#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TP53	7157	broad.mit.edu	37	17	7578411	7578412	+	In_Frame_Ins	INS	-	-	ACG			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			-	ACG	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr17:7578411_7578412insACG	ENST00000269305.4	-	5	707_708	c.518_519insCGT	c.(517-519)gtg>gtCGTg	p.173_173V>VV	TP53_ENST00000413465.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000420246.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000445888.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000455263.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_In_Frame_Ins_p.173_173V>VV	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	173	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V173A(12)|p.V173V(8)|p.0?(8)|p.V173G(6)|p.V173fs*7(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.V173E(1)|p.V41fs*7(1)|p.E171fs*1(1)|p.V173W(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.V80fs*7(1)|p.R174fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAGCGCCTCACAACCTCCGT	0.658		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.960000	0.660000	8.900000e-01	7.300000e-01	0.810000	0.818659	0.810000	0.820000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		55	Substitution - Missense(20)|Deletion - Frameshift(13)|Whole gene deletion(8)|Substitution - coding silent(8)|Deletion - In frame(5)|Insertion - Frameshift(1)	p.V173A(12)|p.V173V(8)|p.0?(8)|p.V173G(6)|p.V173fs*7(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.V173E(1)|p.V41fs*7(1)|p.E171fs*1(1)|p.V173W(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.V80fs*7(1)|p.R174fs*7(1)	large_intestine(10)|central_nervous_system(8)|lung(7)|haematopoietic_and_lymphoid_tissue(5)|bone(5)|stomach(4)|biliary_tract(3)|oesophagus(3)|upper_aerodigestive_tract(2)|cervix(2)|liver(2)|endometrium(1)|ovary(1)|prostate(1)|breast(1)	24185						c.(517-519)gtg>gtCGTg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)																																			SO:0001652	inframe_insertion	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578411_7578412insACG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.518_519insCGT	chr17.hg19:g.7578411_7578412insACG	ENSP00000269305:p.Val173dup	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000420246.2_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000359597.4_In_Frame_Ins_p.173_173V>VV|TP53_ENST00000413465.2_In_Frame_Ins_p.173_173V>VV	p.173_173V>VV	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.687130	P04637	P53_HUMAN		5	707_708	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Ins	INS	ENST00000269305.4	0	1	hg19	c.518_519insCGT	CCDS11118.1	0																																																																																								0.257862		TCGA-HZ-8636-01A-21D-2396-08	0.658	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0	0	0	0	45	0	45	44	1	1.670000	-3.551603	1	0.410000	NM_000546		0	85	93	0	316	313	0	0	1	0	1	0	0	45	45	0	1.000000	1	1	0	166	136	739	85	316
ATP9A	10079	broad.mit.edu	37	20	50238628	50238635	+	Frame_Shift_Del	DEL	GATGTCTT	GATGTCTT	-	rs370051932		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			GATGTCTT	-	GATGTCTT	GATGTCTT		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr20:50238628_50238635delGATGTCTT	ENST00000338821.5	-	19	2357_2364	c.2093_2100delAAGACATC	c.(2092-2100)caagacatcfs	p.QDI698fs	ATP9A_ENST00000311637.5_Frame_Shift_Del_p.QDI562fs|ATP9A_ENST00000402822.1_Frame_Shift_Del_p.QDI577fs	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	698					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GAAAAACGTGGATGTCTTGGTTTCTGGT	0.51																																						ENST00000338821.5	0.340000	0.170000	3.000000e-01	2.000000e-01	0.240000	0.257449	0.240000	0.250000																										0				48						c.(2092-2100)caagacatcfs		ATPase, class II, type 9A																																				SO:0001589	frameshift_variant	10079	0	0					g.chr20:50238628_50238635delGATGTCTT	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2093_2100delAAGACATC	chr20.hg19:g.50238628_50238635delGATGTCTT	ENSP00000342481:p.Gln698fs	0					ATP9A_ENST00000402822.1_Frame_Shift_Del_p.QDI577fs|ATP9A_ENST00000311637.5_Frame_Shift_Del_p.QDI562fs	p.QDI698fs	NM_006045.1	NP_006036.1	0	1	1	1.949394	O75110	ATP9A_HUMAN		19	2357_2364	-			E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Frame_Shift_Del	DEL	ENST00000338821.5	1	1	hg19	c.2093_2100delAAGACATC	CCDS33489.1	0																																																																																								0.345608		TCGA-HZ-8636-01A-21D-2396-08	0.510	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	1	0	1		24	2		0	0	0	1	82	0	82	79	1	1.670000	-2.665561	1	0.410000	NM_006045		0	34	41	0	560	565	0	0	1	0		0	0	82	82	0	0.939960	9.906996e-01		0	0	121	0	34	560
SYT15	83849	broad.mit.edu	37	10	46965752	46965752	+	Missense_Mutation	SNP	C	C	T	rs538202309	byFrequency	TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr10:46965752C>T	ENST00000374321.4	-	5	851	c.785G>A	c.(784-786)cGt>cAt	p.R262H	SYT15_ENST00000374323.4_Missense_Mutation_p.R315H|SYT15_ENST00000374325.3_Missense_Mutation_p.R262H|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000503753.1_Missense_Mutation_p.R262H	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						CCAGATGACACGCCGGCAGTC	0.607													C|||	2	0.000399361	0.0008	0.0	5008	,	,		41009	0.001		0.0	False		,,,				2504	0.0				Ovarian(57;1152 1428 19651 37745)	ENST00000374321.4	0.630000	0.310000	5.500000e-01	3.800000e-01	0.460000	0.473781	0.460000	0.460000																										0				13						c.(784-786)cGt>cAt		synaptotagmin XV							73.0	78.0	76.0					10																	46965752		2137	4245	6382	SO:0001583	missense	83849	16	121130	36				g.chr10:46965752C>T	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.785G>A	chr10.hg19:g.46965752C>T	ENSP00000363441:p.Arg262His	0					SYT15_ENST00000374323.4_Missense_Mutation_p.R315H|SYT15_ENST00000503753.1_Missense_Mutation_p.R262H|SYT15_ENST00000374325.3_Missense_Mutation_p.R262H|RP11-38L15.3_ENST00000506914.1_RNA	p.R262H	NM_031912.4	NP_114118.2	0	0	0	2.029479	Q9BQS2	SYT15_HUMAN		5	851	-			A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	1	1	hg19	c.785G>A	CCDS44376.1	0	.	.	.	.	.	.	.	.	.	.	.	6.785	0.513877	0.12944	.	.	ENSG00000204176	ENST00000416127;ENST00000374328;ENST00000374325;ENST00000503753;ENST00000374330;ENST00000374323;ENST00000374321	D;T;T;T;T	0.95272	-3.66;3.13;3.13;3.13;3.13	5.13	-5.29	0.02747	5.13	-5.29	0.02747	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	1.006260	0.07978	N	0.985110	D	0.83788	0.5330	N	0.12182	0.205	0.09310	N	1	B;B	0.13145	0.002;0.007	B;B	0.09377	0.002;0.004	T	0.71002	-0.4718	10	0.36615	T	0.2	.	3.5654	0.07897	0.1045:0.2315:0.1321:0.5319	.	262;262	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	H	262;52;262;262;101;315;262	ENSP00000363448:R52H;ENSP00000363445:R262H;ENSP00000427607:R262H;ENSP00000363443:R315H;ENSP00000363441:R262H	ENSP00000363441:R262H	R	-	2	0	0	SYT15	46385758	46385758	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-2.197000	0.01240	-0.739000	0.04809	-0.254000	0.11334	CGT	0.376783		TCGA-HZ-8636-01A-21D-2396-08	0.607	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	62	1	1.670000	-3.318796	1	0.410000	NM_031912		0	28	26	0	251	250	1		1	0		0	0	64	64	0	1.000000	0	0	0	0	1	0	28	251
CDHR1	92211	broad.mit.edu	37	10	85974118	85974118	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr10:85974118C>T	ENST00000372117.3	+	17	2424	c.2321C>T	c.(2320-2322)cCc>cTc	p.P774L	CDHR1_ENST00000440770.2_Missense_Mutation_p.P478L|CDHR1_ENST00000332904.3_Intron	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	774	Pro-rich.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GAGAAACCTCCCAATGAGAAC	0.617																																						ENST00000372117.3	0.150000	0.030000	1.200000e-01	5.000000e-02	0.080000	0.091654	0.080000	0.090000																										0				36						c.(2320-2322)cCc>cTc		cadherin-related family member 1							86.0	79.0	81.0					10																	85974118		2203	4300	6503	SO:0001583	missense	92211	0	0					g.chr10:85974118C>T	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.2321C>T	chr10.hg19:g.85974118C>T	ENSP00000361189:p.Pro774Leu	0					CDHR1_ENST00000332904.3_Intron|CDHR1_ENST00000440770.2_Missense_Mutation_p.P478L	p.P774L	NM_033100.2	NP_149091.1	0	0	0	2.029479	Q96JP9	CDHR1_HUMAN		17	2424	+			Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	0	1	hg19	c.2321C>T	CCDS7372.1	0	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817901	0.32145	.	.	ENSG00000148600	ENST00000372117;ENST00000440770	T;T	0.55930	0.64;0.49	5.44	4.54	0.55810	5.44	4.54	0.55810	.	1.112700	0.06432	N	0.724327	T	0.47525	0.1450	L	0.57536	1.79	0.34497	D	0.705606	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.47971	-0.9075	10	0.21540	T	0.41	-26.0702	5.1749	0.15129	0.1663:0.6647:0.0:0.169	.	478;774	E7EN47;Q96JP9	.;CDHR1_HUMAN	L	774;478	ENSP00000361189:P774L;ENSP00000415980:P478L	ENSP00000361189:P774L	P	+	2	0	0	CDHR1	85964098	85964098	0.576000	0.26700	0.971000	0.41717	0.773000	0.43773	2.688000	0.46984	1.308000	0.44962	0.561000	0.74099	CCC	0.376783		TCGA-HZ-8636-01A-21D-2396-08	0.617	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	0	0	1	2	2	2	2	0	0	0	0	79	79	79	78	1	1.670000	-2.817233	1	0.410000	NM_033100		0	11	11	0	590	585	0		1			0	0	79	79	0	0.998275	0	0	0	0	0	0	11	590
MUC5B	727897	broad.mit.edu	37	11	1250411	1250411	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr11:1250411C>G	ENST00000529681.1	+	9	1046	c.988C>G	c.(988-990)Ccc>Gcc	p.P330A	MUC5B_ENST00000447027.1_Missense_Mutation_p.P330A|MUC5B_ENST00000531082.1_3'UTR	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	330	TIL 1.			PL -> T (in Ref. 2; AAC67545). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGGACCTGCCCCCTCAACAT	0.687																																						ENST00000529681.1	1.000000	0.550000	1	7.300000e-01	0.940000	0.890096	0.940000	1.000000																										0				137						c.(988-990)Ccc>Gcc		mucin 5B, oligomeric mucus/gel-forming							25.0	32.0	30.0					11																	1250411		2074	4190	6264	SO:0001583	missense	727897	0	0					g.chr11:1250411C>G	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.988C>G	chr11.hg19:g.1250411C>G	ENSP00000436812:p.Pro330Ala	0					MUC5B_ENST00000447027.1_Missense_Mutation_p.P330A|MUC5B_ENST00000531082.1_3'UTR	p.P330A	NM_002458.2	NP_002449.2	0	1	1	1.929722	Q9HC84	MUC5B_HUMAN		9	1046	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	1	1	hg19	c.988C>G	CCDS44515.2	1	.	.	.	.	.	.	.	.	.	.	C	6.296	0.422771	0.11928	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	D;D	0.91521	-2.86;-2.86	3.36	1.37	0.22104	3.36	1.37	0.22104	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.94863	0.8340	M	0.90145	3.09	0.41081	D	0.985529	P;D;D	0.76494	0.892;0.999;0.999	P;D;D	0.69654	0.776;0.965;0.965	D	0.93936	0.7219	9	0.87932	D	0	.	9.0327	0.36269	0.0:0.8092:0.0:0.1908	.	330;986;330	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	A	330;330;330;363	ENSP00000436812:P330A;ENSP00000415793:P330A	ENSP00000343037:P330A	P	+	1	0	0	MUC5B	1206987	1206987	1.000000	0.71417	0.469000	0.27204	0.138000	0.21146	2.905000	0.48727	0.620000	0.30215	0.205000	0.17691	CCC	0.338083		TCGA-HZ-8636-01A-21D-2396-08	0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	1.670000	-19.999990	1	0.410000	XM_001126093		0	13	13	0	46	44	1		1	1		0	0	14	14	0	0.999670	4.950115e-01	0	4	0	3	0	13	46
MUC5B	727897	broad.mit.edu	37	11	1262417	1262417	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr11:1262417C>T	ENST00000529681.1	+	31	4365	c.4307C>T	c.(4306-4308)cCg>cTg	p.P1436L	MUC5B_ENST00000447027.1_Missense_Mutation_p.P1439L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1436	7 X Cys-rich subdomain repeats.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCCCCTCCCCGGCCCCAGGC	0.662																																						ENST00000529681.1	1.000000	0.510000	1	7.100000e-01	0.940000	0.881879	0.940000	1.000000																										0				137						c.(4306-4308)cCg>cTg		mucin 5B, oligomeric mucus/gel-forming							23.0	28.0	26.0					11																	1262417		2024	4159	6183	SO:0001583	missense	727897	7	120490	30				g.chr11:1262417C>T	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.4307C>T	chr11.hg19:g.1262417C>T	ENSP00000436812:p.Pro1436Leu	0					MUC5B_ENST00000447027.1_Missense_Mutation_p.P1439L|RP11-532E4.2_ENST00000532061.2_RNA	p.P1436L	NM_002458.2	NP_002449.2	0	1	1	1.929722	Q9HC84	MUC5B_HUMAN		31	4365	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	0	1	hg19	c.4307C>T	CCDS44515.2	1	.	.	.	.	.	.	.	.	.	.	c	7.753	0.703670	0.15172	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.17054	2.3;2.5	4.28	0.654	0.17833	4.28	0.654	0.17833	.	.	.	.	.	T	0.09202	0.0227	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.30504	-0.9976	9	0.87932	D	0	.	6.5043	0.22186	0.1219:0.5936:0.0:0.2846	.	2129;1439	A7Y9J9;E9PBJ0	.;.	L	1436;1439;1437;1506	ENSP00000436812:P1436L;ENSP00000415793:P1439L	ENSP00000343037:P1437L	P	+	2	0	0	MUC5B	1218993	1218993	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.004000	0.13106	-0.519000	0.06444	-1.615000	0.00797	CCG	0.338083		TCGA-HZ-8636-01A-21D-2396-08	0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.670000	-19.827010	1	0.410000	XM_001126093		0	10	10	0	35	33	1		1	0		0	0	9	9	0	0.997420	5.754112e-01	0	1	0	7	0	10	35
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999914	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	2	4	6	2.641319	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.520169		TCGA-HZ-8636-01A-21D-2396-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	9	9	9	8	1	1.670000	-19.999920	1	0.410000	NM_033360		2968	29	29	5046	75	74	1	1	1	1	1	0	0	9	9	1	1.000000	9.999982e-01	1	31	124	32	360	29	75
ATP12A	479	broad.mit.edu	37	13	25263488	25263488	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr13:25263488C>T	ENST00000381946.3	+	5	688	c.521C>T	c.(520-522)tCc>tTc	p.S174F	ATP12A_ENST00000218548.6_Missense_Mutation_p.S174F			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	174					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AACATCATGTCCAGCTTCAAT	0.537																																					Pancreas(156;1582 1935 18898 22665 26498)	ENST00000381946.3	0.270000	0.090000	2.200000e-01	1.300000e-01	0.170000	0.180415	0.170000	0.170000																										0				74						c.(520-522)tCc>tTc		ATPase, H+/K+ transporting, nongastric, alpha polypeptide							198.0	181.0	187.0					13																	25263488		2203	4300	6503	SO:0001583	missense	479	0	0					g.chr13:25263488C>T	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.521C>T	chr13.hg19:g.25263488C>T	ENSP00000371372:p.Ser174Phe	1					ATP12A_ENST00000218548.6_Missense_Mutation_p.S174F	p.S174F			0	1	1	1.674578	P54707	AT12A_HUMAN		5	688	+		Lung SC(185;0.0225)|Breast(139;0.077)	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	1	1	hg19	c.521C>T	CCDS31948.1	0	.	.	.	.	.	.	.	.	.	.	C	16.33	3.091802	0.55968	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.89050	-2.46;-2.46	5.14	5.14	0.70334	5.14	5.14	0.70334	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.320771	0.30101	N	0.010404	D	0.89431	0.6713	M	0.64404	1.975	0.28626	N	0.907899	P;P	0.37612	0.531;0.602	B;B	0.42282	0.382;0.378	D	0.87031	0.2135	10	0.87932	D	0	.	16.1375	0.81497	0.0:1.0:0.0:0.0	.	174;174	P54707-2;P54707	.;AT12A_HUMAN	F	174	ENSP00000218548:S174F;ENSP00000371372:S174F	ENSP00000218548:S174F	S	+	2	0	0	ATP12A	24161488	24161488	0.998000	0.40836	1.000000	0.80357	0.960000	0.62799	3.379000	0.52440	2.680000	0.91292	0.561000	0.74099	TCC	0.257862		TCGA-HZ-8636-01A-21D-2396-08	0.537	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.670000	-3.964014	1	0.410000	NM_001676		0	15	15	0	324	321	0		1			0	0	64	64	0	0.999872	0	0	0	0	0	0	15	324
OSGEP	55644	broad.mit.edu	37	14	20916117	20916117	+	Nonsense_Mutation	SNP	G	G	A	rs551255070		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr14:20916117G>A	ENST00000206542.4	-	8	1160	c.739C>T	c.(739-741)Cga>Tga	p.R247*	OSGEP_ENST00000554249.1_Nonsense_Mutation_p.R65*|OSGEP_ENST00000555656.1_Nonsense_Mutation_p.R48*	NM_017807.3	NP_060277.1			O-sialoglycoprotein endopeptidase											endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(4)|stomach(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0231)|READ - Rectum adenocarcinoma(17;0.196)		GCCATGGCTCGCTCTGTGATC	0.453																																						ENST00000206542.4	1.000000	0.180000	3.400000e-01	2.200000e-01	0.270000	0.327656	0.270000	0.270000																										0				11						c.(739-741)Cga>Tga		O-sialoglycoprotein endopeptidase							104.0	108.0	107.0					14																	20916117		2203	4300	6503	SO:0001587	stop_gained	55644	2	121412	38				g.chr14:20916117G>A	AB050442	CCDS9549.1	14q12	2010-03-19			ENSG00000092094	ENSG00000092094	3.4.24.57		18028	protein-coding gene	gene with protein product		610107				12039036	Standard	NM_017807		Approved	PRSMG1, GCPL1, OSGEP1, KAE1	uc001vxf.3	Q9NPF4	OTTHUMG00000029543	ENST00000206542.4:c.739C>T	chr14.hg19:g.20916117G>A	ENSP00000206542:p.Arg247*	0					OSGEP_ENST00000554249.1_Nonsense_Mutation_p.R65*|OSGEP_ENST00000555656.1_Nonsense_Mutation_p.R48*	p.R247*	NM_017807.3	NP_060277.1	1	2	3	2.222707			Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	8	1160	-	all_cancers(95;0.00123)	all_lung(585;0.235)		Nonsense_Mutation	SNP	ENST00000206542.4	0	1	hg19	c.739C>T	CCDS9549.1	0	.	.	.	.	.	.	.	.	.	.	G	38	7.251523	0.98164	.	.	ENSG00000092094	ENST00000555656;ENST00000206542;ENST00000554249;ENST00000555223;ENST00000555785	.	.	.	4.71	4.71	0.59529	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.4092	16.4221	0.83766	0.0:0.0:1.0:0.0	.	.	.	.	X	48;247;65;65;48	.	ENSP00000206542:R247X	R	-	1	2	2	OSGEP	19985957	19985957	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.358000	0.44134	2.141000	0.66446	0.455000	0.32223	CGA	0.420688		TCGA-HZ-8636-01A-21D-2396-08	0.453	OSGEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073635.3	1	0	1	2	18	6	2	1	1	1	1	111	111	111	111	1	1.670000	-5.604061	1	0.410000	NM_017807		0	33	33	0	578	566	0		1	0		1	1	111	111	0	0.987000	5.844350e-01	0	1	0	111	0	33	578
STRN3	29966	broad.mit.edu	37	14	31404475	31404475	+	Silent	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr14:31404475G>A	ENST00000357479.5	-	7	1078	c.882C>T	c.(880-882)gaC>gaT	p.D294D	STRN3_ENST00000355683.5_Silent_p.D294D|STRN3_ENST00000366206.2_5'Flank	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	294					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		TATCAGGATCGTCAGTTAGGT	0.398																																						ENST00000357479.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.999852	0.990000	1.000000																										0				20						c.(880-882)gaC>gaT		striatin, calmodulin binding protein 3							104.0	101.0	102.0					14																	31404475		2203	4300	6503	SO:0001819	synonymous_variant	29966	2	121412	31				g.chr14:31404475G>A		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.882C>T	chr14.hg19:g.31404475G>A		0					STRN3_ENST00000366206.2_5'Flank|STRN3_ENST00000355683.5_Silent_p.D294D	p.D294D	NM_001083893.1	NP_001077362.1	1	2	3	2.222707	Q13033	STRN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	7	1078	-	Hepatocellular(127;0.0877)|Breast(36;0.148)		A2RTX7|A6NHZ7|Q9NRA5	Silent	SNP	ENST00000357479.5	1	1	hg19	c.882C>T	CCDS41938.1	1	.	.	.	.	.	.	.	.	.	.	G	8.536	0.872216	0.17322	.	.	ENSG00000196792	ENST00000556577	.	.	.	5.68	0.861	0.19048	5.68	0.861	0.19048	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.6586	8.8975	0.35474	0.71:0.0:0.29:0.0	.	.	.	.	X	55	.	.	R	-	1	2	2	STRN3	30474226	30474226	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.139000	0.31504	0.117000	0.18138	-0.367000	0.07326	CGA	0.420688		TCGA-HZ-8636-01A-21D-2396-08	0.398	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	0	0	1	2	20	6	2	1	1	1	1	69	69	69	68	1	1.670000	-20.000000	1	0.410000	NM_014574		0	107	106	0	317	310	1		1	1		1	1	69	69	0	1.000000	9.998198e-01	0	17	0	53	0	107	317
OTX2	5015	broad.mit.edu	37	14	57268475	57268475	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr14:57268475G>A	ENST00000555006.1	-	4	1256	c.848C>T	c.(847-849)tCg>tTg	p.S283L	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000339475.5_Missense_Mutation_p.S291L|OTX2_ENST00000408990.3_Missense_Mutation_p.S283L			P32243	OTX2_HUMAN	orthodenticle homeobox 2	283					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					GAATTTCCACGAGGATGTCTG	0.408																																						ENST00000555006.1	1.000000	0.790000	1	8.700000e-01	0.970000	0.949542	0.970000	1.000000																										0				19						c.(847-849)tCg>tTg		orthodenticle homeobox 2							60.0	64.0	63.0					14																	57268475		2203	4300	6503	SO:0001583	missense	5015	1	121412	35				g.chr14:57268475G>A	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.848C>T	chr14.hg19:g.57268475G>A	ENSP00000452336:p.Ser283Leu	0					OTX2_ENST00000339475.5_Missense_Mutation_p.S291L|OTX2_ENST00000408990.3_Missense_Mutation_p.S283L|RP11-1085N6.6_ENST00000602485.1_lincRNA	p.S283L			1	2	3	2.222707	P32243	OTX2_HUMAN		4	1256	-	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)		B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	1	1	hg19	c.848C>T	CCDS41960.1	1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296371	0.40594	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006	D;D;D	0.93712	-3.27;-3.26;-3.26	5.65	3.84	0.44239	5.65	3.84	0.44239	.	0.605732	0.13764	N	0.364391	D	0.92506	0.7620	M	0.84219	2.685	0.80722	D	1	P;P	0.51537	0.946;0.838	B;B	0.39258	0.295;0.283	D	0.91171	0.4968	10	0.72032	D	0.01	.	11.382	0.49763	0.1438:0.0:0.8562:0.0	.	291;283	F1T0D1;P32243	.;OTX2_HUMAN	L	291;283;283	ENSP00000343819:S291L;ENSP00000386185:S283L;ENSP00000452336:S283L	ENSP00000343819:S291L	S	-	2	0	0	OTX2	56338228	56338228	1.000000	0.71417	0.762000	0.31397	0.989000	0.77384	9.501000	0.97979	0.949000	0.37715	0.655000	0.94253	TCG	0.420688		TCGA-HZ-8636-01A-21D-2396-08	0.408	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	0	0	1	2	25	2	2	1	1	1	1	55	55	55	55	1	1.670000	-2.937433	1	0.410000	NM_021728.		0	89	89	0	369	367	1		1			1	1	55	55	0	1.000000	0	0	0	0	0	0	89	369
RYR3	6263	broad.mit.edu	37	15	34102719	34102719	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr15:34102719C>T	ENST00000389232.4	+	71	10136	c.10066C>T	c.(10066-10068)Cgg>Tgg	p.R3356W	RYR3_ENST00000415757.3_Missense_Mutation_p.R3351W	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3356					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GACAAAGCGGCGGGGAGACTT	0.512																																						ENST00000389232.4	1.000000	0.790000	1	8.900000e-01	0.990000	0.962883	0.990000	1.000000																										0				311						c.(10066-10068)Cgg>Tgg		ryanodine receptor 3							68.0	92.0	84.0					15																	34102719		1923	4118	6041	SO:0001583	missense	6263	1	120846	28				g.chr15:34102719C>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10066C>T	chr15.hg19:g.34102719C>T	ENSP00000373884:p.Arg3356Trp	1					RYR3_ENST00000415757.3_Missense_Mutation_p.R3351W	p.R3356W	NM_001036.3	NP_001027.3	0	1	1	1.911035	Q15413	RYR3_HUMAN		71	10136	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.10066C>T	CCDS45210.1	1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458025	0.63401	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T	0.68025	-0.3	5.15	2.81	0.32909	5.15	2.81	0.32909	.	0.000000	0.85682	D	0.000000	T	0.81153	0.4763	M	0.83603	2.65	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.982	T	0.82230	-0.0560	10	0.87932	D	0	.	12.2165	0.54410	0.5396:0.4604:0.0:0.0	.	3351;3356	Q15413-2;Q15413	.;RYR3_HUMAN	W	3356;3356;3351	ENSP00000373884:R3356W	ENSP00000354735:R3351W	R	+	1	2	2	RYR3	31890011	31890011	0.946000	0.32159	1.000000	0.80357	0.726000	0.41606	2.244000	0.43124	0.419000	0.25927	-0.397000	0.06425	CGG	0.319296		TCGA-HZ-8636-01A-21D-2396-08	0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.670000	-3.949679	1	0.410000			0	56	56	0	176	168	1		1			0	0	30	30	0	1.000000	0	0	0	0	0	0	56	176
DLL4	54567	broad.mit.edu	37	15	41224371	41224371	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr15:41224371A>T	ENST00000249749.5	+	5	937	c.661A>T	c.(661-663)Atc>Ttc	p.I221F		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	221	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TCCCTTAGCTATCTGTCTTTC	0.577																																						ENST00000249749.5	0.290000	0.080000	2.300000e-01	1.200000e-01	0.170000	0.180856	0.170000	0.160000																										0				4						c.(661-663)Atc>Ttc		delta-like 4 (Drosophila)							78.0	82.0	80.0					15																	41224371		2001	4179	6180	SO:0001583	missense	54567	0	0					g.chr15:41224371A>T	AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.661A>T	chr15.hg19:g.41224371A>T	ENSP00000249749:p.Ile221Phe	1						p.I221F	NM_019074.3	NP_061947.1	0	1	1	1.911035	Q9NR61	DLL4_HUMAN		5	937	+		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	Q3KP23|Q9NQT9	Missense_Mutation	SNP	ENST00000249749.5	1	1	hg19	c.661A>T	CCDS45232.1	0	.	.	.	.	.	.	.	.	.	.	A	16.91	3.252334	0.59212	.	.	ENSG00000128917	ENST00000249749	T	0.66815	-0.23	5.74	-1.63	0.08345	5.74	-1.63	0.08345	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.186750	0.56097	D	0.000028	T	0.65749	0.2721	M	0.86953	2.85	0.36665	D	0.878153	B	0.30179	0.271	B	0.24701	0.055	T	0.67902	-0.5550	10	0.87932	D	0	.	12.0444	0.53471	0.758:0.0:0.242:0.0	.	221	Q9NR61	DLL4_HUMAN	F	221	ENSP00000249749:I221F	ENSP00000249749:I221F	I	+	1	0	0	DLL4	39011663	39011663	0.835000	0.29415	0.968000	0.41197	0.989000	0.77384	0.957000	0.29215	-0.286000	0.09076	0.533000	0.62120	ATC	0.319296		TCGA-HZ-8636-01A-21D-2396-08	0.577	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.670000	-11.927010	1	0.410000			0	10	10	0	243	239	0		1	0		0	0	65	65	0	0.996796	4.655933e-01	0	0	0	37	0	10	243
TLN2	83660	broad.mit.edu	37	15	63089584	63089584	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr15:63089584G>A	ENST00000561311.1	+	47	6447	c.6217G>A	c.(6217-6219)Gac>Aac	p.D2073N	TLN2_ENST00000306829.6_Missense_Mutation_p.D2073N			Q9Y4G6	TLN2_HUMAN	talin 2	2073					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCTGGGCTCCGACGACCCCGA	0.672																																						ENST00000561311.1	0.340000	0.120000	2.800000e-01	1.600000e-01	0.210000	0.225280	0.210000	0.210000																										0				99						c.(6217-6219)Gac>Aac		talin 2							24.0	27.0	26.0					15																	63089584		2203	4297	6500	SO:0001583	missense	83660	9	121338	37				g.chr15:63089584G>A	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6217G>A	chr15.hg19:g.63089584G>A	ENSP00000453508:p.Asp2073Asn	1					TLN2_ENST00000306829.6_Missense_Mutation_p.D2073N	p.D2073N			0	1	1	1.961557	Q9Y4G6	TLN2_HUMAN		47	6447	+			A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	0	1	hg19	c.6217G>A	CCDS32261.1	0	.	.	.	.	.	.	.	.	.	.	G	9.079	0.998848	0.19121	.	.	ENSG00000171914	ENST00000306829	T	0.13196	2.61	5.91	0.627	0.17675	5.91	0.627	0.17675	.	0.291923	0.41938	N	0.000789	T	0.08582	0.0213	L	0.28115	0.83	0.42219	D	0.991842	B	0.22080	0.064	B	0.14578	0.011	T	0.29088	-1.0023	10	0.29301	T	0.29	-4.2882	10.025	0.42066	0.3442:0.0:0.6558:0.0	.	2073	Q9Y4G6	TLN2_HUMAN	N	2073	ENSP00000303476:D2073N	ENSP00000303476:D2073N	D	+	1	0	0	TLN2	60876637	60876637	1.000000	0.71417	0.002000	0.10522	0.333000	0.28666	4.144000	0.58057	-0.130000	0.11599	-0.982000	0.02568	GAC	0.316061		TCGA-HZ-8636-01A-21D-2396-08	0.672	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.670000	-16.315840	1	0.410000			0	14	14	0	262	259	0		1	0		0	0	34	34	0	0.999757	1.559849e-01	0	0	0	13	0	14	262
IGDCC4	57722	broad.mit.edu	37	15	65703590	65703590	+	Silent	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr15:65703590G>A	ENST00000352385.2	-	2	398	c.189C>T	c.(187-189)gcC>gcT	p.A63A		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	63	Ig-like C2-type 1.|Poly-Ala.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGGGTCCAGCGGCAGCAGCCC	0.642																																						ENST00000352385.2	0.430000	0.150000	3.600000e-01	2.100000e-01	0.270000	0.289285	0.270000	0.270000																										0				44						c.(187-189)gcC>gcT		immunoglobulin superfamily, DCC subclass, member 4							45.0	40.0	41.0					15																	65703590		2201	4299	6500	SO:0001819	synonymous_variant	57722	2	121410	30				g.chr15:65703590G>A		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.189C>T	chr15.hg19:g.65703590G>A		1						p.A63A	NM_020962.1	NP_066013.1	0	1	1	1.961557	Q8TDY8	IGDC4_HUMAN		2	398	-			Q9HCE4	Silent	SNP	ENST00000352385.2	1	1	hg19	c.189C>T	CCDS10206.1	0																																																																																								0.316061		TCGA-HZ-8636-01A-21D-2396-08	0.642	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	1	0	1	2	2	2	2	0	0	0	0	35	35	35	34	1	1.670000	-17.874960	1	0.410000	NM_020962		0	14	13	0	200	199	0		1	0		0	0	35	35	0	0.999770	6.224334e-02	0	0	0	6	0	14	200
HCN4	10021	broad.mit.edu	37	15	73614835	73614835	+	Missense_Mutation	SNP	G	G	A	rs542636933	byFrequency	TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr15:73614835G>A	ENST00000261917.3	-	8	4592	c.3599C>T	c.(3598-3600)cCa>cTa	p.P1200L		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	1200					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TAGATTGGATGGCAGTTTGGA	0.542													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		12998	0.0		0.0	False		,,,				2504	0.0					ENST00000261917.3	0.760000	0.130000	5.700000e-01	2.300000e-01	0.380000	0.408519	0.380000	0.340000																										0				55						c.(3598-3600)cCa>cTa		hyperpolarization activated cyclic nucleotide-gated potassium channel 4							15.0	15.0	15.0					15																	73614835		2193	4286	6479	SO:0001583	missense	10021	8	121004	32				g.chr15:73614835G>A	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.3599C>T	chr15.hg19:g.73614835G>A	ENSP00000261917:p.Pro1200Leu	1						p.P1200L	NM_005477.2	NP_005468.1	0	1	1	1.970624	Q9Y3Q4	HCN4_HUMAN		8	4592	-			Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	0	1	hg19	c.3599C>T	CCDS10248.1	0	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655637	0.47467	.	.	ENSG00000138622	ENST00000261917	D	0.99436	-5.9	3.52	2.57	0.30868	3.52	2.57	0.30868	.	.	.	.	.	D	0.98520	0.9506	L	0.43152	1.355	0.58432	D	0.999999	D	0.60160	0.987	P	0.51516	0.672	D	0.97417	1.0006	9	0.87932	D	0	.	10.8488	0.46759	0.0:0.1926:0.8073:0.0	.	1200	Q9Y3Q4	HCN4_HUMAN	L	1200	ENSP00000261917:P1200L	ENSP00000261917:P1200L	P	-	2	0	0	HCN4	71401888	71401888	1.000000	0.71417	0.996000	0.52242	0.454000	0.32378	8.203000	0.89739	0.550000	0.28991	0.305000	0.20034	CCA	0.325676		TCGA-HZ-8636-01A-21D-2396-08	0.542	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	0	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.670000	-8.971758	1	0.410000	NM_005477		0	4	4	0	44	44	1		1	0		0	0	10	10	0	0.893223	1.176471e-02	0	0	0	2	0	4	44
HCN4	10021	broad.mit.edu	37	15	73615826	73615826	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr15:73615826C>T	ENST00000261917.3	-	8	3601	c.2608G>A	c.(2608-2610)Gga>Aga	p.G870R		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	870					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGGCTCAGTCCAGCGGGGGCA	0.697																																						ENST00000261917.3	0.290000	0.080000	2.300000e-01	1.200000e-01	0.170000	0.182611	0.170000	0.170000																										0				55						c.(2608-2610)Gga>Aga		hyperpolarization activated cyclic nucleotide-gated potassium channel 4							44.0	46.0	45.0					15																	73615826		2197	4294	6491	SO:0001583	missense	10021	0	0					g.chr15:73615826C>T	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2608G>A	chr15.hg19:g.73615826C>T	ENSP00000261917:p.Gly870Arg	1						p.G870R	NM_005477.2	NP_005468.1	0	1	1	1.970624	Q9Y3Q4	HCN4_HUMAN		8	3601	-			Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	1	1	hg19	c.2608G>A	CCDS10248.1	0	.	.	.	.	.	.	.	.	.	.	C	9.866	1.197648	0.22037	.	.	ENSG00000138622	ENST00000261917	T	0.78003	-1.14	3.21	3.21	0.36854	3.21	3.21	0.36854	.	.	.	.	.	T	0.78710	0.4326	L	0.36672	1.1	0.41256	D	0.986742	D	0.71674	0.998	D	0.64042	0.921	T	0.76293	-0.3012	9	0.35671	T	0.21	.	10.0634	0.42288	0.2012:0.7988:0.0:0.0	.	870	Q9Y3Q4	HCN4_HUMAN	R	870	ENSP00000261917:G870R	ENSP00000261917:G870R	G	-	1	0	0	HCN4	71402879	71402879	0.140000	0.22579	0.787000	0.31911	0.879000	0.50718	1.447000	0.35101	1.608000	0.50180	0.448000	0.29417	GGA	0.325676		TCGA-HZ-8636-01A-21D-2396-08	0.697	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	1	0	1	2	2	2	2	0	0	0	0	27	27	27	26	1	1.670000	-11.728630	1	0.410000	NM_005477		0	10	9	0	243	240	0		1	0		0	0	27	27	0	0.996796	0	0	0	0	1	0	10	243
GPRC5B	51704	broad.mit.edu	37	16	19883726	19883726	+	Missense_Mutation	SNP	G	G	A	rs149830893		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr16:19883726G>A	ENST00000300571.2	-	2	633	c.442C>T	c.(442-444)Cgg>Tgg	p.R148W	GPRC5B_ENST00000569847.1_Missense_Mutation_p.R148W|GPRC5B_ENST00000535671.1_Missense_Mutation_p.R148W|GPRC5B_ENST00000537135.1_Missense_Mutation_p.R174W|GPRC5B_ENST00000569479.1_Missense_Mutation_p.R148W	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	148					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						ACCAGCCTCCGCACGCGCCAT	0.677													G|||	1	0.000199681	0.0	0.0	5008	,	,		17004	0.001		0.0	False		,,,				2504	0.0					ENST00000300571.2	1.000000	0.100000	2.800000e-01	1.400000e-01	0.200000	0.244835	0.200000	0.190000																										0				25						c.(442-444)Cgg>Tgg		G protein-coupled receptor, class C, group 5, member B		G	TRP/ARG	1,4387		0,1,2193	26.0	25.0	25.0		442	4.3	0.9	16	dbSNP_134	25	0,8590		0,0,4295	no	missense	GPRC5B	NM_016235.1	101	0,1,6488	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging	148/404	19883726	1,12977	2194	4295	6489	SO:0001583	missense	51704	7	121338	39				g.chr16:19883726G>A	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.442C>T	chr16.hg19:g.19883726G>A	ENSP00000300571:p.Arg148Trp	0					GPRC5B_ENST00000569479.1_Missense_Mutation_p.R148W|GPRC5B_ENST00000535671.1_Missense_Mutation_p.R148W|GPRC5B_ENST00000569847.1_Missense_Mutation_p.R148W|GPRC5B_ENST00000537135.1_Missense_Mutation_p.R174W	p.R148W	NM_016235.1	NP_057319.1	1	2	3	2.190921	Q9NZH0	GPC5B_HUMAN		2	633	-			D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	ENST00000300571.2	1	1	hg19	c.442C>T	CCDS10581.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	23.0	4.360599	0.82353	2.28E-4	0.0	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000537135	D;D;D	0.88124	-2.34;-2.34;-2.34	5.27	4.31	0.51392	5.27	4.31	0.51392	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.90844	0.7124	L	0.52364	1.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.90235	0.4282	9	.	.	.	.	14.4869	0.67624	0.0:0.0:0.8522:0.1478	.	174;148	B7Z831;Q9NZH0	.;GPC5B_HUMAN	W	148;148;174	ENSP00000300571:R148W;ENSP00000442858:R148W;ENSP00000441775:R174W	.	R	-	1	2	2	GPRC5B	19791227	19791227	0.997000	0.39634	0.859000	0.33776	0.948000	0.59901	4.463000	0.60128	1.445000	0.47624	0.650000	0.86243	CGG	0.417169		TCGA-HZ-8636-01A-21D-2396-08	0.677	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.670000	-3.387955	1	0.410000			0	11	11	0	271	265	0		1	0		0	0	28	28	0	0.998222	7.342855e-01	0	0	0	65	0	11	271
GNAO1	2775	broad.mit.edu	37	16	56362667	56362667	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr16:56362667G>A	ENST00000262493.6	+	4	1274	c.428G>A	c.(427-429)cGg>cAg	p.R143Q	GNAO1_ENST00000262494.7_Missense_Mutation_p.R143Q	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	143					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				TGCTTCAACCGGTCCCGGGAG	0.607																																						ENST00000262493.6	1.000000	0.940000	1	9.900000e-01	0.990000	0.997042	0.990000	1.000000																										0				17						c.(427-429)cGg>cAg		guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O							78.0	74.0	75.0					16																	56362667		2198	4300	6498	SO:0001583	missense	2775	2	121412	31				g.chr16:56362667G>A		CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.428G>A	chr16.hg19:g.56362667G>A	ENSP00000262493:p.Arg143Gln	0					GNAO1_ENST00000262494.7_Missense_Mutation_p.R143Q	p.R143Q	NM_020988.2	NP_066268.1	1	2	3	2.183221	P09471	GNAO_HUMAN		4	1274	+		all_neural(199;0.159)	P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	ENST00000262493.6	1	1	hg19	c.428G>A	CCDS10756.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.486569	0.96323	.	.	ENSG00000087258	ENST00000262493;ENST00000262494	D;D	0.90133	-2.62;-2.62	4.95	4.95	0.65309	4.95	4.95	0.65309	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.96182	0.8755	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.96	D	0.97114	0.9806	10	0.87932	D	0	.	18.1807	0.89777	0.0:0.0:1.0:0.0	.	143;143	P09471;P09471-2	GNAO_HUMAN;.	Q	143	ENSP00000262493:R143Q;ENSP00000262494:R143Q	ENSP00000262493:R143Q	R	+	2	0	0	GNAO1	54920168	54920168	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.276000	0.75962	0.462000	0.41574	CGG	0.415986		TCGA-HZ-8636-01A-21D-2396-08	0.607	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.670000	-4.547234	1	0.410000	NM_020988		0	80	79	0	259	256	1		1	0		0	0	41	41	0	1.000000	9.560853e-01	0	0	0	19	0	80	259
BANP	54971	broad.mit.edu	37	16	88066732	88066732	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr16:88066732C>T	ENST00000393207.1	+	9	1278	c.1057C>T	c.(1057-1059)Cca>Tca	p.P353S	BANP_ENST00000286122.7_Missense_Mutation_p.P353S|BANP_ENST00000355022.4_Missense_Mutation_p.P322S|BANP_ENST00000538234.1_Missense_Mutation_p.P361S|BANP_ENST00000393208.2_Missense_Mutation_p.P322S|BANP_ENST00000355163.5_Missense_Mutation_p.P328S|BANP_ENST00000479780.2_Missense_Mutation_p.P322S	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	353	DNA-binding. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GATGAGCACCCCACCTCCTGC	0.647																																						ENST00000393207.1	1.000000	0.170000	4.200000e-01	2.300000e-01	0.310000	0.351914	0.310000	0.310000																										0				12						c.(1057-1059)Cca>Tca		BTG3 associated nuclear protein							29.0	25.0	26.0					16																	88066732		2198	4300	6498	SO:0001583	missense	54971	0	0					g.chr16:88066732C>T	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.1057C>T	chr16.hg19:g.88066732C>T	ENSP00000376902:p.Pro353Ser	0					BANP_ENST00000393208.2_Missense_Mutation_p.P322S|BANP_ENST00000355163.5_Missense_Mutation_p.P328S|BANP_ENST00000479780.2_Missense_Mutation_p.P322S|BANP_ENST00000355022.4_Missense_Mutation_p.P322S|BANP_ENST00000538234.1_Missense_Mutation_p.P361S|BANP_ENST00000286122.7_Missense_Mutation_p.P353S	p.P353S	NM_001173543.1	NP_001167014.1	1	2	3	2.183221	Q8N9N5	BANP_HUMAN		9	1278	+			A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	ENST00000393207.1	0	1	hg19	c.1057C>T	CCDS54054.1	0	.	.	.	.	.	.	.	.	.	.	C	7.093	0.572586	0.13623	.	.	ENSG00000172530	ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	.	.	.	4.28	1.91	0.25777	4.28	1.91	0.25777	.	0.524714	0.20730	N	0.086739	T	0.34106	0.0886	N	0.19112	0.55	0.28197	N	0.927508	B;B;B;D;B;B	0.76494	0.02;0.042;0.001;0.999;0.002;0.359	B;B;B;D;B;B	0.79784	0.024;0.08;0.001;0.993;0.002;0.167	T	0.17776	-1.0358	9	0.09590	T	0.72	.	6.988	0.24739	0.1477:0.4406:0.4117:0.0	.	361;328;322;353;322;322	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	S	353;328;318;322;322;322;322;361;353	.	ENSP00000286122:P353S	P	+	1	0	0	BANP	86624233	86624233	0.387000	0.25188	0.864000	0.33941	0.030000	0.12068	1.150000	0.31639	0.894000	0.36317	0.305000	0.20034	CCA	0.415986		TCGA-HZ-8636-01A-21D-2396-08	0.647	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269166.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.670000	-3.320787	1	0.410000	NM_017869		0	13	11	0	195	190	0		1	0		0	0	19	19	0	0.999480	7.620167e-01	0	1	0	41	0	13	195
NEURL4	84461	broad.mit.edu	37	17	7225225	7225225	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr17:7225225C>T	ENST00000399464.2	-	17	2845	c.2830G>A	c.(2830-2832)Gtc>Atc	p.V944I	NEURL4_ENST00000570460.1_Missense_Mutation_p.V920I|NEURL4_ENST00000315614.7_Missense_Mutation_p.V942I|RP11-542C16.2_ENST00000575474.1_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	944	NHR 5. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTACTGAAGACAAGGCCATGA	0.587																																						ENST00000399464.2	0.360000	0.150000	3.000000e-01	1.900000e-01	0.240000	0.251417	0.240000	0.240000																										0				34						c.(2830-2832)Gtc>Atc		neuralized E3 ubiquitin protein ligase 4							100.0	101.0	101.0					17																	7225225		2134	4228	6362	SO:0001583	missense	84461	0	0					g.chr17:7225225C>T		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.2830G>A	chr17.hg19:g.7225225C>T	ENSP00000382390:p.Val944Ile	1					NEURL4_ENST00000315614.7_Missense_Mutation_p.V942I|RP11-542C16.2_ENST00000575474.1_5'Flank|NEURL4_ENST00000570460.1_Missense_Mutation_p.V920I	p.V944I	NM_032442.2	NP_115818.2	0	1	1	1.687130	Q96JN8	NEUL4_HUMAN		17	2845	-			Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	1	1	hg19	c.2830G>A	CCDS42251.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.070973	0.93950	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.41065	1.02;1.01	5.87	5.87	0.94306	5.87	5.87	0.94306	NEUZ (3);	0.000000	0.85682	D	0.000000	T	0.65923	0.2738	M	0.76002	2.32	0.50039	D	0.999849	D;D	0.63046	0.99;0.992	D;D	0.77004	0.98;0.989	T	0.64820	-0.6317	10	0.49607	T	0.09	-27.2431	17.7017	0.88296	0.0:1.0:0.0:0.0	.	942;944	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	I	942;944	ENSP00000319826:V942I;ENSP00000382390:V944I	ENSP00000319826:V942I	V	-	1	0	0	NEURL4	7165949	7165949	0.999000	0.42202	0.975000	0.42487	0.983000	0.72400	4.024000	0.57218	2.781000	0.95711	0.655000	0.94253	GTC	0.257862		TCGA-HZ-8636-01A-21D-2396-08	0.587	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.670000	-19.999660	1	0.410000	NM_032442		0	20	20	0	299	294	0		1	1		0	0	61	61	0	0.999995	6.760828e-01	0	2	0	34	0	20	299
BZRAP1	9256	broad.mit.edu	37	17	56390036	56390036	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr17:56390036C>G	ENST00000343736.4	-	17	2309	c.2146G>C	c.(2146-2148)Gag>Cag	p.E716Q	BZRAP1_ENST00000355701.3_Missense_Mutation_p.E716Q|BZRAP1_ENST00000268893.6_Missense_Mutation_p.E656Q			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	716	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GACACACGCTCTACAAAATTG	0.592																																						ENST00000343736.4	0.500000	0.220000	4.300000e-01	2.800000e-01	0.340000	0.360096	0.340000	0.350000																										0				54						c.(2146-2148)Gag>Cag		benzodiazepine receptor (peripheral) associated protein 1							39.0	38.0	38.0					17																	56390036		2203	4300	6503	SO:0001583	missense	9256	0	0					g.chr17:56390036C>G	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2146G>C	chr17.hg19:g.56390036C>G	ENSP00000345824:p.Glu716Gln	1					BZRAP1_ENST00000355701.3_Missense_Mutation_p.E716Q|BZRAP1_ENST00000268893.6_Missense_Mutation_p.E656Q	p.E716Q			0	1	1	1.739719	O95153	RIMB1_HUMAN		17	2309	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	1	1	hg19	c.2146G>C	CCDS11605.1	0	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825303	0.90955	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.35973	1.28;1.28;1.28	5.67	5.67	0.87782	5.67	5.67	0.87782	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	L	0.50993	1.605	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.91635	0.993;0.999;0.996	T	0.52313	-0.8592	10	0.48119	T	0.1	.	18.7443	0.91787	0.0:1.0:0.0:0.0	.	716;656;716	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	Q	716;716;656	ENSP00000347929:E716Q;ENSP00000345824:E716Q;ENSP00000268893:E656Q	ENSP00000268893:E656Q	E	-	1	0	0	BZRAP1	53745035	53745035	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	7.818000	0.86416	2.677000	0.91161	0.462000	0.41574	GAG	0.257862		TCGA-HZ-8636-01A-21D-2396-08	0.592	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	1.670000	-2.966614	1	0.410000	NM_004758		0	21	20	0	211	206	1		1	1		0	0	39	39	0	0.999997	5.077194e-01	0	2	0	16	0	21	211
OTOP3	347741	broad.mit.edu	37	17	72943167	72943167	+	Missense_Mutation	SNP	C	C	T	rs145029319		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr17:72943167C>T	ENST00000328801.4	+	6	1217	c.1217C>T	c.(1216-1218)aCg>aTg	p.T406M		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	406						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					GAGCTGGACACGGTCAAGAAC	0.607																																						ENST00000328801.4	1.000000	0.360000	6.600000e-01	4.400000e-01	0.520000	0.571597	0.520000	0.520000																										0				23						c.(1216-1218)aCg>aTg		otopetrin 3		C	MET/THR	0,4406		0,0,2203	96.0	91.0	93.0		1217	3.6	1.0	17	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	missense	OTOP3	NM_178233.1	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	406/597	72943167	1,13005	2203	4300	6503	SO:0001583	missense	347741	1	121412	36				g.chr17:72943167C>T	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1217C>T	chr17.hg19:g.72943167C>T	ENSP00000328090:p.Thr406Met	1						p.T406M	NM_178233.1	NP_839947.1	0	2	2	1.916573	Q7RTS5	OTOP3_HUMAN		6	1217	+	all_lung(278;0.151)|Lung NSC(278;0.185)			Missense_Mutation	SNP	ENST00000328801.4	1	1	hg19	c.1217C>T	CCDS11709.1	0	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136971	0.37728	0.0	1.16E-4	ENSG00000182938	ENST00000328801	T	0.23147	1.92	4.54	3.56	0.40772	4.54	3.56	0.40772	.	0.323633	0.28712	N	0.014395	T	0.43919	0.1269	M	0.68317	2.08	0.32154	N	0.58386	D	0.89917	1.0	D	0.79108	0.992	T	0.53774	-0.8391	10	0.59425	D	0.04	-16.305	7.4753	0.27371	0.1649:0.7493:0.0:0.0858	.	406	Q7RTS5	OTOP3_HUMAN	M	406	ENSP00000328090:T406M	ENSP00000328090:T406M	T	+	2	0	0	OTOP3	70454762	70454762	0.281000	0.24258	0.978000	0.43139	0.696000	0.40369	0.869000	0.27996	0.891000	0.36235	0.462000	0.41574	ACG	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.607	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	1.670000	-12.919130	1	0.410000	NM_178233		0	33	32	0	279	275	1		1			0	0	52	52	0	1.000000	0	0	0	0	0	0	33	279
SALL3	27164	broad.mit.edu	37	18	76754689	76754690	+	Missense_Mutation	DNP	TC	TC	GA			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr18:76754689_76754690TC>GA	ENST00000537592.2	+	2	2698_2699	c.2698_2699TC>GA	c.(2698-2700)TCg>GAg	p.S900E	SALL3_ENST00000536229.3_Missense_Mutation_p.S767E|SALL3_ENST00000575389.2_Missense_Mutation_p.S900E	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	900	Poly-Ser.				forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GTCCGAGTCCTCGTCCTCGCAG	0.733																																						ENST00000537592.2			0	0																														0				74						c.(2698-2700)Tcg>Gcg|c.(2698-2700)tCg>tAg		spalt-like transcription factor 3																																				SO:0001583	missense	27164	1	117834|117818	31|36				g.chr18:76754689T>G|g.chr18:76754690C>A	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	Exception_encountered	chr18.hg19:g.76754689_76754690delinsGA	ENSP00000441823:p.Ser900Glu						SALL3_ENST00000536229.3_Missense_Mutation_p.S767A|SALL3_ENST00000575389.2_Missense_Mutation_p.S900A|SALL3_ENST00000536229.3_Nonsense_Mutation_p.S767*|SALL3_ENST00000575389.2_Nonsense_Mutation_p.S900*	p.S900A|p.S900*	NM_171999.3	NP_741996.2					Q9BXA9	SALL3_HUMAN		2	2698|2699	+		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)	Q9UGH1	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000537592.2	0	1	hg19	c.2698T>G|c.2699C>A	CCDS12013.1																										5.43	4.24|4.54	0.50183|0.55810																																												0			74855677|74855678																TCGA-HZ-8636-01A-21D-2396-08	0.733	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	0	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.670000	-7.544553|-3.607852	1	0.410000	NM_171999		0	5	5	0	182|180	162|164	0		1			0	0	19	19	0	0.917802|0.922295	0	0	0	0	0	0	5	180
ATP4A	495	broad.mit.edu	37	19	36050774	36050774	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr19:36050774C>T	ENST00000262623.3	-	7	1017	c.989G>A	c.(988-990)cGg>cAg	p.R330Q		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	330					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GACCATGGCCCGCAGGAAGGT	0.582																																						ENST00000262623.3	1.000000	0.750000	1	8.500000e-01	0.960000	0.941553	0.960000	1.000000																										0				53						c.(988-990)cGg>cAg		ATPase, H+/K+ exchanging, alpha polypeptide	Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)						83.0	68.0	73.0					19																	36050774		2203	4300	6503	SO:0001583	missense	495	0	0					g.chr19:36050774C>T		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.989G>A	chr19.hg19:g.36050774C>T	ENSP00000262623:p.Arg330Gln	0						p.R330Q	NM_000704.2	NP_000695.2	0	1	1	2.098773	P20648	ATP4A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)	7	1017	-	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		O00738	Missense_Mutation	SNP	ENST00000262623.3	1	1	hg19	c.989G>A	CCDS12467.1	1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.282969	0.59867	.	.	ENSG00000105675	ENST00000262623	D	0.88354	-2.37	3.83	3.83	0.44106	3.83	3.83	0.44106	ATPase, P-type, ATPase-associated domain (1);	0.181592	0.34223	N	0.004155	T	0.79203	0.4406	N	0.10874	0.06	0.36501	D	0.869005	B	0.27264	0.173	B	0.29716	0.106	T	0.80504	-0.1353	10	0.40728	T	0.16	.	13.5911	0.61961	0.0:1.0:0.0:0.0	.	330	P20648	ATP4A_HUMAN	Q	330	ENSP00000262623:R330Q	ENSP00000262623:R330Q	R	-	2	0	0	ATP4A	40742614	40742614	0.048000	0.20356	1.000000	0.80357	0.997000	0.91878	2.051000	0.41307	2.146000	0.66826	0.561000	0.74099	CGG	0.388696		TCGA-HZ-8636-01A-21D-2396-08	0.582	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	1	0	1	2	2	2	2	0	0	0	0	56	56	56	55	1	1.670000	-3.510310	1	0.410000	NM_000704		0	54	53	0	207	205	1		1			0	0	56	56	0	1.000000	0	0	0	0	0	0	54	207
ZNF628	89887	broad.mit.edu	37	19	55993096	55993096	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr19:55993096G>C	ENST00000598519.1	+	3	1089	c.536G>C	c.(535-537)gGa>gCa	p.G179A	ZNF628_ENST00000391718.2_Missense_Mutation_p.G175A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	179					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		TACACCTGTGGAGTCTGCGGG	0.711																																						ENST00000598519.1	1.000000	0.590000	1	7.300000e-01	0.890000	0.874978	0.890000	1.000000																										0				7						c.(535-537)gGa>gCa		zinc finger protein 628							23.0	23.0	23.0					19																	55993096		2201	4295	6496	SO:0001583	missense	89887	0	0					g.chr19:55993096G>C	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.536G>C	chr19.hg19:g.55993096G>C	ENSP00000469591:p.Gly179Ala	0					ZNF628_ENST00000391718.2_Missense_Mutation_p.G175A	p.G179A			1	2	3	2.174778	Q5EBL2	ZN628_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	3	1089	+	Breast(117;0.155)		Q86X34	Missense_Mutation	SNP	ENST00000598519.1	1	1	hg19	c.536G>C	CCDS33116.3	1	.	.	.	.	.	.	.	.	.	.	.	5.185	0.219611	0.09863	.	.	ENSG00000197483	ENST00000391718	T	0.07114	3.22	3.62	2.54	0.30619	3.62	2.54	0.30619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.308416	0.22071	U	0.065039	T	0.06096	0.0158	L	0.31157	0.91	0.09310	N	1	B	0.16603	0.018	B	0.16289	0.015	T	0.38779	-0.9645	10	0.20046	T	0.44	-4.2285	9.8863	0.41264	0.0:0.4083:0.5917:0.0	.	175	Q5EBL2	ZN628_HUMAN	A	175	ENSP00000375598:G175A	ENSP00000375598:G175A	G	+	2	0	0	ZNF628	60684908	60684908	0.003000	0.15002	0.064000	0.19789	0.009000	0.06853	1.406000	0.34646	0.845000	0.35118	0.484000	0.47621	GGA	0.418347		TCGA-HZ-8636-01A-21D-2396-08	0.711	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.670000	-20.000000	1	0.410000	XM_058964		0	24	23	0	111	109	0		1	1		0	0	17	17	0	1.000000	6.608511e-01	0	2	0	10	0	24	111
ZNF71	58491	broad.mit.edu	37	19	57133444	57133444	+	Silent	SNP	G	G	A	rs201252925		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr19:57133444G>A	ENST00000328070.6	+	3	1023	c.789G>A	c.(787-789)acG>acA	p.T263T		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		ACCAGCGCACGCACACCGGGG	0.677																																						ENST00000328070.6	1.000000	0.250000	4.600000e-01	3.100000e-01	0.370000	0.413981	0.370000	0.370000																										0				26						c.(787-789)acG>acA		zinc finger protein 71							53.0	54.0	54.0					19																	57133444		2203	4300	6503	SO:0001819	synonymous_variant	58491	2	121356	34				g.chr19:57133444G>A	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.789G>A	chr19.hg19:g.57133444G>A		0						p.T263T	NM_021216.4	NP_067039.1	1	2	3	2.174778	Q9NQZ8	ZNF71_HUMAN		3	1023	+			Q15919|Q9UC09|Q9UQD3	Silent	SNP	ENST00000328070.6	1	1	hg19	c.789G>A	CCDS12947.1	0																																																																																								0.418347		TCGA-HZ-8636-01A-21D-2396-08	0.677	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	1.670000	-20.000000	1	0.410000	NM_021216		0	32	30	0	395	393	0		1	1		0	0	47	47	0	1.000000	6.899537e-01	0	4	0	27	0	32	395
MTOR	2475	broad.mit.edu	37	1	11269497	11269497	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr1:11269497C>T	ENST00000361445.4	-	25	3749	c.3673G>A	c.(3673-3675)Gaa>Aaa	p.E1225K		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1225					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCCTCCTCTTCATCAGCAAGT	0.433																																						ENST00000361445.4	0.130000	0.050000	1.100000e-01	6.000000e-02	0.080000	0.093957	0.080000	0.090000																										0				149						c.(3673-3675)Gaa>Aaa		mechanistic target of rapamycin (serine/threonine kinase)	Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)						231.0	222.0	225.0					1																	11269497		2203	4300	6503	SO:0001583	missense	2475	0	0					g.chr1:11269497C>T	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3673G>A	chr1.hg19:g.11269497C>T	ENSP00000354558:p.Glu1225Lys	0						p.E1225K	NM_004958.3	NP_004949.1	0	1	1	1.981445	P42345	MTOR_HUMAN		25	3749	-			Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	0	1	hg19	c.3673G>A	CCDS127.1	0	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733505	0.48939	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.67523	-0.27	5.92	5.92	0.95590	5.92	5.92	0.95590	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76190	0.3953	L	0.44542	1.39	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.72308	-0.4332	10	0.38643	T	0.18	-15.5656	20.3207	0.98668	0.0:1.0:0.0:0.0	.	1225	P42345	MTOR_HUMAN	K	1225	ENSP00000354558:E1225K	ENSP00000354558:E1225K	E	-	1	0	0	MTOR	11192084	11192084	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.456000	0.80751	2.813000	0.96785	0.561000	0.74099	GAA	0.350041		TCGA-HZ-8636-01A-21D-2396-08	0.433	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	0	0	1	2	2	2	2	0	0	0	0	143	143	143	143	1	1.670000	-2.574860	1	0.410000	NM_004958		0	21	20	0	1012	998	0		1	0		0	0	143	143	0	0.999997	2.253097e-01	0	1	0	41	0	21	1012
SLC30A7	148867	broad.mit.edu	37	1	101379319	101379319	+	Silent	SNP	T	T	C			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr1:101379319T>C	ENST00000370112.4	+	6	799	c.612T>C	c.(610-612)caT>caC	p.H204H	SLC30A7_ENST00000357650.4_Silent_p.H204H	NM_001144884.1|NM_133496.4	NP_001138356.1|NP_598003.2	Q8NEW0	ZNT7_HUMAN	solute carrier family 30 (zinc transporter), member 7	204	His-rich loop.				cellular protein metabolic process (GO:0044267)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	cation transmembrane transporter activity (GO:0008324)			endometrium(3)|large_intestine(2)|lung(10)	15		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)		Epithelial(280;0.0437)|all cancers(265;0.0498)|COAD - Colon adenocarcinoma(174;0.162)|Colorectal(144;0.19)|Lung(183;0.201)		GTGCTGCACATAGCCATGATC	0.463																																					NSCLC(91;473 1491 3102 16827 21633)	ENST00000370112.4	1.000000	0.950000	1	9.900000e-01	0.990000	0.997389	0.990000	1.000000																										0				15						c.(610-612)caT>caC		solute carrier family 30 (zinc transporter), member 7							174.0	136.0	149.0					1																	101379319		2203	4300	6503	SO:0001819	synonymous_variant	148867	0	0					g.chr1:101379319T>C	AF233345	CCDS776.1	1p21.1	2013-05-22			ENSG00000162695	ENSG00000162695		"""Solute carriers"""	19306	protein-coding gene	gene with protein product		611149				12446736	Standard	NM_133496		Approved	ZnTL2, ZNT7	uc001dto.2	Q8NEW0	OTTHUMG00000011815	ENST00000370112.4:c.612T>C	chr1.hg19:g.101379319T>C		1					SLC30A7_ENST00000357650.4_Silent_p.H204H	p.H204H	NM_001144884.1|NM_133496.4	NP_001138356.1|NP_598003.2	0	1	1	1.950430	Q8NEW0	ZNT7_HUMAN		6	799	+		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)	B2R949|D3DT61|Q8TCH2	Silent	SNP	ENST00000370112.4	1	1	hg19	c.612T>C	CCDS776.1	1																																																																																								0.338083		TCGA-HZ-8636-01A-21D-2396-08	0.463	SLC30A7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032711.1	1	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	1.670000	-20.000000	1	0.410000	NM_133496		0	78	78	0	211	210	1		1	1		0	0	54	54	0	1.000000	9.993715e-01	0	19	0	14	0	78	211
RSC1A1	6248	broad.mit.edu	37	1	15987039	15987039	+	Missense_Mutation	SNP	G	G	A	rs370483687		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr1:15987039G>A	ENST00000345034.1	+	1	676	c.676G>A	c.(676-678)Gat>Aat	p.D226N	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	226					intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGAATGTGGATCCTCCAAG	0.428																																						ENST00000345034.1	0.580000	0.280000	5.000000e-01	3.400000e-01	0.410000	0.429200	0.410000	0.420000																										0				11						c.(676-678)Gat>Aat		regulatory solute carrier protein, family 1, member 1		G	ASN/ASP,	1,4405	2.1+/-5.4	0,1,2202	58.0	55.0	56.0		676,	2.6	0.1	1		56	0,8600		0,0,4300	no	missense,utr-3	RSC1A1,DDI2	NM_006511.1,NM_032341.4	23,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,	226/618,	15987039	1,13005	2203	4300	6503	SO:0001583	missense	6248	1	121412	33				g.chr1:15987039G>A	BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.676G>A	chr1.hg19:g.15987039G>A	ENSP00000341963:p.Asp226Asn	0					DDI2_ENST00000480945.1_3'UTR	p.D226N	NM_006511.1	NP_006502.1	0	1	1	1.981445	Q92681	RSCA1_HUMAN		1	676	+		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)	B2RBP5	Missense_Mutation	SNP	ENST00000345034.1	1	1	hg19	c.676G>A	CCDS161.1	0	.	.	.	.	.	.	.	.	.	.	G	1.555	-0.538146	0.04082	2.27E-4	0.0	ENSG00000215695	ENST00000345034	T	0.25749	1.78	5.61	2.6	0.31112	5.61	2.6	0.31112	.	0.951788	0.08658	N	0.912835	T	0.13030	0.0316	N	0.14661	0.345	0.09310	N	1	B	0.31548	0.328	B	0.32465	0.146	T	0.33752	-0.9856	10	0.11485	T	0.65	-24.3955	4.6168	0.12430	0.0835:0.1587:0.6044:0.1534	.	226	Q92681	RSCA1_HUMAN	N	226	ENSP00000341963:D226N	ENSP00000341963:D226N	D	+	1	0	0	RSC1A1	15859626	15859626	0.004000	0.15560	0.065000	0.19835	0.041000	0.13682	1.461000	0.35255	0.668000	0.31126	0.561000	0.74099	GAT	0.350041		TCGA-HZ-8636-01A-21D-2396-08	0.428	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.670000	-20.000000	1	0.410000	NM_006511		0	27	25	0	258	255	0		1	1		0	0	49	49	0	1.000000	8.516301e-01	0	6	0	29	0	27	258
RPA2	6118	broad.mit.edu	37	1	28240605	28240605	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr1:28240605G>A	ENST00000373912.3	-	2	385	c.86C>T	c.(85-87)tCg>tTg	p.S29L	RPA2_ENST00000313433.7_Missense_Mutation_p.S117L|RPA2_ENST00000373909.3_Missense_Mutation_p.S37L	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa	29	Gly/Ser-rich.				base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTGCGGGCGATCCAAAGCC	0.502								Direct reversal of damage;Nucleotide excision repair (NER)																														ENST00000373912.3	0.520000	0.220000	4.400000e-01	2.800000e-01	0.350000	0.369699	0.350000	0.350000																										0				11						c.(85-87)tCg>tTg	Direct reversal of damage;Nucleotide excision repair (NER)	replication protein A2, 32kDa							57.0	66.0	63.0					1																	28240605		2203	4300	6503	SO:0001583	missense	6118	0	0					g.chr1:28240605G>A	BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.86C>T	chr1.hg19:g.28240605G>A	ENSP00000363021:p.Ser29Leu	1					RPA2_ENST00000313433.7_Missense_Mutation_p.S117L|RPA2_ENST00000373909.3_Missense_Mutation_p.S37L	p.S29L	NM_002946.3	NP_002937.1	0	1	1	1.950430	P15927	RFA2_HUMAN		2	385	-		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)	Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	ENST00000373912.3	1	1	hg19	c.86C>T	CCDS314.1	0	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057680	0.76074	.	.	ENSG00000117748	ENST00000373912;ENST00000373909;ENST00000313433;ENST00000444045	T;T;T;T	0.26810	2.03;2.02;1.99;1.71	4.59	3.67	0.42095	4.59	3.67	0.42095	.	0.184267	0.49305	D	0.000144	T	0.16896	0.0406	L	0.33485	1.01	0.40306	D	0.978667	P;B	0.39748	0.686;0.428	B;B	0.31290	0.127;0.087	T	0.04976	-1.0914	10	0.42905	T	0.14	-2.2818	12.0254	0.53367	0.0875:0.0:0.9124:0.0	.	29;37	P15927;P15927-2	RFA2_HUMAN;.	L	29;37;117;33	ENSP00000363021:S29L;ENSP00000363017:S37L;ENSP00000363015:S117L;ENSP00000387649:S33L	ENSP00000363015:S117L	S	-	2	0	0	RPA2	28113192	28113192	1.000000	0.71417	0.789000	0.31954	0.788000	0.44548	5.916000	0.69981	1.050000	0.40346	0.555000	0.69702	TCG	0.338083		TCGA-HZ-8636-01A-21D-2396-08	0.502	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011179.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	1.670000	-20.000000	1	0.410000	NM_002946		0	20	20	0	223	220	1		1	1		0	0	32	32	0	0.999996	9.996186e-01	0	16	0	128	0	20	223
CTSK	1513	broad.mit.edu	37	1	150776542	150776542	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	G	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr1:150776542C>G	ENST00000271651.3	-	5	683	c.573G>C	c.(571-573)aaG>aaC	p.K191N	CTSK_ENST00000480670.1_5'UTR	NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	191					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			TACCCCGGTTCTTCTGCACAT	0.493																																						ENST00000271651.3	1.000000	0.330000	1	3.800000e-01	0.440000	0.542803	0.440000	0.430000																										0				7						c.(571-573)aaG>aaC		cathepsin K							183.0	165.0	171.0					1																	150776542		2203	4300	6503	SO:0001583	missense	1513	0	0					g.chr1:150776542C>G	BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.573G>C	chr1.hg19:g.150776542C>G	ENSP00000271651:p.Lys191Asn	1					CTSK_ENST00000480670.1_5'UTR	p.K191N	NM_000396.3	NP_000387.1	2	4	6	2.593216	P43235	CATK_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)	5	683	-	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		Q6FHS6	Missense_Mutation	SNP	ENST00000271651.3	1	1	hg19	c.573G>C	CCDS969.1	0	.	.	.	.	.	.	.	.	.	.	C	13.78	2.337959	0.41398	.	.	ENSG00000143387	ENST00000271651;ENST00000443913	D;D	0.97710	-4.5;-4.5	5.57	1.37	0.22104	5.57	1.37	0.22104	Peptidase C1A, papain C-terminal (2);	0.660593	0.16298	N	0.220576	D	0.89959	0.6866	L	0.39147	1.195	0.33900	D	0.638336	B	0.02656	0.0	B	0.06405	0.002	T	0.81263	-0.1012	10	0.44086	T	0.13	.	4.733	0.12974	0.0:0.4528:0.3003:0.2469	.	191	P43235	CATK_HUMAN	N	191;250	ENSP00000271651:K191N;ENSP00000405083:K250N	ENSP00000271651:K191N	K	-	3	2	2	CTSK	149043166	149043166	0.000000	0.05858	0.992000	0.48379	0.967000	0.64934	-0.585000	0.05794	0.303000	0.22785	-0.251000	0.11542	AAG	0.513683		TCGA-HZ-8636-01A-21D-2396-08	0.493	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084732.1	1	0	1	2	2	2	2	0	0	0	0	122	122	122	122	1	1.670000	-12.573230	1	0.410000	NM_000396		0	59	58	0	746	734	0		1	0		0	0	122	122	0	1.000000	1	0	0	0	1228	0	59	746
EPB41L1	2036	broad.mit.edu	37	20	34785959	34785959	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr20:34785959A>G	ENST00000338074.2	+	14	1825	c.1664A>G	c.(1663-1665)aAt>aGt	p.N555S	EPB41L1_ENST00000202028.5_Missense_Mutation_p.N481S|EPB41L1_ENST00000373941.1_Missense_Mutation_p.N555S|EPB41L1_ENST00000373950.2_Missense_Mutation_p.N446S|EPB41L1_ENST00000373946.3_Missense_Mutation_p.N512S|EPB41L1_ENST00000441639.1_Missense_Mutation_p.N481S	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	555					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GAGAAAGCCAATGAGGTAGGT	0.597																																						ENST00000338074.2	0.860000	0.460000	7.600000e-01	5.500000e-01	0.650000	0.663677	0.650000	0.650000																										0				37						c.(1663-1665)aAt>aGt		erythrocyte membrane protein band 4.1-like 1							21.0	23.0	22.0					20																	34785959		2202	4298	6500	SO:0001583	missense	2036	5	121366	35				g.chr20:34785959A>G	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1664A>G	chr20.hg19:g.34785959A>G	ENSP00000337168:p.Asn555Ser	0					EPB41L1_ENST00000441639.1_Missense_Mutation_p.N481S|EPB41L1_ENST00000373950.2_Missense_Mutation_p.N446S|EPB41L1_ENST00000373946.3_Missense_Mutation_p.N512S|EPB41L1_ENST00000373941.1_Missense_Mutation_p.N555S|EPB41L1_ENST00000202028.5_Missense_Mutation_p.N481S	p.N555S	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	0	1	1	1.949394	Q9H4G0	E41L1_HUMAN		14	1825	+	Breast(12;0.0239)		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	1	1	hg19	c.1664A>G	CCDS13271.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.414|0.414	-0.911860|-0.911860	0.02434|0.02434	.|.	.|.	ENSG00000088367|ENSG00000088367	ENST00000451082|ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000344237;ENST00000338074;ENST00000373941;ENST00000454226	.|D;T;D;D;D;D	.|0.82526	.|-1.54;-1.47;-1.54;-1.62;-1.55;-1.55	5.15|5.15	-0.0314|-0.0314	0.13910|0.13910	5.15|5.15	-0.0314|-0.0314	0.13910|0.13910	.|.	.|0.285159	.|0.37857	.|N	.|0.001905	T|T	0.59155|0.59155	0.2173|0.2173	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B;B	.|0.04013	.|0.0;0.0;0.0;0.001;0.0;0.001	T|T	0.44667|0.44667	-0.9313|-0.9313	5|10	.|0.08837	.|T	.|0.75	.|.	8.306|8.306	0.32042|0.32042	0.3337:0.138:0.5284:0.0|0.3337:0.138:0.5284:0.0	.|.	.|555;555;512;446;446;481	.|B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.|.;E41L1_HUMAN;.;.;.;.	V|S	121|481;446;555;446;481;512;129;555;555;53	.|ENSP00000202028:N481S;ENSP00000363061:N446S;ENSP00000399214:N481S;ENSP00000363057:N512S;ENSP00000337168:N555S;ENSP00000363052:N555S	.|ENSP00000202028:N481S	M|N	+|+	1|2	0|0	0|0	EPB41L1|EPB41L1	34249373|34249373	34249373|34249373	0.013000|0.013000	0.17824|0.17824	0.396000|0.396000	0.26296|0.26296	0.942000|0.942000	0.58702|0.58702	0.227000|0.227000	0.17795|0.17795	-0.280000|-0.280000	0.09154|0.09154	0.533000|0.533000	0.62120|0.62120	ATG|AAT	0.345608		TCGA-HZ-8636-01A-21D-2396-08	0.597	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.670000	-20.000000	1	0.410000	NM_012156		0	34	32	0	194	189	1		1	1		0	0	27	27	0	1.000000	9.999999e-01	0	41	0	112	0	34	194
CABIN1	23523	broad.mit.edu	37	22	24451432	24451432	+	Silent	SNP	G	G	A	rs200436672	byFrequency	TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr22:24451432G>A	ENST00000398319.2	+	9	1288	c.903G>A	c.(901-903)tcG>tcA	p.S301S	CABIN1_ENST00000263119.5_Silent_p.S301S|CABIN1_ENST00000405822.2_Silent_p.S251S	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	301					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTGATTTGTCGGACTACCAGG	0.572													G|||	2	0.000399361	0.0	0.0	5008	,	,		19364	0.002		0.0	False		,,,				2504	0.0					ENST00000398319.2	0.860000	0.570000	7.900000e-01	6.300000e-01	0.710000	0.718257	0.710000	0.710000																										0				65						c.(901-903)tcG>tcA		calcineurin binding protein 1		G	,,	1,4405	2.1+/-5.4	0,1,2202	118.0	105.0	110.0		903,753,903	-8.7	0.8	22		110	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CABIN1	NM_001199281.1,NM_001201429.1,NM_012295.3	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	301/2221,251/2171,301/2221	24451432	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23523	24	121412	47				g.chr22:24451432G>A	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.903G>A	chr22.hg19:g.24451432G>A		1					CABIN1_ENST00000263119.5_Silent_p.S301S|CABIN1_ENST00000405822.2_Silent_p.S251S	p.S301S	NM_001199281.1	NP_001186210.1	0	0	0	1.712291	Q9Y6J0	CABIN_HUMAN		9	1288	+			G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	ENST00000398319.2	1	1	hg19	c.903G>A	CCDS13823.1	0																																																																																								0.257862		TCGA-HZ-8636-01A-21D-2396-08	0.572	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.670000	-2.678476	1	0.410000	NM_012295		0	74	73	0	326	320	1		1	1		0	0	64	64	0	1.000000	9.999866e-01	0	16	0	58	0	74	326
HMGXB4	10042	broad.mit.edu	37	22	35689619	35689619	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr22:35689619T>C	ENST00000216106.5	+	11	1909	c.1781T>C	c.(1780-1782)aTt>aCt	p.I594T	HMGXB4_ENST00000444518.2_Missense_Mutation_p.I485T	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	594					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTAGACAACATTGCTTACATC	0.408																																						ENST00000216106.5	1.000000	0.030000	1	5.000000e-02	0.090000	0.297454	0.090000	0.080000																										0				19						c.(1780-1782)aTt>aCt		HMG box domain containing 4							196.0	171.0	179.0					22																	35689619		2203	4300	6503	SO:0001583	missense	10042	0	0					g.chr22:35689619T>C	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1781T>C	chr22.hg19:g.35689619T>C	ENSP00000216106:p.Ile594Thr	1					HMGXB4_ENST00000444518.2_Missense_Mutation_p.I485T	p.I594T	NM_001003681.2	NP_001003681.1	0	2	2	2.197826	Q9UGU5	HMGX4_HUMAN		11	1909	+			O75672|O75673|Q9UMT5	Missense_Mutation	SNP	ENST00000216106.5	0	1	hg19	c.1781T>C	CCDS33641.1	0	.	.	.	.	.	.	.	.	.	.	T	26.6	4.756822	0.89843	.	.	ENSG00000100281	ENST00000444518;ENST00000216106	T;T	0.34072	1.38;1.42	5.98	5.98	0.97165	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	M	0.68593	2.085	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.62651	-0.6809	10	0.87932	D	0	-3.1144	16.4622	0.84064	0.0:0.0:0.0:1.0	.	594	Q9UGU5	HMGX4_HUMAN	T	485;594	ENSP00000398302:I485T;ENSP00000216106:I594T	ENSP00000216106:I594T	I	+	2	0	0	HMGXB4	34019619	34019619	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.008000	0.88588	2.289000	0.77006	0.533000	0.62120	ATT	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.408	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	0	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.670000	-6.768274	1	0.410000	NM_005487		0	7	7	0	423	415	0		1	1		0	0	55	55	0	0.979455	4.239445e-01	0	2	0	78	0	7	423
C1QTNF6	114904	broad.mit.edu	37	22	37578651	37578651	+	Silent	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr22:37578651C>T	ENST00000337843.2	-	3	489	c.414G>A	c.(412-414)ccG>ccA	p.P138P	C1QTNF6_ENST00000255836.6_Intron|C1QTNF6_ENST00000397110.2_Silent_p.P138P|C1QTNF6_ENST00000470655.1_Intron|RP1-151B14.6_ENST00000419128.1_RNA	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	119	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						GCTTCTGGCACGGGGCGCCGG	0.672																																						ENST00000337843.2	0.290000	0.090000	2.400000e-01	1.300000e-01	0.170000	0.188627	0.170000	0.180000																										0				11						c.(412-414)ccG>ccA		C1q and tumor necrosis factor related protein 6							30.0	34.0	33.0					22																	37578651		2203	4300	6503	SO:0001819	synonymous_variant	114904	4	121380	36				g.chr22:37578651C>T	AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.414G>A	chr22.hg19:g.37578651C>T		1					RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000470655.1_Intron|C1QTNF6_ENST00000255836.6_Intron|C1QTNF6_ENST00000397110.2_Silent_p.P138P	p.P138P	NM_031910.3	NP_114116.3	0	0	0	1.727643	Q9BXI9	C1QT6_HUMAN		3	489	-			Q5H9G8|Q6ZRM7	Silent	SNP	ENST00000337843.2	1	1	hg19	c.414G>A	CCDS13943.1	0																																																																																								0.265438		TCGA-HZ-8636-01A-21D-2396-08	0.672	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318807.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	58	1	1.670000	-14.570890	1	0.410000	NM_182486		0	13	13	0	273	269	0		1	1		0	0	59	59	0	0.999524	8.756727e-01	0	5	0	75	0	13	273
TPO	7173	broad.mit.edu	37	2	1426892	1426892	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:1426892C>T	ENST00000345913.4	+	3	261	c.170C>T	c.(169-171)aCg>aTg	p.T57M	TPO_ENST00000346956.3_Missense_Mutation_p.T57M|TPO_ENST00000382198.1_Missense_Mutation_p.T57M|TPO_ENST00000539820.1_Missense_Mutation_p.T57M|TPO_ENST00000337415.3_Missense_Mutation_p.T57M|TPO_ENST00000349624.3_Missense_Mutation_p.T57M|TPO_ENST00000329066.4_Missense_Mutation_p.T57M|TPO_ENST00000382269.3_Missense_Mutation_p.T57M|TPO_ENST00000382201.3_Missense_Mutation_p.T57M|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	57					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ATGTACGCCACGATGCAGAGG	0.592																																						ENST00000345913.4	0.870000	0.460000	7.700000e-01	5.500000e-01	0.650000	0.663737	0.650000	0.650000																										0				95						c.(169-171)aCg>aTg		thyroid peroxidase	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)						77.0	66.0	69.0					2																	1426892		2203	4300	6503	SO:0001583	missense	7173	0	0					g.chr2:1426892C>T		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.170C>T	chr2.hg19:g.1426892C>T	ENSP00000318820:p.Thr57Met	0					TPO_ENST00000382201.3_Missense_Mutation_p.T57M|TPO_ENST00000382269.3_Missense_Mutation_p.T57M|TPO_ENST00000539820.1_Missense_Mutation_p.T57M|TPO_ENST00000382198.1_Missense_Mutation_p.T57M|TPO_ENST00000337415.3_Missense_Mutation_p.T57M|TPO_ENST00000329066.4_Missense_Mutation_p.T57M|TPO_ENST00000349624.3_Missense_Mutation_p.T57M|TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.T57M	p.T57M	NM_000547.5	NP_000538.3	0	1	1	2.005848	P07202	PERT_HUMAN		3	261	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	1	1	hg19	c.170C>T	CCDS1643.1	0	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977929	0.53720	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198	T;T;T;T;T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29;0.29;0.29;0.29;0.29	3.72	3.72	0.42706	3.72	3.72	0.42706	.	0.376195	0.25383	N	0.031063	T	0.71837	0.3387	M	0.78801	2.425	0.09310	N	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;0.997	P;P;D;P;P	0.63703	0.862;0.796;0.917;0.862;0.714	T	0.63391	-0.6648	10	0.87932	D	0	-20.6374	11.2868	0.49226	0.0:1.0:0.0:0.0	.	57;57;57;57;57	P07202-4;P07202-5;E9PFM6;P07202-2;P07202	.;.;.;.;PERT_HUMAN	M	57	ENSP00000371704:T57M;ENSP00000337263:T57M;ENSP00000318820:T57M;ENSP00000263886:T57M;ENSP00000332044:T57M;ENSP00000444840:T57M;ENSP00000329869:T57M;ENSP00000371636:T57M;ENSP00000390994:T57M;ENSP00000371633:T57M	ENSP00000329869:T57M	T	+	2	0	0	TPO	1405899	1405899	0.020000	0.18652	0.004000	0.12327	0.026000	0.11368	1.587000	0.36622	2.347000	0.79759	0.467000	0.42956	ACG	0.365796		TCGA-HZ-8636-01A-21D-2396-08	0.592	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.670000	-20.000000	1	0.410000	NM_000547		0	31	31	0	184	181	1		1			0	0	28	28	0	1.000000	0	0	0	0	0	0	31	184
LRP2	4036	broad.mit.edu	37	2	170070366	170070366	+	Silent	SNP	G	G	A	rs569277988		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:170070366G>A	ENST00000263816.3	-	36	6126	c.5841C>T	c.(5839-5841)aaC>aaT	p.N1947N		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1947					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTCCATCCACGTTTCCTCTTT	0.353																																						ENST00000263816.3	1.000000	0.760000	1	8.600000e-01	0.960000	0.942293	0.960000	1.000000																										0				315						c.(5839-5841)aaC>aaT		low density lipoprotein receptor-related protein 2	"""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"						58.0	57.0	57.0					2																	170070366		2203	4300	6503	SO:0001819	synonymous_variant	4036	2	121402	31				g.chr2:170070366G>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5841C>T	chr2.hg19:g.170070366G>A		0						p.N1947N	NM_004525.2	NP_004516.2	0	0	0	2.029558	P98164	LRP2_HUMAN		36	6126	-			O00711|Q16215	Silent	SNP	ENST00000263816.3	1	1	hg19	c.5841C>T	CCDS2232.1	1																																																																																								0.376783		TCGA-HZ-8636-01A-21D-2396-08	0.353	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	1	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	1.670000	-20.000000	1	0.410000	NM_004525		0	61	60	0	229	226	0		1	0		0	0	44	44	0	1.000000	0	0	0	0	1	0	61	229
ZNF804A	91752	broad.mit.edu	37	2	185802911	185802911	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:185802911G>C	ENST00000302277.6	+	4	3382	c.2788G>C	c.(2788-2790)Gac>Cac	p.D930H		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	930							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGAAGCAATTGACAATACCCT	0.378																																						ENST00000302277.6	0.480000	0.250000	4.200000e-01	3.000000e-01	0.360000	0.369321	0.360000	0.360000																										0				146						c.(2788-2790)Gac>Cac		zinc finger protein 804A							90.0	87.0	88.0					2																	185802911		2203	4300	6503	SO:0001583	missense	91752	0	0					g.chr2:185802911G>C	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2788G>C	chr2.hg19:g.185802911G>C	ENSP00000303252:p.Asp930His	0						p.D930H	NM_194250.1	NP_919226.1	0	0	0	2.029558	Q7Z570	Z804A_HUMAN		4	3382	+			A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	1	1	hg19	c.2788G>C	CCDS2291.1	0	.	.	.	.	.	.	.	.	.	.	G	3.883	-0.025550	0.07589	.	.	ENSG00000170396	ENST00000302277	T	0.06142	3.34	5.57	0.657	0.17850	5.57	0.657	0.17850	.	1.003210	0.08031	N	0.993607	T	0.06188	0.0160	L	0.36672	1.1	0.09310	N	1	P	0.34780	0.468	B	0.35971	0.215	T	0.40850	-0.9541	10	0.62326	D	0.03	-0.8515	5.0665	0.14585	0.3841:0.2901:0.3258:0.0	.	930	Q7Z570	Z804A_HUMAN	H	930	ENSP00000303252:D930H	ENSP00000303252:D930H	D	+	1	0	0	ZNF804A	185511156	185511156	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	0.072000	0.14617	0.039000	0.15632	0.591000	0.81541	GAC	0.376783		TCGA-HZ-8636-01A-21D-2396-08	0.378	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.670000	-20.000000	1	0.410000	NM_194250		0	38	38	0	446	440	0		1	0		0	0	74	74	0	1.000000	1.866584e-02	0	0	0	3	0	38	446
SDPR	8436	broad.mit.edu	37	2	192711597	192711597	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:192711597G>A	ENST00000304141.4	-	1	384	c.55C>T	c.(55-57)Cgg>Tgg	p.R19W	AC098617.1_ENST00000424116.2_RNA	NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			TTTTCCTGCCGCATGTCAGAC	0.607																																						ENST00000304141.4	0.160000	0.030000	1.200000e-01	5.000000e-02	0.080000	0.091752	0.080000	0.080000																										0				23						c.(55-57)Cgg>Tgg		serum deprivation response							64.0	64.0	64.0					2																	192711597		2203	4300	6503	SO:0001583	missense	8436	0	0					g.chr2:192711597G>A	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.55C>T	chr2.hg19:g.192711597G>A	ENSP00000305675:p.Arg19Trp	0					AC098617.1_ENST00000424116.2_RNA	p.R19W	NM_004657.5	NP_004648.1	0	0	0	2.029558			OV - Ovarian serous cystadenocarcinoma(117;0.0647)	1	384	-				Missense_Mutation	SNP	ENST00000304141.4	0	1	hg19	c.55C>T	CCDS2313.1	0	.	.	.	.	.	.	.	.	.	.	G	3.773	-0.047252	0.07407	.	.	ENSG00000168497	ENST00000304141	T	0.64618	-0.11	4.84	1.97	0.26223	4.84	1.97	0.26223	.	1.325690	0.04910	N	0.453002	T	0.42426	0.1202	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.30621	-0.9972	10	0.44086	T	0.13	-0.3117	6.636	0.22883	0.0846:0.0:0.5985:0.317	.	19	O95810	SDPR_HUMAN	W	19	ENSP00000305675:R19W	ENSP00000305675:R19W	R	-	1	2	2	SDPR	192419842	192419842	0.008000	0.16893	0.127000	0.21898	0.208000	0.24298	1.612000	0.36889	0.304000	0.22809	0.555000	0.69702	CGG	0.376783		TCGA-HZ-8636-01A-21D-2396-08	0.607	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	0	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.670000	-2.979026	1	0.410000	NM_004657		0	7	7	0	392	385	0		1	0		0	0	53	53	0	0.979563	3.511390e-01	0	0	0	63	0	7	392
KIF3C	3797	broad.mit.edu	37	2	26204102	26204102	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:26204102G>A	ENST00000264712.3	-	1	1264	c.685C>T	c.(685-687)Cgt>Tgt	p.R229C	KIF3C_ENST00000405914.1_Missense_Mutation_p.R229C	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	229	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGAGCCACGTTCGCTGCAC	0.627																																						ENST00000264712.3	0.380000	0.170000	3.200000e-01	2.100000e-01	0.260000	0.272456	0.260000	0.260000																										0				29						c.(685-687)Cgt>Tgt		kinesin family member 3C							59.0	58.0	59.0					2																	26204102		2203	4300	6503	SO:0001583	missense	3797	0	0					g.chr2:26204102G>A		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.685C>T	chr2.hg19:g.26204102G>A	ENSP00000264712:p.Arg229Cys	0					KIF3C_ENST00000405914.1_Missense_Mutation_p.R229C	p.R229C	NM_002254.6	NP_002245	0	1	1	2.005848	O14782	KIF3C_HUMAN		1	1264	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	1	1	hg19	c.685C>T	CCDS1719.1	0	.	.	.	.	.	.	.	.	.	.	G	9.272	1.045812	0.19748	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.75821	-0.97;-0.97	5.67	2.82	0.32997	5.67	2.82	0.32997	Kinesin, motor domain (4);	0.419809	0.26915	N	0.021842	T	0.62865	0.2463	M	0.69463	2.115	0.25228	N	0.98986	D;P	0.54964	0.969;0.919	B;B	0.35899	0.213;0.213	T	0.61792	-0.6990	10	0.56958	D	0.05	.	5.0533	0.14520	0.1584:0.0:0.5619:0.2797	.	229;229	B7ZM25;O14782	.;KIF3C_HUMAN	C	229;35;229	ENSP00000264712:R229C;ENSP00000385030:R229C	ENSP00000264712:R229C	R	-	1	0	0	KIF3C	26057606	26057606	0.032000	0.19561	0.708000	0.30435	0.901000	0.52897	0.305000	0.19254	0.761000	0.33130	0.655000	0.94253	CGT	0.365796		TCGA-HZ-8636-01A-21D-2396-08	0.627	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.670000	-20.000000	1	0.410000			0	23	23	0	373	367	0		1	1		0	0	52	52	0	0.999999	4.452233e-01	0	3	0	22	0	23	373
DPYSL5	56896	broad.mit.edu	37	2	27156166	27156166	+	Missense_Mutation	SNP	C	C	T	rs372829541		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:27156166C>T	ENST00000288699.6	+	7	913	c.755C>T	c.(754-756)tCg>tTg	p.S252L	DPYSL5_ENST00000401478.1_Missense_Mutation_p.S252L	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	252					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.S252L(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAGTATCTCGGCTGGTGAC	0.517																																						ENST00000288699.6	0.840000	0.500000	7.600000e-01	5.800000e-01	0.660000	0.675241	0.660000	0.670000																										1	Substitution - Missense(1)	p.S252L(1)	lung(1)	27						c.(754-756)tCg>tTg		dihydropyrimidinase-like 5		C	LEU/SER	0,4406		0,0,2203	246.0	178.0	201.0		755	6.0	1.0	2		201	1,8599	1.2+/-3.3	0,1,4299	no	missense	DPYSL5	NM_020134.3	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	252/565	27156166	1,13005	2203	4300	6503	SO:0001583	missense	56896	8	121412	41				g.chr2:27156166C>T	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.755C>T	chr2.hg19:g.27156166C>T	ENSP00000288699:p.Ser252Leu	0					DPYSL5_ENST00000401478.1_Missense_Mutation_p.S252L	p.S252L	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	0	1	1	2.005848	Q9BPU6	DPYL5_HUMAN		7	913	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	1	1	hg19	c.755C>T	CCDS1730.1	0	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303258	0.81136	0.0	1.16E-4	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.90385	-2.66;-2.66	6.04	6.04	0.98038	6.04	6.04	0.98038	Amidohydrolase 1 (1);	0.110781	0.64402	D	0.000007	D	0.87212	0.6121	L	0.48174	1.505	0.46478	D	0.999068	P	0.40360	0.714	B	0.31390	0.129	D	0.87568	0.2476	10	0.54805	T	0.06	-9.1882	19.3507	0.94384	0.0:1.0:0.0:0.0	.	252	Q9BPU6	DPYL5_HUMAN	L	252	ENSP00000288699:S252L;ENSP00000385549:S252L	ENSP00000288699:S252L	S	+	2	0	0	DPYSL5	27009670	27009670	0.999000	0.42202	0.998000	0.56505	0.991000	0.79684	4.261000	0.58841	2.873000	0.98535	0.561000	0.74099	TCG	0.365796		TCGA-HZ-8636-01A-21D-2396-08	0.517	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.670000	-2.668736	1	0.410000	NM_020134		0	50	50	0	289	287	1		1			0	0	52	52	0	1.000000	0	0	0	0	0	0	50	289
OBSL1	23363	broad.mit.edu	37	2	220428119	220428119	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr2:220428119C>T	ENST00000404537.1	-	7	2694	c.2638G>A	c.(2638-2640)Gtc>Atc	p.V880I	OBSL1_ENST00000603926.1_Missense_Mutation_p.V880I|OBSL1_ENST00000289656.3_Missense_Mutation_p.V467I|OBSL1_ENST00000373873.4_Missense_Mutation_p.V880I|OBSL1_ENST00000265318.4_Missense_Mutation_p.V880I|OBSL1_ENST00000373876.1_Missense_Mutation_p.V880I	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	880	Ig-like 6.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		TCTCCAGCGACGCACTGAAAC	0.662																																						ENST00000404537.1	0.510000	0.170000	4.200000e-01	2.400000e-01	0.320000	0.335991	0.320000	0.320000																										0										c.(2638-2640)Gtc>Atc		obscurin-like 1							34.0	40.0	38.0					2																	220428119		2077	4196	6273	SO:0001583	missense	23363	5	120994	34				g.chr2:220428119C>T	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2638G>A	chr2.hg19:g.220428119C>T	ENSP00000385636:p.Val880Ile	0					OBSL1_ENST00000265318.4_Missense_Mutation_p.V880I|OBSL1_ENST00000603926.1_Missense_Mutation_p.V880I|OBSL1_ENST00000373876.1_Missense_Mutation_p.V880I|OBSL1_ENST00000289656.3_Missense_Mutation_p.V467I|OBSL1_ENST00000373873.4_Missense_Mutation_p.V880I	p.V880I	NM_015311.2	NP_056126.1	0	0	0	2.029558	O75147	OBSL1_HUMAN		7	2694	-		Renal(207;0.0376)	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	1	1	hg19	c.2638G>A	CCDS46520.1	0	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186517	0.38609	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	4.69	3.72	0.42706	4.69	3.72	0.42706	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76593	0.4009	L	0.58810	1.83	0.09310	N	1	D;D;D;D	0.76494	0.998;0.999;0.989;0.991	D;D;P;P	0.68943	0.934;0.961;0.475;0.688	T	0.64871	-0.6305	9	0.34782	T	0.22	.	13.3942	0.60840	0.0:0.9118:0.0:0.0881	.	881;880;467;880	A4KVA4;O75147;A8MSZ8;O75147-2	.;OBSL1_HUMAN;.;.	I	880;880;880;880;467	ENSP00000265318:V880I;ENSP00000385636:V880I;ENSP00000362983:V880I;ENSP00000362980:V880I;ENSP00000289656:V467I	ENSP00000265318:V880I	V	-	1	0	0	OBSL1	220136363	220136363	0.002000	0.14202	0.472000	0.27241	0.415000	0.31203	1.292000	0.33342	2.433000	0.82419	0.561000	0.74099	GTC	0.376783		TCGA-HZ-8636-01A-21D-2396-08	0.662	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.670000	-16.539090	1	0.410000			0	12	12	0	163	156	0		1	1		0	0	31	31	0	0.999001	9.996797e-01	0	5	0	196	0	12	163
WNT7A	7476	broad.mit.edu	37	3	13860779	13860779	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr3:13860779C>T	ENST00000285018.4	-	4	1016	c.712G>A	c.(712-714)Gtg>Atg	p.V238M		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	238					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						ACAGGCTCCACGTGAACGGCC	0.602																																						ENST00000285018.4	0.510000	0.280000	4.500000e-01	3.300000e-01	0.380000	0.398102	0.380000	0.390000																										0				24						c.(712-714)Gtg>Atg		wingless-type MMTV integration site family, member 7A							111.0	105.0	107.0					3																	13860779		2203	4300	6503	SO:0001583	missense	7476	0	0					g.chr3:13860779C>T	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.712G>A	chr3.hg19:g.13860779C>T	ENSP00000285018:p.Val238Met	1						p.V238M	NM_004625.3	NP_004616.2	0	0	0	1.889187	O00755	WNT7A_HUMAN		4	1016	-			Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	1	1	hg19	c.712G>A	CCDS2616.1	0	.	.	.	.	.	.	.	.	.	.	c	22.2	4.255353	0.80135	.	.	ENSG00000154764	ENST00000285018	T	0.80994	-1.44	4.18	4.18	0.49190	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.88775	0.6528	M	0.80847	2.515	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	D	0.88867	0.3330	10	0.37606	T	0.19	.	16.889	0.86082	0.0:1.0:0.0:0.0	.	238	O00755	WNT7A_HUMAN	M	238	ENSP00000285018:V238M	ENSP00000285018:V238M	V	-	1	0	0	WNT7A	13835780	13835780	1.000000	0.71417	0.986000	0.45419	0.963000	0.63663	7.812000	0.86109	2.048000	0.60808	0.558000	0.71614	GTG	0.330382		TCGA-HZ-8636-01A-21D-2396-08	0.602	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	1	0	1	2	2	2	2	0	0	0	0	57	57	57	54	1	1.670000	-20.000000	1	0.410000	NM_004625		0	43	42	0	428	420	0		1	1		0	0	57	57	0	1.000000	9.920235e-01	0	5	0	71	0	43	428
SCN5A	6331	broad.mit.edu	37	3	38593036	38593036	+	Silent	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr3:38593036C>T	ENST00000333535.4	-	28	4976	c.4827G>A	c.(4825-4827)tcG>tcA	p.S1609S	SCN5A_ENST00000425664.1_Silent_p.S1591S|SCN5A_ENST00000450102.2_Silent_p.S1555S|SCN5A_ENST00000449557.2_Silent_p.S1555S|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Silent_p.S1555S|SCN5A_ENST00000413689.1_Silent_p.S1609S|SCN5A_ENST00000423572.2_Silent_p.S1608S|SCN5A_ENST00000414099.2_Silent_p.S1591S|SCN5A_ENST00000455624.2_Silent_p.S1576S|SCN5A_ENST00000443581.1_Silent_p.S1608S			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1609			S -> W (in LQT3). {ECO:0000269|PubMed:16922724}.		AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GGATGATGTCCGAGAGCACAG	0.612																																						ENST00000333535.4	0.840000	0.540000	7.700000e-01	6.100000e-01	0.680000	0.696092	0.680000	0.690000																										0				107						c.(4825-4827)tcG>tcA		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						59.0	63.0	62.0					3																	38593036		2203	4300	6503	SO:0001819	synonymous_variant	6331	0	0					g.chr3:38593036C>T	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4827G>A	chr3.hg19:g.38593036C>T		1					SCN5A_ENST00000450102.2_Silent_p.S1555S|SCN5A_ENST00000451551.2_Silent_p.S1555S|SCN5A_ENST00000413689.1_Silent_p.S1609S|SCN5A_ENST00000423572.2_Silent_p.S1608S|SCN5A_ENST00000455624.2_Silent_p.S1576S|SCN5A_ENST00000443581.1_Silent_p.S1608S|SCN5A_ENST00000425664.1_Silent_p.S1591S|SCN5A_ENST00000449557.2_Silent_p.S1555S|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000414099.2_Silent_p.S1591S	p.S1609S			0	0	0	1.889187	Q14524	SCN5A_HUMAN		28	4976	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	1	1	hg19	c.4827G>A	CCDS46796.1	0																																																																																								0.330382		TCGA-HZ-8636-01A-21D-2396-08	0.612	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	1.670000	-2.277746	0	0.410000	NM_198056		0	68	66	0	354	344	1		1			0	0	72	72	0	1.000000	0	0	0	0	0	0	68	354
ATR	545	broad.mit.edu	37	3	142281392	142281392	+	Silent	SNP	A	A	G			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr3:142281392A>G	ENST00000350721.4	-	4	973	c.852T>C	c.(850-852)gaT>gaC	p.D284D	ATR_ENST00000383101.3_Silent_p.D284D	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	284					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATTGGTCAGTATCCATTTCTA	0.348								Other conserved DNA damage response genes																														ENST00000350721.4	1.000000	0.300000	1	3.400000e-01	0.400000	0.515835	0.400000	0.390000																										0				122						c.(850-852)gaT>gaC	Other conserved DNA damage response genes	ATR serine/threonine kinase							83.0	89.0	87.0					3																	142281392		2202	4300	6502	SO:0001819	synonymous_variant	545	0	0					g.chr3:142281392A>G	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.852T>C	chr3.hg19:g.142281392A>G		1					ATR_ENST00000383101.3_Silent_p.D284D	p.D284D	NM_001184.3	NP_001175.2	1	2	3	2.293405	Q13535	ATR_HUMAN		4	973	-			Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	1	1	hg19	c.852T>C	CCDS3124.1	0																																																																																								0.443107		TCGA-HZ-8636-01A-21D-2396-08	0.348	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	1	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	1.670000	-20.000000	1	0.410000	NM_001184		0	56	55	0	684	679	0		1	1		0	0	82	82	0	1.000000	4.330305e-01	0	2	0	17	0	56	684
PALLD	23022	broad.mit.edu	37	4	169837051	169837051	+	Missense_Mutation	SNP	G	G	A	rs114171764		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr4:169837051G>A	ENST00000505667.1	+	17	2896	c.2723G>A	c.(2722-2724)cGt>cAt	p.R908H	PALLD_ENST00000507735.1_Missense_Mutation_p.R404H|PALLD_ENST00000512127.1_Missense_Mutation_p.R509H|PALLD_ENST00000261509.6_Missense_Mutation_p.R891H|PALLD_ENST00000335742.7_Missense_Mutation_p.R733H|CBR4_ENST00000509108.1_Intron			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	1115					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TCAAGGCCTCGTTCTAGATCA	0.393									Pancreatic Cancer, Familial Clustering of				G|||	1	0.000199681	0.0	0.0	5008	,	,		16396	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(109;1482 1532 18347 40239 51172)	ENST00000505667.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				48						c.(2722-2724)cGt>cAt		palladin, cytoskeletal associated protein							90.0	90.0	90.0					4																	169837051		2203	4300	6503	SO:0001583	missense	23022	25	121410	44	Pancreatic Cancer, Familial Clustering of	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	g.chr4:169837051G>A	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2723G>A	chr4.hg19:g.169837051G>A	ENSP00000425556:p.Arg908His	1					PALLD_ENST00000261509.6_Missense_Mutation_p.R891H|PALLD_ENST00000507735.1_Missense_Mutation_p.R404H|CBR4_ENST00000509108.1_Intron|PALLD_ENST00000512127.1_Missense_Mutation_p.R509H|PALLD_ENST00000335742.7_Missense_Mutation_p.R733H	p.R908H			0	2	2	2.155429	Q8WX93	PALLD_HUMAN		17	2896	+		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	1	1	hg19	c.2723G>A	CCDS54818.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	25.7	4.660793	0.88154	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000507735	T;T;T;T;T	0.66638	-0.19;-0.22;0.12;-0.12;0.16	5.68	5.68	0.88126	5.68	5.68	0.88126	.	0.000000	0.31859	U	0.006948	T	0.81138	0.4760	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71656	0.974;0.959;0.959;0.974	T	0.80525	-0.1344	10	0.51188	T	0.08	.	19.7942	0.96472	0.0:0.0:1.0:0.0	.	908;1115;509;891	B7ZMM5;Q8WX93;B3KTG2;B2RTX2	.;PALLD_HUMAN;.;.	H	891;733;908;509;404	ENSP00000261509:R891H;ENSP00000336735:R733H;ENSP00000425556:R908H;ENSP00000426947:R509H;ENSP00000424016:R404H	ENSP00000261509:R891H	R	+	2	0	0	PALLD	170073626	170073626	1.000000	0.71417	0.995000	0.50966	0.933000	0.57130	9.869000	0.99810	2.684000	0.91462	0.313000	0.20887	CGT	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.393	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.670000	-20.000000	1	0.410000	NM_016081		0	110	108	0	249	245	1		1	1		0	0	53	53	0	1.000000	1	0	67	0	664	0	110	249
TSSK1B	83942	broad.mit.edu	37	5	112770240	112770240	+	Silent	SNP	G	G	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr5:112770240G>A	ENST00000390666.3	-	1	488	c.297C>T	c.(295-297)ctC>ctT	p.L99L	CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000510381.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	99	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		TGATTAACTCGAGGAGGTCGC	0.537																																						ENST00000390666.3	0.310000	0.090000	2.500000e-01	1.300000e-01	0.180000	0.196161	0.180000	0.180000																										0				13						c.(295-297)ctC>ctT		testis-specific serine kinase 1B							61.0	66.0	64.0					5																	112770240		2190	4296	6486	SO:0001819	synonymous_variant	83942	0	0					g.chr5:112770240G>A	AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.297C>T	chr5.hg19:g.112770240G>A		0					MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000416046.2_RNA	p.L99L	NM_032028.3	NP_114417.1	0	0	0	1.958709	Q9BXA7	TSSK1_HUMAN		1	488	-		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)	B2R8D9	Silent	SNP	ENST00000390666.3	1	1	hg19	c.297C>T	CCDS4112.1	0																																																																																								0.351506		TCGA-HZ-8636-01A-21D-2396-08	0.537	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250774.2	0	0	1	2	2	2	2	0	0	0	0	47	47	47	47	1	1.670000	-11.596390	1	0.410000	NM_032028		0	10	10	0	235	231	0		1			0	0	47	47	0	0.996795	0	0	0	0	0	0	10	235
FBXL7	23194	broad.mit.edu	37	5	15937245	15937245	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr5:15937245C>T	ENST00000504595.1	+	4	1907	c.1426C>T	c.(1426-1428)Cgc>Tgc	p.R476C	MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000510662.1_Missense_Mutation_p.R429C|FBXL7_ENST00000329673.7_Missense_Mutation_p.R464C	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	476					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R476C(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CTTTGTCAAACGCCACTGCAA	0.577																																						ENST00000504595.1	0.370000	0.070000	2.800000e-01	1.200000e-01	0.180000	0.205078	0.180000	0.170000																										1	Substitution - Missense(1)	p.R476C(1)	lung(1)	60						c.(1426-1428)Cgc>Tgc		F-box and leucine-rich repeat protein 7							21.0	24.0	23.0					5																	15937245		2120	4246	6366	SO:0001583	missense	23194	0	0					g.chr5:15937245C>T	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1426C>T	chr5.hg19:g.15937245C>T	ENSP00000423630:p.Arg476Cys	0					FBXL7_ENST00000329673.7_Missense_Mutation_p.R464C|MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000510662.1_Missense_Mutation_p.R429C	p.R476C	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	0	1	1	1.994765	Q9UJT9	FBXL7_HUMAN		4	1907	+			B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	0	1	hg19	c.1426C>T	CCDS54833.1	0	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928841	0.92389	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.54866	0.55;0.55;0.55	5.36	5.36	0.76844	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.65801	0.2726	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	P	0.56216	0.794	T	0.69250	-0.5194	10	0.87932	D	0	.	19.0895	0.93221	0.0:1.0:0.0:0.0	.	476	Q9UJT9	FBXL7_HUMAN	C	476;429;464	ENSP00000423630:R476C;ENSP00000425184:R429C;ENSP00000329632:R464C	ENSP00000329632:R464C	R	+	1	0	0	FBXL7	15990245	15990245	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.731000	0.84895	2.521000	0.84997	0.650000	0.86243	CGC	0.365796		TCGA-HZ-8636-01A-21D-2396-08	0.577	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	0	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.670000	-9.976643	1	0.410000	NM_012304		0	5	5	0	124	123	0		1	0		0	0	18	18	0	0.937520	3.453894e-01	0	0	0	27	0	5	124
BTF3	689	broad.mit.edu	37	5	72798334	72798335	+	Missense_Mutation	DNP	AA	AA	GT			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			A	G|T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr5:72798334_72798335AA>GT	ENST00000335895.8	+	3	242_243	c.91_92AA>GT	c.(91-93)AAg>GTg	p.K31V	BTF3_ENST00000514505.2_3'UTR|BTF3_ENST00000380591.3_Missense_Mutation_p.K75V	NM_001207.4	NP_001198.2	O00478	BT3A3_HUMAN	basic transcription factor 3	0	Ig-like V-type 1.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(2)	5		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		CAGAAAGAAGAAGGTGGTTCAT	0.386																																						ENST00000335895.8	0.970000|0.980000	0.520000|0.530000	8.600000e-01|8.700000e-01	6.200000e-01|6.300000e-01	0.730000|0.740000	0.742879|0.754032	0.730000|0.740000	0.730000|0.750000																										0				5						c.(91-93)Aag>Gag|c.(91-93)aAg>aTg		basic transcription factor 3																																				SO:0001583	missense	689	0	0					g.chr5:72798334A>G|g.chr5:72798335A>T	M90352	CCDS4019.1, CCDS34185.1	5q13.3	2010-06-17			ENSG00000145741	ENSG00000145741			1125	protein-coding gene	gene with protein product		602542	"""nascent-polypeptide-associated complex beta polypeptide"""	NACB		2320128, 1386332, 15716105	Standard	NM_001207		Approved	BTF3a, BTF3b	uc003kcr.1	P20290	OTTHUMG00000102031	Exception_encountered	chr5.hg19:g.72798334_72798335delinsGT	ENSP00000338516:p.Lys31Val	0					BTF3_ENST00000380591.3_Missense_Mutation_p.K75E|BTF3_ENST00000514505.2_3'UTR|BTF3_ENST00000380591.3_Missense_Mutation_p.K75M|BTF3_ENST00000514505.2_3'UTR	p.K31E|p.K31M	NM_001207.4	NP_001198.2	0	0	0	1.958709	O00478	BT3A3_HUMAN		3	242|243	+		Lung NSC(167;0.00405)|Ovarian(174;0.0175)	B4DWI7|E9PCP5	Missense_Mutation	SNP	ENST00000335895.8	1	1	hg19	c.91A>G|c.92A>T	CCDS4019.1	0																									5.55	5.55	0.83447																																												0			72834090|72834091														0.351506		TCGA-HZ-8636-01A-21D-2396-08	0.386	BTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219815.2	1	0	1|0	2	2	2	2	0	0	0	0	36	36	36	36	1	1.670000	-18.024930|-18.228150	1	0.410000	NM_001207		0	32	28	0	161|158	168|164	1		1	1		0	0	36	36	0	1.000000	1	0	707|701	0	1848	0	32	158
POU5F2	134187	broad.mit.edu	37	5	93077092	93077092	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr5:93077092C>T	ENST00000510627.4	-	1	251	c.178G>A	c.(178-180)Gtg>Atg	p.V60M	FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000509163.1_Intron|POU5F2_ENST00000606183.1_5'Flank|FAM172A_ENST00000509739.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000505869.1_Intron	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	60					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		ATCCTCCACACGTCAGGGCCT	0.672																																						ENST00000510627.4	0.510000	0.150000	4.100000e-01	2.200000e-01	0.300000	0.323557	0.300000	0.300000																										0										c.(178-180)Gtg>Atg		POU domain class 5, transcription factor 2							17.0	20.0	19.0					5																	93077092		1926	4128	6054	SO:0001583	missense	134187	0	0					g.chr5:93077092C>T		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.178G>A	chr5.hg19:g.93077092C>T	ENSP00000464890:p.Val60Met	0					FAM172A_ENST00000505869.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000509739.1_Intron|POU5F2_ENST00000606183.1_5'Flank|FAM172A_ENST00000509163.1_Intron	p.V60M	NM_153216.1	NP_694948.1	0	0	0	1.958709	Q8N7G0	PO5F2_HUMAN		1	251	-		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)	Q15169|Q6MZL7|Q8N748	Missense_Mutation	SNP	ENST00000510627.4	0	1	hg19	c.178G>A	CCDS59489.1	0																																																																																								0.351506		TCGA-HZ-8636-01A-21D-2396-08	0.672	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	1	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	1.670000	-14.615780	1	0.410000	NM_153216		0	10	10	0	137	137	0		1			0	0	15	15	0	0.997200	0	0	0	0	0	0	10	137
SLC36A3	285641	broad.mit.edu	37	5	150660632	150660632	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr5:150660632C>G	ENST00000335230.3	-	9	1498	c.1087G>C	c.(1087-1089)Gag>Cag	p.E363Q	SLC36A3_ENST00000377713.3_Missense_Mutation_p.E404Q	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	363						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCCAGCTCTCTGACACTTGG	0.507																																						ENST00000335230.3	0.570000	0.290000	5.000000e-01	3.500000e-01	0.420000	0.430537	0.420000	0.420000																										0				21						c.(1087-1089)Gag>Cag		solute carrier family 36, member 3							178.0	145.0	156.0					5																	150660632		2203	4300	6503	SO:0001583	missense	285641	0	0					g.chr5:150660632C>G	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1087G>C	chr5.hg19:g.150660632C>G	ENSP00000334750:p.Glu363Gln	0					SLC36A3_ENST00000377713.3_Missense_Mutation_p.E404Q	p.E363Q	NM_181774.3	NP_861439.3	0	0	0	1.958709	Q495N2	S36A3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	9	1498	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	1	1	hg19	c.1087G>C	CCDS4314.1	0	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070848	0.36566	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02197	4.4;4.4	4.06	4.06	0.47325	4.06	4.06	0.47325	.	0.363547	0.29752	N	0.011295	T	0.04003	0.0112	L	0.57130	1.785	0.38876	D	0.956801	B;B;B	0.33777	0.041;0.425;0.109	B;B;B	0.36378	0.07;0.223;0.061	T	0.54016	-0.8356	10	0.15952	T	0.53	.	16.7998	0.85611	0.0:1.0:0.0:0.0	.	404;363;348	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	Q	363;404	ENSP00000334750:E363Q;ENSP00000366942:E404Q	ENSP00000334750:E363Q	E	-	1	0	0	SLC36A3	150640825	150640825	0.985000	0.35326	0.994000	0.49952	0.828000	0.46876	3.426000	0.52778	2.249000	0.74217	0.561000	0.74099	GAG	0.351506		TCGA-HZ-8636-01A-21D-2396-08	0.507	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.670000	-20.000000	1	0.410000	NM_181774		0	31	29	0	295	290	0		1			0	0	62	62	0	1.000000	0	0	0	0	0	0	31	295
ECI2	10455	broad.mit.edu	37	6	4119468	4119468	+	Silent	SNP	C	C	T	rs114924821		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr6:4119468C>T	ENST00000380118.3	-	8	873	c.837G>A	c.(835-837)ccG>ccA	p.P279P	ECI2_ENST00000380125.2_Silent_p.P249P|ECI2_ENST00000465828.1_Silent_p.P249P|C6orf201_ENST00000380175.4_Intron|C6orf201_ENST00000430835.2_Intron|ECI2_ENST00000361538.2_Silent_p.P249P|ECI2_ENST00000413766.2_Silent_p.P112P|C6orf201_ENST00000333388.5_Intron			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	279	ECH-like.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						AGCATCCTTCCGGACTTTGGC	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		19607	0.0		0.001	False		,,,				2504	0.0					ENST00000380118.3	0.610000	0.300000	5.300000e-01	3.600000e-01	0.440000	0.455766	0.440000	0.440000																										0				11						c.(835-837)ccG>ccA		enoyl-CoA delta isomerase 2		C	,,,	0,4406		0,0,2203	86.0	88.0	87.0		,747,747,837	-10.6	0.2	6	dbSNP_133	87	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous,coding-synonymous,coding-synonymous	ECI2,C6orf201	NM_001085401.1,NM_001166010.1,NM_006117.2,NM_206836.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	,249/365,249/365,279/395	4119468	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10455	11	121412	43				g.chr6:4119468C>T	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.837G>A	chr6.hg19:g.4119468C>T		1					ECI2_ENST00000413766.2_Silent_p.P112P|ECI2_ENST00000380125.2_Silent_p.P249P|ECI2_ENST00000465828.1_Silent_p.P249P|C6orf201_ENST00000430835.2_Intron|ECI2_ENST00000361538.2_Silent_p.P249P|C6orf201_ENST00000380175.4_Intron|C6orf201_ENST00000333388.5_Intron	p.P279P			0	0	0	1.891332	O75521	ECI2_HUMAN		8	873	-			Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Silent	SNP	ENST00000380118.3	1	1	hg19	c.837G>A	CCDS43420.2	0																																																																																								0.330382		TCGA-HZ-8636-01A-21D-2396-08	0.363	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.670000	-2.429501	0	0.410000	NM_006117		0	27	26	0	233	228	1		1	1		0	0	53	53	0	1.000000	9.998485e-01	0	6	0	114	0	27	233
FKBP5	2289	broad.mit.edu	37	6	35604901	35604901	+	Missense_Mutation	SNP	G	G	A	rs201013987		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr6:35604901G>A	ENST00000539068.1	-	3	342	c.140C>T	c.(139-141)cCg>cTg	p.P47L	FKBP5_ENST00000357266.4_Missense_Mutation_p.P47L|FKBP5_ENST00000540787.1_Intron|FKBP5_ENST00000536438.1_Missense_Mutation_p.P47L|FKBP5_ENST00000542713.1_Missense_Mutation_p.P47L	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	47	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						TCCAATCATCGGCGTTTCCTC	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		17360	0.001		0.0	False		,,,				2504	0.0					ENST00000539068.1	1.000000	0.100000	1	1.400000e-01	0.200000	0.382540	0.200000	0.190000																										0				17						c.(139-141)cCg>cTg		FK506 binding protein 5		G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	105.0	97.0	99.0		140,140,140,140	5.4	1.0	6		99	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense	FKBP5	NM_001145775.1,NM_001145776.1,NM_001145777.1,NM_004117.3	98,98,98,98	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging	47/458,47/458,47/269,47/458	35604901	2,13004	2203	4300	6503	SO:0001583	missense	2289	8	121410	42				g.chr6:35604901G>A	U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.140C>T	chr6.hg19:g.35604901G>A	ENSP00000441205:p.Pro47Leu	1					FKBP5_ENST00000542713.1_Missense_Mutation_p.P47L|FKBP5_ENST00000540787.1_Intron|FKBP5_ENST00000357266.4_Missense_Mutation_p.P47L|FKBP5_ENST00000536438.1_Missense_Mutation_p.P47L	p.P47L	NM_001145776.1	NP_001139248.1	0	3	3	2.354674	Q13451	FKBP5_HUMAN		3	342	-			F5H7R1|Q59EB8|Q5TGM6	Missense_Mutation	SNP	ENST00000539068.1	1	1	hg19	c.140C>T	CCDS4808.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	28.0	4.879464	0.91740	0.0	2.33E-4	ENSG00000096060	ENST00000536438;ENST00000357266;ENST00000539068;ENST00000337746;ENST00000543400;ENST00000542713;ENST00000373875	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.38	5.38	0.77491	5.38	5.38	0.77491	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.000000	0.85682	D	0.000000	D	0.82563	0.5064	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.991;1.0	D	0.88558	0.3121	10	0.87932	D	0	-13.9393	16.0837	0.81023	0.0:0.0:1.0:0.0	.	47;47	F5H7R1;Q13451	.;FKBP5_HUMAN	L	47;47;47;47;10;47;45	ENSP00000444810:P47L;ENSP00000349811:P47L;ENSP00000441205:P47L;ENSP00000442340:P47L	ENSP00000338160:P47L	P	-	2	0	0	FKBP5	35712879	35712879	1.000000	0.71417	0.989000	0.46669	0.953000	0.61014	8.309000	0.89969	2.515000	0.84797	0.655000	0.94253	CCG	0.453678		TCGA-HZ-8636-01A-21D-2396-08	0.338	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040309.2	0	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.670000	-2.747154	1	0.410000			0	12	12	0	331	329	0		1	0		0	0	39	39	0	0.999125	8.618237e-01	0	0	0	100	0	12	331
NUPL2	11097	broad.mit.edu	37	7	23221735	23221735	+	Missense_Mutation	SNP	C	C	G	rs370296256		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr7:23221735C>G	ENST00000258742.5	+	1	290	c.31C>G	c.(31-33)Cgg>Ggg	p.R11G	NUPL2_ENST00000487595.1_3'UTR|NUPL2_ENST00000410002.3_Missense_Mutation_p.R11G|AC005082.1_ENST00000366347.4_Intron	NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	11					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCTTCAAGGCCGGTGCCGCTT	0.612																																						ENST00000258742.5	1.000000	0.990000	1	9.900000e-01	0.990000	0.998939	0.990000	1.000000																										0				19						c.(31-33)Cgg>Ggg		nucleoporin like 2							83.0	68.0	73.0					7																	23221735		2203	4300	6503	SO:0001583	missense	11097	0	0					g.chr7:23221735C>G	U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	ENST00000258742.5:c.31C>G	chr7.hg19:g.23221735C>G	ENSP00000258742:p.Arg11Gly	0					AC005082.1_ENST00000366347.4_Intron|NUPL2_ENST00000487595.1_3'UTR|NUPL2_ENST00000410002.3_Missense_Mutation_p.R11G	p.R11G	NM_007342.2	NP_031368.1	1	2	3	2.162848	O15504	NUPL2_HUMAN		1	290	+			A4D143|B4DP42|Q49AE7|Q9BS49	Missense_Mutation	SNP	ENST00000258742.5	1	1	hg19	c.31C>G	CCDS5379.1	1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173319	0.57584	.	.	ENSG00000136243	ENST00000258742;ENST00000410002;ENST00000413919	T;T;T	0.47528	0.84;0.84;0.84	5.14	3.29	0.37713	5.14	3.29	0.37713	Zinc finger, CCCH-type (1);	0.129374	0.51477	D	0.000094	T	0.59770	0.2218	M	0.67700	2.07	0.45676	D	0.99859	D	0.76494	0.999	D	0.68943	0.961	T	0.57871	-0.7736	10	0.48119	T	0.1	-13.7234	6.8112	0.23805	0.2509:0.6099:0.0:0.1392	.	11	O15504	NUPL2_HUMAN	G	11	ENSP00000258742:R11G;ENSP00000387330:R11G;ENSP00000401475:R11G	ENSP00000258742:R11G	R	+	1	2	2	NUPL2	23188260	23188260	1.000000	0.71417	0.871000	0.34182	0.994000	0.84299	1.853000	0.39358	0.825000	0.34637	0.655000	0.94253	CGG	0.412409		TCGA-HZ-8636-01A-21D-2396-08	0.612	NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214017.2	1	0	0	2	2	2	2	0	0	0	0	25	25	25	25	1	1.670000	-20.000000	1	0.410000	NM_007342		0	59	58	0	169	169	1		1	1		0	0	25	25	0	1.000000	9.997790e-01	0	11	0	29	0	59	169
PCLO	27445	broad.mit.edu	37	7	82544266	82544266	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr7:82544266G>T	ENST00000333891.9	-	7	13373	c.13036C>A	c.(13036-13038)Caa>Aaa	p.Q4346K	PCLO_ENST00000437081.1_Missense_Mutation_p.Q1066K|PCLO_ENST00000423517.2_Missense_Mutation_p.Q4346K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCTCTACTTTGACTAATTGGC	0.488																																						ENST00000333891.9	0.620000	0.320000	5.300000e-01	3.800000e-01	0.450000	0.465807	0.450000	0.450000																										0				259						c.(13036-13038)Caa>Aaa		piccolo presynaptic cytomatrix protein							97.0	95.0	96.0					7																	82544266		1882	4118	6000	SO:0001583	missense	27445	0	0					g.chr7:82544266G>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13036C>A	chr7.hg19:g.82544266G>T	ENSP00000334319:p.Gln4346Lys	0					PCLO_ENST00000437081.1_Missense_Mutation_p.Q1066K|PCLO_ENST00000423517.2_Missense_Mutation_p.Q4346K	p.Q4346K	NM_033026.5	NP_149015.2	1	2	3	2.162848				7	13373	-				Missense_Mutation	SNP	ENST00000333891.9	1	1	hg19	c.13036C>A	CCDS47630.1	0	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459440	0.63401	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.18338	2.22;2.22	5.61	5.61	0.85477	5.61	5.61	0.85477	.	.	.	.	.	T	0.43700	0.1259	M	0.68593	2.085	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.81914	0.98;0.995;0.995	T	0.27806	-1.0063	9	0.87932	D	0	.	19.6481	0.95790	0.0:0.0:1.0:0.0	.	4277;4346;4346	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	K	4346;4346;1066	ENSP00000334319:Q4346K;ENSP00000388393:Q4346K	ENSP00000334319:Q4346K	Q	-	1	0	0	PCLO	82382202	82382202	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.869000	0.99810	2.651000	0.90000	0.557000	0.71058	CAA	0.412409		TCGA-HZ-8636-01A-21D-2396-08	0.488	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	1	0	1	2	2	2	2	0	0	0	0	57	57	57	55	1	1.670000	-12.399780	1	0.410000	NM_014510		0	39	39	0	383	377	0		1	1		0	0	57	57	0	1.000000	1.713584e-01	0	3	0	5	0	39	383
TRPV6	55503	broad.mit.edu	37	7	142574925	142574925	+	Missense_Mutation	SNP	G	G	A	rs148239732		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr7:142574925G>A	ENST00000359396.3	-	4	702	c.457C>T	c.(457-459)Cgc>Tgc	p.R153C	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	153					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					GGACTACGGCGGAAGGCAGTG	0.622																																						ENST00000359396.3	1.000000	0.870000	1	9.600000e-01	0.990000	0.986949	0.990000	1.000000																										0				42						c.(457-459)Cgc>Tgc		transient receptor potential cation channel, subfamily V, member 6		G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	74.0	66.0	69.0		457	0.9	0.5	7	dbSNP_134	69	0,8600		0,0,4300	no	missense	TRPV6	NM_018646.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	153/726	142574925	1,13005	2203	4300	6503	SO:0001583	missense	55503	4	121412	38				g.chr7:142574925G>A	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.457C>T	chr7.hg19:g.142574925G>A	ENSP00000352358:p.Arg153Cys	0					RP11-114L10.2_ENST00000438839.1_RNA	p.R153C	NM_018646.3	NP_061116	0	0	0	2.126706	Q9H1D0	TRPV6_HUMAN		4	702	-	Melanoma(164;0.059)		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	1	1	hg19	c.457C>T	CCDS5874.1	1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.884573	0.33255	2.27E-4	0.0	ENSG00000165125	ENST00000359396	T	0.53640	0.61	3.86	0.902	0.19290	3.86	0.902	0.19290	Ankyrin repeat-containing domain (3);	0.461329	0.22855	N	0.054809	T	0.27933	0.0688	N	0.24115	0.695	0.41057	D	0.985342	B	0.18863	0.031	B	0.21546	0.035	T	0.05716	-1.0868	10	0.46703	T	0.11	-1.2388	3.8826	0.09085	0.3834:0.0:0.4439:0.1726	.	153	Q9H1D0	TRPV6_HUMAN	C	153	ENSP00000352358:R153C	ENSP00000352358:R153C	R	-	1	0	0	TRPV6	142285047	142285047	0.951000	0.32395	0.502000	0.27614	0.877000	0.50540	1.532000	0.36029	0.307000	0.22880	0.655000	0.94253	CGC	0.405122		TCGA-HZ-8636-01A-21D-2396-08	0.622	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	1	0	1	2	2	2	2	0	0	0	0	51	51	51	50	1	1.670000	-3.619015	1	0.410000	NM_014274		0	81	80	0	283	278	1		1	1		0	0	51	51	0	1.000000	9.433976e-01	0	9	0	10	0	81	283
EHMT1	79813	broad.mit.edu	37	9	140648742	140648742	+	Splice_Site	SNP	C	C	T	rs45450992	byFrequency	TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chr9:140648742C>T	ENST00000460843.1	+	8	1395	c.1368C>T	c.(1366-1368)ctC>ctT	p.L456L	EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000462484.1_Splice_Site_p.L456L|EHMT1_ENST00000334856.6_Splice_Site_p.L425L	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	456					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GCGGTGCCCTCGGTAAATGCC	0.577													C|||	283	0.0565096	0.0598	0.062	5008	,	,		15388	0.001		0.0885	False		,,,				2504	0.0726					ENST00000460843.1	0.730000	0.420000	6.600000e-01	4.900000e-01	0.570000	0.581127	0.570000	0.570000																										0				41						c.(1366-1368)ctC>ctT		euchromatic histone-lysine N-methyltransferase 1		C	,	248,4158	143.5+/-178.5	6,236,1961	64.0	69.0	67.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1368,1368	-9.1	0.0	9	dbSNP_127	67	769,7831	183.5+/-231.7	35,699,3566	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	EHMT1	NM_001145527.1,NM_024757.4	,	41,935,5527	TT,TC,CC		8.9419,5.6287,7.8195	,	456/809,456/1299	140648742	1017,11989	2203	4300	6503	SO:0001630	splice_region_variant	79813	8665	121412	71				g.chr9:140648742C>T	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1369+1C>T	chr9.hg19:g.140648742C>T		0					EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000462484.1_Splice_Site_p.L456L|EHMT1_ENST00000334856.6_Splice_Site_p.L425L	p.L456L	NM_024757.4	NP_079033.4	0	0	0	1.982324	Q9H9B1	EHMT1_HUMAN		8	1395	+	all_cancers(76;0.164)		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Splice_Site	SNP	ENST00000460843.1	1	0	hg19	c.1368C>T	CCDS7050.2	0																																																																																								0.360156		TCGA-HZ-8636-01A-21D-2396-08	0.577	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	0	0	1	2	2	2	2	0	0	0	0	43	43	43	43	1	1.670000	-2.710216	1	0.410000	NM_024757	Silent	0	46	45	0	314	311	1		1	1		0	0	43	43	0	1.000000	9.973912e-01	0	15	0	49	0	46	314
SASH3	54440	broad.mit.edu	37	X	128927070	128927070	+	Silent	SNP	C	C	A	rs142835579		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chrX:128927070C>A	ENST00000356892.3	+	7	1021	c.907C>A	c.(907-909)Cgg>Agg	p.R303R	RP4-753P9.3_ENST00000432513.1_RNA	NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	303	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R303R(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						TCCACAGCACCGGGCCAAGCT	0.587																																						ENST00000356892.3	1.000000	0.800000	1	8.800000e-01	0.970000	0.954390	0.970000	1.000000																										1	Substitution - coding silent(1)	p.R303R(1)	upper_aerodigestive_tract(1)	12						c.(907-909)Cgg>Agg		SAM and SH3 domain containing 3		C		3,3832		0,3,1629,571	83.0	69.0	74.0		907	2.8	1.0	X	dbSNP_134	74	0,6728		0,0,2428,1872	no	coding-synonymous	SASH3	NM_018990.3		0,3,4057,2443	AA,AC,CC,C		0.0,0.0782,0.0284		303/381	128927070	3,10560	2203	4300	6503	SO:0001819	synonymous_variant	54440	4	121410	39				g.chrX:128927070C>A	BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.907C>A	chrX.hg19:g.128927070C>A							RP4-753P9.3_ENST00000432513.1_RNA	p.R303R	NM_018990.3	NP_061863.1	0	1	1		O75995	SASH3_HUMAN		7	1021	+			A6NCH1|A8K7K8|Q5JZ38	Silent	SNP	ENST00000356892.3	1	1	hg19	c.907C>A	CCDS14614.1	1																																																																																								0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.587	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058208.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.670000	-3.176236	1	0.410000	NM_018990		0	92	91	0	366	359	1		1	0		0	0	74	74	0	1.000000	9.884624e-01	0	0	0	30	0	92	366
SPANXC	64663	broad.mit.edu	37	X	140335774	140335774	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chrX:140335774C>T	ENST00000358993.2	-	2	208	c.170G>A	c.(169-171)aGg>aAg	p.R57K		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	57						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					TTTCACGTTCCTCCTGTAGCG	0.502																																						ENST00000358993.2	0.800000	0.640000	7.700000e-01	6.700000e-01	0.720000	0.726684	0.720000	0.720000																										0				6						c.(169-171)aGg>aAg		SPANX family, member C							208.0	150.0	170.0					X																	140335774		2138	4137	6275	SO:0001583	missense	64663	1	114528	32				g.chrX:140335774C>T	AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.170G>A	chrX.hg19:g.140335774C>T	ENSP00000351884:p.Arg57Lys							p.R57K	NM_022661.2	NP_073152.1	0	1	1		Q9NY87	SPNXC_HUMAN		2	208	-	Acute lymphoblastic leukemia(192;7.65e-05)		Q32WL9|Q5JX88	Missense_Mutation	SNP	ENST00000358993.2	1	1	hg19	c.170G>A	CCDS14673.1	0	.	.	.	.	.	.	.	.	.	.	c	9.847	1.192504	0.21954	.	.	ENSG00000198573	ENST00000358993	T	0.05925	3.37	.	.	.	.	.	.	.	.	.	.	.	T	0.09818	0.0241	N	0.25485	0.75	0.09310	N	1	D	0.57257	0.979	D	0.71414	0.973	T	0.33523	-0.9865	7	0.12766	T	0.61	.	.	.	.	.	57	Q9NY87	SPNXC_HUMAN	K	57	ENSP00000351884:R57K	ENSP00000351884:R57K	R	-	2	0	0	SPANXC	140163440	140163440	0.024000	0.19004	0.009000	0.14445	0.009000	0.06853	0.064000	0.14437	0.328000	0.23435	0.330000	0.21533	AGG	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.502	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058590.1	0	0	1	2	2	2	2	0	0	0	0	275	275	275	327	1	1.670000	-3.017764	1	0.410000	NM_022661		0	262	226	0	1500	1290	0		1			0	0	275	275	0	1.000000	0	0	0	0	0	0	262	1500
DNASE1L1	1774	broad.mit.edu	37	X	153631476	153631476	+	Missense_Mutation	SNP	C	C	T	rs199865662		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chrX:153631476C>T	ENST00000393638.1	-	7	867	c.581G>A	c.(580-582)cGc>cAc	p.R194H	DNASE1L1_ENST00000369809.1_Missense_Mutation_p.R194H|SNORA70_ENST00000384436.1_RNA	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	194					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTTGTCCAGGCGCTTTTTGGT	0.612																																						ENST00000393638.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999904	0.990000	1.000000																										0				6						c.(580-582)cGc>cAc		deoxyribonuclease I-like 1							62.0	60.0	60.0					X																	153631476		2203	4300	6503	SO:0001583	missense	1774	1	121404	41				g.chrX:153631476C>T	L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.581G>A	chrX.hg19:g.153631476C>T	ENSP00000377255:p.Arg194His						DNASE1L1_ENST00000369809.1_Missense_Mutation_p.R194H|SNORA70_ENST00000384436.1_RNA	p.R194H	NM_001009934.1	NP_001009934.1	0	1	1		P49184	DNSL1_HUMAN		7	867	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		D3DWW7|Q5HY41	Missense_Mutation	SNP	ENST00000393638.1	1	1	hg19	c.581G>A	CCDS14747.1	1	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278287	0.23307	.	.	ENSG00000013563	ENST00000369809;ENST00000393638;ENST00000014935;ENST00000369808;ENST00000369807;ENST00000309585;ENST00000451865	T;T;T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39;-1.39;1.41	5.11	3.35	0.38373	5.11	3.35	0.38373	Endonuclease/exonuclease/phosphatase (2);	0.664814	0.16178	N	0.225967	T	0.65344	0.2682	L	0.27053	0.805	0.26742	N	0.970362	B	0.32160	0.358	B	0.30105	0.111	T	0.52419	-0.8578	10	0.27785	T	0.31	-14.5753	6.7231	0.23340	0.0:0.698:0.0:0.302	.	194	P49184	DNSL1_HUMAN	H	194	ENSP00000358824:R194H;ENSP00000377255:R194H;ENSP00000014935:R194H;ENSP00000358823:R194H;ENSP00000358822:R194H;ENSP00000309168:R194H;ENSP00000393346:R194H	ENSP00000014935:R194H	R	-	2	0	0	DNASE1L1	153284670	153284670	1.000000	0.71417	0.726000	0.30738	0.133000	0.20885	1.655000	0.37345	0.398000	0.25338	0.597000	0.82753	CGC	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.612	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080928.2	1	0	1	2	2	2	2	0	0	0	0	77	77	77	75	1	1.670000	-20.000000	1	0.410000			0	156	156	0	471	468	1		1	0		0	0	77	77	0	1.000000	1	0	0	0	218	0	156	471
MAGEB1	4112	broad.mit.edu	37	X	30269599	30269599	+	Missense_Mutation	SNP	C	C	T	rs145293151		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chrX:30269599C>T	ENST00000378981.3	+	4	1310	c.989C>T	c.(988-990)aCg>aTg	p.T330M	MAGEB1_ENST00000397550.1_Missense_Mutation_p.T330M|MAGEB1_ENST00000397548.2_Missense_Mutation_p.T330M	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	330										NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						ACTACTGCCACGACTTTTAGA	0.527																																						ENST00000378981.3	0.980000	0.650000	9.000000e-01	7.300000e-01	0.810000	0.820031	0.810000	0.820000																										0				32						c.(988-990)aCg>aTg		melanoma antigen family B, 1		C	MET/THR,MET/THR,MET/THR	0,3833		0,0,1631,571	79.0	72.0	75.0		989,989,989	-6.2	0.0	X	dbSNP_134	75	1,6727		0,1,2427,1872	yes	missense,missense,missense	MAGEB1	NM_002363.4,NM_177404.2,NM_177415.2	81,81,81	0,1,4058,2443	TT,TC,CC,C		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging,possibly-damaging	330/348,330/348,330/348	30269599	1,10560	2202	4300	6502	SO:0001583	missense	4112	6	121410	38				g.chrX:30269599C>T		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.989C>T	chrX.hg19:g.30269599C>T	ENSP00000368264:p.Thr330Met						MAGEB1_ENST00000397548.2_Missense_Mutation_p.T330M|MAGEB1_ENST00000397550.1_Missense_Mutation_p.T330M	p.T330M	NM_002363.4	NP_002354.2	0	1	1		P43366	MAGB1_HUMAN		4	1310	+			B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	ENST00000378981.3	1	1	hg19	c.989C>T	CCDS14222.1	0	.	.	.	.	.	.	.	.	.	.	C	1.310	-0.602440	0.03744	0.0	1.49E-4	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.01629	4.72;4.72;4.72	3.09	-6.18	0.02085	3.09	-6.18	0.02085	.	.	.	.	.	T	0.00724	0.0024	N	0.08118	0	0.09310	N	1	P	0.34892	0.474	B	0.19666	0.026	T	0.27806	-1.0063	9	0.31617	T	0.26	.	2.6292	0.04939	0.1313:0.4097:0.2575:0.2015	.	330	P43366	MAGB1_HUMAN	M	330	ENSP00000368264:T330M;ENSP00000380683:T330M;ENSP00000380681:T330M	ENSP00000368264:T330M	T	+	2	0	0	MAGEB1	30179520	30179520	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.555000	0.00925	-4.807000	0.00031	-1.407000	0.01130	ACG	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.527	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	0	0	1	2	24	2	2	1	1	1	1	62	62	62	61	1	1.670000	-20.000000	1	0.410000	NM_002363		0	80	79	0	398	396	1		1			1	1	62	62	0	1.000000	0	0	0	0	0	0	80	398
SRPX2	27286	broad.mit.edu	37	X	99924269	99924269	+	Missense_Mutation	SNP	C	C	T	rs370685595		TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chrX:99924269C>T	ENST00000373004.3	+	10	1548	c.1120C>T	c.(1120-1122)Cgg>Tgg	p.R374W		NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	374					angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						ACTGGATTTGCGGCATGTGAC	0.552																																						ENST00000373004.3	0.210000	0.040000	1.600000e-01	7.000000e-02	0.110000	0.121384	0.110000	0.100000																										0				19						c.(1120-1122)Cgg>Tgg		sushi-repeat containing protein, X-linked 2		C	TRP/ARG	0,3835		0,0,1632,571	94.0	71.0	79.0		1120	3.5	1.0	X		79	1,6727		0,1,2427,1872	no	missense	SRPX2	NM_014467.2	101	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	374/466	99924269	1,10562	2203	4300	6503	SO:0001583	missense	27286	4	121410	33				g.chrX:99924269C>T	AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.1120C>T	chrX.hg19:g.99924269C>T	ENSP00000362095:p.Arg374Trp							p.R374W	NM_014467.2	NP_055282.1	0	1	1		O60687	SRPX2_HUMAN		10	1548	+			B3KQT3|Q8WW85	Missense_Mutation	SNP	ENST00000373004.3	1	1	hg19	c.1120C>T	CCDS14471.1	0	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905934	0.72868	0.0	1.49E-4	ENSG00000102359	ENST00000373004	T	0.73897	-0.79	5.39	3.55	0.40652	5.39	3.55	0.40652	.	0.106917	0.64402	D	0.000003	D	0.86024	0.5834	M	0.83223	2.63	0.51767	D	0.999933	D	0.89917	1.0	D	0.85130	0.997	D	0.85856	0.1407	9	.	.	.	-2.9549	13.6078	0.62058	0.299:0.701:0.0:0.0	.	374	O60687	SRPX2_HUMAN	W	374	ENSP00000362095:R374W	.	R	+	1	2	2	SRPX2	99810925	99810925	1.000000	0.71417	0.989000	0.46669	0.990000	0.78478	0.863000	0.27913	0.429000	0.26202	0.596000	0.82720	CGG	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.552	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057486.1	0	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.670000	-3.159425	1	0.410000	NM_014467		0	7	7	0	311	307	0		1	0		0	0	36	36	0	0.980020	6.082881e-01	0	0	0	87	0	7	311
GAB3	139716	broad.mit.edu	37	X	153927709	153927709	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-8636-01A-21D-2396-08	TCGA-HZ-8636-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e10fd06-7031-4ceb-87ba-968cfd18cea5	4631085a-4eb9-4424-b246-14506cf16dee	g.chrX:153927709C>A	ENST00000369575.3	-	6	1233	c.1202G>T	c.(1201-1203)gGt>gTt	p.G401V	GAB3_ENST00000424127.2_Missense_Mutation_p.G402V|GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	401					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACCAGAGGCACCAGCCTGGGG	0.547																																						ENST00000369575.3	0.280000	0.130000	2.400000e-01	1.600000e-01	0.190000	0.206480	0.190000	0.200000																										0				25						c.(1201-1203)gGt>gTt		GRB2-associated binding protein 3							86.0	79.0	81.0					X																	153927709		2203	4300	6503	SO:0001583	missense	139716	0	0					g.chrX:153927709C>A	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1202G>T	chrX.hg19:g.153927709C>A	ENSP00000358588:p.Gly401Val						GAB3_ENST00000424127.2_Missense_Mutation_p.G402V|GAB3_ENST00000496390.1_5'UTR	p.G401V	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	0	1	1		Q8WWW8	GAB3_HUMAN		6	1233	-	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	1	1	hg19	c.1202G>T	CCDS14760.1	0	.	.	.	.	.	.	.	.	.	.	C	10.41	1.341281	0.24339	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.16073	2.37;2.37;2.37	5.85	-4.34	0.03666	5.85	-4.34	0.03666	.	1.256530	0.05135	N	0.493327	T	0.09202	0.0227	N	0.12182	0.205	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.35226	-0.9797	10	0.51188	T	0.08	-22.0678	6.7413	0.23437	0.3925:0.3004:0.3071:0.0	.	402;402;401	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	V	401;402;402	ENSP00000358588:G401V;ENSP00000358581:G402V;ENSP00000399588:G402V	ENSP00000358581:G402V	G	-	2	0	0	GAB3	153580903	153580903	0.000000	0.05858	0.000000	0.03702	0.239000	0.25481	0.182000	0.16900	-1.830000	0.01199	-1.178000	0.01721	GGT	0.410000		TCGA-HZ-8636-01A-21D-2396-08	0.547	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	1	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	1.670000	-19.999990	1	0.410000	NM_001081573		0	27	26	0	631	623	0		1	0		0	0	90	90	0	1.000000	1.178356e-01	0	0	0	14	0	27	631
