#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CSRNP1	64651	broad.mit.edu	37	3	39185116	39185117	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr3:39185116_39185117delAG	ENST00000273153.5	-	5	1376_1377	c.1199_1200delCT	c.(1198-1200)tctfs	p.S400fs	CSRNP1_ENST00000514182.1_Frame_Shift_Del_p.S400fs	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	400					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CACCGAAGTCAGAGTCACTGAA	0.604																																						ENST00000273153.5	0.520000	0.200000	4.400000e-01	2.600000e-01	0.340000	0.356785	0.340000	0.340000																										0				24						c.(1198-1200)tctfs		cysteine-serine-rich nuclear protein 1																																				SO:0001589	frameshift_variant	64651	0	0					g.chr3:39185116_39185117delAG	AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.1199_1200delCT	chr3.hg19:g.39185118_39185119delAG	ENSP00000273153:p.Ser400fs	1					CSRNP1_ENST00000514182.1_Frame_Shift_Del_p.S400fs	p.S400fs	NM_033027.3	NP_149016.2	0	0	0	1.778713	Q96S65	CSRN1_HUMAN		5	1376_1377	-			Q69YY5	Frame_Shift_Del	DEL	ENST00000273153.5	0	1	hg19	c.1199_1200delCT	CCDS2682.1	0																																																																																								0.208566		TCGA-HZ-A4BK-01A-11D-A26I-08	0.604	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	1	0	0		25	2		0		0	3	59		59	60	1	1.790000	-19.418880	1	0.320000	NM_033027			16	23		234	233	0		0	1	0	0	0	59	0		0.107729	7.721509e-01	0	5	0	38	0	16	234
MKX	283078	broad.mit.edu	37	10	27964309	27964309	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:27964309G>A	ENST00000375790.5	-	7	1340	c.908C>T	c.(907-909)aCg>aTg	p.T303M	MKX_ENST00000419761.1_Missense_Mutation_p.T303M			Q8IYA7	MKX_HUMAN	mohawk homeobox	303					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						CTTCCAATACGTGTCATCCTT	0.458																																						ENST00000375790.5	0.650000	0.390000	5.900000e-01	4.500000e-01	0.510000	0.524804	0.510000	0.520000																										0				16						c.(907-909)aCg>aTg		mohawk homeobox							250.0	221.0	231.0					10																	27964309		2203	4300	6503	SO:0001583	missense	283078	0	0					g.chr10:27964309G>A	BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.908C>T	chr10.hg19:g.27964309G>A	ENSP00000364946:p.Thr303Met	0					MKX_ENST00000419761.1_Missense_Mutation_p.T303M	p.T303M			0	0	0	2.000691	Q8IYA7	MKX_HUMAN		7	1340	-			B3KWM5	Missense_Mutation	SNP	ENST00000375790.5	1	1	hg19	c.908C>T	CCDS7156.1	0	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675117	0.88445	.	.	ENSG00000150051	ENST00000375790;ENST00000419761	T;T	0.19394	2.15;2.15	6.05	6.05	0.98169	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.11916	-1.0568	10	0.72032	D	0.01	-26.4697	20.6013	0.99457	0.0:0.0:1.0:0.0	.	303	Q8IYA7	MKX_HUMAN	M	303	ENSP00000364946:T303M;ENSP00000400896:T303M	ENSP00000364946:T303M	T	-	2	0	0	MKX	28004315	28004315	1.000000	0.71417	0.989000	0.46669	0.896000	0.52359	7.322000	0.79097	2.878000	0.98634	0.650000	0.86243	ACG	0.295191		TCGA-HZ-A4BK-01A-11D-A26I-08	0.458	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047332.3	1	0	1		2	2	2	0		0	0	92		92	92	1	1.790000	-15.191460	1	0.320000	NM_173576			59	58		626	625	0		1			0	0	92	0		1.000000	0	0	0	0	0	0	59	626
CCDC7	79741	broad.mit.edu	37	10	32740612	32740612	+	Silent	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:32740612G>A	ENST00000362006.5	+	2	585	c.42G>A	c.(40-42)tcG>tcA	p.S14S	CCDC7_ENST00000537047.1_Silent_p.S14S|CCDC7_ENST00000277657.6_Silent_p.S14S|CCDC7_ENST00000535327.1_Silent_p.S14S|CCDC7_ENST00000539197.1_Silent_p.S14S|CCDC7_ENST00000545067.1_Silent_p.S14S	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	14										NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				GTAACAAATCGGCAAATGTTC	0.323																																						ENST00000362006.5	1.000000	0.710000	1	8.200000e-01	0.930000	0.919019	0.930000	1.000000																										0				14						c.(40-42)tcG>tcA		coiled-coil domain containing 7							85.0	84.0	84.0					10																	32740612		2203	4300	6503	SO:0001819	synonymous_variant	79741	0	0					g.chr10:32740612G>A	BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.42G>A	chr10.hg19:g.32740612G>A		0					CCDC7_ENST00000277657.6_Silent_p.S14S|CCDC7_ENST00000537047.1_Silent_p.S14S|CCDC7_ENST00000545067.1_Silent_p.S14S|CCDC7_ENST00000539197.1_Silent_p.S14S|CCDC7_ENST00000535327.1_Silent_p.S14S	p.S14S	NM_145023.4	NP_659460.3	0	0	0	2.000691	Q96M83	CCDC7_HUMAN		2	585	+		Breast(68;0.000207)|Prostate(175;0.0107)	Q5VW55|Q8IVQ0|Q8NEQ0	Silent	SNP	ENST00000362006.5	1	1	hg19	c.42G>A	CCDS7173.1	1																																																																																								0.295191		TCGA-HZ-A4BK-01A-11D-A26I-08	0.323	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047490.1	1	0	1		2	2	2	0		0	0	46		46	46	1	1.790000	-2.754154	1	0.320000	NM_145023			52	51		282	279	1		1	0		0	0	46	0		1.000000	0	0	1	0	0	0	52	282
P4HA1	5033	broad.mit.edu	37	10	74813157	74813157	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:74813157C>T	ENST00000307116.2	-	6	771	c.655G>A	c.(655-657)Gga>Aga	p.G219R	P4HA1_ENST00000394890.2_Missense_Mutation_p.G219R|P4HA1_ENST00000440381.1_Missense_Mutation_p.G219R|P4HA1_ENST00000412021.2_Missense_Mutation_p.G219R|P4HA1_ENST00000373008.2_Missense_Mutation_p.G219R|P4HA1_ENST00000263556.3_Missense_Mutation_p.G219R			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	219					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCCAGGTCTCCCTGCTGATAT	0.398																																					Colon(147;367 2405 2662 52127)	ENST00000307116.2	0.610000	0.330000	5.300000e-01	3.900000e-01	0.450000	0.465391	0.450000	0.450000																										0				15						c.(655-657)Gga>Aga		prolyl 4-hydroxylase, alpha polypeptide I	Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)						128.0	127.0	127.0					10																	74813157		2203	4300	6503	SO:0001583	missense	5033	0	0					g.chr10:74813157C>T		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.655G>A	chr10.hg19:g.74813157C>T	ENSP00000307318:p.Gly219Arg	0					P4HA1_ENST00000440381.1_Missense_Mutation_p.G219R|P4HA1_ENST00000373008.2_Missense_Mutation_p.G219R|P4HA1_ENST00000412021.2_Missense_Mutation_p.G219R|P4HA1_ENST00000394890.2_Missense_Mutation_p.G219R|P4HA1_ENST00000263556.3_Missense_Mutation_p.G219R	p.G219R			1	2	3	2.081589	P13674	P4HA1_HUMAN		6	771	-	Prostate(51;0.0198)		C9JL12|Q15082|Q15083|Q5VSQ5	Missense_Mutation	SNP	ENST00000307116.2	1	1	hg19	c.655G>A		0	.	.	.	.	.	.	.	.	.	.	C	33	5.226826	0.95173	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	T;T;T;T;T;T	0.52057	0.7;0.7;0.7;0.7;0.7;0.68	5.83	5.83	0.93111	5.83	5.83	0.93111	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77143	0.4087	M	0.91872	3.25	0.80722	D	1	D;D;D	0.76494	0.999;0.991;0.991	D;D;D	0.76575	0.988;0.953;0.953	T	0.81475	-0.0916	10	0.87932	D	0	-4.2197	20.1224	0.97967	0.0:1.0:0.0:0.0	.	219;219;219	C9JL12;Q5VSQ6;P13674	.;.;P4HA1_HUMAN	R	219	ENSP00000307318:G219R;ENSP00000362099:G219R;ENSP00000411688:G219R;ENSP00000378353:G219R;ENSP00000263556:G219R;ENSP00000414464:G219R	ENSP00000263556:G219R	G	-	1	0	0	P4HA1	74483163	74483163	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.468000	0.80943	2.763000	0.94921	0.655000	0.94253	GGA	0.322169		TCGA-HZ-A4BK-01A-11D-A26I-08	0.398	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	1	0	0		2	2	2	0		0	0	68		68	68	1	1.790000	-2.690405	1	0.320000	NM_000917			47	47		603	602	0		1	1		0	0	68	0		1.000000	7.157879e-01	0	4	0	30	0	47	603
BMPR1A	657	broad.mit.edu	37	10	88659808	88659808	+	Missense_Mutation	SNP	G	G	A	rs567009904		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:88659808G>A	ENST00000372037.3	+	7	992	c.455G>A	c.(454-456)cGa>cAa	p.R152Q		NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	152					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						GGCAGCATTCGATGGCTGGTT	0.353			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2				G|||	1	0.000199681	0.0	0.0	5008	,	,		18353	0.001		0.0	False		,,,				2504	0.0				Ovarian(190;603 2086 22044 30335 47971)	ENST00000372037.3	0.650000	0.350000	5.600000e-01	4.100000e-01	0.480000	0.492459	0.480000	0.480000			yes	Rec		Juvenile polyposis	yes	Rec		Juvenile polyposis	10	10q22.3	10q22.3	657	Mis, N, F	"""bone morphogenetic protein receptor, type IA"""				E	E		gastrointestinal polyps			0				24						c.(454-456)cGa>cAa		bone morphogenetic protein receptor, type IA							103.0	101.0	101.0					10																	88659808		2203	4300	6503	SO:0001583	missense	657	1	121412	35	Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	g.chr10:88659808G>A	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.455G>A	chr10.hg19:g.88659808G>A	ENSP00000361107:p.Arg152Gln	0						p.R152Q	NM_004329.2	NP_004320.2	1	2	3	2.081589	P36894	BMR1A_HUMAN		7	992	+			A8K6U9|Q8NEN8	Missense_Mutation	SNP	ENST00000372037.3	1	1	hg19	c.455G>A	CCDS7378.1	0	.	.	.	.	.	.	.	.	.	.	G	10.63	1.402822	0.25291	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	D	0.82803	-1.65	4.77	4.77	0.60923	4.77	4.77	0.60923	.	0.114590	0.64402	D	0.000014	T	0.69441	0.3111	N	0.22421	0.69	0.44241	D	0.997087	B	0.10296	0.003	B	0.06405	0.002	T	0.62567	-0.6827	10	0.13108	T	0.6	.	11.4089	0.49915	0.0856:0.0:0.9144:0.0	.	152	P36894	BMR1A_HUMAN	Q	152	ENSP00000361107:R152Q	ENSP00000224764:R152Q	R	+	2	0	0	BMPR1A	88649788	88649788	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	5.120000	0.64685	2.574000	0.86865	0.563000	0.77884	CGA	0.322169		TCGA-HZ-A4BK-01A-11D-A26I-08	0.353	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	1	0	1		2	2	2	0		0	0	44		44	45	1	1.790000	-10.559320	1	0.320000	NM_004329			42	42		507	502	0		1	0		0	0	44	0		1.000000	4.386800e-01	0	1	0	18	0	42	507
MMRN2	79812	broad.mit.edu	37	10	88702455	88702455	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:88702455C>T	ENST00000372027.5	-	6	2407	c.2086G>A	c.(2086-2088)Ggg>Agg	p.G696R	MMRN2_ENST00000488950.1_5'Flank	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	696					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						CGCGCCAGCCCGGCCAGGGCG	0.776																																						ENST00000372027.5	1.000000	0.410000	1	5.800000e-01	0.810000	0.796554	0.810000	1.000000																										0				19						c.(2086-2088)Ggg>Agg		multimerin 2							5.0	5.0	5.0					10																	88702455		2040	3968	6008	SO:0001583	missense	79812	0	0					g.chr10:88702455C>T	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.2086G>A	chr10.hg19:g.88702455C>T	ENSP00000361097:p.Gly696Arg	0					MMRN2_ENST00000488950.1_5'Flank	p.G696R	NM_024756.2	NP_079032.2	1	2	3	2.081589	Q9H8L6	MMRN2_HUMAN		6	2407	-			Q504V7|Q6P2N2	Missense_Mutation	SNP	ENST00000372027.5	0	1	hg19	c.2086G>A	CCDS7379.1	0	.	.	.	.	.	.	.	.	.	.	C	9.413	1.081066	0.20309	.	.	ENSG00000173269	ENST00000372027;ENST00000443699	T	0.14144	2.53	4.85	-1.39	0.08997	4.85	-1.39	0.08997	.	1.310930	0.05269	N	0.517137	T	0.11324	0.0276	L	0.56769	1.78	0.09310	N	1	P;P;P	0.49961	0.93;0.645;0.93	B;B;B	0.30716	0.119;0.037;0.09	T	0.46569	-0.9182	10	0.35671	T	0.21	-7.3288	9.3618	0.38201	0.0:0.3617:0.5044:0.1339	.	474;635;696	E7EN39;B4E3H8;Q9H8L6	.;.;MMRN2_HUMAN	R	696;474	ENSP00000361097:G696R	ENSP00000361097:G696R	G	-	1	0	0	MMRN2	88692435	88692435	0.000000	0.05858	0.005000	0.12908	0.067000	0.16453	-0.154000	0.10130	0.055000	0.16094	0.305000	0.20034	GGG	0.322169		TCGA-HZ-A4BK-01A-11D-A26I-08	0.776	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049179.2	1	0	1		2	2	2	0		0	0	8		8	8	1	1.790000	-16.452200	1	0.320000	NM_024756			9	9		62	60	0		1	0		0	0	8	0		0.994557	6.375157e-01	0	0	0	16	0	9	62
TUBB8	347688	broad.mit.edu	37	10	94025	94025	+	Missense_Mutation	SNP	T	T	C	rs143154682	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:94025T>C	ENST00000309812.4	-	4	369	c.307A>G	c.(307-309)Aag>Gag	p.K103E	TUBB8_ENST00000447903.2_Missense_Mutation_p.K31E|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_Silent_p.P66P	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	103					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TAGTGTCCCTTGGCCCAGTTG	0.577																																					Pancreas(192;2041 3010 9013 18103)	ENST00000309812.4			0	0																														0				32						c.(307-309)Aag>Gag		tubulin, beta 8 class VIII							69.0	57.0	61.0					10																	94025		2203	4300	6503	SO:0001583	missense	347688	6340	121412	60				g.chr10:94025T>C	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.307A>G	chr10.hg19:g.94025T>C	ENSP00000311042:p.Lys103Glu						TUBB8_ENST00000447903.2_Missense_Mutation_p.K31E|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_Silent_p.P66P	p.K103E	NM_177987.2	NP_817124.1					Q3ZCM7	TBB8_HUMAN		4	369	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	1	0	hg19	c.307A>G	CCDS7051.1		.	.	.	.	.	.	.	.	.	.	T	13.76	2.332365	0.41297	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.70399	-0.48	.	.	.	.	.	.	Tubulin/FtsZ, GTPase domain (4);	0.078738	0.47455	U	0.000224	D	0.83700	0.5311	H	0.96805	3.885	0.33195	D	0.551322	P;D	0.56968	0.646;0.978	P;P	0.59221	0.621;0.854	T	0.83158	-0.0100	9	0.87932	D	0	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	66;103	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	E	31;69;66;103	ENSP00000403895:K31E	ENSP00000272035:K69E	K	-	1	0	0	RP11-631M21.2	84025	84025	1.000000	0.71417	0.357000	0.25798	0.361000	0.29550	5.418000	0.66429	0.103000	0.17682	0.102000	0.15555	AAG			TCGA-HZ-A4BK-01A-11D-A26I-08	0.577	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	0	0	1		2	2	2	0		0	0	33		33	35	1	1.790000	-1.306220	0	0.320000	NM_177987			48	38		164	156	1		1	0		0	0	33	0		1.000000	0	0	1	0	0	0	48	164
PAPSS2	9060	broad.mit.edu	37	10	89419767	89419767	+	Splice_Site	SNP	T	T	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr10:89419767T>C	ENST00000361175.4	+	1	396		c.e1+2		RP11-57C13.6_ENST00000438082.1_lincRNA|RP11-57C13.3_ENST00000354527.2_RNA|PAPSS2_ENST00000427144.2_5'Flank|PAPSS2_ENST00000456849.1_Splice_Site	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		CAAAAGACGGTAGGCTTCCAG	0.731																																						ENST00000361175.4	1.000000	0.270000	7.800000e-01	4.000000e-01	0.560000	0.588508	0.560000	1.000000																										0				20						c.e1+2		3'-phosphoadenosine 5'-phosphosulfate synthase 2							15.0	20.0	19.0					10																	89419767		2197	4288	6485	SO:0001630	splice_region_variant	9060	0	0					g.chr10:89419767T>C	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.27+2T>C	chr10.hg19:g.89419767T>C		0					PAPSS2_ENST00000456849.1_Splice_Site|RP11-57C13.6_ENST00000438082.1_lincRNA|RP11-57C13.3_ENST00000354527.2_RNA|PAPSS2_ENST00000427144.2_5'Flank		NM_004670.3	NP_004661.2	1	2	3	2.081589	O95340	PAPS2_HUMAN		1	396	+		Melanoma(5;0.019)|Colorectal(252;0.123)	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Splice_Site	SNP	ENST00000361175.4	0	1	hg19		CCDS7385.1	0	.	.	.	.	.	.	.	.	.	.	T	16.95	3.263517	0.59431	.	.	ENSG00000198682	ENST00000361175;ENST00000456849	.	.	.	4.28	4.28	0.50868	4.28	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7299	0.40355	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	PAPSS2	89409747	89409747	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.292000	0.51772	1.794000	0.52575	0.379000	0.24179	.	0.322169		TCGA-HZ-A4BK-01A-11D-A26I-08	0.731	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1	1	0	1		2	2	2	0		0	0	19		19	19	1	1.790000	-13.595830	1	0.320000		Intron		8	8		84	83	0		1			0	0	19	0		0.989525	0	0	0	0	0	0	8	84
OR52D1	390066	broad.mit.edu	37	11	5510886	5510886	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr11:5510886C>A	ENST00000322641.5	+	1	972	c.950C>A	c.(949-951)tCa>tAa	p.S317*	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	317					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S317L(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGAAGACTTCAATATGAATG	0.423																																						ENST00000322641.5	0.530000	0.240000	4.600000e-01	3.000000e-01	0.370000	0.387892	0.370000	0.380000																										1	Substitution - Missense(1)	p.S317L(1)	skin(1)	22						c.(949-951)tCa>tAa		olfactory receptor, family 52, subfamily D, member 1							57.0	56.0	56.0					11																	5510886		2201	4297	6498	SO:0001587	stop_gained	390066	0	0					g.chr11:5510886C>A	BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.950C>A	chr11.hg19:g.5510886C>A	ENSP00000326232:p.Ser317*	0					HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	p.S317*	NM_001005163.2	NP_001005163.1	0	1	1	1.963308	Q9H346	O52D1_HUMAN		1	972	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	B9EGY9|Q6IFI6	Nonsense_Mutation	SNP	ENST00000322641.5	0	1	hg19	c.950C>A	CCDS31384.1	0	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370450	0.42003	.	.	ENSG00000181609	ENST00000322641	.	.	.	4.75	0.744	0.18353	4.75	0.744	0.18353	.	1.338280	0.05072	N	0.481801	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3458	0.21349	0.0:0.5709:0.0:0.4291	.	.	.	.	X	317	.	ENSP00000326232:S317X	S	+	2	0	0	OR52D1	5467462	5467462	0.001000	0.12720	0.000000	0.03702	0.039000	0.13416	0.659000	0.24994	0.304000	0.22809	0.655000	0.94253	TCA	0.278438		TCGA-HZ-A4BK-01A-11D-A26I-08	0.423	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143372.1	1	0	1		2	2	2	0		0	0	27		27	27	1	1.790000	-3.221903	1	0.320000	NM_001005163			24	23		351	349	0		1			0	0	27	0		1.000000	0	0	0	0	0	0	24	351
DCHS1	8642	broad.mit.edu	37	11	6650981	6650981	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr11:6650981C>G	ENST00000299441.3	-	11	5368	c.4957G>C	c.(4957-4959)Gag>Cag	p.E1653Q	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1653	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACGCTGTACTCCTGCTGCTGG	0.647																																						ENST00000299441.3	1.000000	0.550000	9.600000e-01	6.700000e-01	0.800000	0.813103	0.800000	1.000000																										0				103						c.(4957-4959)Gag>Cag		dachsous cadherin-related 1							40.0	41.0	41.0					11																	6650981		2201	4296	6497	SO:0001583	missense	8642	0	0					g.chr11:6650981C>G	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4957G>C	chr11.hg19:g.6650981C>G	ENSP00000299441:p.Glu1653Gln	0					RP11-732A19.6_ENST00000526633.1_RNA	p.E1653Q	NM_003737.2	NP_003728.1	0	1	1	1.963308	Q96JQ0	PCD16_HUMAN		11	5368	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	O15098	Missense_Mutation	SNP	ENST00000299441.3	1	1	hg19	c.4957G>C	CCDS7771.1	0	.	.	.	.	.	.	.	.	.	.	C	6.206	0.406103	0.11754	.	.	ENSG00000166341	ENST00000299441	T	0.03212	4.01	5.25	5.25	0.73442	5.25	5.25	0.73442	Cadherin (2);Cadherin-like (1);	0.136757	0.33144	N	0.005227	T	0.03348	0.0097	N	0.17723	0.515	0.37504	D	0.916866	B	0.22346	0.068	B	0.13407	0.009	T	0.51965	-0.8638	10	0.12766	T	0.61	.	18.0234	0.89261	0.0:1.0:0.0:0.0	.	1653	Q96JQ0	PCD16_HUMAN	Q	1653	ENSP00000299441:E1653Q	ENSP00000299441:E1653Q	E	-	1	0	0	DCHS1	6607557	6607557	0.027000	0.19231	1.000000	0.80357	0.045000	0.14185	2.816000	0.48026	2.744000	0.94065	0.563000	0.77884	GAG	0.278438		TCGA-HZ-A4BK-01A-11D-A26I-08	0.647	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	1	0	1		2	2	2	0		0	0	37		37	36	1	1.790000	-20.000000	1	0.320000	NM_003737			27	25		169	167	1		1	0		0	0	37	0		1.000000	5.168233e-01	0	0	0	12	0	27	169
BEST1	7439	broad.mit.edu	37	11	61719315	61719315	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr11:61719315C>T	ENST00000378043.4	+	2	680	c.37C>T	c.(37-39)Cgc>Tgc	p.R13C	BEST1_ENST00000378042.3_5'UTR|BEST1_ENST00000534553.1_Intron|BEST1_ENST00000301774.9_Intron|BEST1_ENST00000435278.2_Missense_Mutation_p.R13C|BEST1_ENST00000449131.2_Intron	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	13			R -> H (in VMD2). {ECO:0000269|PubMed:10331951}.		chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						GGCTAATGCCCGCTTAGGCTC	0.572																																						ENST00000378043.4	0.560000	0.310000	5.000000e-01	3.600000e-01	0.420000	0.436964	0.420000	0.430000																										0				25						c.(37-39)Cgc>Tgc		bestrophin 1							112.0	98.0	103.0					11																	61719315		2202	4299	6501	SO:0001583	missense	7439	0	0					g.chr11:61719315C>T	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.37C>T	chr11.hg19:g.61719315C>T	ENSP00000367282:p.Arg13Cys	0					BEST1_ENST00000534553.1_Intron|BEST1_ENST00000301774.9_Intron|BEST1_ENST00000449131.2_Intron|BEST1_ENST00000435278.2_Missense_Mutation_p.R13C|BEST1_ENST00000378042.3_5'UTR	p.R13C	NM_004183.3	NP_004174.1	0	1	1	1.943550	O76090	BEST1_HUMAN		2	680	+			A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Missense_Mutation	SNP	ENST00000378043.4	1	1	hg19	c.37C>T	CCDS31580.1	0	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752660	0.89753	.	.	ENSG00000167995	ENST00000378043;ENST00000435278	D;D	0.98280	-4.27;-4.84	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.155755	0.44285	U	0.000476	D	0.99202	0.9723	M	0.92367	3.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70487	0.969;0.949	D	0.99289	1.0898	10	0.72032	D	0.01	.	18.9153	0.92503	0.0:1.0:0.0:0.0	.	13;13	B7Z375;O76090	.;BEST1_HUMAN	C	13	ENSP00000367282:R13C;ENSP00000408390:R13C	ENSP00000367282:R13C	R	+	1	0	0	BEST1	61475891	61475891	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	4.891000	0.63185	2.567000	0.86603	0.561000	0.74099	CGC	0.273504		TCGA-HZ-A4BK-01A-11D-A26I-08	0.572	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	1	0	1		2	2	2	0		0	0	90		90	82	1	1.790000	-2.559126	1	0.320000	NM_004183			42	39		529	478	0		1			0	0	90	0		1.000000	0	0	0	0	0	0	42	529
DSCAML1	57453	broad.mit.edu	37	11	117307888	117307888	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr11:117307888G>A	ENST00000321322.6	-	26	4851	c.4850C>T	c.(4849-4851)gCg>gTg	p.A1617V	DSCAML1_ENST00000527706.1_Missense_Mutation_p.A1347V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1557					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCCGCAGCCCGCACTGTTGCA	0.642																																						ENST00000321322.6	0.530000	0.270000	4.600000e-01	3.200000e-01	0.380000	0.398690	0.380000	0.390000																										0				110						c.(4849-4851)gCg>gTg		Down syndrome cell adhesion molecule like 1							93.0	86.0	89.0					11																	117307888		2201	4296	6497	SO:0001583	missense	57453	0	0					g.chr11:117307888G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.4850C>T	chr11.hg19:g.117307888G>A	ENSP00000315465:p.Ala1617Val	0					DSCAML1_ENST00000527706.1_Missense_Mutation_p.A1347V	p.A1617V	NM_020693.2	NP_065744.2	0	1	1	1.964809	Q8TD84	DSCL1_HUMAN		26	4851	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	1	1	hg19	c.4850C>T	CCDS8384.1	0	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639853	0.67244	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.56611	0.45;0.45	4.1	4.1	0.47936	4.1	4.1	0.47936	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.73916	0.3648	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79507	-0.1775	9	0.87932	D	0	.	16.9031	0.86118	0.0:0.0:1.0:0.0	.	1557	Q8TD84	DSCL1_HUMAN	V	1347;1617;1324	ENSP00000434335:A1347V;ENSP00000315465:A1617V	ENSP00000315465:A1617V	A	-	2	0	0	DSCAML1	116813098	116813098	1.000000	0.71417	0.952000	0.39060	0.376000	0.30014	7.807000	0.86032	2.286000	0.76751	0.655000	0.94253	GCG	0.269759		TCGA-HZ-A4BK-01A-11D-A26I-08	0.642	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	0	0	1		16	2	2	1		1	1	106		106	104	1	1.790000	-3.318771	1	0.320000	NM_020693			32	31		445	438	0		1	0		1	0	106	0		0.993304	1.994647e-01	0	0	0	12	0	32	445
ABCC9	10060	broad.mit.edu	37	12	22025599	22025599	+	Missense_Mutation	SNP	C	C	T	rs542184069		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr12:22025599C>T	ENST00000261201.4	-	16	2157	c.2158G>A	c.(2158-2160)Ggt>Agt	p.G720S	ABCC9_ENST00000261200.4_Missense_Mutation_p.G720S|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000345162.2_Missense_Mutation_p.G684S	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	720	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.G720C(2)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGCATCTCACCGAGGATGGCA	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		13730	0.0		0.001	False		,,,				2504	0.0					ENST00000261201.4	0.520000	0.320000	4.700000e-01	3.600000e-01	0.410000	0.424208	0.410000	0.420000																										2	Substitution - Missense(2)	p.G720C(2)	kidney(2)	118						c.(2158-2160)Ggt>Agt		ATP-binding cassette, sub-family C (CFTR/MRP), member 9	Adenosine triphosphate(DB00171)|Glyburide(DB01016)						238.0	230.0	233.0					12																	22025599		2203	4300	6503	SO:0001583	missense	10060	3	121412	41				g.chr12:22025599C>T	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2158G>A	chr12.hg19:g.22025599C>T	ENSP00000261201:p.Gly720Ser	1					RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000345162.2_Missense_Mutation_p.G684S|ABCC9_ENST00000261200.4_Missense_Mutation_p.G720S	p.G720S	NM_005691.2	NP_005682.2	0	0	0	1.875591	O60706	ABCC9_HUMAN		16	2157	-			O60707	Missense_Mutation	SNP	ENST00000261201.4	1	1	hg19	c.2158G>A	CCDS8694.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.413057	0.96072	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78	5.63	5.63	0.86233	5.63	5.63	0.86233	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96160	0.8748	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96238	0.9173	10	0.87932	D	0	-13.3901	19.6499	0.95796	0.0:1.0:0.0:0.0	.	720;720	O60706;O60706-2	ABCC9_HUMAN;.	S	720;347;720;684	ENSP00000261200:G720S;ENSP00000440521:G347S;ENSP00000261201:G720S;ENSP00000261202:G684S	ENSP00000261200:G720S	G	-	1	0	0	ABCC9	21916866	21916866	1.000000	0.71417	0.917000	0.36280	0.909000	0.53808	7.600000	0.82769	2.814000	0.96858	0.563000	0.77884	GGT	0.247788		TCGA-HZ-A4BK-01A-11D-A26I-08	0.418	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	1	0	1		2	2	2	0		0	0	133		133	133	1	1.790000	-2.578431	1	0.320000	NM_005691			65	64		809	801	0		1	0		0	0	133	0		1.000000	3.107421e-02	0	0	0	4	0	65	809
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	3	4	2.509416	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.447334		TCGA-HZ-A4BK-01A-11D-A26I-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	13		13	13	1	1.790000	-20.000000	1	0.320000	NM_033360			37	37		81	79	1		1	1	1	0	0	13	476		1.000000	9.985002e-01	1	16	193	10	440	37	81
PTPRB	5787	broad.mit.edu	37	12	70965613	70965613	+	Missense_Mutation	SNP	C	C	T	rs201136742	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr12:70965613C>T	ENST00000261266.5	-	10	2472	c.2443G>A	c.(2443-2445)Ggg>Agg	p.G815R	PTPRB_ENST00000550857.1_Missense_Mutation_p.G725R|PTPRB_ENST00000550358.1_Missense_Mutation_p.G945R|PTPRB_ENST00000334414.6_Missense_Mutation_p.G1033R|PTPRB_ENST00000551525.1_Missense_Mutation_p.G1032R|PTPRB_ENST00000538708.1_Missense_Mutation_p.G815R|PTPRB_ENST00000451516.2_Missense_Mutation_p.G725R	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	815	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTTGTTCTCCCATTCCCTTGT	0.378													C|||	2	0.000399361	0.0	0.0	5008	,	,		20946	0.0		0.001	False		,,,				2504	0.001					ENST00000261266.5	0.290000	0.090000	2.400000e-01	1.200000e-01	0.170000	0.186197	0.170000	0.170000																										0				107						c.(2443-2445)Ggg>Agg		protein tyrosine phosphatase, receptor type, B		C	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,3782		0,0,1891	176.0	173.0	174.0		3097,2173,2443,2443	4.9	1.0	12		174	2,8210		0,2,4104	yes	missense,missense,missense,missense	PTPRB	NM_001109754.2,NM_001206971.1,NM_001206972.1,NM_002837.4	125,125,125,125	0,2,5995	TT,TC,CC		0.0244,0.0,0.0167	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1033/2216,725/1908,815/1908,815/1998	70965613	2,11992	1891	4106	5997	SO:0001583	missense	5787	37	120838	45				g.chr12:70965613C>T	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2443G>A	chr12.hg19:g.70965613C>T	ENSP00000261266:p.Gly815Arg	0					PTPRB_ENST00000334414.6_Missense_Mutation_p.G1033R|PTPRB_ENST00000538708.1_Missense_Mutation_p.G815R|PTPRB_ENST00000551525.1_Missense_Mutation_p.G1032R|PTPRB_ENST00000451516.2_Missense_Mutation_p.G725R|PTPRB_ENST00000550358.1_Missense_Mutation_p.G945R|PTPRB_ENST00000550857.1_Missense_Mutation_p.G725R	p.G815R	NM_002837.4	NP_002828.3	0	1	1	2.064127	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)	10	2472	-	Renal(347;0.236)		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	0	1	hg19	c.2443G>A	CCDS44944.1	0	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719849	0.68844	0.0	2.44E-4	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.04862	4.04;4.03;4.01;4.05;4.03;4.08;3.54;3.58	5.96	4.9	0.64082	5.96	4.9	0.64082	Fibronectin, type III (1);	0.105396	0.64402	D	0.000004	T	0.21921	0.0528	M	0.75777	2.31	0.48830	D	0.999717	D;D;D;D;D;D;D	0.71674	0.996;0.996;0.963;0.963;0.998;0.996;0.996	D;D;D;P;D;D;D	0.77557	0.99;0.99;0.914;0.884;0.99;0.967;0.976	T	0.01078	-1.1459	10	0.19590	T	0.45	.	14.3289	0.66541	0.0:0.9205:0.0:0.0795	.	725;815;912;1032;1033;815;945	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	R	1033;725;945;815;725;815;1032;912	ENSP00000334928:G1033R;ENSP00000393028:G725R;ENSP00000448058:G945R;ENSP00000438927:G815R;ENSP00000447302:G725R;ENSP00000261266:G815R;ENSP00000448349:G1032R;ENSP00000446982:G912R	ENSP00000261266:G815R	G	-	1	0	0	PTPRB	69251880	69251880	1.000000	0.71417	0.967000	0.41034	0.981000	0.71138	4.846000	0.62860	2.832000	0.97577	0.655000	0.94253	GGG	0.318910		TCGA-HZ-A4BK-01A-11D-A26I-08	0.378	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1	0	0	1		33	2	2	1		1	1	31		31	31	1	1.790000	-2.614571	1	0.320000				11	11		387	383	0		0	0		1	0	31	0		0.000393	5.568229e-03	0	0	0	4	0	11	387
RIMBP2	23504	broad.mit.edu	37	12	130935797	130935797	+	Silent	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr12:130935797G>A	ENST00000261655.4	-	5	559	c.396C>T	c.(394-396)tcC>tcT	p.S132S	RIMBP2_ENST00000536002.1_Silent_p.S40S|RIMBP2_ENST00000535703.1_Silent_p.S40S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	132					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.S132S(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGGGCTTGGCGGACAGAGGCT	0.642																																						ENST00000261655.4	1.000000	0.910000	1	9.900000e-01	0.990000	0.994680	0.990000	1.000000																										1	Substitution - coding silent(1)	p.S132S(1)	NS(1)	96						c.(394-396)tcC>tcT		RIMS binding protein 2							59.0	57.0	58.0					12																	130935797		2203	4300	6503	SO:0001819	synonymous_variant	23504	3	121412	37				g.chr12:130935797G>A	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.396C>T	chr12.hg19:g.130935797G>A		0					RIMBP2_ENST00000536002.1_Silent_p.S40S|RIMBP2_ENST00000535703.1_Silent_p.S40S	p.S132S	NM_015347.4	NP_056162.4	0	1	1	2.064127	O15034	RIMB2_HUMAN		5	559	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	Q96ID2	Silent	SNP	ENST00000261655.4	1	1	hg19	c.396C>T	CCDS31925.1	1																																																																																								0.318910		TCGA-HZ-A4BK-01A-11D-A26I-08	0.642	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	1	0	1		2	2	2	0		0	0	76		76	76	1	1.790000	-3.256130	1	0.320000	NM_015347			72	71		319	314	1		1	0		0	0	76	0		1.000000	0	0	0	0	1	0	72	319
N6AMT2	221143	broad.mit.edu	37	13	21311867	21311867	+	Silent	SNP	A	A	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr13:21311867A>C	ENST00000382758.1	-	3	269	c.222T>G	c.(220-222)ggT>ggG	p.G74G	N6AMT2_ENST00000382754.4_Silent_p.G74G			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	74						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		CTCACCTGCCACCTTCTCCTA	0.413																																						ENST00000382758.1	1.000000	0.440000	1	6.100000e-01	0.820000	0.810502	0.820000	1.000000																										0				7						c.(220-222)ggT>ggG		N-6 adenine-specific DNA methyltransferase 2 (putative)							68.0	53.0	58.0					13																	21311867		2203	4300	6503	SO:0001819	synonymous_variant	221143	1	121412	32				g.chr13:21311867A>C	AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.222T>G	chr13.hg19:g.21311867A>C		0					N6AMT2_ENST00000382754.4_Silent_p.G74G	p.G74G			0	0	0	1.964807	Q8WVE0	N6MT2_HUMAN		3	269	-		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)	B5G4V1	Silent	SNP	ENST00000382758.1	0	0	hg19	c.222T>G	CCDS9293.1	0																																																																																								0.283305		TCGA-HZ-A4BK-01A-11D-A26I-08	0.413	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044083.1	1	0	0		2	2	2	0		0	0	10		10	10	1	1.790000	-8.168176	1	0.320000	NM_174928			10	10		62	62	1		1	0		0	0	10	0		0.997569	4.427470e-01	0	1	0	9	0	10	62
MYH7	4625	broad.mit.edu	37	14	23898246	23898246	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr14:23898246C>T	ENST00000355349.3	-	14	1487	c.1325G>A	c.(1324-1326)cGc>cAc	p.R442H		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	442	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGCATTGATGCGCGTCACCAT	0.557																																						ENST00000355349.3	1.000000	0.250000	4.700000e-01	3.100000e-01	0.370000	0.422203	0.370000	0.370000																										0				137	GRCh37	CM066922	MYH7	M		c.(1324-1326)cGc>cAc		myosin, heavy chain 7, cardiac muscle, beta							137.0	118.0	125.0					14																	23898246		2203	4300	6503	SO:0001583	missense	4625	2	121412	34				g.chr14:23898246C>T	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1325G>A	chr14.hg19:g.23898246C>T	ENSP00000347507:p.Arg442His	0						p.R442H	NM_000257.2	NP_000248.2	1	2	3	2.112338	P12883	MYH7_HUMAN		14	1487	-	all_cancers(95;2.54e-05)		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	1	1	hg19	c.1325G>A	CCDS9601.1	0	.	.	.	.	.	.	.	.	.	.	c	23.5	4.429693	0.83776	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.88741	-2.42	4.18	4.18	0.49190	4.18	4.18	0.49190	Myosin head, motor domain (2);	.	.	.	.	D	0.95513	0.8542	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96729	0.9538	9	0.87932	D	0	.	16.6862	0.85309	0.0:1.0:0.0:0.0	.	442	P12883	MYH7_HUMAN	H	442	ENSP00000347507:R442H	ENSP00000347507:R442H	R	-	2	0	0	MYH7	22968086	22968086	0.566000	0.26618	0.974000	0.42286	0.583000	0.36354	5.795000	0.69074	2.166000	0.68216	0.455000	0.32223	CGC	0.328594		TCGA-HZ-A4BK-01A-11D-A26I-08	0.557	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	1	0	1		2	2	2	0		0	0	85		85	84	1	1.790000	-2.920770	1	0.320000	NM_000257			30	30		479	472	0		1			0	0	85	0		1.000000	0	0	0	0	0	0	30	479
GFER	2671	broad.mit.edu	37	16	2034871	2034871	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr16:2034871G>T	ENST00000248114.6	+	2	388	c.382G>T	c.(382-384)Gac>Tac	p.D128Y	GFER_ENST00000567719.1_Missense_Mutation_p.D53Y|GFER_ENST00000569451.1_Intron|AC005606.14_ENST00000564438.1_lincRNA	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	128	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	ACAGCAGCAAGACATGGCCCA	0.567																																						ENST00000248114.6	0.590000	0.300000	5.100000e-01	3.600000e-01	0.430000	0.445613	0.430000	0.430000																										0				5						c.(382-384)Gac>Tac		growth factor, augmenter of liver regeneration	Flavin adenine dinucleotide(DB03147)						111.0	108.0	109.0					16																	2034871		2198	4300	6498	SO:0001583	missense	2671	0	0					g.chr16:2034871G>T	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.382G>T	chr16.hg19:g.2034871G>T	ENSP00000248114:p.Asp128Tyr	0					AC005606.14_ENST00000564438.1_lincRNA|GFER_ENST00000569451.1_Intron|GFER_ENST00000567719.1_Missense_Mutation_p.D53Y	p.D128Y	NM_005262.2	NP_005253.3	0	1	1	1.956849	P55789	ALR_HUMAN		2	388	+			Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	1	1	hg19	c.382G>T	CCDS32368.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.125726	0.94429	.	.	ENSG00000127554	ENST00000248114;ENST00000425414	T	0.64991	-0.13	4.52	4.52	0.55395	4.52	4.52	0.55395	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.050318	0.85682	D	0.000000	T	0.71264	0.3319	M	0.83483	2.645	0.58432	D	0.999999	P;P	0.46064	0.85;0.872	B;P	0.46237	0.258;0.508	T	0.78881	-0.2029	10	0.87932	D	0	-26.419	16.3969	0.83610	0.0:0.0:1.0:0.0	.	54;128	Q9UQK8;P55789	.;ALR_HUMAN	Y	128;48	ENSP00000248114:D128Y	ENSP00000248114:D128Y	D	+	1	0	0	GFER	1974872	1974872	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.026000	0.93700	2.330000	0.79161	0.609000	0.83330	GAC	0.272260		TCGA-HZ-A4BK-01A-11D-A26I-08	0.567	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	1	0	1		2	2	2	0		0	0	90		90	89	1	1.790000	-20.000000	1	0.320000	NM_005262			34	34		420	418	1		1	1		0	0	90	0		1.000000	9.812473e-01	0	12	0	68	0	34	420
CHST4	10164	broad.mit.edu	37	16	71570744	71570744	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr16:71570744C>T	ENST00000338482.5	+	3	507	c.164C>T	c.(163-165)tCt>tTt	p.S55F	RP11-510M2.5_ENST00000568523.1_RNA|CHST4_ENST00000539698.3_Missense_Mutation_p.S55F|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000572450.1_Missense_Mutation_p.S55F			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	55					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						CGCTCTGGCTCTTCTTTTGTG	0.567																																						ENST00000338482.5	1.000000	0.370000	1	4.500000e-01	0.540000	0.629360	0.540000	0.510000																										0				21						c.(163-165)tCt>tTt		carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4							127.0	121.0	123.0					16																	71570744		2198	4300	6498	SO:0001583	missense	10164	0	0					g.chr16:71570744C>T	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.164C>T	chr16.hg19:g.71570744C>T	ENSP00000341206:p.Ser55Phe	1					RP11-510M2.5_ENST00000568523.1_RNA|CHST4_ENST00000539698.3_Missense_Mutation_p.S55F|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000572450.1_Missense_Mutation_p.S55F	p.S55F			1	2	3	2.278718	Q8NCG5	CHST4_HUMAN		3	507	+			Q8IV46|Q9Y5R3	Missense_Mutation	SNP	ENST00000338482.5	1	1	hg19	c.164C>T	CCDS10902.1	0	.	.	.	.	.	.	.	.	.	.	C	29.4	5.007182	0.93287	.	.	ENSG00000140835	ENST00000338482;ENST00000539698	D;D	0.84298	-1.83;-1.83	6.0	6.0	0.97389	6.0	6.0	0.97389	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.94798	0.8320	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95535	0.8607	10	0.87932	D	0	-16.064	17.9887	0.89162	0.0:1.0:0.0:0.0	.	55	Q8NCG5	CHST4_HUMAN	F	55	ENSP00000341206:S55F;ENSP00000441204:S55F	ENSP00000341206:S55F	S	+	2	0	0	CHST4	70128245	70128245	1.000000	0.71417	0.960000	0.40013	0.968000	0.65278	7.794000	0.85869	2.848000	0.98002	0.655000	0.94253	TCT	0.384058		TCGA-HZ-A4BK-01A-11D-A26I-08	0.567	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	1	0	1		2	2	2	0		0	0	51		51	51	1	1.790000	-20.000000	1	0.320000	NM_005769			38	38		471	464	0		1	1		0	0	51	0		1.000000	9.994422e-01	0	5	0	135	0	38	471
KRT37	8688	broad.mit.edu	37	17	39577780	39577780	+	Silent	SNP	G	G	C	rs372151417		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr17:39577780G>C	ENST00000225550.3	-	6	1079	c.1080C>G	c.(1078-1080)gcC>gcG	p.A360A	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	360	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				TCTGCATCTGGGCCAGCTCTG	0.572																																						ENST00000225550.3	1.000000	0.740000	1	8.600000e-01	0.990000	0.948601	0.990000	1.000000																										0				25						c.(1078-1080)gcC>gcG		keratin 37							67.0	64.0	65.0					17																	39577780		2203	4300	6503	SO:0001819	synonymous_variant	8688	0	0					g.chr17:39577780G>C	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.1080C>G	chr17.hg19:g.39577780G>C		0					AC003958.2_ENST00000432258.1_RNA	p.A360A	NM_003770.4	NP_003761.3	0	1	1	1.953449	O76014	KRT37_HUMAN		6	1079	-		Breast(137;0.000496)		Silent	SNP	ENST00000225550.3	1	1	hg19	c.1080C>G	CCDS32653.1	1																																																																																								0.265976		TCGA-HZ-A4BK-01A-11D-A26I-08	0.572	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	1	0	1		2	2	2	0		0	0	32		32	30	1	1.790000	-3.226081	1	0.320000	NM_003770			40	39		190	190	1		1			0	0	32	0		1.000000	0	0	0	0	0	0	40	190
DHX8	1659	broad.mit.edu	37	17	41566830	41566830	+	Silent	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr17:41566830C>T	ENST00000262415.3	+	2	234	c.162C>T	c.(160-162)atC>atT	p.I54I	DHX8_ENST00000540306.1_Silent_p.I54I	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	54					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		AATTTGTGATCAGTCTTGCTG	0.333																																					NSCLC(56;1548 1661 49258 49987)	ENST00000262415.3	1.000000	0.620000	1	7.100000e-01	0.820000	0.843197	0.820000	0.790000																										0				42						c.(160-162)atC>atT		DEAH (Asp-Glu-Ala-His) box polypeptide 8							100.0	104.0	103.0					17																	41566830		2202	4300	6502	SO:0001819	synonymous_variant	1659	0	0					g.chr17:41566830C>T	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.162C>T	chr17.hg19:g.41566830C>T		1					DHX8_ENST00000540306.1_Silent_p.I54I	p.I54I	NM_004941.1	NP_004932.1	1	2	3	2.297785	Q14562	DHX8_HUMAN		2	234	+		Breast(137;0.00908)		Silent	SNP	ENST00000262415.3	1	1	hg19	c.162C>T	CCDS11464.1	0																																																																																								0.390244		TCGA-HZ-A4BK-01A-11D-A26I-08	0.333	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1	1	0	1		2	2	2	0		0	0	33		33	33	1	1.790000	-19.649920	1	0.320000				55	55		425	418	1		1	1		0	0	33	0		1.000000	9.943996e-01	0	34	0	29	0	55	425
TP53	7157	broad.mit.edu	37	17	7578479	7578479	+	Missense_Mutation	SNP	G	G	T	rs28934874|rs137852790|rs137852791		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr17:7578479G>T	ENST00000269305.4	-	5	640	c.451C>A	c.(451-453)Ccc>Acc	p.P151T	TP53_ENST00000455263.2_Missense_Mutation_p.P151T|TP53_ENST00000445888.2_Missense_Mutation_p.P151T|TP53_ENST00000359597.4_Missense_Mutation_p.P151T|TP53_ENST00000420246.2_Missense_Mutation_p.P151T|TP53_ENST00000413465.2_Missense_Mutation_p.P151T|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151S(68)|p.P151T(16)|p.P151A(13)|p.P152fs*18(9)|p.0?(8)|p.T150fs*16(6)|p.P151fs*30(6)|p.?(5)|p.P58A(2)|p.P58S(2)|p.P19A(2)|p.P19S(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.P58T(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.P19T(1)|p.P152fs*14(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGGCGGGGGTGTGGAATCA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.650000	9.600000e-01	7.500000e-01	0.850000	0.856571	0.850000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		156	Substitution - Missense(107)|Deletion - Frameshift(23)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(6)|Unknown(5)	p.P151S(68)|p.P151T(16)|p.P151A(13)|p.P152fs*18(9)|p.0?(8)|p.T150fs*16(6)|p.P151fs*30(6)|p.?(5)|p.P58A(2)|p.P58S(2)|p.P19A(2)|p.P19S(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.P58T(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.P19T(1)|p.P152fs*14(1)|p.T18fs*16(1)|p.T150_P151delTP(1)	upper_aerodigestive_tract(20)|large_intestine(17)|ovary(16)|lung(15)|oesophagus(12)|endometrium(11)|stomach(9)|breast(9)|central_nervous_system(7)|liver(7)|skin(7)|haematopoietic_and_lymphoid_tissue(5)|soft_tissue(4)|urinary_tract(4)|prostate(4)|bone(4)|vulva(2)|pancreas(2)|biliary_tract(1)	24185	GRCh37	CM012662|CM941326	TP53	M	rs28934874	c.(451-453)Ccc>Acc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						55.0	55.0	55.0					17																	7578479		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578479G>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.451C>A	chr17.hg19:g.7578479G>T	ENSP00000269305:p.Pro151Thr	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.P151T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P151T|TP53_ENST00000420246.2_Missense_Mutation_p.P151T|TP53_ENST00000359597.4_Missense_Mutation_p.P151T|TP53_ENST00000413465.2_Missense_Mutation_p.P151T	p.P151T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.793607	P04637	P53_HUMAN		5	640	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.451C>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136405	0.56936	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99884	-7.49;-7.49;-7.49;-7.49;-7.49;-7.49;-7.49;-7.49;-7.49	5.59	5.59	0.84812	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99894	0.9949	M	0.87038	2.855	0.54753	D	0.999983	D;P;D;D;P;P;D	0.89917	0.999;0.711;0.994;0.982;0.882;0.755;1.0	D;P;D;D;P;P;D	0.97110	0.981;0.749;0.961;0.954;0.736;0.837;1.0	D	0.96419	0.9310	10	0.87932	D	0	-14.1156	17.4784	0.87667	0.0:0.0:1.0:0.0	rs28934874	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151T;ENSP00000352610:P151T;ENSP00000269305:P151T;ENSP00000398846:P151T;ENSP00000391127:P151T;ENSP00000391478:P151T;ENSP00000425104:P19T;ENSP00000423862:P58T;ENSP00000424104:P151T	ENSP00000269305:P151T	P	-	1	0	0	TP53	7519204	7519204	1.000000	0.71417	0.971000	0.41717	0.067000	0.16453	7.823000	0.86660	2.804000	0.96469	0.655000	0.94253	CCC	0.193548		TCGA-HZ-A4BK-01A-11D-A26I-08	0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	5	0		0	0	62		62	62	1	1.790000	-19.999960	1	0.320000	NM_000546			45	44		222	216	1		1	1	1	0	1	62	1746		1.000000	9.998693e-01	1	31	282	38	1097	45	222
PLEKHM1	9842	broad.mit.edu	37	17	43531559	43531559	+	Silent	SNP	G	G	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr17:43531559G>C	ENST00000430334.3	-	7	1792	c.1659C>G	c.(1657-1659)ctC>ctG	p.L553L	AC091132.1_ENST00000433601.1_RNA|PLEKHM1_ENST00000421073.2_Silent_p.L464L	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	553	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GCTCGCAGAAGAGCTCCTTCC	0.627																																						ENST00000430334.3	1.000000	0.810000	1	9.900000e-01	0.990000	0.984408	0.990000	1.000000																										0				26						c.(1657-1659)ctC>ctG		pleckstrin homology domain containing, family M (with RUN domain) member 1							18.0	16.0	17.0					17																	43531559		2202	4297	6499	SO:0001819	synonymous_variant	9842	0	0					g.chr17:43531559G>C	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.1659C>G	chr17.hg19:g.43531559G>C		0					PLEKHM1_ENST00000421073.2_Silent_p.L464L|AC091132.1_ENST00000433601.1_RNA	p.L553L	NM_014798.2	NP_055613.1	0	1	1	1.958797	Q9Y4G2	PKHM1_HUMAN		7	1792	-	Renal(3;0.0405)		Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Silent	SNP	ENST00000430334.3	1	1	hg19	c.1659C>G	CCDS32671.1	1																																																																																								0.288107		TCGA-HZ-A4BK-01A-11D-A26I-08	0.627	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	1	0	1		2	2	2	0		0	0	21		21	21	1	1.790000	-20.000000	1	0.320000	NM_014798			25	25		99	97	1		1	1		0	0	21	0		1.000000	9.977731e-01	0	13	0	28	0	25	99
ZSWIM4	65249	broad.mit.edu	37	19	13915898	13915898	+	Silent	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr19:13915898G>A	ENST00000254323.2	+	3	837	c.648G>A	c.(646-648)ctG>ctA	p.L216L	ZSWIM4_ENST00000440752.2_5'UTR	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	216							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CTGAGGTGCTGCCCACTGCTC	0.622											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000254323.2	1.000000	0.720000	1	8.500000e-01	0.990000	0.947141	0.990000	1.000000																										0				27						c.(646-648)ctG>ctA		zinc finger, SWIM-type containing 4							45.0	39.0	41.0					19																	13915898		2203	4300	6503	SO:0001819	synonymous_variant	65249	0	0					g.chr19:13915898G>A	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.648G>A	chr19.hg19:g.13915898G>A		0		OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	691	ZSWIM4_ENST00000440752.2_5'UTR	p.L216L	NM_023072.2	NP_075560.2	0	0	0	2.052404	Q9H7M6	ZSWM4_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)	3	837	+				Silent	SNP	ENST00000254323.2	1	1	hg19	c.648G>A	CCDS32924.1	1																																																																																								0.315620		TCGA-HZ-A4BK-01A-11D-A26I-08	0.622	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	1	0	1		2	2	2	0		0	0	51		51	49	1	1.790000	-20.000000	1	0.320000	XM_031342			36	36		186	186	1		1	1		0	0	51	0		1.000000	7.260347e-01	0	5	0	10	0	36	186
PKN1	5585	broad.mit.edu	37	19	14581423	14581423	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr19:14581423G>A	ENST00000242783.6	+	20	2638	c.2473G>A	c.(2473-2475)Gac>Aac	p.D825N	PKN1_ENST00000342216.4_Missense_Mutation_p.D831N	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	825	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GGAGGTCTTCGACAGCATCGT	0.672																																					NSCLC(185;2539 2965 10733 52867)	ENST00000242783.6	0.990000	0.280000	7.900000e-01	4.100000e-01	0.580000	0.602676	0.580000	1.000000																										0				31						c.(2473-2475)Gac>Aac		protein kinase N1							20.0	24.0	22.0					19																	14581423		1995	4150	6145	SO:0001583	missense	5585	0	0					g.chr19:14581423G>A	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2473G>A	chr19.hg19:g.14581423G>A	ENSP00000242783:p.Asp825Asn	0					PKN1_ENST00000342216.4_Missense_Mutation_p.D831N	p.D825N	NM_002741.3	NP_002732.3	0	0	0	2.052404	Q16512	PKN1_HUMAN		20	2638	+			A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	0	1	hg19	c.2473G>A	CCDS42513.1	0	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392493	0.83011	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.53206	0.63;0.63	4.18	4.18	0.49190	4.18	4.18	0.49190	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000001	T	0.55194	0.1905	N	0.25992	0.78	0.47276	D	0.999378	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.60757	-0.7200	10	0.87932	D	0	-20.007	14.0135	0.64511	0.0:0.0:1.0:0.0	.	831;825	Q16512-2;Q16512	.;PKN1_HUMAN	N	825;831	ENSP00000242783:D825N;ENSP00000343325:D831N	ENSP00000242783:D825N	D	+	1	0	0	PKN1	14442423	14442423	1.000000	0.71417	0.977000	0.42913	0.569000	0.35902	9.037000	0.93765	2.177000	0.69029	0.555000	0.69702	GAC	0.315620		TCGA-HZ-A4BK-01A-11D-A26I-08	0.672	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	1	0	1		2	2	2	0		0	0	17		17	17	1	1.790000	-13.536980	1	0.320000	NM_002741, NM_213560			8	8		80	80	0		1	1		0	0	17	0		0.990495	9.999999e-01	0	32	0	567	0	8	80
ZNF681	148213	broad.mit.edu	37	19	23927097	23927097	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr19:23927097C>G	ENST00000402377.3	-	4	1396	c.1255G>C	c.(1255-1257)Gaa>Caa	p.E419Q	ZNF681_ENST00000395385.3_Missense_Mutation_p.E350Q	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TAGGGTTTTTCTCCAGTATGA	0.368																																						ENST00000402377.3	0.550000	0.220000	4.600000e-01	2.800000e-01	0.360000	0.376120	0.360000	0.360000																										0				21						c.(1255-1257)Gaa>Caa		zinc finger protein 681							70.0	74.0	73.0					19																	23927097		2203	4300	6503	SO:0001583	missense	148213	0	0					g.chr19:23927097C>G	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1255G>C	chr19.hg19:g.23927097C>G	ENSP00000384000:p.Glu419Gln	0					ZNF681_ENST00000395385.3_Missense_Mutation_p.E350Q	p.E419Q	NM_138286.2	NP_612143.2	0	0	0	2.052404	Q96N22	ZN681_HUMAN		4	1396	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	1	1	hg19	c.1255G>C	CCDS12414.2	0	.	.	.	.	.	.	.	.	.	.	.	10.28	1.307625	0.23821	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.25912	1.77;1.77	1.51	1.51	0.23008	1.51	1.51	0.23008	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42988	0.1227	L	0.56769	1.78	0.23820	N	0.996755	D	0.89917	1.0	D	0.83275	0.996	T	0.11916	-1.0568	9	0.66056	D	0.02	.	8.4797	0.33034	0.0:1.0:0.0:0.0	.	419	Q96N22	ZN681_HUMAN	Q	419;350	ENSP00000384000:E419Q;ENSP00000378783:E350Q	ENSP00000378783:E350Q	E	-	1	0	0	ZNF681	23718937	23718937	0.277000	0.24220	0.053000	0.19242	0.038000	0.13279	2.609000	0.46317	0.798000	0.33994	0.313000	0.20887	GAA	0.315620		TCGA-HZ-A4BK-01A-11D-A26I-08	0.368	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	1	0	1		2	2	2	0		0	0	26		26	26	1	1.790000	-19.547280	1	0.320000	NM_138286			17	17		276	274	0		1	0		0	0	26	0		0.999967	0	0	0	0	1	0	17	276
PSG7	5676	broad.mit.edu	37	19	43430713	43430713	+	RNA	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr19:43430713G>A	ENST00000406070.2	-	0	961				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TTTTCAATGCGTCGCTTTACC	0.493																																						ENST00000406070.2	1.000000	0.420000	5.800000e-01	4.600000e-01	0.500000	0.569502	0.500000	0.510000																										0												pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)							237.0	219.0	225.0					19																	43430713		2202	4284	6486			5676	0	0					g.chr19:43430713G>A			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		chr19.hg19:g.43430713G>A		0					PSG7_ENST00000446844.3_RNA		NM_002783.2	NP_002774.2	2	2	4	2.170201	Q13046	PSG7_HUMAN		0	961	-		Prostate(69;0.00682)	Q15232	RNA	SNP	ENST00000406070.2	1	1	hg19			0																																																																																								0.353120		TCGA-HZ-A4BK-01A-11D-A26I-08	0.493	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	0	0	1		2	2	2	0		0	0	286		286	286	1	1.790000	-20.000000	1	0.320000	NM_001206650			162	122		1944	1517	0		1			0	0	286	0		1.000000	0	0	0	0	0	0	162	1944
COL11A1	1301	broad.mit.edu	37	1	103453235	103453235	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:103453235G>C	ENST00000370096.3	-	30	2768	c.2456C>G	c.(2455-2457)gCa>gGa	p.A819G	COL11A1_ENST00000353414.4_Missense_Mutation_p.A780G|COL11A1_ENST00000512756.1_Missense_Mutation_p.A703G|COL11A1_ENST00000358392.2_Missense_Mutation_p.A831G	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	819	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGTTGGGCCTGCTCGACCTTT	0.473																																						ENST00000370096.3	1.000000	0.290000	5.500000e-01	3.600000e-01	0.440000	0.476370	0.440000	0.430000																										0				258						c.(2455-2457)gCa>gGa		collagen, type XI, alpha 1							92.0	87.0	89.0					1																	103453235		2203	4300	6503	SO:0001583	missense	1301	1	121392	30				g.chr1:103453235G>C	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2456C>G	chr1.hg19:g.103453235G>C	ENSP00000359114:p.Ala819Gly	0					COL11A1_ENST00000512756.1_Missense_Mutation_p.A703G|COL11A1_ENST00000358392.2_Missense_Mutation_p.A831G|COL11A1_ENST00000353414.4_Missense_Mutation_p.A780G	p.A819G	NM_001854.3	NP_001845.3	1	2	3	2.108766	P12107	COBA1_HUMAN		30	2768	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	1	1	hg19	c.2456C>G	CCDS778.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.34|11.34	1.608907|1.608907	0.28623|0.28623	.|.	.|.	ENSG00000060718|ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756|ENST00000370090	D;D;D;D|.	0.83755|.	-1.76;-1.76;-1.76;-1.76|.	4.39|4.39	4.39|4.39	0.52855|0.52855	4.39|4.39	4.39|4.39	0.52855|0.52855	.|.	0.140030|.	0.47455|.	D|.	0.000236|.	T|T	0.37758|0.37758	0.1015|0.1015	N|N	0.25332|0.25332	0.735|0.735	0.48511|0.48511	D|D	0.999661|0.999661	B;B;B;B|B	0.25441|0.13145	0.126;0.073;0.073;0.043|0.007	B;B;B;B|B	0.28784|0.14023	0.094;0.088;0.088;0.04|0.01	T|T	0.24261|0.24261	-1.0165|-1.0165	10|8	0.22706|0.39692	T|T	0.39|0.17	.|.	17.507|17.507	0.87748|0.87748	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	703;780;831;819|34	E9PCU0;P12107-3;P12107-2;P12107|F5H5Z5	.;.;.;COBA1_HUMAN|.	G|E	819;831;780;703|34	ENSP00000359114:A819G;ENSP00000351163:A831G;ENSP00000302551:A780G;ENSP00000426533:A703G|.	ENSP00000302551:A780G|ENSP00000359108:Q34E	A|Q	-|-	2|1	0|0	0|0	COL11A1|COL11A1	103225823|103225823	103225823|103225823	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.751000|0.751000	0.42716|0.42716	7.157000|7.157000	0.77461|0.77461	2.417000|2.417000	0.82017|0.82017	0.460000|0.460000	0.39030|0.39030	GCA|CAG	0.327532		TCGA-HZ-A4BK-01A-11D-A26I-08	0.473	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	1	0	1		2	2	2	0		0	0	57		57	56	1	1.790000	-3.142687	1	0.320000	NM_080630			26	26		353	347	0		1	0		0	0	57	0		1.000000	6.270098e-01	0	0	0	30	0	26	353
CPSF3L	54973	broad.mit.edu	37	1	1254756	1254756	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:1254756C>T	ENST00000435064.1	-	4	431	c.349G>A	c.(349-351)Gag>Aag	p.E117K	CPSF3L_ENST00000419704.1_Intron|CPSF3L_ENST00000411962.1_Intron|CPSF3L_ENST00000545578.1_Missense_Mutation_p.E88K|CPSF3L_ENST00000540437.1_Missense_Mutation_p.E123K|CPSF3L_ENST00000450926.2_Missense_Mutation_p.E117K|RP5-890O3.9_ENST00000444968.1_RNA|CPSF3L_ENST00000462432.1_5'Flank|CPSF3L_ENST00000421495.2_Intron	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor 3-like	117					snRNA processing (GO:0016180)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|integrator complex (GO:0032039)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(3)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		AAGTTGGCCTCGCCCTTCTTG	0.597																																						ENST00000435064.1	1.000000	0.980000	1	9.900000e-01	0.990000	0.999070	0.990000	1.000000																										0				13						c.(349-351)Gag>Aag		cleavage and polyadenylation specific factor 3-like							201.0	184.0	190.0					1																	1254756		2203	4300	6503	SO:0001583	missense	54973	1	121406	15				g.chr1:1254756C>T	AL136813	CCDS21.1, CCDS57959.1, CCDS57960.1, CCDS57961.1, CCDS72678.1	1p36.33	2008-02-05			ENSG00000127054	ENSG00000127054			26052	protein-coding gene	gene with protein product	"""integrator complex subunit 11"""	611354				15684398, 16239144	Standard	NM_001256456		Approved	FLJ20542, RC-68, CPSF73L, INT11, INTS11	uc001aee.2	Q5TA45	OTTHUMG00000003330	ENST00000435064.1:c.349G>A	chr1.hg19:g.1254756C>T	ENSP00000413493:p.Glu117Lys	0					CPSF3L_ENST00000540437.1_Missense_Mutation_p.E123K|CPSF3L_ENST00000450926.2_Missense_Mutation_p.E117K|CPSF3L_ENST00000545578.1_Missense_Mutation_p.E88K|CPSF3L_ENST00000411962.1_Intron|CPSF3L_ENST00000462432.1_5'Flank|CPSF3L_ENST00000421495.2_Intron|CPSF3L_ENST00000419704.1_Intron|RP5-890O3.9_ENST00000444968.1_RNA	p.E117K	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	0	1	1	1.995128	Q5TA45	INT11_HUMAN		4	431	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	A8K5S2|B3KPR3|B4DM87|G3V1S5|Q5TA46|Q5TA48|Q5TA52|Q5TA53|Q5TA54|Q7L3D7|Q96HY1|Q9BW36|Q9H0F9|Q9H8R5|Q9HAA6|Q9NWX9	Missense_Mutation	SNP	ENST00000435064.1	1	1	hg19	c.349G>A	CCDS21.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.371699	0.82573	.	.	ENSG00000127054	ENST00000435064;ENST00000294579;ENST00000540437;ENST00000450926;ENST00000545578;ENST00000434694;ENST00000527719;ENST00000530031;ENST00000534345	T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.85;0.8;0.87;0.86;0.8	4.61	4.61	0.57282	4.61	4.61	0.57282	Beta-lactamase-like (2);	0.112509	0.64402	D	0.000012	T	0.56804	0.2010	L	0.55017	1.72	0.80722	D	1	P;D;P;P	0.64830	0.541;0.994;0.541;0.596	B;P;B;B	0.62491	0.197;0.903;0.197;0.201	T	0.53165	-0.8477	10	0.02654	T	1	-40.1331	17.6427	0.88141	0.0:1.0:0.0:0.0	.	117;136;123;117	Q5TA45-3;Q5TA51;G3V1S5;Q5TA45	.;.;.;INT11_HUMAN	K	117;129;123;117;88;117;123;164;118	ENSP00000413493:E117K;ENSP00000445001:E123K;ENSP00000392848:E117K;ENSP00000444672:E88K;ENSP00000411233:E117K;ENSP00000436743:E123K;ENSP00000432009:E164K;ENSP00000435772:E118K	ENSP00000294579:E129K	E	-	1	0	0	CPSF3L	1244619	1244619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.580000	0.82523	2.399000	0.81585	0.561000	0.74099	GAG	0.286913		TCGA-HZ-A4BK-01A-11D-A26I-08	0.597	CPSF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009360.2	1	0	1		2	2	2	0		0	0	188		188	188	1	1.790000	-3.105670	1	0.320000	NM_017871			204	202		877	873	1		1	1		0	0	188	0		1.000000	1	0	40	0	99	0	204	877
PTCHD2	57540	broad.mit.edu	37	1	11595630	11595630	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:11595630G>A	ENST00000294484.6	+	20	3883	c.3745G>A	c.(3745-3747)Gtg>Atg	p.V1249M	PTCHD2_ENST00000304391.6_Missense_Mutation_p.R135H|PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1249M	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1249					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGGCTCCTCCGTGGATTACTG	0.647																																						ENST00000294484.6	0.550000	0.270000	4.800000e-01	3.300000e-01	0.400000	0.413711	0.400000	0.400000																										0				76						c.(3745-3747)Gtg>Atg		patched domain containing 2							68.0	80.0	76.0					1																	11595630		2133	4230	6363	SO:0001583	missense	57540	0	0					g.chr1:11595630G>A	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3745G>A	chr1.hg19:g.11595630G>A	ENSP00000294484:p.Val1249Met	0					PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1249M|PTCHD2_ENST00000304391.6_Missense_Mutation_p.R135H	p.V1249M	NM_020780.1	NP_065831.1	0	1	1	1.957420	Q9P2K9	PTHD2_HUMAN		20	3883	+	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	1	1	hg19	c.3745G>A	CCDS41247.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.12|18.12	3.552516|3.552516	0.65425|0.65425	.|.	.|.	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.94457	.|-3.43;-2.84	5.54|5.54	5.54|5.54	0.83059|0.83059	5.54|5.54	5.54|5.54	0.83059|0.83059	.|Membrane transport protein, MMPL type (1);	.|0.000000	.|0.64402	.|D	.|0.000003	D|D	0.97334|0.97334	0.9128|0.9128	M|M	0.81802|0.81802	2.56|2.56	0.48185|0.48185	D|D	0.999605|0.999605	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.97740|0.97740	1.0208|1.0208	6|10	0.87932|0.72032	D|D	0|0.01	-24.6787|-24.6787	18.4583|18.4583	0.90729|0.90729	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1249	.|Q9P2K9	.|PTHD2_HUMAN	H|M	135|1249	.|ENSP00000294484:V1249M;ENSP00000374226:V1249M	ENSP00000303400:R135H|ENSP00000294484:V1249M	R|V	+|+	2|1	0|0	0|0	PTCHD2|PTCHD2	11518217|11518217	11518217|11518217	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.766000|0.766000	0.43426|0.43426	7.578000|7.578000	0.82498|0.82498	2.604000|2.604000	0.88044|0.88044	0.655000|0.655000	0.94253|0.94253	CGT|GTG	0.260870		TCGA-HZ-A4BK-01A-11D-A26I-08	0.647	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	1	0	1		2	2	2	0		0	0	76		76	76	1	1.790000	-20.000000	1	0.320000	XM_052561			30	30		396	390	0		1			0	0	76	0		1.000000	0	0	0	0	0	0	30	396
NTNG1	22854	broad.mit.edu	37	1	108023321	108023321	+	Silent	SNP	G	G	A	rs375220736		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:108023321G>A	ENST00000370068.1	+	8	2325	c.1479G>A	c.(1477-1479)acG>acA	p.T493T	NTNG1_ENST00000370066.1_Silent_p.T434T|NTNG1_ENST00000370072.3_Silent_p.T448T|NTNG1_ENST00000370070.2_Silent_p.T414T|NTNG1_ENST00000370074.4_Silent_p.T392T|NTNG1_ENST00000370067.1_Silent_p.T414T|NTNG1_ENST00000370061.3_Silent_p.T459T|NTNG1_ENST00000370073.2_Silent_p.T493T|NTNG1_ENST00000370065.1_Silent_p.T448T|NTNG1_ENST00000370071.2_Silent_p.T434T|NTNG1_ENST00000542803.1_Silent_p.T493T			Q9Y2I2	NTNG1_HUMAN	netrin G1	493					axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CCGCATACACGGGCATCCTCT	0.687																																						ENST00000370068.1	1.000000	0.200000	5.900000e-01	2.900000e-01	0.410000	0.455991	0.410000	0.390000																										0				37						c.(1477-1479)acG>acA		netrin G1							24.0	27.0	26.0					1																	108023321		2202	4299	6501	SO:0001819	synonymous_variant	22854	1	121328	31				g.chr1:108023321G>A	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1479G>A	chr1.hg19:g.108023321G>A		0					NTNG1_ENST00000370070.2_Silent_p.T414T|NTNG1_ENST00000542803.1_Silent_p.T493T|NTNG1_ENST00000370073.2_Silent_p.T493T|NTNG1_ENST00000370066.1_Silent_p.T434T|NTNG1_ENST00000370074.4_Silent_p.T392T|NTNG1_ENST00000370065.1_Silent_p.T448T|NTNG1_ENST00000370072.3_Silent_p.T448T|NTNG1_ENST00000370067.1_Silent_p.T414T|NTNG1_ENST00000370061.3_Silent_p.T459T|NTNG1_ENST00000370071.2_Silent_p.T434T	p.T493T			1	2	3	2.108766	Q9Y2I2	NTNG1_HUMAN		8	2325	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	ENST00000370068.1	1	1	hg19	c.1479G>A	CCDS44180.1	0																																																																																								0.327532		TCGA-HZ-A4BK-01A-11D-A26I-08	0.687	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	1	0	1		2	2	2	0		0	0	26		26	25	1	1.790000	-2.750477	1	0.320000	NM_014917			9	9		136	136	0		1	0		0	0	26	0		0.994688	0	0	0	0	1	0	9	136
PI4KB	5298	broad.mit.edu	37	1	151288137	151288137	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:151288137C>T	ENST00000368873.1	-	2	989	c.821G>A	c.(820-822)cGc>cAc	p.R274H	PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000368874.4_Missense_Mutation_p.R274H|PI4KB_ENST00000368872.1_Missense_Mutation_p.R274H|PI4KB_ENST00000271657.5_Missense_Mutation_p.R286H|PI4KB_ENST00000368875.2_Missense_Mutation_p.R286H			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	274					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGACTTAGAGCGCTGGTGAGT	0.547																																					Colon(154;765 1838 9854 28443 37492)	ENST00000368873.1	0.710000	0.370000	6.100000e-01	4.400000e-01	0.520000	0.530096	0.520000	0.520000																										0				27						c.(820-822)cGc>cAc		phosphatidylinositol 4-kinase, catalytic, beta							119.0	109.0	113.0					1																	151288137		2203	4300	6503	SO:0001583	missense	5298	1	121412	32				g.chr1:151288137C>T	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.821G>A	chr1.hg19:g.151288137C>T	ENSP00000357867:p.Arg274His	0					PI4KB_ENST00000271657.5_Missense_Mutation_p.R286H|PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000368874.4_Missense_Mutation_p.R274H|PI4KB_ENST00000368875.2_Missense_Mutation_p.R286H|PI4KB_ENST00000368872.1_Missense_Mutation_p.R274H	p.R274H			1	2	3	2.076026	Q9UBF8	PI4KB_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)	2	989	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	1	1	hg19	c.821G>A		0	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755904	0.89843	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000368872;ENST00000438243	T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64	5.11	5.11	0.69529	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.81049	0.4742	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.994;1.0	T	0.82548	-0.0402	10	0.72032	D	0.01	-14.1955	17.2599	0.87067	0.0:1.0:0.0:0.0	.	274;274;274	E9PIH4;Q9UBF8;Q9UBF8-2	.;PI4KB_HUMAN;.	H	274;286;286;274;274;274	ENSP00000357868:R274H;ENSP00000357869:R286H;ENSP00000271657:R286H;ENSP00000357867:R274H;ENSP00000357866:R274H;ENSP00000394719:R274H	ENSP00000271657:R286H	R	-	2	0	0	PI4KB	149554761	149554761	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.567000	0.82357	2.654000	0.90174	0.561000	0.74099	CGC	0.321086		TCGA-HZ-A4BK-01A-11D-A26I-08	0.547	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	1	0	1		2	2	2	0		0	0	58		58	58	1	1.790000	-10.206590	1	0.320000	NM_002651			35	35		386	379	1		1	1		0	0	58	0		1.000000	9.840119e-01	0	8	0	66	0	35	386
RORC	6097	broad.mit.edu	37	1	151789160	151789160	+	Missense_Mutation	SNP	G	G	A	rs546157871		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:151789160G>A	ENST00000318247.6	-	4	385	c.278C>T	c.(277-279)gCg>gTg	p.A93V	RORC_ENST00000356728.6_Missense_Mutation_p.A72V|RORC_ENST00000392697.3_Missense_Mutation_p.A147V|RORC_ENST00000480719.1_5'Flank	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	93					adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CATGCCCAGCGCCAGGCATTT	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18073	0.0		0.0	False		,,,				2504	0.0					ENST00000318247.6	1.000000	0.810000	1	9.900000e-01	0.990000	0.987193	0.990000	1.000000																										0				19						c.(277-279)gCg>gTg		RAR-related orphan receptor C							33.0	30.0	31.0					1																	151789160		2203	4300	6503	SO:0001583	missense	6097	2	121370	21				g.chr1:151789160G>A	U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.278C>T	chr1.hg19:g.151789160G>A	ENSP00000327025:p.Ala93Val	0					RORC_ENST00000480719.1_5'Flank|RORC_ENST00000392697.3_Missense_Mutation_p.A147V|RORC_ENST00000356728.6_Missense_Mutation_p.A72V	p.A93V	NM_005060.3	NP_005051.2	1	2	3	2.076026	P51449	RORG_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)	4	385	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	ENST00000318247.6	0	1	hg19	c.278C>T	CCDS1004.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.486069	0.96323	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.97378	-4.36;-4.36;-4.36	5.24	5.24	0.73138	5.24	5.24	0.73138	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (4);	0.174286	0.35235	U	0.003342	D	0.98150	0.9389	M	0.78223	2.4	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.75484	0.972;0.933;0.981;0.986	D	0.99342	1.0912	10	0.87932	D	0	.	16.3321	0.83039	0.0:0.0:1.0:0.0	.	93;147;93;72	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	V	72;147;93	ENSP00000349164:A72V;ENSP00000376461:A147V;ENSP00000327025:A93V	ENSP00000327025:A93V	A	-	2	0	0	RORC	150055784	150055784	1.000000	0.71417	0.949000	0.38748	0.988000	0.76386	4.057000	0.57455	2.436000	0.82500	0.563000	0.77884	GCG	0.321086		TCGA-HZ-A4BK-01A-11D-A26I-08	0.647	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036626.1	1	0	1		2	2	2	0		0	0	10		10	10	1	1.790000	-20.000000	1	0.320000				14	14		50	48	1		1	1		0	0	10	0		0.999835	9.152741e-01	0	4	0	14	0	14	50
F5	2153	broad.mit.edu	37	1	169528443	169528443	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:169528443C>A	ENST00000367797.3	-	5	879	c.678G>T	c.(676-678)caG>caT	p.Q226H	F5_ENST00000367796.3_Missense_Mutation_p.Q226H|F5_ENST00000546081.1_Missense_Mutation_p.Q89H	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	226	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGGATGATGACTGGCTCCAGC	0.433																																						ENST00000367797.3	1.000000	0.770000	1	8.600000e-01	0.960000	0.940918	0.960000	1.000000																										0				128						c.(676-678)caG>caT		coagulation factor V (proaccelerin, labile factor)	ART-123(DB05777)|Drotrecogin alfa(DB00055)						175.0	139.0	151.0					1																	169528443		2203	4300	6503	SO:0001583	missense	2153	0	0					g.chr1:169528443C>A	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.678G>T	chr1.hg19:g.169528443C>A	ENSP00000356771:p.Gln226His	0					F5_ENST00000367796.3_Missense_Mutation_p.Q226H|F5_ENST00000546081.1_Missense_Mutation_p.Q89H	p.Q226H	NM_000130.4	NP_000121	1	2	3	2.092050	P12259	FA5_HUMAN		5	879	-	all_hematologic(923;0.208)		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	1	1	hg19	c.678G>T	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909285	0.33721	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.99758	-6.65;-6.65;-6.65	5.95	-2.03	0.07365	5.95	-2.03	0.07365	Cupredoxin (2);	1.478620	0.03581	N	0.230089	D	0.98128	0.9382	M	0.72118	2.19	0.32970	D	0.522265	P	0.38642	0.641	B	0.38500	0.275	D	0.99973	1.2094	9	0.41790	T	0.15	0.4292	0.4687	0.00528	0.2015:0.285:0.1978:0.3157	.	226	P12259	FA5_HUMAN	H	226;226;89	ENSP00000356771:Q226H;ENSP00000356770:Q226H;ENSP00000439664:Q89H	ENSP00000356770:Q226H	Q	-	3	2	2	F5	167795067	167795067	0.000000	0.05858	0.010000	0.14722	0.944000	0.59088	-0.983000	0.03759	-0.366000	0.08064	0.650000	0.86243	CAG	0.325397		TCGA-HZ-A4BK-01A-11D-A26I-08	0.433	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	1	0	1		2	2	2	0		0	0	57		57	57	1	1.790000	-20.000000	1	0.320000	NM_000130			77	77		429	425	1		1	1		0	0	57	0		1.000000	5.192964e-01	0	7	0	4	0	77	429
RYR2	6262	broad.mit.edu	37	1	237632473	237632473	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:237632473T>C	ENST00000366574.2	+	17	2011	c.1694T>C	c.(1693-1695)cTg>cCg	p.L565P	RYR2_ENST00000542537.1_Missense_Mutation_p.L549P|RYR2_ENST00000360064.6_Missense_Mutation_p.L563P|MIR4428_ENST00000584884.1_RNA	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	565					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGGAAAGACTGGAAGCTTCT	0.358																																						ENST00000366574.2	1.000000	0.670000	1	7.800000e-01	0.910000	0.898701	0.910000	1.000000																										0				586						c.(1693-1695)cTg>cCg		ryanodine receptor 2 (cardiac)							107.0	106.0	107.0					1																	237632473		1821	4089	5910	SO:0001583	missense	6262	0	0					g.chr1:237632473T>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1694T>C	chr1.hg19:g.237632473T>C	ENSP00000355533:p.Leu565Pro	0					MIR4428_ENST00000584884.1_RNA|RYR2_ENST00000542537.1_Missense_Mutation_p.L549P|RYR2_ENST00000360064.6_Missense_Mutation_p.L563P	p.L565P	NM_001035.2	NP_001026.2	1	2	3	2.084706	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)	17	2011	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	1	1	hg19	c.1694T>C	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.260538	0.59431	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95788	-3.81;-3.81;-3.81	5.14	5.14	0.70334	5.14	5.14	0.70334	Intracellular calcium-release channel (1);	0.000000	0.46145	U	0.000314	D	0.96574	0.8882	M	0.63169	1.94	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	D	0.96379	0.9280	10	0.51188	T	0.08	.	12.4837	0.55859	0.0:0.0:0.0:1.0	.	565	Q92736	RYR2_HUMAN	P	565;563;549	ENSP00000355533:L565P;ENSP00000353174:L563P;ENSP00000443798:L549P	ENSP00000353174:L563P	L	+	2	0	0	RYR2	235699096	235699096	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.165000	0.77544	1.937000	0.56155	0.460000	0.39030	CTG	0.322169		TCGA-HZ-A4BK-01A-11D-A26I-08	0.358	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	1	0	0		2	2	2	0		0	0	23		23	23	1	1.790000	-20.000000	1	0.320000	NM_001035			42	42		247	245	1		1			0	0	23	0		1.000000	0	0	0	0	0	0	42	247
MEGF6	1953	broad.mit.edu	37	1	3422767	3422767	+	Missense_Mutation	SNP	C	C	T	rs541848126	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:3422767C>T	ENST00000356575.4	-	15	2049	c.1823G>A	c.(1822-1824)cGc>cAc	p.R608H	MEGF6_ENST00000294599.4_Missense_Mutation_p.R503H	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	608	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCATTTCTTGCGACAGTGCTT	0.657													c|||	2	0.000399361	0.0	0.0	5008	,	,		16854	0.002		0.0	False		,,,				2504	0.0				Ovarian(73;978 3658)	ENST00000356575.4	1.000000	0.250000	8.200000e-01	3.900000e-01	0.580000	0.610241	0.580000	1.000000																										0				19						c.(1822-1824)cGc>cAc		multiple EGF-like-domains 6							26.0	34.0	32.0					1																	3422767		1995	4139	6134	SO:0001583	missense	1953	4	120060	38				g.chr1:3422767C>T	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1823G>A	chr1.hg19:g.3422767C>T	ENSP00000348982:p.Arg608His	0					MEGF6_ENST00000294599.4_Missense_Mutation_p.R503H	p.R608H	NM_001409.3	NP_001400.3	0	1	1	1.995128	O75095	MEGF6_HUMAN		15	2049	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	0	1	hg19	c.1823G>A	CCDS41237.1	0	.	.	.	.	.	.	.	.	.	.	c	10.97	1.502390	0.26949	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	T;T	0.67698	-0.28;-0.28	3.77	-3.8	0.04307	3.77	-3.8	0.04307	Epidermal growth factor-like, type 3 (1);	0.438446	0.22220	N	0.062976	T	0.44393	0.1291	N	0.26042	0.785	0.20307	N	0.999918	B;B	0.17268	0.013;0.021	B;B	0.19148	0.024;0.008	T	0.17440	-1.0369	10	0.45353	T	0.12	-11.2415	6.3048	0.21133	0.0:0.3423:0.1325:0.5252	.	608;503	O75095;O75095-2	MEGF6_HUMAN;.	H	503;608	ENSP00000294599:R503H;ENSP00000348982:R608H	ENSP00000294599:R503H	R	-	2	0	0	MEGF6	3412627	3412627	0.045000	0.20229	0.141000	0.22245	0.901000	0.52897	0.333000	0.19768	-0.858000	0.04110	-0.494000	0.04653	CGC	0.286913		TCGA-HZ-A4BK-01A-11D-A26I-08	0.657	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	1	0	1		2	2	2	0		0	0	14		14	14	1	1.790000	-5.738573	1	0.320000	NM_001409			6	6		57	56	0		1	1		0	0	14	0		0.965808	9.640186e-01	0	2	0	59	0	6	57
OR2G3	81469	broad.mit.edu	37	1	247769183	247769183	+	Missense_Mutation	SNP	C	C	T	rs371726225		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr1:247769183C>T	ENST00000320002.2	+	1	328	c.296C>T	c.(295-297)gCg>gTg	p.A99V	RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A99G(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GGTTGTGTGGCGCAACTCTAT	0.483																																						ENST00000320002.2	0.670000	0.460000	6.100000e-01	5.000000e-01	0.550000	0.565065	0.550000	0.560000																										1	Substitution - Missense(1)	p.A99G(1)	lung(1)	50						c.(295-297)gCg>gTg		olfactory receptor, family 2, subfamily G, member 3							299.0	263.0	275.0					1																	247769183		2203	4300	6503	SO:0001583	missense	81469	23	121412	47				g.chr1:247769183C>T	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.296C>T	chr1.hg19:g.247769183C>T	ENSP00000326301:p.Ala99Val	0					RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA	p.A99V	NM_001001914.1	NP_001001914.1	1	2	3	2.084706	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)	1	328	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	1	1	hg19	c.296C>T	CCDS31093.1	0	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.048532	0.00394	.	.	ENSG00000177476	ENST00000320002	T	0.00940	5.52	3.8	2.66	0.31614	3.8	2.66	0.31614	GPCR, rhodopsin-like superfamily (1);	0.891435	0.08964	N	0.868207	T	0.00666	0.0022	N	0.16567	0.415	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46034	-0.9220	10	0.02654	T	1	.	5.2568	0.15552	0.0:0.2412:0.0:0.7588	.	99	Q8NGZ4	OR2G3_HUMAN	V	99	ENSP00000326301:A99V	ENSP00000326301:A99V	A	+	2	0	0	OR2G3	245835806	245835806	0.000000	0.05858	0.001000	0.08648	0.082000	0.17680	-1.891000	0.01611	0.643000	0.30638	-0.468000	0.05107	GCG	0.322169		TCGA-HZ-A4BK-01A-11D-A26I-08	0.483	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1	1	0	1		2	2	2	0		0	0	181		181	180	1	1.790000	-20.000000	1	0.320000				121	120		1239	1229	0		1			0	0	181	0		1.000000	0	0	0	0	0	0	121	1239
SULF2	55959	broad.mit.edu	37	20	46295174	46295174	+	Silent	SNP	G	G	A	rs115495231	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr20:46295174G>A	ENST00000359930.4	-	12	2486	c.1635C>T	c.(1633-1635)gaC>gaT	p.D545D	SULF2_ENST00000467815.1_Silent_p.D545D|SULF2_ENST00000361612.4_Silent_p.D545D|SULF2_ENST00000484875.1_Silent_p.D545D	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	545					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						ACACCCTGCCGTCCACCTCGA	0.622													G|||	24	0.00479233	0.0174	0.0014	5008	,	,		20541	0.0		0.0	False		,,,				2504	0.0					ENST00000359930.4	1.000000	0.690000	1	7.700000e-01	0.880000	0.885041	0.880000	1.000000																										0				54						c.(1633-1635)gaC>gaT		sulfatase 2		G	,,	65,4341	61.1+/-98.1	0,65,2138	91.0	85.0	87.0		1635,1635,1635	-9.2	0.0	20	dbSNP_132	87	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous,coding-synonymous,coding-synonymous	SULF2	NM_001161841.1,NM_018837.3,NM_198596.2	,,	0,72,6431	AA,AG,GG		0.0814,1.4753,0.5536	,,	545/871,545/871,545/868	46295174	72,12934	2203	4300	6503	SO:0001819	synonymous_variant	55959	207	121408	56				g.chr20:46295174G>A	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1635C>T	chr20.hg19:g.46295174G>A		1					SULF2_ENST00000361612.4_Silent_p.D545D|SULF2_ENST00000467815.1_Silent_p.D545D|SULF2_ENST00000484875.1_Silent_p.D545D	p.D545D	NM_018837.3	NP_061325.1	2	2	4	2.267356	Q8IWU5	SULF2_HUMAN		12	2486	-			E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	ENST00000359930.4	1	0	hg19	c.1635C>T	CCDS13408.1	1																																																																																								0.381368		TCGA-HZ-A4BK-01A-11D-A26I-08	0.622	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	1	0	1		2	2	2	0		0	0	102		102	102	1	1.790000	-9.043663	1	0.320000	NM_018837			79	78		558	548	1		1	1		0	0	102	0		1.000000	1	0	43	0	182	0	79	558
DYSF	8291	broad.mit.edu	37	2	71896785	71896785	+	Missense_Mutation	SNP	G	G	A	rs143939123	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr2:71896785G>A	ENST00000258104.3	+	50	5853	c.5576G>A	c.(5575-5577)cGt>cAt	p.R1859H	DYSF_ENST00000409762.1_Missense_Mutation_p.R1876H|DYSF_ENST00000409582.3_Missense_Mutation_p.R1897H|DYSF_ENST00000413539.2_Missense_Mutation_p.R1890H|DYSF_ENST00000410020.3_Missense_Mutation_p.R1898H|DYSF_ENST00000394120.2_Missense_Mutation_p.R1860H|DYSF_ENST00000409366.1_Missense_Mutation_p.R1881H|DYSF_ENST00000409651.1_Missense_Mutation_p.R1891H|DYSF_ENST00000429174.2_Missense_Mutation_p.R1880H|DYSF_ENST00000410041.1_Missense_Mutation_p.R1877H|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409744.1_Missense_Mutation_p.R1867H	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1859	C2 7. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.R1859H(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GTGCATTATCGTTCCCTGGGA	0.438													G|||	2	0.000399361	0.0015	0.0	5008	,	,		23536	0.0		0.0	False		,,,				2504	0.0					ENST00000258104.3	0.700000	0.400000	6.200000e-01	4.600000e-01	0.530000	0.548989	0.530000	0.540000																										1	Substitution - Missense(1)	p.R1859H(1)	large_intestine(1)	111						c.(5575-5577)cGt>cAt		dysferlin		G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	219.0	182.0	194.0		5579,5534,5597,5639,5669,5627,5690,5672,5642,5600,5630,5537,5693,5576	4.9	1.0	2	dbSNP_134	194	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	DYSF	NM_001130455.1,NM_001130976.1,NM_001130977.1,NM_001130978.1,NM_001130979.1,NM_001130980.1,NM_001130981.1,NM_001130982.1,NM_001130983.1,NM_001130984.1,NM_001130985.1,NM_001130986.1,NM_001130987.1,NM_003494.3	29,29,29,29,29,29,29,29,29,29,29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	1860/2082,1845/2067,1866/2088,1880/2102,1890/2112,1876/2098,1897/2119,1891/2113,1881/2103,1867/2089,1877/2099,1846/2068,1898/2120,1859/2081	71896785	1,13005	2203	4300	6503	SO:0001583	missense	8291	6	121412	40				g.chr2:71896785G>A	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5576G>A	chr2.hg19:g.71896785G>A	ENSP00000258104:p.Arg1859His	0					DYSF_ENST00000429174.2_Missense_Mutation_p.R1880H|DYSF_ENST00000410020.3_Missense_Mutation_p.R1898H|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000413539.2_Missense_Mutation_p.R1890H|DYSF_ENST00000409762.1_Missense_Mutation_p.R1876H|DYSF_ENST00000409651.1_Missense_Mutation_p.R1891H|DYSF_ENST00000409744.1_Missense_Mutation_p.R1867H|DYSF_ENST00000409582.3_Missense_Mutation_p.R1897H|DYSF_ENST00000409366.1_Missense_Mutation_p.R1881H|DYSF_ENST00000394120.2_Missense_Mutation_p.R1860H|DYSF_ENST00000410041.1_Missense_Mutation_p.R1877H	p.R1859H	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	0	0	0	2.048971	O75923	DYSF_HUMAN		50	5853	+			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	1	1	hg19	c.5576G>A	CCDS1918.1	0	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831448	0.91036	0.0	1.16E-4	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75	4.87	4.87	0.63330	4.87	4.87	0.63330	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.098372	0.64402	D	0.000003	D	0.95294	0.8473	M	0.84433	2.695	0.52099	D	0.999946	D;D;D;D;D;D;D;D;D;D;D;P;D;D;D	0.89917	0.999;0.999;0.999;0.996;0.996;1.0;1.0;1.0;0.977;0.999;0.973;0.614;0.996;0.996;0.999	D;P;D;P;P;D;D;D;P;D;P;B;P;P;D	0.72338	0.967;0.897;0.91;0.897;0.852;0.977;0.977;0.977;0.476;0.938;0.606;0.228;0.897;0.897;0.938	D	0.94569	0.7769	10	0.40728	T	0.16	-26.1585	15.8904	0.79293	0.0:0.0:1.0:0.0	.	623;1891;1898;1881;1846;1877;1867;1876;1866;1890;1897;1880;1845;1860;1859	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	H	1890;1876;1897;1880;1859;1891;1860;1867;1881;1898;1877	ENSP00000407046:R1890H;ENSP00000387137:R1876H;ENSP00000386547:R1897H;ENSP00000398305:R1880H;ENSP00000258104:R1859H;ENSP00000386683:R1891H;ENSP00000377678:R1860H;ENSP00000386285:R1867H;ENSP00000386512:R1881H;ENSP00000386881:R1898H;ENSP00000386617:R1877H	ENSP00000258104:R1859H	R	+	2	0	0	DYSF	71750293	71750293	1.000000	0.71417	0.990000	0.47175	0.912000	0.54170	9.492000	0.97957	2.698000	0.92095	0.655000	0.94253	CGT	0.311183		TCGA-HZ-A4BK-01A-11D-A26I-08	0.438	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	1	0	1		2	2	2	0		0	0	77		77	76	1	1.790000	-13.194030	1	0.320000	NM_003494			46	46		478	473	0		1	0		0	0	77	0		1.000000	8.742329e-01	0	1	0	39	0	46	478
ZDBF2	57683	broad.mit.edu	37	2	207170979	207170979	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr2:207170979C>T	ENST00000374423.3	+	5	2113	c.1727C>T	c.(1726-1728)tCg>tTg	p.S576L		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	576							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AACTATGGATCGAGTTGTTCT	0.438																																						ENST00000374423.3	0.770000	0.300000	6.300000e-01	3.900000e-01	0.500000	0.516214	0.500000	0.490000																										0				95						c.(1726-1728)tCg>tTg		zinc finger, DBF-type containing 2							97.0	88.0	91.0					2																	207170979		1889	4122	6011	SO:0001583	missense	57683	2	120816	27				g.chr2:207170979C>T	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.1727C>T	chr2.hg19:g.207170979C>T	ENSP00000363545:p.Ser576Leu	0						p.S576L	NM_020923.1	NP_065974.1	1	2	3	2.071067	Q9HCK1	ZDBF2_HUMAN		5	2113	+			Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	0	1	hg19	c.1727C>T	CCDS46501.1	0	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389908	0.82902	.	.	ENSG00000204186	ENST00000374423	T	0.45668	0.89	4.33	4.33	0.51752	4.33	4.33	0.51752	.	0.000000	0.35805	N	0.002961	T	0.55529	0.1926	L	0.55481	1.735	0.09310	N	1	D	0.76494	0.999	D	0.64506	0.926	T	0.47262	-0.9131	10	0.72032	D	0.01	.	12.6441	0.56725	0.0:1.0:0.0:0.0	.	576	Q9HCK1	ZDBF2_HUMAN	L	576	ENSP00000363545:S576L	ENSP00000363545:S576L	S	+	2	0	0	ZDBF2	206879224	206879224	0.382000	0.25148	0.012000	0.15200	0.605000	0.37080	1.691000	0.37721	2.694000	0.91930	0.650000	0.86243	TCG	0.321086		TCGA-HZ-A4BK-01A-11D-A26I-08	0.438	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	1	0	1		2	2	2	0		0	0	16		16	16	1	1.790000	-7.128712	1	0.320000	NM_020923			16	16		186	184	0		1	0		0	0	16	0		0.999940	0	0	0	0	1	0	16	186
GNL3	26354	broad.mit.edu	37	3	52726994	52726995	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			G|C	T	G|C	G|C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr3:52726994_52726995GC>TT	ENST00000418458.1	+	10	1149_1150	c.976_977GC>TT	c.(976-978)GCa>TTa	p.A326L	SNORD69_ENST00000391150.1_RNA|SNORD19_ENST00000410413.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.A314L|SNORD19B_ENST00000459623.1_RNA|GLT8D1_ENST00000463827.1_5'Flank	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	326	Intermediate. {ECO:0000250}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		GCGAAGTCCAGCAAGTATTGAA	0.5																																						ENST00000418458.1	0.700000	0.390000	6.200000e-01|6.300000e-01	4.500000e-01|4.600000e-01	0.530000	0.543844|0.547903	0.530000	0.530000|0.540000																										0				12						c.(976-978)Gca>Tca|c.(976-978)gCa>gTa		guanine nucleotide binding protein-like 3 (nucleolar)																																				SO:0001583	missense	26354	0	0					g.chr3:52726994G>T|g.chr3:52726995C>T	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	Exception_encountered	chr3.hg19:g.52726994_52726995delinsTT	ENSP00000395772:p.Ala326Leu	1					SNORD19B_ENST00000459623.1_RNA|SNORD19_ENST00000410413.1_RNA|SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.A314S|GLT8D1_ENST00000463827.1_5'Flank|SNORD19B_ENST00000459623.1_RNA|SNORD19_ENST00000410413.1_RNA|SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.A314V|GLT8D1_ENST00000463827.1_5'Flank	p.A326S|p.A326V	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	0	0	0	1.778713	Q9BVP2	GNL3_HUMAN		10	1149|1150	+			B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Missense_Mutation	SNP	ENST00000418458.1	1	1	hg19	c.976G>T|c.977C>T	CCDS2861.1	0																									5.91	3.9|4.12	0.45041|0.48240																																												0			52702034|52702035														0.208566		TCGA-HZ-A4BK-01A-11D-A26I-08	0.500	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	1	0	1		2	2	2	0		0	0	53		54|53	54|53	1	1.790000	-20.000000	1	0.320000	NM_014366			40	40		359|356	358|355	1		1	1		0	0	54|53	0		1.000000	9.975776e-01|9.983339e-01	0	15	0	69|73	0	40	356
SEMA5B	54437	broad.mit.edu	37	3	122634365	122634365	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr3:122634365C>T	ENST00000357599.3	-	14	2296	c.1910G>A	c.(1909-1911)cGa>cAa	p.R637Q	SEMA5B_ENST00000195173.4_Missense_Mutation_p.R637Q|SEMA5B_ENST00000451055.2_Missense_Mutation_p.R691Q	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	637					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		ATCACAGGATCGAGCTCGACA	0.607																																						ENST00000357599.3	1.000000	0.330000	6.800000e-01	4.200000e-01	0.520000	0.566514	0.520000	0.510000																										0				55						c.(1909-1911)cGa>cAa		sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B							71.0	68.0	69.0					3																	122634365		2203	4300	6503	SO:0001583	missense	54437	2	121412	33				g.chr3:122634365C>T	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1910G>A	chr3.hg19:g.122634365C>T	ENSP00000350215:p.Arg637Gln	0					SEMA5B_ENST00000195173.4_Missense_Mutation_p.R637Q|SEMA5B_ENST00000451055.2_Missense_Mutation_p.R691Q	p.R637Q	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	1	2	3	2.132008	Q9P283	SEM5B_HUMAN		14	2296	-			A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	1	1	hg19	c.1910G>A	CCDS35491.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.335933	0.95758	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	4.88	4.88	0.63580	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.70307	0.3209	H	0.99074	4.42	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.84317	0.0514	10	0.87932	D	0	.	17.2003	0.86904	0.0:1.0:0.0:0.0	.	579;637;637	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	Q	637;637;579;691;637	ENSP00000350215:R637Q;ENSP00000195173:R637Q;ENSP00000389588:R691Q;ENSP00000377208:R637Q	ENSP00000195173:R637Q	R	-	2	0	0	SEMA5B	124117055	124117055	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.596000	0.82721	2.520000	0.84964	0.561000	0.74099	CGA	0.331761		TCGA-HZ-A4BK-01A-11D-A26I-08	0.607	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	1	0	1		2	2	2	0		0	0	45		45	45	1	1.790000	-20.000000	1	0.320000	NM_001031702			22	22		253	251	0		1	0		0	0	45	0		0.999999	0	0	0	0	1	0	22	253
ZNF141	7700	broad.mit.edu	37	4	367212	367212	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr4:367212A>G	ENST00000240499.7	+	4	1135	c.986A>G	c.(985-987)cAt>cGt	p.H329R	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	329					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						CTTACTAAACATAAGAGAATT	0.373																																						ENST00000240499.7	0.760000	0.420000	6.700000e-01	4.900000e-01	0.570000	0.589370	0.570000	0.570000																										0				18						c.(985-987)cAt>cGt		zinc finger protein 141							52.0	57.0	55.0					4																	367212		2202	4294	6496	SO:0001583	missense	7700	2	121394	33				g.chr4:367212A>G	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.986A>G	chr4.hg19:g.367212A>G	ENSP00000240499:p.His329Arg	0					ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	p.H329R	NM_003441.2	NP_003432.1	0	1	1	1.958508	Q15928	ZN141_HUMAN		4	1135	+			Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	1	1	hg19	c.986A>G	CCDS33931.1	0	.	.	.	.	.	.	.	.	.	.	A	20.2	3.945443	0.73672	.	.	ENSG00000131127	ENST00000240499	D	0.86865	-2.18	1.24	1.24	0.21308	1.24	1.24	0.21308	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94938	0.8363	H	0.98199	4.17	0.29054	N	0.884313	D	0.89917	1.0	D	0.97110	1.0	D	0.87220	0.2253	8	.	.	.	.	6.1877	0.20506	1.0:0.0:0.0:0.0	.	329	Q15928	ZN141_HUMAN	R	329	ENSP00000240499:H329R	.	H	+	2	0	0	ZNF141	357212	357212	0.991000	0.36638	0.777000	0.31699	0.982000	0.71751	6.242000	0.72376	0.495000	0.27882	0.260000	0.18958	CAT	0.265976		TCGA-HZ-A4BK-01A-11D-A26I-08	0.373	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	1	0	1		2	2	2	0		0	0	43		43	38	1	1.790000	-20.000000	1	0.320000	NM_003441			40	39		358	325	1		1	0		0	0	43	0		1.000000	8.621457e-02	0	0	0	5	0	40	358
MFAP3L	9848	broad.mit.edu	37	4	170926893	170926893	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr4:170926893C>T	ENST00000361618.3	-	2	443	c.136G>A	c.(136-138)Gtg>Atg	p.V46M	MFAP3L_ENST00000393702.3_Missense_Mutation_p.V46M|MFAP3L_ENST00000506110.1_Missense_Mutation_p.V46M|MFAP3L_ENST00000393704.3_5'Flank	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		ATTACGGGCACAGAGCCCAAG	0.458																																						ENST00000361618.3	0.760000	0.440000	6.800000e-01	5.100000e-01	0.590000	0.603426	0.590000	0.600000																										0				22						c.(136-138)Gtg>Atg		microfibrillar-associated protein 3-like							157.0	140.0	146.0					4																	170926893		2203	4300	6503	SO:0001583	missense	9848	0	0					g.chr4:170926893C>T	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.136G>A	chr4.hg19:g.170926893C>T	ENSP00000354583:p.Val46Met	0					MFAP3L_ENST00000393702.3_Missense_Mutation_p.V46M|MFAP3L_ENST00000393704.3_5'Flank|MFAP3L_ENST00000506110.1_Missense_Mutation_p.V46M	p.V46M	NM_021647.6	NP_067679.6	0	1	1	1.954322	O75121	MFA3L_HUMAN		2	443	-		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	ENST00000361618.3	1	1	hg19	c.136G>A	CCDS34103.1	0	.	.	.	.	.	.	.	.	.	.	C	4.276	0.050406	0.08243	.	.	ENSG00000198948	ENST00000361618;ENST00000393702;ENST00000506110;ENST00000504999;ENST00000506764;ENST00000510306	D;D;D;D;D	0.96073	-1.78;-3.9;-3.9;-3.9;-3.9	5.18	1.49	0.22878	5.18	1.49	0.22878	Immunoglobulin-like fold (1);	0.598203	0.18825	N	0.130155	D	0.91068	0.7189	L	0.43152	1.355	0.25324	N	0.989092	B	0.09022	0.002	B	0.08055	0.003	T	0.81221	-0.1031	10	0.32370	T	0.25	-0.0058	9.0328	0.36269	0.0:0.6194:0.0:0.3806	.	46	O75121	MFA3L_HUMAN	M	46	ENSP00000354583:V46M;ENSP00000377305:V46M;ENSP00000422571:V46M;ENSP00000425303:V46M;ENSP00000426247:V46M	ENSP00000354583:V46M	V	-	1	0	0	MFAP3L	171163468	171163468	0.074000	0.21230	0.741000	0.31004	0.040000	0.13550	0.703000	0.25646	0.292000	0.22492	-0.258000	0.10820	GTG	0.260870		TCGA-HZ-A4BK-01A-11D-A26I-08	0.458	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	1	0	1		2	2	2	0		0	0	42		42	42	1	1.790000	-20.000000	1	0.320000	NM_021647			46	46		397	394	1		1			0	0	42	0		1.000000	0	0	0	0	0	0	46	397
PCDHB3	56132	broad.mit.edu	37	5	140482020	140482020	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr5:140482020C>T	ENST00000231130.2	+	1	1787	c.1787C>T	c.(1786-1788)tCg>tTg	p.S596L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	596	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACGGCGACTCGGGCCAGAAC	0.716																																						ENST00000231130.2	1.000000	0.340000	5.600000e-01	4.000000e-01	0.470000	0.507214	0.470000	0.460000																										0				72						c.(1786-1788)tCg>tTg		protocadherin beta 3							10.0	12.0	11.0					5																	140482020		1777	3609	5386	SO:0001583	missense	56132	0	0					g.chr5:140482020C>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1787C>T	chr5.hg19:g.140482020C>T	ENSP00000231130:p.Ser596Leu	0					AC005754.7_ENST00000607216.1_RNA	p.S596L	NM_018937.2	NP_061760.1	1	2	3	2.115615	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1787	+			B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	1	1	hg19	c.1787C>T	CCDS4245.1	0	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939596	0.73557	.	.	ENSG00000113205	ENST00000231130	T	0.49432	0.78	4.08	3.13	0.36017	4.08	3.13	0.36017	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.68339	0.2990	M	0.82630	2.6	0.33058	D	0.533707	D	0.76494	0.999	D	0.66084	0.941	T	0.79077	-0.1951	9	0.87932	D	0	.	13.9076	0.63845	0.0:0.8468:0.1532:0.0	.	596	Q9Y5E6	PCDB3_HUMAN	L	596	ENSP00000231130:S596L	ENSP00000231130:S596L	S	+	2	0	0	PCDHB3	140462204	140462204	0.005000	0.15991	0.999000	0.59377	0.998000	0.95712	2.101000	0.41787	1.993000	0.58246	0.556000	0.70494	TCG	0.328594		TCGA-HZ-A4BK-01A-11D-A26I-08	0.716	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	0	0	1		7	2	2	0		0	1	124		124	166	1	1.790000	-9.916132	1	0.320000	NM_018937			42	14		529	220	0		1			0	0	124	0		0.996159	0	0	0	0	0	0	42	529
FAT2	2196	broad.mit.edu	37	5	150907687	150907687	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr5:150907687G>A	ENST00000261800.5	-	15	10046	c.10034C>T	c.(10033-10035)gCg>gTg	p.A3345V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3345	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCATCAGTCGCTGATACCTG	0.532																																						ENST00000261800.5	1.000000	0.930000	1	9.900000e-01	0.990000	0.996110	0.990000	1.000000																										0				196						c.(10033-10035)gCg>gTg		FAT atypical cadherin 2							102.0	95.0	97.0					5																	150907687		2203	4300	6503	SO:0001583	missense	2196	0	0					g.chr5:150907687G>A	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.10034C>T	chr5.hg19:g.150907687G>A	ENSP00000261800:p.Ala3345Val	0						p.A3345V	NM_001447.2	NP_001438.1	1	2	3	2.115615	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	15	10046	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	1	1	hg19	c.10034C>T	CCDS4317.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026947	0.93518	.	.	ENSG00000086570	ENST00000261800	T	0.59364	0.27	5.73	5.73	0.89815	5.73	5.73	0.89815	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000004	T	0.77824	0.4188	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.78917	-0.2015	10	0.72032	D	0.01	.	19.9191	0.97079	0.0:0.0:1.0:0.0	.	3345;536	Q9NYQ8;E9PDJ8	FAT2_HUMAN;.	V	3345	ENSP00000261800:A3345V	ENSP00000261800:A3345V	A	-	2	0	0	FAT2	150887880	150887880	1.000000	0.71417	0.917000	0.36280	0.778000	0.44026	9.067000	0.93955	2.707000	0.92482	0.643000	0.83706	GCG	0.328594		TCGA-HZ-A4BK-01A-11D-A26I-08	0.532	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	1	0	1		2	2	2	0		0	0	87		87	87	1	1.790000	-3.283273	1	0.320000	NM_001447			92	91		420	414	1		1	0		0	0	87	0		1.000000	0	0	0	0	1	0	92	420
TARS	6897	broad.mit.edu	37	5	33455699	33455699	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr5:33455699T>C	ENST00000265112.3	+	6	894	c.583T>C	c.(583-585)Tct>Cct	p.S195P	TARS_ENST00000502553.1_Missense_Mutation_p.S195P|TARS_ENST00000414361.2_Missense_Mutation_p.S74P|TARS_ENST00000541634.1_Missense_Mutation_p.S91P|TARS_ENST00000455217.2_Missense_Mutation_p.S228P	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	195					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CAGGGGTGTGTCTAGCAATGA	0.348																																						ENST00000265112.3	1.000000	0.850000	1	9.600000e-01	0.990000	0.985288	0.990000	1.000000																										0				29						c.(583-585)Tct>Cct		threonyl-tRNA synthetase	L-Threonine(DB00156)						79.0	81.0	81.0					5																	33455699		2203	4300	6503	SO:0001583	missense	6897	0	0					g.chr5:33455699T>C	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.583T>C	chr5.hg19:g.33455699T>C	ENSP00000265112:p.Ser195Pro	0					TARS_ENST00000414361.2_Missense_Mutation_p.S74P|TARS_ENST00000502553.1_Missense_Mutation_p.S195P|TARS_ENST00000541634.1_Missense_Mutation_p.S91P|TARS_ENST00000455217.2_Missense_Mutation_p.S228P	p.S195P	NM_152295.4	NP_689508.3	0	1	1	1.959612	P26639	SYTC_HUMAN		6	894	+			A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	ENST00000265112.3	1	1	hg19	c.583T>C	CCDS3899.1	1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.139242	0.56936	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04	5.45	5.45	0.79879	5.45	5.45	0.79879	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.000000	0.85682	D	0.000000	T	0.35508	0.0934	M	0.90145	3.09	0.80722	D	1	B;D;D;D	0.76494	0.058;0.999;0.993;0.999	B;D;D;D	0.68943	0.035;0.961;0.956;0.944	T	0.39881	-0.9592	10	0.62326	D	0.03	-26.5112	15.5522	0.76161	0.0:0.0:0.0:1.0	.	74;228;91;195	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	P	195;195;91;228;74	ENSP00000424387:S195P;ENSP00000265112:S195P;ENSP00000438469:S91P;ENSP00000387710:S228P;ENSP00000394291:S74P	ENSP00000265112:S195P	S	+	1	0	0	TARS	33491456	33491456	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	8.040000	0.89188	2.084000	0.62774	0.392000	0.25879	TCT	0.280880		TCGA-HZ-A4BK-01A-11D-A26I-08	0.348	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207367.1	1	0	1		2	2	2	0		0	0	13		13	13	1	1.790000	-20.000000	1	0.320000	NM_152295			56	55		244	243	1		1	1		0	0	13	0		1.000000	9.999815e-01	0	28	0	45	0	56	244
ADAMTS12	81792	broad.mit.edu	37	5	33549440	33549440	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr5:33549440C>T	ENST00000504830.1	-	21	4509	c.4174G>A	c.(4174-4176)Gtg>Atg	p.V1392M	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.V1307M	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1392	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CGGCTGTCCACGCACTGAATC	0.562										HNSCC(64;0.19)																												ENST00000504830.1	0.660000	0.380000	5.900000e-01	4.400000e-01	0.510000	0.519964	0.510000	0.510000																										0				216						c.(4174-4176)Gtg>Atg		ADAM metallopeptidase with thrombospondin type 1 motif, 12							86.0	95.0	92.0					5																	33549440		2203	4300	6503	SO:0001583	missense	81792	1	121412	31				g.chr5:33549440C>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4174G>A	chr5.hg19:g.33549440C>T	ENSP00000422554:p.Val1392Met	0	HNSCC(64;0.19)				ADAMTS12_ENST00000352040.3_Missense_Mutation_p.V1307M	p.V1392M	NM_030955.2	NP_112217.2	0	1	1	1.959612	P58397	ATS12_HUMAN		21	4509	-			A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	1	1	hg19	c.4174G>A	CCDS34140.1	0	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033374	0.35893	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.62232	0.04;0.04	5.16	1.05	0.20165	5.16	1.05	0.20165	.	0.339195	0.30483	N	0.009529	T	0.45377	0.1339	L	0.42529	1.33	0.80722	D	1	B;B	0.29716	0.255;0.194	B;B	0.22601	0.024;0.04	T	0.20472	-1.0274	10	0.51188	T	0.08	.	4.7832	0.13213	0.0:0.4534:0.2926:0.254	.	1307;1392	P58397-3;P58397	.;ATS12_HUMAN	M	1392;1307	ENSP00000422554:V1392M;ENSP00000344847:V1307M	ENSP00000344847:V1307M	V	-	1	0	0	ADAMTS12	33585197	33585197	0.799000	0.28903	0.986000	0.45419	0.987000	0.75469	-0.063000	0.11655	-0.105000	0.12132	-0.312000	0.09012	GTG	0.280880		TCGA-HZ-A4BK-01A-11D-A26I-08	0.562	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	1	0	1		2	2	2	0		0	0	112		112	110	1	1.790000	-13.145400	1	0.320000	NM_030955			47	50		494	489	0		1	0		0	0	112	0		1.000000	4.476366e-01	0	0	0	17	0	47	494
FLT4	2324	broad.mit.edu	37	5	180039570	180039570	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr5:180039570G>A	ENST00000261937.6	-	26	3551	c.3473C>T	c.(3472-3474)gCg>gTg	p.A1158V	FLT4_ENST00000393347.3_Missense_Mutation_p.A1158V|FLT4_ENST00000502649.1_Missense_Mutation_p.A1158V	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1158	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGCAGGTCTCGCCTTGGGGTC	0.642																																					Colon(97;1075 1466 27033 27547 35871)	ENST00000261937.6	1.000000	0.950000	1	9.900000e-01	0.990000	0.997682	0.990000	1.000000																										0				71						c.(3472-3474)gCg>gTg		fms-related tyrosine kinase 4	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)						80.0	82.0	81.0					5																	180039570		2203	4300	6503	SO:0001583	missense	2324	0	0					g.chr5:180039570G>A	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3473C>T	chr5.hg19:g.180039570G>A	ENSP00000261937:p.Ala1158Val	0					FLT4_ENST00000502649.1_Missense_Mutation_p.A1158V|FLT4_ENST00000393347.3_Missense_Mutation_p.A1158V	p.A1158V	NM_182925.4	NP_891555.2	1	2	3	2.115615	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	26	3551	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	1	1	hg19	c.3473C>T	CCDS4457.1	1	.	.	.	.	.	.	.	.	.	.	g	15.17	2.754723	0.49362	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649	D;D;D	0.83075	-1.68;-1.68;-1.68	3.57	1.45	0.22620	3.57	1.45	0.22620	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.70701	0.3254	N	0.16862	0.45	0.33893	D	0.637638	B;B	0.32203	0.36;0.36	B;B	0.34824	0.19;0.19	T	0.74365	-0.3689	9	0.56958	D	0.05	.	10.3063	0.43683	0.0:0.0:0.301:0.699	.	1158;1158	E9PD35;P35916	.;VGFR3_HUMAN	V	1158	ENSP00000261937:A1158V;ENSP00000377016:A1158V;ENSP00000426057:A1158V	ENSP00000261937:A1158V	A	-	2	0	0	FLT4	179972176	179972176	0.999000	0.42202	0.974000	0.42286	0.708000	0.40852	2.991000	0.49409	0.774000	0.33427	0.457000	0.33378	GCG	0.328594		TCGA-HZ-A4BK-01A-11D-A26I-08	0.642	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4	1	0	1		2	2	2	0		0	0	106		106	105	1	1.790000	-3.394788	1	0.320000				100	100		448	442	1		1	0	0	0	0	106	0		1.000000	9.008794e-01	0	0	0	20	1	100	448
PACSIN1	29993	broad.mit.edu	37	6	34498289	34498289	+	Missense_Mutation	SNP	A	A	C			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr6:34498289A>C	ENST00000538621.1	+	8	1207	c.962A>C	c.(961-963)aAg>aCg	p.K321T	PACSIN1_ENST00000244458.2_Missense_Mutation_p.K321T|PACSIN1_ENST00000374043.2_Missense_Mutation_p.K279T	NM_001199583.2	NP_001186512.1	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in neurons 1	321					actin filament organization (GO:0007015)|establishment of protein localization to plasma membrane (GO:0090002)|membrane tubulation (GO:0097320)|neuron projection morphogenesis (GO:0048812)|positive regulation of dendrite development (GO:1900006)|protein localization to membrane (GO:0072657)|synaptic vesicle endocytosis (GO:0048488)	axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	13						AAACAGCCTAAGAAGGCAGAG	0.632																																						ENST00000538621.1	0.620000	0.170000	4.900000e-01	2.500000e-01	0.350000	0.374805	0.350000	0.340000																										0				13						c.(961-963)aAg>aCg		protein kinase C and casein kinase substrate in neurons 1							108.0	87.0	94.0					6																	34498289		2203	4300	6503	SO:0001583	missense	29993	0	0					g.chr6:34498289A>C	AB037800	CCDS4793.1	6p21.3	2008-02-05			ENSG00000124507	ENSG00000124507			8570	protein-coding gene	gene with protein product	"""syndapin I"""	606512				11179684	Standard	NM_020804		Approved	SDPI	uc003ojp.4	Q9BY11	OTTHUMG00000014547	ENST00000538621.1:c.962A>C	chr6.hg19:g.34498289A>C	ENSP00000439639:p.Lys321Thr	1					PACSIN1_ENST00000244458.2_Missense_Mutation_p.K321T|PACSIN1_ENST00000374043.2_Missense_Mutation_p.K279T	p.K321T	NM_001199583.2	NP_001186512.1	0	0	0	1.781395	Q9BY11	PACN1_HUMAN		8	1207	+			Q9P2G8	Missense_Mutation	SNP	ENST00000538621.1	1	1	hg19	c.962A>C	CCDS4793.1	0	.	.	.	.	.	.	.	.	.	.	A	14.77	2.635770	0.47049	.	.	ENSG00000124507	ENST00000244458;ENST00000374043;ENST00000436831;ENST00000538621	T;T;T	0.24538	1.85;1.85;1.85	4.43	4.43	0.53597	4.43	4.43	0.53597	.	0.208574	0.48286	D	0.000188	T	0.25717	0.0626	M	0.72118	2.19	0.58432	D	0.999999	D	0.63880	0.993	P	0.53266	0.722	T	0.05835	-1.0861	10	0.18710	T	0.47	-17.1727	13.5105	0.61508	1.0:0.0:0.0:0.0	.	321	Q9BY11	PACN1_HUMAN	T	321;279;321;321	ENSP00000244458:K321T;ENSP00000363155:K279T;ENSP00000439639:K321T	ENSP00000244458:K321T	K	+	2	0	0	PACSIN1	34606267	34606267	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	3.935000	0.56560	1.875000	0.54330	0.374000	0.22700	AAG	0.208566		TCGA-HZ-A4BK-01A-11D-A26I-08	0.632	PACSIN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040236.1	1	0	1		2	2	2	0		0	0	27		27	27	1	1.790000	-12.463340	1	0.320000				8	8		115	114	0		1	0		0	0	27	0		0.989806	5.714286e-03	0	0	0	2	0	8	115
ASB15	142685	broad.mit.edu	37	7	123254593	123254593	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr7:123254593A>G	ENST00000451558.1	+	6	558	c.37A>G	c.(37-39)Aca>Gca	p.T13A	ASB15_ENST00000540573.1_Missense_Mutation_p.T13A|RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000451215.1_Missense_Mutation_p.T13A|RP11-390E23.3_ENST00000422401.1_RNA|RP11-390E23.3_ENST00000440504.1_RNA|ASB15_ENST00000434204.1_Missense_Mutation_p.T13A|ASB15_ENST00000275699.3_Missense_Mutation_p.T13A			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	13					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						AGACCATCTTACAAGTTATGA	0.363																																						ENST00000451558.1	0.610000	0.400000	5.600000e-01	4.500000e-01	0.500000	0.511531	0.500000	0.500000																										0				12						c.(37-39)Aca>Gca		ankyrin repeat and SOCS box containing 15							211.0	213.0	212.0					7																	123254593		2203	4300	6503	SO:0001583	missense	142685	0	0					g.chr7:123254593A>G	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.37A>G	chr7.hg19:g.123254593A>G	ENSP00000397655:p.Thr13Ala	0					RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000275699.3_Missense_Mutation_p.T13A|ASB15_ENST00000451215.1_Missense_Mutation_p.T13A|RP11-390E23.3_ENST00000440504.1_RNA|RP11-390E23.3_ENST00000422401.1_RNA|ASB15_ENST00000434204.1_Missense_Mutation_p.T13A|ASB15_ENST00000540573.1_Missense_Mutation_p.T13A	p.T13A			0	1	1	1.949217	Q8WXK1	ASB15_HUMAN		6	558	+			Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	1	1	hg19	c.37A>G	CCDS34742.1	0	.	.	.	.	.	.	.	.	.	.	A	13.89	2.373191	0.42105	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000437535;ENST00000451215;ENST00000540573;ENST00000447789;ENST00000275699	T;T;T;T;T;T;T	0.68903	-0.3;-0.3;0.83;-0.3;-0.3;-0.36;-0.3	6.04	1.13	0.20643	6.04	1.13	0.20643	.	0.270670	0.31221	N	0.008021	T	0.42899	0.1223	N	0.24115	0.695	0.28159	N	0.929077	B	0.09022	0.002	B	0.06405	0.002	T	0.32534	-0.9903	10	0.02654	T	1	-39.6481	9.3766	0.38286	0.7265:0.0:0.2735:0.0	.	13	Q8WXK1	ASB15_HUMAN	A	13	ENSP00000397655:T13A;ENSP00000390963:T13A;ENSP00000406163:T13A;ENSP00000416433:T13A;ENSP00000438643:T13A;ENSP00000401166:T13A;ENSP00000275699:T13A	ENSP00000275699:T13A	T	+	1	0	0	ASB15	123041829	123041829	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	2.916000	0.48813	-0.029000	0.13827	0.460000	0.39030	ACA	0.269759		TCGA-HZ-A4BK-01A-11D-A26I-08	0.363	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1	1	0	1		2	2	2	0		0	0	133		133	133	1	1.790000	-20.000000	1	0.320000				83	83		868	859	0		1			0	0	133	0		1.000000	0	0	0	0	0	0	83	868
POM121L12	285877	broad.mit.edu	37	7	53103801	53103801	+	Missense_Mutation	SNP	G	G	A	rs200929126	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr7:53103801G>A	ENST00000408890.4	+	1	453	c.437G>A	c.(436-438)cGt>cAt	p.R146H		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	146								p.R146H(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCCCCTGAGCGTCAGGAGAGC	0.711													G|||	2	0.000399361	0.0008	0.0	5008	,	,		11241	0.0		0.001	False		,,,				2504	0.0					ENST00000408890.4	1.000000	0.620000	1	7.300000e-01	0.870000	0.867961	0.870000	1.000000																										1	Substitution - Missense(1)	p.R146H(1)	endometrium(1)	61						c.(436-438)cGt>cAt		POM121 transmembrane nucleoporin-like 12							18.0	22.0	21.0					7																	53103801		1923	4092	6015	SO:0001583	missense	285877	5	120650	32				g.chr7:53103801G>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.437G>A	chr7.hg19:g.53103801G>A	ENSP00000386133:p.Arg146His	0						p.R146H	NM_182595.3	NP_872401.3	0	1	1	1.949217	Q8N7R1	P1L12_HUMAN		1	453	+			Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	1	1	hg19	c.437G>A	CCDS43584.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	6.394	0.440778	0.12104	.	.	ENSG00000221900	ENST00000408890	T	0.24723	1.84	1.37	-1.98	0.07480	1.37	-1.98	0.07480	.	.	.	.	.	T	0.17408	0.0418	L	0.43923	1.385	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26815	-1.0092	9	0.30078	T	0.28	.	5.2756	0.15647	0.5589:0.0:0.4411:0.0	.	146	Q8N7R1	P1L12_HUMAN	H	146	ENSP00000386133:R146H	ENSP00000386133:R146H	R	+	2	0	0	POM121L12	53071295	53071295	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.211000	0.02997	-0.736000	0.04831	-2.126000	0.00345	CGT	0.269759		TCGA-HZ-A4BK-01A-11D-A26I-08	0.711	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	1	0	1		2	2	2	0		0	0	30		30	30	1	1.790000	-20.000000	1	0.320000	NM_182595			32	32		180	178	0		1			0	0	30	0		1.000000	0	0	0	0	0	0	32	180
REPIN1	29803	broad.mit.edu	37	7	150069256	150069256	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr7:150069256C>G	ENST00000425389.2	+	1	1004	c.926C>G	c.(925-927)tCt>tGt	p.S309C	REPIN1_ENST00000444957.1_Missense_Mutation_p.S309C|REPIN1_ENST00000489432.2_Missense_Mutation_p.S366C|REPIN1_ENST00000540729.1_Missense_Mutation_p.S309C|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000397281.2_Missense_Mutation_p.S309C|REPIN1_ENST00000479668.1_3'UTR	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	309					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			AACCTGCTGTCTCACAGCAAG	0.701																																						ENST00000425389.2	1.000000	0.430000	1	5.900000e-01	0.790000	0.787109	0.790000	1.000000																										0				14						c.(925-927)tCt>tGt		replication initiator 1							10.0	13.0	12.0					7																	150069256		2112	4239	6351	SO:0001583	missense	29803	0	0					g.chr7:150069256C>G	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.926C>G	chr7.hg19:g.150069256C>G	ENSP00000388287:p.Ser309Cys	0					REPIN1_ENST00000397281.2_Missense_Mutation_p.S309C|REPIN1_ENST00000489432.2_Missense_Mutation_p.S366C|REPIN1_ENST00000444957.1_Missense_Mutation_p.S309C|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000540729.1_Missense_Mutation_p.S309C|REPIN1_ENST00000479668.1_3'UTR	p.S309C	NM_014374.3	NP_055189.2	0	1	1	1.995005	Q9BWE0	REPI1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)	1	1004	+	Ovarian(565;0.183)|Melanoma(164;0.226)		C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	ENST00000425389.2	0	1	hg19	c.926C>G	CCDS43677.1	0	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450922	0.43531	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000488943;ENST00000425389	T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13	4.91	4.91	0.64330	4.91	4.91	0.64330	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55049	0.1896	N	0.08118	0	0.22354	N	0.99917	P;D	0.76494	0.553;0.999	B;D	0.69142	0.062;0.962	T	0.49062	-0.8978	9	0.52906	T	0.07	-6.4308	10.6565	0.45678	0.1909:0.8091:0.0:0.0	.	366;309	C9J3L7;Q9BWE0	.;REPI1_HUMAN	C	309;309;309;366;369;309	ENSP00000445016:S309C;ENSP00000380451:S309C;ENSP00000407714:S309C;ENSP00000417291:S366C;ENSP00000419872:S369C;ENSP00000388287:S309C	ENSP00000380451:S309C	S	+	2	0	0	REPIN1	149700189	149700189	0.000000	0.05858	0.995000	0.50966	0.986000	0.74619	-0.090000	0.11163	2.550000	0.86006	0.462000	0.41574	TCT	0.284512		TCGA-HZ-A4BK-01A-11D-A26I-08	0.701	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	0	0	1		2	2	2	0		0	0	19		19	19	1	1.790000	-19.242480	1	0.320000	NM_014374			11	11		72	72	0		1	1		0	0	19	0		0.998720	9.827401e-01	0	5	0	44	0	11	72
SLCO5A1	81796	broad.mit.edu	37	8	70617453	70617453	+	Missense_Mutation	SNP	C	C	T	rs141622109		TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr8:70617453C>T	ENST00000260126.4	-	6	2141	c.1435G>A	c.(1435-1437)Gtc>Atc	p.V479I	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.V479I|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.V424I	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	479						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GCACTGGGGACGATAATAACC	0.413																																						ENST00000260126.4	0.930000	0.500000	8.300000e-01	6.000000e-01	0.700000	0.719057	0.700000	0.710000																										0				53						c.(1435-1437)Gtc>Atc		solute carrier organic anion transporter family, member 5A1		C	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	57.0	59.0	58.0		1435,1270,1435	5.6	1.0	8	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	SLCO5A1	NM_001146008.1,NM_001146009.1,NM_030958.2	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	479/688,424/794,479/849	70617453	1,13005	2203	4300	6503	SO:0001583	missense	81796	2	121412	34				g.chr8:70617453C>T	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1435G>A	chr8.hg19:g.70617453C>T	ENSP00000260126:p.Val479Ile	0					SLCO5A1_ENST00000524945.1_Missense_Mutation_p.V479I|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.V424I	p.V479I	NM_030958.2	NP_112220.2	0	1	1	1.950419	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)	6	2141	-	Breast(64;0.0654)		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	1	1	hg19	c.1435G>A	CCDS6205.1	0	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265449	0.40095	0.0	1.16E-4	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.39787	1.06;1.06;1.06	5.55	5.55	0.83447	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.46464	0.1394	N	0.17474	0.49	0.44221	D	0.997051	D;D;P;P	0.89917	1.0;0.961;0.798;0.871	D;P;B;B	0.83275	0.996;0.621;0.261;0.144	T	0.16689	-1.0394	10	0.05436	T	0.98	.	19.8764	0.96873	0.0:1.0:0.0:0.0	.	424;424;479;479	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	I	479;479;424	ENSP00000260126:V479I;ENSP00000434422:V479I;ENSP00000431611:V424I	ENSP00000260126:V479I	V	-	1	0	0	SLCO5A1	70780007	70780007	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	7.748000	0.85085	2.768000	0.95171	0.655000	0.94253	GTC	0.273504		TCGA-HZ-A4BK-01A-11D-A26I-08	0.413	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	1	0	1		2	2	2	0		0	0	34		34	34	1	1.790000	-20.000000	1	0.320000	NM_030958			35	35		253	251	1		1			0	0	34	0		1.000000	0	0	0	0	0	0	35	253
KCNB2	9312	broad.mit.edu	37	8	73480175	73480175	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr8:73480175C>A	ENST00000523207.1	+	2	794	c.206C>A	c.(205-207)aCa>aAa	p.T69K		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	69					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GACTGCAACACACACGAGAGC	0.522																																						ENST00000523207.1	0.700000	0.400000	6.300000e-01	4.600000e-01	0.540000	0.551796	0.540000	0.540000																										0				85						c.(205-207)aCa>aAa		potassium voltage-gated channel, Shab-related subfamily, member 2	Dalfampridine(DB06637)						80.0	79.0	79.0					8																	73480175		2203	4300	6503	SO:0001583	missense	9312	0	0					g.chr8:73480175C>A	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.206C>A	chr8.hg19:g.73480175C>A	ENSP00000430846:p.Thr69Lys	0						p.T69K	NM_004770.2	NP_004761.2	0	1	1	1.950419	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)	2	794	+	Breast(64;0.137)		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	1	1	hg19	c.206C>A	CCDS6209.1	0	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562910	0.86335	.	.	ENSG00000182674	ENST00000523207	D	0.97041	-4.22	5.71	3.79	0.43588	5.71	3.79	0.43588	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.470461	0.15701	U	0.248917	D	0.97235	0.9096	L	0.43598	1.365	0.47905	D	0.999541	P	0.47677	0.899	P	0.60012	0.867	D	0.97404	0.9998	10	0.87932	D	0	.	15.8203	0.78633	0.0:0.7433:0.2567:0.0	.	69	Q92953	KCNB2_HUMAN	K	69	ENSP00000430846:T69K	ENSP00000430846:T69K	T	+	2	0	0	KCNB2	73642729	73642729	0.998000	0.40836	0.971000	0.41717	0.997000	0.91878	3.977000	0.56874	1.404000	0.46819	0.655000	0.94253	ACA	0.273504		TCGA-HZ-A4BK-01A-11D-A26I-08	0.522	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	1	0	1		2	2	2	0		0	0	79		79	78	1	1.790000	-20.000000	1	0.320000	NM_004770			45	44		438	433	0		1			0	0	79	0		1.000000	0	0	0	0	0	0	45	438
CSMD3	114788	broad.mit.edu	37	8	113697836	113697836	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr8:113697836G>A	ENST00000297405.5	-	15	2525	c.2281C>T	c.(2281-2283)Ctt>Ttt	p.L761F	CSMD3_ENST00000352409.3_Missense_Mutation_p.L761F|CSMD3_ENST00000455883.2_Missense_Mutation_p.L657F|CSMD3_ENST00000343508.3_Missense_Mutation_p.L721F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	761	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L721V(2)|p.L761V(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTGAAAGAAAGATGTATCCGG	0.428										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												ENST00000297405.5	0.570000	0.320000	5.100000e-01	3.700000e-01	0.430000	0.446266	0.430000	0.440000																										4	Substitution - Missense(4)	p.L721V(2)|p.L761V(2)	lung(4)	646						c.(2281-2283)Ctt>Ttt		CUB and Sushi multiple domains 3							103.0	110.0	107.0					8																	113697836		2203	4300	6503	SO:0001583	missense	114788	0	0					g.chr8:113697836G>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2281C>T	chr8.hg19:g.113697836G>A	ENSP00000297405:p.Leu761Phe	0	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_ENST00000352409.3_Missense_Mutation_p.L761F|CSMD3_ENST00000455883.2_Missense_Mutation_p.L657F|CSMD3_ENST00000343508.3_Missense_Mutation_p.L721F	p.L761F	NM_198123.1	NP_937756.1	0	1	1	1.950419	Q7Z407	CSMD3_HUMAN		15	2525	-			Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	1	1	hg19	c.2281C>T	CCDS6315.1	0	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921663	0.73213	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	5.96	5.09	0.68999	5.96	5.09	0.68999	CUB (5);	0.000000	0.64402	D	0.000009	T	0.64670	0.2619	M	0.86420	2.815	0.34498	D	0.705682	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	T	0.77381	-0.2609	10	0.40728	T	0.16	.	15.1353	0.72558	0.0675:0.0:0.9325:0.0	.	657;761;721	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	F	721;761;101;657;761	ENSP00000345799:L721F;ENSP00000297405:L761F;ENSP00000341558:L101F;ENSP00000412263:L657F;ENSP00000343124:L761F	ENSP00000297405:L761F	L	-	1	0	0	CSMD3	113767012	113767012	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.552000	0.73914	1.535000	0.49220	0.655000	0.94253	CTT	0.273504		TCGA-HZ-A4BK-01A-11D-A26I-08	0.428	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	1	0	1		2	2	2	0		0	0	73		73	73	1	1.790000	-10.475410	1	0.320000	NM_052900			42	41		517	515	0		1			0	0	73	0		1.000000	0	0	0	0	0	0	42	517
FRMPD1	22844	broad.mit.edu	37	9	37746200	37746200	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr9:37746200G>A	ENST00000539465.1	+	16	4764	c.4171G>A	c.(4171-4173)Gca>Aca	p.A1391T	FRMPD1_ENST00000377765.3_Missense_Mutation_p.A1391T|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.A1391T(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CTGCACCACCGCACCCCTGTC	0.662																																						ENST00000539465.1	0.450000	0.190000	3.800000e-01	2.400000e-01	0.300000	0.315602	0.300000	0.300000																										1	Substitution - Missense(1)	p.A1391T(1)	kidney(1)	93						c.(4171-4173)Gca>Aca		FERM and PDZ domain containing 1							31.0	37.0	35.0					9																	37746200		2203	4300	6503	SO:0001583	missense	22844	2	121398	34				g.chr9:37746200G>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4171G>A	chr9.hg19:g.37746200G>A	ENSP00000444411:p.Ala1391Thr	0					FRMPD1_ENST00000377765.3_Missense_Mutation_p.A1391T|RP11-613M10.9_ENST00000540557.1_Intron	p.A1391T			0	1	1	1.903436	Q5SYB0	FRPD1_HUMAN		16	4764	+			B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	1	1	hg19	c.4171G>A	CCDS6612.1	0	.	.	.	.	.	.	.	.	.	.	G	1.279	-0.610757	0.03690	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.06608	3.28;3.28	5.3	4.39	0.52855	5.3	4.39	0.52855	.	1.000500	0.08067	N	0.999257	T	0.03305	0.0096	N	0.08118	0	0.19575	N	0.999967	B	0.27679	0.185	B	0.17722	0.019	T	0.35375	-0.9791	10	0.17832	T	0.49	-1.3239	6.7298	0.23377	0.0936:0.1812:0.7251:0.0	.	1391	Q5SYB0	FRPD1_HUMAN	T	1391	ENSP00000366995:A1391T;ENSP00000444411:A1391T	ENSP00000366995:A1391T	A	+	1	0	0	FRMPD1	37736200	37736200	0.008000	0.16893	0.010000	0.14722	0.003000	0.03518	1.688000	0.37690	2.475000	0.83589	0.655000	0.94253	GCA	0.255692		TCGA-HZ-A4BK-01A-11D-A26I-08	0.662	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	0	0	1		2	2	2	0		0	0	66		66	66	1	1.790000	-2.967652	1	0.320000	NM_014907			20	20		355	350	0		1			0	0	66	0		0.999995	0	0	0	0	0	0	20	355
FGD3	89846	broad.mit.edu	37	9	95773521	95773521	+	Silent	SNP	C	C	T	rs140324424	byFrequency	TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr9:95773521C>T	ENST00000375482.3	+	8	1498	c.1002C>T	c.(1000-1002)gcC>gcT	p.A334A	FGD3_ENST00000416701.2_Silent_p.A334A|FGD3_ENST00000337352.6_Silent_p.A334A	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	334	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.A334A(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						TCTCCACAGCCGCCAACCACT	0.632													c|||	6	0.00119808	0.0045	0.0	5008	,	,		15967	0.0		0.0	False		,,,				2504	0.0					ENST00000375482.3	0.480000	0.230000	4.200000e-01	2.800000e-01	0.340000	0.357669	0.340000	0.350000																										2	Substitution - coding silent(2)	p.A334A(2)	lung(2)	17						c.(1000-1002)gcC>gcT		FYVE, RhoGEF and PH domain containing 3		C	,	5,4207		0,5,2101	64.0	77.0	73.0		1002,1002	-4.6	0.9	9	dbSNP_134	73	1,8503		0,1,4251	no	coding-synonymous,coding-synonymous	FGD3	NM_001083536.1,NM_033086.2	,	0,6,6352	TT,TC,CC		0.0118,0.1187,0.0472	,	334/726,334/726	95773521	6,12710	2106	4252	6358	SO:0001819	synonymous_variant	89846	29	121078	47				g.chr9:95773521C>T	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1002C>T	chr9.hg19:g.95773521C>T		0					FGD3_ENST00000416701.2_Silent_p.A334A|FGD3_ENST00000337352.6_Silent_p.A334A	p.A334A	NM_001083536.1	NP_001077005.1	0	1	1	1.903436	Q5JSP0	FGD3_HUMAN		8	1498	+			F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Silent	SNP	ENST00000375482.3	1	1	hg19	c.1002C>T	CCDS43849.1	0																																																																																								0.255692		TCGA-HZ-A4BK-01A-11D-A26I-08	0.632	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	1	0	1		2	2	2	0		0	0	86		86	85	1	1.790000	-2.879450	1	0.320000	NM_033086			29	28		445	441	0		1	0		0	0	86	0		1.000000	7.386623e-01	0	0	0	42	0	29	445
SVEP1	79987	broad.mit.edu	37	9	113261346	113261346	+	Silent	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chr9:113261346G>A	ENST00000401783.2	-	7	1992	c.1656C>T	c.(1654-1656)gtC>gtT	p.V552V	SVEP1_ENST00000302728.8_Silent_p.V552V|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Silent_p.V529V|SVEP1_ENST00000374461.1_Silent_p.V529V	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	552	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCTGAACTCCGACATTCCATT	0.413																																						ENST00000401783.2	0.840000	0.340000	7.100000e-01	4.400000e-01	0.560000	0.583911	0.560000	0.550000																										0				147						c.(1654-1656)gtC>gtT		sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1							60.0	56.0	57.0					9																	113261346		1933	4152	6085	SO:0001819	synonymous_variant	79987	13	120904	40				g.chr9:113261346G>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1656C>T	chr9.hg19:g.113261346G>A		0					SVEP1_ENST00000302728.8_Silent_p.V552V|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Silent_p.V529V|SVEP1_ENST00000374461.1_Silent_p.V529V	p.V552V	NM_153366.3	NP_699197.3	0	1	1	1.903436	Q4LDE5	SVEP1_HUMAN		7	1992	-			Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	0	1	hg19	c.1656C>T	CCDS48004.1	0																																																																																								0.255692		TCGA-HZ-A4BK-01A-11D-A26I-08	0.413	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	24		24	24	1	1.790000	-3.142743	1	0.320000				17	17		154	151	0		1	0		0	0	24	0		0.999969	0	0	0	0	1	0	17	154
GPM6B	2824	broad.mit.edu	37	X	13803924	13803924	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chrX:13803924C>T	ENST00000356942.5	-	2	506	c.65G>A	c.(64-66)tGc>tAc	p.C22Y	GPM6B_ENST00000316715.4_Missense_Mutation_p.C62Y|GPM6B_ENST00000355135.2_Missense_Mutation_p.C62Y|GPM6B_ENST00000493677.1_Missense_Mutation_p.C36Y|GPM6B_ENST00000454189.2_Missense_Mutation_p.C3Y|GPM6B_ENST00000398361.3_5'UTR	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	22					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						GCATTCAAAGCAGCCTGAACC	0.527																																						ENST00000356942.5	0.560000	0.240000	4.800000e-01	3.100000e-01	0.380000	0.400205	0.380000	0.390000																										0				6						c.(64-66)tGc>tAc		glycoprotein M6B							40.0	35.0	37.0					X																	13803924		2203	4300	6503	SO:0001583	missense	2824	0	0					g.chrX:13803924C>T		CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.65G>A	chrX.hg19:g.13803924C>T	ENSP00000349420:p.Cys22Tyr						GPM6B_ENST00000454189.2_Missense_Mutation_p.C3Y|GPM6B_ENST00000493677.1_Missense_Mutation_p.C36Y|GPM6B_ENST00000398361.3_5'UTR|GPM6B_ENST00000355135.2_Missense_Mutation_p.C62Y|GPM6B_ENST00000316715.4_Missense_Mutation_p.C62Y	p.C22Y	NM_005278.3	NP_005269.1	0	1	1		Q13491	GPM6B_HUMAN		2	506	-			O76077|Q86X43|Q8N956	Missense_Mutation	SNP	ENST00000356942.5	1	1	hg19	c.65G>A	CCDS14158.1	0	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434116	0.83776	.	.	ENSG00000046653	ENST00000316715;ENST00000454189;ENST00000493677;ENST00000355135;ENST00000356942;ENST00000475307	D;D;D;D;D;D	0.99245	-5.62;-5.62;-5.62;-5.62;-5.62;-5.62	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.99450	0.9805	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.999	D	0.98897	1.0775	10	0.87932	D	0	-0.0619	18.8027	0.92025	0.0:1.0:0.0:0.0	.	36;3;22;62;14;62	B7Z613;Q13491-2;Q13491;Q13491-3;Q59FD5;Q8N956	.;.;GPM6B_HUMAN;.;.;.	Y	62;3;36;62;22;22	ENSP00000316861:C62Y;ENSP00000389915:C3Y;ENSP00000419904:C36Y;ENSP00000347258:C62Y;ENSP00000349420:C22Y;ENSP00000418594:C22Y	ENSP00000316861:C62Y	C	-	2	0	0	GPM6B	13713845	13713845	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.350000	0.79385	2.387000	0.81309	0.600000	0.82982	TGC	0.320000		TCGA-HZ-A4BK-01A-11D-A26I-08	0.527	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055822.1	1	0	1		2	2	2	0		0	0	30		30	30	1	1.790000	-20.000000	1	0.320000	NM_001001995			19	19		133	130	0		1	0		0	0	30	0		0.999992	1.759531e-02	0	0	0	2	0	19	133
ZIC3	7547	broad.mit.edu	37	X	136649486	136649486	+	Silent	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chrX:136649486C>T	ENST00000287538.5	+	1	1186	c.636C>T	c.(634-636)gcC>gcT	p.A212A	ZIC3_ENST00000370606.3_Silent_p.A212A|RP1-137H15.2_ENST00000442841.1_RNA	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	212					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					CCTACGCGGCCGGCGCTCAGT	0.662																																						ENST00000287538.5	0.440000	0.200000	3.800000e-01	2.500000e-01	0.300000	0.317809	0.300000	0.310000																										0				37						c.(634-636)gcC>gcT		Zic family member 3							21.0	25.0	23.0					X																	136649486		2156	4210	6366	SO:0001819	synonymous_variant	7547	0	0					g.chrX:136649486C>T	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.636C>T	chrX.hg19:g.136649486C>T							RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Silent_p.A212A	p.A212A	NM_003413.3	NP_003404.1	0	1	1		O60481	ZIC3_HUMAN		1	1186	+	Acute lymphoblastic leukemia(192;0.000127)		B2CNW4|Q14DE5|Q5JY75	Silent	SNP	ENST00000287538.5	1	1	hg19	c.636C>T	CCDS14663.1	0																																																																																								0.320000		TCGA-HZ-A4BK-01A-11D-A26I-08	0.662	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1	1	0	1		2	2	2	0		0	0	36		36	36	1	1.790000	-3.221898	1	0.320000				22	22		200	199	0		1			0	0	36	0		0.999999	0	0	0	0	0	0	22	200
DHRSX	207063	broad.mit.edu	37	X	2161133	2161133	+	Silent	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chrX:2161133C>T	ENST00000334651.5	-	6	787	c.735G>A	c.(733-735)acG>acA	p.T245T		NM_145177.2	NP_660160.2	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	245							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)	16		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TGTAGACGTCCGTGTTGACCA	0.617																																						ENST00000334651.5	0.300000	0.130000	2.600000e-01	1.600000e-01	0.200000	0.214454	0.200000	0.210000																										0				16						c.(733-735)acG>acA		dehydrogenase/reductase (SDR family) X-linked							111.0	103.0	106.0					X																	2161133		2203	4296	6499	SO:0001819	synonymous_variant	207063	0	0					g.chrX:2161133C>T	AJ293620	CCDS35195.1	Xp22.33 and Yp11.2	2014-05-07	2003-09-12		ENSG00000169084	ENSG00000169084		"""Pseudoautosomal regions / PAR1"""	18399	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 6"", ""short chain dehydrogenase/reductase family 46C, member 1"", ""dehydrogenase/reductase (SDR family) Y-linked"""		"""dehydrogenase/reductase (SDR family) X chromosome"""			11731500, 19027726	Standard	NM_145177		Approved	DHRS5X, DHRSXY, DHRSY, DHRS5Y, SDR46C1, SDR7C6	uc004cqf.4	Q8N5I4	OTTHUMG00000021068	ENST00000334651.5:c.735G>A	chrX.hg19:g.2161133C>T								p.T245T	NM_145177.2	NP_660160.2	0	1	1		Q8N5I4	DHRSX_HUMAN		6	787	-		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	Q6UWC7|Q8WUS4|Q96GR8|Q9NTF6	Silent	SNP	ENST00000334651.5	1	1	hg19	c.735G>A	CCDS35195.1	0																																																																																								0.320000		TCGA-HZ-A4BK-01A-11D-A26I-08	0.617	DHRSX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055617.3	1	0	1		2	2	2	0		0	0	81		81	80	1	1.790000	-2.578491	1	0.320000	NM_145177			22	22		309	301	1		1	1		0	0	81	0		0.999999	9.987984e-01	0	21	0	130	0	22	309
STS	412	broad.mit.edu	37	X	7223159	7223159	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chrX:7223159G>A	ENST00000217961.4	+	7	1251	c.1031G>A	c.(1030-1032)gGa>gAa	p.G344E		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	344					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	TCGGACCAGGGAGCACATGTA	0.458									Ichthyosis																													ENST00000217961.4	0.390000	0.180000	3.400000e-01	2.300000e-01	0.270000	0.287685	0.270000	0.280000																										0				27						c.(1030-1032)gGa>gAa		steroid sulfatase (microsomal), isozyme S	Norelgestromin(DB06713)						129.0	108.0	115.0					X																	7223159		2203	4299	6502	SO:0001583	missense	412	0	0		Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chrX:7223159G>A	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1031G>A	chrX.hg19:g.7223159G>A	ENSP00000217961:p.Gly344Glu							p.G344E	NM_000351.4	NP_000342.2	0	1	1		P08842	STS_HUMAN		7	1251	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	1	1	hg19	c.1031G>A	CCDS14127.1	0	.	.	.	.	.	.	.	.	.	.	G	13.21	2.167811	0.38315	.	.	ENSG00000101846	ENST00000217961	D	0.99811	-6.87	3.7	3.7	0.42460	3.7	3.7	0.42460	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	H	0.99825	4.815	0.43107	D	0.994805	D	0.89917	1.0	D	0.97110	1.0	D	0.96487	0.9361	10	0.87932	D	0	.	10.6511	0.45649	0.0:0.0:1.0:0.0	.	344	P08842	STS_HUMAN	E	344	ENSP00000217961:G344E	ENSP00000217961:G344E	G	+	2	0	0	STS	7233159	7233159	1.000000	0.71417	0.030000	0.17652	0.085000	0.17905	5.739000	0.68622	1.615000	0.50252	0.600000	0.82982	GGA	0.320000		TCGA-HZ-A4BK-01A-11D-A26I-08	0.458	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	1	0	1		2	2	2	0		0	0	30		30	30	1	1.790000	-9.894793	1	0.320000	NM_000351			27	27		273	272	0		1	0		0	0	30	0		1.000000	5.017237e-01	0	1	0	17	0	27	273
SRPK3	26576	broad.mit.edu	37	X	153048258	153048258	+	Silent	SNP	C	C	T			TCGA-HZ-A4BK-01A-11D-A26I-08	TCGA-HZ-A4BK-10A-01D-A26I-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	805a330c-6335-4dd8-ad62-faa95c624aa9	1d425431-396e-4129-97c6-b5e29cb9daae	g.chrX:153048258C>T	ENST00000370101.3	+	6	553	c.507C>T	c.(505-507)caC>caT	p.H169H	SRPK3_ENST00000393786.3_Silent_p.H169H|SRPK3_ENST00000489426.1_Silent_p.H236H|SRPK3_ENST00000370100.1_Silent_p.H127H|SRPK3_ENST00000370108.3_Silent_p.H169H|SRPK3_ENST00000370104.1_Silent_p.H169H	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TGCTGGGCCACCAGCTCCTCA	0.652																																					Esophageal Squamous(167;766 3400 32156)	ENST00000370101.3	0.630000	0.270000	5.400000e-01	3.500000e-01	0.430000	0.449075	0.430000	0.430000																										0				13						c.(505-507)caC>caT		SRSF protein kinase 3							45.0	37.0	40.0					X																	153048258		2202	4295	6497	SO:0001819	synonymous_variant	26576	0	0					g.chrX:153048258C>T	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.507C>T	chrX.hg19:g.153048258C>T							SRPK3_ENST00000370104.1_Silent_p.H169H|SRPK3_ENST00000370108.3_Silent_p.H169H|SRPK3_ENST00000393786.3_Silent_p.H169H|SRPK3_ENST00000489426.1_Silent_p.H236H|SRPK3_ENST00000370100.1_Silent_p.H127H	p.H169H	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	0	1	1		Q9UPE1	SRPK3_HUMAN		6	553	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		Q13583|Q4F970|Q562F5|Q9UM62	Silent	SNP	ENST00000370101.3	0	1	hg19	c.507C>T	CCDS35441.1	0	.	.	.	.	.	.	.	.	.	.	C	4.748	0.139064	0.09083	.	.	ENSG00000184343	ENST00000430541	.	.	.	5.77	0.999	0.19862	5.77	0.999	0.19862	.	.	.	.	.	T	0.55752	0.1940	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46233	-0.9206	4	.	.	.	-36.8803	8.7166	0.34414	0.0:0.4138:0.0:0.5862	.	.	.	.	I	183	.	.	T	+	2	0	0	SRPK3	152701452	152701452	0.863000	0.29885	0.998000	0.56505	0.360000	0.29518	-0.028000	0.12350	0.040000	0.15660	-0.192000	0.12808	ACC	0.320000		TCGA-HZ-A4BK-01A-11D-A26I-08	0.652	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	1	0	1		2	2	2	0		0	0	18		18	18	1	1.790000	-20.000000	1	0.320000	NM_014370			19	19		116	115	1		1	0		0	0	18	0		0.999994	2.221517e-02	0	0	0	2	0	19	116
