#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ARL5B	221079	broad.mit.edu	37	10	18961589	18961595	+	Frame_Shift_Del	DEL	ACTAGCT	ACTAGCT	-			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:18961589_18961595delACTAGCT	ENST00000377275.3	+	4	527_533	c.294_300delACTAGCT	c.(292-300)cgactagctfs	p.RLA98fs		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	98					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						ACAGGGAACGACTAGCTATTACAAAAG	0.309																																						ENST00000377275.3	0.490000	0.260000	0.440000	0.310000	0.370000	0.381637	0.370000	0.380000																										0				2						c.(292-300)cgactagctfs		ADP-ribosylation factor-like 5B																																				SO:0001589	frameshift_variant	221079	0	0					g.chr10:18961589_18961595delACTAGCT	AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.294_300delACTAGCT	chr10.hg19:g.18961589_18961595delACTAGCT	ENSP00000366487:p.Arg98fs	0						p.RLA98fs	NM_178815.3	NP_848930.1	0	1	1	2.049442	Q96KC2	ARL5B_HUMAN		4	527_533	+				Frame_Shift_Del	DEL	ENST00000377275.3	1	1	hg19	c.294_300delACTAGCT	CCDS7131.1	0																																																																																								0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.309	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047078.1	1	0	1		20	2		0		0	4	259		259	259	1	1.860000	-7.858647	1	0.350000	NM_178815			39	60		555	568	0		1	0	0	0	0	259	0		0.998148	3.995909e-02	0	1	0	4	0	39	555
MFHAS1	9258	broad.mit.edu	37	8	8749703	8749703	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr8:8749703delG	ENST00000276282.6	-	1	1452	c.866delC	c.(865-867)cctfs	p.P289fs		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	289										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CAGCGCGGCAGGGAACTCCTC	0.627																																					Melanoma(103;1201 2045 17515 28966)	ENST00000276282.6	1.000000	0.700000	1.000000	0.800000	0.920000	0.909728	0.920000	1.000000																										0				21						c.(865-867)cctfs		malignant fibrous histiocytoma amplified sequence 1							26.0	29.0	28.0					8																	8749703		2202	4300	6502	SO:0001589	frameshift_variant	9258	0	0					g.chr8:8749703delG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.866delC	chr8.hg19:g.8749703delG	ENSP00000276282:p.Pro289fs	0						p.P289fs	NM_004225.2	NP_004216.2	1	2	3	2.059506	Q9Y4C4	MFHA1_HUMAN		1	1452	-		Hepatocellular(245;0.217)	Q96CI0	Frame_Shift_Del	DEL	ENST00000276282.6	1	0	hg19	c.866delC	CCDS34844.1	1																																																																																								0.352267		TCGA-HZ-A49I-01A-12D-A26I-08	0.627	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	1	0	1		22	2		0		0	4	121		121	122	1	1.860000	-20.000000	1	0.350000	NM_004225			54	64		282	278	0		1	0	0	0	0	121	0		0.999983	3.191968e-01	0	1	0	6	0	54	282
OTUD6B	51633	broad.mit.edu	37	8	92097044	92097046	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr8:92097044_92097046delATT	ENST00000285420.4	+	7	1019_1021	c.920_922delATT	c.(919-924)cattat>cat	p.Y308del	OTUD6B_ENST00000404789.3_In_Frame_Del_p.Y177del	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	278							cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			TTAGGAGAACATTATAATTCGGT	0.276																																						ENST00000285420.4	1.000000	0.480000	1.000000	0.630000	0.800000	0.805918	0.800000	1.000000																										0				11						c.(919-924)cattat>cat		OTU domain containing 6B																																				SO:0001651	inframe_deletion	51633	0	0					g.chr8:92097044_92097046delATT		CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.920_922delATT	chr8.hg19:g.92097044_92097046delATT	ENSP00000285420:p.Tyr308del	0					OTUD6B_ENST00000404789.3_In_Frame_Del_p.Y177del	p.Y308del	NM_016023.3	NP_057107.3	0	0	0	2.025635	Q8N6M0	OTU6B_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0187)	7	1019_1021	+			A8K6I1|B4DEY0|Q9NTA4|Q9Y387	In_Frame_Del	DEL	ENST00000285420.4	0	1	hg19	c.920_922delATT	CCDS6253.2	0																																																																																								0.340771		TCGA-HZ-A49I-01A-12D-A26I-08	0.276	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000319968.1	1	0	1		2	2		0		0	0	33		33	32	1	1.860000	-10.055960	1	0.350000	NM_016023			15	7		90	92	0		1	0	0	0	0	33	0		0.999864	2.833040e-01	0	0	0	7	0	15	90
CUBN	8029	broad.mit.edu	37	10	17026279	17026279	+	Splice_Site	SNP	C	C	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:17026279C>A	ENST00000377833.4	-	30	4416		c.e30-1			NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)						cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTCCATAGATCTAACATGGGA	0.473																																						ENST00000377833.4	1.000000	0.730000	1.000000	0.840000	0.960000	0.937154	0.960000	1.000000																										0				241						c.e30-1		cubilin (intrinsic factor-cobalamin receptor)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						57.0	56.0	57.0					10																	17026279		2203	4300	6503	SO:0001630	splice_region_variant	8029	0	0					g.chr10:17026279C>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.4351-1G>T	chr10.hg19:g.17026279C>A		0							NM_001081.3	NP_001072.2	0	1	1	2.049442	O60494	CUBN_HUMAN		30	4416	-			B0YIZ4|Q5VTA6|Q96RU9	Splice_Site	SNP	ENST00000377833.4	1	1	hg19		CCDS7113.1	1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.547261	0.65311	.	.	ENSG00000107611	ENST00000377833	.	.	.	5.96	5.96	0.96718	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4008	0.98991	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	CUBN	17066285	17066285	1.000000	0.71417	0.929000	0.37066	0.742000	0.42306	7.165000	0.77544	2.826000	0.97356	0.655000	0.94253	.	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.473	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	1	0	1		2	2	2	0		0	0	99		99	99	1	1.860000	-20.000000	1	0.350000	NM_001081	Intron		48	48		234	231	1		1			0	0	99	0		1.000000	0	0	0	0	0	0	48	234
ARHGAP12	94134	broad.mit.edu	37	10	32143120	32143120	+	Silent	SNP	T	T	C			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:32143120T>C	ENST00000344936.2	-	5	1197	c.963A>G	c.(961-963)gaA>gaG	p.E321E	ARHGAP12_ENST00000396144.4_Silent_p.E321E|ARHGAP12_ENST00000311380.4_Intron|ARHGAP12_ENST00000375250.5_Silent_p.E321E|ARHGAP12_ENST00000375245.4_Intron	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	321					morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				AGTAGTTTTCTTCCGATGAAA	0.348																																						ENST00000344936.2	1.000000	0.890000	1.000000	0.990000	0.990000	0.992313	0.990000	1.000000																										0				31						c.(961-963)gaA>gaG		Rho GTPase activating protein 12							74.0	68.0	70.0					10																	32143120		2203	4300	6503	SO:0001819	synonymous_variant	94134	0	0					g.chr10:32143120T>C	AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.963A>G	chr10.hg19:g.32143120T>C		0					ARHGAP12_ENST00000396144.4_Silent_p.E321E|ARHGAP12_ENST00000311380.4_Intron|ARHGAP12_ENST00000375250.5_Silent_p.E321E|ARHGAP12_ENST00000375245.4_Intron	p.E321E	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	0	1	1	2.049442	Q8IWW6	RHG12_HUMAN		5	1197	-		Prostate(175;0.0199)	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Silent	SNP	ENST00000344936.2	1	1	hg19	c.963A>G	CCDS7170.1	1																																																																																								0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.348	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1	1	0	1		2	2	2	0		0	0	76		76	76	1	1.860000	-20.000000	1	0.350000				73	73		298	296	0		1	0		0	0	76	0		1.000000	9.347391e-01	0	1	0	20	0	73	298
P4HA1	5033	broad.mit.edu	37	10	74806700	74806700	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:74806700C>G	ENST00000307116.2	-	8	1176	c.1060G>C	c.(1060-1062)Gac>Cac	p.D354H	P4HA1_ENST00000412021.2_Missense_Mutation_p.D354H|P4HA1_ENST00000263556.3_Missense_Mutation_p.D354H|P4HA1_ENST00000373008.2_Missense_Mutation_p.D354H|P4HA1_ENST00000394890.2_Missense_Mutation_p.D354H|P4HA1_ENST00000440381.1_Missense_Mutation_p.D354H			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	354					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TTTGCTAGGTCTTTGACGATT	0.328																																					Colon(147;367 2405 2662 52127)	ENST00000307116.2	0.220000	0.080000	0.180000	0.100000	0.140000	0.147927	0.140000	0.140000																										0				15						c.(1060-1062)Gac>Cac		prolyl 4-hydroxylase, alpha polypeptide I	Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)						106.0	106.0	106.0					10																	74806700		2203	4300	6503	SO:0001583	missense	5033	0	0					g.chr10:74806700C>G		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.1060G>C	chr10.hg19:g.74806700C>G	ENSP00000307318:p.Asp354His	0					P4HA1_ENST00000440381.1_Missense_Mutation_p.D354H|P4HA1_ENST00000373008.2_Missense_Mutation_p.D354H|P4HA1_ENST00000412021.2_Missense_Mutation_p.D354H|P4HA1_ENST00000394890.2_Missense_Mutation_p.D354H|P4HA1_ENST00000263556.3_Missense_Mutation_p.D354H	p.D354H			0	0	0	2.040865	P13674	P4HA1_HUMAN		8	1176	-	Prostate(51;0.0198)		C9JL12|Q15082|Q15083|Q5VSQ5	Missense_Mutation	SNP	ENST00000307116.2	1	1	hg19	c.1060G>C		0	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047064	0.55110	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	T;T;T;T;T;T	0.45668	0.9;0.9;0.9;0.9;0.9;0.89	5.94	5.94	0.96194	5.94	5.94	0.96194	Prolyl 4-hydroxylase, alpha subunit (1);	0.204990	0.49916	D	0.000139	T	0.36082	0.0954	L	0.29908	0.895	0.44188	D	0.997006	B;P;P	0.41159	0.002;0.626;0.74	B;B;B	0.36534	0.006;0.227;0.227	T	0.18871	-1.0323	10	0.56958	D	0.05	-16.6435	20.369	0.98888	0.0:1.0:0.0:0.0	.	354;354;354	C9JL12;Q5VSQ6;P13674	.;.;P4HA1_HUMAN	H	354	ENSP00000307318:D354H;ENSP00000362099:D354H;ENSP00000411688:D354H;ENSP00000378353:D354H;ENSP00000263556:D354H;ENSP00000414464:D354H	ENSP00000263556:D354H	D	-	1	0	0	P4HA1	74476706	74476706	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.698000	0.61789	2.819000	0.97034	0.650000	0.86243	GAC	0.347717		TCGA-HZ-A49I-01A-12D-A26I-08	0.328	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	0	0	1		2	2	2	0		0	0	187		187	186	1	1.860000	-3.263552	1	0.350000	NM_000917			17	18		672	664	0		1	1		0	0	187	0		0.999962	6.968838e-01	0	2	0	94	0	17	672
GRID1	2894	broad.mit.edu	37	10	87628834	87628834	+	Missense_Mutation	SNP	G	G	A	rs143353694		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:87628834G>A	ENST00000327946.7	-	6	969	c.884C>T	c.(883-885)aCg>aTg	p.T295M		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	295					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GTTGTTCCTCGTGCATTTCTG	0.572										Multiple Myeloma(13;0.14)																												ENST00000327946.7	1.000000	0.910000	1.000000	0.990000	0.990000	0.993820	0.990000	1.000000																										0				106						c.(883-885)aCg>aTg		glutamate receptor, ionotropic, delta 1		A	MET/THR	0,4406		0,0,2203	211.0	160.0	177.0		884	4.6	1.0	10	dbSNP_134	177	3,8597	819.1+/-406.8	0,3,4297	yes	missense	GRID1	NM_017551.2	81	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	295/1010	87628834	3,13003	2203	4300	6503	SO:0001583	missense	2894	26	121412	46				g.chr10:87628834G>A	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.884C>T	chr10.hg19:g.87628834G>A	ENSP00000330148:p.Thr295Met	0	Multiple Myeloma(13;0.14)					p.T295M	NM_017551.2	NP_060021.1	0	1	1	2.049385	Q9ULK0	GRID1_HUMAN		6	969	-			B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	1	1	hg19	c.884C>T	CCDS31236.1	1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117851	0.37339	0.0	3.49E-4	ENSG00000182771	ENST00000327946	D	0.82526	-1.62	5.71	4.58	0.56647	5.71	4.58	0.56647	Extracellular ligand-binding receptor (1);	0.283290	0.48286	N	0.000183	T	0.50769	0.1635	N	0.00436	-1.5	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44697	-0.9311	10	0.15066	T	0.55	.	8.8037	0.34925	0.8007:0.0:0.1993:0.0	.	295	Q9ULK0	GRID1_HUMAN	M	295	ENSP00000330148:T295M	ENSP00000330148:T295M	T	-	2	0	0	GRID1	87618814	87618814	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.464000	0.60134	0.991000	0.38814	-0.254000	0.11334	ACG	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.572	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	1	0	1		2	2	2	0		0	0	164		164	162	1	1.860000	-3.592518	1	0.350000	XM_043613			90	90		370	369	1		1	0		0	0	164	0		1.000000	8.481529e-01	0	1	0	15	0	90	370
TLL2	7093	broad.mit.edu	37	10	98145915	98145915	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:98145915G>A	ENST00000357947.3	-	15	2135	c.1910C>T	c.(1909-1911)cCg>cTg	p.P637L		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	637	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		ATACTCCTTCGGCCACCCAGG	0.532																																						ENST00000357947.3	0.970000	0.650000	0.890000	0.730000	0.800000	0.815906	0.800000	0.810000																										0				58						c.(1909-1911)cCg>cTg		tolloid-like 2							113.0	109.0	110.0					10																	98145915		2203	4300	6503	SO:0001583	missense	7093	0	0					g.chr10:98145915G>A	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1910C>T	chr10.hg19:g.98145915G>A	ENSP00000350630:p.Pro637Leu	0						p.P637L	NM_012465.3	NP_036597.1	0	1	1	2.049385	Q9Y6L7	TLL2_HUMAN		15	2135	-		Colorectal(252;0.0846)	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	1	1	hg19	c.1910C>T	CCDS7449.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.175833	0.94807	.	.	ENSG00000095587	ENST00000357947	T	0.53206	0.63	4.98	4.98	0.66077	4.98	4.98	0.66077	CUB (5);	0.000000	0.45361	D	0.000367	T	0.78578	0.4305	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84878	0.0829	10	0.72032	D	0.01	.	17.7792	0.88518	0.0:0.0:1.0:0.0	.	637	Q9Y6L7	TLL2_HUMAN	L	637	ENSP00000350630:P637L	ENSP00000350630:P637L	P	-	2	0	0	TLL2	98135905	98135905	1.000000	0.71417	0.988000	0.46212	0.952000	0.60782	9.601000	0.98297	2.761000	0.94854	0.585000	0.79938	CCG	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.532	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1	1	0	1		2	2	2	0		0	0	249		249	245	1	1.860000	-2.879520	1	0.350000				86	84		518	515	1		1			0	0	249	0		1.000000	0	0	0	0	0	0	86	518
PSD	5662	broad.mit.edu	37	10	104173704	104173704	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr10:104173704C>T	ENST00000020673.5	-	5	1901	c.1375G>A	c.(1375-1377)Gcc>Acc	p.A459T	PSD_ENST00000406432.1_Missense_Mutation_p.A459T|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	459	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GCAAGTGGGGCGGGAGCTGGT	0.657																																						ENST00000020673.5	1.000000	0.850000	1.000000	0.940000	0.990000	0.981164	0.990000	1.000000																										0				34						c.(1375-1377)Gcc>Acc		pleckstrin and Sec7 domain containing							36.0	44.0	42.0					10																	104173704		2203	4298	6501	SO:0001583	missense	5662	3	121408	32				g.chr10:104173704C>T	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1375G>A	chr10.hg19:g.104173704C>T	ENSP00000020673:p.Ala459Thr	0					PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Missense_Mutation_p.A459T	p.A459T	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	0	1	1	2.049385	A5PKW4	PSD1_HUMAN		5	1901	-			B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	1	1	hg19	c.1375G>A	CCDS31272.1	1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847795	0.51164	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.49720	0.77;0.77	4.78	4.78	0.61160	4.78	4.78	0.61160	.	0.277670	0.29396	N	0.012273	T	0.31544	0.0800	L	0.27053	0.805	0.35766	D	0.820535	P	0.35551	0.509	B	0.20184	0.028	T	0.37314	-0.9711	10	0.19147	T	0.46	.	17.8792	0.88835	0.0:1.0:0.0:0.0	.	459	A5PKW4	PSD1_HUMAN	T	459;362;459	ENSP00000020673:A459T;ENSP00000384830:A459T	ENSP00000020673:A459T	A	-	1	0	0	PSD	104163694	104163694	1.000000	0.71417	0.995000	0.50966	0.271000	0.26615	5.034000	0.64152	2.224000	0.72417	0.555000	0.69702	GCC	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.657	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2	1	0	1		2	2	2	0		0	0	193		193	190	1	1.860000	-3.267264	1	0.350000				75	73		329	324	1		1	1		0	0	193	0		1.000000	2.364117e-01	0	3	0	2	0	75	329
GLB1L2	89944	broad.mit.edu	37	11	134244879	134244879	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr11:134244879A>C	ENST00000535456.2	+	19	2026	c.1838A>C	c.(1837-1839)gAg>gCg	p.E613A	GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Missense_Mutation_p.E613A|GLB1L2_ENST00000389881.3_Missense_Mutation_p.E613A	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	613					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		ATCGTTTTTGAGGAGACGATG	0.627																																						ENST00000535456.2	1.000000	0.600000	1.000000	0.750000	0.920000	0.896003	0.920000	1.000000																										0				41						c.(1837-1839)gAg>gCg		galactosidase, beta 1-like 2							49.0	43.0	45.0					11																	134244879		2201	4297	6498	SO:0001583	missense	89944	1	121406	29				g.chr11:134244879A>C		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1838A>C	chr11.hg19:g.134244879A>C	ENSP00000444628:p.Glu613Ala	0					GLB1L2_ENST00000389881.3_Missense_Mutation_p.E613A|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Missense_Mutation_p.E613A	p.E613A	NM_138342.3	NP_612351.2	0	0	0	2.036179	Q8IW92	GLBL2_HUMAN		19	2026	+	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	1	1	hg19	c.1838A>C	CCDS31724.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.02|17.02	3.280796|3.280796	0.59758|0.59758	.|.	.|.	ENSG00000149328|ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881|ENST00000525089	D;D;D|.	0.95001|.	-3.58;-3.58;-3.58|.	5.32|5.32	5.32|5.32	0.75619|0.75619	5.32|5.32	5.32|5.32	0.75619|0.75619	Galactose-binding domain-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86497|.	0.5947|.	H|H	0.95539|0.95539	3.685|3.685	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.70016|.	0.967|.	D|.	0.90373|.	0.4382|.	10|.	0.87932|.	D|.	0|.	-36.4735|-36.4735	13.8558|13.8558	0.63527|0.63527	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	613|.	Q8IW92|.	GLBL2_HUMAN|.	A|C	613|551	ENSP00000344659:E613A;ENSP00000444628:E613A;ENSP00000374531:E613A|.	ENSP00000344659:E613A|.	E|X	+|+	2|3	0|0	0|0	GLB1L2|GLB1L2	133750089|133750089	133750089|133750089	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.192000|0.192000	0.23643|0.23643	6.939000|6.939000	0.75911|0.75911	2.001000|2.001000	0.58596|0.58596	0.482000|0.482000	0.46254|0.46254	GAG|TGA	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.627	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	1	0	1		2	2	2	0		0	0	55		55	55	1	1.860000	-20.000000	1	0.350000	NM_138342			21	21		107	102	1		1	1		0	0	55	0		0.999998	9.646393e-01	0	15	0	16	0	21	107
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	2	2	4	2.654299	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.505703		TCGA-HZ-A49I-01A-12D-A26I-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	33		33	33	1	1.860000	-20.000000	1	0.350000	NM_033360			43	42		101	100	1		1	1	1	0	0	33	500		1.000000	8.439835e-01	1	7	78	3	185	43	101
MDM2	4193	broad.mit.edu	37	12	69218184	69218184	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr12:69218184C>G	ENST00000350057.5	+	4	307	c.307C>G	c.(307-309)Cac>Gac	p.H103D	MDM2_ENST00000544561.1_Intron|MDM2_ENST00000478070.1_Intron|MDM2_ENST00000348801.2_Intron|MDM2_ENST00000428863.2_Intron|MDM2_ENST00000356290.4_Intron|MDM2_ENST00000393410.1_Intron|MDM2_ENST00000360430.2_Intron|MDM2_ENST00000258149.5_Intron|MDM2_ENST00000393413.3_Intron|MDM2_ENST00000299252.4_Intron|MDM2_ENST00000393412.3_Intron|MDM2_ENST00000462284.1_Missense_Mutation_p.H134D|MDM2_ENST00000540827.1_Intron|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000258148.7_Intron|MDM2_ENST00000545204.1_Intron			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	128	Necessary for interaction with USP2.|SWIB.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GAACAGGTGTCACCTTGAAGG	0.423			A		"""sarcoma, glioma, colorectal, other"""																																	ENST00000350057.5	1.000000	0.720000	1.000000	0.840000	0.990000	0.942601	0.990000	1.000000				Dom	yes			Dom	yes		12	12q15	12q15	4193	A	Mdm2 p53 binding protein homolog				"""M, O, E, L"""	M, O, E, L			sarcoma, glioma, colorectal, other		0				19						c.(307-309)Cac>Gac		MDM2 proto-oncogene, E3 ubiquitin protein ligase							95.0	91.0	92.0					12																	69218184		1835	4089	5924	SO:0001583	missense	4193	0	0					g.chr12:69218184C>G		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.307C>G	chr12.hg19:g.69218184C>G	ENSP00000266624:p.His103Asp	1					MDM2_ENST00000360430.2_Intron|MDM2_ENST00000299252.4_Intron|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000478070.1_Intron|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000428863.2_Intron|MDM2_ENST00000356290.4_Intron|MDM2_ENST00000393410.1_Intron|MDM2_ENST00000393413.3_Intron|MDM2_ENST00000258149.5_Intron|MDM2_ENST00000393412.3_Intron|MDM2_ENST00000462284.1_Missense_Mutation_p.H134D|MDM2_ENST00000540827.1_Intron|MDM2_ENST00000258148.7_Intron|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000348801.2_Intron	p.H103D			1	2	3	2.249255	Q00987	MDM2_HUMAN	all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)	4	307	+	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	ENST00000350057.5	1	1	hg19	c.307C>G		1	.	.	.	.	.	.	.	.	.	.	C	0.304	-0.971751	0.02215	.	.	ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000311440;ENST00000311420;ENST00000539479;ENST00000393415;ENST00000393416;ENST00000350057	T;T;T	0.43688	1.54;0.94;1.54	5.65	3.79	0.43588	5.65	3.79	0.43588	.	0.565311	0.20923	N	0.083253	T	0.20455	0.0492	N	0.08118	0	0.26660	N	0.971938	B;B;B;B	0.19331	0.0;0.023;0.035;0.0	B;B;B;B	0.14023	0.001;0.01;0.009;0.001	T	0.17258	-1.0375	9	.	.	.	-9.2634	8.905	0.35519	0.1483:0.7763:0.0:0.0755	.	83;128;128;134	Q00987-9;Q00987;Q8NDW2;Q00987-11	.;MDM2_HUMAN;.;.	D	134;83;128;89;128;128;159;103	ENSP00000417281:H134D;ENSP00000444430:H128D;ENSP00000266624:H103D	.	H	+	1	0	0	MDM2	67504451	67504451	0.104000	0.21937	0.032000	0.17829	0.219000	0.24729	1.031000	0.30165	0.833000	0.34828	0.585000	0.79938	CAC	0.408957		TCGA-HZ-A49I-01A-12D-A26I-08	0.423	MDM2-033	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000402665.1	1	0	1		2	2	2	0		0	0	46		46	46	1	1.860000	-3.326894	1	0.350000	NM_006880			44	44		247	247	1		1	0		0	0	46	0		1.000000	9.652173e-01	0	0	0	33	0	44	247
RSRC2	65117	broad.mit.edu	37	12	122999745	122999745	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr12:122999745C>T	ENST00000331738.7	-	6	777	c.632G>A	c.(631-633)aGa>aAa	p.R211K	RSRC2_ENST00000354654.2_Missense_Mutation_p.R163K|RSRC2_ENST00000392442.2_5'Flank	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	211							poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		GCTAAATCTTCTCGGCTTTTC	0.378																																						ENST00000331738.7	1.000000	0.660000	0.920000	0.730000	0.820000	0.832943	0.820000	0.830000																										0				24						c.(631-633)aGa>aAa		arginine/serine-rich coiled-coil 2							212.0	205.0	208.0					12																	122999745		2203	4300	6503	SO:0001583	missense	65117	0	0					g.chr12:122999745C>T	AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.632G>A	chr12.hg19:g.122999745C>T	ENSP00000330188:p.Arg211Lys	1					RSRC2_ENST00000354654.2_Missense_Mutation_p.R163K|RSRC2_ENST00000392442.2_5'Flank	p.R211K	NM_023012.5	NP_075388.2	0	1	1	1.808274	Q7L4I2	RSRC2_HUMAN		6	777	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	ENST00000331738.7	1	1	hg19	c.632G>A	CCDS31920.1	0	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802748	0.70682	.	.	ENSG00000111011	ENST00000331738;ENST00000354654;ENST00000418773;ENST00000344591	T;T;T	0.23950	2.35;1.88;1.88	5.63	5.63	0.86233	5.63	5.63	0.86233	.	0.144353	0.64402	D	0.000005	T	0.21590	0.0520	L	0.27053	0.805	0.39090	D	0.961074	P;B;P;B	0.40834	0.73;0.397;0.73;0.397	B;B;B;B	0.38755	0.281;0.173;0.281;0.173	T	0.02909	-1.1095	10	0.20519	T	0.43	.	20.0442	0.97604	0.0:1.0:0.0:0.0	.	211;163;211;152	F5GXM2;Q7L4I2-2;Q7L4I2;E1B6W4	.;.;RSRC2_HUMAN;.	K	211;163;211;152	ENSP00000330188:R211K;ENSP00000346678:R163K;ENSP00000343315:R152K	ENSP00000330188:R211K	R	-	2	0	0	RSRC2	121565698	121565698	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.692000	0.54727	2.814000	0.96858	0.655000	0.94253	AGA	0.228487		TCGA-HZ-A49I-01A-12D-A26I-08	0.378	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	1	0	1		2	2	2	0		0	0	114		114	114	1	1.860000	-20.000000	1	0.350000	NM_023012			70	69		334	331	1		1	1		0	0	114	0		1.000000	9.999997e-01	0	50	0	55	0	70	334
GPR183	1880	broad.mit.edu	37	13	99947840	99947840	+	Missense_Mutation	SNP	A	A	G	rs576971706		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr13:99947840A>G	ENST00000376414.4	-	2	643	c.560T>C	c.(559-561)tTt>tCt	p.F187S	UBAC2_ENST00000403766.3_Intron|UBAC2_ENST00000376440.2_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	187					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)			cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						AGTTTCTTCAAAGTTTGGATA	0.413													A|||	1	0.000199681	0.0	0.0	5008	,	,		20688	0.0		0.0	False		,,,				2504	0.001					ENST00000376414.4	1.000000	0.810000	1.000000	0.900000	0.990000	0.963024	0.990000	1.000000																										0				23						c.(559-561)tTt>tCt		G protein-coupled receptor 183							92.0	87.0	89.0					13																	99947840		2203	4300	6503	SO:0001583	missense	1880	0	0					g.chr13:99947840A>G	L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.560T>C	chr13.hg19:g.99947840A>G	ENSP00000365596:p.Phe187Ser	0					UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	p.F187S	NM_004951.4	NP_004942.1	1	2	3	2.053284	P32249	GP183_HUMAN		2	643	-			B2R8N5|Q53F99|Q5JUH7	Missense_Mutation	SNP	ENST00000376414.4	1	1	hg19	c.560T>C	CCDS9492.1	1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213653	0.79352	.	.	ENSG00000169508	ENST00000376414	T	0.38401	1.14	5.76	5.76	0.90799	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.053527	0.85682	D	0.000000	T	0.54111	0.1838	L	0.51422	1.61	0.58432	D	0.999999	D	0.76494	0.999	D	0.73380	0.98	T	0.50189	-0.8857	9	.	.	.	.	16.0843	0.81031	1.0:0.0:0.0:0.0	.	187	P32249	GP183_HUMAN	S	187	ENSP00000365596:F187S	.	F	-	2	0	0	GPR183	98745841	98745841	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.962000	0.93254	2.191000	0.70037	0.533000	0.62120	TTT	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.413	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	1	0	1		2	2	2	0		0	0	125		125	124	1	1.860000	-20.000000	1	0.350000	NM_004951			88	88		416	413	1		1	0		0	0	125	0		1.000000	9.999917e-01	0	0	0	81	0	88	416
DHRS4	10901	broad.mit.edu	37	14	24429127	24429127	+	Missense_Mutation	SNP	G	G	T	rs571270624		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr14:24429127G>T	ENST00000313250.5	+	3	526	c.323G>T	c.(322-324)gGa>gTa	p.G108V	DHRS4_ENST00000397075.3_Missense_Mutation_p.G108V|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000558581.1_Intron|DHRS4_ENST00000421831.1_Intron|DHRS4_ENST00000382761.3_Missense_Mutation_p.G90V|DHRS4_ENST00000397074.3_Intron|DHRS4_ENST00000558263.1_Missense_Mutation_p.G108V|DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_Missense_Mutation_p.G108V|DHRS4_ENST00000308178.8_Intron	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	108					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	AAGCTTCATGGAGGTATCGAT	0.478																																						ENST00000313250.5	0.970000	0.780000	0.920000	0.820000	0.870000	0.878457	0.870000	0.880000																										0				14						c.(322-324)gGa>gTa		dehydrogenase/reductase (SDR family) member 4	Vitamin A(DB00162)						306.0	341.0	329.0					14																	24429127		2203	4299	6502	SO:0001583	missense	10901	0	0					g.chr14:24429127G>T	AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.323G>T	chr14.hg19:g.24429127G>T	ENSP00000326219:p.Gly108Val	0					DHRS4_ENST00000397075.3_Missense_Mutation_p.G108V|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000558581.1_Intron|DHRS4_ENST00000382761.3_Missense_Mutation_p.G90V|DHRS4_ENST00000558263.1_Missense_Mutation_p.G108V|DHRS4_ENST00000421831.1_Intron|DHRS4_ENST00000397074.3_Intron|DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_Missense_Mutation_p.G108V|DHRS4_ENST00000308178.8_Intron	p.G108V	NM_021004.2	NP_066284.2	0	0	0	2.036303	Q9BTZ2	DHRS4_HUMAN		3	526	+			B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	ENST00000313250.5	1	0	hg19	c.323G>T	CCDS9605.1	1	.	.	.	.	.	.	.	.	.	.	.	14.94	2.686814	0.48097	.	.	ENSG00000157326	ENST00000313250;ENST00000382761;ENST00000397075;ENST00000543741	T;T;D;T	0.89617	1.12;1.12;-2.54;1.12	2.87	1.93	0.25924	2.87	1.93	0.25924	NAD(P)-binding domain (1);	0.111999	0.64402	D	0.000011	D	0.94892	0.8349	H	0.95260	3.645	0.80722	D	1	D;D;P;D	0.89917	0.983;1.0;0.906;0.995	P;D;P;D	0.79108	0.809;0.992;0.624;0.964	D	0.93034	0.6451	10	0.87932	D	0	.	6.9126	0.24342	0.1546:0.0:0.8454:0.0	.	108;108;108;108	F5GWZ1;Q9BTZ2-2;Q9BTZ2-7;Q9BTZ2	.;.;.;DHRS4_HUMAN	V	108;90;108;108	ENSP00000326219:G108V;ENSP00000372209:G90V;ENSP00000380265:G108V;ENSP00000440508:G108V	ENSP00000326219:G108V	G	+	2	0	0	DHRS4	23498967	23498967	1.000000	0.71417	0.375000	0.26029	0.848000	0.48234	6.768000	0.74980	0.494000	0.27859	0.484000	0.47621	GGA	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.478	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3	1	0	1		11	2	2	1		1	1	731		731	776	1	1.860000	-20.000000	1	0.350000				304	302		1662	1620	0		1	0		1	0	731	0		1.000000	7.905803e-01	0	1	0	17	0	304	1662
DHRS4L2	317749	broad.mit.edu	37	14	24464257	24464257	+	Missense_Mutation	SNP	G	G	T	rs148508271	byFrequency	TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr14:24464257G>T	ENST00000335125.6	+	3	449	c.323G>T	c.(322-324)gGa>gTa	p.G108V	DHRS4L2_ENST00000537912.1_Intron|DHRS4L2_ENST00000558753.1_Intron|DHRS4L2_ENST00000534993.1_Missense_Mutation_p.G7V|DHRS4L2_ENST00000545240.1_Missense_Mutation_p.G108V|DHRS4L2_ENST00000382755.4_Missense_Mutation_p.G106V|DHRS4L2_ENST00000397071.1_Missense_Mutation_p.G108V|DHRS4L2_ENST00000543805.1_Intron	NM_198083.3	NP_932349.2	Q6PKH6	DR4L2_HUMAN	dehydrogenase/reductase (SDR family) member 4 like 2	106						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	10				GBM - Glioblastoma multiforme(265;0.00962)		AAGCTTCATGGAGGTATCGAT	0.493																																						ENST00000335125.6	0.250000	0.170000	0.230000	0.190000	0.200000	0.214540	0.200000	0.210000																										0				10						c.(322-324)gGa>gTa		dehydrogenase/reductase (SDR family) member 4 like 2							520.0	480.0	494.0					14																	24464257		2203	4300	6503	SO:0001583	missense	317749	0	0					g.chr14:24464257G>T		CCDS9606.2, CCDS73621.1	14q11.2	2011-09-14			ENSG00000187630	ENSG00000187630	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	19731	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 3"""	615196					Standard	NM_001193635		Approved	SDR25C3	uc001wlf.3	Q6PKH6	OTTHUMG00000028778	ENST00000335125.6:c.323G>T	chr14.hg19:g.24464257G>T	ENSP00000334801:p.Gly108Val	0					DHRS4L2_ENST00000534993.1_Missense_Mutation_p.G7V|DHRS4L2_ENST00000537912.1_Intron|DHRS4L2_ENST00000558753.1_Intron|DHRS4L2_ENST00000397071.1_Missense_Mutation_p.G108V|DHRS4L2_ENST00000545240.1_Missense_Mutation_p.G108V|DHRS4L2_ENST00000382755.4_Missense_Mutation_p.G106V|DHRS4L2_ENST00000543805.1_Intron	p.G108V	NM_198083.3	NP_932349.2	0	0	0	2.036303	Q6PKH6	DR4L2_HUMAN		3	449	+			Q3YLD4	Missense_Mutation	SNP	ENST00000335125.6	1	0	hg19	c.323G>T	CCDS9606.2	0	.	.	.	.	.	.	.	.	.	.	-	17.18	3.323563	0.60634	.	.	ENSG00000187630	ENST00000534993;ENST00000397071;ENST00000335125;ENST00000545240;ENST00000382755	D;T;T;T	0.89617	-2.54;-0.02;1.12;1.12	4.37	3.46	0.39613	4.37	3.46	0.39613	NAD(P)-binding domain (1);	0.112267	0.64402	D	0.000011	D	0.95143	0.8426	H	0.94462	3.54	0.39857	D	0.973325	D	0.64830	0.994	D	0.73708	0.981	D	0.94913	0.8066	10	0.87932	D	0	.	9.2784	0.37714	0.1119:0.0:0.8881:0.0	.	106	Q6PKH6	DR4L2_HUMAN	V	7;108;108;108;106	ENSP00000380261:G108V;ENSP00000334801:G108V;ENSP00000437883:G108V;ENSP00000372203:G106V	ENSP00000334801:G108V	G	+	2	0	0	DHRS4L2	23534097	23534097	1.000000	0.71417	0.125000	0.21846	0.175000	0.22909	6.775000	0.75018	0.796000	0.33947	0.398000	0.26397	GGA	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.493	DHRS4L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000071858.4	1	0	1		2	2	2	0		0	0	1714		1714	1764	1	1.860000	-4.564867	1	0.350000				159	145		4069	3915	0		1	0		0	0	1714	0		1.000000	5.278142e-02	0	0	0	10	0	159	4069
SERPINA6	866	broad.mit.edu	37	14	94780770	94780770	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr14:94780770C>T	ENST00000341584.3	-	2	362	c.216G>A	c.(214-216)atG>atA	p.M72I		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	72					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	TAGCTAAGGCCATGGAGATGC	0.547																																						ENST00000341584.3	1.000000	0.850000	1.000000	0.960000	0.990000	0.984377	0.990000	1.000000																										0				26						c.(214-216)atG>atA		serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)						84.0	85.0	85.0					14																	94780770		2203	4300	6503	SO:0001583	missense	866	0	0					g.chr14:94780770C>T	J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.216G>A	chr14.hg19:g.94780770C>T	ENSP00000342850:p.Met72Ile	0						p.M72I	NM_001756.3	NP_001747	0	0	0	2.036303	P08185	CBG_HUMAN		2	362	-		all_cancers(154;0.0482)|all_epithelial(191;0.166)	A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	1	1	hg19	c.216G>A	CCDS9924.1	1	.	.	.	.	.	.	.	.	.	.	C	8.748	0.920648	0.17982	.	.	ENSG00000170099	ENST00000341584;ENST00000557225	D;D	0.87103	-2.21;-1.55	5.07	-2.48	0.06423	5.07	-2.48	0.06423	Serpin domain (3);	0.436617	0.21388	N	0.075360	T	0.72961	0.3526	L	0.38649	1.16	0.27668	N	0.946854	B	0.10296	0.003	B	0.14023	0.01	T	0.57551	-0.7792	10	0.09590	T	0.72	.	5.0497	0.14501	0.4235:0.254:0.0:0.3226	.	72	P08185	CBG_HUMAN	I	72	ENSP00000342850:M72I;ENSP00000452018:M72I	ENSP00000342850:M72I	M	-	3	0	0	SERPINA6	93850523	93850523	0.158000	0.22850	0.484000	0.27391	0.982000	0.71751	-0.421000	0.07053	-0.761000	0.04670	0.563000	0.77884	ATG	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.547	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	1	0	1		2	2	2	0		0	0	112		112	111	1	1.860000	-20.000000	1	0.350000	NM_001756			61	61		257	256	1		1	0		0	0	112	0		1.000000	2.506738e-01	0	0	0	5	0	61	257
NLRC3	197358	broad.mit.edu	37	16	3607671	3607671	+	RNA	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr16:3607671C>T	ENST00000301749.7	-	0	2427				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCTGGTTCTCCGCCAAGCTGC	0.527																																						ENST00000301749.7	1.000000	0.560000	1.000000	0.700000	0.870000	0.859079	0.870000	1.000000																										0				34								NLR family, CARD domain containing 3							73.0	71.0	71.0					16																	3607671		2008	4170	6178			197358	3	120956	32				g.chr16:3607671C>T	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3607671C>T		0					NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000603507.1_RNA		NM_178844.2	NP_849172.2	0	0	0	2.036081	Q7RTR2	NLRC3_HUMAN		0	2427	-			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	RNA	SNP	ENST00000301749.7	1	0	hg19			1																																																																																								0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.527	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		1	0	1		2	2	2	0		0	0	71		71	70	1	1.860000	-2.968520	1	0.350000	NM_178844			20	20		110	109	1		1	0		0	0	71	0		0.999997	2.631579e-02	0	0	0	2	0	20	110
TP53	7157	broad.mit.edu	37	17	7577544	7577544	+	Missense_Mutation	SNP	A	A	C	rs587780074|rs397516437		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr17:7577544A>C	ENST00000269305.4	-	7	926	c.737T>G	c.(736-738)aTg>aGg	p.M246R	TP53_ENST00000413465.2_Missense_Mutation_p.M246R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.M246R|TP53_ENST00000455263.2_Missense_Mutation_p.M246R|TP53_ENST00000359597.4_Missense_Mutation_p.M246R|TP53_ENST00000445888.2_Missense_Mutation_p.M246R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	246	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		M -> I (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M246R(10)|p.M246T(9)|p.0?(8)|p.M246K(7)|p.?(5)|p.M246_P250delMNRRP(2)|p.G244fs*17(1)|p.M153T(1)|p.C242fs*98(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*14(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTCCGGTTCATGCCGCCCAT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.900000	0.500000	0.800000	0.590000	0.690000	0.703616	0.690000	0.690000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		47	Substitution - Missense(27)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)|Deletion - In frame(3)	p.M246R(10)|p.M246T(9)|p.0?(8)|p.M246K(7)|p.?(5)|p.M246_P250delMNRRP(2)|p.G244fs*17(1)|p.M153T(1)|p.C242fs*98(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*14(1)|p.G245fs*16(1)	breast(10)|haematopoietic_and_lymphoid_tissue(6)|biliary_tract(6)|upper_aerodigestive_tract(5)|large_intestine(4)|bone(4)|skin(3)|stomach(2)|central_nervous_system(2)|oesophagus(2)|lung(1)|autonomic_ganglia(1)|pancreas(1)	24185						c.(736-738)aTg>aGg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						152.0	113.0	126.0					17																	7577544		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577544A>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.737T>G	chr17.hg19:g.7577544A>C	ENSP00000269305:p.Met246Arg	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.M246R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.M246R|TP53_ENST00000420246.2_Missense_Mutation_p.M246R|TP53_ENST00000359597.4_Missense_Mutation_p.M246R|TP53_ENST00000413465.2_Missense_Mutation_p.M246R	p.M246R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.699086	P04637	P53_HUMAN		7	926	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.737T>G	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	A	21.6	4.177746	0.78564	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.87971	2.92	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.997;0.96;1.0;1.0;0.998	D	0.97237	0.9888	10	0.87932	D	0	-28.5667	12.3101	0.54924	1.0:0.0:0.0:0.0	.	246;246;153;246;246;246	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	R	246;246;246;246;246;246;235;153;114;153	ENSP00000410739:M246R;ENSP00000352610:M246R;ENSP00000269305:M246R;ENSP00000398846:M246R;ENSP00000391127:M246R;ENSP00000391478:M246R;ENSP00000425104:M114R;ENSP00000423862:M153R	ENSP00000269305:M246R	M	-	2	0	0	TP53	7518269	7518269	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.087000	0.94110	2.074000	0.62210	0.379000	0.24179	ATG	0.212121		TCGA-HZ-A49I-01A-12D-A26I-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	148		148	148	1	1.860000	-20.000000	1	0.350000	NM_000546			38	38		217	214	1		1	1	1	0	0	148	1075		1.000000	9.999051e-01	1	44	52	39	347	38	217
CASKIN2	57513	broad.mit.edu	37	17	73497867	73497867	+	Silent	SNP	G	G	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr17:73497867G>T	ENST00000321617.3	-	18	3874	c.3288C>A	c.(3286-3288)ccC>ccA	p.P1096P	CASKIN2_ENST00000433559.2_Silent_p.P1014P	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	1096	Pro-rich.					cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TACCTGCTCCGGGCACCTTGA	0.637																																						ENST00000321617.3	0.190000	0.060000	0.160000	0.080000	0.110000	0.125736	0.110000	0.120000																										0				18						c.(3286-3288)ccC>ccA		CASK interacting protein 2							42.0	54.0	50.0					17																	73497867		2194	4266	6460	SO:0001819	synonymous_variant	57513	0	0					g.chr17:73497867G>T	AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.3288C>A	chr17.hg19:g.73497867G>T		0					CASKIN2_ENST00000433559.2_Silent_p.P1014P	p.P1096P	NM_020753.3	NP_065804.2	0	1	1	2.045126	Q8WXE0	CSKI2_HUMAN	all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)	18	3874	-	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Silent	SNP	ENST00000321617.3	1	1	hg19	c.3288C>A	CCDS11723.1	0																																																																																								0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.637	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447609.1	0	0	1		2	2	2	0		0	0	295		295	293	1	1.860000	-2.368556	0	0.350000	NM_020753			15	15		707	696	0		1	1		0	0	295	0		0.999855	4.586077e-01	0	2	0	69	0	15	707
TCF4	6925	broad.mit.edu	37	18	52924608	52924608	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr18:52924608A>G	ENST00000356073.4	-	14	1695	c.1084T>C	c.(1084-1086)Tgg>Cgg	p.W362R	TCF4_ENST00000566286.1_Missense_Mutation_p.W359R|TCF4_ENST00000354452.3_Missense_Mutation_p.W362R|TCF4_ENST00000561831.3_Missense_Mutation_p.W202R|TCF4_ENST00000568673.1_Missense_Mutation_p.W338R|TCF4_ENST00000564403.2_Missense_Mutation_p.W368R|TCF4_ENST00000568740.1_Missense_Mutation_p.W337R|TCF4_ENST00000570177.2_Missense_Mutation_p.W232R|TCF4_ENST00000565018.2_Missense_Mutation_p.W362R|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000564228.1_Missense_Mutation_p.W291R|TCF4_ENST00000543082.1_Missense_Mutation_p.W320R|TCF4_ENST00000564999.1_Missense_Mutation_p.W362R|TCF4_ENST00000544241.2_Missense_Mutation_p.W291R|TCF4_ENST00000537578.1_Missense_Mutation_p.W338R|TCF4_ENST00000540999.1_Missense_Mutation_p.W338R|TCF4_ENST00000457482.3_Missense_Mutation_p.W202R|TCF4_ENST00000566279.1_Missense_Mutation_p.W302R|TCF4_ENST00000537856.3_Missense_Mutation_p.W232R|TCF4_ENST00000570287.2_Missense_Mutation_p.W202R|TCF4_ENST00000561992.1_Missense_Mutation_p.W232R|TCF4_ENST00000567880.1_Missense_Mutation_p.W302R|TCF4_ENST00000398339.1_Missense_Mutation_p.W464R	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	362					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TTTCTAGACCAAACAGCTGTG	0.408																																						ENST00000356073.4	0.190000	0.060000	0.160000	0.090000	0.110000	0.126932	0.110000	0.120000																										0				41						c.(1084-1086)Tgg>Cgg		transcription factor 4							182.0	165.0	170.0					18																	52924608		2203	4300	6503	SO:0001583	missense	6925	0	0					g.chr18:52924608A>G	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1084T>C	chr18.hg19:g.52924608A>G	ENSP00000348374:p.Trp362Arg	1					TCF4_ENST00000398339.1_Missense_Mutation_p.W464R|TCF4_ENST00000564999.1_Missense_Mutation_p.W362R|TCF4_ENST00000564403.2_Missense_Mutation_p.W368R|TCF4_ENST00000567880.1_Missense_Mutation_p.W302R|TCF4_ENST00000568740.1_Missense_Mutation_p.W337R|TCF4_ENST00000561831.3_Missense_Mutation_p.W202R|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000566286.1_Missense_Mutation_p.W359R|TCF4_ENST00000561992.1_Missense_Mutation_p.W232R|TCF4_ENST00000537578.1_Missense_Mutation_p.W338R|TCF4_ENST00000570287.2_Missense_Mutation_p.W202R|TCF4_ENST00000565018.2_Missense_Mutation_p.W362R|TCF4_ENST00000540999.1_Missense_Mutation_p.W338R|TCF4_ENST00000570177.2_Missense_Mutation_p.W232R|TCF4_ENST00000457482.3_Missense_Mutation_p.W202R|TCF4_ENST00000543082.1_Missense_Mutation_p.W320R|TCF4_ENST00000537856.3_Missense_Mutation_p.W232R|TCF4_ENST00000568673.1_Missense_Mutation_p.W338R|TCF4_ENST00000544241.2_Missense_Mutation_p.W291R|TCF4_ENST00000564228.1_Missense_Mutation_p.W291R|TCF4_ENST00000566279.1_Missense_Mutation_p.W302R|TCF4_ENST00000354452.3_Missense_Mutation_p.W362R	p.W362R	NM_003199.2	NP_003190.1	0	1	1	1.695842	P15884	ITF2_HUMAN		14	1695	-			B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	1	1	hg19	c.1084T>C	CCDS11960.1	0	.	.	.	.	.	.	.	.	.	.	A	23.7	4.446962	0.84101	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02;0.02;0.02;0.02;0.02	5.89	5.89	0.94794	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.81837	0.4907	M	0.87971	2.92	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.999;0.999;0.999;1.0;0.999	D	0.84986	0.0891	10	0.72032	D	0.01	-8.4202	15.2952	0.73898	1.0:0.0:0.0:0.0	.	338;362;202;464;362;320;291;202;359	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	R	362;202;362;320;338;338;291;232;464	ENSP00000346440:W362R;ENSP00000409447:W202R;ENSP00000348374:W362R;ENSP00000439656:W320R;ENSP00000445202:W338R;ENSP00000440731:W338R;ENSP00000441562:W291R;ENSP00000439827:W232R;ENSP00000381382:W464R	ENSP00000346440:W362R	W	-	1	0	0	TCF4	51075606	51075606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.685000	0.91246	2.246000	0.74042	0.533000	0.62120	TGG	0.213789		TCGA-HZ-A49I-01A-12D-A26I-08	0.408	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	0	0	1		2	2	2	0		0	0	228		228	228	1	1.860000	-13.437080	1	0.350000	NM_003199			16	16		611	604	0		1	0		0	0	228	0		0.999927	2.960845e-02	0	0	0	10	0	16	611
ZNF532	55205	broad.mit.edu	37	18	56585592	56585592	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr18:56585592G>A	ENST00000336078.4	+	4	849	c.73G>A	c.(73-75)Gat>Aat	p.D25N	ZNF532_ENST00000591083.1_Missense_Mutation_p.D25N|ZNF532_ENST00000589288.1_Missense_Mutation_p.D25N|ZNF532_ENST00000591230.1_Missense_Mutation_p.D25N|ZNF532_ENST00000591808.1_Missense_Mutation_p.D25N	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						AGATATGGTCGATCCTAAAGC	0.468																																						ENST00000336078.4	1.000000	0.730000	0.970000	0.810000	0.900000	0.897426	0.900000	1.000000																										0				52						c.(73-75)Gat>Aat		zinc finger protein 532							94.0	80.0	85.0					18																	56585592		2203	4300	6503	SO:0001583	missense	55205	0	0					g.chr18:56585592G>A	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.73G>A	chr18.hg19:g.56585592G>A	ENSP00000338217:p.Asp25Asn	1					ZNF532_ENST00000591230.1_Missense_Mutation_p.D25N|ZNF532_ENST00000591808.1_Missense_Mutation_p.D25N|ZNF532_ENST00000591083.1_Missense_Mutation_p.D25N|ZNF532_ENST00000589288.1_Missense_Mutation_p.D25N	p.D25N	NM_018181.4	NP_060651.2	0	1	1	1.695842	Q9HCE3	ZN532_HUMAN		4	849	+			Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	1	1	hg19	c.73G>A	CCDS11969.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.584685	0.96578	.	.	ENSG00000074657	ENST00000336078	T	0.07688	3.17	5.47	5.47	0.80525	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.33818	0.0876	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.07424	-1.0773	10	0.87932	D	0	-18.7627	18.9367	0.92589	0.0:0.0:1.0:0.0	.	25	Q9HCE3	ZN532_HUMAN	N	25	ENSP00000338217:D25N	ENSP00000338217:D25N	D	+	1	0	0	ZNF532	54736572	54736572	1.000000	0.71417	0.986000	0.45419	0.908000	0.53690	9.403000	0.97302	2.560000	0.86352	0.555000	0.69702	GAT	0.213789		TCGA-HZ-A49I-01A-12D-A26I-08	0.468	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	1	0	1		2	2	2	0		0	0	148		148	148	1	1.860000	-20.000000	1	0.350000	NM_018181			70	71		283	282	1		1	0		0	0	148	0		1.000000	7.204050e-01	0	1	0	11	0	70	283
FAM129C	199786	broad.mit.edu	37	19	17660273	17660273	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr19:17660273G>T	ENST00000335393.4	+	15	1918	c.1780G>T	c.(1780-1782)Gcc>Tcc	p.A594S	FAM129C_ENST00000332386.5_Missense_Mutation_p.A594S|FAM129C_ENST00000601861.1_Missense_Mutation_p.A563S|FAM129C_ENST00000599164.1_Missense_Mutation_p.A563S|FAM129C_ENST00000352727.3_Missense_Mutation_p.A558S|FAM129C_ENST00000595684.1_Missense_Mutation_p.A594S|FAM129C_ENST00000600871.1_Intron|FAM129C_ENST00000599124.1_Missense_Mutation_p.A527S|FAM129C_ENST00000449408.2_Missense_Mutation_p.A320S	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	594										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						GACCCTTGGTGCCAATGATGT	0.527																																						ENST00000335393.4	0.870000	0.600000	0.800000	0.660000	0.730000	0.737190	0.730000	0.740000																										0				33						c.(1780-1782)Gcc>Tcc		family with sequence similarity 129, member C							130.0	124.0	126.0					19																	17660273		2203	4300	6503	SO:0001583	missense	199786	0	0					g.chr19:17660273G>T	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1780G>T	chr19.hg19:g.17660273G>T	ENSP00000335040:p.Ala594Ser	0					FAM129C_ENST00000595684.1_Missense_Mutation_p.A594S|FAM129C_ENST00000332386.5_Missense_Mutation_p.A594S|FAM129C_ENST00000599164.1_Missense_Mutation_p.A563S|FAM129C_ENST00000601861.1_Missense_Mutation_p.A563S|FAM129C_ENST00000600871.1_Intron|FAM129C_ENST00000352727.3_Missense_Mutation_p.A558S|FAM129C_ENST00000599124.1_Missense_Mutation_p.A527S|FAM129C_ENST00000449408.2_Missense_Mutation_p.A320S	p.A594S	NM_173544.4	NP_775815	1	2	3	2.052791	Q86XR2	NIBL2_HUMAN		15	1918	+			B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	1	1	hg19	c.1780G>T	CCDS12362.1	0	.	.	.	.	.	.	.	.	.	.	G	11.71	1.719856	0.30503	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000449408	T;T;T;T	0.46819	1.8;1.82;0.86;1.43	2.87	0.639	0.17747	2.87	0.639	0.17747	.	0.762112	0.11046	N	0.605581	T	0.38904	0.1058	M	0.63428	1.95	0.09310	N	1	P;P;P;P	0.36909	0.573;0.573;0.573;0.573	B;B;B;B	0.38378	0.272;0.272;0.272;0.272	T	0.25187	-1.0139	10	0.11182	T	0.66	-4.5539	5.3444	0.16000	0.2787:0.0:0.7213:0.0	.	594;594;558;594	Q86XR2;Q86XR2-3;Q86XR2-4;Q86XR2-2	NIBL2_HUMAN;.;.;.	S	594;594;558;320	ENSP00000335040:A594S;ENSP00000333447:A594S;ENSP00000341067:A558S;ENSP00000394929:A320S	ENSP00000333447:A594S	A	+	1	0	0	FAM129C	17521273	17521273	0.005000	0.15991	0.002000	0.10522	0.082000	0.17680	0.151000	0.16283	0.270000	0.21984	0.557000	0.71058	GCC	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.527	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	1	0	0		2	2	2	0		0	0	295		295	294	1	1.860000	-20.000000	1	0.350000	NM_173544			106	105		721	719	1		1	0		0	0	295	0		1.000000	1.675438e-02	0	0	0	2	0	106	721
CLEC4G	339390	broad.mit.edu	37	19	7796974	7796974	+	Silent	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr19:7796974C>T	ENST00000328853.5	-	1	83	c.15G>A	c.(13-15)agG>agA	p.R5R	CLEC4G_ENST00000598081.1_Splice_Site	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	5						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						ACTTGCTGTACCTGGTGGTGT	0.612																																					Esophageal Squamous(146;540 1807 3349 19438 30853)	ENST00000328853.5	1.000000	0.690000	1.000000	0.800000	0.910000	0.906038	0.910000	1.000000																										0				6						c.(13-15)agG>agA		C-type lectin domain family 4, member G							58.0	53.0	55.0					19																	7796974		2203	4300	6503	SO:0001819	synonymous_variant	339390	5	121412	34				g.chr19:7796974C>T	AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.15G>A	chr19.hg19:g.7796974C>T		0					CLEC4G_ENST00000598081.1_Splice_Site	p.R5R	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	1	2	3	2.052791	Q6UXB4	CLC4G_HUMAN		1	83	-				Silent	SNP	ENST00000328853.5	1	0	hg19	c.15G>A	CCDS12185.1	1																																																																																								0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.612	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461989.1	1	0	1		2	2	2	0		0	0	140		140	140	1	1.860000	-20.000000	1	0.350000	NM_198492			49	49		256	256	1		1	0		0	0	140	0		1.000000	0	0	0	0	1	0	49	256
NLRP2	55655	broad.mit.edu	37	19	55501388	55501388	+	Splice_Site	SNP	A	A	G	rs202152161	byFrequency	TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr19:55501388A>G	ENST00000543010.1	+	9	2509		c.e9-1		NLRP2_ENST00000448584.2_Splice_Site|NLRP2_ENST00000263437.6_Splice_Site|NLRP2_ENST00000538819.1_Splice_Site|NLRP2_ENST00000537859.1_Splice_Site|NLRP2_ENST00000339757.7_Splice_Site|NLRP2_ENST00000391721.4_Splice_Site|NLRP2_ENST00000427260.2_Splice_Site	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TTTCTCCCACAGGTTGGTGTC	0.517													A|||	2	0.000399361	0.0	0.0	5008	,	,		17714	0.0		0.002	False		,,,				2504	0.0					ENST00000543010.1	0.920000	0.570000	0.840000	0.650000	0.740000	0.749823	0.740000	0.740000																										0				11						c.e9-1		NLR family, pyrin domain containing 2							87.0	79.0	82.0					19																	55501388		2203	4300	6503	SO:0001630	splice_region_variant	55655	4	121412	36				g.chr19:55501388A>G	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2367-1A>G	chr19.hg19:g.55501388A>G		1					NLRP2_ENST00000448584.2_Splice_Site|NLRP2_ENST00000263437.6_Splice_Site|NLRP2_ENST00000339757.7_Splice_Site|NLRP2_ENST00000537859.1_Splice_Site|NLRP2_ENST00000538819.1_Splice_Site|NLRP2_ENST00000427260.2_Splice_Site|NLRP2_ENST00000391721.4_Splice_Site		NM_001174081.1	NP_001167552.1	0	1	1	1.727474	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	9	2509	+			B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Splice_Site	SNP	ENST00000543010.1	1	1	hg19		CCDS12913.1	0	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	a	8.379	0.836995	0.16891	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	.	.	.	2.51	2.51	0.30379	2.51	2.51	0.30379	.	.	.	.	.	.	.	.	.	.	.	0.37549	D	0.918615	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9916	0.24758	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	NLRP2	60193200	60193200	0.776000	0.28616	0.108000	0.21378	0.127000	0.20565	3.149000	0.50655	1.407000	0.46875	0.529000	0.55759	.	0.220390		TCGA-HZ-A49I-01A-12D-A26I-08	0.517	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	0	0	1		9	2	2	1		1	1	166		166	162	1	1.860000	-20.000000	1	0.350000	NM_017852	Intron		55	51		295	284	1		1			1	0	166	0		1.000000	0	0	0	0	0	0	55	295
ADORA3	140	broad.mit.edu	37	1	112046027	112046027	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:112046027G>A	ENST00000241356.4	-	0	355				ADORA3_ENST00000369716.4_De_novo_Start_OutOfFrame|ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor						activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	AGCAAGATCCGTCTGTAGGGC	0.542																																						ENST00000241356.4	1.000000	0.570000	1.000000	0.780000	0.990000	0.919731	0.990000	1.000000																										0				12								adenosine A3 receptor	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)						19.0	16.0	17.0					1																	112046027		2183	4250	6433			140	6	120666	34				g.chr1:112046027G>A	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.-51C>T	chr1.hg19:g.112046027G>A		0					ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_De_novo_Start_OutOfFrame|ADORA3_ENST00000369717.4_Intron		NM_000677.3	NP_000668.1	1	2	3	2.052343	P33765	AA3R_HUMAN		0	355	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	A2A3P4|Q6UWU0|Q9BYZ1	Translation_Start_Site	SNP	ENST00000241356.4	0	1	hg19		CCDS839.1	1																																																																																								0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.542	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1	0	0	1		2	2	2	0		0	0	19		19	19	1	1.860000	-3.620766	1	0.350000	NM_000677, NM_020683			11	11		50	50	0		1	0		0	0	19	0		0.998737	3.859287e-01	0	0	0	7	0	11	50
SEMA4A	64218	broad.mit.edu	37	1	156128241	156128241	+	Silent	SNP	C	C	T	rs371685429		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:156128241C>T	ENST00000368285.3	+	5	693	c.426C>T	c.(424-426)tgC>tgT	p.C142C	SEMA4A_ENST00000368286.2_Intron|SEMA4A_ENST00000355014.2_Silent_p.C142C|SEMA4A_ENST00000487358.1_3'UTR|SEMA4A_ENST00000368282.1_Silent_p.C142C|SEMA4A_ENST00000368284.1_Intron	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	142	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					TCTACACCTGCGGCACCTTCG	0.537																																						ENST00000368285.3	1.000000	0.760000	0.970000	0.830000	0.890000	0.901840	0.890000	1.000000																										0				5						c.(424-426)tgC>tgT		sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A		C	,,,	2,4404	4.2+/-10.8	0,2,2201	195.0	181.0	186.0		426,426,,426	-6.4	0.9	1		186	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,intron,coding-synonymous	SEMA4A	NM_001193300.1,NM_001193301.1,NM_001193302.1,NM_022367.3	,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,	142/762,142/762,,142/762	156128241	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	64218	4	121412	44				g.chr1:156128241C>T	AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.426C>T	chr1.hg19:g.156128241C>T		0					SEMA4A_ENST00000368284.1_Intron|SEMA4A_ENST00000487358.1_3'UTR|SEMA4A_ENST00000368286.2_Intron|SEMA4A_ENST00000355014.2_Silent_p.C142C|SEMA4A_ENST00000368282.1_Silent_p.C142C	p.C142C	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	0	0	0	2.034416	Q9H3S1	SEM4A_HUMAN		5	693	+	Hepatocellular(266;0.158)		B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Silent	SNP	ENST00000368285.3	1	1	hg19	c.426C>T	CCDS1132.1	1																																																																																								0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.537	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039484.2	1	0	1		2	2	2	0		0	0	267		267	266	1	1.860000	-20.000000	1	0.350000	NM_022367			149	146		788	775	0		1	0		0	0	267	0		1.000000	4.328970e-01	0	0	0	9	0	149	788
ZBTB17	7709	broad.mit.edu	37	1	16269204	16269204	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:16269204C>A	ENST00000375743.4	-	14	2090	c.1858G>T	c.(1858-1860)Ggg>Tgg	p.G620W	ZBTB17_ENST00000375733.2_Missense_Mutation_p.G620W|ZBTB17_ENST00000537142.1_Missense_Mutation_p.G538W	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	620					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCCACGCCCACACTTATCA	0.612																																						ENST00000375743.4	0.850000	0.400000	0.730000	0.490000	0.600000	0.612745	0.600000	0.600000																										0				15						c.(1858-1860)Ggg>Tgg		zinc finger and BTB domain containing 17							70.0	56.0	61.0					1																	16269204		2203	4300	6503	SO:0001583	missense	7709	0	0					g.chr1:16269204C>A	U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.1858G>T	chr1.hg19:g.16269204C>A	ENSP00000364895:p.Gly620Trp	0					ZBTB17_ENST00000537142.1_Missense_Mutation_p.G538W|ZBTB17_ENST00000375733.2_Missense_Mutation_p.G620W	p.G620W	NM_003443.2	NP_003434.2	1	2	3	2.058303	Q13105	ZBT17_HUMAN		14	2090	-		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	ENST00000375743.4	1	1	hg19	c.1858G>T	CCDS165.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.210920|4.210920	0.79240|0.79240	.|.	.|.	ENSG00000116809|ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142;ENST00000375729|ENST00000440560	T;T;T|.	0.02525|.	4.26;4.26;4.26|.	5.52|5.52	5.52|5.52	0.82312|0.82312	5.52|5.52	5.52|5.52	0.82312|0.82312	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85775|0.85775	0.5775|0.5775	M|M	0.93462|0.93462	3.42|3.42	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.997;0.997;0.999|.	D|D	0.89151|0.89151	0.3523|0.3523	10|5	0.87932|.	D|.	0|.	.|.	14.9728|14.9728	0.71246|0.71246	0.0:0.8577:0.1423:0.0|0.0:0.8577:0.1423:0.0	.|.	620;538;620|.	Q13105-2;F5H411;Q13105|.	.;.;ZBT17_HUMAN|.	W|L	620;620;539;538;176|19	ENSP00000364895:G620W;ENSP00000364885:G620W;ENSP00000438529:G538W|.	ENSP00000364881:G176W|.	G|W	-|-	1|2	0|0	0|0	ZBTB17|ZBTB17	16141791|16141791	16141791|16141791	0.999000|0.999000	0.42202|0.42202	0.890000|0.890000	0.34922|0.34922	0.996000|0.996000	0.88848|0.88848	4.586000|4.586000	0.60984|0.60984	2.579000|2.579000	0.87056|0.87056	0.563000|0.563000	0.77884|0.77884	GGG|TGG	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.612	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	1	0	1		2	2	2	0		0	0	91		91	91	1	1.860000	-2.841694	1	0.350000	NM_003443			25	25		214	212	1		1	1		0	0	91	0		1.000000	9.604565e-01	0	8	0	40	0	25	214
HSPA6	3310	broad.mit.edu	37	1	161495096	161495096	+	Silent	SNP	T	T	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:161495096T>G	ENST00000309758.4	+	1	1061	c.648T>G	c.(646-648)gcT>gcG	p.A216A	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	216					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.A216A(1)		endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CCATTGACGCTGGTGTCTTTG	0.597																																						ENST00000309758.4	0.910000	0.470000	0.800000	0.570000	0.680000	0.692930	0.680000	0.680000																										1	Substitution - coding silent(1)	p.A216A(1)	endometrium(1)	21						c.(646-648)gcT>gcG		heat shock 70kDa protein 6 (HSP70B')							45.0	48.0	47.0					1																	161495096		2203	4300	6503	SO:0001819	synonymous_variant	3310	0	0					g.chr1:161495096T>G		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.648T>G	chr1.hg19:g.161495096T>G		0					RP11-25K21.6_ENST00000537821.2_RNA	p.A216A	NM_002155.3	NP_002146.2	0	0	0	2.034416	P17066	HSP76_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)	1	1061	+	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		Q1HBA8|Q8IYK7|Q9BT95	Silent	SNP	ENST00000309758.4	1	1	hg19	c.648T>G	CCDS1231.1	0																																																																																								0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.597	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	1	0	1		2	2	2	0		0	0	116		116	115	1	1.860000	-3.142893	1	0.350000	NM_002155			31	29		227	227	1		1	0		0	0	116	0		1.000000	3.060620e-01	0	0	0	9	0	31	227
CEP350	9857	broad.mit.edu	37	1	180063129	180063129	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:180063129G>A	ENST00000367607.3	+	34	8307	c.7889G>A	c.(7888-7890)aGt>aAt	p.S2630N	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2630					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S2630I(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GTTAATAGAAGTAGAAGCCTT	0.388																																						ENST00000367607.3	0.380000	0.090000	0.300000	0.140000	0.210000	0.225865	0.210000	0.200000																										2	Substitution - Missense(2)	p.S2630I(2)	kidney(2)	66						c.(7888-7890)aGt>aAt		centrosomal protein 350kDa							37.0	40.0	39.0					1																	180063129		2203	4300	6503	SO:0001583	missense	9857	0	0					g.chr1:180063129G>A	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7889G>A	chr1.hg19:g.180063129G>A	ENSP00000356579:p.Ser2630Asn	0					CEP350_ENST00000490141.1_3'UTR	p.S2630N	NM_014810.4	NP_055625.4	0	0	0	2.041305	Q5VT06	CE350_HUMAN		34	8307	+			O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	1	1	hg19	c.7889G>A	CCDS1336.1	0	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.521005	0.00967	.	.	ENSG00000135837	ENST00000367607;ENST00000417046	T	0.59083	0.29	2.15	0.983	0.19767	2.15	0.983	0.19767	.	.	.	.	.	T	0.41282	0.1152	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23084	-1.0198	8	.	.	.	.	5.4385	0.16494	0.6897:0.0:0.3103:0.0	.	2630;2630	E7EU22;Q5VT06	.;CE350_HUMAN	N	2630;94	ENSP00000356579:S2630N	.	S	+	2	0	0	CEP350	178329752	178329752	0.000000	0.05858	0.551000	0.28230	0.817000	0.46193	0.141000	0.16076	0.258000	0.21686	-0.383000	0.06682	AGT	0.347717		TCGA-HZ-A49I-01A-12D-A26I-08	0.388	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	0	0	1		2	2	2	0		0	0	79		79	79	1	1.860000	-9.941549	1	0.350000	NM_014810			8	8		215	215	0		1	0		0	0	79	0		0.989749	5.089151e-02	0	0	0	9	0	8	215
CR2	1380	broad.mit.edu	37	1	207647654	207647654	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:207647654T>A	ENST00000367058.3	+	12	2321	c.2132T>A	c.(2131-2133)aTt>aAt	p.I711N	CR2_ENST00000367059.3_Missense_Mutation_p.I711N|CR2_ENST00000367057.3_Missense_Mutation_p.I770N|CR2_ENST00000458541.2_Missense_Mutation_p.I684N	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	711	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TTCAAAAAGATTCCACTTTGT	0.388																																						ENST00000367058.3	0.290000	0.110000	0.240000	0.140000	0.190000	0.199659	0.190000	0.190000																										0				69						c.(2131-2133)aTt>aAt		complement component (3d/Epstein Barr virus) receptor 2							103.0	109.0	107.0					1																	207647654		2203	4300	6503	SO:0001583	missense	1380	0	0					g.chr1:207647654T>A	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2132T>A	chr1.hg19:g.207647654T>A	ENSP00000356025:p.Ile711Asn	0					CR2_ENST00000458541.2_Missense_Mutation_p.I684N|CR2_ENST00000367057.3_Missense_Mutation_p.I770N|CR2_ENST00000367059.3_Missense_Mutation_p.I711N	p.I711N	NM_001877.4	NP_001868.2	0	0	0	2.041305	P20023	CR2_HUMAN		12	2321	+			C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	1	1	hg19	c.2132T>A	CCDS1478.1	0	.	.	.	.	.	.	.	.	.	.	T	11.38	1.622221	0.28889	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.66	0.325	0.15903	5.66	0.325	0.15903	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.62392	0.2424	M	0.69823	2.125	0.09310	N	0.999998	P;P;P	0.48294	0.87;0.908;0.565	P;P;P	0.53006	0.632;0.715;0.568	T	0.51236	-0.8731	9	0.17832	T	0.49	.	2.5985	0.04860	0.1401:0.0791:0.2912:0.4896	.	711;711;770	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	N	711;770;711;684	ENSP00000356025:I711N;ENSP00000356024:I770N;ENSP00000356026:I711N;ENSP00000404222:I684N	ENSP00000356024:I770N	I	+	2	0	0	CR2	205714277	205714277	0.840000	0.29493	0.001000	0.08648	0.112000	0.19704	-0.039000	0.12124	-0.193000	0.10415	-0.336000	0.08194	ATT	0.347717		TCGA-HZ-A49I-01A-12D-A26I-08	0.388	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	0	0	1		2	2	2	0		0	0	158		158	158	1	1.860000	-16.544230	1	0.350000	NM_001877			18	19		520	519	0		1	0		0	0	158	0		0.999982	3.895860e-02	0	0	0	9	0	18	520
EPHA8	2046	broad.mit.edu	37	1	22928191	22928191	+	Missense_Mutation	SNP	G	G	A	rs199804540		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:22928191G>A	ENST00000166244.3	+	17	3047	c.2975G>A	c.(2974-2976)cGg>cAg	p.R992Q		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	992	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CAGACCATGCGGGCCCAGCTG	0.682																																						ENST00000166244.3	1.000000	0.340000	1.000000	0.540000	0.790000	0.777507	0.790000	1.000000																										0				61						c.(2974-2976)cGg>cAg		EPH receptor A8		G	GLN/ARG	0,4356		0,0,2178	17.0	18.0	18.0		2975	5.2	1.0	1		18	2,8558		0,2,4278	yes	missense	EPHA8	NM_020526.3	43	0,2,6456	AA,AG,GG		0.0234,0.0,0.0155	probably-damaging	992/1006	22928191	2,12914	2178	4280	6458	SO:0001583	missense	2046	13	119470	42				g.chr1:22928191G>A	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2975G>A	chr1.hg19:g.22928191G>A	ENSP00000166244:p.Arg992Gln	0						p.R992Q	NM_020526.3	NP_065387.1	0	0	0	2.043636	P29322	EPHA8_HUMAN		17	3047	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	1	1	hg19	c.2975G>A	CCDS225.1	0	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928399	0.92389	0.0	2.34E-4	ENSG00000070886	ENST00000166244	T	0.52983	0.64	5.23	5.23	0.72850	5.23	5.23	0.72850	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.64402	D	0.000001	T	0.64182	0.2575	L	0.54965	1.715	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61422	-0.7066	10	0.42905	T	0.14	.	16.319	0.82939	0.0:0.0:1.0:0.0	.	992	P29322	EPHA8_HUMAN	Q	992	ENSP00000166244:R992Q	ENSP00000166244:R992Q	R	+	2	0	0	EPHA8	22800778	22800778	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.524000	0.73791	2.722000	0.93159	0.491000	0.48974	CGG	0.347717		TCGA-HZ-A49I-01A-12D-A26I-08	0.682	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	1	0	1		2	2	2	0		0	0	22		22	22	1	1.860000	-12.665530	1	0.350000	NM_020526			6	6		38	38	1		1			0	0	22	0		0.968676	0	0	0	0	0	0	6	38
CR1L	1379	broad.mit.edu	37	1	207867914	207867914	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:207867914C>G	ENST00000508064.2	+	5	740	c.680C>G	c.(679-681)cCt>cGt	p.P227R	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	227						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGCATTATACCTAACAAATGC	0.448																																						ENST00000508064.2	1.000000	0.940000	1.000000	0.990000	0.990000	0.995541	0.990000	1.000000																										0				22						c.(679-681)cCt>cGt		complement component (3b/4b) receptor 1-like							197.0	189.0	191.0					1																	207867914		1891	4111	6002	SO:0001583	missense	1379	0	0					g.chr1:207867914C>G	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.680C>G	chr1.hg19:g.207867914C>G	ENSP00000421736:p.Pro227Arg	0					CR1L_ENST00000530905.1_Intron	p.P227R	NM_175710.1	NP_783641.1	0	0	0	2.037921	Q2VPA4	CR1L_HUMAN		5	740	+			Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	1	1	hg19	c.680C>G	CCDS44310.1	1	.	.	.	.	.	.	.	.	.	.	C	7.803	0.714144	0.15306	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.35605	1.3	2.38	-0.917	0.10485	2.38	-0.917	0.10485	.	.	.	.	.	T	0.24890	0.0604	L	0.35644	1.08	0.09310	N	1	P	0.38800	0.648	B	0.39419	0.299	T	0.15780	-1.0425	9	0.35671	T	0.21	.	4.9771	0.14146	0.0:0.4127:0.0:0.5873	.	227	Q2VPA4	CR1L_HUMAN	R	227	ENSP00000421736:P227R	ENSP00000434864:P171R	P	+	2	0	0	CR1L	205934537	205934537	0.001000	0.12720	0.032000	0.17829	0.207000	0.24258	0.336000	0.19823	-0.069000	0.12931	0.298000	0.19748	CCT	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.448	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	1	0	1		2	2	2	0		0	0	506		506	538	1	1.860000	-2.794973	1	0.350000	XM_114735			265	246		1154	1092	1		1			0	0	506	0		1.000000	0	0	0	0	0	0	265	1154
ZC3H12A	80149	broad.mit.edu	37	1	37947235	37947235	+	Missense_Mutation	SNP	A	A	T	rs201388317		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:37947235A>T	ENST00000373087.6	+	4	733	c.617A>T	c.(616-618)aAg>aTg	p.K206M		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A									p.K206R(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGAAGAAGAAGATCCTGGTG	0.607													A|||	1	0.000199681	0.0	0.0	5008	,	,		21032	0.0		0.001	False		,,,				2504	0.0					ENST00000373087.6	1.000000	0.690000	0.980000	0.780000	0.870000	0.876360	0.870000	1.000000																										1	Substitution - Missense(1)	p.K206R(1)	kidney(1)	21						c.(616-618)aAg>aTg		zinc finger CCCH-type containing 12A		A	MET/LYS	0,4406		0,0,2203	215.0	196.0	203.0		617	5.4	1.0	1		203	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ZC3H12A	NM_025079.2	95	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	probably-damaging	206/600	37947235	1,13005	2203	4300	6503	SO:0001583	missense	80149	9	121412	46				g.chr1:37947235A>T		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.617A>T	chr1.hg19:g.37947235A>T	ENSP00000362179:p.Lys206Met	0						p.K206M	NM_025079.2	NP_079355.2	1	2	3	2.052343				4	733	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)		Missense_Mutation	SNP	ENST00000373087.6	1	1	hg19	c.617A>T	CCDS417.1	1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.957246	0.92726	0.0	1.16E-4	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.45668	0.89	5.42	5.42	0.78866	5.42	5.42	0.78866	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.62097	0.2400	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.64871	-0.6305	10	0.62326	D	0.03	-37.7323	15.4665	0.75406	1.0:0.0:0.0:0.0	.	206	Q5D1E8	ZC12A_HUMAN	M	206	ENSP00000362179:K206M	ENSP00000362174:K206M	K	+	2	0	0	ZC3H12A	37719822	37719822	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.267000	0.65530	2.054000	0.61138	0.459000	0.35465	AAG	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.607	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	1	0	0		2	2	2	0		0	0	222		222	224	1	1.860000	-20.000000	1	0.350000	NM_025079			72	67		398	404	1		1	1		0	0	222	0		1.000000	9.999026e-01	0	22	0	54	0	72	398
MACF1	23499	broad.mit.edu	37	1	39950371	39950371	+	Silent	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:39950371G>A	ENST00000372915.3	+	96	21966	c.21879G>A	c.(21877-21879)ccG>ccA	p.P7293P	MACF1_ENST00000361689.2_Silent_p.P5335P|MACF1_ENST00000564288.1_Silent_p.P7460P|MACF1_ENST00000539005.1_Silent_p.P5205P|MACF1_ENST00000317713.7_Silent_p.P5335P|MACF1_ENST00000289893.4_Silent_p.P5843P|MACF1_ENST00000567887.1_Silent_p.P7497P|MACF1_ENST00000545844.1_Silent_p.P5335P			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7293	C-terminal tail. {ECO:0000250}.|Ser-rich.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTTCTTCCCCGGCCTCCACAG	0.488																																						ENST00000372915.3	1.000000	0.740000	0.990000	0.820000	0.900000	0.902089	0.900000	1.000000																										0				203						c.(21877-21879)ccG>ccA		microtubule-actin crosslinking factor 1							91.0	99.0	96.0					1																	39950371		2203	4300	6503	SO:0001819	synonymous_variant	23499	3	121412	37				g.chr1:39950371G>A	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21879G>A	chr1.hg19:g.39950371G>A		0					MACF1_ENST00000564288.1_Silent_p.P7460P|MACF1_ENST00000289893.4_Silent_p.P5843P|MACF1_ENST00000361689.2_Silent_p.P5335P|MACF1_ENST00000539005.1_Silent_p.P5205P|MACF1_ENST00000567887.1_Silent_p.P7497P|MACF1_ENST00000317713.7_Silent_p.P5335P|MACF1_ENST00000545844.1_Silent_p.P5335P	p.P7293P			1	2	3	2.052343	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)	96	21966	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	1	1	hg19	c.21879G>A		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.37|10.37	1.331374|1.331374	0.24167|0.24167	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925;ENST00000446276|ENST00000360115;ENST00000442046	.|.	.|.	.|.	6.03|6.03	-2.55|-2.55	0.06288|0.06288	6.03|6.03	-2.55|-2.55	0.06288|0.06288	.|.	.|.	.|.	.|.	.|.	T|T	0.39655|0.39655	0.1086|0.1086	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30357|0.30357	-0.9981|-0.9981	4|4	.|.	.|.	.|.	.|.	2.3493|2.3493	0.04280|0.04280	0.2315:0.3717:0.2762:0.1206|0.2315:0.3717:0.2762:0.1206	.|.	.|.	.|.	.|.	S|Q	4339;360|448;273	.|.	.|.	G|R	+|+	1|2	0|0	0|0	MACF1|MACF1	39722958|39722958	39722958|39722958	0.005000|0.005000	0.15991|0.15991	0.992000|0.992000	0.48379|0.48379	0.996000|0.996000	0.88848|0.88848	-1.287000|-1.287000	0.02785|0.02785	-0.376000|-0.376000	0.07943|0.07943	-0.290000|-0.290000	0.09829|0.09829	GGC|CGG	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.488	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	1	0	1		2	2	4	0		0	0	288		288	287	1	1.860000	-2.922118	1	0.350000	NM_033044			106	108		565	561	1		1	1	1	0	1	288	714		1.000000	1	1	93	45	264	274	106	565
COL24A1	255631	broad.mit.edu	37	1	86372901	86372901	+	Silent	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:86372901C>T	ENST00000370571.2	-	28	3120	c.2754G>A	c.(2752-2754)ggG>ggA	p.G918G	COL24A1_ENST00000436319.1_Silent_p.G918G	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	918	Collagen-like 7.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		GACCTTGACTCCCAGGTGGTC	0.348																																						ENST00000370571.2	0.960000	0.610000	0.870000	0.690000	0.770000	0.782004	0.770000	0.780000																										0				101						c.(2752-2754)ggG>ggA		collagen, type XXIV, alpha 1							89.0	88.0	88.0					1																	86372901		1822	4072	5894	SO:0001819	synonymous_variant	255631	0	0					g.chr1:86372901C>T	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2754G>A	chr1.hg19:g.86372901C>T		0					COL24A1_ENST00000436319.1_Silent_p.G918G	p.G918G	NM_152890.5	NP_690850.2	1	2	3	2.052343	Q17RW2	COOA1_HUMAN		28	3120	-			C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Silent	SNP	ENST00000370571.2	1	1	hg19	c.2754G>A	CCDS41353.1	0																																																																																								0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.348	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	1	0	1		2	2	2	0		0	0	115		115	114	1	1.860000	-3.318825	1	0.350000	NM_152890			71	69		452	448	1		1	0		0	0	115	0		1.000000	0	0	0	0	1	0	71	452
OR2M7	391196	broad.mit.edu	37	1	248487356	248487356	+	Missense_Mutation	SNP	C	C	T	rs145948434		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr1:248487356C>T	ENST00000317965.2	-	1	543	c.515G>A	c.(514-516)cGg>cAg	p.R172Q		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R172L(1)|p.R172Q(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCTATTTCCCGAGACCCACA	0.433																																						ENST00000317965.2	1.000000	0.880000	1.000000	0.930000	0.980000	0.972423	0.980000	1.000000																										2	Substitution - Missense(2)	p.R172L(1)|p.R172Q(1)	lung(1)|skin(1)	42						c.(514-516)cGg>cAg		olfactory receptor, family 2, subfamily M, member 7							178.0	185.0	183.0					1																	248487356		2203	4298	6501	SO:0001583	missense	391196	4	121412	42				g.chr1:248487356C>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.515G>A	chr1.hg19:g.248487356C>T	ENSP00000324557:p.Arg172Gln	0						p.R172Q	NM_001004691.1	NP_001004691.1	0	0	0	2.037921	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)	1	543	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	1	1	hg19	c.515G>A	CCDS31111.1	1	.	.	.	.	.	.	.	.	.	.	C	9.874	1.199628	0.22121	.	.	ENSG00000177186	ENST00000317965	T	0.00044	8.83	1.54	0.552	0.17230	1.54	0.552	0.17230	GPCR, rhodopsin-like superfamily (1);	0.295108	0.18339	U	0.144258	T	0.00109	0.0003	L	0.43701	1.375	0.09310	N	1	B	0.31519	0.327	B	0.32583	0.148	T	0.21965	-1.0230	10	0.52906	T	0.07	.	3.5068	0.07693	0.0:0.4143:0.0:0.5857	.	172	Q8NG81	OR2M7_HUMAN	Q	172	ENSP00000324557:R172Q	ENSP00000324557:R172Q	R	-	2	0	0	OR2M7	246553979	246553979	0.002000	0.14202	0.390000	0.26220	0.131000	0.20780	0.708000	0.25719	0.845000	0.35118	0.184000	0.17185	CGG	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.433	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	1	0	1		2	2	2	0		0	0	518		518	533	1	1.860000	-2.136597	0	0.350000	NM_001004691			314	312		1493	1449	1		1			0	0	518	0		1.000000	0	0	0	0	0	0	314	1493
KIAA1755	85449	broad.mit.edu	37	20	36855620	36855620	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr20:36855620C>T	ENST00000279024.4	-	7	2259	c.1988G>A	c.(1987-1989)cGg>cAg	p.R663Q		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	663										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GAGAATAGCCCGGATAGAGGC	0.572																																						ENST00000279024.4	1.000000	0.480000	0.900000	0.590000	0.730000	0.748828	0.730000	1.000000																										0				54						c.(1987-1989)cGg>cAg		KIAA1755							47.0	43.0	44.0					20																	36855620		2203	4300	6503	SO:0001583	missense	85449	4	121412	31				g.chr20:36855620C>T	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1988G>A	chr20.hg19:g.36855620C>T	ENSP00000279024:p.Arg663Gln	0						p.R663Q	NM_001029864.1	NP_001025035.1	0	0	0	2.017515	Q5JYT7	K1755_HUMAN		7	2259	-		Myeloproliferative disorder(115;0.00874)	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	1	1	hg19	c.1988G>A	CCDS33467.1	0	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474685	0.26511	.	.	ENSG00000149633	ENST00000279024;ENST00000373398;ENST00000435901	T;T	0.61158	0.13;1.2	4.53	0.919	0.19392	4.53	0.919	0.19392	.	0.986535	0.08237	N	0.976570	T	0.36552	0.0971	N	0.17082	0.46	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.21211	-1.0252	10	0.19590	T	0.45	.	6.2707	0.20953	0.0:0.4404:0.0:0.5596	.	663	Q5JYT7	K1755_HUMAN	Q	663;210;1	ENSP00000279024:R663Q;ENSP00000393503:R1Q	ENSP00000279024:R663Q	R	-	2	0	0	KIAA1755	36289034	36289034	0.204000	0.23447	0.000000	0.03702	0.000000	0.00434	1.432000	0.34936	0.215000	0.20761	-0.808000	0.03180	CGG	0.338422		TCGA-HZ-A49I-01A-12D-A26I-08	0.572	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	1	0	1		2	2	2	0		0	0	87		87	86	1	1.860000	-3.081980	1	0.350000	NM_001029864			21	21		139	137	1		1	0		0	0	87	0		0.999998	7.590005e-01	0	0	0	20	0	21	139
KIAA1755	85449	broad.mit.edu	37	20	36859706	36859706	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr20:36859706C>T	ENST00000279024.4	-	5	2040	c.1769G>A	c.(1768-1770)cGg>cAg	p.R590Q		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	590										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				AAGCAGGGGCCGCCCGGCCCT	0.637																																						ENST00000279024.4	1.000000	0.790000	1.000000	0.970000	0.990000	0.980805	0.990000	1.000000																										0				54						c.(1768-1770)cGg>cAg		KIAA1755							46.0	44.0	44.0					20																	36859706		2203	4300	6503	SO:0001583	missense	85449	0	0					g.chr20:36859706C>T	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1769G>A	chr20.hg19:g.36859706C>T	ENSP00000279024:p.Arg590Gln	0						p.R590Q	NM_001029864.1	NP_001025035.1	0	0	0	2.017515	Q5JYT7	K1755_HUMAN		5	2040	-		Myeloproliferative disorder(115;0.00874)	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	1	1	hg19	c.1769G>A	CCDS33467.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812690	0.90707	.	.	ENSG00000149633	ENST00000279024;ENST00000373398	T	0.68903	-0.36	4.97	4.02	0.46733	4.97	4.02	0.46733	.	0.163457	0.27473	N	0.019219	T	0.79718	0.4494	M	0.90019	3.08	0.43579	D	0.995916	D	0.69078	0.997	P	0.54629	0.757	T	0.83267	-0.0045	10	0.54805	T	0.06	.	12.3865	0.55335	0.0:0.9191:0.0:0.0809	.	590	Q5JYT7	K1755_HUMAN	Q	590;137	ENSP00000279024:R590Q	ENSP00000279024:R590Q	R	-	2	0	0	KIAA1755	36293120	36293120	0.995000	0.38212	0.993000	0.49108	0.985000	0.73830	2.737000	0.47393	1.307000	0.44944	0.655000	0.94253	CGG	0.338422		TCGA-HZ-A49I-01A-12D-A26I-08	0.637	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	1	0	1		2	2	2	0		0	0	41		41	40	1	1.860000	-20.000000	1	0.350000	NM_001029864			23	22		86	85	1		1	0		0	0	41	0		1.000000	9.724847e-01	0	0	0	25	0	23	86
SON	6651	broad.mit.edu	37	21	34925124	34925124	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr21:34925124C>T	ENST00000356577.4	+	3	4062	c.3587C>T	c.(3586-3588)cCt>cTt	p.P1196L	SON_ENST00000290239.6_Missense_Mutation_p.P1196L|SON_ENST00000381679.4_Missense_Mutation_p.P1196L|SON_ENST00000300278.4_Missense_Mutation_p.P1196L|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1196					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AATACTTGGCCTACAGAGGTG	0.527																																						ENST00000356577.4	1.000000	0.820000	1.000000	0.890000	0.950000	0.952273	0.950000	1.000000																										0				72						c.(3586-3588)cCt>cTt		SON DNA binding protein							116.0	119.0	118.0					21																	34925124		2203	4300	6503	SO:0001583	missense	6651	0	0					g.chr21:34925124C>T	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3587C>T	chr21.hg19:g.34925124C>T	ENSP00000348984:p.Pro1196Leu	0					SON_ENST00000290239.6_Missense_Mutation_p.P1196L|SON_ENST00000381679.4_Missense_Mutation_p.P1196L|SON_ENST00000300278.4_Missense_Mutation_p.P1196L|SON_ENST00000381692.2_Intron	p.P1196L	NM_138927.1	NP_620305	0	1	1	2.047266	P18583	SON_HUMAN		3	4062	+			D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	1	1	hg19	c.3587C>T	CCDS13629.1	1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.840064	0.51057	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.12672	2.85;2.84;2.83;2.66	5.42	5.42	0.78866	5.42	5.42	0.78866	.	0.627323	0.14275	N	0.329894	T	0.15522	0.0374	L	0.40543	1.245	0.19775	N	0.999954	P;P;B;P;P	0.49253	0.804;0.872;0.015;0.804;0.921	B;B;B;B;B	0.40864	0.288;0.139;0.014;0.288;0.342	T	0.10989	-1.0606	10	0.72032	D	0.01	.	16.7237	0.85416	0.0:1.0:0.0:0.0	.	1196;1196;877;1196;1196	P18583-10;P18583;P18583-2;P18583-3;P18583-6	.;SON_HUMAN;.;.;.	L	1196	ENSP00000348984:P1196L;ENSP00000290239:P1196L;ENSP00000300278:P1196L;ENSP00000371095:P1196L	ENSP00000290239:P1196L	P	+	2	0	0	SON	33846994	33846994	0.862000	0.29867	0.893000	0.35052	0.752000	0.42762	3.035000	0.49759	2.549000	0.85964	0.563000	0.77884	CCT	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.527	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	1	0	1		2	2	2	0		0	0	310		310	307	1	1.860000	-20.000000	1	0.350000	NM_138927			158	158		776	774	1		1	1		0	0	310	0		1.000000	9.976298e-01	0	10	0	36	0	158	776
BRWD1	54014	broad.mit.edu	37	21	40650700	40650700	+	Silent	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr21:40650700G>A	ENST00000333229.2	-	10	1299	c.972C>T	c.(970-972)ggC>ggT	p.G324G	BRWD1_ENST00000380800.3_Silent_p.G324G|BRWD1_ENST00000342449.3_Silent_p.G324G	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	324					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GCATTTGAACGCCTGGCCTAG	0.333																																					Melanoma(170;988 1986 4794 16843 39731)	ENST00000333229.2	1.000000	0.870000	1.000000	0.950000	0.990000	0.984150	0.990000	1.000000																										0				58						c.(970-972)ggC>ggT		bromodomain and WD repeat domain containing 1							84.0	91.0	88.0					21																	40650700		2203	4300	6503	SO:0001819	synonymous_variant	54014	1	121412	33				g.chr21:40650700G>A	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.972C>T	chr21.hg19:g.40650700G>A		0					BRWD1_ENST00000342449.3_Silent_p.G324G|BRWD1_ENST00000380800.3_Silent_p.G324G	p.G324G	NM_018963.4	NP_061836.2	0	1	1	2.047266	Q9NSI6	BRWD1_HUMAN		10	1299	-		Prostate(19;8.44e-08)|all_epithelial(19;0.223)	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	1	1	hg19	c.972C>T	CCDS13662.1	1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312047	0.23821	.	.	ENSG00000185658	ENST00000455867	.	.	.	5.1	-9.33	0.00639	5.1	-9.33	0.00639	.	.	.	.	.	T	0.32436	0.0829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40478	-0.9561	4	.	.	.	.	1.5457	0.02564	0.4764:0.1997:0.1196:0.2044	.	.	.	.	C	36	.	.	R	-	1	0	0	BRWD1	39572570	39572570	0.000000	0.05858	0.822000	0.32727	0.997000	0.91878	-2.790000	0.00767	-1.651000	0.01504	0.591000	0.81541	CGT	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.333	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	1	0	1		2	2	2	0		0	0	256		256	256	1	1.860000	-20.000000	1	0.350000	NM_033656			124	121		555	548	1		1			0	0	256	0		1.000000	0	0	0	0	0	0	124	555
PARVB	29780	broad.mit.edu	37	22	44559738	44559738	+	Splice_Site	SNP	G	G	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr22:44559738G>T	ENST00000338758.7	+	12	1009	c.946G>T	c.(946-948)Gtc>Ttc	p.V316F	PARVB_ENST00000406477.3_Splice_Site_p.V349F|PARVB_ENST00000404989.1_Splice_Site_p.V279F	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	316	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				TCCTTGGCAGGTCCACAATGT	0.622																																						ENST00000338758.7	0.250000	0.060000	0.190000	0.090000	0.130000	0.146730	0.130000	0.130000																										0				25						c.(946-948)Gtc>Ttc		parvin, beta							128.0	92.0	104.0					22																	44559738		2203	4300	6503	SO:0001630	splice_region_variant	29780	0	0					g.chr22:44559738G>T	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.946-1G>T	chr22.hg19:g.44559738G>T		0					PARVB_ENST00000404989.1_Splice_Site_p.V279F|PARVB_ENST00000406477.3_Splice_Site_p.V349F	p.V316F	NM_013327.4	NP_037459.2	0	1	1	2.047147	Q9HBI1	PARVB_HUMAN		12	1009	+		Ovarian(80;0.0246)|all_neural(38;0.0423)	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Splice_Site	SNP	ENST00000338758.7	0	1	hg19	c.946G>T	CCDS14056.1	0	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744371	0.69418	.	.	ENSG00000188677	ENST00000406477;ENST00000338758;ENST00000404989	D;D;D	0.95307	-3.67;-3.67;-3.67	5.42	3.34	0.38264	5.42	3.34	0.38264	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97065	0.9041	M	0.88842	2.985	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.995;0.992	D	0.96302	0.9222	9	.	.	.	-1.022	9.6282	0.39763	0.1707:0.0:0.8293:0.0	.	316;279;316;349	A6NG58;B0QYM8;Q9HBI1;Q9HBI1-2	.;.;PARVB_HUMAN;.	F	349;316;279	ENSP00000384515:V349F;ENSP00000342492:V316F;ENSP00000384353:V279F	.	V	+	1	0	0	PARVB	42891071	42891071	1.000000	0.71417	0.993000	0.49108	0.614000	0.37383	7.331000	0.79192	0.662000	0.31006	0.491000	0.48974	GTC	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.622	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	0	0	1		2	2	2	0		0	0	157		157	156	1	1.860000	-8.130326	1	0.350000	NM_001003828	Missense_Mutation		8	8		338	338	0		1	0		0	0	157	0		0.989575	5.076672e-01	0	0	0	68	0	8	338
LRP1B	53353	broad.mit.edu	37	2	141200116	141200116	+	Silent	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr2:141200116G>A	ENST00000389484.3	-	66	11342	c.10371C>T	c.(10369-10371)gaC>gaT	p.D3457D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3457	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGGATCCTCGTCACAAACCC	0.463										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	ENST00000389484.3	1.000000	0.710000	0.980000	0.790000	0.880000	0.889275	0.880000	1.000000																										0				606						c.(10369-10371)gaC>gaT		low density lipoprotein receptor-related protein 1B							156.0	144.0	148.0					2																	141200116		2203	4300	6503	SO:0001819	synonymous_variant	53353	0	0					g.chr2:141200116G>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10371C>T	chr2.hg19:g.141200116G>A		0	TSP Lung(27;0.18)					p.D3457D	NM_018557.2	NP_061027.2	0	0	0	2.026445	Q9NZR2	LRP1B_HUMAN		66	11342	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	1	1	hg19	c.10371C>T	CCDS2182.1	1																																																																																								0.340771		TCGA-HZ-A49I-01A-12D-A26I-08	0.463	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	1	0	1		2	2	2	0		0	0	162		162	162	1	1.860000	-20.000000	1	0.350000	NM_018557			81	82		431	429	1		1			0	0	162	0		1.000000	0	0	0	0	0	0	81	431
TTN	7273	broad.mit.edu	37	2	179583694	179583694	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr2:179583694G>T	ENST00000591111.1	-	82	23506	c.23282C>A	c.(23281-23283)cCa>cAa	p.P7761Q	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.P8078Q|TTN_ENST00000342992.6_Missense_Mutation_p.P6834Q|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13299	Ig-like 60.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAAAAGATGGTGGTTCTAG	0.443																																						ENST00000591111.1	0.950000	0.280000	0.760000	0.410000	0.570000	0.591315	0.570000	0.550000																										0				1448						c.(23281-23283)cCa>cAa		titin							53.0	50.0	51.0					2																	179583694		1871	4111	5982	SO:0001583	missense	7273	0	0					g.chr2:179583694G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23282C>A	chr2.hg19:g.179583694G>T	ENSP00000465570:p.Pro7761Gln	0					TTN_ENST00000342992.6_Missense_Mutation_p.P6834Q|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.P8078Q|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron	p.P7761Q			0	0	0	2.026445	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	82	23506	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.23282C>A		0	.	.	.	.	.	.	.	.	.	.	G	13.44	2.237650	0.39598	.	.	ENSG00000155657	ENST00000342992	T	0.81078	-1.45	5.71	5.71	0.89125	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.94241	0.8151	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95629	0.8688	9	0.87932	D	0	.	20.2245	0.98337	0.0:0.0:1.0:0.0	.	7761	Q8WZ42	TITIN_HUMAN	Q	6834	ENSP00000343764:P6834Q	ENSP00000343764:P6834Q	P	-	2	0	0	TTN	179291939	179291939	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.434000	0.97515	2.861000	0.98227	0.650000	0.86243	CCA	0.340771		TCGA-HZ-A49I-01A-12D-A26I-08	0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0		0	0	34		34	34	1	1.860000	-15.347340	1	0.350000	NM_133378			9	9		82	81	1		1			0	0	34	0		0.994740	0	0	0	0	0	0	9	82
FANCD2	2177	broad.mit.edu	37	3	10106107	10106107	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr3:10106107C>T	ENST00000419585.1	+	22	2176	c.2015C>T	c.(2014-2016)cCg>cTg	p.P672L	FANCD2_ENST00000287647.3_Missense_Mutation_p.P672L|FANCD2_ENST00000383807.1_Missense_Mutation_p.P672L|FANCD2_ENST00000383806.1_Missense_Mutation_p.P672L			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	672					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGTGTTGTTCCGGAAGGGTAG	0.458			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													ENST00000419585.1	0.380000	0.200000	0.340000	0.240000	0.280000	0.293660	0.280000	0.290000			yes	Rec		Fanconi anaemia D2	yes	Rec		Fanconi anaemia D2	3	3p26	3p26	2177	D, Mis, N, F	"""Fanconi anemia, complementation group D2"""				L	L		AML, leukemia			0				51						c.(2014-2016)cCg>cTg	Involved in tolerance or repair of DNA crosslinks	Fanconi anemia, complementation group D2							262.0	240.0	247.0					3																	10106107		2203	4300	6503	SO:0001583	missense	2177	3	121412	37	Fanconi Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	g.chr3:10106107C>T	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2015C>T	chr3.hg19:g.10106107C>T	ENSP00000398754:p.Pro672Leu	0					FANCD2_ENST00000287647.3_Missense_Mutation_p.P672L|FANCD2_ENST00000383806.1_Missense_Mutation_p.P672L|FANCD2_ENST00000383807.1_Missense_Mutation_p.P672L	p.P672L			0	0	0	2.037599	Q9BXW9	FACD2_HUMAN		22	2176	+			Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	1	1	hg19	c.2015C>T	CCDS33696.1	0	.	.	.	.	.	.	.	.	.	.	C	11.49	1.654704	0.29425	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.58	4.65	0.58169	5.58	4.65	0.58169	.	0.272563	0.42172	D	0.000754	T	0.31606	0.0802	L	0.46741	1.465	0.38805	D	0.955286	B;B	0.18610	0.016;0.029	B;B	0.11329	0.006;0.006	T	0.15954	-1.0419	10	0.27785	T	0.31	.	6.7806	0.23643	0.1764:0.7359:0.0:0.0877	.	672;672	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	L	672	ENSP00000287647:P672L;ENSP00000373318:P672L;ENSP00000373317:P672L;ENSP00000398754:P672L	ENSP00000287647:P672L	P	+	2	0	0	FANCD2	10081107	10081107	0.601000	0.26907	0.984000	0.44739	0.786000	0.44442	2.069000	0.41481	2.808000	0.96608	0.585000	0.79938	CCG	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.458	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1	0	0	1		2	2	2	0		0	0	287		287	359	1	1.860000	-3.136632	1	0.350000				39	38		730	709	0		1	0		0	0	287	0		1.000000	1.090857e-01	0	0	0	11	0	39	730
NEK10	152110	broad.mit.edu	37	3	27346443	27346443	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr3:27346443G>A	ENST00000429845.2	-	13	1185	c.823C>T	c.(823-825)Cgc>Tgc	p.R275C	NEK10_ENST00000341435.5_Missense_Mutation_p.R275C			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	275					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CAAAGTAGGCGCAGCAACTCC	0.502																																						ENST00000429845.2	0.480000	0.100000	0.370000	0.160000	0.250000	0.272178	0.250000	0.230000																										0				41						c.(823-825)Cgc>Tgc		NIMA-related kinase 10							44.0	41.0	42.0					3																	27346443		1568	3582	5150	SO:0001583	missense	152110	6	120400	32				g.chr3:27346443G>A	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.823C>T	chr3.hg19:g.27346443G>A	ENSP00000395849:p.Arg275Cys	0					NEK10_ENST00000341435.5_Missense_Mutation_p.R275C	p.R275C			0	0	0	2.037599	Q6ZWH5	NEK10_HUMAN		13	1185	-			A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	0	1	hg19	c.823C>T		0	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541047	0.45280	.	.	ENSG00000163491	ENST00000341435;ENST00000396636	T	0.51071	0.72	5.38	5.38	0.77491	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65647	0.2711	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.67608	-0.5627	10	0.87932	D	0	.	14.7031	0.69168	0.0717:0.0:0.9283:0.0	.	275	Q6ZWH5	NEK10_HUMAN	C	275	ENSP00000343847:R275C	ENSP00000343847:R275C	R	-	1	0	0	NEK10	27321447	27321447	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	4.640000	0.61368	2.695000	0.91970	0.650000	0.86243	CGC	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.502	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	0	0	1		2	2	2	0		0	0	44		44	44	1	1.860000	-8.857866	1	0.350000	NM_152534			6	6		136	135	0		1	0		0	0	44	0		0.965248	1.480307e-02	0	0	0	4	0	6	136
SLC6A20	54716	broad.mit.edu	37	3	45817325	45817325	+	Silent	SNP	C	C	T	rs376095861		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr3:45817325C>T	ENST00000358525.4	-	4	625	c.510G>A	c.(508-510)ccG>ccA	p.P170P	SLC6A20_ENST00000456124.2_Silent_p.P170P|SLC6A20_ENST00000353278.4_Silent_p.P170P	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	170					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		GGCACAGCGCCGGCTCCCACT	0.622																																						ENST00000358525.4	1.000000	0.900000	1.000000	0.980000	0.990000	0.991416	0.990000	1.000000																										0				13						c.(508-510)ccG>ccA		solute carrier family 6 (proline IMINO transporter), member 20		C	,	0,4406		0,0,2203	131.0	118.0	123.0		510,510	-4.2	0.7	3		123	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC6A20	NM_020208.3,NM_022405.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	170/593,170/556	45817325	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54716	3	121412	38				g.chr3:45817325C>T	AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.510G>A	chr3.hg19:g.45817325C>T		0					SLC6A20_ENST00000456124.2_Silent_p.P170P|SLC6A20_ENST00000353278.4_Silent_p.P170P	p.P170P	NM_020208.3	NP_064593.1	0	0	0	2.037599	Q9NP91	S6A20_HUMAN		4	625	-			A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	ENST00000358525.4	1	1	hg19	c.510G>A	CCDS43077.1	1																																																																																								0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.622	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	1	0	1		2	2	2	0		0	0	223		223	222	1	1.860000	-3.180656	1	0.350000	NM_020208			107	107		453	442	1		1	1		0	0	223	0		1.000000	9.637646e-01	0	3	0	22	0	107	453
NUDT9	53343	broad.mit.edu	37	4	88370318	88370318	+	Missense_Mutation	SNP	T	T	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr4:88370318T>A	ENST00000302174.4	+	5	879	c.555T>A	c.(553-555)aaT>aaA	p.N185K	NUDT9_ENST00000515371.1_3'UTR|NUDT9_ENST00000473942.1_Missense_Mutation_p.N135K	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	185	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		GCAGTGGAAATAAAATCATGC	0.338																																						ENST00000302174.4	1.000000	0.860000	0.980000	0.910000	0.950000	0.953341	0.950000	0.970000																										0				11						c.(553-555)aaT>aaA		nudix (nucleoside diphosphate linked moiety X)-type motif 9							96.0	95.0	95.0					4																	88370318		2203	4299	6502	SO:0001583	missense	53343	0	0					g.chr4:88370318T>A	AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.555T>A	chr4.hg19:g.88370318T>A	ENSP00000303575:p.Asn185Lys	1					NUDT9_ENST00000473942.1_Missense_Mutation_p.N135K|NUDT9_ENST00000515371.1_3'UTR	p.N185K	NM_024047.4	NP_076952.1	0	0	0	1.720113	Q9BW91	NUDT9_HUMAN		5	879	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000302174.4	1	1	hg19	c.555T>A	CCDS3620.1	1	.	.	.	.	.	.	.	.	.	.	T	7.271	0.607206	0.14002	.	.	ENSG00000170502	ENST00000302174;ENST00000512216;ENST00000473942;ENST00000440591	T;T;T;T	0.14022	2.54;2.54;2.54;2.54	5.18	3.95	0.45737	5.18	3.95	0.45737	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.390200	0.31697	N	0.007215	T	0.08626	0.0214	L	0.34521	1.04	0.38231	D	0.941037	B;B	0.34200	0.144;0.441	B;B	0.30401	0.019;0.115	T	0.19289	-1.0310	10	0.09590	T	0.72	-20.4549	9.3747	0.38275	0.0:0.0829:0.0:0.9171	.	185;185	Q96KB3;Q9BW91	.;NUDT9_HUMAN	K	185;135;135;153	ENSP00000303575:N185K;ENSP00000424702:N135K;ENSP00000421811:N135K;ENSP00000410270:N153K	ENSP00000303575:N185K	N	+	3	2	2	NUDT9	88589342	88589342	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	1.139000	0.31504	0.878000	0.35920	0.460000	0.39030	AAT	0.208764		TCGA-HZ-A49I-01A-12D-A26I-08	0.338	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2	1	0	1		10	2	2	0		0	1	118		118	117	1	1.860000	-20.000000	1	0.350000				77	76		198	196	1		1	1		0	0	118	0		1.000000	9.999950e-01	0	34	0	16	0	77	198
ENPP6	133121	broad.mit.edu	37	4	185033945	185033945	+	Silent	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr4:185033945G>A	ENST00000296741.2	-	6	1014	c.873C>T	c.(871-873)agC>agT	p.S291S		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	291					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		GTTCCACTGTGCTCAGTTTGT	0.398																																						ENST00000296741.2	0.990000	0.750000	0.960000	0.820000	0.890000	0.893266	0.890000	0.910000																										0				15						c.(871-873)agC>agT		ectonucleotide pyrophosphatase/phosphodiesterase 6							145.0	141.0	142.0					4																	185033945		2203	4300	6503	SO:0001819	synonymous_variant	133121	0	0					g.chr4:185033945G>A	AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.873C>T	chr4.hg19:g.185033945G>A		1						p.S291S	NM_153343.3	NP_699174.1	0	0	0	1.706032	Q6UWR7	ENPP6_HUMAN		6	1014	-		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)	Q4W5Q1|Q96M57	Silent	SNP	ENST00000296741.2	1	1	hg19	c.873C>T	CCDS3834.1	1																																																																																								0.212121		TCGA-HZ-A49I-01A-12D-A26I-08	0.398	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	1	0	1		12	2	2	0		0	1	191		191	191	1	1.860000	-20.000000	1	0.350000	NM_153343			107	108		445	440	0		1			0	0	191	0		1.000000	0	0	0	0	0	0	107	445
MTMR12	54545	broad.mit.edu	37	5	32235181	32235181	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr5:32235181G>A	ENST00000382142.3	-	14	1569	c.1399C>T	c.(1399-1401)Ccc>Tcc	p.P467S	MTMR12_ENST00000510216.1_5'Flank|MTMR12_ENST00000264934.5_Intron|RNU6-1079P_ENST00000362861.1_RNA|MTMR12_ENST00000280285.5_Missense_Mutation_p.P467S	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	467	Interaction with MTM1.|Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AATGCCGGGGGATGCTGGTGC	0.453																																						ENST00000382142.3	0.320000	0.070000	0.240000	0.110000	0.170000	0.184082	0.170000	0.160000																										0				34						c.(1399-1401)Ccc>Tcc		myotubularin related protein 12							55.0	56.0	56.0					5																	32235181		2203	4300	6503	SO:0001583	missense	54545	1	121412	32				g.chr5:32235181G>A	AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1399C>T	chr5.hg19:g.32235181G>A	ENSP00000371577:p.Pro467Ser	0					MTMR12_ENST00000510216.1_5'Flank|MTMR12_ENST00000264934.5_Intron|MTMR12_ENST00000280285.5_Missense_Mutation_p.P467S|RNU6-1079P_ENST00000362861.1_RNA	p.P467S	NM_001040446.1	NP_001035536.1	1	2	3	2.050384	Q9C0I1	MTMRC_HUMAN		14	1569	-			Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	ENST00000382142.3	1	1	hg19	c.1399C>T	CCDS34138.1	0	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097433	0.56075	.	.	ENSG00000150712	ENST00000280285;ENST00000382142	D;D	0.96619	-4.07;-4.07	5.12	3.3	0.37823	5.12	3.3	0.37823	Myotubularin phosphatase domain (1);	0.281329	0.35903	N	0.002906	D	0.94430	0.8208	M	0.73753	2.245	0.80722	D	1	B;P	0.48503	0.116;0.911	B;B	0.39840	0.051;0.311	D	0.91776	0.5431	10	0.54805	T	0.06	.	9.7409	0.40418	0.0733:0.0:0.7865:0.1402	.	467;467	Q9C0I1-2;Q9C0I1	.;MTMRC_HUMAN	S	467	ENSP00000280285:P467S;ENSP00000371577:P467S	ENSP00000280285:P467S	P	-	1	0	0	MTMR12	32270938	32270938	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	5.051000	0.64257	0.529000	0.28599	0.462000	0.41574	CCC	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.453	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366579.1	0	0	1		2	2	2	0		0	0	93		93	91	1	1.860000	-9.460262	1	0.350000	NM_019061			8	8		268	268	0		1	0		0	0	93	0		0.989655	1.077405e-01	0	1	0	16	0	8	268
ITGA1	3672	broad.mit.edu	37	5	52235424	52235424	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr5:52235424C>T	ENST00000282588.6	+	25	3541	c.3083C>T	c.(3082-3084)gCa>gTa	p.A1028V	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1028					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTCTAGAATGCAAACTGCAGA	0.383																																						ENST00000282588.6	1.000000	0.540000	0.880000	0.640000	0.750000	0.760813	0.750000	0.750000																										0				51						c.(3082-3084)gCa>gTa		integrin, alpha 1							91.0	90.0	90.0					5																	52235424		2203	4300	6503	SO:0001583	missense	3672	0	0					g.chr5:52235424C>T	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3083C>T	chr5.hg19:g.52235424C>T	ENSP00000282588:p.Ala1028Val	0					CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	p.A1028V	NM_181501.1	NP_852478.1	1	2	3	2.050384	P56199	ITA1_HUMAN		25	3541	+		Lung NSC(810;5.05e-05)|Breast(144;0.0851)	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	1	1	hg19	c.3083C>T	CCDS3955.1	0	.	.	.	.	.	.	.	.	.	.	C	8.986	0.976553	0.18736	.	.	ENSG00000213949	ENST00000282588	T	0.43688	0.94	6.05	0.357	0.16079	6.05	0.357	0.16079	Integrin alpha-2 (1);	0.925991	0.09267	N	0.825684	T	0.12347	0.0300	N	0.00583	-1.355	0.20489	N	0.999896	B	0.02656	0.0	B	0.04013	0.001	T	0.31194	-0.9952	10	0.13108	T	0.6	.	8.9331	0.35684	0.0:0.5162:0.0:0.4838	.	1028	P56199	ITA1_HUMAN	V	1028	ENSP00000282588:A1028V	ENSP00000282588:A1028V	A	+	2	0	0	ITGA1	52271181	52271181	0.062000	0.20869	0.366000	0.25914	0.548000	0.35241	0.078000	0.14761	0.099000	0.17552	0.650000	0.86243	GCA	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.383	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	1	0	1		2	2	2	0		0	0	89		89	89	1	1.860000	-16.529710	1	0.350000	NM_181501			36	36		238	238	1		1	1		0	0	89	0		1.000000	9.999090e-01	0	14	0	82	0	36	238
ITK	3702	broad.mit.edu	37	5	156675985	156675985	+	Missense_Mutation	SNP	G	G	A	rs56005928	byFrequency	TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr5:156675985G>A	ENST00000422843.3	+	16	1911	c.1759G>A	c.(1759-1761)Gtc>Atc	p.V587I	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	587	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> I (in dbSNP:rs56005928). {ECO:0000269|PubMed:17344846}.		activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CTCCACACACGTCTACCAGAT	0.507			T	SYK	peripheral T-cell lymphoma								G|||	9	0.00179712	0.0	0.0	5008	,	,		20194	0.001		0.007	False		,,,				2504	0.001				Esophageal Squamous(70;1378 1469 8785 19883)	ENST00000422843.3	1.000000	0.670000	1.000000	0.780000	0.890000	0.888646	0.890000	1.000000				Dom	yes			Dom	yes		5	5q31-q32	5q31-q32	3702	T	IL2-inducible T-cell kinase				L	L	SYK		peripheral T-cell lymphoma		0				70						c.(1759-1761)Gtc>Atc		IL2-inducible T-cell kinase	Pazopanib(DB06589)	G	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	104.0	88.0	93.0		1759	0.3	0.1	5	dbSNP_129	93	23,8577	16.6+/-54.9	0,23,4277	yes	missense	ITK	NM_005546.3	29	0,25,6478	AA,AG,GG		0.2674,0.0454,0.1922	benign	587/621	156675985	25,12981	2203	4300	6503	SO:0001583	missense	3702	415	121412	58				g.chr5:156675985G>A	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1759G>A	chr5.hg19:g.156675985G>A	ENSP00000398655:p.Val587Ile	0					ITK_ENST00000519749.1_3'UTR	p.V587I	NM_005546.3	NP_005537.3	0	1	1	2.049467	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	16	1911	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	1	0	hg19	c.1759G>A	CCDS4336.1	1	7	0.003205128205128205	0	0.0	0	0.0	1	0.0017482517482517483	6	0.0079155672823219	G	2.773	-0.255181	0.05829	4.54E-4	0.002674	ENSG00000113263	ENST00000422843	D	0.82433	-1.61	5.41	0.282	0.15692	5.41	0.282	0.15692	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.405452	0.29987	N	0.010696	T	0.55497	0.1924	N	0.14661	0.345	0.26058	N	0.981382	B	0.02656	0.0	B	0.04013	0.001	T	0.41875	-0.9484	10	0.11794	T	0.64	.	9.2885	0.37771	0.6236:0.0:0.3764:0.0	rs56005928	587	Q08881	ITK_HUMAN	I	587	ENSP00000398655:V587I	ENSP00000398655:V587I	V	+	1	0	0	ITK	156608563	156608563	0.001000	0.12720	0.084000	0.20598	0.536000	0.34869	0.012000	0.13287	-0.100000	0.12241	-0.806000	0.03193	GTC	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.507	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2	0	0	1		11	2	2	1		1	1	116		116	114	1	1.860000	-3.620247	1	0.350000				49	49		263	258	1		1	0		1	0	116	0		1.000000	0	0	0	0	1	0	49	263
PRL	5617	broad.mit.edu	37	6	22292852	22292852	+	Missense_Mutation	SNP	C	C	T	rs570230762		TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr6:22292852C>T	ENST00000306482.1	-	3	745	c.227G>A	c.(226-228)cGg>cAg	p.R76Q	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	76					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					AATGAACCCCCGGCCATGGGT	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		16481	0.001		0.0	False		,,,				2504	0.0					ENST00000306482.1	1.000000	0.740000	0.980000	0.830000	0.920000	0.912589	0.920000	0.990000																										0				16						c.(226-228)cGg>cAg		prolactin							110.0	91.0	97.0					6																	22292852		2203	4300	6503	SO:0001583	missense	5617	6	121412	39				g.chr6:22292852C>T	D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.227G>A	chr6.hg19:g.22292852C>T	ENSP00000302150:p.Arg76Gln	1					RP3-404K8.2_ENST00000561912.1_RNA	p.R76Q	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	0	1	1	1.668703	P01236	PRL_HUMAN		3	745	-	Ovarian(93;0.163)		Q15199|Q92996	Missense_Mutation	SNP	ENST00000306482.1	1	1	hg19	c.227G>A	CCDS4548.1	1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178944	0.38511	.	.	ENSG00000172179	ENST00000306482;ENST00000438606	D	0.88431	-2.38	6.07	3.33	0.38152	6.07	3.33	0.38152	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.249538	0.42294	N	0.000740	T	0.71290	0.3322	L	0.54863	1.705	0.09310	N	0.999997	B;P	0.43826	0.024;0.818	B;B	0.33799	0.023;0.17	T	0.61662	-0.7017	10	0.33940	T	0.23	2.0715	9.4164	0.38523	0.0:0.7519:0.1196:0.1286	.	76;77	P01236;Q5I0G2	PRL_HUMAN;.	Q	76;45	ENSP00000302150:R76Q	ENSP00000302150:R76Q	R	-	2	0	0	PRL	22400831	22400831	0.014000	0.17966	0.001000	0.08648	0.607000	0.37147	0.491000	0.22419	0.443000	0.26582	0.655000	0.94253	CGG	0.212121		TCGA-HZ-A49I-01A-12D-A26I-08	0.458	PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043327.1	1	0	1		2	2	2	0		0	0	96		96	95	1	1.860000	-3.286340	1	0.350000	NM_000948			51	51		184	183	1		1			0	0	96	0		1.000000	0	0	0	0	0	0	51	184
BACH2	60468	broad.mit.edu	37	6	90661558	90661558	+	Silent	SNP	C	C	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr6:90661558C>T	ENST00000257749.4	-	7	974	c.267G>A	c.(265-267)ccG>ccA	p.P89P	RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000343122.3_Silent_p.P89P|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000537989.1_Silent_p.P89P	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	89	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		ACTGTAACAGCGGCCCAAAGC	0.527																																						ENST00000257749.4	0.290000	0.070000	0.230000	0.110000	0.160000	0.174945	0.160000	0.160000																										0				45						c.(265-267)ccG>ccA		BTB and CNC homology 1, basic leucine zipper transcription factor 2							46.0	46.0	46.0					6																	90661558		2202	4297	6499	SO:0001819	synonymous_variant	60468	1	121370	29				g.chr6:90661558C>T	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.267G>A	chr6.hg19:g.90661558C>T		0					RP3-512E2.2_ENST00000413986.1_RNA|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Silent_p.P89P|BACH2_ENST00000343122.3_Silent_p.P89P	p.P89P	NM_021813.2	NP_068585.1	0	0	0	2.030089	Q9BYV9	BACH2_HUMAN		7	974	-		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	ENST00000257749.4	1	1	hg19	c.267G>A	CCDS5026.1	0																																																																																								0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.527	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	0	0	1		2	2	2	0		0	0	132		132	132	1	1.860000	-8.664479	1	0.350000	NM_021813			8	8		280	278	0		1	0		0	0	132	0		0.989337	0	0	0	0	1	0	8	280
SKAP2	8935	broad.mit.edu	37	7	26883668	26883668	+	Silent	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr7:26883668G>A	ENST00000345317.2	-	4	601	c.288C>T	c.(286-288)gaC>gaT	p.D96D	SKAP2_ENST00000539623.1_De_novo_Start_OutOfFrame	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	96					B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						GGGCTTCATCGTCTTTATCAT	0.408																																						ENST00000345317.2	0.980000	0.720000	0.920000	0.780000	0.850000	0.859373	0.850000	0.860000																										0				17						c.(286-288)gaC>gaT		src kinase associated phosphoprotein 2							196.0	193.0	194.0					7																	26883668		2203	4300	6503	SO:0001819	synonymous_variant	8935	1	121412	39				g.chr7:26883668G>A		CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.288C>T	chr7.hg19:g.26883668G>A		0					SKAP2_ENST00000539623.1_De_novo_Start_OutOfFrame	p.D96D	NM_003930.3	NP_003921.2	0	1	1	2.046091	O75563	SKAP2_HUMAN		4	601	-			A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Silent	SNP	ENST00000345317.2	1	0	hg19	c.288C>T	CCDS5400.1	1																																																																																								0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.408	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1	1	0	1		2	2	2	0		0	0	357		357	356	1	1.860000	-20.000000	1	0.350000				144	143		814	807	1		1	1		0	0	357	0		1.000000	9.510221e-01	0	8	0	22	0	144	814
PLEKHA8	84725	broad.mit.edu	37	7	30094411	30094411	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr7:30094411T>G	ENST00000449726.1	+	8	1233	c.883T>G	c.(883-885)Tgc>Ggc	p.C295G	PLEKHA8_ENST00000396259.1_Missense_Mutation_p.C295G|PLEKHA8_ENST00000258679.7_Missense_Mutation_p.C295G|PLEKHA8_ENST00000396257.2_Missense_Mutation_p.C295G	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	295					ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						AGACTCAAGTTGCTCTCCGGA	0.403																																						ENST00000449726.1	1.000000	0.730000	0.980000	0.810000	0.880000	0.892742	0.880000	1.000000																										0				17						c.(883-885)Tgc>Ggc		pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8							154.0	149.0	151.0					7																	30094411		2203	4300	6503	SO:0001583	missense	84725	0	0					g.chr7:30094411T>G	BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.883T>G	chr7.hg19:g.30094411T>G	ENSP00000397947:p.Cys295Gly	0					PLEKHA8_ENST00000258679.7_Missense_Mutation_p.C295G|PLEKHA8_ENST00000396257.2_Missense_Mutation_p.C295G|PLEKHA8_ENST00000396259.1_Missense_Mutation_p.C295G	p.C295G	NM_001197027.1	NP_001183956.1	0	1	1	2.046091	Q96JA3	PKHA8_HUMAN		8	1233	+			B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Missense_Mutation	SNP	ENST00000449726.1	1	1	hg19	c.883T>G	CCDS56473.1	1	.	.	.	.	.	.	.	.	.	.	T	6.983	0.551408	0.13374	.	.	ENSG00000106086	ENST00000258679;ENST00000449726;ENST00000396257;ENST00000396259;ENST00000440706	.	.	.	5.63	1.47	0.22746	5.63	1.47	0.22746	.	1.546830	0.03461	N	0.212180	T	0.19127	0.0459	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.0;0.0;0.002;0.0	T	0.16541	-1.0399	9	0.20046	T	0.44	-5.9383	0.163	0.00105	0.2309:0.1762:0.2132:0.3797	.	295;295;295;295	Q96JA3-2;Q96JA3;Q96JA3-3;B4DH00	.;PKHA8_HUMAN;.;.	G	295;295;295;295;321	.	ENSP00000258679:C295G	C	+	1	0	0	PLEKHA8	30060936	30060936	0.141000	0.22595	0.004000	0.12327	0.048000	0.14542	1.196000	0.32198	0.445000	0.26639	0.533000	0.62120	TGC	0.348861		TCGA-HZ-A49I-01A-12D-A26I-08	0.403	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	206		206	205	1	1.860000	-20.000000	1	0.350000	NM_032639			102	102		549	545	1		1	0		0	0	206	0		1.000000	2.421924e-01	0	0	0	6	0	102	549
MGAM	8972	broad.mit.edu	37	7	141752741	141752741	+	Missense_Mutation	SNP	G	G	C	rs139662456	byFrequency	TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr7:141752741G>C	ENST00000549489.2	+	26	3211	c.3116G>C	c.(3115-3117)cGc>cCc	p.R1039P	MGAM_ENST00000475668.2_Missense_Mutation_p.R1039P	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1039					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AACCCCCTTCGCCTGGATGTC	0.453																																						ENST00000549489.2	0.950000	0.570000	0.860000	0.660000	0.750000	0.762801	0.750000	0.750000																										0				13						c.(3115-3117)cGc>cCc		maltase-glucoamylase (alpha-glucosidase)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						81.0	78.0	79.0					7																	141752741		1945	4146	6091	SO:0001583	missense	8972	0	0					g.chr7:141752741G>C	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3116G>C	chr7.hg19:g.141752741G>C	ENSP00000447378:p.Arg1039Pro	0					MGAM_ENST00000475668.2_Missense_Mutation_p.R1039P	p.R1039P	NM_004668.2	NP_004659.2	0	0	0	2.043567	O43451	MGA_HUMAN		26	3211	+	Melanoma(164;0.0272)		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	1	0	hg19	c.3116G>C	CCDS47727.1	0	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343095	0.41498	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.13538	2.58	4.39	0.436	0.16549	4.39	0.436	0.16549	Glycoside hydrolase-type carbohydrate-binding (1);	0.871763	0.09557	N	0.786123	T	0.29945	0.0749	M	0.92122	3.275	0.09310	N	1	P	0.49253	0.921	P	0.47118	0.538	T	0.18493	-1.0335	10	0.62326	D	0.03	.	7.83	0.29336	0.4799:0.0:0.5201:0.0	.	1039	O43451	MGA_HUMAN	P	1039;1039;916	ENSP00000447378:R1039P	ENSP00000316431:R916P	R	+	2	0	0	MGAM	141399210	141399210	0.005000	0.15991	0.006000	0.13384	0.017000	0.09413	1.298000	0.33412	-0.287000	0.09064	-0.717000	0.03617	CGC	0.347717		TCGA-HZ-A49I-01A-12D-A26I-08	0.453	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3	1	0	1		2	2	2	0		0	0	120		120	117	1	1.860000	-5.553828	1	0.350000				53	53		346	344	1		1			0	0	120	0		1.000000	0	0	0	0	0	0	53	346
RP1L1	94137	broad.mit.edu	37	8	10470187	10470187	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr8:10470187C>G	ENST00000382483.3	-	4	1644	c.1421G>C	c.(1420-1422)aGg>aCg	p.R474T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	474					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTCCGGGGTCCTGGGGCAGCA	0.701																																						ENST00000382483.3	1.000000	0.770000	1.000000	0.870000	0.980000	0.952008	0.980000	1.000000																										0				148						c.(1420-1422)aGg>aCg		retinitis pigmentosa 1-like 1							25.0	30.0	28.0					8																	10470187		1954	4118	6072	SO:0001583	missense	94137	1	120526	28				g.chr8:10470187C>G	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1421G>C	chr8.hg19:g.10470187C>G	ENSP00000371923:p.Arg474Thr	0						p.R474T	NM_178857.5	NP_849188.4	1	2	3	2.091493	Q8IWN7	RP1L1_HUMAN		4	1644	-			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	1	1	hg19	c.1421G>C	CCDS43708.1	1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778440	0.31502	.	.	ENSG00000183638	ENST00000382483	T	0.04917	3.53	4.99	4.99	0.66335	4.99	4.99	0.66335	.	0.443402	0.16804	U	0.198863	T	0.05914	0.0154	N	0.24115	0.695	0.09310	N	1	P	0.48764	0.915	P	0.45232	0.474	T	0.38394	-0.9663	10	0.30854	T	0.27	-7.7844	8.8491	0.35188	0.0:0.8913:0.0:0.1087	.	474	A6NKC6	.	T	474	ENSP00000371923:R474T	ENSP00000371923:R474T	R	-	2	0	0	RP1L1	10507597	10507597	0.041000	0.20044	0.010000	0.14722	0.065000	0.16274	1.394000	0.34509	2.302000	0.77476	0.561000	0.74099	AGG	0.357866		TCGA-HZ-A49I-01A-12D-A26I-08	0.701	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1	1	0	1		2	2	2	0		0	0	174		174	173	1	1.860000	-3.173588	1	0.350000				67	67		328	325	1		1	0		0	0	174	0		1.000000	0	0	0	0	1	0	67	328
VPS13B	157680	broad.mit.edu	37	8	100861089	100861089	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr8:100861089G>T	ENST00000358544.2	+	55	10214	c.10103G>T	c.(10102-10104)gGa>gTa	p.G3368V	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.G3343V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3368					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCCCCAGAAGGAAAAGCAGGA	0.398																																					Colon(161;2205 2542 7338 31318)	ENST00000358544.2	0.180000	0.060000	0.150000	0.080000	0.110000	0.124876	0.110000	0.120000																										0				193						c.(10102-10104)gGa>gTa		vacuolar protein sorting 13 homolog B (yeast)							175.0	158.0	164.0					8																	100861089		2203	4300	6503	SO:0001583	missense	157680	0	0					g.chr8:100861089G>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10103G>T	chr8.hg19:g.100861089G>T	ENSP00000351346:p.Gly3368Val	1					VPS13B_ENST00000357162.2_Missense_Mutation_p.G3343V|VPS13B_ENST00000395996.1_3'UTR	p.G3368V	NM_017890.4	NP_060360.3	0	1	1	1.655022	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)	55	10214	+	Breast(36;3.73e-07)		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	1	1	hg19	c.10103G>T	CCDS6280.1	0	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707973	0.68615	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.73469	-0.75;-0.75	5.83	4.04	0.47022	5.83	4.04	0.47022	.	0.181715	0.47852	D	0.000206	T	0.73458	0.3589	L	0.40543	1.245	0.80722	D	1	P;P	0.47191	0.836;0.891	P;P	0.52343	0.696;0.617	T	0.68762	-0.5323	10	0.27785	T	0.31	.	12.4675	0.55768	0.1326:0.0:0.8674:0.0	.	3343;3368	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	V	3343;3368	ENSP00000349685:G3343V;ENSP00000351346:G3368V	ENSP00000349685:G3343V	G	+	2	0	0	VPS13B	100930265	100930265	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.888000	0.69758	0.817000	0.34445	0.650000	0.86243	GGA	0.212121		TCGA-HZ-A49I-01A-12D-A26I-08	0.398	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	0	0	1		2	2	2	0		0	0	177		177	176	1	1.860000	-3.218429	1	0.350000	NM_184042			16	16		620	614	0		1	0		0	0	177	0		0.999928	1.427359e-02	0	0	0	7	0	16	620
PLEC	5339	broad.mit.edu	37	8	144992083	144992083	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr8:144992083G>A	ENST00000322810.4	-	32	12486	c.12317C>T	c.(12316-12318)gCg>gTg	p.A4106V	PLEC_ENST00000345136.3_Missense_Mutation_p.A3969V|PLEC_ENST00000357649.2_Missense_Mutation_p.A3973V|PLEC_ENST00000436759.2_Missense_Mutation_p.A3996V|PLEC_ENST00000354589.3_Missense_Mutation_p.A3969V|PLEC_ENST00000527096.1_Missense_Mutation_p.A3992V|PLEC_ENST00000356346.3_Missense_Mutation_p.A3955V|PLEC_ENST00000398774.2_Missense_Mutation_p.A3937V|PLEC_ENST00000354958.2_Missense_Mutation_p.A3947V	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4106	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGCCGCCTGCGCCTCCAGGAG	0.632																																						ENST00000322810.4	1.000000	0.550000	0.960000	0.670000	0.800000	0.809929	0.800000	1.000000																										0				137						c.(12316-12318)gCg>gTg		plectin							27.0	32.0	31.0					8																	144992083		2114	4221	6335	SO:0001583	missense	5339	2	121066	29				g.chr8:144992083G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12317C>T	chr8.hg19:g.144992083G>A	ENSP00000323856:p.Ala4106Val	0					PLEC_ENST00000436759.2_Missense_Mutation_p.A3996V|PLEC_ENST00000354589.3_Missense_Mutation_p.A3969V|PLEC_ENST00000527096.1_Missense_Mutation_p.A3992V|PLEC_ENST00000357649.2_Missense_Mutation_p.A3973V|PLEC_ENST00000354958.2_Missense_Mutation_p.A3947V|PLEC_ENST00000345136.3_Missense_Mutation_p.A3969V|PLEC_ENST00000356346.3_Missense_Mutation_p.A3955V|PLEC_ENST00000398774.2_Missense_Mutation_p.A3937V	p.A4106V	NM_201380.2	NP_958782.1	1	2	3	2.052290	Q15149	PLEC_HUMAN		32	12486	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	1	1	hg19	c.12317C>T	CCDS43772.1	0	.	.	.	.	.	.	.	.	.	.	G	6.744	0.506057	0.12883	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.08	4.21	0.49690	5.08	4.21	0.49690	.	0.000000	0.64402	U	0.000008	D	0.89410	0.6707	M	0.93854	3.465	0.54753	D	0.999989	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999;0.999;0.999;0.999	P;P;P;P;P;P;P;P	0.61940	0.833;0.833;0.833;0.896;0.833;0.833;0.833;0.833	D	0.91813	0.5461	10	0.66056	D	0.02	.	13.6323	0.62202	0.0753:0.0:0.9247:0.0	.	3996;3955;3947;4106;3937;3969;3973;3969	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	V	3969;3973;3969;3937;4106;3947;3955;3996;3992	ENSP00000344848:A3969V;ENSP00000350277:A3973V;ENSP00000346602:A3969V;ENSP00000381756:A3937V;ENSP00000323856:A4106V;ENSP00000347044:A3947V;ENSP00000348702:A3955V;ENSP00000388180:A3996V;ENSP00000434583:A3992V	ENSP00000323856:A4106V	A	-	2	0	0	PLEC	145064071	145064071	1.000000	0.71417	0.926000	0.36857	0.002000	0.02628	6.524000	0.73791	1.397000	0.46682	-0.237000	0.12165	GCG	0.351136		TCGA-HZ-A49I-01A-12D-A26I-08	0.632	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	1	0	1		2	2	2	0		0	0	76		76	76	1	1.860000	-20.000000	1	0.350000	NM_000445			27	27		165	161	1		1	1		0	0	76	0		1.000000	1	0	375	0	501	0	27	165
NR6A1	2649	broad.mit.edu	37	9	127316820	127316820	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HZ-A49I-01A-12D-A26I-08	TCGA-HZ-A49I-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0121cca-1fde-4733-8fe1-0a949d789d93	b2e6fcfc-a9e5-4afc-8f3f-ca0056488a32	g.chr9:127316820G>A	ENST00000487099.2	-	3	329	c.172C>T	c.(172-174)Cga>Tga	p.R58*	NR6A1_ENST00000373584.3_Nonsense_Mutation_p.R54*|NR6A1_ENST00000344523.4_Nonsense_Mutation_p.R58*|NR6A1_ENST00000416460.2_Nonsense_Mutation_p.R54*	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	58					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						AGACAGGTTCGTTGTTCAGCC	0.463																																					Esophageal Squamous(192;272 2884 6208 20560)	ENST00000487099.2	1.000000	0.850000	1.000000	0.950000	0.990000	0.982852	0.990000	1.000000																										0				17						c.(172-174)Cga>Tga		nuclear receptor subfamily 6, group A, member 1							94.0	87.0	90.0					9																	127316820		2203	4300	6503	SO:0001587	stop_gained	2649	0	0					g.chr9:127316820G>A	U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.172C>T	chr9.hg19:g.127316820G>A	ENSP00000420267:p.Arg58*	0					NR6A1_ENST00000344523.4_Nonsense_Mutation_p.R58*|NR6A1_ENST00000416460.2_Nonsense_Mutation_p.R54*|NR6A1_ENST00000373584.3_Nonsense_Mutation_p.R54*	p.R58*	NM_001278546.1	NP_001265475.1	0	0	0	2.038036	Q15406	NR6A1_HUMAN		3	329	-			O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Nonsense_Mutation	SNP	ENST00000487099.2	0	1	hg19	c.172C>T	CCDS35137.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.168299	0.94768	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	.	.	.	5.46	4.54	0.55810	5.46	4.54	0.55810	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	12.3582	0.55188	0.0:0.0:0.6932:0.3068	.	.	.	.	X	58;54;54;58;16	.	ENSP00000341135:R58X	R	-	1	2	2	NR6A1	126356641	126356641	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.424000	0.59868	1.256000	0.44068	0.563000	0.77884	CGA	0.345418		TCGA-HZ-A49I-01A-12D-A26I-08	0.463	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054043.4	1	0	1		2	2	2	0		0	0	139		139	139	1	1.860000	-20.000000	1	0.350000				82	83		357	356	1		1			0	0	139	0		1.000000	0	0	0	0	0	0	82	357
