-03	0	0	0	2	0	4	85
PLCH2	9651	broad.mit.edu	37	1	2418364	2418364	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:2418364G>A	ENST00000419816.2	+	6	1109	c.835G>A	c.(835-837)Gag>Aag	p.E279K	PLCH2_ENST00000378488.3_Missense_Mutation_p.E279K|PLCH2_ENST00000378486.3_Missense_Mutation_p.E279K|PLCH2_ENST00000449969.1_Missense_Mutation_p.E252K|PLCH2_ENST00000288766.5_Intron			O75038	PLCH2_HUMAN	phospholipase C, eta 2	279					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		TGTGACCCTCGAGAGCTGCCA	0.627																																						ENST00000419816.2	1.000000	0.620000	1	8.700000e-01	0.990000	0.952489	0.990000	1.000000																										0				20						c.(835-837)Gag>Aag		phospholipase C, eta 2							50.0	54.0	52.0					1																	2418364		2121	4240	6361	SO:0001583	missense	9651	1	120952	31				g.chr1:2418364G>A	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.835G>A	chr1.hg19:g.2418364G>A	ENSP00000389803:p.Glu279Lys	0					PLCH2_ENST00000378486.3_Missense_Mutation_p.E279K|PLCH2_ENST00000378488.3_Missense_Mutation_p.E279K|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000449969.1_Missense_Mutation_p.E252K	p.E279K			1	2	3	2.037207	O75038	PLCH2_HUMAN		6	1109	+	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	0	1	hg19	c.835G>A		1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983526	0.53827	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.19938	2.11;2.11;2.11	3.87	3.87	0.44632	3.87	3.87	0.44632	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.120124	0.56097	D	0.000039	T	0.42787	0.1218	M	0.69823	2.125	0.80722	D	1	D;D;P;D	0.69078	0.995;0.997;0.942;0.991	P;D;P;P	0.67548	0.869;0.952;0.563;0.876	T	0.34329	-0.9833	10	0.37606	T	0.19	.	14.9819	0.71316	0.0:0.0:1.0:0.0	.	126;67;252;279	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	K	252;279;279;126;67	ENSP00000397289:E252K;ENSP00000367747:E279K;ENSP00000367749:E279K	ENSP00000278878:E67K	E	+	1	0	0	PLCH2	2408224	2408224	1.000000	0.71417	0.844000	0.33320	0.547000	0.35210	6.280000	0.72626	2.006000	0.58801	0.561000	0.74099	GAG	0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.627	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.940000	-18.299340	1	0.270000	NM_014638		0	10	10	0	54	53	1		1	0		0	0	9	0	0	0.997454	2.659207e-01	0	1	0	5	0	10	54
PINK1	65018	broad.mit.edu	37	1	20964418	20964418	+	Silent	SNP	G	G	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:20964418G>C	ENST00000321556.4	+	2	565	c.471G>C	c.(469-471)ctG>ctC	p.L157L		NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGAGTATCTGATAGGGCAGT	0.547																																					Esophageal Squamous(145;853 1803 8146 34412 35011)	ENST00000321556.4	1.000000	0.740000	1	8.500000e-01	0.980000	0.943427	0.980000	1.000000																										0				14						c.(469-471)ctG>ctC		PTEN induced putative kinase 1							80.0	85.0	83.0					1																	20964418		2203	4300	6503	SO:0001819	synonymous_variant	65018	0	0					g.chr1:20964418G>C	AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.471G>C	chr1.hg19:g.20964418G>C		0						p.L157L	NM_032409.2	NP_115785.1	1	2	3	2.037843	Q9BXM7	PINK1_HUMAN		2	565	+		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	Q8N6T9|Q8NBU3|Q96DE4	Silent	SNP	ENST00000321556.4	1	1	hg19	c.471G>C	CCDS211.1	1																																																																																								0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.547	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	1.940000	-20.000000	1	0.270000	NM_032409		0	52	52	0	346	341	1		1	1		0	0	67	0	0	1.000000	1	0	40	0	189	0	52	346
COL16A1	1307	broad.mit.edu	37	1	32137235	32137235	+	Missense_Mutation	SNP	G	G	A	rs372854054		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:32137235G>A	ENST00000373672.3	-	48	3647	c.3131C>T	c.(3130-3132)cCg>cTg	p.P1044L	COL16A1_ENST00000271069.6_Missense_Mutation_p.P1044L	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1044	Collagen-like 6.|Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TGGAGGACCCGGGGAGCCCCT	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		18366	0.001		0.0	False		,,,				2504	0.0				Colon(143;498 1786 21362 25193 36625)	ENST00000373672.3	1.000000	0.610000	1	7.600000e-01	0.940000	0.901949	0.940000	1.000000																										0				48						c.(3130-3132)cCg>cTg		collagen, type XVI, alpha 1		G	LEU/PRO	0,3814		0,0,1907	43.0	50.0	48.0		3131	5.2	1.0	1		48	2,8232		0,2,4115	no	missense	COL16A1	NM_001856.3	98	0,2,6022	AA,AG,GG		0.0243,0.0,0.0166	probably-damaging	1044/1605	32137235	2,12046	1907	4117	6024	SO:0001583	missense	1307	23	120852	43				g.chr1:32137235G>A	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3131C>T	chr1.hg19:g.32137235G>A	ENSP00000362776:p.Pro1044Leu	0					COL16A1_ENST00000271069.6_Missense_Mutation_p.P1044L	p.P1044L	NM_001856.3	NP_001847.3	1	2	3	2.037843	Q07092	COGA1_HUMAN		48	3647	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	1	1	hg19	c.3131C>T	CCDS41297.1	1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217879	0.58560	0.0	2.43E-4	ENSG00000084636	ENST00000373672;ENST00000271069	D;D	0.94184	-3.37;-3.17	5.21	5.21	0.72293	5.21	5.21	0.72293	.	0.218028	0.39834	N	0.001253	D	0.96352	0.8810	M	0.78285	2.405	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.96373	0.9275	10	0.62326	D	0.03	.	14.6242	0.68608	0.0:0.0:1.0:0.0	.	1044;1044	Q07092;Q07092-2	COGA1_HUMAN;.	L	1044	ENSP00000362776:P1044L;ENSP00000271069:P1044L	ENSP00000271069:P1044L	P	-	2	0	0	COL16A1	31909822	31909822	1.000000	0.71417	0.957000	0.39632	0.844000	0.47949	3.842000	0.55858	2.599000	0.87857	0.655000	0.94253	CCG	0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.940000	-2.668485	1	0.270000	NM_001856		0	21	20	0	147	147	1		1	1		0	0	30	0	0	0.999998	9.999991e-01	0	13	0	164	0	21	147
ZNF362	149076	broad.mit.edu	37	1	33745956	33745956	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:33745956G>A	ENST00000539719.1	+	5	751	c.581G>A	c.(580-582)cGc>cAc	p.R194H	ZNF362_ENST00000373428.5_Missense_Mutation_p.R194H	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	194				R -> L (in Ref. 1; AAL55863). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAACGCGGCCGCAAAAAGATC	0.647																																					Pancreas(162;1431 2676 35353 38425)	ENST00000539719.1	1.000000	0.070000	2.900000e-01	1.200000e-01	0.190000	0.237351	0.190000	0.170000																										0				10						c.(580-582)cGc>cAc		zinc finger protein 362							24.0	26.0	25.0					1																	33745956		2203	4300	6503	SO:0001583	missense	149076	0	0					g.chr1:33745956G>A		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.581G>A	chr1.hg19:g.33745956G>A	ENSP00000446335:p.Arg194His	0					ZNF362_ENST00000373428.5_Missense_Mutation_p.R194H	p.R194H	NM_152493.2	NP_689706.2	1	2	3	2.037843	Q5T0B9	ZN362_HUMAN		5	751	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	Q8WYU4	Missense_Mutation	SNP	ENST00000539719.1	0	1	hg19	c.581G>A	CCDS377.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.713649	0.96830	.	.	ENSG00000160094	ENST00000483388;ENST00000539719;ENST00000373428	T;T	0.09163	3.01;3.01	5.99	5.99	0.97316	5.99	5.99	0.97316	.	0.468737	0.18085	N	0.152172	T	0.37404	0.1002	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.02512	-1.1148	10	0.87932	D	0	-36.2752	18.0311	0.89285	0.0:0.0:1.0:0.0	.	194	Q5T0B9	ZN362_HUMAN	H	181;194;194	ENSP00000446335:R194H;ENSP00000362527:R194H	ENSP00000362527:R194H	R	+	2	0	0	ZNF362	33518543	33518543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.314000	0.96306	2.857000	0.98124	0.650000	0.86243	CGC	0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.647	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	0	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	1.940000	-2.803090	1	0.270000	NM_152493		0	6	6	0	251	248	0		1	0		0	0	38	0	0	0.964198	4.163360e-01	0	0	0	54	0	6	251
DOCK7	85440	broad.mit.edu	37	1	62954668	62954668	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:62954668A>C	ENST00000340370.5	-	41	5354	c.5337T>G	c.(5335-5337)gaT>gaG	p.D1779E	DOCK7_ENST00000251157.5_Missense_Mutation_p.D1801E	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1810	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GTTTCTTTGCATCCCGATTAG	0.328																																						ENST00000340370.5	1.000000	0.620000	1	7.300000e-01	0.870000	0.868529	0.870000	1.000000																										0				92						c.(5335-5337)gaT>gaG		dedicator of cytokinesis 7							140.0	141.0	140.0					1																	62954668		2203	4300	6503	SO:0001583	missense	85440	0	0					g.chr1:62954668A>C		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5337T>G	chr1.hg19:g.62954668A>C	ENSP00000340742:p.Asp1779Glu	0					DOCK7_ENST00000251157.5_Missense_Mutation_p.D1801E	p.D1779E	NM_033407.2	NP_212132.2	1	2	3	2.037843	Q96N67	DOCK7_HUMAN		41	5354	-			Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	1	1	hg19	c.5337T>G	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.05|17.05	3.289641|3.289641	0.59976|0.59976	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|T;T	.|0.05319	.|3.46;3.46	5.74|5.74	0.777|0.777	0.18538|0.18538	5.74|5.74	0.777|0.777	0.18538|0.18538	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.07908|0.07908	0.0198|0.0198	L|L	0.46885|0.46885	1.475|1.475	0.58432|0.58432	D|D	0.999998|0.999998	.|B;P;P;P;P;P	.|0.51351	.|0.264;0.46;0.944;0.765;0.494;0.627	.|B;B;P;B;B;B	.|0.46659	.|0.171;0.307;0.523;0.441;0.262;0.399	T|T	0.27673|0.27673	-1.0067|-1.0067	5|10	.|0.36615	.|T	.|0.2	.|.	9.7468|9.7468	0.40451|0.40451	0.7365:0.0:0.2635:0.0|0.7365:0.0:0.2635:0.0	.|.	.|1810;1801;1779;1770;1770;1801	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	G|E	973|1810;1801;1779;540	.|ENSP00000251157:D1801E;ENSP00000340742:D1779E	.|ENSP00000251157:D1801E	C|D	-|-	1|3	0|2	0|2	DOCK7|DOCK7	62727256|62727256	62727256|62727256	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.731000|0.731000	0.26058|0.26058	0.120000|0.120000	0.18254|0.18254	0.482000|0.482000	0.46254|0.46254	TGC|GAT	0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.328	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.940000	-14.474980	1	0.270000	NM_033407		0	34	34	0	259	258	1		1	1		0	0	48	0	0	1.000000	9.978092e-01	0	16	0	58	0	34	259
TCTEX1D1	200132	broad.mit.edu	37	1	67242967	67242967	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:67242967C>T	ENST00000282670.2	+	5	498	c.370C>T	c.(370-372)Cca>Tca	p.P124S		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	124										large_intestine(2)|lung(10)|skin(1)	13						CTTGATGATTCCACGGTATAA	0.383																																						ENST00000282670.2	1.000000	0.730000	1	8.200000e-01	0.930000	0.920342	0.930000	1.000000																										0				13						c.(370-372)Cca>Tca		Tctex1 domain containing 1							121.0	122.0	121.0					1																	67242967		2203	4300	6503	SO:0001583	missense	200132	0	0					g.chr1:67242967C>T	AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.370C>T	chr1.hg19:g.67242967C>T	ENSP00000282670:p.Pro124Ser	0						p.P124S	NM_152665.2	NP_689878.2	1	2	3	2.037843	Q8N7M0	TC1D1_HUMAN		5	498	+			Q06YR9|Q5VYE1	Missense_Mutation	SNP	ENST00000282670.2	1	1	hg19	c.370C>T	CCDS633.1	1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.582064	0.46006	.	.	ENSG00000152760	ENST00000282670	T	0.31247	1.5	5.83	5.83	0.93111	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.38692	0.1050	M	0.75264	2.295	0.80722	D	1	P	0.42123	0.771	P	0.48334	0.574	T	0.10154	-1.0642	10	0.44086	T	0.13	-5.2119	19.7289	0.96175	0.0:1.0:0.0:0.0	.	124	Q8N7M0	TC1D1_HUMAN	S	124	ENSP00000282670:P124S	ENSP00000282670:P124S	P	+	1	0	0	TCTEX1D1	67015555	67015555	1.000000	0.71417	0.977000	0.42913	0.029000	0.11900	5.357000	0.66058	2.770000	0.95276	0.655000	0.94253	CCA	0.275865		TCGA-HZ-8315-01A-11D-2396-08	0.383	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025399.2	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.940000	-20.000000	1	0.270000	NM_152665		0	73	72	0	515	513	1		1	0		0	0	65	0	0	1.000000	7.970409e-02	0	0	0	4	0	73	515
AMY2A	279	broad.mit.edu	37	1	104160219	104160219	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	C	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr1:104160219G>C	ENST00000414303.2	+	1	221	c.157G>C	c.(157-159)Gga>Cga	p.G53R		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	53					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	GAAGGGATTTGGAGGGGTTCA	0.408																																						ENST00000414303.2	1.000000	0.990000	1	9.900000e-01	0.990000	0.999725	0.990000	1.000000																										0				22						c.(157-159)Gga>Cga		amylase, alpha 2A (pancreatic)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)						285.0	237.0	253.0					1																	104160219		2201	4279	6480	SO:0001583	missense	279	0	0					g.chr1:104160219G>C	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.157G>C	chr1.hg19:g.104160219G>C	ENSP00000397582:p.Gly53Arg	0						p.G53R	NM_000699.2	NP_000690.1	1	2	3	2.045032	P04746	AMYP_HUMAN		1	221	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	1	1	hg19	c.157G>C	CCDS783.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.95|13.95	2.389476|2.389476	0.42410|0.42410	.|.	.|.	ENSG00000243480|ENSG00000243480	ENST00000414303;ENST00000393932|ENST00000423678	D|.	0.98249|.	-4.82|.	3.22|3.22	3.22|3.22	0.36961|0.36961	3.22|3.22	3.22|3.22	0.36961|0.36961	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);|.	0.049955|.	0.85682|.	D|.	0.000000|.	T|T	0.75613|0.75613	0.3873|0.3873	M|M	0.89534|0.89534	3.04|3.04	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.83275|.	0.994;0.996|.	T|T	0.81378|0.81378	-0.0960|-0.0960	10|5	0.87932|.	D|.	0|.	.|.	14.5293|14.5293	0.67912|0.67912	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	53;53|.	B9EJG1;P04746|.	.;AMYP_HUMAN|.	R|S	53|51	ENSP00000397582:G53R|.	ENSP00000377509:G53R|.	G|W	+|+	1|2	0|0	0|0	AMY2A|AMY2A	103961742|103961742	103961742|103961742	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.031000|0.031000	0.12232|0.12232	8.935000|8.935000	0.92923|0.92923	1.784000|1.784000	0.52394|0.52394	0.455000|0.455000	0.32223|0.32223	GGA|TGG	0.276834		TCGA-HZ-8315-01A-11D-2396-08	0.408	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	1	0	1	2	2	2	2	0	0	0	0	141	141	141	156	1	1.940000	-20.000000	1	0.270000	NM_000699		0	117	71	0	594	430	1		1	0		0	0	141	0	0	1.000000	1	0	0	0	162	0	117	594
ISM1	140862	broad.mit.edu	37	20	13260457	13260457	+	Silent	SNP	C	C	T	rs377766422		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr20:13260457C>T	ENST00000262487.4	+	3	561	c.555C>T	c.(553-555)gaC>gaT	p.D185D	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	185						extracellular region (GO:0005576)				NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						GTACCTCAGACGACAGCAACT	0.597																																						ENST00000262487.4	0.970000	0.510000	8.500000e-01	6.100000e-01	0.720000	0.740312	0.720000	0.720000																										0				17						c.(553-555)gaC>gaT		isthmin 1, angiogenesis inhibitor		C		0,3820		0,0,1910	61.0	70.0	67.0		555	-12.1	0.4	20		67	1,8231		0,1,4115	no	coding-synonymous	ISM1	NM_080826.1		0,1,6025	TT,TC,CC		0.0121,0.0,0.0083		185/465	13260457	1,12051	1910	4116	6026	SO:0001819	synonymous_variant	140862	17	120832	43				g.chr20:13260457C>T	AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.555C>T	chr20.hg19:g.13260457C>T		0					TASP1_ENST00000539805.1_Intron	p.D185D	NM_080826.1	NP_543016.1	0	0	0	2.006643	B1AKI9	ISM1_HUMAN		3	561	+			Q8WVH9	Silent	SNP	ENST00000262487.4	1	1	hg19	c.555C>T	CCDS46579.1	0																																																																																								0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.597	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078039.2	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.940000	-9.746629	1	0.270000			0	34	34	0	309	305	1		1	0		0	0	62	0	0	1.000000	9.922688e-01	0	0	0	71	0	34	309
PLTP	5360	broad.mit.edu	37	20	44539794	44539794	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr20:44539794G>C	ENST00000477313.1	-	2	791	c.197C>G	c.(196-198)tCt>tGt	p.S66C	PLTP_ENST00000420868.2_Missense_Mutation_p.S66C|PLTP_ENST00000372420.1_5'Flank|PLTP_ENST00000354050.4_Missense_Mutation_p.S66C|PLTP_ENST00000372431.3_Missense_Mutation_p.S66C|PLTP_ENST00000542937.1_Missense_Mutation_p.S86C			P55058	PLTP_HUMAN	phospholipid transfer protein	66					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				CACTTACTCAGAGATGTTGTA	0.637																																						ENST00000477313.1	1.000000	0.800000	1	8.900000e-01	0.990000	0.962854	0.990000	1.000000																										0				21						c.(196-198)tCt>tGt		phospholipid transfer protein							69.0	75.0	73.0					20																	44539794		2203	4300	6503	SO:0001583	missense	5360	0	0					g.chr20:44539794G>C	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.197C>G	chr20.hg19:g.44539794G>C	ENSP00000417138:p.Ser66Cys	0					PLTP_ENST00000542937.1_Missense_Mutation_p.S86C|PLTP_ENST00000372431.3_Missense_Mutation_p.S66C|PLTP_ENST00000354050.4_Missense_Mutation_p.S66C|PLTP_ENST00000420868.2_Missense_Mutation_p.S66C|PLTP_ENST00000372420.1_5'Flank	p.S66C			0	0	0	2.006643	P55058	PLTP_HUMAN		2	791	-		Myeloproliferative disorder(115;0.0122)	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	1	1	hg19	c.197C>G	CCDS13386.1	1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886362	0.72410	.	.	ENSG00000100979	ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T	0.06933	3.24;3.24;3.24;3.24;3.41	5.07	5.07	0.68467	5.07	5.07	0.68467	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.208418	0.48767	D	0.000178	T	0.24275	0.0588	M	0.64997	1.995	0.49687	D	0.999818	D;D;D;D;D;D	0.76494	0.994;0.997;0.999;0.999;0.999;0.999	P;P;D;D;D;D	0.70227	0.819;0.819;0.968;0.946;0.968;0.968	T	0.00086	-1.2094	10	0.62326	D	0.03	.	12.8555	0.57882	0.0:0.2974:0.7026:0.0	.	66;66;66;66;66;86	E7EV16;B4DRB4;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;PLTP_HUMAN;.	C	66;66;66;86;66	ENSP00000361508:S66C;ENSP00000335290:S66C;ENSP00000417138:S66C;ENSP00000440296:S86C;ENSP00000411671:S66C	ENSP00000335290:S66C	S	-	2	0	0	PLTP	43973201	43973201	0.997000	0.39634	0.964000	0.40570	0.993000	0.82548	2.708000	0.47152	2.636000	0.89361	0.467000	0.42956	TCT	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.637	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	1	0	1	2	2	2	2	0	0	0	0	98	98	98	97	1	1.940000	-3.075803	1	0.270000	NM_006227		0	71	70	0	447	443	1		1	1		0	0	98	0	0	1.000000	1	0	4	0	197	0	71	447
KCNB1	3745	broad.mit.edu	37	20	47990731	47990731	+	Missense_Mutation	SNP	G	G	A	rs368043123		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr20:47990731G>A	ENST00000371741.4	-	2	1532	c.1366C>T	c.(1366-1368)Cgg>Tgg	p.R456W		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	456					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	TCAATGCTCCGGGCAAAAGCA	0.453																																						ENST00000371741.4	1.000000	0.840000	1	9.200000e-01	0.990000	0.973316	0.990000	1.000000																										0				53						c.(1366-1368)Cgg>Tgg		potassium voltage-gated channel, Shab-related subfamily, member 1	Dalfampridine(DB06637)						173.0	160.0	165.0					20																	47990731		2203	4300	6503	SO:0001583	missense	3745	0	0					g.chr20:47990731G>A	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1366C>T	chr20.hg19:g.47990731G>A	ENSP00000360806:p.Arg456Trp	0						p.R456W	NM_004975.2	NP_004966.1	0	0	0	2.007955	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)	2	1532	-			Q14193	Missense_Mutation	SNP	ENST00000371741.4	1	1	hg19	c.1366C>T	CCDS13418.1	1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650170	0.67472	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	D	0.96940	-4.18	5.77	4.81	0.61882	5.77	4.81	0.61882	.	0.068374	0.64402	D	0.000015	D	0.97660	0.9233	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98457	1.0594	10	0.72032	D	0.01	.	16.1196	0.81342	0.0:0.0:0.8649:0.135	.	456	Q14721	KCNB1_HUMAN	W	456;411	ENSP00000360806:R456W	ENSP00000360806:R456W	R	-	1	2	2	KCNB1	47424138	47424138	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.569000	0.73992	1.552000	0.49463	0.655000	0.94253	CGG	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.453	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	1	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	1.940000	-2.443734	0	0.270000	NM_004975		0	106	106	0	661	657	1		1			0	0	112	0	0	1.000000	0	0	0	0	0	0	106	661
ADNP	23394	broad.mit.edu	37	20	49510803	49510803	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr20:49510803C>T	ENST00000396029.3	-	5	1015	c.448G>A	c.(448-450)Gat>Aat	p.D150N	ADNP_ENST00000396032.3_Missense_Mutation_p.D150N|ADNP_ENST00000349014.3_Missense_Mutation_p.D150N|ADNP_ENST00000371602.4_Missense_Mutation_p.D150N	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	150					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						TTAAGGCCATCATTTTTGTTT	0.398																																						ENST00000396029.3	1.000000	0.760000	9.900000e-01	8.300000e-01	0.910000	0.912477	0.910000	1.000000																										0				39						c.(448-450)Gat>Aat		activity-dependent neuroprotector homeobox							187.0	182.0	184.0					20																	49510803		2203	4300	6503	SO:0001583	missense	23394	0	0					g.chr20:49510803C>T	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.448G>A	chr20.hg19:g.49510803C>T	ENSP00000379346:p.Asp150Asn	0					ADNP_ENST00000349014.3_Missense_Mutation_p.D150N|ADNP_ENST00000396032.3_Missense_Mutation_p.D150N|ADNP_ENST00000371602.4_Missense_Mutation_p.D150N	p.D150N	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	0	0	0	2.007955	Q9H2P0	ADNP_HUMAN		5	1015	-			E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	1	1	hg19	c.448G>A	CCDS13433.1	1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.251232	0.39797	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032;ENST00000534467	T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.086182	0.85682	D	0.000000	T	0.59473	0.2196	N	0.19112	0.55	0.48571	D	0.999676	B	0.31318	0.319	B	0.29598	0.104	T	0.55535	-0.8126	10	0.31617	T	0.26	-14.7975	20.206	0.98277	0.0:1.0:0.0:0.0	.	150	Q9H2P0	ADNP_HUMAN	N	150	ENSP00000360662:D150N;ENSP00000342905:D150N;ENSP00000379346:D150N;ENSP00000379349:D150N;ENSP00000436181:D150N	ENSP00000342905:D150N	D	-	1	0	0	ADNP	48944210	48944210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.286000	0.58995	2.785000	0.95823	0.655000	0.94253	GAT	0.266037		TCGA-HZ-8315-01A-11D-2396-08	0.398	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	1	0	1	2	2	2	2	0	0	0	0	154	154	154	153	1	1.940000	-20.000000	1	0.270000	NM_181442		0	127	127	0	895	888	1		1	1		0	0	154	0	0	1.000000	9.999262e-01	0	20	0	75	0	127	895
ADAMTS5	11096	broad.mit.edu	37	21	28296738	28296738	+	Silent	SNP	G	G	A	rs11911960	byFrequency	TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr21:28296738G>A	ENST00000284987.5	-	8	2548	c.2427C>T	c.(2425-2427)agC>agT	p.S809S	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	809	Spacer.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GGCTCCAACCGCTATAGTTCA	0.443													G|||	43	0.00858626	0.0287	0.0043	5008	,	,		20333	0.001		0.0	False		,,,				2504	0.001				Esophageal Squamous(53;683 1080 10100 14424 45938)	ENST00000284987.5	1.000000	0.850000	1	9.200000e-01	0.990000	0.974852	0.990000	1.000000																										0				72						c.(2425-2427)agC>agT		ADAM metallopeptidase with thrombospondin type 1 motif, 5		G		94,4312	76.2+/-114.5	1,92,2110	175.0	169.0	171.0		2427	-9.2	0.1	21	dbSNP_120	171	1,8599	2.2+/-6.3	0,1,4299	no	coding-synonymous	ADAMTS5	NM_007038.3		1,93,6409	AA,AG,GG		0.0116,2.1335,0.7304		809/931	28296738	95,12911	2203	4300	6503	SO:0001819	synonymous_variant	11096	295	121412	59				g.chr21:28296738G>A	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2427C>T	chr21.hg19:g.28296738G>A		0					AP001601.2_ENST00000426771.1_RNA	p.S809S	NM_007038.3	NP_008969.2	1	2	3	2.017182	Q9UNA0	ATS5_HUMAN		8	2548	-			Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	1	0	hg19	c.2427C>T	CCDS13579.1	1																																																																																								0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.443	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	132	1	1.940000	-8.465305	1	0.270000			0	118	118	0	742	731	1		1	0		0	0	132	0	0	1.000000	2.504840e-01	0	0	0	7	0	118	742
THOC5	8563	broad.mit.edu	37	22	29913325	29913325	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr22:29913325C>A	ENST00000490103.1	-	16	1642	c.1520G>T	c.(1519-1521)tGc>tTc	p.C507F	THOC5_ENST00000397871.1_Missense_Mutation_p.C507F|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397872.1_Missense_Mutation_p.C507F|THOC5_ENST00000397873.2_Missense_Mutation_p.C507F	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	507					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GAGGTACTGGCAATCACTGGT	0.488																																						ENST00000490103.1	1.000000	0.660000	1	8.200000e-01	0.990000	0.934321	0.990000	1.000000																										0				21						c.(1519-1521)tGc>tTc		THO complex 5							124.0	100.0	108.0					22																	29913325		2203	4300	6503	SO:0001583	missense	8563	0	0					g.chr22:29913325C>A	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1520G>T	chr22.hg19:g.29913325C>A	ENSP00000420306:p.Cys507Phe	0					THOC5_ENST00000397873.2_Missense_Mutation_p.C507F|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Missense_Mutation_p.C507F|THOC5_ENST00000397872.1_Missense_Mutation_p.C507F	p.C507F	NM_003678.4	NP_003669.4	1	2	3	2.025855	Q13769	THOC5_HUMAN		16	1642	-			O60839|Q9UPZ5	Missense_Mutation	SNP	ENST00000490103.1	1	1	hg19	c.1520G>T	CCDS13859.1	1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760500	0.89932	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.39358	0.1075	M	0.65975	2.015	0.80722	D	1	D	0.55605	0.972	P	0.47528	0.549	T	0.19943	-1.0290	10	0.56958	D	0.05	-28.072	19.6653	0.95890	0.0:1.0:0.0:0.0	.	507	Q13769	THOC5_HUMAN	F	507	ENSP00000420306:C507F;ENSP00000380970:C507F;ENSP00000380969:C507F;ENSP00000380971:C507F	ENSP00000380969:C507F	C	-	2	0	0	THOC5	28243325	28243325	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.792000	0.69052	2.733000	0.93635	0.655000	0.94253	TGC	0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.488	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	1	0	1	2	2	2	2	0	0	0	0	29	29	29	28	1	1.940000	-20.000000	1	0.270000	NM_003678		0	22	22	0	140	139	1		1	1		0	0	29	0	0	0.999999	9.993355e-01	0	19	0	59	0	22	140
CNTNAP5	129684	broad.mit.edu	37	2	125281910	125281910	+	Missense_Mutation	SNP	C	C	T	rs17727261	byFrequency	TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr2:125281910C>T	ENST00000431078.1	+	9	1719	c.1355C>T	c.(1354-1356)tCg>tTg	p.S452L		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	452	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.		S -> L (in dbSNP:rs17727261).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTGTGGCACTCGGTTAGCATC	0.522													C|||	90	0.0179712	0.0015	0.0187	5008	,	,		17605	0.001		0.0626	False		,,,				2504	0.0112					ENST00000431078.1	1.000000	0.770000	1	9.100000e-01	0.990000	0.970097	0.990000	1.000000																										0				176						c.(1354-1356)tCg>tTg		contactin associated protein-like 5		C	LEU/SER	23,4135		0,23,2056	75.0	80.0	78.0	http://www.ncbi.nlm.nih.gov/pubmed?term	1355	5.9	0.9	2	dbSNP_123	78	429,8005		13,403,3801	yes	missense	CNTNAP5	NM_130773.2	145	13,426,5857	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	5.0866,0.5532,3.5896	benign	452/1307	125281910	452,12140	2079	4217	6296	SO:0001583	missense	129684	4107	121040	67				g.chr2:125281910C>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1355C>T	chr2.hg19:g.125281910C>T	ENSP00000399013:p.Ser452Leu	0						p.S452L	NM_130773.2	NP_570129.1	1	2	3	2.018485	Q8WYK1	CNTP5_HUMAN		9	1719	+			Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	1	0	hg19	c.1355C>T	CCDS46401.1	1	59	0.027014652014652016	2	0.0040650406504065045	9	0.024861878453038673	0	0.0	48	0.0633245382585752	C	15.22	2.768382	0.49680	0.005532	0.050866	ENSG00000155052	ENST00000431078	T	0.79033	-1.23	5.95	5.95	0.96441	5.95	5.95	0.96441	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.339680	0.21126	N	0.079740	T	0.34250	0.0891	M	0.66439	2.03	0.44337	D	0.997224	B	0.14805	0.011	B	0.11329	0.006	T	0.61584	-0.7033	10	0.54805	T	0.06	.	19.3736	0.94500	0.0:1.0:0.0:0.0	rs17727261;rs52806650;rs17727261	452	Q8WYK1	CNTP5_HUMAN	L	452	ENSP00000399013:S452L	ENSP00000399013:S452L	S	+	2	0	0	CNTNAP5	124998380	124998380	0.758000	0.28405	0.908000	0.35775	0.349000	0.29174	1.421000	0.34815	2.825000	0.97269	0.655000	0.94253	TCG	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.522	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.940000	-2.427948	0	0.270000			0	32	32	0	186	185	1		1	0		0	0	39	0	0	1.000000	0	0	0	0	1	0	32	186
THSD7B	80731	broad.mit.edu	37	2	138208441	138208441	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr2:138208441C>T	ENST00000409968.1	+	15	3164	c.2986C>T	c.(2986-2988)Ccc>Tcc	p.P996S	THSD7B_ENST00000413152.2_Missense_Mutation_p.P965S|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.P996S			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	996	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATGTGTCATTCCCTGCCCATT	0.363																																						ENST00000409968.1	1.000000	0.850000	1	9.900000e-01	0.990000	0.989123	0.990000	1.000000																										0				134						c.(2986-2988)Ccc>Tcc		thrombospondin, type I, domain containing 7B							111.0	104.0	106.0					2																	138208441		1844	4108	5952	SO:0001583	missense	80731	0	0					g.chr2:138208441C>T			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2986C>T	chr2.hg19:g.138208441C>T	ENSP00000387145:p.Pro996Ser	0					THSD7B_ENST00000272643.3_Missense_Mutation_p.P996S|THSD7B_ENST00000413152.2_Missense_Mutation_p.P965S|THSD7B_ENST00000543459.1_Intron	p.P996S			1	2	3	2.018485	Q9C0I4	THS7B_HUMAN		15	3164	+				Missense_Mutation	SNP	ENST00000409968.1	1	1	hg19	c.2986C>T		1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.784951	0.70222	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.62232	2.24;0.04;0.04	5.83	5.83	0.93111	5.83	5.83	0.93111	.	0.056119	0.64402	N	0.000001	T	0.78272	0.4257	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74668	-0.3588	10	0.38643	T	0.18	.	20.1996	0.98256	0.0:1.0:0.0:0.0	.	965	C9JKN6	.	S	996;996;965	ENSP00000387145:P996S;ENSP00000272643:P996S;ENSP00000413841:P965S	ENSP00000272643:P996S	P	+	1	0	0	THSD7B	137924911	137924911	1.000000	0.71417	0.951000	0.38953	0.314000	0.28054	4.906000	0.63293	2.776000	0.95493	0.650000	0.86243	CCC	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.363	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	0	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.940000	-17.608500	1	0.270000	XM_046570.9		0	31	31	0	159	158	1		1	0		0	0	25	0	0	1.000000	5.110579e-01	0	0	0	10	0	31	159
SCN1A	6323	broad.mit.edu	37	2	166904211	166904211	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr2:166904211C>G	ENST00000303395.4	-	8	1095	c.1096G>C	c.(1096-1098)Gat>Cat	p.D366H	SCN1A_ENST00000375405.3_Missense_Mutation_p.D366H|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.D366H|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.D366H			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	366			D -> E (in EIEE6; dbSNP:rs121917958). {ECO:0000269|PubMed:18413471}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGAAGGTATCAAAGCTTGTG	0.418																																						ENST00000303395.4	1.000000	0.740000	1	8.300000e-01	0.930000	0.926408	0.930000	1.000000																										0				200						c.(1096-1098)Gat>Cat		sodium channel, voltage-gated, type I, alpha subunit	Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)						109.0	109.0	109.0					2																	166904211		2203	4300	6503	SO:0001583	missense	6323	0	0					g.chr2:166904211C>G	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1096G>C	chr2.hg19:g.166904211C>G	ENSP00000303540:p.Asp366His	0					AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.D366H|SCN1A_ENST00000409050.1_Missense_Mutation_p.D366H|SCN1A_ENST00000423058.2_Missense_Mutation_p.D366H|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA	p.D366H			1	2	3	2.018485	P35498	SCN1A_HUMAN		8	1095	-			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	1	1	hg19	c.1096G>C	CCDS54413.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006572	0.74932	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97529	-4.42;-4.42;-4.42;-4.42	5.0	5.0	0.66597	5.0	5.0	0.66597	Ion transport (1);	0.000000	0.64402	D	0.000004	D	0.99149	0.9706	H	0.98111	4.15	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	P;D;D	0.97110	0.789;1.0;0.998	D	0.98988	1.0807	10	0.87932	D	0	.	18.6483	0.91419	0.0:1.0:0.0:0.0	.	366;366;366	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	H	366	ENSP00000407030:D366H;ENSP00000303540:D366H;ENSP00000364554:D366H;ENSP00000386312:D366H	ENSP00000303540:D366H	D	-	1	0	0	SCN1A	166612457	166612457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.773000	0.85462	2.492000	0.84095	0.655000	0.94253	GAT	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.418	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	1	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	1.940000	-20.000000	1	0.270000	NM_006920		0	72	72	0	495	494	1		1			0	0	105	0	0	1.000000	0	0	0	0	0	0	72	495
CYP26B1	56603	broad.mit.edu	37	2	72362468	72362468	+	Silent	SNP	G	G	A	rs145145054		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr2:72362468G>A	ENST00000001146.2	-	3	713	c.510C>T	c.(508-510)cgC>cgT	p.R170R	CYP26B1_ENST00000412253.1_5'UTR|CYP26B1_ENST00000546307.1_Silent_p.R95R	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	170					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TGCTCCAGGCGCGCAGTGTGT	0.622													g|||	1	0.000199681	0.0	0.0	5008	,	,		18933	0.0		0.0	False		,,,				2504	0.001					ENST00000001146.2	1.000000	0.870000	1	9.700000e-01	0.990000	0.986591	0.990000	1.000000																										0				28						c.(508-510)cgC>cgT		cytochrome P450, family 26, subfamily B, polypeptide 1		G		2,4404	4.2+/-10.8	0,2,2201	98.0	94.0	95.0		510	-10.1	0.1	2	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CYP26B1	NM_019885.2		0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231		170/513	72362468	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	56603	9	121412	42				g.chr2:72362468G>A		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.510C>T	chr2.hg19:g.72362468G>A		0					CYP26B1_ENST00000546307.1_Silent_p.R95R|CYP26B1_ENST00000412253.1_5'UTR	p.R170R	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	1	2	3	2.018485	Q9NR63	CP26B_HUMAN		3	713	-			B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	ENST00000001146.2	1	1	hg19	c.510C>T	CCDS1919.1	1																																																																																								0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.622	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	1	0	1	2	2	2	2	0	0	0	0	97	97	97	95	1	1.940000	-20.000000	1	0.270000	NM_019885		0	78	78	0	456	452	1		1	1		0	0	97	0	0	1.000000	1.601893e-01	0	2	0	3	0	78	456
HECW2	57520	broad.mit.edu	37	2	197183345	197183345	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr2:197183345C>T	ENST00000260983.3	-	9	2451	c.2269G>A	c.(2269-2271)Gaa>Aaa	p.E757K	HECW2_ENST00000409111.1_Missense_Mutation_p.E401K	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	757	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GCACTGCCTTCTTCTTGCGGT	0.657																																						ENST00000260983.3	1.000000	0.800000	1	9.300000e-01	0.990000	0.975877	0.990000	1.000000																										0				113						c.(2269-2271)Gaa>Aaa		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2							52.0	51.0	52.0					2																	197183345		2203	4300	6503	SO:0001583	missense	57520	0	0					g.chr2:197183345C>T	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2269G>A	chr2.hg19:g.197183345C>T	ENSP00000260983:p.Glu757Lys	0					HECW2_ENST00000409111.1_Missense_Mutation_p.E401K	p.E757K	NM_020760.1	NP_065811.1	0	1	1	2.014552	Q9P2P5	HECW2_HUMAN		9	2451	-			B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	1	1	hg19	c.2269G>A	CCDS33354.1	1	.	.	.	.	.	.	.	.	.	.	C	8.519	0.868363	0.17250	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.32515	1.45;1.48	4.91	4.91	0.64330	4.91	4.91	0.64330	.	1.013590	0.07918	N	0.975412	T	0.22742	0.0549	N	0.19112	0.55	0.33047	D	0.532252	B	0.23316	0.083	B	0.19946	0.027	T	0.04781	-1.0927	10	0.07813	T	0.8	.	16.4632	0.84070	0.0:1.0:0.0:0.0	.	757	Q9P2P5	HECW2_HUMAN	K	401;757	ENSP00000386775:E401K;ENSP00000260983:E757K	ENSP00000260983:E757K	E	-	1	0	0	HECW2	196891590	196891590	1.000000	0.71417	0.057000	0.19452	0.030000	0.12068	5.590000	0.67530	2.558000	0.86282	0.462000	0.41574	GAA	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.657	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	1.940000	-20.000000	1	0.270000	NM_020760		0	42	42	0	244	240	1		1	0		0	0	62	0	0	1.000000	3.969538e-01	0	0	0	9	0	42	244
SEC22C	9117	broad.mit.edu	37	3	42590112	42590112	+	Missense_Mutation	SNP	G	G	A	rs145549289	byFrequency	TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr3:42590112G>A	ENST00000273156.7	-	7	958	c.749C>T	c.(748-750)tCg>tTg	p.S250L	SEC22C_ENST00000417572.1_Missense_Mutation_p.S250L|SEC22C_ENST00000423701.2_Missense_Mutation_p.S228L|SEC22C_ENST00000536332.1_Missense_Mutation_p.S180L	NM_004206.3|NM_032970.3	NP_004197.1|NP_116752.1	Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	0					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		GCTGGCTCACGAGGTTTGGTC	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		16773	0.002		0.0	False		,,,				2504	0.0					ENST00000273156.7	1.000000	0.610000	1	7.400000e-01	0.880000	0.874588	0.880000	1.000000																										0				3						c.(748-750)tCg>tTg		SEC22 vesicle trafficking protein homolog C (S. cerevisiae)							91.0	81.0	84.0					3																	42590112		2203	4300	6503	SO:0001583	missense	9117	33	121412	44				g.chr3:42590112G>A	AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000273156.7:c.749C>T	chr3.hg19:g.42590112G>A	ENSP00000273156:p.Ser250Leu	0					SEC22C_ENST00000536332.1_Missense_Mutation_p.S180L|SEC22C_ENST00000417572.1_Missense_Mutation_p.S250L|SEC22C_ENST00000423701.2_Missense_Mutation_p.S228L	p.S250L	NM_004206.3|NM_032970.3	NP_004197.1|NP_116752.1	1	2	3	2.018515	Q9BRL7	SC22C_HUMAN		7	958	-			O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	ENST00000273156.7	1	1	hg19	c.749C>T	CCDS2699.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	15.00	2.702337	0.48307	.	.	ENSG00000093183	ENST00000423701;ENST00000273156;ENST00000417572;ENST00000536332	T;T;T;T	0.24151	2.23;2.22;2.22;1.87	3.71	-4.25	0.03766	3.71	-4.25	0.03766	.	.	.	.	.	T	0.14098	0.0341	N	0.22421	0.69	0.09310	N	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.27872	-1.0061	9	0.87932	D	0	.	5.8941	0.18929	0.5888:0.0:0.2683:0.143	.	180;228;250	F5H0H7;Q9BRL7-3;Q9BRL7-2	.;.;.	L	228;250;250;180	ENSP00000414576:S228L;ENSP00000273156:S250L;ENSP00000407564:S250L;ENSP00000439845:S180L	ENSP00000273156:S250L	S	-	2	0	0	SEC22C	42565116	42565116	0.017000	0.18338	0.000000	0.03702	0.029000	0.11900	0.171000	0.16685	-1.089000	0.03073	-0.182000	0.12963	TCG	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.547	SEC22C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254733.1	0	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.940000	-2.841989	1	0.270000	NM_004206		0	28	28	0	206	205	1		1	1		0	0	49	0	0	1.000000	9.999955e-01	0	20	0	128	0	28	206
CADPS	8618	broad.mit.edu	37	3	62535605	62535605	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr3:62535605G>A	ENST00000383710.4	-	11	2288	c.1939C>T	c.(1939-1941)Cag>Tag	p.Q647*	CADPS_ENST00000357948.3_Nonsense_Mutation_p.Q647*|CADPS_ENST00000283269.9_Nonsense_Mutation_p.Q647*	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	647					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GCATCCAGCTGAGGTACATTT	0.478																																						ENST00000383710.4	1.000000	0.680000	1	7.800000e-01	0.890000	0.888487	0.890000	1.000000																										0				92						c.(1939-1941)Cag>Tag		Ca++-dependent secretion activator							108.0	101.0	103.0					3																	62535605		2203	4300	6503	SO:0001587	stop_gained	8618	0	0					g.chr3:62535605G>A	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1939C>T	chr3.hg19:g.62535605G>A	ENSP00000373215:p.Gln647*	0					CADPS_ENST00000283269.9_Nonsense_Mutation_p.Q647*|CADPS_ENST00000357948.3_Nonsense_Mutation_p.Q647*	p.Q647*	NM_003716.3	NP_003707.2	1	2	3	2.018515	Q9ULU8	CAPS1_HUMAN		11	2288	-		Lung SC(41;0.0452)	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Nonsense_Mutation	SNP	ENST00000383710.4	0	1	hg19	c.1939C>T	CCDS46858.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.157087	0.99349	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000542833	.	.	.	4.71	4.71	0.59529	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	18.2011	0.89838	0.0:0.0:1.0:0.0	.	.	.	.	X	647;647;647;647;142	.	ENSP00000283269:Q647X	Q	-	1	0	0	CADPS	62510645	62510645	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.601000	0.98297	2.612000	0.88384	0.585000	0.79938	CAG	0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.478	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	1	0	1	2	2	2	2	0	0	0	0	89	89	89	88	1	1.940000	-3.075757	1	0.270000	NM_003716, NM_183393, NM_183394		0	57	56	0	416	413	1		1	0		0	0	89	0	0	1.000000	4.391032e-01	0	0	0	12	0	57	416
MFI2	4241	broad.mit.edu	37	3	196736601	196736601	+	Silent	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr3:196736601C>T	ENST00000296350.5	-	11	1526	c.1413G>A	c.(1411-1413)cgG>cgA	p.R471R		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	471	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		AGCGCTTGCCCCGAAGCTCAT	0.642																																						ENST00000296350.5	1.000000	0.660000	1	7.700000e-01	0.890000	0.889747	0.890000	1.000000																										0				20						c.(1411-1413)cgG>cgA		antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5							52.0	55.0	54.0					3																	196736601		2203	4300	6503	SO:0001819	synonymous_variant	4241	0	0					g.chr3:196736601C>T		CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.1413G>A	chr3.hg19:g.196736601C>T		0						p.R471R	NM_005929.5	NP_005920.2	1	2	3	2.018515	P08582	TRFM_HUMAN	Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	11	1526	-	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Q9BQE2	Silent	SNP	ENST00000296350.5	1	1	hg19	c.1413G>A	CCDS3325.1	1																																																																																								0.270984		TCGA-HZ-8315-01A-11D-2396-08	0.642	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340458.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	71	1	1.940000	-2.774755	1	0.270000			0	42	42	0	304	299	1		1	1		0	0	72	0	0	1.000000	9.998600e-01	0	33	0	65	0	42	304
DCUN1D4	23142	broad.mit.edu	37	4	52779460	52779460	+	Nonsense_Mutation	SNP	C	C	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr4:52779460C>G	ENST00000334635.5	+	10	905	c.725C>G	c.(724-726)tCa>tGa	p.S242*	DCUN1D4_ENST00000381441.3_Nonsense_Mutation_p.S207*|DCUN1D4_ENST00000381437.4_Nonsense_Mutation_p.S182*|DCUN1D4_ENST00000451288.2_Nonsense_Mutation_p.S286*	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	242	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			CATCAGCAATCAAAATACAAA	0.333																																						ENST00000334635.5	1.000000	0.590000	1	7.400000e-01	0.920000	0.888370	0.920000	1.000000																										0				9						c.(724-726)tCa>tGa		DCN1, defective in cullin neddylation 1, domain containing 4							75.0	74.0	74.0					4																	52779460		2202	4300	6502	SO:0001587	stop_gained	23142	0	0					g.chr4:52779460C>G	D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.725C>G	chr4.hg19:g.52779460C>G	ENSP00000334625:p.Ser242*	0					DCUN1D4_ENST00000381437.4_Nonsense_Mutation_p.S182*|DCUN1D4_ENST00000381441.3_Nonsense_Mutation_p.S207*|DCUN1D4_ENST00000451288.2_Nonsense_Mutation_p.S286*	p.S242*	NM_001040402.1	NP_001035492.1	1	2	3	2.034066	Q92564	DCNL4_HUMAN	GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)	10	905	+			B4DH25|Q7Z3F3|Q7Z6B8	Nonsense_Mutation	SNP	ENST00000334635.5	0	1	hg19	c.725C>G	CCDS33982.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.793471	0.98492	.	.	ENSG00000109184	ENST00000334635;ENST00000381441;ENST00000381437;ENST00000451288;ENST00000510808	.	.	.	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-10.8354	19.5352	0.95251	0.0:1.0:0.0:0.0	.	.	.	.	X	242;207;182;286;52	.	ENSP00000334625:S242X	S	+	2	0	0	DCUN1D4	52474217	52474217	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.850000	0.98022	0.650000	0.86243	TCA	0.274894		TCGA-HZ-8315-01A-11D-2396-08	0.333	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	1.940000	-20.000000	1	0.270000	NM_015115		0	21	19	0	151	151	0		1	0		0	0	30	0	0	0.999998	9.666357e-01	0	1	0	42	0	21	151
FCHSD1	89848	broad.mit.edu	37	5	141028827	141028827	+	Missense_Mutation	SNP	G	G	A	rs199923199	byFrequency	TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr5:141028827G>A	ENST00000435817.2	-	6	474	c.424C>T	c.(424-426)Cgg>Tgg	p.R142W	FCHSD1_ENST00000523856.1_5'Flank|FCHSD1_ENST00000522783.1_Missense_Mutation_p.R140W|FCHSD1_ENST00000522126.1_Missense_Mutation_p.R66W|FCHSD1_ENST00000519800.1_Missense_Mutation_p.R140W	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	142									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGCTCCCGGACAGACTGC	0.602													G|||	3	0.000599042	0.0	0.0	5008	,	,		18661	0.0		0.0	False		,,,				2504	0.0031					ENST00000435817.2	1.000000	0.760000	1	8.300000e-01	0.920000	0.921257	0.920000	1.000000																									FCHSD1/BRAF(2)	0				24						c.(424-426)Cgg>Tgg		FCH and double SH3 domains 1							120.0	139.0	132.0					5																	141028827		2138	4249	6387	SO:0001583	missense	89848	91	121194	53				g.chr5:141028827G>A	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.424C>T	chr5.hg19:g.141028827G>A	ENSP00000399259:p.Arg142Trp	0					FCHSD1_ENST00000519800.1_Missense_Mutation_p.R140W|FCHSD1_ENST00000523856.1_5'Flank|FCHSD1_ENST00000522783.1_Missense_Mutation_p.R140W|FCHSD1_ENST00000522126.1_Missense_Mutation_p.R66W	p.R142W	NM_033449.2	NP_258260.1	1	2	3	2.023144	Q86WN1	FCSD1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	6	474	-			Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	ENST00000435817.2	1	1	hg19	c.424C>T	CCDS47295.1	1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634995	0.67130	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000522783;ENST00000519800	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	5.11	3.09	0.35607	5.11	3.09	0.35607	.	0.154663	0.38436	N	0.001683	T	0.24314	0.0589	L	0.40543	1.245	0.32546	N	0.532998	D	0.76494	0.999	D	0.63793	0.918	T	0.24404	-1.0161	10	0.87932	D	0	-18.4959	11.9792	0.53111	0.0:0.0:0.5971:0.4029	.	142	Q86WN1	FCSD1_HUMAN	W	142;66;140;140	ENSP00000399259:R142W;ENSP00000427796:R66W;ENSP00000428677:R140W;ENSP00000428776:R140W	ENSP00000399259:R142W	R	-	1	2	2	FCHSD1	141009011	141009011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.385000	0.34408	1.129000	0.42072	0.561000	0.74099	CGG	0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.602	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	1	0	1	2	2	2	2	0	0	0	0	166	166	166	162	1	1.940000	-2.716734	1	0.270000	NM_033449		0	96	94	0	672	666	0		1	1		0	0	166	0	0	1.000000	8.912457e-01	0	12	0	16	0	96	672
ABCB5	340273	broad.mit.edu	37	7	20668330	20668330	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr7:20668330T>C	ENST00000404938.2	+	4	780	c.128T>C	c.(127-129)cTg>cCg	p.L43P		NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	43					antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GCTGATGGACTGGACATCACA	0.463																																						ENST00000404938.2	1.000000	0.600000	1	7.600000e-01	0.950000	0.904486	0.950000	1.000000																										0				77						c.(127-129)cTg>cCg		ATP-binding cassette, sub-family B (MDR/TAP), member 5							153.0	127.0	135.0					7																	20668330		1568	3582	5150	SO:0001583	missense	340273	0	0					g.chr7:20668330T>C	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.128T>C	chr7.hg19:g.20668330T>C	ENSP00000384881:p.Leu43Pro	0						p.L43P	NM_001163941.1	NP_001157413.1	0	1	1	2.013477	Q2M3G0	ABCB5_HUMAN		4	780	+			A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	0	1	hg19	c.128T>C	CCDS55090.1	1	.	.	.	.	.	.	.	.	.	.	T	8.232	0.804788	0.16467	.	.	ENSG00000004846	ENST00000404938	D	0.87256	-2.23	4.29	4.29	0.51040	4.29	4.29	0.51040	.	.	.	.	.	T	0.73984	0.3657	N	0.08118	0	0.80722	D	1	B	0.24768	0.111	B	0.25884	0.064	T	0.70978	-0.4725	9	0.39692	T	0.17	.	10.4067	0.44260	0.0:0.0:0.0:1.0	.	43	A7BKA4	.	P	43	ENSP00000384881:L43P	ENSP00000384881:L43P	L	+	2	0	0	ABCB5	20634855	20634855	1.000000	0.71417	0.931000	0.37212	0.198000	0.23893	3.709000	0.54853	1.892000	0.54788	0.377000	0.23210	CTG	0.268024		TCGA-HZ-8315-01A-11D-2396-08	0.463	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.940000	-20.000000	1	0.270000	NM_178559		0	18	18	0	121	121	1		1			0	0	17	0	0	0.999988	0	0	0	0	0	0	18	121
STK31	56164	broad.mit.edu	37	7	23826539	23826539	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr7:23826539C>T	ENST00000355870.3	+	20	2602	c.2483C>T	c.(2482-2484)tCa>tTa	p.S828L	STK31_ENST00000428484.1_Missense_Mutation_p.S805L|STK31_ENST00000354639.3_Missense_Mutation_p.S805L|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.S828L	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	828	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CCTTTAAATTCAGAAGTAAGT	0.353																																						ENST00000355870.3	1.000000	0.700000	1	8.000000e-01	0.900000	0.898842	0.900000	1.000000																										0				67						c.(2482-2484)tCa>tTa		serine/threonine kinase 31							146.0	136.0	139.0					7																	23826539		2203	4300	6503	SO:0001583	missense	56164	0	0					g.chr7:23826539C>T	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2483C>T	chr7.hg19:g.23826539C>T	ENSP00000348132:p.Ser828Leu	0					STK31_ENST00000354639.3_Missense_Mutation_p.S805L|STK31_ENST00000428484.1_Missense_Mutation_p.S805L|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.S828L	p.S828L	NM_031414.4	NP_113602.2	0	1	1	2.013477	Q9BXU1	STK31_HUMAN		20	2602	+			B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	1	1	hg19	c.2483C>T	CCDS5386.1	1	.	.	.	.	.	.	.	.	.	.	C	2.271	-0.366888	0.05069	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.72051	-0.62;2.32;-0.62;-0.62	5.45	3.65	0.41850	5.45	3.65	0.41850	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.330943	0.28659	N	0.014566	T	0.46171	0.1379	N	0.05574	-0.02	0.34125	D	0.664527	B;B	0.18461	0.012;0.028	B;B	0.19946	0.016;0.027	T	0.45948	-0.9226	10	0.10111	T	0.7	-0.3709	10.3969	0.44207	0.0:0.7807:0.0:0.2193	.	828;828	B4DZ06;Q9BXU1	.;STK31_HUMAN	L	828;828;805;805	ENSP00000348132:S828L;ENSP00000411852:S828L;ENSP00000346660:S805L;ENSP00000406146:S805L	ENSP00000346660:S805L	S	+	2	0	0	STK31	23793064	23793064	1.000000	0.71417	0.998000	0.56505	0.003000	0.03518	1.847000	0.39299	0.684000	0.31448	-0.225000	0.12378	TCA	0.268024		TCGA-HZ-8315-01A-11D-2396-08	0.353	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	1.940000	-19.999820	1	0.270000	NM_031414		0	64	63	0	458	457	1		1	0		0	0	96	0	0	1.000000	7.844409e-02	0	1	0	3	0	64	458
SOX17	64321	broad.mit.edu	37	8	55372342	55372342	+	Silent	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr8:55372342C>T	ENST00000297316.4	+	2	1236	c.1032C>T	c.(1030-1032)gaC>gaT	p.D344D		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	344	Gln/Pro-rich.|Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CCTGCCGGGACGGCACGGACC	0.692																																						ENST00000297316.4	1.000000	0.680000	1	9.100000e-01	0.990000	0.964044	0.990000	1.000000																										0				18						c.(1030-1032)gaC>gaT		SRY (sex determining region Y)-box 17							16.0	19.0	18.0					8																	55372342		2198	4296	6494	SO:0001819	synonymous_variant	64321	0	0					g.chr8:55372342C>T	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.1032C>T	chr8.hg19:g.55372342C>T		0						p.D344D	NM_022454.3	NP_071899.1	1	2	3	2.023674	Q9H6I2	SOX17_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)	2	1236	+		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)		Silent	SNP	ENST00000297316.4	0	1	hg19	c.1032C>T	CCDS6159.1	1																																																																																								0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.692	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.940000	-19.990370	1	0.270000			0	12	12	0	62	62	0		1	0		0	0	15	0	0	0.999389	2.758901e-01	0	0	0	6	0	12	62
ZNF483	158399	broad.mit.edu	37	9	114304519	114304519	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr9:114304519G>C	ENST00000309235.5	+	6	1462	c.1304G>C	c.(1303-1305)gGa>gCa	p.G435A	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						AATGAGAGTGGAGAAAAAACT	0.398																																						ENST00000309235.5	1.000000	0.780000	1	8.900000e-01	0.990000	0.960360	0.990000	1.000000																										0				31						c.(1303-1305)gGa>gCa		zinc finger protein 483							61.0	67.0	65.0					9																	114304519		2203	4300	6503	SO:0001583	missense	158399	0	0					g.chr9:114304519G>C	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1304G>C	chr9.hg19:g.114304519G>C	ENSP00000311679:p.Gly435Ala	0					ZNF483_ENST00000358151.4_Intron	p.G435A	NM_133464.2	NP_597721.2	0	1	1	2.014283	Q8TF39	ZN483_HUMAN		6	1462	+			Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	1	1	hg19	c.1304G>C	CCDS35106.1	1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638780	0.47153	.	.	ENSG00000173258	ENST00000309235	T	0.64618	-0.11	4.34	0.334	0.15948	4.34	0.334	0.15948	.	0.376195	0.19591	N	0.110638	T	0.53546	0.1803	M	0.67625	2.065	0.80722	D	1	B	0.19331	0.035	B	0.18561	0.022	T	0.49093	-0.8975	10	0.66056	D	0.02	-8.169	5.1547	0.15029	0.2783:0.1531:0.5686:0.0	.	435	Q8TF39	ZN483_HUMAN	A	435	ENSP00000311679:G435A	ENSP00000311679:G435A	G	+	2	0	0	ZNF483	113344340	113344340	0.988000	0.35896	0.063000	0.19743	0.538000	0.34931	1.257000	0.32932	0.066000	0.16515	0.650000	0.86243	GGA	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.398	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.940000	-2.966719	1	0.270000	XM_088567		0	62	62	0	392	390	1		1			0	0	62	0	0	1.000000	0	0	0	0	0	0	62	392
DDX31	64794	broad.mit.edu	37	9	135505739	135505739	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr9:135505739C>A	ENST00000372159.3	-	16	2009	c.1858G>T	c.(1858-1860)Gcc>Tcc	p.A620S	DDX31_ENST00000372153.1_Silent_p.P611P|DDX31_ENST00000438527.3_Missense_Mutation_p.A491S	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	620	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		CCAATCCGGGCGGTTCTTCCA	0.478																																						ENST00000372159.3	0.960000	0.640000	8.900000e-01	7.100000e-01	0.790000	0.805574	0.790000	0.800000																										0				27						c.(1858-1860)Gcc>Tcc		DEAD (Asp-Glu-Ala-Asp) box polypeptide 31							104.0	110.0	108.0					9																	135505739		2203	4300	6503	SO:0001583	missense	64794	0	0					g.chr9:135505739C>A	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.1858G>T	chr9.hg19:g.135505739C>A	ENSP00000361232:p.Ala620Ser	0					DDX31_ENST00000438527.3_Missense_Mutation_p.A491S|DDX31_ENST00000372153.1_Silent_p.P611P	p.A620S	NM_022779.7	NP_073616.6	0	1	1	2.014283	Q9H8H2	DDX31_HUMAN		16	2009	-			Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	1	1	hg19	c.1858G>T	CCDS6951.1	0	.	.	.	.	.	.	.	.	.	.	C	24.8	4.576160	0.86645	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000438527	T;T	0.77358	-1.09;-1.09	5.54	5.54	0.83059	5.54	5.54	0.83059	Helicase, C-terminal (3);	0.045953	0.85682	D	0.000000	D	0.90280	0.6960	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91727	0.5393	10	0.87932	D	0	-21.3098	18.551	0.91065	0.0:1.0:0.0:0.0	.	620	Q9H8H2	DDX31_HUMAN	S	620;620;491	ENSP00000361232:A620S;ENSP00000387730:A491S	ENSP00000361228:A620S	A	-	1	0	0	DDX31	134495560	134495560	1.000000	0.71417	0.991000	0.47740	0.920000	0.55202	6.339000	0.72969	2.619000	0.88677	0.650000	0.86243	GCC	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.478	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	1	0	1	2	2	2	2	0	0	0	0	116	116	116	116	1	1.940000	-3.318794	1	0.270000	NM_138620		0	82	82	0	675	668	1		1	1		0	0	116	0	0	1.000000	5.971098e-01	0	5	0	13	0	82	675
MAN1B1	11253	broad.mit.edu	37	9	139994279	139994279	+	Missense_Mutation	SNP	G	G	A	rs138090529	byFrequency	TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr9:139994279G>A	ENST00000371589.4	+	6	935	c.862G>A	c.(862-864)Ggt>Agt	p.G288S	MAN1B1_ENST00000474902.1_5'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	288					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		GTTTGGCCTCGGTCTCACACT	0.582													G|||	4	0.000798722	0.003	0.0	5008	,	,		22234	0.0		0.0	False		,,,				2504	0.0					ENST00000371589.4	1.000000	0.910000	1	9.900000e-01	0.990000	0.994466	0.990000	1.000000																										0				14						c.(862-864)Ggt>Agt		mannosidase, alpha, class 1B, member 1		G	SER/GLY	7,4399	12.9+/-30.5	0,7,2196	204.0	162.0	176.0		862	4.8	1.0	9	dbSNP_134	176	0,8600		0,0,4300	yes	missense	MAN1B1	NM_016219.3	56	0,7,6496	AA,AG,GG		0.0,0.1589,0.0538	probably-damaging	288/700	139994279	7,12999	2203	4300	6503	SO:0001583	missense	11253	14	121412	45				g.chr9:139994279G>A	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.862G>A	chr9.hg19:g.139994279G>A	ENSP00000360645:p.Gly288Ser	0					MAN1B1_ENST00000474902.1_5'UTR	p.G288S	NM_016219.4	NP_057303.2	0	1	1	2.014283	Q9UKM7	MA1B1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0878)	6	935	+	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	ENST00000371589.4	1	1	hg19	c.862G>A	CCDS7029.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.47|19.47	3.834053|3.834053	0.71373|0.71373	0.001589|0.001589	0.0|0.0	ENSG00000177239|ENSG00000177239	ENST00000371589|ENST00000535144	T|.	0.73469|.	-0.75|.	4.79|4.79	4.79|4.79	0.61399|0.61399	4.79|4.79	4.79|4.79	0.61399|0.61399	.|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|T	0.73321|0.73321	0.3572|0.3572	M|M	0.69248|0.69248	2.105|2.105	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.997;0.997;0.999|.	T|T	0.73603|0.73603	-0.3930|-0.3930	9|5	.|.	.|.	.|.	-24.0316|-24.0316	16.7961|16.7961	0.85602|0.85602	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	189;252;288;189|.	B4DPS9;B4DR05;Q9UKM7;Q68D80|.	.;.;MA1B1_HUMAN;.|.	S|Q	288|261	ENSP00000360645:G288S|.	.|.	G|R	+|+	1|2	0|0	0|0	MAN1B1|MAN1B1	139114100|139114100	139114100|139114100	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.045000|0.045000	0.14185|0.14185	9.492000|9.492000	0.97957|0.97957	2.221000|2.221000	0.72209|0.72209	0.561000|0.561000	0.74099|0.74099	GGT|CGG	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.582	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	1	0	1	2	2	2	2	0	0	0	0	102	102	102	101	1	1.940000	-2.478464	0	0.270000	NM_016219		0	68	68	0	367	364	1		1	1		0	0	102	0	0	1.000000	9.999997e-01	0	27	0	92	0	68	367
EXD3	54932	broad.mit.edu	37	9	140218269	140218269	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr9:140218269C>T	ENST00000340951.4	-	19	2287	c.2092G>A	c.(2092-2094)Gac>Aac	p.D698N	EXD3_ENST00000342129.4_Missense_Mutation_p.D349N	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						AGGGAGCAGTCGACCGAGAGG	0.672																																						ENST00000340951.4	1.000000	0.610000	1	7.600000e-01	0.940000	0.904131	0.940000	1.000000																										0				12						c.(2092-2094)Gac>Aac		exonuclease 3'-5' domain containing 3							26.0	31.0	29.0					9																	140218269		2080	4224	6304	SO:0001583	missense	54932	2	120438	31				g.chr9:140218269C>T		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.2092G>A	chr9.hg19:g.140218269C>T	ENSP00000340474:p.Asp698Asn	0					EXD3_ENST00000342129.4_Missense_Mutation_p.D349N	p.D698N	NM_017820.3	NP_060290.3	0	1	1	2.014283	Q9NX53	MUT7B_HUMAN		19	2287	-			Q6P1M1|Q8IXT8	Missense_Mutation	SNP	ENST00000340951.4	1	1	hg19	c.2092G>A	CCDS48066.1	1	.	.	.	.	.	.	.	.	.	.	C	3.497	-0.102696	0.06967	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	T;T	0.63417	-0.04;0.62	3.9	1.53	0.23141	3.9	1.53	0.23141	.	0.123662	0.53938	D	0.000054	T	0.35307	0.0927	N	0.13235	0.315	0.24060	N	0.996012	P;P	0.46064	0.872;0.87	B;B	0.40134	0.274;0.32	T	0.27191	-1.0081	10	0.14252	T	0.57	.	5.8079	0.18450	0.0:0.6142:0.0:0.3858	.	349;698	Q8N9H8-3;Q8N9H8	.;MUT7_HUMAN	N	349;698	ENSP00000343705:D349N;ENSP00000340474:D698N	ENSP00000340474:D698N	D	-	1	0	0	EXD3	139338090	139338090	0.153000	0.22777	0.245000	0.24217	0.031000	0.12232	0.399000	0.20916	0.567000	0.29293	0.305000	0.20034	GAC	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.672	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	1.940000	-20.000000	1	0.270000	NM_017820		0	21	21	0	143	139	1		1	1		0	0	37	0	0	0.999998	8.826903e-01	0	3	0	25	0	21	143
MELK	9833	broad.mit.edu	37	9	36651774	36651774	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr9:36651774T>G	ENST00000298048.2	+	12	1137	c.953T>G	c.(952-954)cTt>cGt	p.L318R	MELK_ENST00000543751.1_Missense_Mutation_p.L286R|MELK_ENST00000538311.1_Missense_Mutation_p.L124R|MELK_ENST00000536860.1_Missense_Mutation_p.L270R|MELK_ENST00000545008.1_Missense_Mutation_p.L247R|MELK_ENST00000541717.1_Missense_Mutation_p.L318R|MELK_ENST00000536329.1_Missense_Mutation_p.L247R|MELK_ENST00000536987.1_Missense_Mutation_p.L187R	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	318	UBA-like.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GCTACCTATCTTCTGCTTCTA	0.418																																					Ovarian(82;980 1317 7225 14391 18624)	ENST00000298048.2	0.210000	0.090000	1.800000e-01	1.100000e-01	0.140000	0.156312	0.140000	0.140000																										0				29						c.(952-954)cTt>cGt		maternal embryonic leucine zipper kinase							234.0	232.0	232.0					9																	36651774		2203	4300	6503	SO:0001583	missense	9833	0	0					g.chr9:36651774T>G	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.953T>G	chr9.hg19:g.36651774T>G	ENSP00000298048:p.Leu318Arg	0					MELK_ENST00000541717.1_Missense_Mutation_p.L318R|MELK_ENST00000543751.1_Missense_Mutation_p.L286R|MELK_ENST00000536329.1_Missense_Mutation_p.L247R|MELK_ENST00000545008.1_Missense_Mutation_p.L247R|MELK_ENST00000538311.1_Missense_Mutation_p.L124R|MELK_ENST00000536987.1_Missense_Mutation_p.L187R|MELK_ENST00000536860.1_Missense_Mutation_p.L270R	p.L318R	NM_014791.3	NP_055606.1	1	2	3	2.024828	Q14680	MELK_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	12	1137	+		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	0	1	hg19	c.953T>G	CCDS6606.1	0	.	.	.	.	.	.	.	.	.	.	T	18.91	3.723067	0.68959	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.73575	-0.56;0.41;0.19;0.72;0.1;-0.76;-0.46;-0.57	5.63	4.45	0.53987	5.63	4.45	0.53987	.	0.056841	0.64402	D	0.000001	T	0.80581	0.4650	L	0.57536	1.79	0.58432	D	0.999995	D;D;P;P;D;P;P	0.62365	0.983;0.982;0.746;0.548;0.991;0.923;0.761	D;D;P;B;P;P;B	0.65684	0.937;0.914;0.508;0.328;0.86;0.771;0.21	T	0.81158	-0.1060	10	0.59425	D	0.04	-12.4522	9.0796	0.36542	0.162:0.0:0.0:0.838	.	238;247;270;318;247;286;318	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	R	318;124;187;247;270;247;318;286	ENSP00000298048:L318R;ENSP00000438226:L124R;ENSP00000439184:L187R;ENSP00000445452:L247R;ENSP00000439792:L270R;ENSP00000443550:L247R;ENSP00000437804:L318R;ENSP00000441596:L286R	ENSP00000298048:L318R	L	+	2	0	0	MELK	36641774	36641774	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.724000	0.47285	2.145000	0.66743	0.533000	0.62120	CTT	0.271966		TCGA-HZ-8315-01A-11D-2396-08	0.418	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	0	0	1	2	2	2	2	0	0	0	0	242	242	242	240	1	1.940000	-2.969780	1	0.270000	NM_014791		0	28	27	0	1423	1410	0		1	0		0	0	242	0	0	1.000000	1.649973e-02	0	0	0	10	0	28	1423
CACNA1B	774	broad.mit.edu	37	9	140952517	140952517	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chr9:140952517G>A	ENST00000371372.1	+	28	4268	c.4123G>A	c.(4123-4125)Gtg>Atg	p.V1375M	CACNA1B_ENST00000371357.1_Missense_Mutation_p.V1376M|CACNA1B_ENST00000277549.5_Missense_Mutation_p.V571M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.V1376M|CACNA1B_ENST00000371363.1_Missense_Mutation_p.V1375M|CACNA1B_ENST00000277551.2_Missense_Mutation_p.V1375M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1375					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAAACACTCCGTGGATGCCAC	0.557																																						ENST00000371372.1	1.000000	0.640000	1	7.600000e-01	0.890000	0.882651	0.890000	1.000000																										0				80						c.(4123-4125)Gtg>Atg		calcium channel, voltage-dependent, N type, alpha 1B subunit	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)						149.0	138.0	142.0					9																	140952517		2011	4194	6205	SO:0001583	missense	774	4	120952	37				g.chr9:140952517G>A	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4123G>A	chr9.hg19:g.140952517G>A	ENSP00000360423:p.Val1375Met	0					CACNA1B_ENST00000277551.2_Missense_Mutation_p.V1375M|CACNA1B_ENST00000277549.5_Missense_Mutation_p.V571M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.V1376M|CACNA1B_ENST00000371363.1_Missense_Mutation_p.V1375M|CACNA1B_ENST00000371357.1_Missense_Mutation_p.V1376M	p.V1375M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	0	1	1	2.014283	Q00975	CAC1B_HUMAN		28	4268	+	all_cancers(76;0.166)		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	1	1	hg19	c.4123G>A	CCDS59522.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939034	0.73557	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.120881	0.56097	D	0.000031	D	0.96571	0.8881	N	0.01809	-0.71	0.80722	D	1	B;D;D	0.89917	0.219;1.0;1.0	B;D;D	0.80764	0.052;0.994;0.994	D	0.97604	1.0125	10	0.38643	T	0.18	.	19.4443	0.94840	0.0:0.0:1.0:0.0	.	1375;1376;1375	B1AQK4;B1AQK7;B1AQK6	.;.;.	M	1375;1375;571;1375;1376;1376	ENSP00000360423:V1375M;ENSP00000277551:V1375M;ENSP00000277549:V571M;ENSP00000360414:V1375M;ENSP00000360408:V1376M;ENSP00000360406:V1376M	ENSP00000277549:V571M	V	+	1	0	0	CACNA1B	140072338	140072338	1.000000	0.71417	0.938000	0.37757	0.920000	0.55202	9.725000	0.98778	2.682000	0.91365	0.555000	0.69702	GTG	0.269013		TCGA-HZ-8315-01A-11D-2396-08	0.557	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.940000	-15.479160	1	0.270000	NM_000718		0	36	36	0	262	260	1		1			0	0	47	0	0	1.000000	0	0	0	0	0	0	36	262
ARHGAP6	395	broad.mit.edu	37	X	11157013	11157013	+	Silent	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:11157013G>A	ENST00000337414.4	-	13	3767	c.2895C>T	c.(2893-2895)aaC>aaT	p.N965N	ARHGAP6_ENST00000534860.1_Intron|ARHGAP6_ENST00000303025.6_Silent_p.N762N|ARHGAP6_ENST00000380736.1_Silent_p.N762N	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	965					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GGGCATCGGGGTTGTCGGTCG	0.741																																						ENST00000337414.4	1.000000	0.320000	1	5.000000e-01	0.730000	0.738314	0.730000	1.000000																										0				38						c.(2893-2895)aaC>aaT		Rho GTPase activating protein 6							8.0	8.0	8.0					X																	11157013		2148	4218	6366	SO:0001819	synonymous_variant	395	0	0					g.chrX:11157013G>A	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2895C>T	chrX.hg19:g.11157013G>A							ARHGAP6_ENST00000534860.1_Intron|ARHGAP6_ENST00000303025.6_Silent_p.N762N|ARHGAP6_ENST00000380736.1_Silent_p.N762N	p.N965N	NM_013427.2	NP_038286.2	0	1	1		O43182	RHG06_HUMAN		13	3767	-			B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Silent	SNP	ENST00000337414.4	0	1	hg19	c.2895C>T	CCDS14140.1	0																																																																																								0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.741	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.940000	-14.399860	1	0.270000	NM_013427		0	6	6	0	56	55	0		1	0		0	0	10	0	0	0.964019	3.565390e-02	0	0	0	3	0	6	56
DCAF12L2	340578	broad.mit.edu	37	X	125298663	125298663	+	Silent	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:125298663G>A	ENST00000360028.2	-	1	1271	c.1245C>T	c.(1243-1245)gaC>gaT	p.D415D	DCAF12L2_ENST00000538699.1_Silent_p.D415D			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	415										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TCACCCAGACGTCATCTTGGT	0.617																																						ENST00000360028.2	1.000000	0.820000	1	9.000000e-01	0.980000	0.962663	0.980000	1.000000																										0				64						c.(1243-1245)gaC>gaT		DDB1 and CUL4 associated factor 12-like 2							102.0	104.0	104.0					X																	125298663		2203	4300	6503	SO:0001819	synonymous_variant	340578	2	121408	34				g.chrX:125298663G>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1245C>T	chrX.hg19:g.125298663G>A							DCAF12L2_ENST00000538699.1_Silent_p.D415D	p.D415D			0	1	1		Q5VW00	DC122_HUMAN		1	1271	-			B2RN42	Silent	SNP	ENST00000360028.2	1	1	hg19	c.1245C>T	CCDS43991.1	1																																																																																								0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.617	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	1	0	1	2	2	2	2	0	0	0	0	101	101	101	99	1	1.940000	-20.000000	1	0.270000	NM_001013628		0	120	119	0	778	765	0		1			0	0	101	0	0	1.000000	0	0	0	0	0	0	120	778
RBBP7	5931	broad.mit.edu	37	X	16876907	16876907	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:16876907C>T	ENST00000380087.2	-	4	733	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	RBBP7_ENST00000380084.4_Missense_Mutation_p.E169K|RBBP7_ENST00000404022.1_Missense_Mutation_p.E116K			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	125					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					CGGTTTACTTCTCCTTCGTGA	0.393																																						ENST00000380087.2	1.000000	0.700000	1	7.900000e-01	0.890000	0.892026	0.890000	1.000000																										0				25						c.(373-375)Gaa>Aaa		retinoblastoma binding protein 7							234.0	185.0	202.0					X																	16876907		2203	4300	6503	SO:0001583	missense	5931	0	0					g.chrX:16876907C>T	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.373G>A	chrX.hg19:g.16876907C>T	ENSP00000369427:p.Glu125Lys						RBBP7_ENST00000404022.1_Missense_Mutation_p.E116K|RBBP7_ENST00000380084.4_Missense_Mutation_p.E169K	p.E125K			0	1	1		Q16576	RBBP7_HUMAN		4	733	-	Hepatocellular(33;0.0997)		Q5JP00	Missense_Mutation	SNP	ENST00000380087.2	1	1	hg19	c.373G>A	CCDS14179.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.395799	0.96009	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000416035	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.01	5.17	5.17	0.71159	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85762	0.5772	H	0.96720	3.87	0.80722	D	1	P;D;D	0.76494	0.932;0.999;0.976	P;D;P	0.68765	0.631;0.96;0.494	D	0.90904	0.4771	10	0.87932	D	0	-0.0253	16.9044	0.86122	0.0:1.0:0.0:0.0	.	116;125;169	E9PC52;Q16576;Q5JP00	.;RBBP7_HUMAN;.	K	125;169;116;45	ENSP00000369427:E125K;ENSP00000369424:E169K;ENSP00000386068:E116K;ENSP00000392714:E45K	ENSP00000369424:E169K	E	-	1	0	0	RBBP7	16786828	16786828	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.772000	0.85439	2.286000	0.76751	0.594000	0.82650	GAA	0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.393	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.940000	-20.000000	1	0.270000	NM_002893		0	68	66	0	494	491	1		1	1		0	0	79	0	0	1.000000	1	0	221	0	206	0	68	494
NLGN3	54413	broad.mit.edu	37	X	70367846	70367846	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:70367846C>T	ENST00000358741.3	+	2	550	c.247C>T	c.(247-249)Cgt>Tgt	p.R83C	NLGN3_ENST00000536169.1_Missense_Mutation_p.R83C|NLGN3_ENST00000374051.3_Missense_Mutation_p.R83C	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	83					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CGGCGAGAAACGTTTCCTGCC	0.642																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	ENST00000358741.3	1.000000	0.710000	1	8.700000e-01	0.990000	0.954204	0.990000	1.000000																										0				37						c.(247-249)Cgt>Tgt		neuroligin 3							56.0	46.0	50.0					X																	70367846		2203	4298	6501	SO:0001583	missense	54413	0	0					g.chrX:70367846C>T	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.247C>T	chrX.hg19:g.70367846C>T	ENSP00000351591:p.Arg83Cys						NLGN3_ENST00000536169.1_Missense_Mutation_p.R83C|NLGN3_ENST00000374051.3_Missense_Mutation_p.R83C	p.R83C	NM_181303.1	NP_851820.1	0	1	1		Q9NZ94	NLGN3_HUMAN		2	550	+	Renal(35;0.156)		B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	1	1	hg19	c.247C>T	CCDS55441.1	1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395069	0.62066	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000395855;ENST00000358741	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	4.41	4.41	0.53225	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.94915	0.8356	H	0.99425	4.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96501	0.9371	10	0.87932	D	0	.	13.1622	0.59550	0.1595:0.8405:0.0:0.0	.	83;83;83	D3DVV1;B7Z5Y1;Q9NZ94-2	.;.;.	C	83	ENSP00000445298:R83C;ENSP00000363163:R83C;ENSP00000379196:R83C;ENSP00000351591:R83C	ENSP00000351591:R83C	R	+	1	0	0	NLGN3	70284571	70284571	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.908000	0.48750	2.044000	0.60594	0.436000	0.28706	CGT	0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.642	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	35	1	1.940000	-20.000000	1	0.270000	NM_018977		0	26	26	0	157	151	1		1	0		0	0	37	0	0	1.000000	2.173538e-02	0	0	0	2	0	26	157
ABCB7	22	broad.mit.edu	37	X	74282184	74282184	+	Silent	SNP	C	C	T	rs371978286		TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:74282184C>T	ENST00000373394.3	-	14	1921	c.1914G>A	c.(1912-1914)tcG>tcA	p.S638S	ABCB7_ENST00000534570.1_5'Flank|ABCB7_ENST00000339447.4_Silent_p.S598S|ABCB7_ENST00000253577.3_Silent_p.S639S			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	638	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TCGAATCTAACGATGAAGTAG	0.353													C|||	2	0.000529801	0.0	0.0029	3775	,	,		13370	0.0		0.0	False		,,,				2504	0.0					ENST00000373394.3	1.000000	0.740000	1	8.700000e-01	0.990000	0.953382	0.990000	1.000000																										0				20						c.(1912-1914)tcG>tcA		ATP-binding cassette, sub-family B (MDR/TAP), member 7		C		0,3835		0,0,1632,571	82.0	73.0	76.0		1917	-0.5	1.0	X		76	1,6727		0,1,2427,1872	no	coding-synonymous	ABCB7	NM_004299.3		0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095		639/754	74282184	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	22	1	121386	38				g.chrX:74282184C>T	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1914G>A	chrX.hg19:g.74282184C>T							ABCB7_ENST00000534570.1_5'Flank|ABCB7_ENST00000339447.4_Silent_p.S598S|ABCB7_ENST00000253577.3_Silent_p.S639S	p.S638S			0	1	1		O75027	ABCB7_HUMAN		14	1921	-			G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Silent	SNP	ENST00000373394.3	1	1	hg19	c.1914G>A		1																																																																																								0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.353	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	1.940000	-18.697620	1	0.270000	NM_004299		0	41	40	0	258	256	1		1	0		0	0	42	0	0	1.000000	9.993014e-01	0	0	0	72	0	41	258
CYLC1	1538	broad.mit.edu	37	X	83128929	83128929	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:83128929T>G	ENST00000329312.4	+	4	1250	c.1213T>G	c.(1213-1215)Ttc>Gtc	p.F405V		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	405					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GAAAATTACATTCTCTACTGA	0.318																																						ENST00000329312.4	1.000000	0.590000	1	7.500000e-01	0.940000	0.899132	0.940000	1.000000																										0				58						c.(1213-1215)Ttc>Gtc		cylicin, basic protein of sperm head cytoskeleton 1							28.0	22.0	24.0					X																	83128929		2190	4288	6478	SO:0001583	missense	1538	0	0					g.chrX:83128929T>G	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1213T>G	chrX.hg19:g.83128929T>G	ENSP00000331556:p.Phe405Val							p.F405V	NM_021118.1	NP_066941.1	0	1	1		P35663	CYLC1_HUMAN		4	1250	+			A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	0	1	hg19	c.1213T>G	CCDS35341.1	1	.	.	.	.	.	.	.	.	.	.	t	0.010	-1.788629	0.00623	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.17370	2.28	3.29	-0.897	0.10553	3.29	-0.897	0.10553	.	.	.	.	.	T	0.03959	0.0111	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37934	-0.9684	9	0.02654	T	1	29.047	2.6173	0.04907	0.2556:0.0:0.3484:0.396	.	405;405	P35663;F5H4V5	CYLC1_HUMAN;.	V	405	ENSP00000331556:F405V	ENSP00000331556:F405V	F	+	1	0	0	CYLC1	83015585	83015585	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.233000	0.09041	-0.546000	0.06216	-0.175000	0.13238	TTC	0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.318	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	1	0	1	2	2	2	2	0	0	0	0	14	14	14	13	1	1.940000	-3.024453	1	0.270000	NM_021118		0	18	18	0	123	122	1		1			0	0	14	0	0	0.999987	0	0	0	0	0	0	18	123
MTM1	4534	broad.mit.edu	37	X	149839952	149839952	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8315-01A-11D-2396-08	TCGA-HZ-8315-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde75dc0-9d77-41e0-b20e-df1f53944288	0f6b2835-2fa6-48d2-9d05-1a6db3f410af	g.chrX:149839952G>A	ENST00000370396.2	+	15	1750	c.1696G>A	c.(1696-1698)Gaa>Aaa	p.E566K	MTM1_ENST00000543350.1_Missense_Mutation_p.E451K|MTM1_ENST00000542741.1_3'UTR|MTM1_ENST00000413012.2_Missense_Mutation_p.E529K|MTM1_ENST00000306167.7_3'UTR	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	566					endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.E566K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					CTTACGCGACGAATACATAAA	0.522																																						ENST00000370396.2	1.000000	0.650000	1	7.600000e-01	0.880000	0.883291	0.880000	1.000000																										1	Substitution - Missense(1)	p.E566K(1)	lung(1)	26						c.(1696-1698)Gaa>Aaa		myotubularin 1							117.0	93.0	101.0					X																	149839952		2203	4300	6503	SO:0001583	missense	4534	0	0					g.chrX:149839952G>A	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1696G>A	chrX.hg19:g.149839952G>A	ENSP00000359423:p.Glu566Lys						MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.E451K|MTM1_ENST00000413012.2_Missense_Mutation_p.E529K|MTM1_ENST00000542741.1_3'UTR	p.E566K	NM_000252.2	NP_000243.1	0	1	1		Q13496	MTM1_HUMAN		15	1750	+	Acute lymphoblastic leukemia(192;6.56e-05)		A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	1	1	hg19	c.1696G>A	CCDS14694.1	1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781327	0.31502	.	.	ENSG00000171100	ENST00000370396;ENST00000543350;ENST00000413012	D;D;D	0.96011	-3.88;-3.65;-3.85	4.85	4.85	0.62838	4.85	4.85	0.62838	.	0.256266	0.40554	N	0.001065	D	0.91690	0.7373	L	0.28400	0.85	0.34666	D	0.723206	B;B	0.31435	0.323;0.323	B;B	0.25884	0.064;0.064	D	0.94029	0.7299	10	0.72032	D	0.01	.	17.4112	0.87486	0.0:0.0:1.0:0.0	.	529;566	B7Z491;Q13496	.;MTM1_HUMAN	K	566;451;529	ENSP00000359423:E566K;ENSP00000439784:E451K;ENSP00000389157:E529K	ENSP00000359423:E566K	E	+	1	0	0	MTM1	149590610	149590610	1.000000	0.71417	0.022000	0.16811	0.059000	0.15707	5.349000	0.66010	2.123000	0.65237	0.600000	0.82982	GAA	0.270000		TCGA-HZ-8315-01A-11D-2396-08	0.522	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	1	0	1	2	2	2	2	0	0	0	0	65	65	65	62	1	1.940000	-20.000000	1	0.270000	NM_000252		0	40	40	0	292	289	1		1	0		0	0	65	0	0	1.000000	8.874977e-01	0	0	0	30	0	40	292
