#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CTNNA3	29119	broad.mit.edu	37	10	68940142	68940142	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr10:68940142C>T	ENST00000433211.2	-	7	1154	c.980G>A	c.(979-981)cGg>cAg	p.R327Q	CTNNA3_ENST00000545309.1_Missense_Mutation_p.R327Q|CTNNA3_ENST00000373744.4_Missense_Mutation_p.R327Q	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.R327Q(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TGCGATAATCCGCTCTCGGTG	0.517																																						ENST00000433211.2	1.000000	0.370000	0.850000	0.480000	0.630000	0.662434	0.630000	0.600000																										2	Substitution - Missense(2)	p.R327Q(2)	skin(2)	95						c.(979-981)cGg>cAg		catenin (cadherin-associated protein), alpha 3							147.0	126.0	133.0					10																	68940142		2203	4300	6503	SO:0001583	missense	29119	1	121400	29				g.chr10:68940142C>T	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.980G>A	chr10.hg19:g.68940142C>T	ENSP00000389714:p.Arg327Gln	0					CTNNA3_ENST00000545309.1_Missense_Mutation_p.R327Q|CTNNA3_ENST00000373744.4_Missense_Mutation_p.R327Q	p.R327Q	NM_013266.2	NP_037398.2	1	2	3	2.005453				7	1154	-				Missense_Mutation	SNP	ENST00000433211.2	1	1	hg19	c.980G>A	CCDS7269.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.199060	0.94997	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309	T;T;T	0.38722	1.45;1.45;1.12	5.83	5.83	0.93111	5.830000	5.830000	0.931110	.	0.000000	0.46442	D	0.000281	T	0.64811	0.2632	M	0.67700	2.07	0.49213	D	0.999767	D;D;D;D	0.89917	1.0;1.0;0.984;0.998	D;D;P;D	0.87578	0.998;0.998;0.889;0.992	T	0.61816	-0.6985	10	0.45353	T	0.12	-7.9917	18.8814	0.92357	0.0:1.0:0.0:0.0	.	327;327;327;327	A8K141;F2Z2R0;Q9UI47-2;Q9UI47	.;.;.;CTNA3_HUMAN	Q	327	ENSP00000389714:R327Q;ENSP00000362849:R327Q;ENSP00000441444:R327Q	ENSP00000362849:R327Q	R	-	2	0	0	CTNNA3	68610148	68610148	1.000000	0.71417	0.995000	0.50966	0.937000	0.57800	6.079000	0.71291	2.753000	0.94483	0.585000	0.79938	CGG	0.125770		TCGA-HZ-8317-01A-11D-2396-08	0.517	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	0	0	1		2	2	2	0		0	0	68		68	67	1	2	-2.788331	1	0.120000	NM_013266			17	17		453	448	0		1			0	0	68	0		0.999963	0	0	0	0	0	0	17	453
OR52A1	23538	broad.mit.edu	37	11	5173196	5173196	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr11:5173196G>A	ENST00000380367.1	-	2	821	c.404C>T	c.(403-405)gCc>gTc	p.A135V	OR52A1_ENST00000328942.1_Missense_Mutation_p.A135V			Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A, member 1	135					sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	19		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAGATGTTGGCATGTCTTAG	0.498																																						ENST00000380367.1	1.000000	0.370000	1.000000	0.520000	0.720000	0.738210	0.720000	1.000000																										0				19						c.(403-405)gCc>gTc		olfactory receptor, family 52, subfamily A, member 1							101.0	85.0	90.0					11																	5173196		2201	4298	6499	SO:0001583	missense	23538	7	121412	37				g.chr11:5173196G>A	AF154673	CCDS31374.1	11p15.4	2012-08-09			ENSG00000182070	ENSG00000182070		"""GPCR / Class A : Olfactory receptors"""	8318	protein-coding gene	gene with protein product						10512676	Standard	NM_012375		Approved	HPFH1OR	uc010qyy.2	Q9UKL2	OTTHUMG00000066603	ENST00000380367.1:c.404C>T	chr11.hg19:g.5173196G>A	ENSP00000369725:p.Ala135Val	0					OR52A1_ENST00000328942.1_Missense_Mutation_p.A135V	p.A135V			1	2	3	2.007412	Q9UKL2	O52A1_HUMAN		2	821	-		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)	Q6IF31	Missense_Mutation	SNP	ENST00000380367.1	1	1	hg19	c.404C>T	CCDS31374.1	0	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919421	0.33908	.	.	ENSG00000182070	ENST00000380367;ENST00000328942	T;T	0.00411	7.53;7.53	5.28	3.38	0.38709	5.280000	3.380000	0.387090	GPCR, rhodopsin-like superfamily (1);	0.674735	0.13640	N	0.373031	T	0.00496	0.0016	M	0.68952	2.095	0.09310	N	1	P	0.42161	0.772	B	0.38842	0.283	T	0.49862	-0.8894	10	0.87932	D	0	.	14.4598	0.67440	0.0:0.3045:0.6955:0.0	.	135	Q9UKL2	O52A1_HUMAN	V	135	ENSP00000369725:A135V;ENSP00000333684:A135V	ENSP00000333684:A135V	A	-	2	0	0	OR52A1	5129772	5129772	0.000000	0.05858	0.022000	0.16811	0.311000	0.27955	0.180000	0.16860	0.765000	0.33221	0.591000	0.81541	GCC	0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.498	OR52A1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142810.2	0	0	1		2	2	2	0		0	0	46		46	46	1	2	-3.276522	1	0.120000	NM_012375			11	11		259	257	0		1			0	0	46	0		0.998362	0	0	0	0	0	0	11	259
STK33	65975	broad.mit.edu	37	11	8486310	8486310	+	Silent	SNP	C	C	T	rs1446464	byFrequency	TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr11:8486310C>T	ENST00000447869.1	-	3	1317	c.399G>A	c.(397-399)gcG>gcA	p.A133A	STK33_ENST00000396672.1_Silent_p.A133A|STK33_ENST00000534493.1_Silent_p.A92A|STK33_ENST00000358872.3_5'UTR|STK33_ENST00000315204.1_Silent_p.A133A|STK33_ENST00000396673.1_Silent_p.A133A			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	133	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A133A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		CCTTGTCTGTCGCTTCAATGA	0.393																																						ENST00000447869.1	1.000000	0.540000	1.000000	0.650000	0.790000	0.805205	0.790000	1.000000																										1	Substitution - coding silent(1)	p.A133A(1)	stomach(1)	23						c.(397-399)gcG>gcA		serine/threonine kinase 33							295.0	247.0	263.0					11																	8486310		2201	4296	6497	SO:0001819	synonymous_variant	65975	0	0					g.chr11:8486310C>T	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.399G>A	chr11.hg19:g.8486310C>T		0					STK33_ENST00000534493.1_Silent_p.A92A|STK33_ENST00000315204.1_Silent_p.A133A|STK33_ENST00000396673.1_Silent_p.A133A|STK33_ENST00000396672.1_Silent_p.A133A|STK33_ENST00000358872.3_5'UTR	p.A133A			1	2	3	2.007412	Q9BYT3	STK33_HUMAN		3	1317	-			Q658S6|Q8NEF5	Silent	SNP	ENST00000447869.1	1	0	hg19	c.399G>A	CCDS7789.1	0																																																																																								0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.393	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2	1	0	1		2	2	2	0		0	0	61		61	60	1	2	-2.148813	0	0.120000	NM_030906			30	30		620	612	0		1	0		0	0	61	0		1.000000	1.757860e-01	0	0	0	16	0	30	620
LDHC	3948	broad.mit.edu	37	11	18467784	18467784	+	Silent	SNP	G	G	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr11:18467784G>T	ENST00000541669.1	+	7	849	c.738G>T	c.(736-738)ggG>ggT	p.G246G	LDHC_ENST00000536880.1_Silent_p.G232G|LDHC_ENST00000544105.1_Intron|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000546146.1_Intron|LDHC_ENST00000280704.4_Silent_p.G246G|LDHC_ENST00000535809.1_Intron			P07864	LDHC_HUMAN	lactate dehydrogenase C	246					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGCTGAAGGGGTATACCTCTT	0.378																																						ENST00000541669.1	1.000000	0.400000	0.790000	0.490000	0.610000	0.649536	0.610000	0.590000																										0				24						c.(736-738)ggG>ggT		lactate dehydrogenase C							178.0	176.0	177.0					11																	18467784		2199	4293	6492	SO:0001819	synonymous_variant	3948	0	0					g.chr11:18467784G>T	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.738G>T	chr11.hg19:g.18467784G>T		0					LDHC_ENST00000535809.1_Intron|LDHC_ENST00000544105.1_Intron|LDHC_ENST00000280704.4_Silent_p.G246G|LDHC_ENST00000546146.1_Intron|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000536880.1_Silent_p.G232G	p.G246G			1	2	3	2.007412	P07864	LDHC_HUMAN		7	849	+			D3DQY4|Q6GSG8|Q7Z7J4	Silent	SNP	ENST00000541669.1	1	1	hg19	c.738G>T	CCDS7840.1	0																																																																																								0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.378	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	0	0	1		2	2	2	0		0	0	102		102	102	1	2	-3.697135	1	0.120000	NM_017448			25	25		679	672	0		1			0	0	102	0		1.000000	0	0	0	0	0	0	25	679
GRIK4	2900	broad.mit.edu	37	11	120838027	120838027	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr11:120838027C>T	ENST00000527524.2	+	19	2677	c.2390C>T	c.(2389-2391)gCt>gTt	p.A797V	GRIK4_ENST00000438375.2_Missense_Mutation_p.A797V	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	797					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GATCACAGAGCTAAAGGTAAG	0.522																																						ENST00000527524.2	1.000000	0.180000	0.720000	0.290000	0.440000	0.502783	0.440000	0.390000																										0				69						c.(2389-2391)gCt>gTt		glutamate receptor, ionotropic, kainate 4							109.0	98.0	102.0					11																	120838027		2203	4299	6502	SO:0001583	missense	2900	0	0					g.chr11:120838027C>T	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2390C>T	chr11.hg19:g.120838027C>T	ENSP00000435648:p.Ala797Val	0					GRIK4_ENST00000438375.2_Missense_Mutation_p.A797V	p.A797V	NM_001282470.1	NP_001269399.1	1	2	3	2.007412	Q16099	GRIK4_HUMAN		19	2677	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	0	1	hg19	c.2390C>T	CCDS8433.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.503700	0.96371	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.54479	0.57;0.57	5.41	5.41	0.78517	5.410000	5.410000	0.785170	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.71204	0.3312	M	0.64676	1.99	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.73678	-0.3907	10	0.87932	D	0	.	18.7905	0.91973	0.0:1.0:0.0:0.0	.	797	Q16099	GRIK4_HUMAN	V	797	ENSP00000435648:A797V;ENSP00000404063:A797V	ENSP00000404063:A797V	A	+	2	0	0	GRIK4	120343237	120343237	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.032000	0.70918	2.537000	0.85549	0.563000	0.77884	GCT	0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.522	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	0	0	1		21	2	2	1		1	1	36		36	36	1	2	-7.284224	1	0.120000	NM_014619			6	6		246	245	0		0			1	0	36	0		0.002207	0	0	0	0	0	0	6	246
KCNA1	3736	broad.mit.edu	37	12	5021286	5021286	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr12:5021286G>A	ENST00000382545.3	+	2	1849	c.742G>A	c.(742-744)Gac>Aac	p.D248N	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	248					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CAGCAAGACGGACTTCTTCAA	0.493																																						ENST00000382545.3	0.800000	0.320000	0.670000	0.410000	0.530000	0.550898	0.530000	0.520000																										0				63						c.(742-744)Gac>Aac		potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)						85.0	80.0	82.0					12																	5021286		2203	4300	6503	SO:0001583	missense	3736	0	0					g.chr12:5021286G>A	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.742G>A	chr12.hg19:g.5021286G>A	ENSP00000371985:p.Asp248Asn	0					KCNA1_ENST00000543874.2_Intron	p.D248N	NM_000217.2	NP_000208.2	0	1	1	1.995546	Q09470	KCNA1_HUMAN		2	1849	+			A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	1	1	hg19	c.742G>A	CCDS8535.1	0	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538245	0.27475	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.97256	-4.31	4.97	4.97	0.65823	4.970000	4.970000	0.658230	Ion transport (1);	0.124139	0.56097	D	0.000038	D	0.94059	0.8096	L	0.31664	0.95	0.41605	D	0.988877	B	0.16603	0.018	B	0.25759	0.063	D	0.90746	0.4653	10	0.19590	T	0.45	.	17.7728	0.88497	0.0:0.0:1.0:0.0	.	248	Q09470	KCNA1_HUMAN	N	248	ENSP00000371985:D248N	ENSP00000228858:D248N	D	+	1	0	0	KCNA1	4891547	4891547	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.661000	0.83786	2.735000	0.93741	0.655000	0.94253	GAC	0.114153		TCGA-HZ-8317-01A-11D-2396-08	0.493	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	0	0	1		2	2	2	0		0	0	67		67	67	1	2	-15.019970	1	0.120000	NM_000217			17	17		514	505	0		1			0	0	67	0		0.999960	0	0	0	0	0	0	17	514
DDX11	1663	broad.mit.edu	37	12	31256819	31256819	+	Missense_Mutation	SNP	C	C	G	rs368042207		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr12:31256819C>G	ENST00000407793.2	+	27	3016	c.2765C>G	c.(2764-2766)cCg>cGg	p.P922R	DDX11_ENST00000542838.1_3'UTR|DDX11_ENST00000545668.1_Missense_Mutation_p.P922R|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_3'UTR|DDX11_ENST00000350437.4_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	922					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TTGTCCTGCCCGCTGGAGACA	0.607										Multiple Myeloma(12;0.14)																												ENST00000407793.2	0.930000	0.330000	0.760000	0.440000	0.590000	0.609678	0.590000	0.570000																										0				57						c.(2764-2766)cCg>cGg		DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11							70.0	72.0	71.0					12																	31256819		2203	4300	6503	SO:0001583	missense	1663	0	0					g.chr12:31256819C>G	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.2765C>G	chr12.hg19:g.31256819C>G	ENSP00000384703:p.Pro922Arg	0	Multiple Myeloma(12;0.14)				DDX11_ENST00000228264.6_3'UTR|DDX11_ENST00000545668.1_Missense_Mutation_p.P922R|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000350437.4_3'UTR|DDX11_ENST00000542838.1_3'UTR	p.P922R	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	0	1	1	1.999956	Q96FC9	DDX11_HUMAN		27	3016	+	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	0	1	hg19	c.2765C>G	CCDS44856.1	0	.	.	.	.	.	.	.	.	.	.	C	3.745	-0.052757	0.07362	.	.	ENSG00000013573	ENST00000407793;ENST00000545668	T;T	0.73152	-0.72;-0.72	1.32	0.398	0.16319	1.320000	0.398000	0.163190	.	.	.	.	.	T	0.44435	0.1293	N	0.08118	0	0.09310	N	0.999997	B	0.29232	0.238	B	0.27608	0.081	T	0.30416	-0.9979	9	0.41790	T	0.15	.	3.8887	0.09110	0.0:0.756:0.0:0.244	.	922	Q96FC9	DDX11_HUMAN	R	922	ENSP00000384703:P922R;ENSP00000440402:P922R	ENSP00000384703:P922R	P	+	2	0	0	DDX11	31148086	31148086	0.000000	0.05858	0.010000	0.14722	0.007000	0.05969	-0.158000	0.10070	0.136000	0.18733	-1.250000	0.01514	CCG	0.115222		TCGA-HZ-8317-01A-11D-2396-08	0.607	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	0	0	1		2	2	2	0		0	0	76		76	76	1	2	-2.410988	0	0.120000	NM_030653			13	13		357	354	0		1	1		0	0	76	0		0.999529	2.013004e-01	0	3	0	18	0	13	357
CD163L1	283316	broad.mit.edu	37	12	7559406	7559406	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr12:7559406C>T	ENST00000313599.3	-	5	866	c.809G>A	c.(808-810)cGc>cAc	p.R270H	CD163L1_ENST00000416109.2_Missense_Mutation_p.R280H|CD163L1_ENST00000396630.1_Missense_Mutation_p.R270H			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	270	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CCCCATACAGCGGTTAGTTCC	0.448																																						ENST00000313599.3	1.000000	0.520000	0.940000	0.640000	0.780000	0.789459	0.780000	1.000000																										0				96						c.(808-810)cGc>cAc		CD163 molecule-like 1							209.0	186.0	194.0					12																	7559406		2203	4300	6503	SO:0001583	missense	283316	2	121412	37				g.chr12:7559406C>T	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.809G>A	chr12.hg19:g.7559406C>T	ENSP00000315945:p.Arg270His	0					CD163L1_ENST00000396630.1_Missense_Mutation_p.R270H|CD163L1_ENST00000416109.2_Missense_Mutation_p.R280H	p.R270H			0	1	1	1.995546	Q9NR16	C163B_HUMAN		5	866	-			B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	1	1	hg19	c.809G>A	CCDS8577.1	0	.	.	.	.	.	.	.	.	.	.	C	10.37	1.331677	0.24167	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.36340	1.26;1.26;1.26	1.88	-1.44	0.08856	1.880000	-1.440000	0.088560	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.24044	0.0582	L	0.37697	1.125	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.09377	0.004;0.004	T	0.21008	-1.0258	9	0.42905	T	0.14	.	5.8061	0.18440	0.0:0.3986:0.0:0.6014	.	280;270	E7EVK4;Q9NR16	.;C163B_HUMAN	H	270;280;270	ENSP00000315945:R270H;ENSP00000393474:R280H;ENSP00000379871:R270H	ENSP00000315945:R270H	R	-	2	0	0	CD163L1	7450673	7450673	0.000000	0.05858	0.000000	0.03702	0.560000	0.35617	-4.189000	0.00277	-0.331000	0.08501	0.460000	0.39030	CGC	0.114153		TCGA-HZ-8317-01A-11D-2396-08	0.448	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	1	0	1		2	2	2	0		0	0	88		88	88	1	2	-4.786469	1	0.120000	NM_174941			27	24		545	539	0		1	0		0	0	88	0		1.000000	1.147734e-01	0	0	0	12	0	27	545
LRP1	4035	broad.mit.edu	37	12	57606324	57606324	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr12:57606324G>A	ENST00000243077.3	+	89	14087	c.13621G>A	c.(13621-13623)Gac>Aac	p.D4541N		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4541	Interaction with MAFB. {ECO:0000250}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CGAGATAGGGGACCCCTTGGC	0.677																																						ENST00000243077.3	0.790000	0.220000	0.620000	0.330000	0.460000	0.483256	0.460000	0.440000																										0				184						c.(13621-13623)Gac>Aac		low density lipoprotein receptor-related protein 1	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						36.0	36.0	36.0					12																	57606324		2203	4300	6503	SO:0001583	missense	4035	0	0					g.chr12:57606324G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.13621G>A	chr12.hg19:g.57606324G>A	ENSP00000243077:p.Asp4541Asn	0						p.D4541N	NM_002332.2	NP_002323.2	0	1	1	1.999956	Q07954	LRP1_HUMAN		89	14087	+			Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	0	1	hg19	c.13621G>A	CCDS8932.1	0	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978696	0.74360	.	.	ENSG00000123384	ENST00000243077	D	0.91068	-2.78	4.66	4.66	0.58398	4.660000	4.660000	0.583980	.	0.000000	0.56097	D	0.000037	D	0.85932	0.5812	L	0.44542	1.39	0.80722	D	1	B	0.27498	0.18	B	0.24848	0.056	D	0.84674	0.0713	10	0.66056	D	0.02	.	10.7064	0.45958	0.0925:0.0:0.9075:0.0	.	4541	Q07954	LRP1_HUMAN	N	4541	ENSP00000243077:D4541N	ENSP00000243077:D4541N	D	+	1	0	0	LRP1	55892591	55892591	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.464000	0.80887	2.403000	0.81681	0.491000	0.48974	GAC	0.115222		TCGA-HZ-8317-01A-11D-2396-08	0.677	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	0	0	1		2	2	2	0		0	0	42		42	42	1	2	-9.451333	1	0.120000	NM_002332			9	9		324	323	0		1	1		0	0	42	0		0.994303	9.970539e-01	0	6	0	375	0	9	324
CHD8	57680	broad.mit.edu	37	14	21868724	21868724	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr14:21868724C>T	ENST00000557364.1	-	23	4681	c.4418G>A	c.(4417-4419)cGt>cAt	p.R1473H	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.R1194H|CHD8_ENST00000399982.2_Missense_Mutation_p.R1473H			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1473					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTCAGTCATACGTCGCTTGAA	0.428																																						ENST00000557364.1	1.000000	0.320000	0.910000	0.470000	0.660000	0.684868	0.660000	1.000000																										0				85						c.(4417-4419)cGt>cAt		chromodomain helicase DNA binding protein 8							63.0	62.0	62.0					14																	21868724		1859	4101	5960	SO:0001583	missense	57680	1	120810	36				g.chr14:21868724C>T	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4418G>A	chr14.hg19:g.21868724C>T	ENSP00000451601:p.Arg1473His	0					CHD8_ENST00000430710.3_Missense_Mutation_p.R1194H|CHD8_ENST00000399982.2_Missense_Mutation_p.R1473H|CHD8_ENST00000555962.1_Intron	p.R1473H			0	0	0	1.958275	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	23	4681	-	all_cancers(95;0.00121)		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	0	1	hg19	c.4418G>A	CCDS53885.1	0	.	.	.	.	.	.	.	.	.	.	C	10.69	1.421067	0.25639	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.83335	-1.71;-1.71;-1.71	4.92	4.92	0.64577	4.920000	4.920000	0.645770	.	0.061161	0.64402	D	0.000003	T	0.66327	0.2778	N	0.11313	0.125	0.51012	D	0.999901	B;B	0.11235	0.001;0.004	B;B	0.11329	0.005;0.006	T	0.61202	-0.7110	10	0.22706	T	0.39	-8.9064	10.6212	0.45481	0.0:0.9113:0.0:0.0887	.	1473;1194	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	H	1194;1473;1193;1473	ENSP00000406288:R1194H;ENSP00000382863:R1473H;ENSP00000451601:R1473H	ENSP00000262707:R1193H	R	-	2	0	0	CHD8	20938564	20938564	0.947000	0.32204	1.000000	0.80357	0.974000	0.67602	2.058000	0.41374	2.546000	0.85860	0.650000	0.86243	CGT	0.096138		TCGA-HZ-8317-01A-11D-2396-08	0.428	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	0	0	1		2	2	2	0		0	0	36		36	36	1	2	-10.194580	1	0.120000	NM_020920			8	8		189	187	0		1	1		0	0	36	0		0.989376	3.879856e-01	0	3	0	27	0	8	189
CTSG	1511	broad.mit.edu	37	14	25043976	25043976	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr14:25043976G>A	ENST00000216336.2	-	3	280	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	82	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		GTGTTTTCCCGTCTCTGGATA	0.532																																						ENST00000216336.2	0.790000	0.300000	0.660000	0.400000	0.520000	0.536177	0.520000	0.510000																										0				25						c.(244-246)Cgg>Tgg		cathepsin G							179.0	150.0	159.0					14																	25043976		2203	4300	6503	SO:0001583	missense	1511	0	0					g.chr14:25043976G>A	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.244C>T	chr14.hg19:g.25043976G>A	ENSP00000216336:p.Arg82Trp	0						p.R82W	NM_001911.2	NP_001902.1	0	0	0	1.983519	P08311	CATG_HUMAN		3	280	-			Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	ENST00000216336.2	1	1	hg19	c.244C>T	CCDS9631.1	0	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323852	0.60634	.	.	ENSG00000100448	ENST00000216336	D	0.89270	-2.49	5.14	-0.234	0.13074	5.140000	-0.234000	0.130740	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.162600	0.03040	N	0.153196	D	0.90082	0.6902	L	0.42686	1.345	0.09310	N	1	D	0.53462	0.96	P	0.57324	0.818	T	0.77091	-0.2716	10	0.72032	D	0.01	.	6.4544	0.21922	0.1768:0.4321:0.3911:0.0	.	82	P08311	CATG_HUMAN	W	82	ENSP00000216336:R82W	ENSP00000216336:R82W	R	-	1	2	2	CTSG	24113816	24113816	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.555000	0.05999	-0.140000	0.11394	0.655000	0.94253	CGG	0.108229		TCGA-HZ-8317-01A-11D-2396-08	0.532	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	0	0	1		2	2	2	0		0	0	70		70	70	1	2	-3.206707	1	0.120000	NM_001911			16	16		495	491	0		1	0		0	0	70	0		0.999929	6.513625e-01	0	0	0	69	0	16	495
RALGAPA1	253959	broad.mit.edu	37	14	36064899	36064899	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr14:36064899C>T	ENST00000389698.3	-	36	6022	c.5632G>A	c.(5632-5634)Gta>Ata	p.V1878I	RALGAPA1_ENST00000258840.6_Missense_Mutation_p.V1925I|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.V1878I|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.V1891I	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1878	Minimal domain that binds to TCF3/E12. {ECO:0000250}.|Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGAAATATTACCTCTACTGTA	0.353																																						ENST00000389698.3	0.620000	0.200000	0.500000	0.280000	0.380000	0.397124	0.380000	0.360000																										0				67						c.(5632-5634)Gta>Ata		Ral GTPase activating protein, alpha subunit 1 (catalytic)							144.0	141.0	142.0					14																	36064899		2202	4300	6502	SO:0001583	missense	253959	0	0					g.chr14:36064899C>T	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5632G>A	chr14.hg19:g.36064899C>T	ENSP00000374348:p.Val1878Ile	0					RALGAPA1_ENST00000382366.3_Missense_Mutation_p.V1891I|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.V1925I|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.V1878I	p.V1878I	NM_014990.1	NP_055805.1	0	0	0	1.983519	Q6GYQ0	RGPA1_HUMAN		36	6022	-			A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	1	1	hg19	c.5632G>A	CCDS32065.1	0	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542814	0.86022	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	D;D;D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99;-2.99;-2.99	5.05	5.05	0.67936	5.050000	5.050000	0.679360	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.93973	0.8070	L	0.39085	1.19	0.53688	D	0.999976	D;P;P;P	0.76494	0.999;0.927;0.918;0.756	D;P;P;P	0.80764	0.994;0.842;0.554;0.531	D	0.94142	0.7398	10	0.51188	T	0.08	-13.6603	18.7911	0.91974	0.0:1.0:0.0:0.0	.	1925;1891;1878;1878	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	I	1878;1878;1878;1925;516;1891;1925	ENSP00000374348:V1878I;ENSP00000302647:V1878I;ENSP00000258840:V1925I;ENSP00000451133:V516I;ENSP00000371803:V1891I;ENSP00000451877:V1925I	ENSP00000258840:V1925I	V	-	1	0	0	RALGAPA1	35134650	35134650	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.039000	0.70972	2.493000	0.84123	0.655000	0.94253	GTA	0.108229		TCGA-HZ-8317-01A-11D-2396-08	0.353	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	0	0	1		2	2	2	0		0	0	76		76	76	1	2	-3.171494	1	0.120000	XM_210022			12	12		516	513	0		1	1		0	0	76	0		0.999100	3.861833e-01	0	3	0	52	0	12	516
GPR135	64582	broad.mit.edu	37	14	59930560	59930560	+	Missense_Mutation	SNP	C	C	T	rs201849909		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr14:59930560C>T	ENST00000395116.1	-	1	1500	c.1385G>A	c.(1384-1386)cGc>cAc	p.R462H		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	462						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R462H(2)		breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		TGGATTTTTGCGGGCCCACAT	0.607													c|||	1	0.000199681	0.0	0.0	5008	,	,		14292	0.001		0.0	False		,,,				2504	0.0					ENST00000395116.1	0.920000	0.150000	0.680000	0.270000	0.440000	0.479153	0.440000	0.390000																										2	Substitution - Missense(2)	p.R462H(2)	lung(1)|endometrium(1)	13						c.(1384-1386)cGc>cAc		G protein-coupled receptor 135							33.0	35.0	34.0					14																	59930560		2203	4300	6503	SO:0001583	missense	64582	3	121410	33				g.chr14:59930560C>T	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1385G>A	chr14.hg19:g.59930560C>T	ENSP00000378548:p.Arg462His	0						p.R462H	NM_022571.5	NP_072093.2	0	0	0	1.983519	Q8IZ08	GP135_HUMAN		1	1500	-			Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	0	1	hg19	c.1385G>A	CCDS9738.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	22.5	4.292998	0.80914	.	.	ENSG00000181619	ENST00000395116	T	0.61980	0.06	4.89	3.08	0.35506	4.890000	3.080000	0.355060	.	0.387780	0.22539	U	0.058753	T	0.46034	0.1372	N	0.24115	0.695	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.30297	-0.9983	10	0.39692	T	0.17	-2.7593	11.0647	0.47968	0.0:0.8502:0.0:0.1498	.	462	Q8IZ08	GP135_HUMAN	H	462	ENSP00000378548:R462H	ENSP00000378548:R462H	R	-	2	0	0	GPR135	59000313	59000313	1.000000	0.71417	0.940000	0.37924	0.994000	0.84299	3.548000	0.53670	0.675000	0.31264	0.651000	0.88453	CGC	0.108229		TCGA-HZ-8317-01A-11D-2396-08	0.607	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	0	0	1		2	2	2	0		0	0	31		31	31	1	2	-3.207487	1	0.120000	NM_022571			4	4		156	153	0		1	0		0	0	31	0		0.885401	0	0	0	0	1	0	4	156
SPTB	6710	broad.mit.edu	37	14	65260215	65260215	+	Silent	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr14:65260215C>T	ENST00000389721.5	-	13	2198	c.2166G>A	c.(2164-2166)tcG>tcA	p.S722S	SPTB_ENST00000389722.3_Silent_p.S722S|SPTB_ENST00000556626.1_Silent_p.S722S|SPTB_ENST00000542895.1_Silent_p.S722S|SPTB_ENST00000389720.3_Silent_p.S722S	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	722					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CCCACTGTGCCGACACCTCCT	0.582																																						ENST00000389721.5	0.820000	0.260000	0.660000	0.360000	0.500000	0.519884	0.500000	0.480000																										0				106						c.(2164-2166)tcG>tcA		spectrin, beta, erythrocytic							56.0	54.0	55.0					14																	65260215		2203	4300	6503	SO:0001819	synonymous_variant	6710	6	121412	35				g.chr14:65260215C>T		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.2166G>A	chr14.hg19:g.65260215C>T		0					SPTB_ENST00000389722.3_Silent_p.S722S|SPTB_ENST00000389720.3_Silent_p.S722S|SPTB_ENST00000556626.1_Silent_p.S722S|SPTB_ENST00000542895.1_Silent_p.S722S	p.S722S	NM_000347.5	NP_000338.3	0	0	0	1.983519	P11277	SPTB1_HUMAN		13	2198	-		all_lung(585;4.15e-09)	Q15510|Q15519	Silent	SNP	ENST00000389721.5	0	1	hg19	c.2166G>A	CCDS32100.1	0																																																																																								0.108229		TCGA-HZ-8317-01A-11D-2396-08	0.582	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1	0	0	1		27	2	2	1		1	1	40		40	38	1	2	-10.809540	1	0.120000				11	11		358	355	0		0			1	0	40	0		0.005231	0	0	0	0	0	0	11	358
HERC2	8924	broad.mit.edu	37	15	28370291	28370291	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr15:28370291C>T	ENST00000261609.7	-	84	12959	c.12851G>A	c.(12850-12852)gGa>gAa	p.G4284E		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATTGGTGGTTCCGTCTCCCAG	0.532																																						ENST00000261609.7	1.000000	0.340000	0.640000	0.410000	0.500000	0.556049	0.500000	0.490000																										0				204						c.(12850-12852)gGa>gAa		HECT and RLD domain containing E3 ubiquitin protein ligase 2							234.0	211.0	219.0					15																	28370291		2203	4300	6503	SO:0001583	missense	8924	1	121412	35				g.chr15:28370291C>T	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12851G>A	chr15.hg19:g.28370291C>T	ENSP00000261609:p.Gly4284Glu	0						p.G4284E	NM_004667.5	NP_004658.3	1	2	3	2.010751				84	12959	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		Missense_Mutation	SNP	ENST00000261609.7	1	1	hg19	c.12851G>A	CCDS10021.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.116754	0.94385	.	.	ENSG00000128731	ENST00000261609	D	0.84589	-1.87	5.19	5.19	0.71726	5.190000	5.190000	0.717260	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.93307	0.7867	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94249	0.7492	10	0.87932	D	0	.	18.7201	0.91689	0.0:1.0:0.0:0.0	.	4284	O95714	HERC2_HUMAN	E	4284	ENSP00000261609:G4284E	ENSP00000261609:G4284E	G	-	2	0	0	HERC2	26043886	26043886	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.808000	0.86044	2.408000	0.81797	0.655000	0.94253	GGA	0.126811		TCGA-HZ-8317-01A-11D-2396-08	0.532	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	0	0	1		2	2	2	0		0	0	228		228	228	1	2	-2.712279	1	0.120000	NM_004667			32	32		1058	1046	1		1	1		0	0	228	0		1.000000	6.829055e-01	0	7	0	72	0	32	1058
TGM5	9333	broad.mit.edu	37	15	43527883	43527883	+	Nonsense_Mutation	SNP	G	G	A	rs144532387		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr15:43527883G>A	ENST00000220420.5	-	10	1505	c.1498C>T	c.(1498-1500)Cga>Tga	p.R500*	TGM5_ENST00000349114.4_Nonsense_Mutation_p.R418*	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	500					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	TCACTGGGTCGAAGGGAAGGT	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21348	0.0		0.0	False		,,,				2504	0.0					ENST00000220420.5	1.000000	0.390000	1.000000	0.540000	0.730000	0.748289	0.730000	1.000000																										0				44						c.(1498-1500)Cga>Tga		transglutaminase 5	L-Glutamine(DB00130)	G	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	103.0	108.0		1252,1498	5.6	0.0	15	dbSNP_134	108	1,8597	1.2+/-3.3	0,1,4298	yes	stop-gained,stop-gained	TGM5	NM_004245.3,NM_201631.3	,	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	,	418/639,500/721	43527883	2,13002	2203	4299	6502	SO:0001587	stop_gained	9333	6	121412	38				g.chr15:43527883G>A	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1498C>T	chr15.hg19:g.43527883G>A	ENSP00000220420:p.Arg500*	0					TGM5_ENST00000349114.4_Nonsense_Mutation_p.R418*	p.R500*	NM_201631.3	NP_963925.2	1	2	3	2.010751	O43548	TGM5_HUMAN		10	1505	-		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)	O43549|Q0VF40|Q9UEZ4	Nonsense_Mutation	SNP	ENST00000220420.5	0	1	hg19	c.1498C>T	CCDS32212.1	0	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771567	0.90108	2.27E-4	1.16E-4	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	.	.	.	5.58	5.58	0.84498	5.580000	5.580000	0.844980	.	1.990680	0.02559	N	0.096485	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-0.2829	15.0606	0.71951	0.0:0.0:1.0:0.0	.	.	.	.	X	500;418;499	.	ENSP00000220420:R500X	R	-	1	2	2	TGM5	41315175	41315175	0.001000	0.12720	0.032000	0.17829	0.207000	0.24258	0.862000	0.27899	2.631000	0.89168	0.655000	0.94253	CGA	0.126811		TCGA-HZ-8317-01A-11D-2396-08	0.562	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	0	0	1		2	2	2	0		0	0	46		46	46	1	2	-3.318794	1	0.120000	NM_004245			12	12		278	276	0		1	0		0	0	46	0		0.999132	6.164718e-03	0	0	0	3	0	12	278
TLE3	7090	broad.mit.edu	37	15	70346894	70346894	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr15:70346894G>T	ENST00000558939.1	-	16	3095	c.1718C>A	c.(1717-1719)aCg>aAg	p.T573K	TLE3_ENST00000451782.2_Missense_Mutation_p.T570K|TLE3_ENST00000558379.1_Missense_Mutation_p.T568K|TLE3_ENST00000317509.8_Missense_Mutation_p.T561K|TLE3_ENST00000440567.3_Missense_Mutation_p.T563K|TLE3_ENST00000558201.1_Missense_Mutation_p.T579K|TLE3_ENST00000559929.1_Missense_Mutation_p.T583K|TLE3_ENST00000559048.1_Missense_Mutation_p.T573K|TLE3_ENST00000560589.1_Missense_Mutation_p.T517K|TLE3_ENST00000559191.1_Missense_Mutation_p.T154K|TLE3_ENST00000560939.1_Missense_Mutation_p.T575K|TLE3_ENST00000557907.1_Missense_Mutation_p.T565K|TLE3_ENST00000442299.2_Missense_Mutation_p.T565K|TLE3_ENST00000557997.1_Missense_Mutation_p.T565K|TLE3_ENST00000539550.1_Missense_Mutation_p.T500K	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	573					Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGCCGAGGACGTCAGCTCGGC	0.662																																						ENST00000558939.1	1.000000	0.510000	1.000000	0.690000	0.930000	0.875582	0.930000	1.000000																										0				31						c.(1717-1719)aCg>aAg		transducin-like enhancer of split 3							37.0	42.0	41.0					15																	70346894		2192	4297	6489	SO:0001583	missense	7090	0	0					g.chr15:70346894G>T	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1718C>A	chr15.hg19:g.70346894G>T	ENSP00000452871:p.Thr573Lys	0					TLE3_ENST00000317509.8_Missense_Mutation_p.T561K|TLE3_ENST00000451782.2_Missense_Mutation_p.T570K|TLE3_ENST00000560939.1_Missense_Mutation_p.T575K|TLE3_ENST00000440567.3_Missense_Mutation_p.T563K|TLE3_ENST00000558201.1_Missense_Mutation_p.T579K|TLE3_ENST00000539550.1_Missense_Mutation_p.T500K|TLE3_ENST00000557997.1_Missense_Mutation_p.T565K|TLE3_ENST00000559191.1_Missense_Mutation_p.T154K|TLE3_ENST00000559048.1_Missense_Mutation_p.T573K|TLE3_ENST00000442299.2_Missense_Mutation_p.T565K|TLE3_ENST00000560589.1_Missense_Mutation_p.T517K|TLE3_ENST00000557907.1_Missense_Mutation_p.T565K|TLE3_ENST00000558379.1_Missense_Mutation_p.T568K|TLE3_ENST00000559929.1_Missense_Mutation_p.T583K	p.T573K	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	1	2	3	2.010751	Q04726	TLE3_HUMAN		16	3095	-			B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	ENST00000558939.1	0	1	hg19	c.1718C>A	CCDS45293.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.098445	0.94197	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	4.83	4.83	0.62350	4.830000	4.830000	0.623500	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66992	0.2846	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.997;0.999;0.996;0.999;0.999;0.999;0.999;0.998	D;D;D;D;D;D;D;P	0.74348	0.983;0.96;0.937;0.977;0.971;0.977;0.957;0.908	T	0.68209	-0.5469	10	0.49607	T	0.09	-5.6579	17.7019	0.88298	0.0:0.0:1.0:0.0	.	563;570;565;568;561;573;573;500	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	K	565;570;573;563;500	ENSP00000390007:T565K;ENSP00000394717:T570K;ENSP00000415057:T563K;ENSP00000442594:T500K	ENSP00000319233:T573K	T	-	2	0	0	TLE3	68133948	68133948	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	9.530000	0.98051	2.515000	0.84797	0.462000	0.41574	ACG	0.126811		TCGA-HZ-8317-01A-11D-2396-08	0.662	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	1	0	1		2	2	2	0		0	0	42		42	42	1	2	-15.978110	1	0.120000	NM_005078			13	13		232	228	0		1	0		0	0	42	0		0.999525	2.291915e-01	0	1	0	15	0	13	232
MYH4	4622	broad.mit.edu	37	17	10348217	10348217	+	Splice_Site	SNP	C	C	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr17:10348217C>A	ENST00000255381.2	-	38	5577		c.e38-1		CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle						actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GCTCTCTCACCTGGAAGGGAA	0.483																																						ENST00000255381.2	1.000000	0.070000	0.290000	0.110000	0.170000	0.272819	0.170000	0.160000																										0				149						c.e38-1		myosin, heavy chain 4, skeletal muscle							261.0	205.0	224.0					17																	10348217		2203	4300	6503	SO:0001630	splice_region_variant	4622	0	0					g.chr17:10348217C>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5467-1G>T	chr17.hg19:g.10348217C>A		0					RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA		NM_017533.2	NP_060003.2	1	2	3	2.013150	Q9Y623	MYH4_HUMAN		38	5577	-				Splice_Site	SNP	ENST00000255381.2	0	1	hg19		CCDS11154.1	0	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308539	0.81247	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.5	5.5	0.81552	5.500000	5.500000	0.815520	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7739	0.96383	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	MYH4	10288942	10288942	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.776000	0.85560	2.744000	0.94065	0.655000	0.94253	.	0.127330		TCGA-HZ-8317-01A-11D-2396-08	0.483	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	0	0	1		2	2	2	0		0	0	111		111	110	1	2	-2.556550	1	0.120000	NM_017533	Intron		7	6		725	716	0		1			0	0	111	0		0.979681	0	0	0	0	0	0	7	725
KIAA0100	9703	broad.mit.edu	37	17	26961608	26961608	+	Silent	SNP	A	A	G			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr17:26961608A>G	ENST00000528896.2	-	16	3071	c.2997T>C	c.(2995-2997)ccT>ccC	p.P999P	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000389003.3_Silent_p.P856P|KIAA0100_ENST00000544884.1_Silent_p.P856P|RP11-192H23.7_ENST00000583787.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	999						extracellular region (GO:0005576)		p.P999P(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CAGGGGGAAAAGGGCTGCCTG	0.493																																						ENST00000528896.2	1.000000	0.050000	0.240000	0.090000	0.140000	0.233097	0.140000	0.130000																										1	Substitution - coding silent(1)	p.P999P(1)	prostate(1)	68						c.(2995-2997)ccT>ccC		KIAA0100							110.0	106.0	107.0					17																	26961608		2203	4300	6503	SO:0001819	synonymous_variant	9703	0	0					g.chr17:26961608A>G	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2997T>C	chr17.hg19:g.26961608A>G		0					RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Silent_p.P856P|KIAA0100_ENST00000544884.1_Silent_p.P856P|RP11-192H23.7_ENST00000577814.1_RNA	p.P999P	NM_014680.3	NP_055495.2	1	2	3	2.008007	Q14667	K0100_HUMAN		16	3071	-	Lung NSC(42;0.00431)		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	0	1	hg19	c.2997T>C	CCDS32595.1	0																																																																																								0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	0	0	1		2	2	2	0		0	0	108		108	108	1	2	-1.822892	0	0.120000	NM_014680			6	6		763	754	0		1	0		0	0	108	0		0.963756	1.596628e-01	0	0	0	77	0	6	763
SLFN5	162394	broad.mit.edu	37	17	33591445	33591445	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr17:33591445C>T	ENST00000299977.4	+	4	1530	c.1382C>T	c.(1381-1383)gCg>gTg	p.A461V	SLFN5_ENST00000542451.1_Intron	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	461					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.A461V(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		AAGTGGGATGCGGGGTGCAAG	0.488																																						ENST00000299977.4	1.000000	0.060000	0.330000	0.110000	0.190000	0.275749	0.190000	0.170000																										1	Substitution - Missense(1)	p.A461V(1)	large_intestine(1)	34						c.(1381-1383)gCg>gTg		schlafen family member 5							106.0	101.0	102.0					17																	33591445		2203	4300	6503	SO:0001583	missense	162394	0	0					g.chr17:33591445C>T	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.1382C>T	chr17.hg19:g.33591445C>T	ENSP00000299977:p.Ala461Val	0					SLFN5_ENST00000542451.1_Intron	p.A461V	NM_144975.3	NP_659412.3	1	2	3	2.008007	Q08AF3	SLFN5_HUMAN		4	1530	+		Ovarian(249;0.17)	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	ENST00000299977.4	0	1	hg19	c.1382C>T	CCDS32619.1	0	.	.	.	.	.	.	.	.	.	.	c	10.19	1.281290	0.23392	.	.	ENSG00000166750	ENST00000299977	T	0.02103	4.45	3.46	-6.55	0.01854	3.460000	-6.550000	0.018540	.	3.058740	0.01369	N	0.012514	T	0.02688	0.0081	M	0.62723	1.935	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.43065	-0.9414	10	0.32370	T	0.25	.	2.054	0.03577	0.1462:0.4354:0.1471:0.2712	.	461	Q08AF3	SLFN5_HUMAN	V	461	ENSP00000299977:A461V	ENSP00000299977:A461V	A	+	2	0	0	SLFN5	30615558	30615558	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-2.060000	0.01392	-1.294000	0.02360	-0.302000	0.09304	GCG	0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.488	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	0	0	1		2	2	2	0		0	0	68		68	68	1	2	-2.290819	0	0.120000	NM_144975			5	5		494	490	0		1	0		0	0	68	0		0.936503	6.757447e-02	0	0	0	34	0	5	494
TNRC6C	57690	broad.mit.edu	37	17	76046827	76046827	+	Missense_Mutation	SNP	G	G	A	rs200217894		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr17:76046827G>A	ENST00000588061.1	+	5	2411	c.1684G>A	c.(1684-1686)Gca>Aca	p.A562T	TNRC6C_ENST00000544502.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000588847.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000301624.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000541771.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000335749.4_Missense_Mutation_p.A562T			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	562	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GAGTGGGGCCGCAAATCAGGA	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		17135	0.0		0.0	False		,,,				2504	0.001					ENST00000588061.1	1.000000	0.060000	0.300000	0.100000	0.170000	0.259706	0.170000	0.150000																										0				40						c.(1684-1686)Gca>Aca		trinucleotide repeat containing 6C		G	THR/ALA,THR/ALA	0,4056		0,0,2028	53.0	59.0	57.0		1684,1684	3.8	0.6	17		57	1,8375		0,1,4187	no	missense,missense	TNRC6C	NM_001142640.1,NM_018996.3	58,58	0,1,6215	AA,AG,GG		0.0119,0.0,0.0080	benign,benign	562/1727,562/1691	76046827	1,12431	2028	4188	6216	SO:0001583	missense	57690	32	120932	47				g.chr17:76046827G>A	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1684G>A	chr17.hg19:g.76046827G>A	ENSP00000468647:p.Ala562Thr	0					TNRC6C_ENST00000335749.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000301624.4_Missense_Mutation_p.A562T|TNRC6C_ENST00000544502.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000588847.1_Missense_Mutation_p.A562T|TNRC6C_ENST00000541771.1_Missense_Mutation_p.A562T	p.A562T			1	2	3	2.008007	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)	5	2411	+			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	0	1	hg19	c.1684G>A	CCDS45798.1	0	.	.	.	.	.	.	.	.	.	.	G	6.103	0.387346	0.11581	0.0	1.19E-4	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.14516	2.5;2.51;2.51;2.5	5.75	3.79	0.43588	5.750000	3.790000	0.435880	.	0.922167	0.09205	N	0.834117	T	0.10680	0.0261	L	0.29908	0.895	0.26878	N	0.9676	B;B;B	0.13145	0.005;0.007;0.004	B;B;B	0.08055	0.002;0.003;0.001	T	0.38286	-0.9668	10	0.13108	T	0.6	0.8073	10.4778	0.44676	0.2076:0.0:0.7924:0.0	.	562;562;562	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	T	562	ENSP00000336783:A562T;ENSP00000301624:A562T;ENSP00000440310:A562T;ENSP00000442421:A562T	ENSP00000301624:A562T	A	+	1	0	0	TNRC6C	73558422	73558422	0.864000	0.29904	0.557000	0.28306	0.995000	0.86356	3.175000	0.50855	0.800000	0.34041	0.655000	0.94253	GCA	0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.582	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	0	0	1		20	3	2	1		1	1	87		87	86	1	2	-1.985803	0	0.120000	NM_018996			5	5		544	531	0		0	0		1	0	87	0		0.001497	2.448587e-03	0	0	0	22	0	5	544
SMAD4	4089	broad.mit.edu	37	18	48593394	48593394	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr18:48593394A>T	ENST00000342988.3	+	10	1683	c.1145A>T	c.(1144-1146)cAc>cTc	p.H382L	SMAD4_ENST00000398417.2_Missense_Mutation_p.H382L|SMAD4_ENST00000588745.1_Missense_Mutation_p.H286L	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	382	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CTAAGGTTGCACATAGGCAAA	0.338																																						ENST00000342988.3	1.000000	0.360000	0.810000	0.470000	0.610000	0.644069	0.610000	0.580000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1144-1146)cAc>cTc		SMAD family member 4							180.0	151.0	161.0					18																	48593394		2203	4300	6503	SO:0001583	missense	4089	0	0					g.chr18:48593394A>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1145A>T	chr18.hg19:g.48593394A>T	ENSP00000341551:p.His382Leu	0					SMAD4_ENST00000588745.1_Missense_Mutation_p.H286L|SMAD4_ENST00000398417.2_Missense_Mutation_p.H382L	p.H382L	NM_005359.5	NP_005350.1	1	2	3	2.001983	Q13485	SMAD4_HUMAN		10	1683	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Missense_Mutation	SNP	ENST00000342988.3	1	1	hg19	c.1145A>T	CCDS11950.1	0	.	.	.	.	.	.	.	.	.	.	A	28.2	4.901257	0.92035	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98822	-5.16;-5.16	5.65	5.65	0.86999	5.650000	5.650000	0.869990	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98874	0.9619	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99873	1.1099	10	0.87932	D	0	.	14.8693	0.70444	1.0:0.0:0.0:0.0	.	382	Q13485	SMAD4_HUMAN	L	382	ENSP00000341551:H382L;ENSP00000381452:H382L	ENSP00000341551:H382L	H	+	2	0	0	SMAD4	46847392	46847392	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.236000	0.95360	2.151000	0.67156	0.460000	0.39030	CAC	0.125249		TCGA-HZ-8317-01A-11D-2396-08	0.338	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	0	0	1		2	2	2	0		0	0	79		79	79	1	2	-3.998939	1	0.120000	NM_005359			17	17		466	458	0		1	1	1	0	0	79	591		0.999961	7.102852e-01	9.999855e-01	2	22	67	509	17	466
LYPD3	27076	broad.mit.edu	37	19	43965886	43965886	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr19:43965886G>A	ENST00000244333.3	-	5	746	c.658C>T	c.(658-660)Cgc>Tgc	p.R220C		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	220	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				GAGTTACAGCGGGACCCCTGG	0.622																																						ENST00000244333.3	1.000000	0.420000	0.840000	0.510000	0.630000	0.674103	0.630000	0.610000																										0				11						c.(658-660)Cgc>Tgc		LY6/PLAUR domain containing 3							92.0	95.0	94.0					19																	43965886		2203	4300	6503	SO:0001583	missense	27076	9	121412	43				g.chr19:43965886G>A	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.658C>T	chr19.hg19:g.43965886G>A	ENSP00000244333:p.Arg220Cys	0						p.R220C	NM_014400.2	NP_055215.2	1	2	3	2.016719	O95274	LYPD3_HUMAN		5	746	-		Prostate(69;0.0153)	Q9UJ74	Missense_Mutation	SNP	ENST00000244333.3	1	1	hg19	c.658C>T	CCDS12620.1	0	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578355	0.65878	.	.	ENSG00000124466	ENST00000244333;ENST00000377995	T	0.69926	-0.44	4.38	4.38	0.52667	4.380000	4.380000	0.526670	CD59 antigen (1);	0.194301	0.35067	N	0.003473	T	0.71829	0.3386	L	0.36672	1.1	0.48975	D	0.999739	D	0.89917	1.0	D	0.70716	0.97	T	0.70461	-0.4865	10	0.38643	T	0.18	.	13.21	0.59819	0.0:0.0:1.0:0.0	.	220	O95274	LYPD3_HUMAN	C	220;168	ENSP00000244333:R220C	ENSP00000244333:R220C	R	-	1	0	0	LYPD3	48657726	48657726	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.529000	0.60588	2.396000	0.81511	0.603000	0.83216	CGC	0.128368		TCGA-HZ-8317-01A-11D-2396-08	0.622	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	0	0	1		2	2	2	0		0	0	101		101	97	1	2	-2.494819	0	0.120000	NM_014400			28	28		741	730	0		1	1		0	0	101	0		1.000000	2.977999e-01	0	3	0	26	0	28	741
ZNF473	25888	broad.mit.edu	37	19	50548290	50548290	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr19:50548290G>T	ENST00000595661.1	+	6	1085	c.590G>T	c.(589-591)aGc>aTc	p.S197I	CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000391821.2_Missense_Mutation_p.S197I|ZNF473_ENST00000270617.3_Missense_Mutation_p.S197I|ZNF473_ENST00000445728.3_Missense_Mutation_p.S185I|CTD-2126E3.3_ENST00000599914.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	197					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TCCGACCACAGCCAGCAGGAT	0.468																																						ENST00000595661.1	1.000000	0.310000	0.820000	0.410000	0.560000	0.608495	0.560000	0.520000																										0				37						c.(589-591)aGc>aTc		zinc finger protein 473							65.0	61.0	63.0					19																	50548290		2203	4300	6503	SO:0001583	missense	25888	0	0					g.chr19:50548290G>T	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.590G>T	chr19.hg19:g.50548290G>T	ENSP00000472808:p.Ser197Ile	0					ZNF473_ENST00000391821.2_Missense_Mutation_p.S197I|ZNF473_ENST00000270617.3_Missense_Mutation_p.S197I|CTD-2126E3.3_ENST00000599410.1_RNA|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000445728.3_Missense_Mutation_p.S185I	p.S197I			1	2	3	2.016719	Q8WTR7	ZN473_HUMAN		6	1085	+		all_neural(266;0.0459)|Ovarian(192;0.0728)	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	1	1	hg19	c.590G>T	CCDS33077.1	0	.	.	.	.	.	.	.	.	.	.	G	13.95	2.391145	0.42410	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.09817	3.01;3.01;2.94	4.36	0.983	0.19767	4.360000	0.983000	0.197670	.	0.440569	0.19421	N	0.114692	T	0.07413	0.0187	L	0.29908	0.895	0.28136	N	0.929982	P	0.50943	0.94	P	0.45037	0.467	T	0.27606	-1.0069	10	0.15499	T	0.54	-6.7845	6.053	0.19796	0.1824:0.158:0.6596:0.0	.	197	Q8WTR7	ZN473_HUMAN	I	197;197;185	ENSP00000270617:S197I;ENSP00000375697:S197I;ENSP00000388961:S185I	ENSP00000270617:S197I	S	+	2	0	0	ZNF473	55240102	55240102	.	.	0.124000	0.21820	0.120000	0.20174	.	.	0.336000	0.23639	0.655000	0.94253	AGC	0.128368		TCGA-HZ-8317-01A-11D-2396-08	0.468	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	0	0	1		2	2	2	0		0	0	67		67	67	1	2	-13.004760	1	0.120000	XM_046390			14	14		434	427	0		1	1		0	0	67	0		0.999734	2.848522e-02	0	2	0	6	0	14	434
LILRB2	10288	broad.mit.edu	37	19	54782828	54782828	+	Missense_Mutation	SNP	C	C	T	rs532414442		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr19:54782828C>T	ENST00000391749.4	-	6	1065	c.794G>A	c.(793-795)cGc>cAc	p.R265H	LILRB2_ENST00000391746.1_Missense_Mutation_p.R265H|LILRB2_ENST00000314446.5_Missense_Mutation_p.R265H|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000434421.1_Missense_Mutation_p.R149H|LILRB2_ENST00000391748.1_Missense_Mutation_p.R265H	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	265	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGAGCTGGCGAAGGTCACG	0.637																																						ENST00000391749.4	1.000000	0.350000	1.000000	0.460000	0.620000	0.684709	0.620000	0.560000																										0				44						c.(793-795)cGc>cAc		leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2							71.0	74.0	73.0					19																	54782828		2203	4300	6503	SO:0001583	missense	10288	12	121366	42				g.chr19:54782828C>T	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.794G>A	chr19.hg19:g.54782828C>T	ENSP00000375629:p.Arg265His	0					LILRB2_ENST00000434421.1_Missense_Mutation_p.R149H|LILRB2_ENST00000314446.5_Missense_Mutation_p.R265H|LILRB2_ENST00000391746.1_Missense_Mutation_p.R265H|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391748.1_Missense_Mutation_p.R265H	p.R265H	NM_001278406.1	NP_001265335.1	1	2	3	2.109859	Q8N423	LIRB2_HUMAN		6	1065	-	Ovarian(34;0.19)		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	0	1	hg19	c.794G>A	CCDS12886.1	0	.	.	.	.	.	.	.	.	.	.	C	12.71	2.018126	0.35606	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68	2.6	-3.34	0.04943	2.600000	-3.340000	0.049430	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.782710	0.03355	N	0.196682	T	0.17704	0.0425	L	0.42581	1.335	0.09310	N	1	D;P;D	0.58970	0.961;0.933;0.984	P;P;P	0.53809	0.735;0.735;0.735	T	0.24154	-1.0168	10	0.23302	T	0.38	.	5.3689	0.16129	0.6328:0.1698:0.1974:0.0	.	265;282;265	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	H	265;265;265;265;149	ENSP00000375628:R265H;ENSP00000319960:R265H;ENSP00000375629:R265H;ENSP00000375626:R265H;ENSP00000410117:R149H	ENSP00000319960:R265H	R	-	2	0	0	LILRB2	59474640	59474640	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.344000	0.02639	-1.121000	0.02949	-1.465000	0.01017	CGC	0.149101		TCGA-HZ-8317-01A-11D-2396-08	0.637	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1	0	0	1		25	2	2	1		1	1	63		63	62	1	2	-2.740496	1	0.120000				17	16		504	490	0		0	0		1	0	63	0		0.113788	3.761790e-02	0	0	0	9	0	17	504
USP29	57663	broad.mit.edu	37	19	57642253	57642253	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr19:57642253G>A	ENST00000254181.4	+	4	2664	c.2210G>A	c.(2209-2211)tGt>tAt	p.C737Y	USP29_ENST00000598197.1_Missense_Mutation_p.C737Y	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	737	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTCCAGCAGTGTATTGAGGAG	0.458																																						ENST00000254181.4	1.000000	0.610000	1.000000	0.770000	0.970000	0.910166	0.970000	1.000000																										0				85						c.(2209-2211)tGt>tAt		ubiquitin specific peptidase 29							63.0	59.0	60.0					19																	57642253		2203	4300	6503	SO:0001583	missense	57663	0	0					g.chr19:57642253G>A		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2210G>A	chr19.hg19:g.57642253G>A	ENSP00000254181:p.Cys737Tyr	0					USP29_ENST00000598197.1_Missense_Mutation_p.C737Y	p.C737Y	NM_020903.2	NP_065954.1	1	2	3	2.032443	Q9HBJ7	UBP29_HUMAN		4	2664	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		Missense_Mutation	SNP	ENST00000254181.4	1	1	hg19	c.2210G>A	CCDS33124.1	1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.235668	0.00277	.	.	ENSG00000131864	ENST00000254181	T	0.41400	1.0	2.18	-3.46	0.04767	2.180000	-3.460000	0.047670	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.15089	0.0364	N	0.10916	0.065	0.09310	N	1	B	0.21381	0.055	B	0.22386	0.039	T	0.26916	-1.0089	9	0.09084	T	0.74	.	0.5372	0.00638	0.4081:0.1745:0.2268:0.1905	.	737	Q9HBJ7	UBP29_HUMAN	Y	737	ENSP00000254181:C737Y	ENSP00000254181:C737Y	C	+	2	0	0	USP29	62334065	62334065	0.001000	0.12720	0.000000	0.03702	0.039000	0.13416	0.000000	0.12993	-0.815000	0.04346	0.467000	0.42956	TGT	0.131465		TCGA-HZ-8317-01A-11D-2396-08	0.458	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1	1	0	1		2	2	2	0		0	0	48		48	48	1	2	-19.999990	1	0.120000				23	23		398	395	0		1			0	0	48	0		0.999999	0	0	0	0	0	0	23	398
AKR7A2	8574	broad.mit.edu	37	1	19632583	19632583	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr1:19632583C>T	ENST00000235835.3	-	6	868	c.847G>A	c.(847-849)Gca>Aca	p.A283T	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	283					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GCGCCATATGCGGCCTGCAGG	0.632																																						ENST00000235835.3	1.000000	0.070000	0.360000	0.130000	0.200000	0.305180	0.200000	0.170000																										0				9						c.(847-849)Gca>Aca		aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)							81.0	76.0	77.0					1																	19632583		2203	4300	6503	SO:0001583	missense	8574	2	121412	36				g.chr1:19632583C>T	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.847G>A	chr1.hg19:g.19632583C>T	ENSP00000235835:p.Ala283Thr	0					RNU6-1099P_ENST00000363533.1_RNA	p.A283T	NM_003689.3	NP_003680.2	1	2	3	2.016801	O43488	ARK72_HUMAN		6	868	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	O75749|Q5TG63	Missense_Mutation	SNP	ENST00000235835.3	0	1	hg19	c.847G>A	CCDS194.1	0	.	.	.	.	.	.	.	.	.	.	C	2.734	-0.263746	0.05754	.	.	ENSG00000053371	ENST00000235835;ENST00000330072;ENST00000489286	T;T	0.04234	3.67;3.67	3.84	-4.86	0.03132	3.840000	-4.860000	0.031320	NADP-dependent oxidoreductase domain (3);	0.486606	0.22144	N	0.064003	T	0.02807	0.0084	L	0.32530	0.975	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.41963	-0.9479	10	0.20046	T	0.44	.	6.4401	0.21845	0.123:0.3475:0.0:0.5296	.	283	O43488	ARK72_HUMAN	T	283;238;145	ENSP00000235835:A283T;ENSP00000339084:A238T	ENSP00000235835:A283T	A	-	1	0	0	AKR7A2	19505170	19505170	0.010000	0.17322	0.001000	0.08648	0.017000	0.09413	0.315000	0.19451	-0.830000	0.04262	-1.010000	0.02471	GCA	0.128368		TCGA-HZ-8317-01A-11D-2396-08	0.632	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	0	0	0		2	2	2	0		0	0	67		67	67	1	2	-2.217485	0	0.120000	NM_003689			6	6		559	554	0		1	1		0	0	67	0		0.964157	4.924976e-01	0	2	0	137	0	6	559
MUC1	4582	broad.mit.edu	37	1	155161799	155161799	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr1:155161799T>G	ENST00000368395.1	-	2	405	c.334A>C	c.(334-336)Acc>Ccc	p.T112P	MUC1_ENST00000338684.5_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368390.3_Intron|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000368398.3_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000368392.3_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	892					cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTGGCGGGGTGGTGGAGCCC	0.711			T	IGH@	B-NHL																																	ENST00000368395.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000				Dom	yes			Dom	yes		1	1q21	1q21	4582	T	"""mucin 1, transmembrane"""				L	L	IGH@		B-NHL		0				10						c.(334-336)Acc>Ccc		mucin 1, cell surface associated																																				SO:0001583	missense	4582	181	120668	36				g.chr1:155161799T>G	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.334A>C	chr1.hg19:g.155161799T>G	ENSP00000357380:p.Thr112Pro	0					RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000368390.3_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000368398.3_Intron	p.T112P	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	1	2	3	2.087313	P15941	MUC1_HUMAN	Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)	2	405	-	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Missense_Mutation	SNP	ENST00000368395.1	0	1	hg19	c.334A>C	CCDS55640.1	1	.	.	.	.	.	.	.	.	.	.	T	8.249	0.808546	0.16467	.	.	ENSG00000185499	ENST00000368395;ENST00000425082	T	0.20200	2.09	2.73	0.35	0.16037	2.730000	0.350000	0.160370	.	2.188600	0.02617	N	0.102742	T	0.11024	0.0269	N	0.14661	0.345	0.09310	N	0.999999	D	0.65815	0.995	D	0.68483	0.958	T	0.17684	-1.0361	10	0.39692	T	0.17	.	3.1844	0.06596	0.0:0.2782:0.2183:0.5034	.	112	P15941	MUC1_HUMAN	P	112	ENSP00000357380:T112P	ENSP00000357380:T112P	T	-	1	0	0	MUC1	153428423	153428423	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.417000	0.07088	0.027000	0.15297	-1.038000	0.02383	ACC	0.143135		TCGA-HZ-8317-01A-11D-2396-08	0.711	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086735.1	0	0	1		18	77	2	1		1	1	17		17	17	1	2	-2.653245	1	0.120000	NM_002456			22	21		91	88	0		1	1		1	0	17	0		0.763028	9.863666e-01	0	91	0	550	0	22	91
IFI44	10561	broad.mit.edu	37	1	79128422	79128422	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr1:79128422C>G	ENST00000370747.4	+	8	1232	c.1147C>G	c.(1147-1149)Ctt>Gtt	p.L383V	IFI44_ENST00000495254.1_3'UTR	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	383					response to virus (GO:0009615)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						TGGATTTGCTCTTTCTGACAT	0.368																																						ENST00000370747.4	0.980000	0.360000	0.810000	0.480000	0.630000	0.649344	0.630000	1.000000																										0				21						c.(1147-1149)Ctt>Gtt		interferon-induced protein 44							123.0	111.0	115.0					1																	79128422		2203	4300	6503	SO:0001583	missense	10561	0	0					g.chr1:79128422C>G	D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.1147C>G	chr1.hg19:g.79128422C>G	ENSP00000359783:p.Leu383Val	0					IFI44_ENST00000495254.1_3'UTR	p.L383V	NM_006417.4	NP_006408.3	0	0	0	1.978634	Q8TCB0	IFI44_HUMAN		8	1232	+			B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	ENST00000370747.4	1	1	hg19	c.1147C>G	CCDS688.1	0	.	.	.	.	.	.	.	.	.	.	C	3.724	-0.056868	0.07362	.	.	ENSG00000137965	ENST00000370747	T	0.08458	3.09	3.79	0.729	0.18266	3.790000	0.729000	0.182660	.	0.232813	0.26457	N	0.024265	T	0.01489	0.0048	L	0.39633	1.23	0.80722	D	1	B	0.33266	0.404	B	0.27715	0.082	T	0.47497	-0.9113	10	0.13108	T	0.6	-4.7103	3.4522	0.07502	0.0:0.4573:0.1987:0.344	.	383	Q8TCB0	IFI44_HUMAN	V	383	ENSP00000359783:L383V	ENSP00000359783:L383V	L	+	1	0	0	IFI44	78901010	78901010	0.907000	0.30839	0.079000	0.20413	0.941000	0.58515	0.126000	0.15769	0.153000	0.19213	0.514000	0.50259	CTT	0.106054		TCGA-HZ-8317-01A-11D-2396-08	0.368	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	1	0	1		2	2	2	0		0	0	64		64	64	1	2	-3.912737	1	0.120000	NM_006417			14	13		353	347	0		1	1		0	0	64	0		0.999733	8.486199e-01	0	7	0	81	0	14	353
HEATR1	55127	broad.mit.edu	37	1	236739626	236739626	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr1:236739626G>A	ENST00000366582.3	-	22	3091	c.2977C>T	c.(2977-2979)Cat>Tat	p.H993Y	HEATR1_ENST00000366581.2_Missense_Mutation_p.H993Y	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	993					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AACTTCTGATGAGATTTCAGT	0.318																																						ENST00000366582.3	0.780000	0.360000	0.670000	0.440000	0.550000	0.564383	0.550000	0.550000																										0				87						c.(2977-2979)Cat>Tat		HEAT repeat containing 1							133.0	141.0	139.0					1																	236739626		2203	4300	6503	SO:0001583	missense	55127	0	0					g.chr1:236739626G>A	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2977C>T	chr1.hg19:g.236739626G>A	ENSP00000355541:p.His993Tyr	0					HEATR1_ENST00000366581.2_Missense_Mutation_p.H993Y	p.H993Y	NM_018072.5	NP_060542.4	0	1	1	1.995684	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)	22	3091	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	1	1	hg19	c.2977C>T	CCDS31066.1	0	.	.	.	.	.	.	.	.	.	.	G	2.336	-0.352148	0.05173	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66099	-0.17;-0.19	5.33	3.46	0.39613	5.330000	3.460000	0.396130	Armadillo-type fold (2);	0.584047	0.17920	N	0.157540	T	0.44138	0.1279	L	0.31294	0.92	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27226	-1.0080	10	0.02654	T	1	.	11.691	0.51516	0.1441:0.0:0.8559:0.0	.	993;993	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	Y	993	ENSP00000355541:H993Y;ENSP00000355540:H993Y	ENSP00000355540:H993Y	H	-	1	0	0	HEATR1	234806249	234806249	1.000000	0.71417	0.983000	0.44433	0.946000	0.59487	2.700000	0.47085	0.646000	0.30693	0.460000	0.39030	CAT	0.114688		TCGA-HZ-8317-01A-11D-2396-08	0.318	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	0	0	1		2	2	2	0		0	0	101		101	101	1	2	-2.903066	1	0.120000	XM_375853			24	23		700	697	0		1	0		0	0	101	0		1.000000	1.515303e-01	0	0	0	20	0	24	700
DNMT3B	1789	broad.mit.edu	37	20	31385055	31385055	+	Silent	SNP	G	G	C			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr20:31385055G>C	ENST00000328111.2	+	14	1761	c.1440G>C	c.(1438-1440)gtG>gtC	p.V480V	DNMT3B_ENST00000344505.4_Silent_p.V460V|DNMT3B_ENST00000456297.2_Silent_p.V384V|DNMT3B_ENST00000348286.2_Silent_p.V460V|DNMT3B_ENST00000201963.3_Silent_p.V472V|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000353855.2_Silent_p.V460V|DNMT3B_ENST00000443239.3_Silent_p.V418V	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	480	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACTGCACTGTGTGCTGCGAGG	0.582																																						ENST00000328111.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999631	0.990000	1.000000																										0				39						c.(1438-1440)gtG>gtC		DNA (cytosine-5-)-methyltransferase 3 beta							103.0	103.0	103.0					20																	31385055		2203	4300	6503	SO:0001819	synonymous_variant	1789	0	0					g.chr20:31385055G>C		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.1440G>C	chr20.hg19:g.31385055G>C		0					DNMT3B_ENST00000348286.2_Silent_p.V460V|DNMT3B_ENST00000353855.2_Silent_p.V460V|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000344505.4_Silent_p.V460V|DNMT3B_ENST00000456297.2_Silent_p.V384V|DNMT3B_ENST00000443239.3_Silent_p.V418V|DNMT3B_ENST00000201963.3_Silent_p.V472V	p.V480V	NM_006892.3	NP_008823.1	1	2	3	2.079120	Q9UBC3	DNM3B_HUMAN		14	1761	+			A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Silent	SNP	ENST00000328111.2	1	1	hg19	c.1440G>C	CCDS13205.1	1																																																																																								0.141631		TCGA-HZ-8317-01A-11D-2396-08	0.582	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	1	0	1		2	2	2	0		0	0	100		100	98	1	2	-14.341810	1	0.120000	NM_006892			62	62		728	720	0		1	1		0	0	100	0		1.000000	1.023110e-01	0	2	0	5	0	62	728
ZNF335	63925	broad.mit.edu	37	20	44578999	44578999	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr20:44578999C>T	ENST00000322927.2	-	22	3446	c.3346G>A	c.(3346-3348)Ggg>Agg	p.G1116R	ZNF335_ENST00000426788.1_Missense_Mutation_p.G961R	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1116					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.G1116W(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TTGAGGTGCCCGTTACGGTTG	0.612																																						ENST00000322927.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.998705	0.990000	1.000000																										1	Substitution - Missense(1)	p.G1116W(1)	lung(1)	51						c.(3346-3348)Ggg>Agg		zinc finger protein 335							97.0	100.0	99.0					20																	44578999		2203	4300	6503	SO:0001583	missense	63925	1	121400	35				g.chr20:44578999C>T	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3346G>A	chr20.hg19:g.44578999C>T	ENSP00000325326:p.Gly1116Arg	0					ZNF335_ENST00000426788.1_Missense_Mutation_p.G961R	p.G1116R	NM_022095.3	NP_071378.1	1	2	3	2.079120	Q9H4Z2	ZN335_HUMAN		22	3446	-		Myeloproliferative disorder(115;0.0122)	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	1	1	hg19	c.3346G>A	CCDS13389.1	1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302358	0.60195	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.10192	3.05;2.9	4.64	4.64	0.57946	4.640000	4.640000	0.579460	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.21227	0.0511	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.989	T	0.03077	-1.1075	10	0.72032	D	0.01	-33.3619	17.0199	0.86431	0.0:1.0:0.0:0.0	.	961;1116	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	R	1116;893;961	ENSP00000325326:G1116R;ENSP00000397098:G961R	ENSP00000243961:G893R	G	-	1	0	0	ZNF335	44012406	44012406	1.000000	0.71417	0.964000	0.40570	0.400000	0.30750	7.178000	0.77657	2.585000	0.87301	0.655000	0.94253	GGG	0.141631		TCGA-HZ-8317-01A-11D-2396-08	0.612	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	1	0	1		2	2	2	0		0	0	107		107	105	1	2	-2.352652	0	0.120000	NM_022095			53	53		649	637	0		1	1		0	0	107	0		1.000000	8.346610e-01	0	7	0	35	0	53	649
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371085.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999374	0.990000	1.000000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		88	Substitution - Missense(88)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)	441						c.(601-603)cGt>cAt		GNAS complex locus							80.0	78.0	79.0					20																	57484421		2203	4300	6503	SO:0001583	missense	2778	10	121412	32				g.chr20:57484421G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	chr20.hg19:g.57484421G>A	ENSP00000360126:p.Arg201His	0	TSP Lung(22;0.16)				GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H	p.R201H	NM_000516.4	NP_000507.1	1	2	3	2.079120	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	8	1026	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	0	1	hg19	c.602G>A	CCDS13472.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	5.530000	5.530000	0.826870	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	0	GNAS	56917816	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT	0.141631		TCGA-HZ-8317-01A-11D-2396-08	0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	1	0	1		22	91	2	1		1	1	62		62	62	1	2	-2.716734	1	0.120000	NM_000516			37	37		401	399	0		1	1	1	1	0	62	523		0.983810	9.999708e-01	1	321	38	2045	536	37	401
CRYBB3	1417	broad.mit.edu	37	22	25597368	25597368	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr22:25597368C>T	ENST00000215855.2	+	2	85	c.5C>T	c.(4-6)gCg>gTg	p.A2V	CRYBB3_ENST00000404334.1_Missense_Mutation_p.A2V	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	2	N-terminal arm.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.A2V(1)		large_intestine(2)|lung(2)|prostate(1)	5						GGGGAGATGGCGGAACAGCAC	0.597																																						ENST00000215855.2	0.290000	0.060000	0.220000	0.100000	0.150000	0.168187	0.150000	0.150000																										1	Substitution - Missense(1)	p.A2V(1)	prostate(1)	5						c.(4-6)gCg>gTg		crystallin, beta B3							85.0	89.0	88.0					22																	25597368		2203	4300	6503	SO:0001583	missense	1417	1	121412	35				g.chr22:25597368C>T		CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.5C>T	chr22.hg19:g.25597368C>T	ENSP00000215855:p.Ala2Val	0					CRYBB3_ENST00000404334.1_Missense_Mutation_p.A2V	p.A2V	NM_004076.3	NP_004067.1	0	0	0	1.926876	P26998	CRBB3_HUMAN		2	85	+			Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	ENST00000215855.2	0	1	hg19	c.5C>T	CCDS13830.1	0	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307872	0.23821	.	.	ENSG00000100053	ENST00000215855;ENST00000404334	T;T	0.79554	-0.93;-1.28	4.81	2.29	0.28610	4.810000	2.290000	0.286100	.	0.512848	0.13707	U	0.368369	T	0.64382	0.2593	L	0.34521	1.04	0.28366	N	0.920233	B	0.34313	0.448	B	0.25140	0.058	T	0.61192	-0.7112	10	0.72032	D	0.01	.	3.7975	0.08746	0.1677:0.5667:0.1634:0.1022	.	2	P26998	CRBB3_HUMAN	V	2	ENSP00000215855:A2V;ENSP00000386123:A2V	ENSP00000215855:A2V	A	+	2	0	0	CRYBB3	23927368	23927368	0.964000	0.33143	0.869000	0.34112	0.052000	0.14988	2.195000	0.42677	1.018000	0.39521	-0.122000	0.15005	GCG	0.081420		TCGA-HZ-8317-01A-11D-2396-08	0.597	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	0	0	1		2	2	2	0		0	0	100		100	100	1	2	-1.898831	0	0.120000	NM_004076			7	6		739	735	0		1	0		0	0	100	0		0.980279	3.821138e-04	0	0	0	3	0	7	739
MYH9	4627	broad.mit.edu	37	22	36702080	36702080	+	Silent	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr22:36702080C>T	ENST00000216181.5	-	17	2285	c.2055G>A	c.(2053-2055)ccG>ccA	p.P685P		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	685	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GCACGAGATGCGGGTCCAGCT	0.592			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													ENST00000216181.5	0.360000	0.070000	0.270000	0.120000	0.180000	0.202276	0.180000	0.180000				Dom	yes			Dom	yes		22	22q13.1	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	yes	Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome	L	L	ALK		ALCL		0				86						c.(2053-2055)ccG>ccA		myosin, heavy chain 9, non-muscle							66.0	62.0	64.0					22																	36702080		2203	4300	6503	SO:0001819	synonymous_variant	4627	4	121404	36	Hereditary Macrothrombocytopenia, MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	g.chr22:36702080C>T		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2055G>A	chr22.hg19:g.36702080C>T		0						p.P685P	NM_002473.4	NP_002464.1	0	0	0	1.926876	P35579	MYH9_HUMAN		17	2285	-			A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	0	1	hg19	c.2055G>A	CCDS13927.1	0																																																																																								0.081420		TCGA-HZ-8317-01A-11D-2396-08	0.592	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	0	0	1		2	16	2	1		1	0	90		90	89	1	2	-2.229277	0	0.120000	NM_002473			6	6		533	527	0		1	0		1	0	90	0		0.963915	5.177535e-03	0	0	0	419	0	6	533
SLC8A1	6546	broad.mit.edu	37	2	40656239	40656239	+	Silent	SNP	G	G	A	rs545044457		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr2:40656239G>A	ENST00000403092.1	-	2	1215	c.1182C>T	c.(1180-1182)caC>caT	p.H394H	SLC8A1_ENST00000542756.1_Silent_p.H394H|SLC8A1_ENST00000405269.1_Silent_p.H394H|SLC8A1_ENST00000542024.1_Silent_p.H394H|SLC8A1_ENST00000402441.1_Silent_p.H394H|SLC8A1_ENST00000408028.2_Silent_p.H394H|SLC8A1_ENST00000405901.3_Silent_p.H394H|SLC8A1_ENST00000406785.2_Silent_p.H394H|SLC8A1_ENST00000332839.4_Silent_p.H394H|SLC8A1_ENST00000406391.2_Silent_p.H394H			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	394					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGTTGACCTCGTGCATGCTGA	0.468													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21448	0.0		0.0	False		,,,				2504	0.0					ENST00000403092.1	1.000000	0.340000	0.810000	0.450000	0.590000	0.632195	0.590000	0.560000																										0				100						c.(1180-1182)caC>caT		solute carrier family 8 (sodium/calcium exchanger), member 1	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						129.0	103.0	112.0					2																	40656239		2203	4300	6503	SO:0001819	synonymous_variant	6546	4	121402	36				g.chr2:40656239G>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1182C>T	chr2.hg19:g.40656239G>A		0					SLC8A1_ENST00000542024.1_Silent_p.H394H|SLC8A1_ENST00000406391.2_Silent_p.H394H|SLC8A1_ENST00000542756.1_Silent_p.H394H|SLC8A1_ENST00000332839.4_Silent_p.H394H|SLC8A1_ENST00000402441.1_Silent_p.H394H|SLC8A1_ENST00000405269.1_Silent_p.H394H|SLC8A1_ENST00000408028.2_Silent_p.H394H|SLC8A1_ENST00000405901.3_Silent_p.H394H|SLC8A1_ENST00000406785.2_Silent_p.H394H	p.H394H			1	2	3	2.008043	P32418	NAC1_HUMAN		2	1215	-			A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	1	1	hg19	c.1182C>T	CCDS1806.1	0																																																																																								0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	0	0	1		19	2	2	1		1	1	83		83	83	1	2	-3.906712	1	0.120000	NM_021097			16	16		456	457	0		0	0		1	0	83	0		0.365502	1.015588e-01	0	0	0	15	0	16	456
TATDN2	9797	broad.mit.edu	37	3	10312110	10312110	+	Missense_Mutation	SNP	G	G	A	rs374867810		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr3:10312110G>A	ENST00000287652.4	+	4	2295	c.1244G>A	c.(1243-1245)cGc>cAc	p.R415H	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Missense_Mutation_p.R415H	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	415					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.R415H(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						AGCCGGAGCCGCATGAGTGAT	0.567																																						ENST00000287652.4	1.000000	0.050000	0.220000	0.080000	0.130000	0.209160	0.130000	0.120000																										1	Substitution - Missense(1)	p.R415H(1)	prostate(1)	28						c.(1243-1245)cGc>cAc		TatD DNase domain containing 2							86.0	86.0	86.0					3																	10312110		2203	4300	6503	SO:0001583	missense	9797	2	121412	39				g.chr3:10312110G>A	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.1244G>A	chr3.hg19:g.10312110G>A	ENSP00000287652:p.Arg415His	0					RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Missense_Mutation_p.R415H	p.R415H	NM_014760.3	NP_055575.3	1	2	3	2.002898	Q93075	TATD2_HUMAN		4	2295	+			Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	0	1	hg19	c.1244G>A	CCDS33698.1	0	.	.	.	.	.	.	.	.	.	.	G	8.315	0.822940	0.16678	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.43294	0.95;0.95	4.65	-7.6	0.01303	4.650000	-7.600000	0.013030	.	.	.	.	.	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15723	-1.0427	9	0.30854	T	0.27	-1.0794	1.7629	0.02995	0.2604:0.0815:0.319:0.3391	.	415	Q93075	TATD2_HUMAN	H	415	ENSP00000287652:R415H;ENSP00000408736:R415H	ENSP00000287652:R415H	R	+	2	0	0	TATDN2	10287110	10287110	0.000000	0.05858	0.002000	0.10522	0.142000	0.21351	-0.096000	0.11059	-0.765000	0.04645	-0.280000	0.10049	CGC	0.125249		TCGA-HZ-8317-01A-11D-2396-08	0.567	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	0	0	1		2	2	2	0		0	0	117		117	116	1	2	-1.859880	0	0.120000	XM_376203			6	6		826	821	0		1	0		0	0	117	0		0.964246	6.819056e-02	0	0	0	49	0	6	826
CCR3	1232	broad.mit.edu	37	3	46307531	46307531	+	Silent	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr3:46307531C>T	ENST00000357422.2	+	4	1425	c.882C>T	c.(880-882)tgC>tgT	p.C294C	CCR3_ENST00000545097.1_Silent_p.C315C|CCR3_ENST00000541018.1_Silent_p.C294C|CCR3_ENST00000395942.2_Silent_p.C294C|CCR3_ENST00000395940.2_Silent_p.C294C			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	294					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		ACTCCCACTGCTGCATGAACC	0.527																																						ENST00000357422.2	1.000000	0.090000	0.420000	0.160000	0.250000	0.324132	0.250000	0.230000																										0				18						c.(880-882)tgC>tgT		chemokine (C-C motif) receptor 3							120.0	100.0	107.0					3																	46307531		2203	4300	6503	SO:0001819	synonymous_variant	1232	0	0					g.chr3:46307531C>T	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.882C>T	chr3.hg19:g.46307531C>T		0					CCR3_ENST00000541018.1_Silent_p.C294C|CCR3_ENST00000545097.1_Silent_p.C315C|CCR3_ENST00000395940.2_Silent_p.C294C|CCR3_ENST00000395942.2_Silent_p.C294C	p.C294C			1	2	3	2.002898	P51677	CCR3_HUMAN		4	1425	+			B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Silent	SNP	ENST00000357422.2	0	1	hg19	c.882C>T	CCDS2738.1	0																																																																																								0.125249		TCGA-HZ-8317-01A-11D-2396-08	0.527	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2	0	0	1		2	2	2	0		0	0	54		54	54	1	2	-5.330120	1	0.120000				5	5		366	358	0		1			0	0	54	0		0.934313	0	0	0	0	0	0	5	366
RHOA	387	broad.mit.edu	37	3	49405942	49405942	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr3:49405942A>T	ENST00000418115.1	-	3	580	c.196T>A	c.(196-198)Tat>Aat	p.Y66N	RHOA_ENST00000454011.2_Intron|RHOA_ENST00000422781.1_Missense_Mutation_p.Y66N|RHOA-IT1_ENST00000428083.1_RNA	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	66					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		AGGCGATCATAATCTTCCTGC	0.493																																						ENST00000418115.1	1.000000	0.610000	1.000000	0.730000	0.870000	0.869421	0.870000	1.000000																										0				12						c.(196-198)Tat>Aat		ras homolog family member A							122.0	117.0	119.0					3																	49405942		2203	4300	6503	SO:0001583	missense	387	0	0					g.chr3:49405942A>T	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.196T>A	chr3.hg19:g.49405942A>T	ENSP00000400175:p.Tyr66Asn	0					RHOA_ENST00000422781.1_Missense_Mutation_p.Y66N|RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000454011.2_Intron	p.Y66N	NM_001664.2	NP_001655.1	1	2	3	2.002898	P61586	RHOA_HUMAN		3	580	-			P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	1	1	hg19	c.196T>A	CCDS2795.1	1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889072	0.91814	.	.	ENSG00000067560	ENST00000418115;ENST00000422781;ENST00000445425	D;D;D	0.81579	-1.51;-1.51;-1.51	5.78	5.78	0.91487	5.780000	5.780000	0.914870	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91696	0.7375	M	0.92970	3.365	0.80722	D	1	P	0.40398	0.716	P	0.60012	0.867	D	0.93013	0.6433	10	0.87932	D	0	.	14.9619	0.71164	1.0:0.0:0.0:0.0	.	66	P61586	RHOA_HUMAN	N	66	ENSP00000400175:Y66N;ENSP00000413587:Y66N;ENSP00000408402:Y66N	ENSP00000400175:Y66N	Y	-	1	0	0	RHOA	49380946	49380946	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.163000	0.94750	2.219000	0.72066	0.450000	0.29827	TAT	0.125249		TCGA-HZ-8317-01A-11D-2396-08	0.493	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	1	0	1		2	2	2	0		0	0	90		90	88	1	2	-20.000000	1	0.120000	NM_001664			33	33		609	606	1		1	1		0	0	90	0		1.000000	1	0	193	0	1322	0	33	609
TPRG1	285386	broad.mit.edu	37	3	189028237	189028237	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr3:189028237G>A	ENST00000345063.3	+	5	709	c.542G>A	c.(541-543)cGc>cAc	p.R181H	TPRG1_ENST00000433971.1_Missense_Mutation_p.R181H	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	181						cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CTTCTGTCCCGCTGGAACCCA	0.473																																						ENST00000345063.3	1.000000	0.090000	0.410000	0.150000	0.250000	0.318509	0.250000	0.210000																										0				16						c.(541-543)cGc>cAc		tumor protein p63 regulated 1							80.0	78.0	79.0					3																	189028237		2203	4300	6503	SO:0001583	missense	285386	7	121406	37				g.chr3:189028237G>A	AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.542G>A	chr3.hg19:g.189028237G>A	ENSP00000341031:p.Arg181His	0					TPRG1_ENST00000433971.1_Missense_Mutation_p.R181H	p.R181H	NM_198485.3	NP_940887.1	1	2	3	2.002898	Q6ZUI0	TPRG1_HUMAN	Lung(62;6.93e-06)	5	709	+	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)		Missense_Mutation	SNP	ENST00000345063.3	0	1	hg19	c.542G>A	CCDS3292.1	0	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865563	0.71949	.	.	ENSG00000188001	ENST00000433971;ENST00000345063	.	.	.	5.83	4.93	0.64822	5.830000	4.930000	0.648220	.	0.052144	0.64402	D	0.000001	T	0.61350	0.2340	M	0.74647	2.275	0.52099	D	0.999945	B	0.17465	0.022	B	0.10450	0.005	T	0.62248	-0.6894	9	0.87932	D	0	-2.1854	10.2396	0.43303	0.1661:0.0:0.8339:0.0	.	181	Q6ZUI0	TPRG1_HUMAN	H	181	.	ENSP00000341031:R181H	R	+	2	0	0	TPRG1	190510931	190510931	1.000000	0.71417	0.494000	0.27515	0.710000	0.40934	4.374000	0.59543	1.416000	0.47057	0.585000	0.79938	CGC	0.125249		TCGA-HZ-8317-01A-11D-2396-08	0.473	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343931.1	0	0	1		2	2	2	0		0	0	66		66	65	1	2	-2.774100	1	0.120000	NM_198485			5	5		375	374	0		1	0		0	0	66	0		0.937502	4.661744e-02	0	0	0	21	0	5	375
KLB	152831	broad.mit.edu	37	4	39448687	39448687	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr4:39448687G>A	ENST00000257408.4	+	4	2438	c.2341G>A	c.(2341-2343)Gac>Aac	p.D781N		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	781	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CAAGACCGGGGACTACCCCGC	0.672																																						ENST00000257408.4	1.000000	0.370000	0.870000	0.490000	0.640000	0.671535	0.640000	0.610000																										0				29						c.(2341-2343)Gac>Aac		klotho beta							28.0	31.0	30.0					4																	39448687		2188	4276	6464	SO:0001583	missense	152831	0	0					g.chr4:39448687G>A	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2341G>A	chr4.hg19:g.39448687G>A	ENSP00000257408:p.Asp781Asn	0						p.D781N	NM_175737.3	NP_783864.1	1	2	3	2.005616	Q86Z14	KLOTB_HUMAN		4	2438	+			Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	1	1	hg19	c.2341G>A	CCDS3451.1	0	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854905	0.71719	.	.	ENSG00000134962	ENST00000257408	T	0.33654	1.4	4.95	4.95	0.65309	4.950000	4.950000	0.653090	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.050736	0.85682	D	0.000000	T	0.41465	0.1160	M	0.65975	2.015	0.49051	D	0.99974	P;P	0.44139	0.827;0.827	B;B	0.43445	0.42;0.42	T	0.46289	-0.9202	10	0.87932	D	0	-32.5532	12.6289	0.56646	0.0803:0.0:0.9197:0.0	.	772;781	B7ZL50;Q86Z14	.;KLOTB_HUMAN	N	781	ENSP00000257408:D781N	ENSP00000257408:D781N	D	+	1	0	0	KLB	39125082	39125082	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	5.387000	0.66243	2.293000	0.77203	0.313000	0.20887	GAC	0.125770		TCGA-HZ-8317-01A-11D-2396-08	0.672	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	1	0	1		2	2	2	0		0	0	51		51	51	1	2	-15.594620	1	0.120000	NM_175737			16	16		420	415	0		1	0		0	0	51	0		0.999930	4.636798e-03	0	0	0	3	0	16	420
LPHN3	23284	broad.mit.edu	37	4	62812695	62812695	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr4:62812695C>T	ENST00000514591.1	+	15	2608	c.2279C>T	c.(2278-2280)gCc>gTc	p.A760V	LPHN3_ENST00000506700.1_Missense_Mutation_p.A760V|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000514157.1_Missense_Mutation_p.A760V|LPHN3_ENST00000506720.1_Missense_Mutation_p.A828V|LPHN3_ENST00000512091.2_Missense_Mutation_p.A760V|LPHN3_ENST00000506746.1_Missense_Mutation_p.A828V|LPHN3_ENST00000504896.1_Missense_Mutation_p.A760V|LPHN3_ENST00000511324.1_Missense_Mutation_p.A828V|LPHN3_ENST00000508693.1_Missense_Mutation_p.A828V|LPHN3_ENST00000509896.1_Missense_Mutation_p.A828V|LPHN3_ENST00000545650.1_Missense_Mutation_p.A760V|LPHN3_ENST00000514996.1_Missense_Mutation_p.A760V|LPHN3_ENST00000507164.1_Missense_Mutation_p.A828V|LPHN3_ENST00000508946.1_Missense_Mutation_p.A760V|LPHN3_ENST00000507625.1_Missense_Mutation_p.A828V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	747					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.A760V(3)|p.A760G(1)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ACGGAGAATGCCAGTATGAAG	0.403																																						ENST00000514591.1	1.000000	0.030000	0.160000	0.060000	0.100000	0.184781	0.100000	0.090000																										4	Substitution - Missense(4)	p.A760V(3)|p.A760G(1)	prostate(3)|lung(1)	125						c.(2278-2280)gCc>gTc		latrophilin 3							261.0	245.0	250.0					4																	62812695		1885	4119	6004	SO:0001583	missense	23284	0	0					g.chr4:62812695C>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2279C>T	chr4.hg19:g.62812695C>T	ENSP00000422533:p.Ala760Val	0					LPHN3_ENST00000511324.1_Missense_Mutation_p.A828V|LPHN3_ENST00000514996.1_Missense_Mutation_p.A760V|LPHN3_ENST00000506700.1_Missense_Mutation_p.A760V|LPHN3_ENST00000509896.1_Missense_Mutation_p.A828V|LPHN3_ENST00000508946.1_Missense_Mutation_p.A760V|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000508693.1_Missense_Mutation_p.A828V|LPHN3_ENST00000514157.1_Missense_Mutation_p.A760V|LPHN3_ENST00000512091.2_Missense_Mutation_p.A760V|LPHN3_ENST00000507164.1_Missense_Mutation_p.A828V|LPHN3_ENST00000506746.1_Missense_Mutation_p.A828V|LPHN3_ENST00000506720.1_Missense_Mutation_p.A828V|LPHN3_ENST00000507625.1_Missense_Mutation_p.A828V|LPHN3_ENST00000545650.1_Missense_Mutation_p.A760V|LPHN3_ENST00000504896.1_Missense_Mutation_p.A760V	p.A760V			1	2	3	2.005616	Q9HAR2	LPHN3_HUMAN		15	2608	+			E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	0	1	hg19	c.2279C>T	CCDS54768.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.409129	0.96072	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75	5.51	5.51	0.81932	5.510000	5.510000	0.819320	Domain of unknown function DUF3497 (1);	0.000000	0.85682	D	0.000000	T	0.30603	0.0770	M	0.65975	2.015	0.80722	D	1	D;D;D	0.56746	0.977;0.977;0.972	P;P;P	0.59703	0.862;0.862;0.616	T	0.00849	-1.1541	10	0.66056	D	0.02	.	19.4278	0.94751	0.0:1.0:0.0:0.0	.	760;747;760	E9PE04;Q9HAR2;Q9HAR2-2	.;LPHN3_HUMAN;.	V	760;760;828;828;760;760;747;760;828;828;828;760;760;760;828;828;760	ENSP00000423388:A760V;ENSP00000422533:A760V;ENSP00000423787:A828V;ENSP00000425033:A828V;ENSP00000424120:A760V;ENSP00000439831:A760V;ENSP00000421476:A828V;ENSP00000424030:A828V;ENSP00000421372:A828V;ENSP00000425201:A760V;ENSP00000423434:A760V;ENSP00000421627:A760V;ENSP00000420931:A828V;ENSP00000425884:A828V;ENSP00000424258:A760V	ENSP00000280009:A760V	A	+	2	0	0	LPHN3	62495290	62495290	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.595000	0.87683	0.557000	0.71058	GCC	0.125770		TCGA-HZ-8317-01A-11D-2396-08	0.403	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1	0	0	1		2	2	2	0		0	0	167		167	165	1	2	-1.905658	0	0.120000				7	7		1259	1246	0		1	0		0	0	167	0		0.979846	4.474573e-05	0	0	0	2	0	7	1259
COPS4	51138	broad.mit.edu	37	4	83978424	83978424	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr4:83978424G>A	ENST00000264389.2	+	6	713	c.578G>A	c.(577-579)cGt>cAt	p.R193H	COPS4_ENST00000503682.1_Missense_Mutation_p.R193H|COPS4_ENST00000511653.1_Missense_Mutation_p.R193H|COPS4_ENST00000509093.1_Missense_Mutation_p.R193H	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	193					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TGCTATGCACGTGTTCTTGAT	0.338																																						ENST00000264389.2	1.000000	0.220000	0.680000	0.320000	0.450000	0.508598	0.450000	0.420000																										0				13						c.(577-579)cGt>cAt		COP9 signalosome subunit 4							69.0	67.0	68.0					4																	83978424		2203	4300	6503	SO:0001583	missense	51138	0	0					g.chr4:83978424G>A	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.578G>A	chr4.hg19:g.83978424G>A	ENSP00000264389:p.Arg193His	0					COPS4_ENST00000509093.1_Missense_Mutation_p.R193H|COPS4_ENST00000503682.1_Missense_Mutation_p.R193H|COPS4_ENST00000511653.1_Missense_Mutation_p.R193H	p.R193H	NM_016129.2	NP_057213.2	1	2	3	2.005616	Q9BT78	CSN4_HUMAN		6	713	+		Hepatocellular(203;0.114)	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	ENST00000264389.2	1	1	hg19	c.578G>A	CCDS3600.1	0	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672433	0.88348	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.57107	0.47;0.59;0.65;0.42;0.55	5.57	4.73	0.59995	5.570000	4.730000	0.599950	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.74520	0.3727	M	0.86028	2.79	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;1.0;1.0	D;P;D;D	0.79784	0.991;0.721;0.981;0.993	T	0.79200	-0.1901	10	0.66056	D	0.02	-7.0725	14.2998	0.66339	0.0714:0.0:0.9286:0.0	.	193;193;193;193	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	H	193;193;81;193;193	ENSP00000425976:R193H;ENSP00000264389:R193H;ENSP00000425486:R81H;ENSP00000424791:R193H;ENSP00000424655:R193H	ENSP00000264389:R193H	R	+	2	0	0	COPS4	84197448	84197448	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.370000	0.97159	1.355000	0.45865	0.467000	0.42956	CGT	0.125770		TCGA-HZ-8317-01A-11D-2396-08	0.338	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1	0	0	1		2	2	2	0		0	0	46		46	46	1	2	-9.025456	1	0.120000				9	8		346	343	0		1	1		0	0	46	0		0.994065	7.164739e-01	0	4	0	91	0	9	346
POU4F2	5458	broad.mit.edu	37	4	147561030	147561030	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr4:147561030C>A	ENST00000281321.3	+	2	548	c.300C>A	c.(298-300)ttC>ttA	p.F100L	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	100					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					GCAATATATTCGGCGGGCTGG	0.612																																						ENST00000281321.3	1.000000	0.090000	0.450000	0.160000	0.270000	0.341458	0.270000	0.230000																										0				33						c.(298-300)ttC>ttA		POU class 4 homeobox 2							38.0	57.0	51.0					4																	147561030		2203	4300	6503	SO:0001583	missense	5458	0	0					g.chr4:147561030C>A	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.300C>A	chr4.hg19:g.147561030C>A	ENSP00000281321:p.Phe100Leu	0					AC093887.1_ENST00000584185.1_RNA	p.F100L	NM_004575.2	NP_004566.2	1	2	3	2.005616	Q12837	PO4F2_HUMAN		2	548	+	all_hematologic(180;0.151)		B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	0	1	hg19	c.300C>A	CCDS34074.1	0	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656967	0.67586	.	.	ENSG00000151615	ENST00000281321	T	0.20881	2.04	5.9	5.05	0.67936	5.900000	5.050000	0.679360	.	0.000000	0.85682	D	0.000000	T	0.39937	0.1097	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.19451	-1.0305	10	0.59425	D	0.04	.	10.1163	0.42593	0.0:0.8456:0.0:0.1544	.	100	Q12837	PO4F2_HUMAN	L	100	ENSP00000281321:F100L	ENSP00000281321:F100L	F	+	3	2	2	POU4F2	147780480	147780480	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.989000	0.40707	1.489000	0.48450	0.563000	0.77884	TTC	0.125770		TCGA-HZ-8317-01A-11D-2396-08	0.612	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	0	0	1		2	2	2	0		0	0	36		36	36	1	2	-3.144570	1	0.120000	NM_004575			5	5		349	343	0		1			0	0	36	0		0.935132	0	0	0	0	0	0	5	349
PCDHB13	56123	broad.mit.edu	37	5	140594939	140594939	+	Missense_Mutation	SNP	C	C	T	rs535862350		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr5:140594939C>T	ENST00000341948.4	+	1	1431	c.1244C>T	c.(1243-1245)gCg>gTg	p.A415V		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	415	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAAGCAGAGCGGAATACAAC	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		20671	0.0		0.0	False		,,,				2504	0.001					ENST00000341948.4	1.000000	0.310000	0.700000	0.400000	0.520000	0.566118	0.520000	0.490000																										0				66						c.(1243-1245)gCg>gTg		protocadherin beta 13							112.0	103.0	106.0					5																	140594939		2203	4300	6503	SO:0001583	missense	56123	2	121412	35				g.chr5:140594939C>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1244C>T	chr5.hg19:g.140594939C>T	ENSP00000345491:p.Ala415Val	0						p.A415V	NM_018933.2	NP_061756.1	1	2	3	2.007773	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1431	+			A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	0	1	hg19	c.1244C>T	CCDS4255.1	0	.	.	.	.	.	.	.	.	.	.	N	14.50	2.553086	0.45487	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.03663	3.85	3.5	1.63	0.23807	3.500000	1.630000	0.238070	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.14270	0.0345	H	0.94423	3.535	0.09310	N	1	P	0.36199	0.543	B	0.42462	0.388	T	0.03863	-1.0997	9	0.87932	D	0	.	10.3549	0.43958	0.148:0.7087:0.1433:0.0	.	415	Q9Y5F0	PCDBD_HUMAN	V	415	ENSP00000345491:A415V	ENSP00000345491:A415V	A	+	2	0	0	PCDHB13	140575123	140575123	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	1.246000	0.32803	0.051000	0.15978	-2.031000	0.00424	GCG	0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.478	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	0	0	1		2	2	2	0		0	0	81		81	81	1	2	-3.420294	1	0.120000	NM_018933			19	19		618	608	0		1	0		0	0	81	0		0.999989	9.583748e-03	0	0	0	5	0	19	618
PCDHGA1	56114	broad.mit.edu	37	5	140712120	140712120	+	Silent	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr5:140712120G>A	ENST00000517417.1	+	1	1869	c.1869G>A	c.(1867-1869)acG>acA	p.T623T	PCDHGA1_ENST00000378105.3_Silent_p.T623T	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	623	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCTGCACACGGGCGAGGTGC	0.701																																						ENST00000517417.1	1.000000	0.520000	1.000000	0.670000	0.840000	0.837788	0.840000	1.000000																										0				78						c.(1867-1869)acG>acA		protocadherin gamma subfamily A, 1							20.0	25.0	23.0					5																	140712120		2146	4222	6368	SO:0001819	synonymous_variant	56114	1	120766	26				g.chr5:140712120G>A	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1869G>A	chr5.hg19:g.140712120G>A		0					PCDHGA1_ENST00000378105.3_Silent_p.T623T	p.T623T	NM_018912.2	NP_061735.1	1	2	3	2.007773	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1869	+			Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	0	1	hg19	c.1869G>A	CCDS54922.1	0																																																																																								0.126291		TCGA-HZ-8317-01A-11D-2396-08	0.701	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	0	0	1		2	2	2	0		0	0	73		73	91	1	2	-2.671616	1	0.120000	NM_018912			20	17		390	301	0		1			0	0	73	0		0.999951	0	0	0	0	0	0	20	390
SYNGAP1	8831	broad.mit.edu	37	6	33405686	33405686	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr6:33405686G>A	ENST00000418600.2	+	8	1105	c.1004G>A	c.(1003-1005)cGc>cAc	p.R335H	SYNGAP1_ENST00000293748.5_Missense_Mutation_p.R335H|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.R276H|MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	335	C2.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GACAAAAAGCGCAAGAAGGAC	0.607																																						ENST00000418600.2	0.410000	0.090000	0.320000	0.150000	0.220000	0.238534	0.220000	0.210000																										0				43						c.(1003-1005)cGc>cAc		synaptic Ras GTPase activating protein 1							75.0	69.0	71.0					6																	33405686		2203	4300	6503	SO:0001583	missense	8831	0	0					g.chr6:33405686G>A	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1004G>A	chr6.hg19:g.33405686G>A	ENSP00000403636:p.Arg335His	0					SYNGAP1_ENST00000428982.2_Missense_Mutation_p.R276H|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.R335H|SYNGAP1_ENST00000496374.1_3'UTR|MIR5004_ENST00000579078.1_RNA	p.R335H	NM_006772.2	NP_006763.2	0	0	0	1.963680	Q96PV0	SYGP1_HUMAN		8	1105	+			A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	0	1	hg19	c.1004G>A	CCDS34434.2	0	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763499	0.69763	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.40476	1.03;1.03;1.03	4.5	3.63	0.41609	4.500000	3.630000	0.416090	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000001	T	0.41558	0.1164	L	0.44542	1.39	0.51482	D	0.999924	D;D;D;P	0.89917	1.0;1.0;1.0;0.889	D;D;D;P	0.87578	0.998;0.996;0.996;0.487	T	0.43877	-0.9364	10	0.87932	D	0	.	8.4886	0.33086	0.1058:0.0:0.8942:0.0	.	335;335;335;335	Q96PV0;Q96PV0-2;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.;.	H	335;335;335;276	ENSP00000293748:R335H;ENSP00000403636:R335H;ENSP00000412475:R276H	ENSP00000293748:R335H	R	+	2	0	0	SYNGAP1	33513664	33513664	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.360000	0.44151	1.110000	0.41699	0.655000	0.94253	CGC	0.099468		TCGA-HZ-8317-01A-11D-2396-08	0.607	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	0	0	1		2	2	2	0		0	0	77		77	77	1	2	-2.746196	1	0.120000	XM_166407			7	7		528	521	0		1	0		0	0	77	0		0.979797	1.698580e-02	0	0	0	12	0	7	528
STXBP5	134957	broad.mit.edu	37	6	147703993	147703993	+	Silent	SNP	A	A	G			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr6:147703993A>G	ENST00000321680.6	+	27	3273	c.3273A>G	c.(3271-3273)aaA>aaG	p.K1091K	STXBP5_ENST00000367480.3_Silent_p.K1038K|STXBP5_ENST00000179882.6_Silent_p.K746K|STXBP5_ENST00000367481.3_Silent_p.K1055K	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	1091	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		AAGGCGTAAAAGGGGCAGCAT	0.502																																						ENST00000321680.6	0.220000	0.040000	0.170000	0.070000	0.110000	0.122305	0.110000	0.110000																										0				42						c.(3271-3273)aaA>aaG		syntaxin binding protein 5 (tomosyn)							156.0	151.0	153.0					6																	147703993		2203	4300	6503	SO:0001819	synonymous_variant	134957	0	0					g.chr6:147703993A>G	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.3273A>G	chr6.hg19:g.147703993A>G		0					STXBP5_ENST00000367481.3_Silent_p.K1055K|STXBP5_ENST00000179882.6_Silent_p.K746K|STXBP5_ENST00000367480.3_Silent_p.K1038K	p.K1091K	NM_001127715.2	NP_001121187.1	0	0	0	1.963680	Q5T5C0	STXB5_HUMAN		27	3273	+		Ovarian(120;0.0164)	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	ENST00000321680.6	0	1	hg19	c.3273A>G	CCDS47499.1	0																																																																																								0.099468		TCGA-HZ-8317-01A-11D-2396-08	0.502	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1	0	0	1		2	2	2	0		0	0	114		114	113	1	2	-2.475667	0	0.120000				6	6		915	906	0		1	0		0	0	114	0		0.963939	4.028711e-02	0	0	0	40	0	6	915
FREM1	158326	broad.mit.edu	37	9	14842569	14842569	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr9:14842569C>T	ENST00000380880.3	-	9	2266	c.1483G>A	c.(1483-1485)Gtg>Atg	p.V495M	FREM1_ENST00000422223.2_Missense_Mutation_p.V495M|FREM1_ENST00000380881.4_Missense_Mutation_p.V496M			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	495					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.V496L(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CGGAAGACCACGAAGTCTTTG	0.517																																						ENST00000380880.3	0.810000	0.340000	0.680000	0.440000	0.550000	0.568880	0.550000	0.550000																										1	Substitution - Missense(1)	p.V496L(1)	ovary(1)	100						c.(1483-1485)Gtg>Atg		FRAS1 related extracellular matrix 1							123.0	126.0	125.0					9																	14842569		2042	4192	6234	SO:0001583	missense	158326	1	121018	35				g.chr9:14842569C>T	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1483G>A	chr9.hg19:g.14842569C>T	ENSP00000370262:p.Val495Met	0					FREM1_ENST00000380881.4_Missense_Mutation_p.V496M|FREM1_ENST00000422223.2_Missense_Mutation_p.V495M	p.V495M			0	1	1	1.987992	Q5H8C1	FREM1_HUMAN		9	2266	-			B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	1	1	hg19	c.1483G>A	CCDS47952.1	0	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549879	0.65311	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.46063	0.88;0.88;0.88	5.63	2.76	0.32466	5.630000	2.760000	0.324660	.	0.122894	0.56097	D	0.000034	T	0.53142	0.1778	M	0.66939	2.045	0.39628	D	0.970137	D	0.76494	0.999	D	0.63957	0.92	T	0.54846	-0.8232	10	0.62326	D	0.03	-13.2093	5.4312	0.16454	0.0:0.5833:0.1427:0.274	.	495	Q5H8C1	FREM1_HUMAN	M	496;495;495	ENSP00000370263:V496M;ENSP00000412940:V495M;ENSP00000370262:V495M	ENSP00000370257:V498M	V	-	1	0	0	FREM1	14832569	14832569	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	1.080000	0.30779	0.847000	0.35167	0.655000	0.94253	GTG	0.112545		TCGA-HZ-8317-01A-11D-2396-08	0.517	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	0	0	1		2	2	2	0		0	0	99		99	98	1	2	-3.712540	1	0.120000	NM_144966			20	20		580	573	0		1	0		0	0	99	0		0.999995	3.721191e-03	0	0	0	3	0	20	580
ENTPD8	377841	broad.mit.edu	37	9	140331454	140331454	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chr9:140331454T>C	ENST00000472938.1	-	4	438	c.422A>G	c.(421-423)gAc>gGc	p.D141G	ENTPD8_ENST00000371506.2_Missense_Mutation_p.D141G|ENTPD8_ENST00000344119.2_Missense_Mutation_p.D141G			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	141					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		TGCAAAGATGTCCCTGGCCTG	0.682																																						ENST00000472938.1	0.900000	0.300000	0.730000	0.420000	0.560000	0.580626	0.560000	0.540000																										0				7						c.(421-423)gAc>gGc		ectonucleoside triphosphate diphosphohydrolase 8							51.0	56.0	54.0					9																	140331454		2202	4298	6500	SO:0001583	missense	377841	0	0					g.chr9:140331454T>C	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.422A>G	chr9.hg19:g.140331454T>C	ENSP00000420531:p.Asp141Gly	0					ENTPD8_ENST00000371506.2_Missense_Mutation_p.D141G|ENTPD8_ENST00000344119.2_Missense_Mutation_p.D141G	p.D141G			0	0	0	1.941747	Q5MY95	ENTP8_HUMAN		4	438	-	all_cancers(76;0.0926)		A2BG17|Q6UVZ0	Missense_Mutation	SNP	ENST00000472938.1	1	1	hg19	c.422A>G	CCDS43913.1	0	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941896	0.34283	.	.	ENSG00000188833	ENST00000344119;ENST00000371506;ENST00000472938	T;T;T	0.12039	2.72;2.72;2.72	4.07	-2.28	0.06826	4.070000	-2.280000	0.068260	.	1.335750	0.04809	N	0.434870	T	0.11452	0.0279	L	0.49455	1.56	0.18873	N	0.999981	B;B	0.34399	0.452;0.005	B;B	0.29862	0.108;0.021	T	0.30650	-0.9971	10	0.38643	T	0.18	0.6553	4.5654	0.12184	0.0:0.2689:0.3092:0.4219	.	141;141	Q5MY95-2;Q5MY95	.;ENTP8_HUMAN	G	141	ENSP00000344089:D141G;ENSP00000360561:D141G;ENSP00000420531:D141G	ENSP00000344089:D141G	D	-	2	0	0	ENTPD8	139451275	139451275	0.000000	0.05858	0.033000	0.17914	0.596000	0.36781	0.070000	0.14573	-0.340000	0.08388	0.459000	0.35465	GAC	0.088272		TCGA-HZ-8317-01A-11D-2396-08	0.682	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355991.1	0	0	1		2	2	2	0		0	0	55		55	54	1	2	-12.829270	1	0.120000	NM_198585			12	12		335	332	0		1	0		0	0	55	0		0.999109	6.355940e-02	0	0	0	11	0	12	335
AMOT	154796	broad.mit.edu	37	X	112058796	112058796	+	Silent	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chrX:112058796C>T	ENST00000524145.1	-	3	1256	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	AMOT_ENST00000371958.1_Silent_p.Q162Q|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000304758.1_5'UTR			Q4VCS5	AMOT_HUMAN	angiomotin	394					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q394Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gctgctgctgctgttgttggt	0.582																																						ENST00000524145.1	0.590000	0.140000	0.450000	0.210000	0.320000	0.341430	0.320000	0.300000																										1	Substitution - coding silent(1)	p.Q394Q(1)	lung(1)	43						c.(1180-1182)caG>caA		angiomotin							38.0	34.0	36.0					X																	112058796		2203	4300	6503	SO:0001819	synonymous_variant	154796	0	0					g.chrX:112058796C>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1182G>A	chrX.hg19:g.112058796C>T							AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371958.1_Silent_p.Q162Q	p.Q394Q			0	1	1		Q4VCS5	AMOT_HUMAN		3	1256	-			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	0	1	hg19	c.1182G>A	CCDS48154.1	0																																																																																								0.120000		TCGA-HZ-8317-01A-11D-2396-08	0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	0	0	1		2	2	2	0		0	0	41		41	45	1	2	-2.975317	1	0.120000	NM_133265			7	3		374	400	0		1	0	0	0	0	41	1		0.984412	2.306821e-02	0	0	0	11	1	7	374
NSDHL	50814	broad.mit.edu	37	X	152031181	152031181	+	Silent	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chrX:152031181C>T	ENST00000370274.3	+	5	650	c.456C>T	c.(454-456)ggC>ggT	p.G152G	NSDHL_ENST00000440023.1_Silent_p.G152G	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	152					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)	p.G152G(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TCTTTGAGGGCGTCGATATCA	0.413																																						ENST00000370274.3	0.860000	0.400000	0.740000	0.490000	0.600000	0.622241	0.600000	0.600000																										1	Substitution - coding silent(1)	p.G152G(1)	endometrium(1)	15						c.(454-456)ggC>ggT		NAD(P) dependent steroid dehydrogenase-like							159.0	138.0	145.0					X																	152031181		2203	4300	6503	SO:0001819	synonymous_variant	50814	0	0					g.chrX:152031181C>T	X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.456C>T	chrX.hg19:g.152031181C>T							NSDHL_ENST00000440023.1_Silent_p.G152G	p.G152G	NM_015922.2	NP_057006.1	0	1	1		Q15738	NSDHL_HUMAN		5	650	+	Acute lymphoblastic leukemia(192;6.56e-05)		D3DWT6|O00344	Silent	SNP	ENST00000370274.3	1	1	hg19	c.456C>T	CCDS14717.1	0																																																																																								0.120000		TCGA-HZ-8317-01A-11D-2396-08	0.413	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060927.1	0	0	1		2	2	2	0		0	0	112		112	112	1	2	-3.984244	1	0.120000	NM_015922			24	24		636	634	0		1	0		0	0	112	0		1.000000	6.166855e-01	0	0	0	56	0	24	636
FTHL17	53940	broad.mit.edu	37	X	31089614	31089614	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chrX:31089614C>T	ENST00000359202.3	-	1	556	c.457G>A	c.(457-459)Gtg>Atg	p.V153M		NM_031894.2	NP_114100.1	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	153	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)		ferric iron binding (GO:0008199)			endometrium(2)|large_intestine(2)|liver(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	23						AGGTTGCTCACGTAGCCACCC	0.617																																						ENST00000359202.3	0.990000	0.420000	0.840000	0.530000	0.670000	0.689982	0.670000	1.000000																										0				23						c.(457-459)Gtg>Atg		ferritin, heavy polypeptide-like 17							68.0	59.0	62.0					X																	31089614		2202	4300	6502	SO:0001583	missense	53940	0	0					g.chrX:31089614C>T	AF285592	CCDS14227.1	Xp21.2	2010-07-06			ENSG00000132446	ENSG00000132446			3987	protein-coding gene	gene with protein product	"""cancer/testis antigen 38"""	300308				11279525	Standard	NM_031894		Approved	CT38	uc004dcl.1	Q9BXU8	OTTHUMG00000021332	ENST00000359202.3:c.457G>A	chrX.hg19:g.31089614C>T	ENSP00000368207:p.Val153Met							p.V153M	NM_031894.2	NP_114100.1	0	1	1		Q9BXU8	FHL17_HUMAN		1	556	-			Q6NT24|Q6NTE2	Missense_Mutation	SNP	ENST00000359202.3	1	1	hg19	c.457G>A	CCDS14227.1	0	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565741	0.27915	.	.	ENSG00000132446	ENST00000359202	T	0.65549	-0.16	3.95	-7.89	0.01174	3.950000	-7.890000	0.011740	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.813860	0.11045	N	0.605645	T	0.63307	0.2500	M	0.75777	2.31	0.20489	N	0.999899	D	0.67145	0.996	P	0.52109	0.69	T	0.73445	-0.3980	10	0.62326	D	0.03	.	7.1071	0.25370	0.0696:0.0807:0.4098:0.4399	.	153	Q9BXU8	FHL17_HUMAN	M	153	ENSP00000368207:V153M	ENSP00000368207:V153M	V	-	1	0	0	FTHL17	30999535	30999535	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-5.299000	0.00133	-5.197000	0.00019	-0.337000	0.08149	GTG	0.120000		TCGA-HZ-8317-01A-11D-2396-08	0.617	FTHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056178.1	1	0	1		2	2	2	0		0	0	65		65	65	1	2	-18.315950	1	0.120000	NM_031894			19	19		453	449	0		1			0	0	65	0		0.999990	0	0	0	0	0	0	19	453
PLXNB3	5365	broad.mit.edu	37	X	153036952	153036952	+	Missense_Mutation	SNP	G	G	A	rs141109198		TCGA-HZ-8317-01A-11D-2396-08	TCGA-HZ-8317-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9626cf9d-70d8-414a-87ff-4626c3cc4023	c3e58127-1737-432b-b0a5-aedcfc3ddab4	g.chrX:153036952G>A	ENST00000361971.5	+	14	2473	c.2359G>A	c.(2359-2361)Gac>Aac	p.D787N	PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538776.1_Missense_Mutation_p.D440N|PLXNB3_ENST00000538966.1_Missense_Mutation_p.D810N|PLXNB3_ENST00000538282.1_Missense_Mutation_p.D397N	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	787	PSI 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GATCCTGTACGACTGCGCCAT	0.672																																						ENST00000361971.5	1.000000	0.420000	0.990000	0.570000	0.760000	0.767359	0.760000	1.000000																										0				32						c.(2359-2361)Gac>Aac		plexin B3		G	ASN/ASP,ASN/ASP	0,3820		0,0,0,1630,560	38.0	36.0	37.0		2428,2359	5.1	1.0	X	dbSNP_134	37	2,6718		0,1,1,2425,1867	no	missense,missense	PLXNB3	NM_001163257.1,NM_005393.2	23,23	0,1,1,4055,2427	AA,AG,A,GG,G		0.0298,0.0,0.019	benign,benign	810/1933,787/1910	153036952	2,10538	2190	4294	6484	SO:0001583	missense	5365	9	120806	36				g.chrX:153036952G>A	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.2359G>A	chrX.hg19:g.153036952G>A	ENSP00000355378:p.Asp787Asn						PLXNB3_ENST00000538282.1_Missense_Mutation_p.D397N|PLXNB3_ENST00000538776.1_Missense_Mutation_p.D440N|PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538966.1_Missense_Mutation_p.D810N	p.D787N	NM_005393.2	NP_005384.2	0	1	1		Q9ULL4	PLXB3_HUMAN		14	2473	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	1	1	hg19	c.2359G>A	CCDS14729.1	0	.	.	.	.	.	.	.	.	.	.	G	9.597	1.127716	0.20959	0.0	2.98E-4	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.65549	5.37;5.34;4.75;-0.16	5.11	5.11	0.69529	5.110000	5.110000	0.695290	.	0.049715	0.85682	D	0.000000	T	0.36853	0.0982	N	0.21373	0.66	0.44261	D	0.997117	B;P;B;B	0.36249	0.008;0.545;0.024;0.003	B;B;B;B	0.28849	0.004;0.095;0.02;0.003	T	0.41893	-0.9483	10	0.02654	T	1	.	8.7349	0.34523	0.1051:0.0:0.8949:0.0	.	440;469;810;787	B7Z3H9;B7Z9A5;F5H773;Q9ULL4	.;.;.;PLXB3_HUMAN	N	810;787;440;397	ENSP00000442736:D810N;ENSP00000355378:D787N;ENSP00000445569:D440N;ENSP00000441919:D397N	ENSP00000355378:D787N	D	+	1	0	0	PLXNB3	152690146	152690146	0.213000	0.23551	0.985000	0.45067	0.052000	0.14988	1.359000	0.34113	2.111000	0.64477	0.529000	0.55759	GAC	0.120000		TCGA-HZ-8317-01A-11D-2396-08	0.672	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1	1	0	1		2	2	2	0		0	0	56		56	55	1	2	-14.026490	1	0.120000				12	12		253	251	0		1	0		0	0	56	0		0.999137	1.488194e-01	0	0	0	14	0	12	253
