#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ADAMTS14	140766	broad.mit.edu	37	10	72489912	72489912	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr10:72489912C>T	ENST00000373207.1	+	6	1009	c.1009C>T	c.(1009-1011)Cgc>Tgc	p.R337C	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R337C	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	337	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GCAGGTGTGTCGCTGGGCACA	0.667																																						ENST00000373207.1	1.000000	0.590000	1.000000	0.710000	0.860000	0.861751	0.860000	1.000000																										0				50						c.(1009-1011)Cgc>Tgc		ADAM metallopeptidase with thrombospondin type 1 motif, 14							77.0	71.0	73.0					10																	72489912		2203	4300	6503	SO:0001583	missense	140766	2	121408	33				g.chr10:72489912C>T	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1009C>T	chr10.hg19:g.72489912C>T	ENSP00000362303:p.Arg337Cys	0					ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R337C	p.R337C	NM_080722.3	NP_542453.2	1	2	3	2.066575	Q8WXS8	ATS14_HUMAN		6	1009	+			Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	1	1	hg19	c.1009C>T	CCDS7306.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.163344	0.94727	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.64260	-0.09;-0.09	4.7	4.7	0.59300	4.7	4.7	0.59300	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.80798	0.4692	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.959;0.982	D	0.84031	0.0359	10	0.87932	D	0	.	17.8161	0.88634	0.0:1.0:0.0:0.0	.	337;337	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	C	337	ENSP00000362304:R337C;ENSP00000362303:R337C	ENSP00000362303:R337C	R	+	1	0	0	ADAMTS14	72159918	72159918	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.739000	0.68622	2.608000	0.88229	0.655000	0.94253	CGC	0.233716		TCGA-HZ-8637-01A-11D-2396-08	0.667	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	1	0	1		2	2	2	0		0	0	112		112	111	1	1.850000	-3.318794	1	0.200000	NM_080722			35	35		415	414	0		1	0		0	0	112	0		1	2.175318e-01	0	1	0	10	0	35	415
CTR9	9646	broad.mit.edu	37	11	10776660	10776660	+	Silent	SNP	A	A	G			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr11:10776660A>G	ENST00000361367.2	+	3	726	c.300A>G	c.(298-300)gaA>gaG	p.E100E		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	100					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTCGGAAAGAAAAGAATAAGG	0.358																																						ENST00000361367.2	0.180000	0.030000	0.130000	0.050000	0.080000	0.099815	0.080000	0.090000																										0				40						c.(298-300)gaA>gaG		CTR9, Paf1/RNA polymerase II complex component							108.0	112.0	111.0					11																	10776660		2201	4294	6495	SO:0001819	synonymous_variant	9646	0	0					g.chr11:10776660A>G	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.300A>G	chr11.hg19:g.10776660A>G		1						p.E100E	NM_014633.3	NP_055448.1	0	1	1	1.853927	Q6PD62	CTR9_HUMAN		3	726	+			D3DQV8|Q15015	Silent	SNP	ENST00000361367.2	0	1	hg19	c.300A>G	CCDS7805.1	0																																																																																								0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.358	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	0	0	1		15	4	2	1		1	1	150		150	149	1	1.850000	-3.317029	1	0.200000	NM_014633			6	6		615	610	0		0	0		1	0	150	0		3.611229e-02	2.752186e-02	0	2	0	88	0	6	615
HTR3A	3359	broad.mit.edu	37	11	113857759	113857759	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr11:113857759G>A	ENST00000504030.2	+	8	1574	c.1129G>A	c.(1129-1131)Gac>Aac	p.D377N	HTR3A_ENST00000506841.2_Missense_Mutation_p.D409N|HTR3A_ENST00000535865.1_Missense_Mutation_p.D121N|HTR3A_ENST00000375498.2_Missense_Mutation_p.D383N|HTR3A_ENST00000355556.2_Missense_Mutation_p.D415N|HTR3A_ENST00000299961.5_Missense_Mutation_p.D362N			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	377					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	CAAGACTGATGACTGCTCAGG	0.582																																						ENST00000504030.2	1.000000	0.140000	1.000000	0.210000	0.300000	0.412372	0.300000	0.260000																										0				36						c.(1129-1131)Gac>Aac		5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)						26.0	29.0	28.0					11																	113857759		2197	4292	6489	SO:0001583	missense	3359	0	0					g.chr11:113857759G>A	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.1129G>A	chr11.hg19:g.113857759G>A	ENSP00000424189:p.Asp377Asn	1					HTR3A_ENST00000535865.1_Missense_Mutation_p.D121N|HTR3A_ENST00000355556.2_Missense_Mutation_p.D415N|HTR3A_ENST00000375498.2_Missense_Mutation_p.D383N|HTR3A_ENST00000506841.2_Missense_Mutation_p.D409N|HTR3A_ENST00000299961.5_Missense_Mutation_p.D362N	p.D377N			1	3	4	2.303692	P46098	5HT3A_HUMAN		8	1574	+		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	0	1	hg19	c.1129G>A		0	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383357	0.25031	.	.	ENSG00000166736	ENST00000504030;ENST00000355556;ENST00000375498;ENST00000506841;ENST00000535865;ENST00000299961	D;T;D;T;D;D	0.83914	-1.78;1.9;-1.78;1.9;-1.78;-1.78	5.5	3.26	0.37387	5.5	3.26	0.37387	.	1.090970	0.06727	N	0.775992	T	0.76772	0.4034	L	0.38175	1.15	0.38660	D	0.952058	B;B;B	0.14012	0.002;0.008;0.009	B;B;B	0.19666	0.01;0.012;0.026	T	0.64162	-0.6472	10	0.29301	T	0.29	-20.6259	9.712	0.40251	0.2049:0.0:0.7951:0.0	.	362;415;383	B4DSY6;G5E986;Q7KZM7	.;.;.	N	377;415;383;409;121;362	ENSP00000424189:D377N;ENSP00000347754:D415N;ENSP00000364648:D383N;ENSP00000424776:D409N;ENSP00000437776:D121N;ENSP00000299961:D362N	ENSP00000299961:D362N	D	+	1	0	0	HTR3A	113362969	113362969	0.956000	0.32656	0.839000	0.33178	0.112000	0.19704	1.552000	0.36244	1.459000	0.47892	0.655000	0.94253	GAC	0.306759		TCGA-HZ-8637-01A-11D-2396-08	0.582	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	0	0	1		2	2	2	0		0	0	101		101	100	1	1.850000	-9.328989	1	0.200000	NM_000869			10	10		419	413	0		1			0	0	101	0		9.967305e-01	0	0	0	0	0	0	10	419
OR4C11	219429	broad.mit.edu	37	11	55371698	55371698	+	Missense_Mutation	SNP	C	C	T	rs140943798		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr11:55371698C>T	ENST00000302231.4	-	1	176	c.152G>A	c.(151-153)cGg>cAg	p.R51Q		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						TCCTAGTGTCCGGCTGGACTT	0.408													c|||	1	0.000199681	0.0008	0.0	5008	,	,		12783	0.0		0.0	False		,,,				2504	0.0					ENST00000302231.4	1.000000	0.740000	0.980000	0.830000	0.910000	0.907134	0.910000	0.970000																										0				33						c.(151-153)cGg>cAg		olfactory receptor, family 4, subfamily C, member 11		C	GLN/ARG	0,4358		0,0,2179	76.0	72.0	74.0		152	-3.5	0.0	11	dbSNP_134	74	12,7998		2,8,3995	yes	missense	OR4C11	NM_001004700.2	43	2,8,6174	TT,TC,CC		0.1498,0.0,0.097	benign	51/311	55371698	12,12356	2179	4005	6184	SO:0001583	missense	219429	134	113230	52				g.chr11:55371698C>T	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.152G>A	chr11.hg19:g.55371698C>T	ENSP00000306651:p.Arg51Gln	1						p.R51Q	NM_001004700.2	NP_001004700.2	0	1	1	1.853927	Q6IEV9	OR4CB_HUMAN		1	176	-			B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	1	1	hg19	c.152G>A	CCDS31503.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	0.005	-2.153505	0.00325	0.0	0.001498	ENSG00000172188	ENST00000302231	T	0.01076	5.37	4.34	-3.53	0.04667	4.34	-3.53	0.04667	GPCR, rhodopsin-like superfamily (1);	0.915015	0.09091	N	0.849832	T	0.00666	0.0022	N	0.05414	-0.055	0.09310	N	1	B	0.14012	0.009	B	0.04013	0.001	T	0.46541	-0.9184	10	0.16896	T	0.51	.	6.9427	0.24502	0.0:0.2633:0.1376:0.5991	.	51	Q6IEV9	OR4CB_HUMAN	Q	51	ENSP00000306651:R51Q	ENSP00000306651:R51Q	R	-	2	0	0	OR4C11	55128274	55128274	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.195000	0.00563	-0.427000	0.07350	-0.701000	0.03672	CGG	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.408	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	1	0	1		2	2	2	0		0	0	151		151	149	1	1.850000	-2.841672	1	0.200000	NM_001004700			67	67		547	537	1		1			0	0	151	0		1	0	0	0	0	0	0	67	547
TECTA	7007	broad.mit.edu	37	11	120998885	120998885	+	Silent	SNP	C	C	T	rs397517145		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr11:120998885C>T	ENST00000392793.1	+	9	2470	c.2199C>T	c.(2197-2199)tcC>tcT	p.S733S	TECTA_ENST00000264037.2_Silent_p.S733S			O75443	TECTA_HUMAN	tectorin alpha	733	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CCTTCCCCTCCGAGTTCTCCT	0.612																																						ENST00000392793.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																									TECTA/TBCEL(2)	0				135						c.(2197-2199)tcC>tcT		tectorin alpha							99.0	89.0	93.0					11																	120998885		2203	4299	6502	SO:0001819	synonymous_variant	7007	9	121412	43				g.chr11:120998885C>T	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2199C>T	chr11.hg19:g.120998885C>T		1					TECTA_ENST00000264037.2_Silent_p.S733S	p.S733S			1	3	4	2.303692	O75443	TECTA_HUMAN		9	2470	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		Silent	SNP	ENST00000392793.1	1	1	hg19	c.2199C>T	CCDS8434.1	1																																																																																								0.306759		TCGA-HZ-8637-01A-11D-2396-08	0.612	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	1	0	1		2	2	2	0		0	0	192		192	191	1	1.850000	-3.670058	1	0.200000	NM_005422			191	186		687	683	1		1	0		0	0	192	0		1	4.768854e-02	0	0	0	2	0	191	687
CAPZA3	93661	broad.mit.edu	37	12	18891410	18891410	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr12:18891410G>C	ENST00000317658.3	+	1	366	c.208G>C	c.(208-210)Gta>Cta	p.V70L	PLCZ1_ENST00000447925.2_5'Flank|PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000266505.7_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000435379.1_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	70					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				TGGAAATCCAGTACTCTTGTC	0.423																																						ENST00000317658.3	1.000000	0.810000	1.000000	0.930000	0.990000	0.976676	0.990000	1.000000																										0				19						c.(208-210)Gta>Cta		capping protein (actin filament) muscle Z-line, alpha 3							118.0	107.0	111.0					12																	18891410		2203	4300	6503	SO:0001583	missense	93661	0	0					g.chr12:18891410G>C	AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.208G>C	chr12.hg19:g.18891410G>C	ENSP00000326238:p.Val70Leu	0					PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000435379.1_5'Flank|PLCZ1_ENST00000447925.2_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000266505.7_5'Flank	p.V70L	NM_033328.2	NP_201585.1	1	2	3	2.090495	Q96KX2	CAZA3_HUMAN		1	366	+	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)	Q969J0	Missense_Mutation	SNP	ENST00000317658.3	1	1	hg19	c.208G>C	CCDS8681.1	1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661852	0.67700	.	.	ENSG00000177938	ENST00000317658	.	.	.	4.39	4.39	0.52855	4.39	4.39	0.52855	.	0.000000	0.64402	D	0.000002	T	0.76849	0.4045	M	0.72353	2.195	0.41152	D	0.986031	D	0.63046	0.992	D	0.76071	0.987	T	0.80065	-0.1538	9	0.72032	D	0.01	-16.3283	13.8066	0.63236	0.0:0.0:1.0:0.0	.	70	Q96KX2	CAZA3_HUMAN	L	70	.	ENSP00000326238:V70L	V	+	1	0	0	CAPZA3	18782677	18782677	0.990000	0.36364	0.889000	0.34880	0.991000	0.79684	4.256000	0.58810	2.278000	0.76064	0.462000	0.41574	GTA	0.214145		TCGA-HZ-8637-01A-11D-2396-08	0.423	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	1	0	1		2	2	2	0		0	0	130		130	130	1	1.850000	-20.000000	1	0.200000	NM_033328			59	59		513	510	1		1			0	0	130	0		1	0	0	0	0	0	0	59	513
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.990000	0.480000	0.940000	0.640000	0.810000	0.800523	0.810000	0.940000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	1	1	1.912163	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	18		18	18	1	1.850000	-7.636344	1	0.200000	NM_033360			11	10		88	87	1		1	1	1	0	0	18	333		9.984887e-01	8.135095e-01	1	9	42	18	383	11	88
ADCY6	112	broad.mit.edu	37	12	49164673	49164673	+	Silent	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr12:49164673G>A	ENST00000307885.4	-	19	3826	c.3132C>T	c.(3130-3132)aaC>aaT	p.N1044N	ADCY6_ENST00000550422.1_Silent_p.N991N|MIR4701_ENST00000583094.1_RNA|ADCY6_ENST00000357869.3_Silent_p.N991N	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	1044					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.N1044N(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						AGGTGCTGGCGTTCAGCCCTG	0.567																																						ENST00000307885.4	0.240000	0.040000	0.180000	0.070000	0.110000	0.131610	0.110000	0.110000																										1	Substitution - coding silent(1)	p.N1044N(1)	endometrium(1)	29						c.(3130-3132)aaC>aaT		adenylate cyclase 6							114.0	96.0	102.0					12																	49164673		2203	4300	6503	SO:0001819	synonymous_variant	112	0	0					g.chr12:49164673G>A		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.3132C>T	chr12.hg19:g.49164673G>A		0					ADCY6_ENST00000357869.3_Silent_p.N991N|MIR4701_ENST00000583094.1_RNA|ADCY6_ENST00000550422.1_Silent_p.N991N	p.N1044N	NM_015270.3	NP_056085.1	0	1	1	1.983498	O43306	ADCY6_HUMAN		19	3826	-			Q9NR75|Q9UDB0	Silent	SNP	ENST00000307885.4	0	1	hg19	c.3132C>T	CCDS8767.1	0																																																																																								0.172699		TCGA-HZ-8637-01A-11D-2396-08	0.567	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	0	0	1		2	2	2	0		0	0	93		93	93	1	1.850000	-4.739982	1	0.200000	NM_020983			5	6		429	427	0		1	0		0	0	93	0		9.375018e-01	2.654719e-01	0	0	0	73	0	5	429
KRT4	3851	broad.mit.edu	37	12	53202186	53202186	+	Silent	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr12:53202186G>A	ENST00000551956.1	-	6	1509	c.1017C>T	c.(1015-1017)atC>atT	p.I339I	KRT4_ENST00000458244.2_Silent_p.I319I|KRT4_ENST00000293774.4_Silent_p.I413I			P19013	K2C4_HUMAN	keratin 4	353	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						GGTCAACCGAGATCTGGAGCT	0.498																																					Pancreas(190;284 2995 41444 45903)	ENST00000551956.1	0.440000	0.160000	0.360000	0.210000	0.280000	0.294233	0.280000	0.280000																										0				29						c.(1015-1017)atC>atT		keratin 4							93.0	94.0	94.0					12																	53202186		2185	4295	6480	SO:0001819	synonymous_variant	3851	0	0					g.chr12:53202186G>A		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.1017C>T	chr12.hg19:g.53202186G>A		0					KRT4_ENST00000293774.4_Silent_p.I413I|KRT4_ENST00000458244.2_Silent_p.I319I	p.I339I			0	0	0	1.982588	P19013	K2C4_HUMAN		6	1509	-			F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	1	1	hg19	c.1017C>T	CCDS41787.2	0																																																																																								0.178645		TCGA-HZ-8637-01A-11D-2396-08	0.498	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	0	0	1		2	2	2	0		0	0	131		131	130	1	1.850000	-13.241080	1	0.200000	NM_002272			15	15		508	505	0		1	0		0	0	131	0		9.998686e-01	2.887631e-03	0	0	0	3	0	15	508
ACSS3	79611	broad.mit.edu	37	12	81568670	81568670	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr12:81568670G>A	ENST00000548058.1	+	8	2112	c.1202G>A	c.(1201-1203)cGt>cAt	p.R401H	ACSS3_ENST00000261206.3_Missense_Mutation_p.R400H|ACSS3_ENST00000548324.1_Missense_Mutation_p.R83H			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	401						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						AGAGCAATCCGTCAACAGGAC	0.502																																						ENST00000548058.1	0.760000	0.290000	0.640000	0.380000	0.500000	0.516527	0.500000	0.480000																										0				51						c.(1201-1203)cGt>cAt		acyl-CoA synthetase short-chain family member 3							117.0	98.0	105.0					12																	81568670		2203	4300	6503	SO:0001583	missense	79611	5	121410	37				g.chr12:81568670G>A		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1202G>A	chr12.hg19:g.81568670G>A	ENSP00000449535:p.Arg401His	0					ACSS3_ENST00000548324.1_Missense_Mutation_p.R83H|ACSS3_ENST00000261206.3_Missense_Mutation_p.R400H	p.R401H			0	0	0	1.982588	Q9H6R3	ACSS3_HUMAN		8	2112	+			Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	1	1	hg19	c.1202G>A	CCDS9022.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.332027	0.95733	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.40756	1.02;1.02;1.02	5.83	5.83	0.93111	5.83	5.83	0.93111	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	L	0.57130	1.785	0.80722	D	1	P;D	0.89917	0.956;1.0	B;D	0.77004	0.412;0.989	T	0.63769	-0.6562	10	0.72032	D	0.01	-13.3289	20.126	0.97982	0.0:0.0:1.0:0.0	.	83;401	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	H	401;400;83	ENSP00000449535:R401H;ENSP00000261206:R400H;ENSP00000448965:R83H	ENSP00000261206:R400H	R	+	2	0	0	ACSS3	80092801	80092801	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.056000	0.93881	2.749000	0.94314	0.655000	0.94253	CGT	0.178645		TCGA-HZ-8637-01A-11D-2396-08	0.502	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	0	0	1		2	2	2	0		0	0	82		82	81	1	1.850000	-16.697130	1	0.200000	NM_024560			15	15		280	277	0		1	0		0	0	82	0		9.998732e-01	2.930162e-01	0	0	0	20	0	15	280
LRRC43	254050	broad.mit.edu	37	12	122669269	122669269	+	Silent	SNP	G	G	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr12:122669269G>T	ENST00000339777.4	+	2	382	c.354G>T	c.(352-354)acG>acT	p.T118T	LRRC43_ENST00000425921.1_5'UTR	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	118										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		ACCCGCTGACGATCACAGACA	0.582																																						ENST00000339777.4	1.000000	0.660000	1.000000	0.860000	0.990000	0.950799	0.990000	1.000000																										0				19						c.(352-354)acG>acT		leucine rich repeat containing 43							42.0	43.0	43.0					12																	122669269		2005	4166	6171	SO:0001819	synonymous_variant	254050	0	0					g.chr12:122669269G>T	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.354G>T	chr12.hg19:g.122669269G>T		0					LRRC43_ENST00000425921.1_5'UTR	p.T118T	NM_152759.4	NP_689972.3	0	0	0	1.982588	Q8N309	LRC43_HUMAN		2	382	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		Q6ZVT9	Silent	SNP	ENST00000339777.4	1	1	hg19	c.354G>T	CCDS45001.1	1																																																																																								0.178645		TCGA-HZ-8637-01A-11D-2396-08	0.582	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	1	0	1		2	2	2	0		0	0	45		45	45	1	1.850000	-8.977229	1	0.200000	NM_152759			16	16		125	123	1		1	0		0	0	45	0		9.999450e-01	4.068604e-02	0	1	0	2	0	16	125
LCP1	3936	broad.mit.edu	37	13	46718595	46718595	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr13:46718595C>T	ENST00000398576.2	-	14	1623	c.1235G>A	c.(1234-1236)cGa>cAa	p.R412Q	LCP1_ENST00000435666.2_5'Flank|LCP1_ENST00000323076.2_Missense_Mutation_p.R412Q			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	412	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		ATGATTGACTCGAGGGTTAAC	0.423			T	BCL6	NHL																																	ENST00000398576.2	0.640000	0.240000	0.530000	0.320000	0.410000	0.431288	0.410000	0.400000				Dom	yes			Dom	yes		13	13q14.1-q14.3	13q14.1-q14.3	3936	T	lymphocyte cytosolic protein 1 (L-plastin)				L	L	BCL6		NHL		0				34						c.(1234-1236)cGa>cAa		lymphocyte cytosolic protein 1 (L-plastin)							129.0	119.0	122.0					13																	46718595		2203	4300	6503	SO:0001583	missense	3936	0	0					g.chr13:46718595C>T	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1235G>A	chr13.hg19:g.46718595C>T	ENSP00000381581:p.Arg412Gln	0					LCP1_ENST00000435666.2_5'Flank|LCP1_ENST00000323076.2_Missense_Mutation_p.R412Q	p.R412Q			0	0	0	2.014613	P13796	PLSL_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	14	1623	-		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	1	1	hg19	c.1235G>A	CCDS9403.1	0	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492704	0.64074	.	.	ENSG00000136167	ENST00000323076;ENST00000398576	D;D	0.94828	-3.53;-3.53	5.91	5.07	0.68467	5.91	5.07	0.68467	Calponin homology domain (5);	0.117460	0.64402	N	0.000014	D	0.89969	0.6869	L	0.33624	1.015	0.80722	D	1	P	0.39060	0.657	B	0.35353	0.201	D	0.88903	0.3354	10	0.37606	T	0.19	-1.5	14.0981	0.65037	0.0:0.9281:0.0:0.0719	.	412	P13796	PLSL_HUMAN	Q	412	ENSP00000315757:R412Q;ENSP00000381581:R412Q	ENSP00000315757:R412Q	R	-	2	0	0	LCP1	45616596	45616596	0.989000	0.36119	0.995000	0.50966	0.996000	0.88848	2.576000	0.46033	1.507000	0.48752	0.555000	0.69702	CGA	0.191919		TCGA-HZ-8637-01A-11D-2396-08	0.423	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	1	0	1		2	2	2	0		0	0	118		118	118	1	1.850000	-2.854798	1	0.200000	NM_002298			15	15		346	341	0		1	1		0	0	118	0		9.998657e-01	1	0	17	0	1184	0	15	346
PCDH9	5101	broad.mit.edu	37	13	67802512	67802512	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr13:67802512C>T	ENST00000377865.2	-	1	195	c.61G>A	c.(61-63)Gca>Aca	p.A21T	PCDH9_ENST00000328454.5_Missense_Mutation_p.A21T|PCDH9_ENST00000544246.1_Missense_Mutation_p.A21T|PCDH9_ENST00000377861.3_Missense_Mutation_p.A21T|PCDH9_ENST00000456367.1_Missense_Mutation_p.A21T			Q9HC56	PCDH9_HUMAN	protocadherin 9	21					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A21T(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TGAGCTATTGCGGAATCCAGC	0.383																																						ENST00000377865.2	0.270000	0.040000	0.200000	0.080000	0.130000	0.148399	0.130000	0.130000																										1	Substitution - Missense(1)	p.A21T(1)	endometrium(1)	103						c.(61-63)Gca>Aca		protocadherin 9							73.0	73.0	73.0					13																	67802512		2203	4300	6503	SO:0001583	missense	5101	0	0					g.chr13:67802512C>T	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.61G>A	chr13.hg19:g.67802512C>T	ENSP00000367096:p.Ala21Thr	0					PCDH9_ENST00000456367.1_Missense_Mutation_p.A21T|PCDH9_ENST00000544246.1_Missense_Mutation_p.A21T|PCDH9_ENST00000328454.5_Missense_Mutation_p.A21T|PCDH9_ENST00000377861.3_Missense_Mutation_p.A21T	p.A21T			0	0	0	2.014613	Q9HC56	PCDH9_HUMAN		1	195	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	0	1	hg19	c.61G>A	CCDS9444.1	0	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463505	0.26248	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.54866	0.61;0.61;0.55;0.55;0.57	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.104012	0.64402	D	0.000003	T	0.45657	0.1353	L	0.29908	0.895	0.45490	D	0.998456	B;B;B;B	0.21071	0.051;0.0;0.005;0.022	B;B;B;B	0.15870	0.006;0.0;0.014;0.006	T	0.23583	-1.0184	10	0.41790	T	0.15	.	20.1012	0.97876	0.0:1.0:0.0:0.0	.	21;21;21;21	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	T	21	ENSP00000442186:A21T;ENSP00000367096:A21T;ENSP00000401699:A21T;ENSP00000332060:A21T;ENSP00000367092:A21T	ENSP00000332060:A21T	A	-	1	0	0	PCDH9	66700513	66700513	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.625000	0.61262	2.754000	0.94517	0.650000	0.86243	GCA	0.191919		TCGA-HZ-8637-01A-11D-2396-08	0.383	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	0	0	1		2	2	2	0		0	0	82		82	82	1	1.850000	-3.019464	1	0.200000	NM_203487			5	5		389	388	0		1	0		0	0	82	0		9.370836e-01	7.867789e-04	0	0	0	3	0	5	389
TEP1	7011	broad.mit.edu	37	14	20851408	20851408	+	Silent	SNP	A	A	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr14:20851408A>C	ENST00000262715.5	-	27	4012	c.3972T>G	c.(3970-3972)tcT>tcG	p.S1324S	TEP1_ENST00000556935.1_Silent_p.S1216S|TEP1_ENST00000545983.1_5'Flank	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1324	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GGGCCCGAGCAGAGGCCTCCA	0.647																																						ENST00000262715.5	1.000000	0.780000	1.000000	0.970000	0.990000	0.980197	0.990000	1.000000																										0				96						c.(3970-3972)tcT>tcG		telomerase-associated protein 1							32.0	35.0	34.0					14																	20851408		2203	4300	6503	SO:0001819	synonymous_variant	7011	0	0					g.chr14:20851408A>C		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3972T>G	chr14.hg19:g.20851408A>C		1					TEP1_ENST00000545983.1_5'Flank|TEP1_ENST00000556935.1_Silent_p.S1216S	p.S1324S	NM_007110.4	NP_009041.2	1	2	3	2.244705	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	27	4012	-	all_cancers(95;0.00123)	all_lung(585;0.235)	A0AUV9	Silent	SNP	ENST00000262715.5	1	1	hg19	c.3972T>G	CCDS9548.1	1																																																																																								0.272727		TCGA-HZ-8637-01A-11D-2396-08	0.647	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	1	0	1		2	2	2	0		0	0	31		31	30	1	1.850000	-20.000000	1	0.200000	NM_007110			24	20		200	197	1		1	1		0	0	31	0		9.999997e-01	9.826646e-01	0	7	0	50	0	24	200
SPTBN5	51332	broad.mit.edu	37	15	42147503	42147503	+	Silent	SNP	G	G	T	rs577570685	byFrequency	TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr15:42147503G>T	ENST00000320955.6	-	55	9569	c.9342C>A	c.(9340-9342)acC>acA	p.T3114T		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3114					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CGAGGAGCAGGGTCTCTCGCT	0.682																																						ENST00000320955.6	1.000000	0.430000	0.970000	0.580000	0.750000	0.765324	0.750000	1.000000																										0				62						c.(9340-9342)acC>acA		spectrin, beta, non-erythrocytic 5							22.0	27.0	25.0					15																	42147503		2048	4175	6223	SO:0001819	synonymous_variant	51332	0	0					g.chr15:42147503G>T	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.9342C>A	chr15.hg19:g.42147503G>T		0						p.T3114T	NM_016642.2	NP_057726.4	0	0	0	1.932025	Q9NRC6	SPTN5_HUMAN		55	9569	-		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		Silent	SNP	ENST00000320955.6	1	1	hg19	c.9342C>A		0																																																																																								0.156118		TCGA-HZ-8637-01A-11D-2396-08	0.682	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	1	0	1		2	2	2	0		0	0	36		36	36	1	1.850000	-18.375930	1	0.200000	NM_016642			13	13		149	147	0		1	0		0	0	36	0		9.995706e-01	2.178559e-02	0	0	0	3	0	13	149
SPPL2A	84888	broad.mit.edu	37	15	51012246	51012246	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr15:51012246T>C	ENST00000261854.5	-	14	1653	c.1379A>G	c.(1378-1380)aAg>aGg	p.K460R	SPPL2A_ENST00000559293.1_5'Flank	NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	460					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		AGGTTGCCCCTTTTTCATCAG	0.408																																					Melanoma(50;790 1209 4069 22965 33125)	ENST00000261854.5	0.260000	0.050000	0.200000	0.080000	0.130000	0.145963	0.130000	0.130000																										0				15						c.(1378-1380)aAg>aGg		signal peptide peptidase like 2A							128.0	111.0	117.0					15																	51012246		2196	4294	6490	SO:0001583	missense	84888	0	0					g.chr15:51012246T>C		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.1379A>G	chr15.hg19:g.51012246T>C	ENSP00000261854:p.Lys460Arg	0					SPPL2A_ENST00000559293.1_5'Flank	p.K460R	NM_032802.3	NP_116191.2	0	0	0	1.914572	Q8TCT8	SPP2A_HUMAN		14	1653	-			B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	ENST00000261854.5	0	1	hg19	c.1379A>G	CCDS10138.1	0	.	.	.	.	.	.	.	.	.	.	T	5.356	0.250885	0.10130	.	.	ENSG00000138600	ENST00000261854	T	0.17054	2.3	5.66	4.52	0.55395	5.66	4.52	0.55395	.	0.218396	0.51477	D	0.000088	T	0.06508	0.0167	N	0.04746	-0.17	0.20638	N	0.999871	P	0.41475	0.751	B	0.40982	0.345	T	0.14671	-1.0464	10	0.12766	T	0.61	-3.5127	1.9865	0.03437	0.2572:0.0784:0.1375:0.5268	.	460	Q8TCT8	PSL2_HUMAN	R	460	ENSP00000261854:K460R	ENSP00000261854:K460R	K	-	2	0	0	AC012100.1	48799538	48799538	1.000000	0.71417	0.976000	0.42696	0.949000	0.60115	2.041000	0.41213	0.955000	0.37878	0.477000	0.44152	AAG	0.148936		TCGA-HZ-8637-01A-11D-2396-08	0.408	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	0	0	1		2	2	2	0		0	0	112		112	112	1	1.850000	-2.624012	1	0.200000	NM_032802			6	6		437	433	0		1	0		0	0	112	0		9.642191e-01	9.021831e-01	0	1	0	304	0	6	437
HSF4	3299	broad.mit.edu	37	16	67203674	67203674	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr16:67203674A>G	ENST00000521374.1	+	13	1465	c.1465A>G	c.(1465-1467)Agt>Ggt	p.S489G	NOL3_ENST00000432069.2_5'Flank|HSF4_ENST00000584272.1_Missense_Mutation_p.S459G|HSF4_ENST00000264009.8_Missense_Mutation_p.S489G|HSF4_ENST00000421453.1_Missense_Mutation_p.S459G|NOL3_ENST00000564053.1_5'Flank			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	489					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CCCGGAAGCCAGTCCCTCCCC	0.667											OREG0023873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000521374.1	0.730000	0.390000	0.650000	0.460000	0.540000	0.560454	0.540000	0.550000																										0				12						c.(1465-1467)Agt>Ggt		heat shock transcription factor 4							40.0	46.0	44.0					16																	67203674		1851	4075	5926	SO:0001583	missense	3299	0	0					g.chr16:67203674A>G	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.1465A>G	chr16.hg19:g.67203674A>G	ENSP00000430947:p.Ser489Gly	0		OREG0023873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1097	NOL3_ENST00000432069.2_5'Flank|HSF4_ENST00000584272.1_Missense_Mutation_p.S459G|NOL3_ENST00000564053.1_5'Flank|HSF4_ENST00000421453.1_Missense_Mutation_p.S459G|HSF4_ENST00000264009.8_Missense_Mutation_p.S489G	p.S489G			0	0	0	1.978917	Q9ULV5	HSF4_HUMAN		13	1465	+		Ovarian(137;0.0563)	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	1	1	hg19	c.1465A>G	CCDS42175.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.29|11.29	1.593884|1.593884	0.28445|0.28445	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000519601;ENST00000520304|ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374	.|.	.|.	.|.	4.63|4.63	3.47|3.47	0.39725|0.39725	4.63|4.63	3.47|3.47	0.39725|0.39725	.|.	.|0.322852	.|0.26812	.|N	.|0.022370	T|T	0.24509|0.24509	0.0594|0.0594	N|N	0.19112|0.19112	0.55|0.55	0.25125|0.25125	N|N	0.990618|0.990618	.|B;B	.|0.17268	.|0.021;0.012	.|B;B	.|0.21151	.|0.033;0.014	T|T	0.13656|0.13656	-1.0501|-1.0501	5|9	.|0.29301	.|T	.|0.29	-17.1419|-17.1419	6.2709|6.2709	0.20953|0.20953	0.8712:0.0:0.1288:0.0|0.8712:0.0:0.1288:0.0	.|.	.|459;489	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	R|G	220;132|459;489;413;489	.|.	.|ENSP00000264009:S489G	Q|S	+|+	2|1	0|0	0|0	HSF4|HSF4	65761175|65761175	65761175|65761175	0.525000|0.525000	0.26290|0.26290	0.986000|0.986000	0.45419|0.45419	0.152000|0.152000	0.21847|0.21847	0.176000|0.176000	0.16782|0.16782	0.841000|0.841000	0.35020|0.35020	0.460000|0.460000	0.39030|0.39030	CAG|AGT	0.176955		TCGA-HZ-8637-01A-11D-2396-08	0.667	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	1	0	1		2	2	2	0		0	0	180		180	180	1	1.850000	-20.000000	1	0.200000	NM_001538			36	35		599	592	1		1	1		0	0	180	0		1	9.694871e-01	0	23	0	71	0	36	599
WWP2	11060	broad.mit.edu	37	16	69832593	69832593	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr16:69832593G>A	ENST00000359154.2	+	3	180	c.79G>A	c.(79-81)Gca>Aca	p.A27T	WWP2_ENST00000448661.1_Missense_Mutation_p.A27T|WWP2_ENST00000356003.2_Missense_Mutation_p.A27T|WWP2_ENST00000569174.1_Missense_Mutation_p.A27T	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	27	C2.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGTGGTGTCCGCAAAGCCCAA	0.527											OREG0023909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000359154.2	0.180000	0.030000	0.140000	0.060000	0.090000	0.103864	0.090000	0.090000																										0				42						c.(79-81)Gca>Aca		WW domain containing E3 ubiquitin protein ligase 2							117.0	115.0	116.0					16																	69832593		2198	4300	6498	SO:0001583	missense	11060	0	0					g.chr16:69832593G>A	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.79G>A	chr16.hg19:g.69832593G>A	ENSP00000352069:p.Ala27Thr	0		OREG0023909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1117	WWP2_ENST00000356003.2_Missense_Mutation_p.A27T|WWP2_ENST00000448661.1_Missense_Mutation_p.A27T|WWP2_ENST00000569174.1_Missense_Mutation_p.A27T	p.A27T	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	0	0	0	1.978917	O00308	WWP2_HUMAN		3	180	+			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	0	1	hg19	c.79G>A	CCDS10885.1	0	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551721	0.86127	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003	T;T;T	0.80738	-1.41;-1.41;-1.41	5.76	5.76	0.90799	5.76	5.76	0.90799	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.198406	0.45606	D	0.000349	T	0.76054	0.3934	M	0.67397	2.05	0.80722	D	1	P	0.46020	0.871	B	0.32583	0.148	T	0.78339	-0.2242	9	.	.	.	.	16.6952	0.85333	0.0:0.0:1.0:0.0	.	27	O00308	WWP2_HUMAN	T	27	ENSP00000352069:A27T;ENSP00000396871:A27T;ENSP00000348283:A27T	.	A	+	1	0	0	WWP2	68390094	68390094	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.778000	0.62368	2.713000	0.92767	0.655000	0.94253	GCA	0.176955		TCGA-HZ-8637-01A-11D-2396-08	0.527	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	0	0	1		2	2	7	0		0	0	178		178	176	1	1.850000	-1.702172	0	0.200000	NM_007014			7	7		735	730	0		1	0	0	0	1	178	374		9.801817e-01	1.124622e-01	3.263101e-01	0	4	52	506	7	735
ANKRD11	29123	broad.mit.edu	37	16	89341354	89341354	+	Silent	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr16:89341354G>A	ENST00000301030.4	-	11	8041	c.7581C>T	c.(7579-7581)atC>atT	p.I2527I	ANKRD11_ENST00000378330.2_Silent_p.I2527I	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2527					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CACAGGATACGATCAGCTTCT	0.637																																						ENST00000301030.4	1.000000	0.730000	0.980000	0.830000	0.920000	0.910192	0.920000	0.990000																										0				83						c.(7579-7581)atC>atT		ankyrin repeat domain 11							52.0	49.0	50.0					16																	89341354		2198	4300	6498	SO:0001819	synonymous_variant	29123	1	121410	31				g.chr16:89341354G>A	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7581C>T	chr16.hg19:g.89341354G>A		1					ANKRD11_ENST00000378330.2_Silent_p.I2527I	p.I2527I	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	0	1	1	1.852776	Q6UB99	ANR11_HUMAN		11	8041	-		all_hematologic(23;0.00824)|Colorectal(91;0.0475)	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	1	1	hg19	c.7581C>T	CCDS32513.1	1																																																																																								0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.637	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	1	0	1		2	2	2	0		0	0	88		88	87	1	1.850000	-20.000000	1	0.200000	NM_013275			45	43		338	333	1		1	1		0	0	88	0		1	9.971774e-01	0	17	0	52	0	45	338
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	24185	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	c.(733-735)Ggc>Agc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	SO:0001583	missense	7157	1	121412	39	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577548C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	chr17.hg19:g.7577548C>T	ENSP00000269305:p.Gly245Ser	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S	p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	2.044442	P04637	P53_HUMAN		7	922	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.733G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	0	TP53	7518273	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	116		116	115	1	1.850000	-2.964390	1	0.200000	NM_000546			81	81		319	315	1		1	1	1	0	0	116	793		1	1	1	77	193	73	819	81	319
ABCA10	10349	broad.mit.edu	37	17	67144973	67144973	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr17:67144973G>A	ENST00000269081.4	-	40	5536	c.4627C>T	c.(4627-4629)Cct>Tct	p.P1543S	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1543					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TCATTTTAAGGGTCTTCCTGT	0.338																																						ENST00000269081.4	0.670000	0.240000	0.550000	0.330000	0.430000	0.448098	0.430000	0.420000																										0				81						c.(4627-4629)Cct>Tct		ATP-binding cassette, sub-family A (ABC1), member 10							82.0	85.0	84.0					17																	67144973		2203	4300	6503	SO:0001583	missense	10349	0	0					g.chr17:67144973G>A	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.4627C>T	chr17.hg19:g.67144973G>A	ENSP00000269081:p.Pro1543Ser	1					ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	p.P1543S	NM_080282.3	NP_525021.3	0	1	1	1.916763	Q8WWZ4	ABCAA_HUMAN		40	5536	-	Breast(10;6.95e-12)		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	1	1	hg19	c.4627C>T	CCDS11684.1	0	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225136	0.39300	.	.	ENSG00000154263	ENST00000269081	D	0.88586	-2.4	3.81	0.564	0.17302	3.81	0.564	0.17302	.	.	.	.	.	D	0.88295	0.6398	L	0.29908	0.895	0.19775	N	0.999955	D;D	0.76494	0.994;0.999	P;D	0.69142	0.878;0.962	T	0.77186	-0.2680	9	0.87932	D	0	.	5.6355	0.17534	0.3789:0.0:0.6211:0.0	.	535;1543	B4DPV2;Q8WWZ4	.;ABCAA_HUMAN	S	1543	ENSP00000269081:P1543S	ENSP00000269081:P1543S	P	-	1	0	0	ABCA10	64656568	64656568	0.128000	0.22383	0.004000	0.12327	0.010000	0.07245	0.205000	0.17356	0.216000	0.20781	-0.267000	0.10333	CCT	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.338	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	1	0	1		2	2	2	0		0	0	85		85	84	1	1.850000	-3.213629	1	0.200000	NM_080282			14	13		277	274	0		1	0		0	0	85	0		9.997504e-01	1.984003e-01	0	0	0	16	0	14	277
AQP4	361	broad.mit.edu	37	18	24436320	24436320	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr18:24436320C>T	ENST00000383168.4	-	5	955	c.827G>A	c.(826-828)aGc>aAc	p.S276N	AQP4_ENST00000583022.1_5'UTR|AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|AQP4_ENST00000581374.1_Missense_Mutation_p.S254N|AQP4_ENST00000440832.3_Missense_Mutation_p.S254N	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	276					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					CTCCATGTAGCTTCCTTTTGT	0.488																																						ENST00000383168.4	1.000000	0.090000	0.250000	0.120000	0.160000	0.289947	0.160000	0.160000																										0				11						c.(826-828)aGc>aAc		aquaporin 4							277.0	237.0	251.0					18																	24436320		2203	4300	6503	SO:0001583	missense	361	0	0					g.chr18:24436320C>T	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.827G>A	chr18.hg19:g.24436320C>T	ENSP00000372654:p.Ser276Asn	0					AQP4_ENST00000583022.1_5'UTR|AQP4_ENST00000440832.3_Missense_Mutation_p.S254N|AQP4_ENST00000581374.1_Missense_Mutation_p.S254N|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000582605.1_RNA	p.S276N	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	1	2	3	2.099616	P55087	AQP4_HUMAN		5	955	-	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)		P78564	Missense_Mutation	SNP	ENST00000383168.4	0	1	hg19	c.827G>A	CCDS11889.1	0	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806238	0.31961	.	.	ENSG00000171885	ENST00000383168;ENST00000440832;ENST00000383170	D	0.85955	-2.05	5.75	3.87	0.44632	5.75	3.87	0.44632	.	0.399736	0.30492	N	0.009517	T	0.65037	0.2653	N	0.08118	0	0.23401	N	0.997751	B	0.02656	0.0	B	0.06405	0.002	T	0.44283	-0.9338	10	0.31617	T	0.26	.	3.4375	0.07452	0.0:0.4876:0.278:0.2344	.	276	P55087	AQP4_HUMAN	N	276;256;172	ENSP00000372654:S276N	ENSP00000372654:S276N	S	-	2	0	0	AQP4	22690318	22690318	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.608000	0.36847	2.717000	0.92951	0.650000	0.86243	AGC	0.215686		TCGA-HZ-8637-01A-11D-2396-08	0.488	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254914.2	0	0	1		2	2	2	0		0	0	363		363	361	1	1.850000	-2.841789	1	0.200000	NM_001650, NM_004028			22	22		1411	1397	0		1	0		0	0	363	0		9.999985e-01	0	0	1	0	0	0	22	1411
TYK2	7297	broad.mit.edu	37	19	10476252	10476252	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:10476252C>G	ENST00000525621.1	-	7	1433	c.952G>C	c.(952-954)Gtg>Ctg	p.V318L	TYK2_ENST00000529370.1_Missense_Mutation_p.V318L|TYK2_ENST00000524462.1_Missense_Mutation_p.V133L|TYK2_ENST00000264818.6_Missense_Mutation_p.V318L	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	318	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GTGCCTGTCACCAGCACCTCG	0.677																																						ENST00000525621.1	0.260000	0.050000	0.200000	0.090000	0.130000	0.150775	0.130000	0.130000																										0				64						c.(952-954)Gtg>Ctg		tyrosine kinase 2							50.0	61.0	57.0					19																	10476252		2203	4300	6503	SO:0001583	missense	7297	0	0					g.chr19:10476252C>G		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.952G>C	chr19.hg19:g.10476252C>G	ENSP00000431885:p.Val318Leu	0					TYK2_ENST00000529370.1_Missense_Mutation_p.V318L|TYK2_ENST00000264818.6_Missense_Mutation_p.V318L|TYK2_ENST00000524462.1_Missense_Mutation_p.V133L	p.V318L	NM_003331.4	NP_003322.3	0	1	1	1.987759	P29597	TYK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)	7	1433	-			Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	0	1	hg19	c.952G>C	CCDS12236.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.086512|4.086512	0.76642|0.76642	.|.	.|.	ENSG00000105397|ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370|ENST00000525220	D;D;D;D|.	0.87650|.	-1.59;-1.56;-1.56;-2.28|.	5.18|5.18	5.18|5.18	0.71444|0.71444	5.18|5.18	5.18|5.18	0.71444|0.71444	FERM domain (1);|.	0.130327|.	0.32218|.	N|.	0.006403|.	T|T	0.77391|0.77391	0.4123|0.4123	M|M	0.81682|0.81682	2.555|2.555	0.54753|0.54753	D|D	0.999981|0.999981	D;D|.	0.67145|.	0.994;0.996|.	P;P|.	0.60286|.	0.804;0.872|.	T|T	0.78966|0.78966	-0.1995|-0.1995	10|5	0.87932|.	D|.	0|.	-30.7247|-30.7247	16.2126|16.2126	0.82170|0.82170	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	318;318|.	E9PPF2;P29597|.	.;TYK2_HUMAN|.	L|C	133;318;318;65;318|96	ENSP00000433203:V133L;ENSP00000431885:V318L;ENSP00000264818:V318L;ENSP00000432728:V318L|.	ENSP00000264818:V318L|.	V|W	-|-	1|3	0|0	0|0	TYK2|TYK2	10337252|10337252	10337252|10337252	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.489000|0.489000	0.33432|0.33432	4.262000|4.262000	0.58847|0.58847	2.422000|2.422000	0.82143|0.82143	0.561000|0.561000	0.74099|0.74099	GTG|TGG	0.169263		TCGA-HZ-8637-01A-11D-2396-08	0.677	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1	0	0	1		2	2	2	0		0	0	147		147	147	1	1.850000	-6.200647	1	0.200000				7	6		497	490	0		1	1		0	0	147	0		9.796081e-01	5.030247e-01	0	2	0	109	0	7	497
LTBP4	8425	broad.mit.edu	37	19	41120241	41120241	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:41120241C>T	ENST00000308370.7	+	22	2902	c.2902C>T	c.(2902-2904)Cga>Tga	p.R968*	LTBP4_ENST00000243562.9_Nonsense_Mutation_p.R66*|LTBP4_ENST00000545697.1_Nonsense_Mutation_p.R421*|LTBP4_ENST00000204005.9_Nonsense_Mutation_p.R931*|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000396819.3_Nonsense_Mutation_p.R901*	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	968	Cys-rich.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ATGTCGCGAGCGAGGCCCAGC	0.662																																						ENST00000308370.7	1.000000	0.070000	0.300000	0.120000	0.190000	0.255725	0.190000	0.170000																										0				1						c.(2902-2904)Cga>Tga		latent transforming growth factor beta binding protein 4							37.0	40.0	39.0					19																	41120241		1988	4156	6144	SO:0001587	stop_gained	8425	0	0					g.chr19:41120241C>T	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2902C>T	chr19.hg19:g.41120241C>T	ENSP00000311905:p.Arg968*	0					LTBP4_ENST00000545697.1_Nonsense_Mutation_p.R421*|LTBP4_ENST00000204005.9_Nonsense_Mutation_p.R931*|LTBP4_ENST00000396819.3_Nonsense_Mutation_p.R901*|LTBP4_ENST00000243562.9_Nonsense_Mutation_p.R66*|LTBP4_ENST00000602240.1_3'UTR	p.R968*	NM_001042544.1	NP_001036009.1	1	2	3	2.052763	Q8N2S1	LTBP4_HUMAN	Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)	22	2902	+			O00508|O75412|O75413	Nonsense_Mutation	SNP	ENST00000308370.7	0	1	hg19	c.2902C>T		0	.	.	.	.	.	.	.	.	.	.	C	40	8.375412	0.98784	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819;ENST00000243562	.	.	.	4.42	3.32	0.38043	4.42	3.32	0.38043	.	0.436821	0.16974	N	0.191978	.	.	.	.	.	.	0.25981	N	0.982375	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	2.7137	0.05181	0.1743:0.5273:0.1922:0.1063	.	.	.	.	X	931;421;968;901;66	.	ENSP00000204005:R931X	R	+	1	2	2	LTBP4	45812081	45812081	0.474000	0.25886	0.998000	0.56505	0.950000	0.60333	0.304000	0.19228	2.280000	0.76307	0.455000	0.32223	CGA	0.207136		TCGA-HZ-8637-01A-11D-2396-08	0.662	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	97		97	96	1	1.850000	-6.193536	1	0.200000	NM_003573			6	6		346	343	0		1	0		0	0	97	0		9.643740e-01	7.568489e-01	0	1	0	154	0	6	346
ZNF576	79177	broad.mit.edu	37	19	44103397	44103397	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:44103397G>A	ENST00000336564.4	+	3	654	c.500G>A	c.(499-501)cGg>cAg	p.R167Q	ZNF576_ENST00000525771.1_Missense_Mutation_p.R167Q|SRRM5_ENST00000607544.1_Intron|ZNF576_ENST00000533118.1_Missense_Mutation_p.R167Q|ZNF576_ENST00000391965.2_Missense_Mutation_p.R167Q|ZNF576_ENST00000528387.1_Missense_Mutation_p.R167Q|ZNF576_ENST00000529930.1_Missense_Mutation_p.R167Q|SRRM5_ENST00000526798.1_Intron	NM_001145347.1	NP_001138819.1	Q9H609	ZN576_HUMAN	zinc finger protein 576	167					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|prostate(1)	2		Prostate(69;0.0199)				CGGCATGCCCGGGGGGAGCTC	0.622																																						ENST00000336564.4	1.000000	0.290000	0.780000	0.390000	0.530000	0.583222	0.530000	0.500000																										0				2						c.(499-501)cGg>cAg		zinc finger protein 576							29.0	26.0	27.0					19																	44103397		2203	4299	6502	SO:0001583	missense	79177	2	121406	32				g.chr19:44103397G>A	AK026353	CCDS12625.1	19q13.31	2013-09-20			ENSG00000124444	ENSG00000124444		"""Zinc fingers, C2H2-type"""	28357	protein-coding gene	gene with protein product						12477932	Standard	NM_024327		Approved	MGC2508	uc002owz.2	Q9H609	OTTHUMG00000165479	ENST00000336564.4:c.500G>A	chr19.hg19:g.44103397G>A	ENSP00000337852:p.Arg167Gln	0					ZNF576_ENST00000391965.2_Missense_Mutation_p.R167Q|SRRM5_ENST00000607544.1_Intron|SRRM5_ENST00000526798.1_Intron|ZNF576_ENST00000529930.1_Missense_Mutation_p.R167Q|ZNF576_ENST00000525771.1_Missense_Mutation_p.R167Q|ZNF576_ENST00000533118.1_Missense_Mutation_p.R167Q|ZNF576_ENST00000528387.1_Missense_Mutation_p.R167Q	p.R167Q	NM_001145347.1	NP_001138819.1	1	2	3	2.084900	Q9H609	ZN576_HUMAN		3	654	+		Prostate(69;0.0199)	Q9BU03	Missense_Mutation	SNP	ENST00000336564.4	1	1	hg19	c.500G>A	CCDS12625.1	0	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013050	0.75161	.	.	ENSG00000124444	ENST00000391965;ENST00000525771;ENST00000533118;ENST00000528387;ENST00000529930;ENST00000336564	T;T;T;T;T;T	0.01347	4.99;4.99;4.99;4.99;4.99;4.99	4.04	3.01	0.34805	4.04	3.01	0.34805	Zinc finger, C2H2 (1);	0.190264	0.34580	N	0.003841	T	0.01189	0.0039	L	0.41236	1.265	0.80722	D	1	P	0.47106	0.89	B	0.31547	0.132	T	0.67738	-0.5593	10	0.66056	D	0.02	-20.071	7.5009	0.27518	0.1158:0.0:0.8842:0.0	.	167	Q9H609	ZN576_HUMAN	Q	167	ENSP00000375827:R167Q;ENSP00000436182:R167Q;ENSP00000435899:R167Q;ENSP00000435934:R167Q;ENSP00000435463:R167Q;ENSP00000337852:R167Q	ENSP00000337852:R167Q	R	+	2	0	0	ZNF576	48795237	48795237	0.064000	0.20934	0.993000	0.49108	0.676000	0.39594	1.784000	0.38674	1.306000	0.44926	0.655000	0.94253	CGG	0.212598		TCGA-HZ-8637-01A-11D-2396-08	0.622	ZNF576-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384397.1	1	0	1		2	2	2	0		0	0	58		58	54	1	1.850000	-2.855906	1	0.200000	NM_024327			13	13		253	237	0		1	1		0	0	58	0		9.993556e-01	9.233555e-01	0	11	0	78	0	13	253
SIGLEC9	27180	broad.mit.edu	37	19	51629104	51629104	+	Silent	SNP	G	G	A	rs368922715		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:51629104G>A	ENST00000250360.3	+	2	739	c.672G>A	c.(670-672)acG>acA	p.T224T	SIGLEC9_ENST00000440804.3_Silent_p.T224T	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	224	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GCGTGACCACGAACAAGACCG	0.662													.|||	1	0.000199681	0.0	0.0	5008	,	,		17718	0.0		0.0	False		,,,				2504	0.001					ENST00000250360.3	1.000000	0.030000	0.170000	0.060000	0.090000	0.196056	0.090000	0.090000																										0				45						c.(670-672)acG>acA		sialic acid binding Ig-like lectin 9		G	,	1,4405		0,1,2202	86.0	82.0	84.0		672,672	-5.8	0.0	19		84	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	SIGLEC9	NM_001198558.1,NM_014441.2	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	224/480,224/464	51629104	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	27180	21	121412	46				g.chr19:51629104G>A	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.672G>A	chr19.hg19:g.51629104G>A		0					SIGLEC9_ENST00000440804.3_Silent_p.T224T	p.T224T	NM_014441.2	NP_055256.1	1	2	3	2.071109	Q9Y336	SIGL9_HUMAN		2	739	+		all_neural(266;0.0529)	Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	0	1	hg19	c.672G>A	CCDS12825.1	0																																																																																								0.210267		TCGA-HZ-8637-01A-11D-2396-08	0.662	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	0	0	1		2	2	2	0		0	0	171		171	166	1	1.850000	-2.732389	1	0.200000	NM_014441			6	6		680	671	0		1	0		0	0	171	0		9.636218e-01	4.545529e-02	0	0	0	32	0	6	680
NLRP12	91662	broad.mit.edu	37	19	54314419	54314419	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:54314419T>C	ENST00000324134.6	-	3	662	c.494A>G	c.(493-495)gAg>gGg	p.E165G	NLRP12_ENST00000391773.1_Missense_Mutation_p.E165G|NLRP12_ENST00000351894.4_Missense_Mutation_p.E165G|NLRP12_ENST00000391775.3_Missense_Mutation_p.E165G|NLRP12_ENST00000354278.3_Missense_Mutation_p.E165G|NLRP12_ENST00000535162.1_Missense_Mutation_p.E165G|NLRP12_ENST00000391772.1_Missense_Mutation_p.E165G|NLRP12_ENST00000345770.5_Missense_Mutation_p.E165G	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	165					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GTTTGAGTGCTCCTTCACCAG	0.612																																						ENST00000324134.6	1.000000	0.020000	0.190000	0.050000	0.090000	0.218211	0.090000	0.090000																										0				80						c.(493-495)gAg>gGg		NLR family, pyrin domain containing 12							77.0	72.0	74.0					19																	54314419		2203	4300	6503	SO:0001583	missense	91662	0	0					g.chr19:54314419T>C	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.494A>G	chr19.hg19:g.54314419T>C	ENSP00000319377:p.Glu165Gly	0					NLRP12_ENST00000535162.1_Missense_Mutation_p.E165G|NLRP12_ENST00000354278.3_Missense_Mutation_p.E165G|NLRP12_ENST00000391772.1_Missense_Mutation_p.E165G|NLRP12_ENST00000345770.5_Missense_Mutation_p.E165G|NLRP12_ENST00000391773.1_Missense_Mutation_p.E165G|NLRP12_ENST00000351894.4_Missense_Mutation_p.E165G|NLRP12_ENST00000391775.3_Missense_Mutation_p.E165G	p.E165G	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	1	2	3	2.088948	P59046	NAL12_HUMAN		3	662	-	Ovarian(34;0.19)		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	0	1	hg19	c.494A>G	CCDS12864.1	0	.	.	.	.	.	.	.	.	.	.	T	16.00	2.998559	0.54147	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19;-2.19;-2.19	4.25	3.21	0.36854	4.25	3.21	0.36854	.	0.156011	0.29707	N	0.011410	D	0.90745	0.7095	M	0.78801	2.425	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.66716	0.922;0.946;0.922;0.946	D	0.89923	0.4060	10	0.72032	D	0.01	.	5.111	0.14809	0.0:0.221:0.0:0.7789	.	165;165;165;165	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	G	165	ENSP00000319377:E165G;ENSP00000438030:E165G;ENSP00000340473:E165G;ENSP00000346231:E165G;ENSP00000375655:E165G;ENSP00000375653:E165G;ENSP00000375652:E165G	ENSP00000319377:E165G	E	-	2	0	0	NLRP12	59006231	59006231	0.002000	0.14202	0.979000	0.43373	0.937000	0.57800	1.332000	0.33805	1.716000	0.51395	0.254000	0.18369	GAG	0.213373		TCGA-HZ-8637-01A-11D-2396-08	0.612	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	0	0	1		15	2	2	1		1	1	143		143	142	1	1.850000	-3.286626	1	0.200000	NM_144687			5	5		607	596	0		0	0		1	0	143	0		1.783473e-02	1.112259e-04	0	0	0	2	0	5	607
NLRP7	199713	broad.mit.edu	37	19	55450705	55450705	+	Silent	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:55450705G>A	ENST00000590030.1	-	3	1522	c.1482C>T	c.(1480-1482)gcC>gcT	p.A494A	NLRP7_ENST00000328092.5_Silent_p.A494A|NLRP7_ENST00000588756.1_Silent_p.A494A|NLRP7_ENST00000448121.2_Silent_p.A494A|NLRP7_ENST00000446217.1_Silent_p.A522A|NLRP7_ENST00000340844.2_Silent_p.A494A|NLRP7_ENST00000592784.1_Silent_p.A494A			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	494							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CGATGTCCCAGGCGTGGCCGT	0.567																																						ENST00000590030.1	1.000000	0.160000	0.560000	0.230000	0.310000	0.414235	0.310000	0.290000																										0				73						c.(1480-1482)gcC>gcT		NLR family, pyrin domain containing 7							67.0	65.0	66.0					19																	55450705		2203	4300	6503	SO:0001819	synonymous_variant	199713	3	121412	36				g.chr19:55450705G>A	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1482C>T	chr19.hg19:g.55450705G>A		0					NLRP7_ENST00000446217.1_Silent_p.A522A|NLRP7_ENST00000588756.1_Silent_p.A494A|NLRP7_ENST00000592784.1_Silent_p.A494A|NLRP7_ENST00000340844.2_Silent_p.A494A|NLRP7_ENST00000328092.5_Silent_p.A494A|NLRP7_ENST00000448121.2_Silent_p.A494A	p.A494A			1	2	3	2.104591	Q8WX94	NALP7_HUMAN		3	1522	-			E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	1	1	hg19	c.1482C>T	CCDS33109.1	0																																																																																								0.216454		TCGA-HZ-8637-01A-11D-2396-08	0.567	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	0	0	1		2	2	2	0		0	0	117		117	117	1	1.850000	-12.672340	1	0.200000	NM_139176			14	14		483	475	0		1	0		0	0	117	0		9.997312e-01	2.956655e-02	0	0	0	9	0	14	483
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																						ENST00000397910.4	0.220000	0.030000	0.170000	0.060000	0.100000	0.120889	0.100000	0.100000																										0				590						c.(982-984)ccT>ccC		mucin 16, cell surface associated							96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9090831A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	chr19.hg19:g.9090831A>G		0						p.P328P	NM_024690.2	NP_078966.2	0	1	1	1.987759	Q8WXI7	MUC16_HUMAN		1	1187	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.984T>C	CCDS54212.1	0																																																																																								0.169263		TCGA-HZ-8637-01A-11D-2396-08	0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1		15	2	2	1		1	1	120		120	119	1	1.850000	-2.332097	0	0.200000	NM_024690			5	5		466	465	0		0	0		1	0	120	0		1.919073e-02	0	0	0	0	1	0	5	466
ZNF749	388567	broad.mit.edu	37	19	57956396	57956396	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr19:57956396T>C	ENST00000334181.4	+	3	2130	c.1880T>C	c.(1879-1881)cTg>cCg	p.L627P	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	627					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		CGCTGTACACTGAGTAGACAT	0.363																																						ENST00000334181.4	1.000000	0.140000	0.480000	0.190000	0.260000	0.375995	0.260000	0.240000																										0				13						c.(1879-1881)cTg>cCg		zinc finger protein 749							61.0	65.0	64.0					19																	57956396		2203	4300	6503	SO:0001583	missense	388567	0	0					g.chr19:57956396T>C	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1880T>C	chr19.hg19:g.57956396T>C	ENSP00000333980:p.Leu627Pro	0					AC004076.9_ENST00000596831.1_Intron	p.L627P	NM_001023561.2	NP_001018855.2	1	2	3	2.104591	O43361	ZN749_HUMAN		3	2130	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		Missense_Mutation	SNP	ENST00000334181.4	0	1	hg19	c.1880T>C	CCDS33132.2	0	.	.	.	.	.	.	.	.	.	.	T	14.39	2.521528	0.44866	.	.	ENSG00000186230	ENST00000334181	T	0.53857	0.6	2.36	2.36	0.29203	2.36	2.36	0.29203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.73009	0.3532	M	0.86740	2.835	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60042	-0.7340	9	0.87932	D	0	.	9.3548	0.38159	0.0:0.0:0.0:1.0	.	627	O43361	ZN749_HUMAN	P	627	ENSP00000333980:L627P	ENSP00000333980:L627P	L	+	2	0	0	ZNF749	62648208	62648208	0.071000	0.21146	0.001000	0.08648	0.364000	0.29643	2.842000	0.48230	1.069000	0.40788	0.260000	0.18958	CTG	0.216454		TCGA-HZ-8637-01A-11D-2396-08	0.363	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	0	0	1		2	2	2	0		0	0	144		144	144	1	1.850000	-11.568430	1	0.200000	NM_001023561			14	14		571	570	0		1	1		0	0	144	0		9.997545e-01	2.188233e-02	0	2	0	7	0	14	571
PBXIP1	57326	broad.mit.edu	37	1	154918663	154918663	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr1:154918663T>A	ENST00000368463.3	-	10	1558	c.1487A>T	c.(1486-1488)gAa>gTa	p.E496V	PBXIP1_ENST00000542459.1_Missense_Mutation_p.E341V|PBXIP1_ENST00000368465.1_Missense_Mutation_p.E467V|PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000539880.1_Missense_Mutation_p.E323V	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	496					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCGGCCAGATTCTTCCTTCTT	0.572																																						ENST00000368463.3	1.000000	0.040000	1.000000	0.070000	0.100000	0.317810	0.100000	0.090000																										0				24						c.(1486-1488)gAa>gTa		pre-B-cell leukemia homeobox interacting protein 1							169.0	177.0	174.0					1																	154918663		2203	4300	6503	SO:0001583	missense	57326	0	0					g.chr1:154918663T>A	AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.1487A>T	chr1.hg19:g.154918663T>A	ENSP00000357448:p.Glu496Val	1					PBXIP1_ENST00000368465.1_Missense_Mutation_p.E467V|PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000539880.1_Missense_Mutation_p.E323V|PBXIP1_ENST00000542459.1_Missense_Mutation_p.E341V	p.E496V	NM_020524.2	NP_065385.2	2	2	4	2.217894	Q96AQ6	PBIP1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)	10	1558	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	SNP	ENST00000368463.3	0	1	hg19	c.1487A>T	CCDS1074.1	0	.	.	.	.	.	.	.	.	.	.	T	9.099	1.003675	0.19121	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000351146;ENST00000539880;ENST00000543593;ENST00000542459	T;T;T;T	0.16743	2.33;2.32;2.4;2.35	5.0	-0.118	0.13547	5.0	-0.118	0.13547	.	0.910077	0.09504	N	0.793175	T	0.05868	0.0153	L	0.46157	1.445	0.25606	N	0.986545	P	0.49358	0.923	P	0.46110	0.504	T	0.18967	-1.0320	10	0.41790	T	0.15	-1.4959	1.4242	0.02319	0.1407:0.1709:0.1462:0.5422	.	496	Q96AQ6	PBIP1_HUMAN	V	467;496;496;323;272;341	ENSP00000357450:E467V;ENSP00000357448:E496V;ENSP00000440142:E323V;ENSP00000438584:E341V	ENSP00000295523:E496V	E	-	2	0	0	PBXIP1	153185287	153185287	0.002000	0.14202	0.074000	0.20217	0.034000	0.12701	-0.111000	0.10807	-0.172000	0.10779	-0.377000	0.06932	GAA	0.270073		TCGA-HZ-8637-01A-11D-2396-08	0.572	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	0	0	0		2	2	2	0		0	0	427		427	0	1	1.850000	-7.452377	1	0.200000	NM_020524			16	0		1845	0	0			1		0	0	427	0		0	9.745784e-01	0	20	0	674	0	16	1845
ARHGEF11	9826	broad.mit.edu	37	1	156914928	156914928	+	Silent	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr1:156914928C>T	ENST00000361409.2	-	29	3496	c.2754G>A	c.(2752-2754)aaG>aaA	p.K918K	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Silent_p.K958K|ARHGEF11_ENST00000315174.8_Silent_p.K334K	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	918	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CATTCACATACTTGAGAATCT	0.587																																						ENST00000361409.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				81						c.(2752-2754)aaG>aaA		Rho guanine nucleotide exchange factor (GEF) 11							93.0	97.0	95.0					1																	156914928		2203	4300	6503	SO:0001819	synonymous_variant	9826	0	0					g.chr1:156914928C>T	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2754G>A	chr1.hg19:g.156914928C>T		1					ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000315174.8_Silent_p.K334K|ARHGEF11_ENST00000368194.3_Silent_p.K958K	p.K918K	NM_014784.3	NP_055599.1	2	2	4	2.217894	O15085	ARHGB_HUMAN		29	3496	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	1	1	hg19	c.2754G>A	CCDS1162.1	1																																																																																								0.270073		TCGA-HZ-8637-01A-11D-2396-08	0.587	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	1	0	1		2	2	2	0		0	0	162		162	159	1	1.850000	-20.000000	1	0.200000	NM_198236			124	123		746	741	1		1	1		0	0	162	0		1	9.999996e-01	0	32	0	91	0	124	746
PARK7	11315	broad.mit.edu	37	1	8031011	8031011	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr1:8031011G>A	ENST00000493678.1	+	5	377	c.310G>A	c.(310-312)Gcc>Acc	p.A104T	PARK7_ENST00000377491.1_Missense_Mutation_p.A104T|PARK7_ENST00000338639.5_Missense_Mutation_p.A104T|PARK7_ENST00000377493.5_Missense_Mutation_p.A84T|PARK7_ENST00000497113.1_3'UTR|PARK7_ENST00000377488.1_Missense_Mutation_p.A104T			Q99497	PARK7_HUMAN	parkinson protein 7	104			A -> T (in PARK7). {ECO:0000269|PubMed:15254937}.		adult locomotory behavior (GO:0008344)|autophagy (GO:0006914)|cellular response to glyoxal (GO:0036471)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to oxidative stress (GO:0034599)|dopamine uptake involved in synaptic transmission (GO:0051583)|glycolate biosynthetic process (GO:0046295)|glyoxal catabolic process (GO:1903190)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|lactate biosynthetic process (GO:0019249)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|methylglyoxal catabolic process to D-lactate (GO:0019243)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of death-inducing signaling complex assembly (GO:1903073)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein acetylation (GO:1901984)|negative regulation of protein binding (GO:0032091)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein K48-linked deubiquitination (GO:1903094)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of TRAIL-activated apoptotic signaling pathway (GO:1903122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|negative regulation of ubiquitin-specific protease activity (GO:2000157)|positive regulation of androgen receptor activity (GO:2000825)|positive regulation of dopamine biosynthetic process (GO:1903181)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of L-dopa biosynthetic process (GO:1903197)|positive regulation of L-dopa decarboxylase activity (GO:1903200)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of oxidative phosphorylation uncoupler activity (GO:2000277)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of pyrroline-5-carboxylate reductase activity (GO:1903168)|positive regulation of superoxide dismutase activity (GO:1901671)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine 3-monooxygenase activity (GO:1903178)|protein stabilization (GO:0050821)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of fibril organization (GO:1902903)|regulation of inflammatory response (GO:0050727)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of neuron apoptotic process (GO:0043523)|single fertilization (GO:0007338)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|cupric ion binding (GO:1903135)|cuprous ion binding (GO:1903136)|cytokine binding (GO:0019955)|enzyme binding (GO:0019899)|glyoxalase (glycolic acid-forming) activity (GO:1990422)|glyoxalase III activity (GO:0019172)|identical protein binding (GO:0042802)|L-dopa decarboxylase activator activity (GO:0036478)|mRNA binding (GO:0003729)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|peptidase activity (GO:0008233)|peroxidase activity (GO:0004601)|peroxiredoxin activity (GO:0051920)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|repressing transcription factor binding (GO:0070491)|RNA binding (GO:0003723)|scaffold protein binding (GO:0097110)|small protein activating enzyme binding (GO:0044388)|small protein conjugating enzyme binding (GO:0044390)|superoxide dismutase copper chaperone activity (GO:0016532)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|tyrosine 3-monooxygenase activator activity (GO:0036470)|ubiquitin-specific protease binding (GO:1990381)			large_intestine(1)	1	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;1.28e-70)|GBM - Glioblastoma multiforme(8;3.05e-36)|Colorectal(212;6.83e-08)|COAD - Colon adenocarcinoma(227;7.51e-06)|Kidney(185;5.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000414)|KIRC - Kidney renal clear cell carcinoma(229;0.000967)|STAD - Stomach adenocarcinoma(132;0.00102)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGATAGCCGCCATCTGTGC	0.488																																						ENST00000493678.1	0.260000	0.040000	0.190000	0.070000	0.120000	0.140753	0.120000	0.120000																										0				1	GRCh37	CM032052	PARK7	M		c.(310-312)Gcc>Acc		parkinson protein 7							111.0	104.0	106.0					1																	8031011		2203	4300	6503	SO:0001583	missense	11315	41	121412	47				g.chr1:8031011G>A	D61380	CCDS93.1	1p36.23	2014-04-11	2011-07-21		ENSG00000116288	ENSG00000116288		"""Parkinson disease"""	16369	protein-coding gene	gene with protein product			"""Parkinson disease (autosomal recessive, early onset) 7"""			11462174, 9070310	Standard	NM_007262		Approved	DJ-1, DJ1	uc001aox.4	Q99497	OTTHUMG00000001210	ENST00000493678.1:c.310G>A	chr1.hg19:g.8031011G>A	ENSP00000418770:p.Ala104Thr	0					PARK7_ENST00000377488.1_Missense_Mutation_p.A104T|PARK7_ENST00000338639.5_Missense_Mutation_p.A104T|PARK7_ENST00000377493.5_Missense_Mutation_p.A84T|PARK7_ENST00000497113.1_3'UTR|PARK7_ENST00000377491.1_Missense_Mutation_p.A104T	p.A104T			0	1	1	2.023824	Q99497	PARK7_HUMAN		5	377	+	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)	B2R4Z1|O14805|Q6DR95|Q7LFU2	Missense_Mutation	SNP	ENST00000493678.1	0	1	hg19	c.310G>A	CCDS93.1	0	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592116	0.86953	.	.	ENSG00000116288	ENST00000338639;ENST00000493678;ENST00000377491;ENST00000377488	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	5.11	5.11	0.69529	5.11	5.11	0.69529	ThiJ/PfpI (1);	0.098549	0.64402	D	0.000001	D	0.92805	0.7712	M	0.90145	3.09	0.80722	D	1	D	0.64830	0.994	D	0.63488	0.915	D	0.93915	0.7200	10	0.72032	D	0.01	.	14.4721	0.67523	0.0:0.0:1.0:0.0	.	104	Q99497	PARK7_HUMAN	T	104	ENSP00000340278:A104T;ENSP00000418770:A104T;ENSP00000366711:A104T;ENSP00000366708:A104T	ENSP00000340278:A104T	A	+	1	0	0	PARK7	7953598	7953598	1.000000	0.71417	0.970000	0.41538	0.583000	0.36354	8.154000	0.89641	2.542000	0.85734	0.650000	0.86243	GCC	0.195980		TCGA-HZ-8637-01A-11D-2396-08	0.488	PARK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003577.1	0	0	1		2	2	2	0		0	0	102		102	102	1	1.850000	-2.319697	0	0.200000	NM_007262			5	6		413	411	0		1	1		0	0	102	0		9.375019e-01	9.998995e-01	0	3	0	2183	0	5	413
NUDC	10726	broad.mit.edu	37	1	27269375	27269375	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr1:27269375T>C	ENST00000321265.5	+	6	683	c.560T>C	c.(559-561)tTc>tCc	p.F187S		NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	187	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)				cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		GCGGTCCCTTTCTGTGTGAAC	0.617																																						ENST00000321265.5	1.000000	0.640000	1.000000	0.790000	0.960000	0.918726	0.960000	1.000000																										0				8						c.(559-561)tTc>tCc		nudC nuclear distribution protein							47.0	45.0	46.0					1																	27269375		2203	4300	6503	SO:0001583	missense	10726	0	0					g.chr1:27269375T>C		CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.560T>C	chr1.hg19:g.27269375T>C	ENSP00000319664:p.Phe187Ser	0						p.F187S	NM_006600.3	NP_006591.1	0	0	0	2.013241	Q9Y266	NUDC_HUMAN		6	683	+			Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Missense_Mutation	SNP	ENST00000321265.5	1	1	hg19	c.560T>C	CCDS292.1	1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.450465	0.63290	.	.	ENSG00000090273	ENST00000435827;ENST00000321265	T	0.76578	-1.03	5.37	5.37	0.77165	5.37	5.37	0.77165	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	D	0.84624	0.5513	M	0.73962	2.25	0.80722	D	1	P;P	0.49090	0.919;0.732	P;P	0.54499	0.754;0.551	D	0.86304	0.1682	10	0.59425	D	0.04	-1.6956	15.4283	0.75072	0.0:0.0:0.0:1.0	.	138;187	Q9H2R7;Q9Y266	.;NUDC_HUMAN	S	191;187	ENSP00000319664:F187S	ENSP00000319664:F187S	F	+	2	0	0	NUDC	27141962	27141962	1.000000	0.71417	0.939000	0.37840	0.122000	0.20287	7.697000	0.84279	2.056000	0.61249	0.451000	0.29950	TTC	0.190283		TCGA-HZ-8637-01A-11D-2396-08	0.617	NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2	1	0	1		2	2	2	0		0	0	57		57	55	1	1.850000	-20.000000	1	0.200000				24	23		220	216	1		1	1		0	0	57	0		9.999997e-01	1	0	122	0	278	0	24	220
RPA2	6118	broad.mit.edu	37	1	28240575	28240575	+	Splice_Site	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr1:28240575G>A	ENST00000373912.3	-	2	415	c.116C>T	c.(115-117)tCa>tTa	p.S39L	RPA2_ENST00000313433.7_Splice_Site_p.S127L|RPA2_ENST00000373909.3_Splice_Site_p.S47L	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa	39	Arg/Lys-rich (basic).				base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TCAACCTACTGATTTCTTTTC	0.493								Direct reversal of damage;Nucleotide excision repair (NER)																														ENST00000373912.3	0.460000	0.080000	0.340000	0.140000	0.230000	0.250808	0.230000	0.210000																										0				11						c.(115-117)tCa>tTa	Direct reversal of damage;Nucleotide excision repair (NER)	replication protein A2, 32kDa							63.0	72.0	69.0					1																	28240575		2203	4300	6503	SO:0001630	splice_region_variant	6118	0	0					g.chr1:28240575G>A	BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.117+1C>T	chr1.hg19:g.28240575G>A		0					RPA2_ENST00000313433.7_Splice_Site_p.S127L|RPA2_ENST00000373909.3_Splice_Site_p.S47L	p.S39L	NM_002946.3	NP_002937.1	0	0	0	2.013241	P15927	RFA2_HUMAN		2	415	-		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)	Q52II0|Q5TEI9|Q5TEJ5	Splice_Site	SNP	ENST00000373912.3	0	1	hg19	c.116C>T	CCDS314.1	0	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126577	0.56721	.	.	ENSG00000117748	ENST00000373912;ENST00000373909;ENST00000313433;ENST00000444045	T;T;T;T	0.25085	2.12;2.12;2.09;1.82	4.59	4.59	0.56863	4.59	4.59	0.56863	.	0.415066	0.27088	N	0.020998	T	0.31482	0.0798	L	0.53249	1.67	0.42689	D	0.993576	B;P	0.35944	0.161;0.529	B;B	0.39840	0.081;0.311	T	0.20706	-1.0267	10	0.59425	D	0.04	-0.0166	16.5256	0.84330	0.0:0.0:1.0:0.0	.	39;47	P15927;P15927-2	RFA2_HUMAN;.	L	39;47;127;43	ENSP00000363021:S39L;ENSP00000363017:S47L;ENSP00000363015:S127L;ENSP00000387649:S43L	ENSP00000363015:S127L	S	-	2	0	0	RPA2	28113162	28113162	0.998000	0.40836	0.966000	0.40874	0.153000	0.21895	2.806000	0.47947	2.261000	0.74972	0.555000	0.69702	TCA	0.190283		TCGA-HZ-8637-01A-11D-2396-08	0.493	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011179.1	0	0	1		2	2	2	0		0	0	56		56	56	1	1.850000	-6.462785	1	0.200000	NM_002946	Missense_Mutation		5	5		225	223	0		1	1		0	0	56	0		9.367836e-01	9.675937e-01	0	5	0	284	0	5	225
ASPM	259266	broad.mit.edu	37	1	197072159	197072159	+	Silent	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr1:197072159C>T	ENST00000367409.4	-	18	6478	c.6222G>A	c.(6220-6222)caG>caA	p.Q2074Q	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2074	IQ 15. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.Q2074Q(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GATACCATCTCTGAATTATAA	0.323																																						ENST00000367409.4	1.000000	0.210000	1.000000	0.270000	0.350000	0.497786	0.350000	0.330000																										1	Substitution - coding silent(1)	p.Q2074Q(1)	cervix(1)	165						c.(6220-6222)caG>caA		asp (abnormal spindle) homolog, microcephaly associated (Drosophila)							74.0	81.0	79.0					1																	197072159		2202	4293	6495	SO:0001819	synonymous_variant	259266	0	0					g.chr1:197072159C>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6222G>A	chr1.hg19:g.197072159C>T		1					ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	p.Q2074Q	NM_018136.4	NP_060606.3	2	2	4	2.217894	Q8IZT6	ASPM_HUMAN		18	6478	-			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	1	1	hg19	c.6222G>A	CCDS1389.1	0																																																																																								0.270073		TCGA-HZ-8637-01A-11D-2396-08	0.323	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	0	0	1		2	2	2	0		0	0	103		103	103	1	1.850000	-2.936055	1	0.200000	NM_018136			21	21		689	684	0		1	1		0	0	103	0		9.999973e-01	1.173547e-01	0	2	0	17	0	21	689
SLC12A5	57468	broad.mit.edu	37	20	44685057	44685057	+	Silent	SNP	C	C	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr20:44685057C>A	ENST00000454036.2	+	23	3082	c.3033C>A	c.(3031-3033)tcC>tcA	p.S1011S	SLC12A5_ENST00000243964.3_Silent_p.S988S	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1011					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCTCCCCGTCCCCAGGGGAGG	0.607																																						ENST00000454036.2	1.000000	0.090000	0.500000	0.160000	0.270000	0.366043	0.270000	0.240000																										0				80						c.(3031-3033)tcC>tcA		solute carrier family 12 (potassium/chloride transporter), member 5	Bumetanide(DB00887)|Potassium Chloride(DB00761)						34.0	33.0	34.0					20																	44685057		2203	4300	6503	SO:0001819	synonymous_variant	57468	0	0					g.chr20:44685057C>A	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3033C>A	chr20.hg19:g.44685057C>A		0					SLC12A5_ENST00000243964.3_Silent_p.S988S	p.S1011S	NM_001134771.1	NP_001128243.1	1	2	3	2.082053	Q9H2X9	S12A5_HUMAN		23	3082	+		Myeloproliferative disorder(115;0.0122)	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	0	1	hg19	c.3033C>A	CCDS46610.1	0																																																																																								0.212598		TCGA-HZ-8637-01A-11D-2396-08	0.607	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1	0	0	1		2	2	2	0		0	0	57		57	57	1	1.850000	-6.948549	1	0.200000				5	5		211	209	0		1	0		0	0	57	0		9.367370e-01	8.797285e-04	0	0	0	2	0	5	211
ZNF831	128611	broad.mit.edu	37	20	57766652	57766652	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr20:57766652C>T	ENST00000371030.2	+	1	578	c.578C>T	c.(577-579)aCg>aTg	p.T193M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	193							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CACAGGCGGACGCAGACGCAC	0.662																																						ENST00000371030.2	1.000000	0.020000	0.160000	0.050000	0.080000	0.205699	0.080000	0.080000																										0				125						c.(577-579)aCg>aTg		zinc finger protein 831							48.0	56.0	54.0					20																	57766652		2055	4202	6257	SO:0001583	missense	128611	0	0					g.chr20:57766652C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.578C>T	chr20.hg19:g.57766652C>T	ENSP00000360069:p.Thr193Met	0						p.T193M	NM_178457.1	NP_848552.1	1	2	3	2.082053	Q5JPB2	ZN831_HUMAN		1	578	+	all_lung(29;0.0085)		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	0	1	hg19	c.578C>T	CCDS42894.1	0	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690629	0.48097	.	.	ENSG00000124203	ENST00000371030	T	0.31510	1.49	5.41	4.45	0.53987	5.41	4.45	0.53987	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42832	0.1220	L	0.27053	0.805	0.41770	D	0.989768	D	0.89917	1.0	D	0.85130	0.997	T	0.45614	-0.9249	9	0.87932	D	0	-12.0165	14.5325	0.67936	0.1475:0.8525:0.0:0.0	.	193	Q5JPB2	ZN831_HUMAN	M	193	ENSP00000360069:T193M	ENSP00000360069:T193M	T	+	2	0	0	ZNF831	57200047	57200047	1.000000	0.71417	0.993000	0.49108	0.156000	0.22039	7.755000	0.85180	1.259000	0.44117	0.561000	0.74099	ACG	0.212598		TCGA-HZ-8637-01A-11D-2396-08	0.662	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	0	0	1		2	2	2	0		0	0	175		175	174	1	1.850000	-3.190266	1	0.200000	NM_178457			6	6		766	749	0		1	0		0	0	175	0		9.625691e-01	0	0	0	0	1	0	6	766
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F|U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000486519.1_5'UTR	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																	ENST00000291552.4	1.000000	0.590000	1.000000	0.720000	0.880000	0.871420	0.880000	1.000000				Dom	yes			Dom	yes		21	21q22.3	21q22.3	7307	Mis	U2 small nuclear RNA auxiliary factor 1				L	L			CLL, MDS		57	Substitution - Missense(57)	p.S34F(45)|p.S34Y(12)	haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)	126						c.(100-102)tCt>tTt		U2 small nuclear RNA auxiliary factor 1		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307	5	121412	36				g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	chr21.hg19:g.44524456G>A	ENSP00000291552:p.Ser34Phe	0					U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F	p.S34F	NM_006758.2	NP_006749.1	0	0	0	1.940263	Q01081	U2AF1_HUMAN		2	193	-			Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	1	1	hg19	c.101C>T	CCDS13694.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	0	U2AF1	43397525	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT	0.159664		TCGA-HZ-8637-01A-11D-2396-08	0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	1	0	1		2	2	2	0		0	0	81		81	80	1	1.850000	-3.142704	1	0.200000	NM_006758			24	24		232	228	1		1	1	1	0	0	81	366		9.999997e-01	1	1	54	51	372	495	24	232
RNF149	284996	broad.mit.edu	37	2	101898405	101898405	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:101898405G>A	ENST00000295317.3	-	6	1182	c.1075C>T	c.(1075-1077)Cca>Tca	p.P359S		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	359					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCTGATGGTGGACTGCTGTCA	0.507																																					Colon(25;331 612 6521 7355 31028)	ENST00000295317.3	0.180000	0.030000	0.140000	0.050000	0.090000	0.103117	0.090000	0.090000																										0				12						c.(1075-1077)Cca>Tca		ring finger protein 149							168.0	150.0	157.0					2																	101898405		2203	4300	6503	SO:0001583	missense	284996	0	0					g.chr2:101898405G>A	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.1075C>T	chr2.hg19:g.101898405G>A	ENSP00000295317:p.Pro359Ser	0						p.P359S	NM_173647.3	NP_775918.2	0	0	0	2.007592	Q8NC42	RN149_HUMAN		6	1182	-			Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	0	1	hg19	c.1075C>T	CCDS2051.1	0	.	.	.	.	.	.	.	.	.	.	G	6.110	0.388625	0.11581	.	.	ENSG00000163162	ENST00000295317	T	0.09255	3.0	5.63	0.874	0.19124	5.63	0.874	0.19124	.	1.265960	0.05900	N	0.629823	T	0.02888	0.0086	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40608	-0.9554	10	0.06099	T	0.92	.	4.9472	0.13994	0.5279:0.0:0.3314:0.1408	.	359	Q8NC42	RN149_HUMAN	S	359	ENSP00000295317:P359S	ENSP00000295317:P359S	P	-	1	0	0	RNF149	101264837	101264837	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.576000	0.23744	0.190000	0.20209	0.563000	0.77884	CCA	0.188641		TCGA-HZ-8637-01A-11D-2396-08	0.507	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	0	0	1		2	2	2	0		0	0	195		195	195	1	1.850000	-3.062763	1	0.200000	NM_173647			6	7		657	651	0		1	1		0	0	195	0		9.642608e-01	9.380382e-01	0	8	0	538	0	6	657
CSRNP3	80034	broad.mit.edu	37	2	166514474	166514474	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:166514474C>T	ENST00000342316.4	+	3	624	c.352C>T	c.(352-354)Cgg>Tgg	p.R118W	CSRNP3_ENST00000409420.1_Missense_Mutation_p.R150W|CSRNP3_ENST00000314499.7_Missense_Mutation_p.R118W	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	118					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						GAGGCTCCACCGGGAGATGTT	0.507																																						ENST00000342316.4	1.000000	0.600000	1.000000	0.740000	0.900000	0.881519	0.900000	1.000000																										0				33						c.(352-354)Cgg>Tgg		cysteine-serine-rich nuclear protein 3							52.0	47.0	48.0					2																	166514474		2203	4300	6503	SO:0001583	missense	80034	2	121408	31				g.chr2:166514474C>T	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.352C>T	chr2.hg19:g.166514474C>T	ENSP00000344042:p.Arg118Trp	0					CSRNP3_ENST00000314499.7_Missense_Mutation_p.R118W|CSRNP3_ENST00000409420.1_Missense_Mutation_p.R150W	p.R118W	NM_024969.3	NP_079245.2	0	0	0	2.007592	Q8WYN3	CSRN3_HUMAN		3	624	+			B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	1	1	hg19	c.352C>T	CCDS2225.1	1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553765	0.65425	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000409664;ENST00000342316;ENST00000409420	T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47	5.44	3.43	0.39272	5.44	3.43	0.39272	.	0.108850	0.64402	D	0.000015	T	0.32704	0.0838	L	0.59912	1.85	0.43160	D	0.994949	D	0.71674	0.998	P	0.59643	0.861	T	0.14172	-1.0482	10	0.56958	D	0.05	-9.7028	14.2181	0.65807	0.3795:0.6205:0.0:0.0	.	118	Q8WYN3	CSRN3_HUMAN	W	118;125;118;118;118;150	ENSP00000412081:R118W;ENSP00000318258:R118W;ENSP00000386278:R118W;ENSP00000344042:R118W;ENSP00000387195:R150W	ENSP00000318258:R118W	R	+	1	2	2	CSRNP3	166222720	166222720	1.000000	0.71417	0.999000	0.59377	0.583000	0.36354	2.123000	0.41996	1.263000	0.44181	0.563000	0.77884	CGG	0.188641		TCGA-HZ-8637-01A-11D-2396-08	0.507	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	1	0	1		2	2	2	0		0	0	84		84	84	1	1.850000	-2.879461	1	0.200000	NM_024969			25	25		248	245	0		1	0		0	0	84	0		9.999999e-01	9.249012e-03	0	0	0	2	0	25	248
FN1	2335	broad.mit.edu	37	2	216246983	216246983	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:216246983G>C	ENST00000359671.1	-	31	5108	c.4843C>G	c.(4843-4845)Cag>Gag	p.Q1615E	FN1_ENST00000421182.1_Missense_Mutation_p.Q1615E|FN1_ENST00000345488.5_Missense_Mutation_p.Q1615E|FN1_ENST00000357867.4_Missense_Mutation_p.Q1615E|FN1_ENST00000323926.6_Missense_Mutation_p.Q1706E|FN1_ENST00000446046.1_Missense_Mutation_p.Q1615E|FN1_ENST00000443816.1_Missense_Mutation_p.Q1615E|FN1_ENST00000354785.4_Missense_Mutation_p.Q1706E|FN1_ENST00000356005.4_Missense_Mutation_p.Q1615E|FN1_ENST00000490833.1_5'UTR|FN1_ENST00000432072.2_Missense_Mutation_p.Q1706E|FN1_ENST00000336916.4_Missense_Mutation_p.Q1615E|FN1_ENST00000346544.3_Missense_Mutation_p.Q1615E|FN1_ENST00000357009.2_Missense_Mutation_p.Q1615E			P02751	FINC_HUMAN	fibronectin 1	1615	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CTTGGATTCTGAGCATAGACA	0.448																																						ENST00000359671.1	1.000000	0.700000	1.000000	0.840000	0.990000	0.945640	0.990000	1.000000																									FN1/ALK(2)	0				109						c.(4843-4845)Cag>Gag		fibronectin 1	Ocriplasmin(DB08888)						100.0	90.0	94.0					2																	216246983		2203	4300	6503	SO:0001583	missense	2335	0	0					g.chr2:216246983G>C		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4843C>G	chr2.hg19:g.216246983G>C	ENSP00000352696:p.Gln1615Glu	1					FN1_ENST00000357867.4_Missense_Mutation_p.Q1615E|FN1_ENST00000345488.5_Missense_Mutation_p.Q1615E|FN1_ENST00000336916.4_Missense_Mutation_p.Q1615E|FN1_ENST00000432072.2_Missense_Mutation_p.Q1706E|FN1_ENST00000446046.1_Missense_Mutation_p.Q1615E|FN1_ENST00000357009.2_Missense_Mutation_p.Q1615E|FN1_ENST00000346544.3_Missense_Mutation_p.Q1615E|FN1_ENST00000356005.4_Missense_Mutation_p.Q1615E|FN1_ENST00000323926.6_Missense_Mutation_p.Q1706E|FN1_ENST00000421182.1_Missense_Mutation_p.Q1615E|FN1_ENST00000490833.1_5'UTR|FN1_ENST00000354785.4_Missense_Mutation_p.Q1706E|FN1_ENST00000443816.1_Missense_Mutation_p.Q1615E	p.Q1615E			0	4	4	2.189860	P02751	FINC_HUMAN		31	5108	-		Renal(323;0.127)	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	1	1	hg19	c.4843C>G		1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403313	0.62288	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.089806	0.48286	D	0.000200	T	0.65893	0.2735	L	0.34521	1.04	0.20638	N	0.999873	D;P;P;P;D;D;D;D;D;P;P;D	0.62365	0.991;0.904;0.946;0.478;0.975;0.989;0.991;0.971;0.981;0.946;0.946;0.973	D;D;D;P;P;D;D;P;D;D;D;D	0.79784	0.993;0.953;0.953;0.693;0.832;0.989;0.993;0.77;0.993;0.953;0.953;0.98	T	0.60974	-0.7156	10	0.72032	D	0.01	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	1406;1615;1706;1706;1615;1615;1615;1615;1616;1615;1615;1706	Q68CX6;F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.;.	E	1615;1706;1615;1615;1706;1616;1615;1615;1615;1615;1615;1615;1706;1615;422	ENSP00000394423:Q1615E;ENSP00000323534:Q1706E;ENSP00000338200:Q1615E;ENSP00000350534:Q1615E;ENSP00000346839:Q1706E;ENSP00000352696:Q1615E;ENSP00000265312:Q1615E;ENSP00000273049:Q1615E;ENSP00000349509:Q1615E;ENSP00000410422:Q1615E;ENSP00000415018:Q1615E;ENSP00000399538:Q1706E;ENSP00000348285:Q1615E;ENSP00000416139:Q422E	ENSP00000265313:Q1616E	Q	-	1	0	0	FN1	215955228	215955228	1.000000	0.71417	0.988000	0.46212	0.692000	0.40212	6.444000	0.73452	2.793000	0.96121	0.655000	0.94253	CAG	0.260628		TCGA-HZ-8637-01A-11D-2396-08	0.448	FN1-204	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	104		104	104	1	1.850000	-2.920854	1	0.200000	NM_212476			32	33		324	323	0		1	1		0	0	104	0		1	1	0	32	0	3395	0	32	324
COL4A4	1286	broad.mit.edu	37	2	227945177	227945177	+	Silent	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:227945177T>C	ENST00000396625.3	-	24	1992	c.1785A>G	c.(1783-1785)aaA>aaG	p.K595K	COL4A4_ENST00000329662.7_Silent_p.K595K	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	595	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CTGGATCCCCTTTTTCTCCAG	0.463																																						ENST00000396625.3	1.000000	0.040000	1.000000	0.070000	0.120000	0.321440	0.120000	0.110000																										0				98						c.(1783-1785)aaA>aaG		collagen, type IV, alpha 4							126.0	126.0	126.0					2																	227945177		1858	4099	5957	SO:0001819	synonymous_variant	1286	0	0					g.chr2:227945177T>C		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1785A>G	chr2.hg19:g.227945177T>C		1					COL4A4_ENST00000329662.7_Silent_p.K595K	p.K595K	NM_000092.4	NP_000083.3	0	4	4	2.189860	P53420	CO4A4_HUMAN		24	1992	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	0	1	hg19	c.1785A>G	CCDS42828.1	0																																																																																								0.260628		TCGA-HZ-8637-01A-11D-2396-08	0.463	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	0	0	1		2	2	2	0		0	0	217		217	216	1	1.850000	-1.708373	0	0.200000	NM_000092			9	10		937	930	0		1	0		0	0	217	0		9.940257e-01	5.133982e-03	0	0	0	10	0	9	937
LRRTM1	347730	broad.mit.edu	37	2	80530477	80530477	+	Silent	SNP	G	G	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:80530477G>T	ENST00000295057.3	-	2	1124	c.468C>A	c.(466-468)ctC>ctA	p.L156L	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000541047.1_Intron|LRRTM1_ENST00000409148.1_Silent_p.L156L|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	156					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GCCCGTGGAAGAGGTCGGGCG	0.637										HNSCC(69;0.2)																												ENST00000295057.3	0.410000	0.140000	0.340000	0.190000	0.250000	0.270987	0.250000	0.250000																										0				63						c.(466-468)ctC>ctA		leucine rich repeat transmembrane neuronal 1							81.0	88.0	85.0					2																	80530477		2203	4300	6503	SO:0001819	synonymous_variant	347730	0	0					g.chr2:80530477G>T	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.468C>A	chr2.hg19:g.80530477G>T		0	HNSCC(69;0.2)				LRRTM1_ENST00000409148.1_Silent_p.L156L|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000541047.1_Intron	p.L156L	NM_178839.4	NP_849161.2	0	0	0	1.961225	Q86UE6	LRRT1_HUMAN		2	1124	-			A8K397|D6W5K1|Q96DN1	Silent	SNP	ENST00000295057.3	0	1	hg19	c.468C>A	CCDS1966.1	0																																																																																								0.168399		TCGA-HZ-8637-01A-11D-2396-08	0.637	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	0	0	1		2	2	2	0		0	0	110		110	110	1	1.850000	-3.731229	1	0.200000	NM_178839			13	13		477	471	0		1	0		0	0	110	0		9.995052e-01	8.111271e-03	0	0	0	5	0	13	477
SNRNP200	23020	broad.mit.edu	37	2	96943638	96943638	+	Silent	SNP	C	C	T	rs191125461		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:96943638C>T	ENST00000323853.5	-	40	5738	c.5661G>A	c.(5659-5661)ccG>ccA	p.P1887P	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1887	SEC63 2.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCTTGACGTGCGGATCATTGA	0.498													C|||	1	0.000199681	0.0	0.0014	5008	,	,		24027	0.0		0.0	False		,,,				2504	0.0					ENST00000323853.5	0.390000	0.160000	0.330000	0.210000	0.260000	0.276215	0.260000	0.260000																										0				90						c.(5659-5661)ccG>ccA		small nuclear ribonucleoprotein 200kDa (U5)							133.0	140.0	138.0					2																	96943638		2203	4300	6503	SO:0001819	synonymous_variant	23020	8	121412	42				g.chr2:96943638C>T	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.5661G>A	chr2.hg19:g.96943638C>T		0					SNRNP200_ENST00000349783.5_Intron	p.P1887P	NM_014014.4	NP_054733.2	0	0	0	2.007592	O75643	U520_HUMAN		40	5738	-			O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	ENST00000323853.5	1	1	hg19	c.5661G>A	CCDS2020.1	0																																																																																								0.188641		TCGA-HZ-8637-01A-11D-2396-08	0.498	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	0	0	1		2	2	2	0		0	0	188		188	188	1	1.850000	-2.881146	1	0.200000	NM_014014			21	21		758	753	0		1	1		0	0	188	0		9.999973e-01	9.992998e-01	0	40	0	373	0	21	758
ALPPL2	251	broad.mit.edu	37	2	233273223	233273223	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr2:233273223G>A	ENST00000295453.3	+	7	848	c.796G>A	c.(796-798)Gtg>Atg	p.V266M		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	266					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	TGCCCGGTACGTGTGGAACCG	0.677																																						ENST00000295453.3	1.000000	0.910000	1.000000	0.990000	0.990000	0.993494	0.990000	1.000000																										0				13						c.(796-798)Gtg>Atg		alkaline phosphatase, placental-like 2	Amifostine(DB01143)						83.0	77.0	79.0					2																	233273223		2201	4283	6484	SO:0001583	missense	251	2	121288	30				g.chr2:233273223G>A	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.796G>A	chr2.hg19:g.233273223G>A	ENSP00000295453:p.Val266Met	1						p.V266M	NM_031313.2	NP_112603.2	0	4	4	2.222046	P10696	PPBN_HUMAN		7	848	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	1	1	hg19	c.796G>A	CCDS2491.1	1	.	.	.	.	.	.	.	.	.	.	g	17.79	3.475270	0.63737	.	.	ENSG00000163286	ENST00000295453	D	0.98313	-4.86	3.37	3.37	0.38596	3.37	3.37	0.38596	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99309	0.9758	H	0.97587	4.035	0.51233	D	0.99991	D	0.89917	1.0	D	0.83275	0.996	D	0.98561	1.0641	10	0.87932	D	0	.	15.0806	0.72110	0.0:0.0:1.0:0.0	.	266	P10696	PPBN_HUMAN	M	266	ENSP00000295453:V266M	ENSP00000295453:V266M	V	+	1	0	0	ALPPL2	232981467	232981467	1.000000	0.71417	0.667000	0.29798	0.103000	0.19146	4.761000	0.62243	1.572000	0.49736	0.411000	0.27672	GTG	0.333333		TCGA-HZ-8637-01A-11D-2396-08	0.677	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	1	0	0		2	2	2	0		0	0	193		193	200	1	1.850000	-19.999930	1	0.200000	NM_031313			91	91		884	876	0		1	0		0	0	193	0		1	8.954418e-03	0	1	0	1	0	91	884
MYH15	22989	broad.mit.edu	37	3	108129678	108129678	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr3:108129678T>C	ENST00000273353.3	-	32	4363	c.4307A>G	c.(4306-4308)gAg>gGg	p.E1436G		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1436						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GTCCCCGAGCTCCAGCTGCAG	0.627																																						ENST00000273353.3	0.740000	0.290000	0.620000	0.380000	0.490000	0.506228	0.490000	0.480000																										0				105						c.(4306-4308)gAg>gGg		myosin, heavy chain 15							35.0	37.0	36.0					3																	108129678		2054	4193	6247	SO:0001583	missense	22989	0	0					g.chr3:108129678T>C	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4307A>G	chr3.hg19:g.108129678T>C	ENSP00000273353:p.Glu1436Gly	1						p.E1436G	NM_014981.1	NP_055796.1	0	0	0	1.894115	Q9Y2K3	MYH15_HUMAN		32	4363	-				Missense_Mutation	SNP	ENST00000273353.3	1	1	hg19	c.4307A>G	CCDS43127.1	0	.	.	.	.	.	.	.	.	.	.	T	16.96	3.267172	0.59540	.	.	ENSG00000144821	ENST00000273353	D	0.85629	-2.01	5.2	5.2	0.72013	5.2	5.2	0.72013	Myosin tail (1);	.	.	.	.	D	0.93141	0.7816	M	0.88512	2.96	0.54753	D	0.999989	D	0.69078	0.997	D	0.73708	0.981	D	0.94435	0.7653	9	0.87932	D	0	.	15.0504	0.71865	0.0:0.0:0.0:1.0	.	1436	Q9Y2K3	MYH15_HUMAN	G	1436	ENSP00000273353:E1436G	ENSP00000273353:E1436G	E	-	2	0	0	MYH15	109612368	109612368	1.000000	0.71417	0.076000	0.20297	0.040000	0.13550	5.798000	0.69095	1.962000	0.57031	0.459000	0.35465	GAG	0.139785		TCGA-HZ-8637-01A-11D-2396-08	0.627	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	1	0	1		2	2	2	0		0	0	69		69	68	1	1.850000	-18.290660	1	0.200000	XM_036988			16	16		288	285	0		1	0		0	0	69	0		9.999342e-01	0	0	1	0	0	0	16	288
TRANK1	9881	broad.mit.edu	37	3	36872996	36872996	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr3:36872996T>A	ENST00000429976.2	-	21	8193	c.7946A>T	c.(7945-7947)gAg>gTg	p.E2649V	TRANK1_ENST00000428977.2_Missense_Mutation_p.E2099V|TRANK1_ENST00000301807.6_Missense_Mutation_p.E2099V	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2649							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TTCATCCATCTCATCCTGGCC	0.532																																						ENST00000429976.2	0.970000	0.380000	0.870000	0.530000	0.690000	0.701561	0.690000	0.700000																										0				73						c.(7945-7947)gAg>gTg		tetratricopeptide repeat and ankyrin repeat containing 1							71.0	73.0	72.0					3																	36872996		2058	4189	6247	SO:0001583	missense	9881	0	0					g.chr3:36872996T>A	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7946A>T	chr3.hg19:g.36872996T>A	ENSP00000416168:p.Glu2649Val	1					TRANK1_ENST00000428977.2_Missense_Mutation_p.E2099V|TRANK1_ENST00000301807.6_Missense_Mutation_p.E2099V	p.E2649V	NM_014831.2	NP_055646.2	0	1	1	1.845907	O15050	TRNK1_HUMAN		21	8193	-			Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	1	1	hg19	c.7946A>T	CCDS46789.2	0	.	.	.	.	.	.	.	.	.	.	T	13.18	2.160380	0.38119	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.35236	1.32;1.73;1.32	5.6	4.41	0.53225	5.6	4.41	0.53225	.	0.096709	0.44902	D	0.000403	T	0.31482	0.0798	M	0.65975	2.015	0.30121	N	0.805724	P	0.40731	0.728	B	0.28139	0.086	T	0.43734	-0.9373	10	0.87932	D	0	.	11.1111	0.48232	0.0:0.0:0.1553:0.8447	.	2649	O15050	TRNK1_HUMAN	V	2099;2649;2099	ENSP00000416826:E2099V;ENSP00000416168:E2649V;ENSP00000301807:E2099V	ENSP00000301807:E2099V	E	-	2	0	0	TRANK1	36848000	36848000	0.949000	0.32298	0.652000	0.29579	0.537000	0.34900	2.449000	0.44935	1.035000	0.39972	0.459000	0.35465	GAG	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.532	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	34		34	34	1	1.850000	-5.970849	1	0.200000	NM_014831			11	11		123	122	1		1	1		0	0	34	0		9.985014e-01	9.927052e-01	0	8	0	90	0	11	123
GRM2	2912	broad.mit.edu	37	3	51743379	51743379	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr3:51743379C>T	ENST00000395052.3	+	2	614	c.380C>T	c.(379-381)gCg>gTg	p.A127V	GRM2_ENST00000442933.2_Missense_Mutation_p.A127V|GRM2_ENST00000475478.1_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	127					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCTCTTATGCGACCCATGGT	0.587																																						ENST00000395052.3	0.450000	0.080000	0.330000	0.140000	0.220000	0.243949	0.220000	0.210000																										0				33						c.(379-381)gCg>gTg		glutamate receptor, metabotropic 2							59.0	46.0	50.0					3																	51743379		2203	4297	6500	SO:0001583	missense	2912	2	121292	29				g.chr3:51743379C>T	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.380C>T	chr3.hg19:g.51743379C>T	ENSP00000378492:p.Ala127Val	1					GRM2_ENST00000442933.2_Missense_Mutation_p.A127V|GRM2_ENST00000475478.1_Intron	p.A127V	NM_000839.3	NP_000830.2	0	1	1	1.845907	Q14416	GRM2_HUMAN		2	614	+			B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	0	1	hg19	c.380C>T	CCDS2834.1	0	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981130	0.93044	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.84589	-1.87;-1.87	5.42	5.42	0.78866	5.42	5.42	0.78866	Extracellular ligand-binding receptor (1);	0.062472	0.64402	D	0.000006	D	0.85500	0.5711	L	0.37630	1.12	0.80722	D	1	P	0.48230	0.907	P	0.49887	0.625	D	0.86902	0.2055	10	0.66056	D	0.02	.	19.2362	0.93861	0.0:1.0:0.0:0.0	.	127	Q14416	GRM2_HUMAN	V	127	ENSP00000378492:A127V;ENSP00000408906:A127V	ENSP00000296479:A127V	A	+	2	0	0	GRM2	51718419	51718419	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	6.026000	0.70873	2.555000	0.86185	0.655000	0.94253	GCG	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.587	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1	0	0	1		2	2	2	0		0	0	31		31	29	1	1.850000	-3.730703	1	0.200000				5	6		206	202	0		1	0		0	0	31	0		9.359187e-01	0	0	0	0	1	0	5	206
EPHA3	2042	broad.mit.edu	37	3	89445093	89445093	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr3:89445093G>C	ENST00000336596.2	+	6	1638	c.1413G>C	c.(1411-1413)gaG>gaC	p.E471D	EPHA3_ENST00000452448.2_Missense_Mutation_p.E471D|EPHA3_ENST00000494014.1_Missense_Mutation_p.E471D	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	471	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TGGACTACGAGGTCAAATACT	0.448										TSP Lung(6;0.00050)																												ENST00000336596.2	1.000000	0.040000	0.160000	0.070000	0.100000	0.148035	0.100000	0.110000																										0				139						c.(1411-1413)gaG>gaC		EPH receptor A3							181.0	172.0	175.0					3																	89445093		2203	4300	6503	SO:0001583	missense	2042	0	0					g.chr3:89445093G>C	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1413G>C	chr3.hg19:g.89445093G>C	ENSP00000337451:p.Glu471Asp	0	TSP Lung(6;0.00050)				EPHA3_ENST00000452448.2_Missense_Mutation_p.E471D|EPHA3_ENST00000494014.1_Missense_Mutation_p.E471D	p.E471D	NM_005233.5	NP_005224.2	1	2	3	2.097673	P29320	EPHA3_HUMAN		6	1638	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	0	1	hg19	c.1413G>C	CCDS2922.1	0	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668961	0.67814	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.59083	0.29;0.29;0.29	5.96	4.18	0.49190	5.96	4.18	0.49190	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70228	0.3200	M	0.64260	1.97	0.58432	D	0.999992	D;D	0.71674	0.997;0.998	D;D	0.79108	0.992;0.971	T	0.68758	-0.5324	9	.	.	.	.	10.9314	0.47220	0.1937:0.0:0.8063:0.0	.	471;471	P29320;P29320-2	EPHA3_HUMAN;.	D	471	ENSP00000337451:E471D;ENSP00000399926:E471D;ENSP00000419190:E471D	.	E	+	3	2	2	EPHA3	89527783	89527783	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.525000	0.53502	0.863000	0.35553	0.655000	0.94253	GAG	0.269406		TCGA-HZ-8637-01A-11D-2396-08	0.448	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	0	0	1		2	2	2	0		0	0	250		250	248	1	1.850000	-2.619468	1	0.200000	NM_005233			10	10		1038	1029	0		1	0		0	0	250	0		9.967402e-01	6.004571e-02	0	0	0	37	0	10	1038
PLXNA1	5361	broad.mit.edu	37	3	126736303	126736303	+	Silent	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr3:126736303C>T	ENST00000393409.2	+	17	3312	c.3312C>T	c.(3310-3312)tgC>tgT	p.C1104C	PLXNA1_ENST00000251772.4_Silent_p.C1081C	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1104	IPT/TIG 3.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CCATGGTATGCCGCGCCCCGT	0.677																																						ENST00000393409.2	0.260000	0.040000	0.200000	0.080000	0.130000	0.143344	0.130000	0.120000																										0				67						c.(3310-3312)tgC>tgT		plexin A1							47.0	48.0	48.0					3																	126736303		2203	4299	6502	SO:0001819	synonymous_variant	5361	0	0					g.chr3:126736303C>T	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3312C>T	chr3.hg19:g.126736303C>T		1					PLXNA1_ENST00000251772.4_Silent_p.C1081C	p.C1104C	NM_032242.3	NP_115618.3	0	0	0	1.894115	Q9UIW2	PLXA1_HUMAN		17	3312	+				Silent	SNP	ENST00000393409.2	0	1	hg19	c.3312C>T	CCDS33847.2	0																																																																																								0.139785		TCGA-HZ-8637-01A-11D-2396-08	0.677	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	0	0	1		2	2	2	0		0	0	80		80	80	1	1.850000	-3.112449	1	0.200000	NM_032242			5	5		376	370	0		1	0		0	0	80	0		9.352974e-01	2.862245e-01	0	0	0	68	0	5	376
SNX2	6643	broad.mit.edu	37	5	122152644	122152644	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr5:122152644G>A	ENST00000379516.2	+	9	941	c.833G>A	c.(832-834)gGa>gAa	p.G278E	SNX2_ENST00000510372.1_3'UTR|SNX2_ENST00000514949.1_Missense_Mutation_p.G161E	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	278					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		GCTCTGAGTGGAGCAGGAATA	0.443																																						ENST00000379516.2	0.520000	0.110000	0.390000	0.180000	0.270000	0.292762	0.270000	0.260000																										0				19						c.(832-834)gGa>gAa		sorting nexin 2							71.0	69.0	69.0					5																	122152644		2203	4300	6503	SO:0001583	missense	6643	0	0					g.chr5:122152644G>A	AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.833G>A	chr5.hg19:g.122152644G>A	ENSP00000368831:p.Gly278Glu	1					SNX2_ENST00000514949.1_Missense_Mutation_p.G161E|SNX2_ENST00000510372.1_3'UTR	p.G278E	NM_003100.2	NP_003091.2	0	0	0	1.892832	O60749	SNX2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	9	941	+		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Missense_Mutation	SNP	ENST00000379516.2	0	1	hg19	c.833G>A	CCDS34217.1	0	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778916	0.90195	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	T;T	0.27104	1.74;1.69	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.161709	0.56097	D	0.000027	T	0.43478	0.1249	M	0.87180	2.865	0.80722	D	1	B	0.24920	0.114	B	0.28916	0.096	T	0.44205	-0.9343	10	0.87932	D	0	-20.0384	20.3334	0.98727	0.0:0.0:1.0:0.0	.	278	O60749	SNX2_HUMAN	E	278;161	ENSP00000368831:G278E;ENSP00000421663:G161E	ENSP00000368831:G278E	G	+	2	0	0	SNX2	122180543	122180543	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.688000	0.98670	2.818000	0.97014	0.591000	0.81541	GGA	0.139785		TCGA-HZ-8637-01A-11D-2396-08	0.443	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371392.1	0	0	1		2	2	2	0		0	0	65		65	65	1	1.850000	-2.989720	1	0.200000	NM_003100			6	6		208	205	0		1	1		0	0	65	0		9.640672e-01	9.936445e-01	0	6	0	336	0	6	208
POU4F3	5459	broad.mit.edu	37	5	145719395	145719395	+	Silent	SNP	G	G	A	rs145372405	byFrequency	TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr5:145719395G>A	ENST00000230732.4	+	2	494	c.405G>A	c.(403-405)ccG>ccA	p.P135P	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	135					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGGCGCTCCGGAACACTCGG	0.687																																						ENST00000230732.4	1.000000	0.600000	1.000000	0.720000	0.850000	0.852920	0.850000	1.000000																										0				17						c.(403-405)ccG>ccA		POU class 4 homeobox 3		G		1,4405	2.1+/-5.4	0,1,2202	58.0	58.0	58.0		405	-4.4	1.0	5	dbSNP_134	58	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	POU4F3	NM_002700.2		0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154		135/339	145719395	2,13002	2203	4299	6502	SO:0001819	synonymous_variant	5459	3	121376	35				g.chr5:145719395G>A	U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.405G>A	chr5.hg19:g.145719395G>A		1					CTC-359M8.1_ENST00000515598.1_RNA	p.P135P	NM_002700.2	NP_002691.1	0	0	0	1.892832	Q15319	PO4F3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	2	494	+			O60557|Q2M3F8	Silent	SNP	ENST00000230732.4	1	1	hg19	c.405G>A	CCDS4281.1	1																																																																																								0.139785		TCGA-HZ-8637-01A-11D-2396-08	0.687	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251887.2	1	0	1		18	2	2	1		1	1	65		65	65	1	1.850000	-3.221884	1	0.200000	NM_002700			33	33		323	320	0		1			1	0	65	0		9.892387e-01	0	0	0	0	0	0	33	323
AHRR	57491	broad.mit.edu	37	5	424055	424055	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr5:424055G>A	ENST00000505113.1	+	7	727	c.683G>A	c.(682-684)cGt>cAt	p.R228H	AHRR_ENST00000512529.1_Missense_Mutation_p.R74H|AHRR_ENST00000316418.5_Missense_Mutation_p.R228H|AHRR_ENST00000506456.1_Missense_Mutation_p.R84H	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	228					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TTCATCTGCCGTGTGCGCTGC	0.662																																						ENST00000505113.1	1.000000	0.220000	1.000000	0.290000	0.390000	0.518111	0.390000	0.360000																										0				20						c.(682-684)cGt>cAt		aryl-hydrocarbon receptor repressor							47.0	55.0	52.0					5																	424055		2030	4190	6220	SO:0001583	missense	57491	0	0					g.chr5:424055G>A	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.683G>A	chr5.hg19:g.424055G>A	ENSP00000424601:p.Arg228His	1					AHRR_ENST00000316418.5_Missense_Mutation_p.R228H|AHRR_ENST00000512529.1_Missense_Mutation_p.R74H|AHRR_ENST00000506456.1_Missense_Mutation_p.R84H	p.R228H	NM_001242412.1	NP_001229341.1	2	2	4	2.182973	A9YTQ3	AHRR_HUMAN	Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)	7	727	+			A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Missense_Mutation	SNP	ENST00000505113.1	1	1	hg19	c.683G>A	CCDS56355.1	0	.	.	.	.	.	.	.	.	.	.	G	27.6	4.841778	0.91197	.	.	ENSG00000063438	ENST00000505113;ENST00000316418;ENST00000512529;ENST00000506456	T;T;T;T	0.72615	0.56;0.48;-0.57;-0.67	3.96	3.96	0.45880	3.96	3.96	0.45880	.	0.121518	0.56097	D	0.000027	D	0.85444	0.5698	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.987;0.998	D	0.88474	0.3064	10	0.87932	D	0	.	13.4727	0.61290	0.0:0.0:1.0:0.0	.	84;228;228	D6RE68;A9YTQ3;A9YTQ3-2	.;AHRR_HUMAN;.	H	228;228;74;84	ENSP00000424601:R228H;ENSP00000323816:R228H;ENSP00000424880:R74H;ENSP00000426932:R84H	ENSP00000323816:R228H	R	+	2	0	0	AHRR	477055	477055	1.000000	0.71417	0.987000	0.45799	0.900000	0.52787	8.699000	0.91316	1.749000	0.51849	0.491000	0.48974	CGT	0.257885		TCGA-HZ-8637-01A-11D-2396-08	0.662	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	0	0	1		17	2	2	1		1	1	102		102	101	1	1.850000	-3.616047	1	0.200000	NM_020731			17	17		497	492	0		1			1	0	102	0		5.552867e-01	0	0	0	0	0	0	17	497
IRX4	50805	broad.mit.edu	37	5	1879903	1879903	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr5:1879903G>A	ENST00000505790.1	-	5	907	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C	IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000513692.1_Missense_Mutation_p.R151C|IRX4_ENST00000231357.2_Missense_Mutation_p.R151C	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	151					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GTGGTCTCGCGCGTGGCGTTC	0.637																																						ENST00000505790.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999985	0.990000	1.000000																										0				10						c.(451-453)Cgc>Tgc		iroquois homeobox 4							127.0	95.0	106.0					5																	1879903		2203	4300	6503	SO:0001583	missense	50805	0	0					g.chr5:1879903G>A	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.451C>T	chr5.hg19:g.1879903G>A	ENSP00000423161:p.Arg151Cys	1					IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000231357.2_Missense_Mutation_p.R151C|IRX4_ENST00000513692.1_Missense_Mutation_p.R151C	p.R151C	NM_001278634.1	NP_001265563.1	2	2	4	2.182973	P78413	IRX4_HUMAN		5	907	-			B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	1	1	hg19	c.451C>T	CCDS3867.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509935	0.85282	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692;ENST00000511126	D;D;D;T	0.84370	-1.84;-1.84;-1.84;-0.39	4.55	3.64	0.41730	4.55	3.64	0.41730	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.92573	0.7641	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93692	0.7008	10	0.87932	D	0	-27.2035	12.7693	0.57410	0.0:0.0:0.8352:0.1647	.	151	P78413	IRX4_HUMAN	C	151;151;151;177	ENSP00000231357:R151C;ENSP00000423161:R151C;ENSP00000424235:R151C;ENSP00000421772:R177C	ENSP00000231357:R151C	R	-	1	0	0	IRX4	1932903	1932903	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.297000	0.59061	2.067000	0.61834	0.462000	0.41574	CGC	0.257885		TCGA-HZ-8637-01A-11D-2396-08	0.637	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	1	0	1		2	2	2	0		0	0	109		109	107	1	1.850000	-3.318871	1	0.200000	NM_016358			68	69		426	418	1		1			0	0	109	0		1	0	0	0	0	0	0	68	426
DMGDH	29958	broad.mit.edu	37	5	78325780	78325780	+	Silent	SNP	A	A	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr5:78325780A>C	ENST00000255189.3	-	11	1789	c.1761T>G	c.(1759-1761)tcT>tcG	p.S587S	DMGDH_ENST00000380311.4_Silent_p.S386S|DMGDH_ENST00000540686.1_Silent_p.S207S	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	587					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		ACTCCCCAGGAGATTGGTGAG	0.353																																						ENST00000255189.3	0.420000	0.090000	0.320000	0.140000	0.210000	0.235696	0.210000	0.200000																										0				34						c.(1759-1761)tcT>tcG		dimethylglycine dehydrogenase							72.0	75.0	74.0					5																	78325780		2203	4300	6503	SO:0001819	synonymous_variant	29958	0	0					g.chr5:78325780A>C	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1761T>G	chr5.hg19:g.78325780A>C		1					DMGDH_ENST00000540686.1_Silent_p.S207S|DMGDH_ENST00000380311.4_Silent_p.S386S	p.S587S	NM_013391.2	NP_037523.2	0	1	1	1.761026	Q9UI17	M2GD_HUMAN		11	1789	-		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)	B2RBN0|B4E1J9	Silent	SNP	ENST00000255189.3	0	1	hg19	c.1761T>G	CCDS4044.1	0																																																																																								0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.353	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	0	0	1		2	2	2	0		0	0	58		58	58	1	1.850000	-3.148837	1	0.200000	NM_013391			6	6		251	250	0		1	0		0	0	58	0		9.650622e-01	2.551158e-02	0	0	0	9	0	6	251
TCERG1	10915	broad.mit.edu	37	5	145826931	145826931	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr5:145826931G>T	ENST00000296702.5	+	1	57	c.19G>T	c.(19-21)Gac>Tac	p.D7Y	TCERG1_ENST00000394421.2_Missense_Mutation_p.D7Y	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	7					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGTGGCGGGGACGGGGGCGA	0.617											OREG0016896	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000296702.5	0.920000	0.230000	0.720000	0.350000	0.510000	0.543181	0.510000	0.480000																										0				46						c.(19-21)Gac>Tac		transcription elongation regulator 1							27.0	28.0	28.0					5																	145826931		2202	4299	6501	SO:0001583	missense	10915	1	121338	26				g.chr5:145826931G>T	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.19G>T	chr5.hg19:g.145826931G>T	ENSP00000296702:p.Asp7Tyr	1		OREG0016896	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1697	TCERG1_ENST00000394421.2_Missense_Mutation_p.D7Y	p.D7Y	NM_006706.3	NP_006697.2	0	0	0	1.892832	O14776	TCRG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	1	57	+		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	0	1	hg19	c.19G>T	CCDS4282.1	0	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985832	0.53934	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.25414	1.8;1.8	5.03	5.03	0.67393	5.03	5.03	0.67393	.	0.231983	0.38837	N	0.001560	T	0.19685	0.0473	N	0.14661	0.345	0.35204	D	0.774513	P;P;P	0.50943	0.94;0.902;0.842	B;P;B	0.47981	0.36;0.563;0.36	T	0.12116	-1.0560	10	0.72032	D	0.01	-11.5435	9.5825	0.39497	0.0931:0.0:0.9069:0.0	.	7;7;7	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	Y	7	ENSP00000296702:D7Y;ENSP00000377943:D7Y	ENSP00000296702:D7Y	D	+	1	0	0	TCERG1	145807124	145807124	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.332000	0.52083	2.782000	0.95742	0.655000	0.94253	GAC	0.139785		TCGA-HZ-8637-01A-11D-2396-08	0.617	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	0	0	1		2	2	2	0		0	0	31		31	27	1	1.850000	-11.214320	1	0.200000	NM_001040006			7	6		121	102	0		1	1		0	0	31	0		9.667932e-01	4.270574e-01	0	6	0	18	0	7	121
HECW1	23072	broad.mit.edu	37	7	43351558	43351558	+	Missense_Mutation	SNP	C	C	T	rs368244752		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr7:43351558C>T	ENST00000395891.2	+	4	829	c.224C>T	c.(223-225)tCg>tTg	p.S75L	HECW1_ENST00000453890.1_Missense_Mutation_p.S75L	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	75					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CTGGTCACCTCGGACAGCCGC	0.612																																						ENST00000395891.2	1.000000	0.870000	1.000000	0.990000	0.990000	0.991008	0.990000	1.000000																										0				125						c.(223-225)tCg>tTg		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1		C	LEU/SER	0,4238		0,0,2119	57.0	65.0	62.0		224	5.8	1.0	7		62	1,8469		0,1,4234	no	missense	HECW1	NM_015052.3	145	0,1,6353	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	75/1607	43351558	1,12707	2119	4235	6354	SO:0001583	missense	23072	6	121096	39				g.chr7:43351558C>T	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.224C>T	chr7.hg19:g.43351558C>T	ENSP00000379228:p.Ser75Leu	0					HECW1_ENST00000453890.1_Missense_Mutation_p.S75L	p.S75L	NM_015052.3	NP_055867.3	1	2	3	2.051170	Q76N89	HECW1_HUMAN		4	829	+			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	1	1	hg19	c.224C>T	CCDS5469.2	1	.	.	.	.	.	.	.	.	.	.	C	35	5.425853	0.96131	0.0	1.18E-4	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.35605	1.3;1.3	5.76	5.76	0.90799	5.76	5.76	0.90799	.	0.129505	0.56097	D	0.000040	T	0.45135	0.1327	L	0.39147	1.195	0.80722	D	1	D;B;D	0.71674	0.998;0.017;0.978	P;B;B	0.51385	0.668;0.005;0.357	T	0.39143	-0.9628	10	0.87932	D	0	.	19.9521	0.97203	0.0:1.0:0.0:0.0	.	75;107;75	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	L	75;75;74	ENSP00000379228:S75L;ENSP00000407774:S75L	ENSP00000265522:S74L	S	+	2	0	0	HECW1	43318083	43318083	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	5.920000	0.70017	2.708000	0.92522	0.655000	0.94253	TCG	0.206349		TCGA-HZ-8637-01A-11D-2396-08	0.612	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	0	0	1		17	2	2	1		1	1	84		84	84	1	1.850000	-2.744763	1	0.200000	NM_015052			49	49		377	374	1		1		0	1	0	84	0		9.999905e-01	0	0	0	0	0	1	49	377
COL1A2	1278	broad.mit.edu	37	7	94050355	94050355	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr7:94050355G>A	ENST00000297268.6	+	38	2801	c.2330G>A	c.(2329-2331)cGt>cAt	p.R777H		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	777			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GCTGGAAGTCGTGGTGATGGA	0.423										HNSCC(75;0.22)																												ENST00000297268.6	1.000000	0.480000	0.890000	0.590000	0.720000	0.742178	0.720000	0.700000																									COL1A2/PLAG1(3)	0				115						c.(2329-2331)cGt>cAt		collagen, type I, alpha 2	Collagenase(DB00048)						159.0	154.0	156.0					7																	94050355		2203	4300	6503	SO:0001583	missense	1278	2	121412	35				g.chr7:94050355G>A	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2330G>A	chr7.hg19:g.94050355G>A	ENSP00000297268:p.Arg777His	0	HNSCC(75;0.22)					p.R777H	NM_000089.3	NP_000080.2	1	2	3	2.044574	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)	38	2801	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	1	1	hg19	c.2330G>A	CCDS34682.1	0	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962324	0.92791	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93811	-3.29	5.63	5.63	0.86233	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.97377	0.9142	H	0.94542	3.55	0.58432	D	0.999999	D	0.76494	0.999	P	0.58013	0.831	D	0.97940	1.0325	10	0.87932	D	0	.	20.0609	0.97674	0.0:0.0:1.0:0.0	.	777	P08123	CO1A2_HUMAN	H	777;778	ENSP00000297268:R777H	ENSP00000297268:R777H	R	+	2	0	0	COL1A2	93888291	93888291	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.330000	0.72925	2.824000	0.97209	0.655000	0.94253	CGT	0.205561		TCGA-HZ-8637-01A-11D-2396-08	0.423	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	0	0	1		12	101	2	1		1	1	124		124	123	1	1.850000	-7.825306	1	0.200000	NM_000089			27	27		354	351	0		1	0		1	0	124	0		9.957153e-01	1	0	2	0	5119	0	27	354
PTPRZ1	5803	broad.mit.edu	37	7	121694078	121694078	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr7:121694078G>A	ENST00000393386.2	+	26	6778	c.6367G>A	c.(6367-6369)Gat>Aat	p.D2123N	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.D1256N	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2123	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TATGATTCCTGATGGCCAAAA	0.428																																						ENST00000393386.2	1.000000	0.680000	1.000000	0.770000	0.880000	0.882954	0.880000	1.000000																										0				106						c.(6367-6369)Gat>Aat		protein tyrosine phosphatase, receptor-type, Z polypeptide 1							180.0	172.0	175.0					7																	121694078		2203	4300	6503	SO:0001583	missense	5803	0	0					g.chr7:121694078G>A	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6367G>A	chr7.hg19:g.121694078G>A	ENSP00000377047:p.Asp2123Asn	0					PTPRZ1_ENST00000449182.1_Missense_Mutation_p.D1256N	p.D2123N	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	1	2	3	2.043458	P23471	PTPRZ_HUMAN		26	6778	+			A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	1	1	hg19	c.6367G>A	CCDS34740.1	1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029859	0.54790	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.11063	2.81;2.81	5.39	4.5	0.54988	5.39	4.5	0.54988	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.077127	0.53938	D	0.000057	T	0.20659	0.0497	L	0.31371	0.925	0.53688	D	0.999979	B;P;P	0.46987	0.449;0.888;0.775	B;P;P	0.60236	0.202;0.871;0.697	T	0.01413	-1.1361	10	0.62326	D	0.03	.	16.0827	0.81014	0.0:0.1344:0.8656:0.0	.	1262;1256;2123	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	N	2123;1256	ENSP00000377047:D2123N;ENSP00000410000:D1256N	ENSP00000377047:D2123N	D	+	1	0	0	PTPRZ1	121481314	121481314	1.000000	0.71417	0.996000	0.52242	0.004000	0.04260	9.788000	0.99064	1.251000	0.43983	-0.274000	0.10170	GAT	0.204771		TCGA-HZ-8637-01A-11D-2396-08	0.428	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	1	0	1		2	2	2	0		0	0	171		171	170	1	1.850000	-15.676860	1	0.200000	NM_002851			61	61		637	628	0		1	0		0	0	171	0		1	9.324421e-02	0	1	0	5	0	61	637
KCNU1	157855	broad.mit.edu	37	8	36788639	36788639	+	Silent	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr8:36788639C>T	ENST00000399881.3	+	25	2944	c.2907C>T	c.(2905-2907)caC>caT	p.H969H	KCNU1_ENST00000518904.1_3'UTR	NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	969					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.H969H(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TGTCCTTACACGAAACCATTT	0.418																																						ENST00000399881.3	1.000000	0.640000	1.000000	0.730000	0.840000	0.852768	0.840000	1.000000																										2	Substitution - coding silent(2)	p.H969H(2)	large_intestine(2)	57						c.(2905-2907)caC>caT		potassium channel, subfamily U, member 1							136.0	129.0	131.0					8																	36788639		1890	4114	6004	SO:0001819	synonymous_variant	157855	1	120820	38				g.chr8:36788639C>T	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2907C>T	chr8.hg19:g.36788639C>T		0					KCNU1_ENST00000518904.1_3'UTR	p.H969H	NM_001031836.2	NP_001027006.2	1	2	3	2.057392	A8MYU2	KCNU1_HUMAN		25	2944	+				Silent	SNP	ENST00000399881.3	1	1	hg19	c.2907C>T	CCDS55220.1	0																																																																																								0.207921		TCGA-HZ-8637-01A-11D-2396-08	0.418	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	1	0	1		2	2	2	0		0	0	183		183	182	1	1.850000	-13.638120	1	0.200000	NM_001031836			54	55		598	591	0		1			0	0	183	0		1	0	0	0	0	0	0	54	598
ST18	9705	broad.mit.edu	37	8	53062293	53062293	+	Splice_Site	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr8:53062293T>C	ENST00000276480.7	-	16	2734	c.2051A>G	c.(2050-2052)gAg>gGg	p.E684G	RP11-26M5.3_ENST00000520496.1_RNA	NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	684					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AAACAATACCTCTTTCTCCTC	0.418																																						ENST00000276480.7	1.000000	0.980000	1.000000	0.990000	0.990000	0.998122	0.990000	1.000000																										0				85						c.(2050-2052)gAg>gGg		suppression of tumorigenicity 18, zinc finger							65.0	65.0	65.0					8																	53062293		2203	4300	6503	SO:0001630	splice_region_variant	9705	0	0					g.chr8:53062293T>C	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2052+1A>G	chr8.hg19:g.53062293T>C		1					RP11-26M5.3_ENST00000520496.1_RNA	p.E684G	NM_014682.2	NP_055497.1	2	2	4	2.186960	O60284	ST18_HUMAN		16	2734	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	Q17RY1	Splice_Site	SNP	ENST00000276480.7	1	0	hg19	c.2051A>G	CCDS6149.1	1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.256218	0.80246	.	.	ENSG00000147488	ENST00000276480	T	0.53857	0.6	5.53	5.53	0.82687	5.53	5.53	0.82687	Myelin transcription factor 1 (1);	0.146632	0.64402	D	0.000011	T	0.72819	0.3508	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.75082	-0.3443	10	0.49607	T	0.09	-25.523	15.6592	0.77169	0.0:0.0:0.0:1.0	.	684	O60284	ST18_HUMAN	G	684	ENSP00000276480:E684G	ENSP00000276480:E684G	E	-	2	0	0	ST18	53224846	53224846	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	5.945000	0.70226	2.110000	0.64415	0.377000	0.23210	GAG	0.259259		TCGA-HZ-8637-01A-11D-2396-08	0.418	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1	1	0	1		2	2	2	0		0	0	68		68	68	1	1.850000	-14.571590	1	0.200000		Missense_Mutation		32	32		221	220	1		1	0		0	0	68	0		1	4.688265e-01	0	0	0	12	0	32	221
RNF19A	25897	broad.mit.edu	37	8	101299991	101299991	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr8:101299991G>A	ENST00000519449.1	-	3	728	c.412C>T	c.(412-414)Cgg>Tgg	p.R138W	RNF19A_ENST00000341084.2_Missense_Mutation_p.R138W	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	138					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			TTAGAATGCCGCAAAAGGCAC	0.373																																						ENST00000519449.1	1.000000	0.020000	1.000000	0.050000	0.090000	0.298077	0.090000	0.080000																										0				30						c.(412-414)Cgg>Tgg		ring finger protein 19A, RBR E3 ubiquitin protein ligase							107.0	108.0	107.0					8																	101299991		2203	4300	6503	SO:0001583	missense	25897	5	121412	39				g.chr8:101299991G>A	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.412C>T	chr8.hg19:g.101299991G>A	ENSP00000428968:p.Arg138Trp	1					RNF19A_ENST00000341084.2_Missense_Mutation_p.R138W	p.R138W	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	2	2	4	2.186960	Q9NV58	RN19A_HUMAN	Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	3	728	-	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	0	1	hg19	c.412C>T	CCDS6286.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139684	0.77775	.	.	ENSG00000034677	ENST00000519449;ENST00000341084;ENST00000519527;ENST00000523167	D;D	0.84146	-1.81;-1.81	5.57	3.77	0.43336	5.57	3.77	0.43336	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.056803	0.64402	D	0.000001	D	0.88123	0.6352	M	0.76002	2.32	0.80722	D	1	D	0.63880	0.993	P	0.53490	0.727	D	0.87527	0.2450	10	0.66056	D	0.02	.	10.4328	0.44417	0.07:0.0:0.7955:0.1345	.	138	Q9NV58	RN19A_HUMAN	W	138	ENSP00000428968:R138W;ENSP00000342667:R138W	ENSP00000342667:R138W	R	-	1	2	2	RNF19A	101369167	101369167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.654000	0.67974	0.707000	0.31934	-0.142000	0.14014	CGG	0.259259		TCGA-HZ-8637-01A-11D-2396-08	0.373	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	0	0	1		15	4	2	1		1	1	210		210	209	1	1.850000	-1.799617	0	0.200000	NM_015435			6	6		873	870	0		0	0		1	0	210	0		3.743014e-02	1.985626e-02	0	0	0	114	0	6	873
IFNA7	3444	broad.mit.edu	37	9	21201878	21201878	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr9:21201878G>T	ENST00000239347.3	-	1	326	c.287C>A	c.(286-288)tCa>tAa	p.S96*		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	96					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AGCAGCAGATGAGTCCTCTGT	0.493																																						ENST00000239347.3	0.220000	0.050000	0.170000	0.080000	0.120000	0.133899	0.120000	0.120000																										0				12						c.(286-288)tCa>tAa		interferon, alpha 7							52.0	56.0	54.0					9																	21201878		2202	4281	6483	SO:0001587	stop_gained	3444	0	0					g.chr9:21201878G>T		CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.287C>A	chr9.hg19:g.21201878G>T	ENSP00000239347:p.Ser96*	1						p.S96*	NM_021057.2	NP_066401.2	0	1	1	1.845158	P01567	IFNA7_HUMAN		1	326	-			Q14607|Q5VV14	Nonsense_Mutation	SNP	ENST00000239347.3	0	1	hg19	c.287C>A	CCDS34995.1	0	.	.	.	.	.	.	.	.	.	.	G	13.87	2.365583	0.41902	.	.	ENSG00000214042	ENST00000239347	.	.	.	3.56	0.28	0.15682	3.56	0.28	0.15682	.	0.828141	0.10926	N	0.618941	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2755	0.31871	0.0:0.4864:0.3482:0.1654	.	.	.	.	X	96	.	ENSP00000239347:S96X	S	-	2	0	0	IFNA7	21191878	21191878	0.000000	0.05858	0.000000	0.03702	0.135000	0.20990	0.117000	0.15583	-0.191000	0.10448	0.586000	0.80456	TCA	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.493	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051891.1	0	0	1		2	2	2	0		0	0	155		155	219	1	1.850000	-2.922052	1	0.200000	NM_021057			9	8		653	488	0		1			0	0	155	0		9.805121e-01	0	0	0	0	0	0	9	653
PRUNE2	158471	broad.mit.edu	37	9	79318999	79318999	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr9:79318999T>C	ENST00000376718.3	-	9	7653	c.7530A>G	c.(7528-7530)atA>atG	p.I2510M	PRUNE2_ENST00000428286.1_Missense_Mutation_p.I2151M	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2510					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CCAATTCTGATATTTCCTTGC	0.363																																						ENST00000376718.3	0.150000	0.020000	0.110000	0.040000	0.070000	0.083311	0.070000	0.070000																										0				16						c.(7528-7530)atA>atG		prune homolog 2 (Drosophila)							112.0	103.0	106.0					9																	79318999		1568	3582	5150	SO:0001583	missense	158471	0	0					g.chr9:79318999T>C	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7530A>G	chr9.hg19:g.79318999T>C	ENSP00000365908:p.Ile2510Met	1					PRUNE2_ENST00000428286.1_Missense_Mutation_p.I2151M	p.I2510M	NM_015225.2	NP_056040.2	0	1	1	1.854684	Q8WUY3	PRUN2_HUMAN		9	7653	-			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	0	1	hg19	c.7530A>G	CCDS47982.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.506|8.506	0.865365|0.865365	0.17250|0.17250	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|T	0.46451|0.43294	0.88;0.87|0.95	5.76|5.76	-4.85|-4.85	0.03142|0.03142	5.76|5.76	-4.85|-4.85	0.03142|0.03142	.|.	0.937666|0.937666	0.08922|0.08922	N|N	0.874209|0.874209	T|T	0.24624|0.24624	0.0597|0.0597	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	B|.	0.25486|.	0.127|.	B|.	0.19148|.	0.024|.	T|T	0.33445|0.33445	-0.9868|-0.9868	10|8	0.66056|0.17832	D|T	0.02|0.49	-0.3915|-0.3915	0.7931|0.7931	0.01061|0.01061	0.2162:0.3068:0.1812:0.2958|0.2162:0.3068:0.1812:0.2958	.|.	2510|.	Q8WUY3|.	PRUN2_HUMAN|.	M|V	2510;2151;2509|1832	ENSP00000365908:I2510M;ENSP00000397425:I2151M|ENSP00000389706:I1832V	ENSP00000365908:I2510M|ENSP00000389706:I1832V	I|I	-|-	3|1	3|0	3|0	PRUNE2|PRUNE2	78508819|78508819	78508819|78508819	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.769000|0.769000	0.43574|0.43574	-2.307000|-2.307000	0.01132|0.01132	-0.425000|-0.425000	0.07371|0.07371	0.533000|0.533000	0.62120|0.62120	ATA|ATC	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.363	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	0	0	1		2	2	2	0		0	0	153		153	151	1	1.850000	-3.206609	1	0.200000	NM_138818			5	5		633	624	0		1	0		0	0	153	0		9.353993e-01	2.182250e-02	0	0	0	23	0	5	633
NTRK2	4915	broad.mit.edu	37	9	87338511	87338511	+	Missense_Mutation	SNP	G	G	A	rs117250170		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr9:87338511G>A	ENST00000323115.4	+	6	960	c.607G>A	c.(607-609)Gca>Aca	p.A203T	NTRK2_ENST00000277120.3_Missense_Mutation_p.A203T|NTRK2_ENST00000304053.6_Missense_Mutation_p.A203T|NTRK2_ENST00000359847.3_Missense_Mutation_p.A203T|NTRK2_ENST00000376214.1_Missense_Mutation_p.A203T|NTRK2_ENST00000395866.2_Missense_Mutation_p.A47T|NTRK2_ENST00000395882.1_Missense_Mutation_p.A203T|NTRK2_ENST00000376208.1_Missense_Mutation_p.A203T|NTRK2_ENST00000376213.1_Missense_Mutation_p.A203T			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	203	Ig-like C2-type 1.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	AAATCTGGCCGCACCTAACCT	0.398										TSP Lung(25;0.17)			G|||	1	0.000199681	0.0	0.0	5008	,	,		18578	0.0		0.001	False		,,,				2504	0.0					ENST00000323115.4	0.240000	0.040000	0.180000	0.070000	0.110000	0.131641	0.110000	0.110000																										0				46						c.(607-609)Gca>Aca		neurotrophic tyrosine kinase, receptor, type 2	Amitriptyline(DB00321)	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	179.0	153.0	162.0		607,607,607,607,607	4.5	0.9	9	dbSNP_132	162	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense,missense,missense,missense	NTRK2	NM_001007097.1,NM_001018064.1,NM_001018065.2,NM_001018066.2,NM_006180.3	58,58,58,58,58	0,7,6496	AA,AG,GG		0.0698,0.0227,0.0538	benign,benign,benign,benign,benign	203/478,203/823,203/554,203/538,203/839	87338511	7,12999	2203	4300	6503	SO:0001583	missense	4915	4	121412	48				g.chr9:87338511G>A	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.607G>A	chr9.hg19:g.87338511G>A	ENSP00000314586:p.Ala203Thr	1	TSP Lung(25;0.17)				NTRK2_ENST00000376208.1_Missense_Mutation_p.A203T|NTRK2_ENST00000395866.2_Missense_Mutation_p.A47T|NTRK2_ENST00000395882.1_Missense_Mutation_p.A203T|NTRK2_ENST00000359847.3_Missense_Mutation_p.A203T|NTRK2_ENST00000304053.6_Missense_Mutation_p.A203T|NTRK2_ENST00000376214.1_Missense_Mutation_p.A203T|NTRK2_ENST00000277120.3_Missense_Mutation_p.A203T|NTRK2_ENST00000376213.1_Missense_Mutation_p.A203T	p.A203T			0	1	1	1.854684	Q16620	NTRK2_HUMAN		6	960	+			B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	0	1	hg19	c.607G>A	CCDS35050.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.40	1.340322	0.24339	2.27E-4	6.98E-4	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11	5.64	4.52	0.55395	5.64	4.52	0.55395	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.177702	0.49916	D	0.000137	T	0.12050	0.0293	N	0.01438	-0.865	0.27631	N	0.948042	B;B;B;B;B;B;B;B	0.29936	0.029;0.013;0.013;0.016;0.001;0.005;0.262;0.013	B;B;B;B;B;B;B;B	0.17722	0.019;0.009;0.009;0.016;0.004;0.004;0.019;0.009	T	0.13656	-1.0501	10	0.15952	T	0.53	.	4.7532	0.13071	0.2675:0.0:0.7325:0.0	.	47;203;203;203;203;203;249;203	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	T	203;203;203;203;203;203;203;203;47	ENSP00000365387:A203T;ENSP00000365386:A203T;ENSP00000379221:A203T;ENSP00000365381:A203T;ENSP00000306167:A203T;ENSP00000277120:A203T;ENSP00000314586:A203T;ENSP00000352906:A203T;ENSP00000379207:A47T	ENSP00000277120:A203T	A	+	1	0	0	NTRK2	86528331	86528331	0.010000	0.17322	0.901000	0.35422	0.850000	0.48378	1.337000	0.33862	2.807000	0.96579	0.591000	0.81541	GCA	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.398	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1	0	0	1		2	2	2	0		0	0	97		97	97	1	1.850000	-2.579551	1	0.200000				5	5		395	392	0		1	0		0	0	97	0		9.366725e-01	7.906663e-02	0	0	0	30	0	5	395
ZNF462	58499	broad.mit.edu	37	9	109686870	109686870	+	Missense_Mutation	SNP	G	G	A	rs374076395		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chr9:109686870G>A	ENST00000277225.5	+	3	966	c.677G>A	c.(676-678)cGc>cAc	p.R226H	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.R226H			Q96JM2	ZN462_HUMAN	zinc finger protein 462	226					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTTGTGGAGCGCAGCATCTTA	0.582																																						ENST00000277225.5	0.290000	0.060000	0.220000	0.090000	0.150000	0.165262	0.150000	0.140000																										0				119						c.(676-678)cGc>cAc		zinc finger protein 462		G	HIS/ARG	0,4406		0,0,2203	61.0	60.0	60.0		677	5.8	1.0	9		60	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF462	NM_021224.4	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	226/2507	109686870	1,13005	2203	4300	6503	SO:0001583	missense	58499	2	121412	35				g.chr9:109686870G>A	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.677G>A	chr9.hg19:g.109686870G>A	ENSP00000277225:p.Arg226His	1					ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.R226H	p.R226H			0	1	1	1.854684	Q96JM2	ZN462_HUMAN		3	966	+			Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	0	1	hg19	c.677G>A	CCDS35096.1	0	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176741	0.57692	0.0	1.16E-4	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.08102	3.13;3.58	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.117145	0.64402	D	0.000013	T	0.19805	0.0476	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.71414	0.973;0.94	T	0.01249	-1.1406	9	.	.	.	.	20.0893	0.97812	0.0:0.0:1.0:0.0	.	226;226	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	H	226	ENSP00000277225:R226H;ENSP00000414570:R226H	.	R	+	2	0	0	ZNF462	108726691	108726691	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.515000	0.67049	2.761000	0.94854	0.655000	0.94253	CGC	0.111111		TCGA-HZ-8637-01A-11D-2396-08	0.582	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	0	0	1		2	2	2	0		0	0	84		84	83	1	1.850000	-5.984889	1	0.200000	NM_021224			6	7		365	360	0		1	0		0	0	84	0		9.640962e-01	7.781872e-03	0	0	0	7	0	6	365
DRP2	1821	broad.mit.edu	37	X	100505940	100505940	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:100505940T>C	ENST00000395209.3	+	16	2260	c.1733T>C	c.(1732-1734)tTc>tCc	p.F578S	DRP2_ENST00000538510.1_Missense_Mutation_p.F578S|DRP2_ENST00000541709.1_Missense_Mutation_p.F500S|DRP2_ENST00000402866.1_Missense_Mutation_p.F578S	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	578					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GCATCCCAGTTCCTGGAGTGG	0.542																																						ENST00000395209.3	0.360000	0.180000	0.320000	0.220000	0.260000	0.273514	0.260000	0.260000																										0				31						c.(1732-1734)tTc>tCc		dystrophin related protein 2							164.0	134.0	144.0					X																	100505940		2203	4300	6503	SO:0001583	missense	1821	0	0					g.chrX:100505940T>C	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1733T>C	chrX.hg19:g.100505940T>C	ENSP00000378635:p.Phe578Ser						DRP2_ENST00000541709.1_Missense_Mutation_p.F500S|DRP2_ENST00000538510.1_Missense_Mutation_p.F578S|DRP2_ENST00000402866.1_Missense_Mutation_p.F578S	p.F578S	NM_001939.2	NP_001930.2	0	1	1		Q13474	DRP2_HUMAN		16	2260	+			A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	1	1	hg19	c.1733T>C	CCDS14480.2	0	.	.	.	.	.	.	.	.	.	.	T	28.0	4.885168	0.91814	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	6.06	6.06	0.98353	6.06	6.06	0.98353	EF-hand domain, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93684	0.7001	10	0.87932	D	0	-16.046	15.4998	0.75687	0.0:0.0:0.0:1.0	.	578	Q13474	DRP2_HUMAN	S	578;578;500;578	ENSP00000385038:F578S;ENSP00000378635:F578S;ENSP00000444752:F500S;ENSP00000441051:F578S	ENSP00000378635:F578S	F	+	2	0	0	DRP2	100392596	100392596	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	8.040000	0.89188	2.044000	0.60594	0.486000	0.48141	TTC	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.542	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	0	0	1		2	2	2	0		0	0	237		237	234	1	1.850000	-19.999860	1	0.200000	NM_001939			33	33		1204	1191	0		1			0	0	237	0		1	0	0	0	0	0	0	33	1204
IRS4	8471	broad.mit.edu	37	X	107979420	107979420	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:107979420C>G	ENST00000372129.2	-	1	231	c.155G>C	c.(154-156)gGa>gCa	p.G52A	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	52					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CCACATGGCTCCCGGACAAGA	0.672																																						ENST00000372129.2	1.000000	0.660000	0.990000	0.760000	0.860000	0.870528	0.860000	1.000000																										0				78						c.(154-156)gGa>gCa		insulin receptor substrate 4							20.0	23.0	22.0					X																	107979420		2174	4212	6386	SO:0001583	missense	8471	0	0					g.chrX:107979420C>G	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.155G>C	chrX.hg19:g.107979420C>G	ENSP00000361202:p.Gly52Ala						RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	p.G52A	NM_003604.2	NP_003595.1	0	1	1		O14654	IRS4_HUMAN		1	231	-				Missense_Mutation	SNP	ENST00000372129.2	1	1	hg19	c.155G>C	CCDS14544.1	1	.	.	.	.	.	.	.	.	.	.	c	14.15	2.450387	0.43531	.	.	ENSG00000133124	ENST00000372129	T	0.57436	0.4	3.0	2.13	0.27403	3.0	2.13	0.27403	.	0.434509	0.17021	N	0.190111	T	0.31979	0.0814	N	0.14661	0.345	0.26220	N	0.979178	B	0.18461	0.028	B	0.12156	0.007	T	0.22243	-1.0222	10	0.56958	D	0.05	-3.0499	7.3287	0.26569	0.0:0.8609:0.0:0.1391	.	52	O14654	IRS4_HUMAN	A	52	ENSP00000361202:G52A	ENSP00000361202:G52A	G	-	2	0	0	IRS4	107866076	107866076	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.426000	0.44731	0.679000	0.31345	0.431000	0.28591	GGA	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.672	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	1	0	1		2	2	2	0		0	0	89		89	88	1	1.850000	-20.000000	1	0.200000	NM_003604			54	52		565	560	0		1		0	0	0	89	0		1	0	0	0	0	0	1	54	565
KCNE1L	23630	broad.mit.edu	37	X	108868206	108868206	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:108868206C>T	ENST00000372101.2	-	1	187	c.44G>A	c.(43-45)cGc>cAc	p.R15H		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	15					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GAGCAACAGGCGGCTCAGAAG	0.682																																						ENST00000372101.2	0.720000	0.170000	0.560000	0.270000	0.390000	0.420727	0.390000	0.380000																										0				6						c.(43-45)cGc>cAc		KCNE1-like							11.0	12.0	12.0					X																	108868206		2163	4218	6381	SO:0001583	missense	23630	1	120734	24				g.chrX:108868206C>T	AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.44G>A	chrX.hg19:g.108868206C>T	ENSP00000361173:p.Arg15His							p.R15H	NM_012282.2	NP_036414.1	0	1	1		Q9UJ90	KCE1L_HUMAN		1	187	-				Missense_Mutation	SNP	ENST00000372101.2	1	1	hg19	c.44G>A	CCDS14547.1	0	.	.	.	.	.	.	.	.	.	.	C	15.69	2.906858	0.52333	.	.	ENSG00000176076	ENST00000372101	T	0.71817	-0.6	4.74	1.66	0.24008	4.74	1.66	0.24008	.	0.242758	0.27437	N	0.019376	T	0.41880	0.1178	N	0.08118	0	0.28357	N	0.920618	B	0.13145	0.007	B	0.10450	0.005	T	0.21861	-1.0233	10	0.48119	T	0.1	-25.7468	0.7581	0.01002	0.1549:0.2966:0.2664:0.2821	.	15	Q9UJ90	KCE1L_HUMAN	H	15	ENSP00000361173:R15H	ENSP00000361173:R15H	R	-	2	0	0	KCNE1L	108754862	108754862	0.985000	0.35326	0.988000	0.46212	0.851000	0.48451	0.065000	0.14466	0.476000	0.27440	0.523000	0.50628	CGC	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.682	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057892.1	1	0	1		2	2	2	0		0	0	43		43	23	1	1.850000	-10.141520	1	0.200000	NM_012282			7	4		177	100	0		1			0	0	43	0		8.943698e-01	0	0	0	0	0	0	7	177
CAPN6	827	broad.mit.edu	37	X	110494868	110494868	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:110494868G>T	ENST00000324068.1	-	6	969	c.802C>A	c.(802-804)Ctt>Att	p.L268I	CAPN6_ENST00000541758.1_Missense_Mutation_p.L13I	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	268	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						ACTTCCACAAGTCTCTCTCCA	0.488																																						ENST00000324068.1	0.130000	0.050000	0.110000	0.060000	0.080000	0.092239	0.080000	0.090000																										0				47						c.(802-804)Ctt>Att		calpain 6							279.0	277.0	278.0					X																	110494868		2203	4300	6503	SO:0001583	missense	827	0	0					g.chrX:110494868G>T	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.802C>A	chrX.hg19:g.110494868G>T	ENSP00000317214:p.Leu268Ile						CAPN6_ENST00000541758.1_Missense_Mutation_p.L13I	p.L268I	NM_014289.3	NP_055104.2	0	1	1		Q9Y6Q1	CAN6_HUMAN		6	969	-			D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	0	1	hg19	c.802C>A	CCDS14555.1	0	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074557	0.76415	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	D;D	0.90444	-2.67;-2.28	6.17	5.31	0.75309	6.17	5.31	0.75309	Peptidase C2, calpain, catalytic domain (3);	0.072434	0.56097	D	0.000033	D	0.92496	0.7617	L	0.58428	1.81	0.47276	D	0.999375	D	0.60575	0.988	P	0.61722	0.893	D	0.91917	0.5544	10	0.52906	T	0.07	.	9.6606	0.39952	0.0718:0.0:0.7883:0.1398	.	268	Q9Y6Q1	CAN6_HUMAN	I	268;13	ENSP00000317214:L268I;ENSP00000441736:L13I	ENSP00000317214:L268I	L	-	1	0	0	CAPN6	110381524	110381524	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.051000	0.49885	1.355000	0.45865	0.600000	0.82982	CTT	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.488	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1	0	0	1		2	2	2	0		0	0	701		701	698	1	1.850000	-3.318793	1	0.200000				29	30		3217	3196	0		1	0		0	0	701	0		1	8.630114e-04	0	1	0	4	0	29	3217
AMOT	154796	broad.mit.edu	37	X	112058796	112058796	+	Silent	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:112058796C>T	ENST00000524145.1	-	3	1256	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	AMOT_ENST00000371958.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q			Q4VCS5	AMOT_HUMAN	angiomotin	394					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q394Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gctgctgctgctgttgttggt	0.582																																						ENST00000524145.1	0.310000	0.070000	0.240000	0.110000	0.160000	0.177743	0.160000	0.160000																										1	Substitution - coding silent(1)	p.Q394Q(1)	lung(1)	43						c.(1180-1182)caG>caA		angiomotin							38.0	34.0	36.0					X																	112058796		2203	4300	6503	SO:0001819	synonymous_variant	154796	0	0					g.chrX:112058796C>T	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1182G>A	chrX.hg19:g.112058796C>T							AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000371958.1_Silent_p.Q162Q	p.Q394Q			0	1	1		Q4VCS5	AMOT_HUMAN		3	1256	-			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	0	1	hg19	c.1182G>A	CCDS48154.1	0																																																																																								0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	0	0	1		2	2	2	0		0	0	68		68	72	1	1.850000	-3.110143	1	0.200000	NM_133265			7	4		437	463	0		1	0	0	0	0	68	0		9.840353e-01	1.171922e-02	3.611521e-04	0	0	9	2	7	437
NDUFA1	4694	broad.mit.edu	37	X	119005896	119005896	+	Missense_Mutation	SNP	G	G	A	rs104894884		TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:119005896G>A	ENST00000371437.4	+	1	447	c.22G>A	c.(22-24)Gga>Aga	p.G8R	RNF113A_ENST00000371442.2_5'Flank	NM_004541.3	NP_004532.1	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa	8			G -> R (in MT-C1D). {ECO:0000269|PubMed:17262856}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|large_intestine(2)|stomach(1)	5						GATTCTCCCCGGACTCTCCGT	0.582																																						ENST00000371437.4	0.310000	0.150000	0.270000	0.180000	0.220000	0.232695	0.220000	0.220000																										0				5	GRCh37	CM070206	NDUFA1	M	rs104894884	c.(22-24)Gga>Aga		NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa							184.0	149.0	161.0					X																	119005896		2203	4300	6503	SO:0001583	missense	4694	0	0					g.chrX:119005896G>A		CCDS14590.1	Xq24	2011-07-04	2002-08-29		ENSG00000125356	ENSG00000125356		"""Mitochondrial respiratory chain complex / Complex I"""	7683	protein-coding gene	gene with protein product	"""NADH:ubiquinone oxidoreductase (complex 1)"", ""type I dehydrogenase"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"", ""complex I MWFE subunit"""	300078	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"""			8938439	Standard	NM_004541		Approved	MWFE, CI-MWFE	uc004esc.4	O15239	OTTHUMG00000022287	ENST00000371437.4:c.22G>A	chrX.hg19:g.119005896G>A	ENSP00000360492:p.Gly8Arg						RNF113A_ENST00000371442.2_5'Flank	p.G8R	NM_004541.3	NP_004532.1	0	1	1		O15239	NDUA1_HUMAN		1	447	+				Missense_Mutation	SNP	ENST00000371437.4	1	1	hg19	c.22G>A	CCDS14590.1	0	.	.	.	.	.	.	.	.	.	.	G	14.10	2.436087	0.43224	.	.	ENSG00000125356	ENST00000371437	T	0.78481	-1.18	5.45	5.45	0.79879	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.86810	0.6022	.	.	.	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	D	0.86588	0.1858	9	0.42905	T	0.14	-17.2435	13.6857	0.62515	0.0:0.0:1.0:0.0	.	8	O15239	NDUA1_HUMAN	R	8	ENSP00000360492:G8R	ENSP00000360492:G8R	G	+	1	0	0	NDUFA1	118889924	118889924	1.000000	0.71417	0.749000	0.31150	0.584000	0.36387	3.502000	0.53332	2.300000	0.77407	0.600000	0.82982	GGA	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.582	NDUFA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058080.1	0	0	1		17	2	2	0		0	1	327		327	327	1	1.850000	-2.578158	1	0.200000	NM_004541			34	34		1464	1455	0		1	0		0	0	327	0		9.944770e-01	1	0	1	0	2432	0	34	1464
TFDP3	51270	broad.mit.edu	37	X	132351106	132351106	+	Silent	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:132351106G>A	ENST00000310125.4	-	1	1270	c.1182C>T	c.(1180-1182)aaC>aaT	p.N394N		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	394	Asp/Glu-rich (acidic; NCB domain).				cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					GGTCGTCATCGTTGTTGTCCT	0.498																																						ENST00000310125.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				19						c.(1180-1182)aaC>aaT		transcription factor Dp family, member 3							95.0	93.0	94.0					X																	132351106		2201	4299	6500	SO:0001819	synonymous_variant	51270	10	121400	42				g.chrX:132351106G>A	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.1182C>T	chrX.hg19:g.132351106G>A								p.N394N	NM_016521.2	NP_057605.3	0	1	1		Q5H9I0	TFDP3_HUMAN		1	1270	-	Acute lymphoblastic leukemia(192;0.000127)		Q6DK49|Q9NZ54	Silent	SNP	ENST00000310125.4	1	1	hg19	c.1182C>T	CCDS14636.2	1																																																																																								0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.498	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	1	0	1		2	2	2	0		0	0	209		209	207	1	1.850000	-20.000000	1	0.200000	NM_016521			186	182		773	765	1		1			0	0	209	0		1	0	0	0	0	0	0	186	773
DMD	1756	broad.mit.edu	37	X	32563424	32563424	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:32563424G>A	ENST00000357033.4	-	17	2226	c.2020C>T	c.(2020-2022)Cca>Tca	p.P674S	DMD_ENST00000378677.2_Missense_Mutation_p.P670S|DMD_ENST00000288447.4_Missense_Mutation_p.P666S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	674					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTTAGTGATGGCTGAGTGGTG	0.463																																						ENST00000357033.4	0.510000	0.170000	0.420000	0.230000	0.310000	0.330732	0.310000	0.300000																										0				77						c.(2020-2022)Cca>Tca		dystrophin							194.0	141.0	159.0					X																	32563424		2202	4300	6502	SO:0001583	missense	1756	0	0					g.chrX:32563424G>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2020C>T	chrX.hg19:g.32563424G>A	ENSP00000354923:p.Pro674Ser						DMD_ENST00000288447.4_Missense_Mutation_p.P666S|DMD_ENST00000378677.2_Missense_Mutation_p.P670S	p.P674S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	0	1	1		P11532	DMD_HUMAN		17	2226	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	1	1	hg19	c.2020C>T	CCDS14233.1	0	.	.	.	.	.	.	.	.	.	.	G	9.924	1.212886	0.22289	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.71461	0.2;0.2;-0.57	5.64	4.69	0.59074	5.64	4.69	0.59074	.	0.253065	0.20010	U	0.101151	T	0.56790	0.2009	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.20887	0.049;0.003;0.007;0.002	B;B;B;B	0.19666	0.026;0.015;0.003;0.007	T	0.51284	-0.8725	10	0.18710	T	0.47	.	12.1345	0.53964	0.0:0.0:0.6831:0.3169	.	666;666;674;670	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	S	666;670;674;674;551;666	ENSP00000367948:P670S;ENSP00000354923:P674S;ENSP00000288447:P666S	ENSP00000288447:P666S	P	-	1	0	0	DMD	32473345	32473345	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.541000	0.45735	2.356000	0.79943	0.506000	0.49869	CCA	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.463	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	0	0	1		2	2	2	0		0	0	92		92	92	1	1.850000	-3.639479	1	0.200000	NM_004006			12	12		375	373	0		1	0		0	0	92	0		9.991204e-01	3.506926e-03	0	0	0	3	0	12	375
TBX22	50945	broad.mit.edu	37	X	79279655	79279655	+	Silent	SNP	A	A	G			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:79279655A>G	ENST00000373294.5	+	3	478	c.450A>G	c.(448-450)aaA>aaG	p.K150K	TBX22_ENST00000373296.3_Silent_p.K150K|TBX22_ENST00000442340.1_Silent_p.K30K|TBX22_ENST00000373291.1_Silent_p.K30K	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	150					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGGATTCCAAACGCTATAGGT	0.527																																						ENST00000373294.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				65						c.(448-450)aaA>aaG		T-box 22							152.0	118.0	129.0					X																	79279655		2203	4300	6503	SO:0001819	synonymous_variant	50945	0	0					g.chrX:79279655A>G	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.450A>G	chrX.hg19:g.79279655A>G							TBX22_ENST00000373296.3_Silent_p.K150K|TBX22_ENST00000442340.1_Silent_p.K30K|TBX22_ENST00000373291.1_Silent_p.K30K	p.K150K	NM_016954.2	NP_058650.1	0	1	1		Q9Y458	TBX22_HUMAN		3	478	+			Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	ENST00000373294.5	1	1	hg19	c.450A>G	CCDS14445.1	1																																																																																								0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.527	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	1	0	1		2	2	2	0		0	0	125		125	125	1	1.850000	-20.000000	1	0.200000	NM_016954			101	100		439	436	1		1			0	0	125	0		1	0	0	0	0	0	0	101	439
SYTL4	94121	broad.mit.edu	37	X	99956515	99956515	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:99956515G>A	ENST00000372989.1	-	5	596	c.265C>T	c.(265-267)Cgg>Tgg	p.R89W	SYTL4_ENST00000372981.1_Missense_Mutation_p.R89W|SYTL4_ENST00000263033.5_Missense_Mutation_p.R89W|SYTL4_ENST00000276141.6_Missense_Mutation_p.R89W|SYTL4_ENST00000454200.2_Missense_Mutation_p.R89W|SYTL4_ENST00000455616.1_Missense_Mutation_p.R89W	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	89	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CGGCAGTCCCGACACACCAGG	0.572																																						ENST00000372989.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				27						c.(265-267)Cgg>Tgg		synaptotagmin-like 4	"""Insulin(DB00071)|Insulin Regular(DB00030)"						107.0	90.0	96.0					X																	99956515		2203	4300	6503	SO:0001583	missense	94121	1	121410	47				g.chrX:99956515G>A		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.265C>T	chrX.hg19:g.99956515G>A	ENSP00000362080:p.Arg89Trp						SYTL4_ENST00000454200.2_Missense_Mutation_p.R89W|SYTL4_ENST00000263033.5_Missense_Mutation_p.R89W|SYTL4_ENST00000372981.1_Missense_Mutation_p.R89W|SYTL4_ENST00000276141.6_Missense_Mutation_p.R89W|SYTL4_ENST00000455616.1_Missense_Mutation_p.R89W	p.R89W	NM_080737.2	NP_542775.2	0	1	1		Q96C24	SYTL4_HUMAN		5	596	-			Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	1	1	hg19	c.265C>T	CCDS14472.1	1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920656	0.52653	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.25	4.39	0.52855	5.25	4.39	0.52855	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.262657	0.37530	N	0.002046	D	0.82356	0.5019	M	0.63843	1.955	0.29637	N	0.845039	D;D	0.76494	0.999;0.986	P;P	0.62382	0.901;0.487	T	0.77707	-0.2487	9	.	.	.	-4.0888	8.1107	0.30914	0.0833:0.0:0.7602:0.1565	.	89;89	Q96C24-2;Q96C24	.;SYTL4_HUMAN	W	89	ENSP00000362080:R89W;ENSP00000390252:R89W;ENSP00000403556:R89W;ENSP00000276141:R89W;ENSP00000263033:R89W;ENSP00000362072:R89W	.	R	-	1	2	2	SYTL4	99843171	99843171	0.987000	0.35691	0.961000	0.40146	0.629000	0.37895	3.328000	0.52052	1.119000	0.41883	0.600000	0.82982	CGG	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.572	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	1	0	1		2	2	2	0		0	0	208		208	206	1	1.850000	-2.966736	1	0.200000	NM_080737			153	150		823	808	1		1	1		0	0	208	0		1	5.348295e-01	0	6	0	5	0	153	823
PDZD4	57595	broad.mit.edu	37	X	153069953	153069953	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-8637-01A-11D-2396-08	TCGA-HZ-8637-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2bc6ae6f-fb9e-42e1-b5b4-4a83cc60d88a	5aa2b147-56e6-46e5-829f-ba6ac30defb8	g.chrX:153069953C>T	ENST00000164640.4	-	8	1356	c.1165G>A	c.(1165-1167)Gtc>Atc	p.V389I	PDZD4_ENST00000393758.2_Missense_Mutation_p.V314I|PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000544474.1_Missense_Mutation_p.V280I	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	389						cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTGCGGTTGACGTCCAGGGCG	0.632																																						ENST00000164640.4	0.730000	0.300000	0.620000	0.390000	0.490000	0.509289	0.490000	0.480000																										0				23						c.(1165-1167)Gtc>Atc		PDZ domain containing 4							48.0	40.0	43.0					X																	153069953		2203	4300	6503	SO:0001583	missense	57595	0	0					g.chrX:153069953C>T	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.1165G>A	chrX.hg19:g.153069953C>T	ENSP00000164640:p.Val389Ile						PDZD4_ENST00000393758.2_Missense_Mutation_p.V314I|PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000544474.1_Missense_Mutation_p.V280I	p.V389I	NM_032512.2	NP_115901.2	0	1	1		Q76G19	PDZD4_HUMAN		8	1356	-	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	ENST00000164640.4	1	1	hg19	c.1165G>A	CCDS14732.1	0	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020509	0.35606	.	.	ENSG00000067840	ENST00000164640;ENST00000393758;ENST00000537633;ENST00000544474	T;T;T	0.04706	3.57;3.57;3.77	5.02	5.02	0.67125	5.02	5.02	0.67125	.	0.000000	0.34338	U	0.004046	T	0.09291	0.0229	L	0.46157	1.445	0.43857	D	0.996456	D;P;D;D;D	0.60575	0.98;0.956;0.988;0.988;0.98	P;P;B;P;P	0.48488	0.579;0.475;0.38;0.539;0.579	T	0.15636	-1.0430	10	0.39692	T	0.17	-44.1464	16.1719	0.81822	0.0:1.0:0.0:0.0	.	280;395;389;314;293	B7ZKY3;Q17RL8;Q76G19;D3DWW0;B3KVR9	.;.;PDZD4_HUMAN;.;.	I	389;314;293;280	ENSP00000164640:V389I;ENSP00000377355:V314I;ENSP00000442033:V280I	ENSP00000164640:V389I	V	-	1	0	0	PDZD4	152723147	152723147	0.830000	0.29337	0.989000	0.46669	0.807000	0.45602	2.646000	0.46630	2.069000	0.61940	0.436000	0.28706	GTC	0.200000		TCGA-HZ-8637-01A-11D-2396-08	0.632	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	1	0	1		2	2	2	0		0	0	75		75	74	1	1.850000	-19.227920	1	0.200000	NM_032512			18	18		349	344	0		1	0		0	0	75	0		9.999812e-01	2.185905e-01	0	0	0	17	0	18	349
