#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TP53	7157	broad.mit.edu	37	17	7578484	7578485	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			-	A	-	-		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr17:7578484_7578485insA	ENST00000269305.4	-	5	634_635	c.445_446insT	c.(445-447)tccfs	p.S149fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.S149fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	149	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> F (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S149F(6)|p.S149fs*32(5)|p.S149P(4)|p.S149T(2)|p.D148_T155delDSTPPPGT(1)|p.Q144_G154del11(1)|p.W146_S149>C(1)|p.Q144fs*16(1)|p.S149fs*21(1)|p.D148fs*23(1)|p.S149fs*31(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGGGGTGTGGAATCAACCCAC	0.604		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.840000	0.420000	7.300000e-01	5.100000e-01	0.610000	0.626332	0.610000	0.610000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		35	Substitution - Missense(12)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(5)|Deletion - In frame(3)|Complex - deletion inframe(1)	p.0?(8)|p.S149F(6)|p.S149fs*32(5)|p.S149P(4)|p.S149T(2)|p.D148_T155delDSTPPPGT(1)|p.Q144_G154del11(1)|p.W146_S149>C(1)|p.Q144fs*16(1)|p.S149fs*21(1)|p.D148fs*23(1)|p.S149fs*31(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.V143_S149del(1)	upper_aerodigestive_tract(5)|breast(5)|lung(4)|bone(4)|central_nervous_system(3)|skin(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|thyroid(1)|large_intestine(1)|stomach(1)|urinary_tract(1)|liver(1)|oesophagus(1)	24185						c.(445-447)tccfs	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)																																			SO:0001589	frameshift_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578484_7578485insA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.446dupT	chr17.hg19:g.7578486_7578486dupA	ENSP00000269305:p.Ser149fs	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.S149fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.S149fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.S149fs	p.S149fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.787065	P04637	P53_HUMAN		5	634_635	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	0	1	hg19	c.445_446insT	CCDS11118.1	0																																																																																								0.123596		TCGA-HZ-A77P-01A-11D-A33T-08	0.604	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0	0	0	0	52	0	52	51	1	1.990000	-20.000000	1	0.220000	NM_000546		0	28	28	0	337	329	0	0	1	0	1	0	0	52	1622	0	1.000000	9.827555e-01	1	0	244	80	1968	28	337
CEP350	9857	broad.mit.edu	37	1	179989588	179989594	+	Frame_Shift_Del	DEL	TCAGAAG	TCAGAAG	-			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr1:179989588_179989594delTCAGAAG	ENST00000367607.3	+	12	3097_3103	c.2679_2685delTCAGAAG	c.(2677-2685)attcagaagfs	p.IQK893fs		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	893					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTGCCAGAATTCAGAAGATGCTGGGAA	0.425																																						ENST00000367607.3	1.000000	0.520000	8.500000e-01	6.100000e-01	0.710000	0.735397	0.710000	0.710000																										0				66						c.(2677-2685)attcagaagfs		centrosomal protein 350kDa																																				SO:0001589	frameshift_variant	9857	0	0					g.chr1:179989588_179989594delTCAGAAG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2679_2685delTCAGAAG	chr1.hg19:g.179989588_179989594delTCAGAAG	ENSP00000356579:p.Ile893fs	0						p.IQK893fs	NM_014810.4	NP_055625.4	1	2	3	2.016180	Q5VT06	CE350_HUMAN		12	3097_3103	+			O75068|Q8TDK3|Q8WY20	Frame_Shift_Del	DEL	ENST00000367607.3	1	1	hg19	c.2679_2685delTCAGAAG	CCDS1336.1	0																																																																																								0.225114		TCGA-HZ-A77P-01A-11D-A33T-08	0.425	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	1	0	1		2	2		0	0	0	0	83	0	83	83	1	1.990000	-3.221883	1	0.220000	NM_014810		0	42	51	0	497	497	0	0	1	0		0	0	83	0	0	1.000000	1.869187e-01		0	0	10	0	42	497
SVIL	6840	broad.mit.edu	37	10	29822208	29822208	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr10:29822208G>A	ENST00000355867.4	-	8	1840	c.1088C>T	c.(1087-1089)cCa>cTa	p.P363L	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Missense_Mutation_p.P363L	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	363					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GCCACGGATTGGCTGTCGTGT	0.557																																						ENST00000355867.4	1.000000	0.670000	1	7.900000e-01	0.930000	0.909164	0.930000	1.000000																										0				112						c.(1087-1089)cCa>cTa		supervillin							89.0	75.0	79.0					10																	29822208		2203	4300	6503	SO:0001583	missense	6840	0	0					g.chr10:29822208G>A	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1088C>T	chr10.hg19:g.29822208G>A	ENSP00000348128:p.Pro363Leu	0					SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Missense_Mutation_p.P363L	p.P363L	NM_021738.2	NP_068506.2	1	2	3	2.006060	O95425	SVIL_HUMAN		8	1840	-		Breast(68;0.103)	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	1	1	hg19	c.1088C>T	CCDS7164.1	1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222354	0.58560	.	.	ENSG00000197321	ENST00000375398;ENST00000355867	T;T	0.50277	0.75;0.75	5.85	4.01	0.46588	5.85	4.01	0.46588	.	0.127449	0.51477	N	0.000083	T	0.50394	0.1613	M	0.71581	2.175	0.80722	D	1	P	0.51933	0.949	P	0.45310	0.476	T	0.51710	-0.8671	9	.	.	.	-7.9583	12.1685	0.54144	0.137:0.0:0.863:0.0	.	363	O95425	SVIL_HUMAN	L	363	ENSP00000364547:P363L;ENSP00000348128:P363L	.	P	-	2	0	0	SVIL	29862214	29862214	0.999000	0.42202	0.113000	0.21522	0.654000	0.38779	2.965000	0.49200	0.823000	0.34589	0.655000	0.94253	CCA	0.221712		TCGA-HZ-A77P-01A-11D-A33T-08	0.557	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1	1	0	1	2	2	2	2	0	0	0	0	60	60	60	58	1	1.990000	-3.221884	1	0.220000			0	39	39	0	343	343	0		1	0		0	0	60	0	0	1.000000	1	0	0	0	285	0	39	343
CUL2	8453	broad.mit.edu	37	10	35317808	35317808	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr10:35317808G>A	ENST00000374748.1	-	17	1860	c.1547C>T	c.(1546-1548)gCg>gTg	p.A516V	CUL2_ENST00000374749.3_Missense_Mutation_p.A516V|CUL2_ENST00000374746.1_Missense_Mutation_p.A516V|CUL2_ENST00000537177.1_Missense_Mutation_p.A535V|CUL2_ENST00000374751.3_Missense_Mutation_p.A516V|CUL2_ENST00000374742.1_Missense_Mutation_p.A516V|CUL2_ENST00000602371.1_Missense_Mutation_p.A459V			Q13617	CUL2_HUMAN	cullin 2	516					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						AAGAGGCCACGCACCAGCCTA	0.318																																						ENST00000374748.1	1.000000	0.670000	1	8.300000e-01	0.990000	0.937111	0.990000	1.000000																										0				31						c.(1546-1548)gCg>gTg		cullin 2							35.0	37.0	36.0					10																	35317808		2203	4300	6503	SO:0001583	missense	8453	0	0					g.chr10:35317808G>A	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.1547C>T	chr10.hg19:g.35317808G>A	ENSP00000363880:p.Ala516Val	0					CUL2_ENST00000602371.1_Missense_Mutation_p.A459V|CUL2_ENST00000374751.3_Missense_Mutation_p.A516V|CUL2_ENST00000374742.1_Missense_Mutation_p.A516V|CUL2_ENST00000374749.3_Missense_Mutation_p.A516V|CUL2_ENST00000374746.1_Missense_Mutation_p.A516V|CUL2_ENST00000537177.1_Missense_Mutation_p.A535V	p.A516V			1	2	3	2.006060	Q13617	CUL2_HUMAN		17	1860	-			B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	1	1	hg19	c.1547C>T	CCDS7179.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.511389	0.96386	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177	T;T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77;-0.77	5.77	5.77	0.91146	5.77	5.77	0.91146	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.84745	0.5540	L	0.56280	1.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.995	D	0.84150	0.0422	10	0.59425	D	0.04	-21.1493	20.3626	0.98863	0.0:0.0:1.0:0.0	.	516;535;516	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	V	516;516;516;516;459;516;535	ENSP00000363883:A516V;ENSP00000363880:A516V;ENSP00000363878:A516V;ENSP00000363881:A516V;ENSP00000363874:A516V;ENSP00000444856:A535V	ENSP00000363874:A516V	A	-	2	0	0	CUL2	35357814	35357814	1.000000	0.71417	0.975000	0.42487	0.987000	0.75469	9.864000	0.99589	2.885000	0.99019	0.655000	0.94253	GCG	0.221712		TCGA-HZ-A77P-01A-11D-A33T-08	0.318	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.990000	-11.057850	1	0.220000	NM_003591		0	25	25	0	201	200	1		1	1		0	0	36	0	0	1.000000	9.895377e-01	0	2	0	59	0	25	201
KCNIP2	30819	broad.mit.edu	37	10	103590842	103590842	+	Silent	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr10:103590842G>A	ENST00000356640.2	-	2	431	c.156C>T	c.(154-156)ccC>ccT	p.P52P	KCNIP2_ENST00000358038.3_Silent_p.P52P|KCNIP2_ENST00000343195.4_Intron|KCNIP2_ENST00000370046.1_Intron|KCNIP2_ENST00000348850.5_Intron|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000353068.3_Intron|KCNIP2_ENST00000461105.1_Silent_p.P52P	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	52					clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		CACTGACTGAGGGCAGGGCTT	0.637																																						ENST00000356640.2	1.000000	0.800000	1	9.900000e-01	0.990000	0.985020	0.990000	1.000000																										0				11						c.(154-156)ccC>ccT		Kv channel interacting protein 2							41.0	42.0	41.0					10																	103590842		2203	4300	6503	SO:0001819	synonymous_variant	30819	0	0					g.chr10:103590842G>A		CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.156C>T	chr10.hg19:g.103590842G>A		0					KCNIP2_ENST00000370046.1_Intron|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000461105.1_Silent_p.P52P|KCNIP2_ENST00000358038.3_Silent_p.P52P|KCNIP2_ENST00000343195.4_Intron|KCNIP2_ENST00000353068.3_Intron|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000348850.5_Intron	p.P52P	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	1	2	3	2.021251	Q9NS61	KCIP2_HUMAN		2	431	-		Colorectal(252;0.122)	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Silent	SNP	ENST00000356640.2	0	1	hg19	c.156C>T	CCDS7522.1	1																																																																																								0.225960		TCGA-HZ-A77P-01A-11D-A33T-08	0.637	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049973.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.990000	-20.000000	1	0.220000			0	19	19	0	119	116	1		1	0		0	0	16	0	0	0.999993	0	0	0	0	1	0	19	119
ARNTL	406	broad.mit.edu	37	11	13408297	13408297	+	Silent	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr11:13408297G>T	ENST00000403290.1	+	20	2230	c.1875G>T	c.(1873-1875)ccG>ccT	p.P625P	ARNTL_ENST00000401424.1_Silent_p.P582P|ARNTL_ENST00000361003.4_Silent_p.P507P|ARNTL_ENST00000389707.4_Silent_p.P624P|ARNTL_ENST00000396441.3_Silent_p.P624P|ARNTL_ENST00000403510.3_Silent_p.P581P|ARNTL_ENST00000389708.3_3'UTR|ARNTL_ENST00000403482.3_Silent_p.P623P			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	625					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		TGCCATGGCCGCTGTAAACAC	0.468																																						ENST00000403290.1	1.000000	0.540000	8.800000e-01	6.400000e-01	0.740000	0.761516	0.740000	0.730000																										0				20						c.(1873-1875)ccG>ccT		aryl hydrocarbon receptor nuclear translocator-like							147.0	121.0	130.0					11																	13408297		2200	4294	6494	SO:0001819	synonymous_variant	406	0	0					g.chr11:13408297G>T	D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1875G>T	chr11.hg19:g.13408297G>T		0					ARNTL_ENST00000403510.3_Silent_p.P581P|ARNTL_ENST00000401424.1_Silent_p.P582P|ARNTL_ENST00000403482.3_Silent_p.P623P|ARNTL_ENST00000389708.3_3'UTR|ARNTL_ENST00000361003.4_Silent_p.P507P|ARNTL_ENST00000396441.3_Silent_p.P624P|ARNTL_ENST00000389707.4_Silent_p.P624P	p.P625P			1	2	3	2.008733	O00327	BMAL1_HUMAN		20	2230	+			A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Silent	SNP	ENST00000403290.1	1	1	hg19	c.1875G>T		0																																																																																								0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.468	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000319173.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.990000	-3.221883	1	0.220000	NM_001178		0	40	40	0	450	448	0		1	1		0	0	52	0	0	1.000000	7.617485e-01	0	3	0	30	0	40	450
PAX6	5080	broad.mit.edu	37	11	31823124	31823124	+	Silent	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr11:31823124G>A	ENST00000379132.3	-	5	622	c.342C>T	c.(340-342)aaC>aaT	p.N114N	PAX6_ENST00000379111.2_Silent_p.N114N|PAX6_ENST00000379129.2_Silent_p.N128N|PAX6_ENST00000533156.1_5'Flank|PAX6_ENST00000241001.8_Silent_p.N114N|PAX6_ENST00000419022.1_Silent_p.N128N|PAX6_ENST00000379107.2_Silent_p.N128N|PAX6_ENST00000379115.4_Silent_p.N128N|PAX6_ENST00000379123.5_Silent_p.N114N			P26367	PAX6_HUMAN	paired box 6	114	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GTATGTTATCGTTGGTACAGA	0.512									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																													ENST00000379132.3	1.000000	0.750000	1	8.700000e-01	0.990000	0.953550	0.990000	1.000000																										0				35						c.(340-342)aaC>aaT		paired box 6							82.0	78.0	79.0					11																	31823124		2202	4299	6501	SO:0001819	synonymous_variant	5080	0	0		Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation	Familial Cancer Database	WAGR syndrome	g.chr11:31823124G>A	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.342C>T	chr11.hg19:g.31823124G>A		0					PAX6_ENST00000419022.1_Silent_p.N128N|PAX6_ENST00000379107.2_Silent_p.N128N|PAX6_ENST00000379115.4_Silent_p.N128N|PAX6_ENST00000241001.8_Silent_p.N114N|PAX6_ENST00000379129.2_Silent_p.N128N|PAX6_ENST00000379123.5_Silent_p.N114N|PAX6_ENST00000379111.2_Silent_p.N114N|PAX6_ENST00000533156.1_5'Flank	p.N114N			1	2	3	2.008733	P26367	PAX6_HUMAN		5	622	-	Lung SC(675;0.225)		Q6N006|Q99413	Silent	SNP	ENST00000379132.3	1	1	hg19	c.342C>T	CCDS31451.1	1																																																																																								0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.512	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	1.990000	-20.000000	1	0.220000	NM_001604		0	46	46	0	371	368	1		1	0		0	0	48	0	0	1.000000	2.679514e-01	0	0	0	9	0	46	371
HSD17B12	51144	broad.mit.edu	37	11	43852525	43852525	+	Splice_Site	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr11:43852525G>T	ENST00000278353.4	+	7	620		c.e7-1		RP11-613D13.5_ENST00000524643.1_RNA|HSD17B12_ENST00000529261.1_Splice_Site|RP11-613D13.5_ENST00000499066.2_RNA|RP11-613D13.5_ENST00000530450.1_RNA	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12						cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)			endometrium(2)|large_intestine(4)|lung(4)	10						CTCTCTTGCAGATGACACAAT	0.428																																					Ovarian(58;548 1143 13948 16572 34258)	ENST00000278353.4	1.000000	0.500000	8.500000e-01	6.000000e-01	0.710000	0.727512	0.710000	0.700000																										0				10						c.e7-1		hydroxysteroid (17-beta) dehydrogenase 12							184.0	160.0	168.0					11																	43852525		2203	4300	6503	SO:0001630	splice_region_variant	51144	0	0					g.chr11:43852525G>T	AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.502-1G>T	chr11.hg19:g.43852525G>T		0					RP11-613D13.5_ENST00000524643.1_RNA|HSD17B12_ENST00000529261.1_Splice_Site|RP11-613D13.5_ENST00000499066.2_RNA|RP11-613D13.5_ENST00000530450.1_RNA		NM_016142.2	NP_057226.1	1	2	3	2.008733	Q53GQ0	DHB12_HUMAN		7	620	+			A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Splice_Site	SNP	ENST00000278353.4	1	1	hg19		CCDS7905.1	0	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108041	0.77096	.	.	ENSG00000149084	ENST00000531185;ENST00000278353	.	.	.	6.16	6.16	0.99307	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	HSD17B12	43809101	43809101	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.590000	0.82653	2.937000	0.99478	0.650000	0.86243	.	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.428	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389594.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	1.990000	-3.221883	1	0.220000		Intron	0	35	35	0	416	411	0		1	0		0	0	64	0	0	1.000000	2.769610e-01	0	1	0	12	0	35	416
OR4A47	403253	broad.mit.edu	37	11	48510911	48510911	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr11:48510911C>A	ENST00000446524.1	+	1	643	c.567C>A	c.(565-567)gaC>gaA	p.D189E		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TCTGCACTGACACCCATGCTA	0.438																																						ENST00000446524.1	1.000000	0.650000	9.400000e-01	7.400000e-01	0.830000	0.842556	0.830000	1.000000																										0				29						c.(565-567)gaC>gaA		olfactory receptor, family 4, subfamily A, member 47							155.0	149.0	151.0					11																	48510911		2201	4298	6499	SO:0001583	missense	403253	0	0					g.chr11:48510911C>A	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.567C>A	chr11.hg19:g.48510911C>A	ENSP00000412752:p.Asp189Glu	0						p.D189E	NM_001005512.2	NP_001005512.2	1	2	3	2.008733	Q6IF82	O4A47_HUMAN		1	643	+				Missense_Mutation	SNP	ENST00000446524.1	1	1	hg19	c.567C>A	CCDS31490.1	0	.	.	.	.	.	.	.	.	.	.	N	8.025	0.760507	0.15914	.	.	ENSG00000237388	ENST00000446524	T	0.00227	8.5	4.59	1.62	0.23740	4.59	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	0.222293	0.31415	N	0.007693	T	0.00300	0.0009	M	0.88105	2.93	0.18873	N	0.999985	B	0.23442	0.085	B	0.28784	0.094	T	0.31308	-0.9948	10	0.72032	D	0.01	.	8.1997	0.31417	0.0:0.728:0.0:0.272	.	189	Q6IF82	O4A47_HUMAN	E	189	ENSP00000412752:D189E	ENSP00000412752:D189E	D	+	3	2	2	OR4A47	48467487	48467487	0.229000	0.23729	0.652000	0.29579	0.089000	0.18198	-0.085000	0.11250	0.911000	0.36747	0.205000	0.17691	GAC	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.438	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.990000	-18.922180	1	0.220000	NM_001005512		0	71	71	0	706	698	0		1			0	0	91	0	0	1.000000	0	0	0	0	0	0	71	706
SIPA1	6494	broad.mit.edu	37	11	65408965	65408965	+	Silent	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr11:65408965C>T	ENST00000394224.3	+	2	869	c.573C>T	c.(571-573)aaC>aaT	p.N191N	SIPA1_ENST00000534313.1_Silent_p.N191N|SIPA1_ENST00000394227.3_Silent_p.N191N|SIPA1_ENST00000527525.1_Silent_p.N191N	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	191					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						CACTGCCCAACGCGGCCGTGT	0.637																																						ENST00000394224.3	1.000000	0.690000	1	8.200000e-01	0.970000	0.931520	0.970000	1.000000																										0				10						c.(571-573)aaC>aaT		signal-induced proliferation-associated 1							38.0	38.0	38.0					11																	65408965		2201	4296	6497	SO:0001819	synonymous_variant	6494	6	121338	36				g.chr11:65408965C>T	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.573C>T	chr11.hg19:g.65408965C>T		1					SIPA1_ENST00000394227.3_Silent_p.N191N|SIPA1_ENST00000534313.1_Silent_p.N191N|SIPA1_ENST00000527525.1_Silent_p.N191N	p.N191N	NM_153253.29	NP_694985.29	1	4	5	2.665389	Q96FS4	SIPA1_HUMAN		2	869	+			O14518|O60484|O60618|Q2YD83	Silent	SNP	ENST00000394224.3	1	1	hg19	c.573C>T	CCDS8108.1	1																																																																																								0.413534		TCGA-HZ-A77P-01A-11D-A33T-08	0.637	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	1	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.990000	-20.000000	1	0.220000	NM_006747		0	34	34	0	389	386	0		1	0		0	0	52	0	0	1.000000	9.439446e-01	0	0	0	57	0	34	389
PDE3A	5139	broad.mit.edu	37	12	20801641	20801641	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr12:20801641G>A	ENST00000359062.3	+	13	2625	c.2585G>A	c.(2584-2586)cGt>cAt	p.R862H	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	862	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TATAACGATCGTTCAGTTTTG	0.363																																						ENST00000359062.3	1.000000	0.690000	1	7.800000e-01	0.890000	0.891801	0.890000	1.000000																										0				58						c.(2584-2586)cGt>cAt		phosphodiesterase 3A, cGMP-inhibited	Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)						142.0	135.0	137.0					12																	20801641		2203	4300	6503	SO:0001583	missense	5139	0	0					g.chr12:20801641G>A		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2585G>A	chr12.hg19:g.20801641G>A	ENSP00000351957:p.Arg862His	0					PDE3A_ENST00000544307.1_3'UTR	p.R862H	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	0	1	1	1.999210	Q14432	PDE3A_HUMAN		13	2625	+	Esophageal squamous(101;0.125)	Breast(259;0.134)	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	1	1	hg19	c.2585G>A	CCDS31754.1	1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017327	0.93404	.	.	ENSG00000172572	ENST00000359062	D	0.81908	-1.55	5.76	5.76	0.90799	5.76	5.76	0.90799	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.097634	0.64402	D	0.000001	D	0.91988	0.7462	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92298	0.5847	10	0.87932	D	0	.	19.9617	0.97254	0.0:0.0:1.0:0.0	.	862	Q14432	PDE3A_HUMAN	H	862	ENSP00000351957:R862H	ENSP00000351957:R862H	R	+	2	0	0	PDE3A	20692908	20692908	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	9.412000	0.97347	2.722000	0.93159	0.650000	0.86243	CGT	0.218280		TCGA-HZ-A77P-01A-11D-A33T-08	0.363	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.990000	-18.046600	1	0.220000			0	59	58	0	537	533	1		1	0		0	0	91	0	0	1.000000	9.583613e-01	0	0	0	48	0	59	537
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.330000	8.900000e-01	4.800000e-01	0.660000	0.683693	0.660000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	1	1	1.999210	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.218280		TCGA-HZ-A77P-01A-11D-A33T-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	1.990000	-5.633668	1	0.220000	NM_033360		1231	9	9	6779	116	116	0	1	1	1	1	0	0	18	438	1	0.994774	3.854232e-01	9.999993e-01	3	38	14	470	9	116
FGF23	8074	broad.mit.edu	37	12	4479899	4479899	+	Silent	SNP	G	G	A	rs145147639		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr12:4479899G>A	ENST00000237837.1	-	3	511	c.366C>T	c.(364-366)aaC>aaT	p.N122N		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	122					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			CGTCGTACCCGTTTTCCAGCG	0.607																																						ENST00000237837.1	1.000000	0.750000	1	8.400000e-01	0.940000	0.931910	0.940000	1.000000																										0				22						c.(364-366)aaC>aaT		fibroblast growth factor 23		G		0,4406		0,0,2203	107.0	105.0	106.0		366	0.6	1.0	12	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FGF23	NM_020638.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		122/252	4479899	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8074	2	121410	34				g.chr12:4479899G>A	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.366C>T	chr12.hg19:g.4479899G>A		0						p.N122N	NM_020638.2	NP_065689.1	0	1	1	1.991977	Q9GZV9	FGF23_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)	3	511	-			Q4V758	Silent	SNP	ENST00000237837.1	1	1	hg19	c.366C>T	CCDS8526.1	1																																																																																								0.215686		TCGA-HZ-A77P-01A-11D-A33T-08	0.607	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1	1	0	1	2	2	2	2	0	0	0	0	112	112	112	110	1	1.990000	-19.999930	1	0.220000			0	78	78	0	665	654	1		1			0	0	112	0	0	1.000000	0	0	0	0	0	0	78	665
ADAMTS20	80070	broad.mit.edu	37	12	43847747	43847747	+	Missense_Mutation	SNP	C	C	T	rs150619594		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr12:43847747C>T	ENST00000389420.3	-	12	1722	c.1723G>A	c.(1723-1725)Gga>Aga	p.G575R	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.G575R	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	575	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTTTCGATTCCGCCTCCACAT	0.418																																						ENST00000389420.3	1.000000	0.330000	1	5.000000e-01	0.720000	0.729536	0.720000	1.000000																										0				95						c.(1723-1725)Gga>Aga		ADAM metallopeptidase with thrombospondin type 1 motif, 20		C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	118.0	93.0	102.0		1723	4.8	1.0	12	dbSNP_134	102	0,8600		0,0,4300	no	missense	ADAMTS20	NM_025003.3	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	575/1911	43847747	1,13005	2203	4300	6503	SO:0001583	missense	80070	3	121388	33				g.chr12:43847747C>T	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1723G>A	chr12.hg19:g.43847747C>T	ENSP00000374071:p.Gly575Arg	0					ADAMTS20_ENST00000553158.1_Missense_Mutation_p.G575R	p.G575R	NM_025003.3	NP_079279.3	0	1	1	1.999210	P59510	ATS20_HUMAN		12	1722	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	0	1	hg19	c.1723G>A	CCDS31778.2	0	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774087	0.90108	2.27E-4	0.0	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	D;D	0.83673	-1.75;-1.75	4.77	4.77	0.60923	4.77	4.77	0.60923	.	0.279795	0.24949	N	0.034312	D	0.94847	0.8335	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96742	0.9547	10	0.87932	D	0	.	18.6648	0.91485	0.0:1.0:0.0:0.0	.	575	P59510	ATS20_HUMAN	R	575	ENSP00000374071:G575R;ENSP00000448341:G575R	ENSP00000374068:G575R	G	-	1	0	0	ADAMTS20	42134014	42134014	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.196000	0.77805	2.586000	0.87340	0.585000	0.79938	GGA	0.218280		TCGA-HZ-A77P-01A-11D-A33T-08	0.418	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	0	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.990000	-11.690400	1	0.220000	NM_025003		0	7	7	0	83	81	0		1			0	0	21	0	0	0.980503	0	0	0	0	0	0	7	83
COL2A1	1280	broad.mit.edu	37	12	48367243	48367243	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr12:48367243C>T	ENST00000380518.3	-	54	4575	c.4411G>A	c.(4411-4413)Gga>Aga	p.G1471R	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Missense_Mutation_p.G1402R	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1471	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TCGGGCCCTCCTATGTCCATG	0.527																																						ENST00000380518.3	1.000000	0.740000	1	8.400000e-01	0.950000	0.934226	0.950000	1.000000																										0				64						c.(4411-4413)Gga>Aga		collagen, type II, alpha 1	Collagenase(DB00048)						155.0	146.0	149.0					12																	48367243		2203	4300	6503	SO:0001583	missense	1280	0	0					g.chr12:48367243C>T	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.4411G>A	chr12.hg19:g.48367243C>T	ENSP00000369889:p.Gly1471Arg	0					COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Missense_Mutation_p.G1402R	p.G1471R	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	0	1	1	1.999210	P02458	CO2A1_HUMAN		54	4575	-		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	1	1	hg19	c.4411G>A	CCDS41778.1	1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940351	0.73557	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	T;T	0.78126	-1.15;-1.15	4.65	4.65	0.58169	4.65	4.65	0.58169	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.91112	0.7202	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93677	0.6995	10	0.87932	D	0	.	17.4825	0.87677	0.0:1.0:0.0:0.0	.	1402;1471	P02458-1;P02458	.;CO2A1_HUMAN	R	1471;1402;1402	ENSP00000369889:G1471R;ENSP00000338213:G1402R	ENSP00000338213:G1402R	G	-	1	0	0	COL2A1	46653510	46653510	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.725000	0.84808	2.274000	0.75844	0.561000	0.74099	GGA	0.218280		TCGA-HZ-A77P-01A-11D-A33T-08	0.527	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	1	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	1.990000	-2.774725	1	0.220000	NM_001844		0	64	62	0	542	539	1		1			0	0	78	0	0	1.000000	0	0	0	0	0	0	64	542
KRT86	3892	broad.mit.edu	37	12	52695732	52695732	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr12:52695732C>A	ENST00000423955.2	+	3	210	c.32C>A	c.(31-33)gCc>gAc	p.A11D	KRT86_ENST00000544024.1_Missense_Mutation_p.A11D|KRT86_ENST00000293525.5_Missense_Mutation_p.A11D			O43790	KRT86_HUMAN	keratin 86	11	Head.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGTGGCCGCGCCTTCAGCTGC	0.667																																						ENST00000423955.2	0.310000	0.090000	2.500000e-01	1.300000e-01	0.180000	0.198654	0.180000	0.180000																										0				10						c.(31-33)gCc>gAc		keratin 86							49.0	55.0	53.0					12																	52695732		2166	4279	6445	SO:0001583	missense	3892	1	121260	32				g.chr12:52695732C>A	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.32C>A	chr12.hg19:g.52695732C>A	ENSP00000444533:p.Ala11Asp	0					KRT86_ENST00000293525.5_Missense_Mutation_p.A11D|KRT86_ENST00000544024.1_Missense_Mutation_p.A11D	p.A11D			0	1	1	1.999210	O43790	KRT86_HUMAN		3	210	+			P78387	Missense_Mutation	SNP	ENST00000423955.2	0	1	hg19	c.32C>A	CCDS41785.1	0	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225010	0.39300	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	T;T;T	0.81330	-1.48;-1.48;-1.48	5.01	5.01	0.66863	5.01	5.01	0.66863	.	1.824800	0.03602	U	0.233611	T	0.75064	0.3799	L	0.27053	0.805	0.34929	D	0.749164	B	0.06786	0.001	B	0.04013	0.001	T	0.58411	-0.7641	10	0.56958	D	0.05	.	11.9409	0.52901	0.0:0.8097:0.1903:0.0	.	11	O43790	KRT86_HUMAN	D	11	ENSP00000443169:A11D;ENSP00000444533:A11D;ENSP00000293525:A11D	ENSP00000293525:A11D	A	+	2	0	0	AC021066.1;KRT86	50981999	50981999	0.630000	0.27155	0.988000	0.46212	0.777000	0.43975	0.609000	0.24238	2.320000	0.78422	0.643000	0.83706	GCC	0.218280		TCGA-HZ-A77P-01A-11D-A33T-08	0.667	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.990000	-3.365024	1	0.220000	NM_002284		0	12	12	0	576	571	0		1	0		0	0	68	0	0	0.999080	5.219536e-04	0	0	0	2	0	12	576
FRY	10129	broad.mit.edu	37	13	32783787	32783787	+	Missense_Mutation	SNP	A	A	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr13:32783787A>T	ENST00000380250.3	+	33	4837	c.4341A>T	c.(4339-4341)aaA>aaT	p.K1447N		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1447						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACAATGAGAAATGGAGCAACA	0.463																																						ENST00000380250.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				132						c.(4339-4341)aaA>aaT		furry homolog (Drosophila)							164.0	163.0	163.0					13																	32783787		1962	4151	6113	SO:0001583	missense	10129	0	0					g.chr13:32783787A>T	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.4341A>T	chr13.hg19:g.32783787A>T	ENSP00000369600:p.Lys1447Asn	1						p.K1447N	NM_023037.2	NP_075463.2	1	2	3	2.223144	Q5TBA9	FRY_HUMAN		33	4837	+		Lung SC(185;0.0271)	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	1	1	hg19	c.4341A>T	CCDS41875.1	1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827518	0.50845	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.23754	1.89	5.48	-6.97	0.01616	5.48	-6.97	0.01616	.	0.048340	0.85682	D	0.000000	T	0.15609	0.0376	N	0.22421	0.69	0.58432	D	0.999997	B	0.33345	0.409	B	0.38755	0.281	T	0.03335	-1.1047	10	0.18710	T	0.47	.	16.3704	0.83355	0.4617:0.0:0.5383:0.0	.	1447	Q5TBA9	FRY_HUMAN	N	1447;284	ENSP00000369600:K1447N	ENSP00000369600:K1447N	K	+	3	2	2	FRY	31681787	31681787	0.173000	0.23056	0.847000	0.33407	0.862000	0.49288	-0.307000	0.08167	-1.244000	0.02516	-0.379000	0.06801	AAA	0.297297		TCGA-HZ-A77P-01A-11D-A33T-08	0.463	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	0	0	1	2	2	2	2	0	0	0	0	70	70	70	70	1	1.990000	-20.000000	1	0.220000	NM_023037		0	93	91	0	464	460	1		1	0		0	0	70	0	0	1.000000	4.603075e-01	0	1	0	8	0	93	464
ESR2	2100	broad.mit.edu	37	14	64727336	64727336	+	Silent	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr14:64727336G>A	ENST00000341099.4	-	5	1200	c.783C>T	c.(781-783)gaC>gaT	p.D261D	ESR2_ENST00000555278.1_Silent_p.D261D|ESR2_ENST00000267525.6_Silent_p.D261D|ESR2_ENST00000554572.1_Silent_p.D261D|ESR2_ENST00000353772.3_Silent_p.D261D|ESR2_ENST00000557772.1_Silent_p.D261D|ESR2_ENST00000542956.1_Silent_p.D261D|ESR2_ENST00000358599.5_Silent_p.D261D|ESR2_ENST00000553796.1_Silent_p.D261D|ESR2_ENST00000357782.2_Silent_p.D261D|ESR2_ENST00000555483.1_5'UTR	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	261	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.D261D(2)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GGCTCAGGGCGTCCAGCAGCA	0.682																																						ENST00000341099.4	1.000000	0.910000	1	9.500000e-01	0.980000	0.980654	0.980000	0.990000																										2	Substitution - coding silent(2)	p.D261D(2)	endometrium(2)	23						c.(781-783)gaC>gaT		estrogen receptor 2 (ER beta)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)						26.0	28.0	27.0					14																	64727336		2202	4293	6495	SO:0001819	synonymous_variant	2100	3	121288	34				g.chr14:64727336G>A	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.783C>T	chr14.hg19:g.64727336G>A		1					ESR2_ENST00000357782.2_Silent_p.D261D|ESR2_ENST00000557772.1_Silent_p.D261D|ESR2_ENST00000267525.6_Silent_p.D261D|ESR2_ENST00000353772.3_Silent_p.D261D|ESR2_ENST00000542956.1_Silent_p.D261D|ESR2_ENST00000555278.1_Silent_p.D261D|ESR2_ENST00000553796.1_Silent_p.D261D|ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000358599.5_Silent_p.D261D|ESR2_ENST00000554572.1_Silent_p.D261D	p.D261D	NM_001437.2	NP_001428.1	0	1	1	1.989380	Q92731	ESR2_HUMAN		5	1200	-			A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Silent	SNP	ENST00000341099.4	1	1	hg19	c.783C>T	CCDS9762.1	1																																																																																								0.123596		TCGA-HZ-A77P-01A-11D-A33T-08	0.682	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	63	1	1.990000	-4.189801	1	0.220000			0	78	75	0	272	268	1		1	0		0	0	63	0	0	1.000000	0	0	0	0	1	0	78	272
MKL2	57496	broad.mit.edu	37	16	14280893	14280893	+	Splice_Site	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr16:14280893G>T	ENST00000341243.5	+	1	121		c.e1+1		MKL2_ENST00000572567.1_Splice_Site|MKL2_ENST00000318282.5_Intron|MKL2_ENST00000574045.1_Intron|MKL2_ENST00000571589.1_Intron			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2						blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCAAGGAAGGTCAGTCTGTC	0.478																																						ENST00000341243.5	1.000000	0.460000	1	6.400000e-01	0.880000	0.842927	0.880000	1.000000																										0				42						c.e1+1		MKL/myocardin-like 2							25.0	22.0	23.0					16																	14280893		876	1991	2867	SO:0001630	splice_region_variant	57496	0	0					g.chr16:14280893G>T	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.121+1G>T	chr16.hg19:g.14280893G>T		0					MKL2_ENST00000571589.1_Intron|MKL2_ENST00000572567.1_Splice_Site|MKL2_ENST00000574045.1_Intron|MKL2_ENST00000318282.5_Intron				1	2	3	2.004797	Q9ULH7	MKL2_HUMAN		1	121	+			A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Splice_Site	SNP	ENST00000341243.5	0	1	hg19			1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633236	0.67015	.	.	ENSG00000186260	ENST00000389126;ENST00000341243	.	.	.	5.34	5.34	0.76211	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9209	0.92525	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	MKL2	14188394	14188394	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.420000	0.73349	2.884000	0.98904	0.655000	0.94253	.	0.221712		TCGA-HZ-A77P-01A-11D-A33T-08	0.478	MKL2-202	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	20	20	20	19	1	1.990000	-16.563630	1	0.220000	NM_014048	Intron	0	10	10	0	95	95	0		1			0	0	20	0	0	0.997345	0	0	0	0	0	0	10	95
WWP2	11060	broad.mit.edu	37	16	69951707	69951707	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr16:69951707G>A	ENST00000359154.2	+	10	1201	c.1100G>A	c.(1099-1101)cGc>cAc	p.R367H	WWP2_ENST00000542271.1_Missense_Mutation_p.R251H|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000448661.1_Missense_Mutation_p.R367H|WWP2_ENST00000356003.2_Missense_Mutation_p.R367H	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	367					cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GAGTACGTGCGCAACTATGAG	0.592																																						ENST00000359154.2	0.350000	0.050000	2.400000e-01	9.000000e-02	0.150000	0.179715	0.150000	0.140000																										0				42						c.(1099-1101)cGc>cAc		WW domain containing E3 ubiquitin protein ligase 2							63.0	58.0	60.0					16																	69951707		2198	4300	6498	SO:0001583	missense	11060	3	121410	36				g.chr16:69951707G>A	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1100G>A	chr16.hg19:g.69951707G>A	ENSP00000352069:p.Arg367His	0					WWP2_ENST00000542271.1_Missense_Mutation_p.R251H|WWP2_ENST00000356003.2_Missense_Mutation_p.R367H|WWP2_ENST00000448661.1_Missense_Mutation_p.R367H|WWP2_ENST00000544162.1_3'UTR	p.R367H	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	1	2	3	2.004797	O00308	WWP2_HUMAN		10	1201	+			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	0	1	hg19	c.1100G>A	CCDS10885.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.217011	0.95104	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.34072	1.4;1.4;1.4;1.38	5.72	4.77	0.60923	5.72	4.77	0.60923	.	0.102760	0.64402	D	0.000006	T	0.55641	0.1933	M	0.76328	2.33	0.80722	D	1	D	0.76494	0.999	P	0.59825	0.864	T	0.59177	-0.7503	9	.	.	.	.	14.8283	0.70130	0.0689:0.0:0.9311:0.0	.	367	O00308	WWP2_HUMAN	H	367;367;367;254;251	ENSP00000352069:R367H;ENSP00000396871:R367H;ENSP00000348283:R367H;ENSP00000445616:R251H	.	R	+	2	0	0	WWP2	68509208	68509208	1.000000	0.71417	0.931000	0.37212	0.958000	0.62258	9.869000	0.99810	1.417000	0.47077	0.655000	0.94253	CGC	0.221712		TCGA-HZ-A77P-01A-11D-A33T-08	0.592	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	0	0	0	2	2	2	2	0	0	0	0	24	24	24	24	1	1.990000	-4.333833	1	0.220000	NM_007014		0	5	5	0	308	306	0		1	0	1	0	0	24	700	0	0.936974	2.673187e-01	9.986635e-01	0	2	53	934	5	308
UBB	7314	broad.mit.edu	37	17	16285438	16285438	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr17:16285438C>G	ENST00000395837.1	+	2	398	c.217C>G	c.(217-219)Ctg>Gtg	p.L73V	UBB_ENST00000395839.1_Missense_Mutation_p.L73V|UBB_ENST00000535788.1_Missense_Mutation_p.L73V|UBB_ENST00000578649.1_Intron|UBB_ENST00000302182.3_Missense_Mutation_p.L73V|RP11-138I1.4_ENST00000583934.1_RNA	NM_001281718.1|NM_001281720.1	NP_001268647.1|NP_001268649.1	P0CG47	UBB_HUMAN	ubiquitin B	73	Ubiquitin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		GGTCCTGCGTCTGAGAGGTGG	0.547																																					Melanoma(163;1126 3406 34901)	ENST00000395837.1	1.000000	0.700000	9.700000e-01	8.000000e-01	0.890000	0.889295	0.890000	0.950000																										0				16						c.(217-219)Ctg>Gtg		ubiquitin B							64.0	64.0	64.0					17																	16285438		2203	4297	6500	SO:0001583	missense	7314	0	0					g.chr17:16285438C>G		CCDS11177.1	17p12-p11.2	2010-11-25			ENSG00000170315	ENSG00000170315			12463	protein-coding gene	gene with protein product	"""polyubiquitin B"""	191339				2154095	Standard	NM_018955		Approved	MGC8385, FLJ25987	uc002gpx.3	P0CG47	OTTHUMG00000058987	ENST00000395837.1:c.217C>G	chr17.hg19:g.16285438C>G	ENSP00000379178:p.Leu73Val	1					UBB_ENST00000395839.1_Missense_Mutation_p.L73V|UBB_ENST00000535788.1_Missense_Mutation_p.L73V|UBB_ENST00000578649.1_Intron|RP11-138I1.4_ENST00000583934.1_RNA|UBB_ENST00000302182.3_Missense_Mutation_p.L73V	p.L73V	NM_001281718.1|NM_001281720.1	NP_001268647.1|NP_001268649.1	0	1	1	1.787065	P0CG47	UBB_HUMAN		2	398	+			P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000395837.1	1	1	hg19	c.217C>G	CCDS11177.1	1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999368	0.35226	.	.	ENSG00000170315	ENST00000302182;ENST00000535788;ENST00000395839;ENST00000395837	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	4.05	4.05	0.47172	4.05	4.05	0.47172	Ubiquitin supergroup (1);Ubiquitin (1);	0.000000	0.42420	U	0.000711	T	0.79347	0.4430	M	0.88181	2.935	0.80722	D	1	B	0.10296	0.003	B	0.20955	0.032	T	0.81180	-0.1050	10	0.87932	D	0	.	15.641	0.77001	0.0:1.0:0.0:0.0	.	73	P0CG47	UBB_HUMAN	V	73	ENSP00000304697:L73V;ENSP00000437475:L73V;ENSP00000379180:L73V;ENSP00000379178:L73V	ENSP00000304697:L73V	L	+	1	2	2	UBB	16226163	16226163	1.000000	0.71417	0.926000	0.36857	0.847000	0.48162	4.164000	0.58190	1.989000	0.58080	0.644000	0.83932	CTG	0.123596		TCGA-HZ-A77P-01A-11D-A33T-08	0.547	UBB-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130459.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	97	1	1.990000	-20.000000	1	0.220000	NM_018955		0	52	46	0	385	311	0		1	1		0	0	87	0	0	1.000000	1	0	734	0	5595	0	52	385
LRRC45	201255	broad.mit.edu	37	17	79983019	79983019	+	Missense_Mutation	SNP	T	T	G			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr17:79983019T>G	ENST00000306688.3	+	4	839	c.497T>G	c.(496-498)cTa>cGa	p.L166R	STRA13_ENST00000583767.1_5'Flank|STRA13_ENST00000392359.3_5'Flank|LRRC45_ENST00000583383.1_3'UTR|STRA13_ENST00000580435.1_5'Flank|STRA13_ENST00000584347.1_5'Flank|STRA13_ENST00000306704.6_5'Flank	NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	166						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GAGCTGGCCCTAGCCCTGAAG	0.687																																						ENST00000306688.3	1.000000	0.570000	1	7.700000e-01	0.990000	0.915341	0.990000	1.000000																										0				5						c.(496-498)cTa>cGa		leucine rich repeat containing 45							20.0	24.0	23.0					17																	79983019		2182	4288	6470	SO:0001583	missense	201255	0	0					g.chr17:79983019T>G	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.497T>G	chr17.hg19:g.79983019T>G	ENSP00000306760:p.Leu166Arg	0					STRA13_ENST00000306704.6_5'Flank|STRA13_ENST00000392359.3_5'Flank|STRA13_ENST00000583767.1_5'Flank|LRRC45_ENST00000583383.1_3'UTR|STRA13_ENST00000580435.1_5'Flank|STRA13_ENST00000584347.1_5'Flank	p.L166R	NM_144999.2	NP_659436.1	1	2	3	2.013756	Q96CN5	LRC45_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)	4	839	+	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)			Missense_Mutation	SNP	ENST00000306688.3	0	1	hg19	c.497T>G	CCDS11797.1	1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.085981	0.55861	.	.	ENSG00000169683	ENST00000306688	T	0.51817	0.69	3.85	2.75	0.32379	3.85	2.75	0.32379	.	0.387055	0.24833	N	0.035239	T	0.36248	0.0960	N	0.04373	-0.215	0.36634	D	0.876484	D	0.53462	0.96	P	0.59424	0.857	T	0.32107	-0.9919	9	.	.	.	-12.8284	8.6719	0.34156	0.0:0.0939:0.0:0.9061	.	166	Q96CN5	LRC45_HUMAN	R	166	ENSP00000306760:L166R	.	L	+	2	0	0	LRRC45	77576308	77576308	1.000000	0.71417	0.999000	0.59377	0.468000	0.32798	3.635000	0.54309	1.530000	0.49136	0.460000	0.39030	CTA	0.224267		TCGA-HZ-A77P-01A-11D-A33T-08	0.687	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442058.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.990000	-19.890940	1	0.220000	NM_144999		0	13	13	0	106	105	1		1	1		0	0	16	0	0	0.999614	8.692702e-01	0	9	0	23	0	13	106
EPB41L3	23136	broad.mit.edu	37	18	5419762	5419762	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr18:5419762C>T	ENST00000341928.2	-	12	1794	c.1454G>A	c.(1453-1455)cGg>cAg	p.R485Q	EPB41L3_ENST00000342933.3_Missense_Mutation_p.R485Q|EPB41L3_ENST00000544123.1_Missense_Mutation_p.R503Q|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000400111.3_Missense_Mutation_p.R503Q|EPB41L3_ENST00000540638.2_Missense_Mutation_p.R503Q|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	485	Hydrophilic.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						ccccttcctccgtttgtcctc	0.552																																						ENST00000341928.2	1.000000	0.880000	1	9.900000e-01	0.990000	0.991972	0.990000	1.000000																										0				105						c.(1453-1455)cGg>cAg		erythrocyte membrane protein band 4.1-like 3							198.0	128.0	152.0					18																	5419762		2203	4300	6503	SO:0001583	missense	23136	2	121412	40				g.chr18:5419762C>T	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1454G>A	chr18.hg19:g.5419762C>T	ENSP00000343158:p.Arg485Gln	0					EPB41L3_ENST00000540638.2_Missense_Mutation_p.R503Q|EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000544123.1_Missense_Mutation_p.R503Q|EPB41L3_ENST00000342933.3_Missense_Mutation_p.R485Q|EPB41L3_ENST00000400111.3_Missense_Mutation_p.R503Q	p.R485Q	NM_012307.2	NP_036439.2	1	2	3	2.029318	Q9Y2J2	E41L3_HUMAN		12	1794	-			B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	1	1	hg19	c.1454G>A	CCDS11838.1	1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703468	0.30232	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	T;D;T;D	0.82255	-1.37;-1.56;-1.37;-1.59	5.61	4.73	0.59995	5.61	4.73	0.59995	.	1.452490	0.04085	N	0.310269	T	0.76723	0.4027	L	0.49126	1.545	0.30694	N	0.751003	P;D;B;P;P	0.54601	0.938;0.967;0.357;0.709;0.535	B;B;B;B;B	0.37267	0.245;0.124;0.038;0.131;0.023	T	0.69209	-0.5205	10	0.40728	T	0.16	.	4.881	0.13679	0.18:0.644:0.0:0.1761	.	503;64;394;503;485	F5GX05;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	Q	485;394;503;394;485;503	ENSP00000343158:R485Q;ENSP00000441174:R503Q;ENSP00000341138:R485Q;ENSP00000382981:R503Q	ENSP00000343158:R485Q	R	-	2	0	0	EPB41L3	5409762	5409762	0.999000	0.42202	0.059000	0.19551	0.335000	0.28730	2.452000	0.44961	1.469000	0.48083	0.655000	0.94253	CGG	0.227646		TCGA-HZ-A77P-01A-11D-A33T-08	0.552	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	1.990000	-2.966682	1	0.220000	NM_012307		0	47	46	0	321	314	1		1	0		0	0	47	0	0	1.000000	9.961116e-01	0	0	0	60	0	47	321
TCF4	6925	broad.mit.edu	37	18	53017618	53017618	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr18:53017618C>T	ENST00000356073.4	-	8	1132	c.521G>A	c.(520-522)cGa>cAa	p.R174Q	TCF4_ENST00000561992.1_Missense_Mutation_p.R44Q|TCF4_ENST00000567880.1_Intron|TCF4_ENST00000544241.2_Missense_Mutation_p.R103Q|TCF4_ENST00000566286.1_Missense_Mutation_p.R172Q|TCF4_ENST00000537856.3_Missense_Mutation_p.R44Q|TCF4_ENST00000568740.1_Missense_Mutation_p.R149Q|TCF4_ENST00000568673.1_Missense_Mutation_p.R150Q|TCF4_ENST00000540999.1_Missense_Mutation_p.R150Q|TCF4_ENST00000570177.2_Missense_Mutation_p.R44Q|TCF4_ENST00000537578.1_Missense_Mutation_p.R150Q|TCF4_ENST00000564999.1_Missense_Mutation_p.R174Q|TCF4_ENST00000543082.1_Missense_Mutation_p.R132Q|TCF4_ENST00000565018.2_Missense_Mutation_p.R174Q|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000564228.1_Missense_Mutation_p.R103Q|TCF4_ENST00000354452.3_Missense_Mutation_p.R174Q|TCF4_ENST00000564403.2_Missense_Mutation_p.R174Q|TCF4_ENST00000398339.1_Missense_Mutation_p.R276Q	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	174					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		AGGAACTTTTCGAACTTTCTT	0.368																																						ENST00000356073.4	1.000000	0.730000	9.800000e-01	8.400000e-01	0.920000	0.915927	0.920000	0.990000																										0				41						c.(520-522)cGa>cAa		transcription factor 4							141.0	122.0	128.0					18																	53017618		2203	4300	6503	SO:0001583	missense	6925	0	0					g.chr18:53017618C>T	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.521G>A	chr18.hg19:g.53017618C>T	ENSP00000348374:p.Arg174Gln	1					TCF4_ENST00000398339.1_Missense_Mutation_p.R276Q|TCF4_ENST00000564999.1_Missense_Mutation_p.R174Q|TCF4_ENST00000564403.2_Missense_Mutation_p.R174Q|TCF4_ENST00000567880.1_Intron|TCF4_ENST00000568740.1_Missense_Mutation_p.R149Q|TCF4_ENST00000566286.1_Missense_Mutation_p.R172Q|TCF4_ENST00000561992.1_Missense_Mutation_p.R44Q|TCF4_ENST00000537578.1_Missense_Mutation_p.R150Q|TCF4_ENST00000565018.2_Missense_Mutation_p.R174Q|TCF4_ENST00000540999.1_Missense_Mutation_p.R150Q|TCF4_ENST00000570177.2_Missense_Mutation_p.R44Q|TCF4_ENST00000543082.1_Missense_Mutation_p.R132Q|TCF4_ENST00000537856.3_Missense_Mutation_p.R44Q|TCF4_ENST00000568673.1_Missense_Mutation_p.R150Q|TCF4_ENST00000544241.2_Missense_Mutation_p.R103Q|TCF4_ENST00000564228.1_Missense_Mutation_p.R103Q|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000354452.3_Missense_Mutation_p.R174Q	p.R174Q	NM_003199.2	NP_003190.1	0	1	1	1.759170	P15884	ITF2_HUMAN		8	1132	-			B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	1	1	hg19	c.521G>A	CCDS11960.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347222	0.82022	.	.	ENSG00000196628	ENST00000354452;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.105285	0.42172	D	0.000742	T	0.69269	0.3092	M	0.71036	2.16	0.35708	D	0.816131	D;P;D;D;P;D;D	0.62365	0.991;0.938;0.991;0.984;0.88;0.973;0.973	P;B;P;P;B;P;B	0.47376	0.545;0.346;0.545;0.465;0.115;0.545;0.406	T	0.79983	-0.1573	10	0.87932	D	0	-15.0974	18.1047	0.89516	0.0:1.0:0.0:0.0	.	150;174;150;276;174;132;103	B7Z5M6;G0LNT9;B7Z6Y1;E9PH57;P15884;B3KUC0;B3KT62	.;.;.;.;ITF2_HUMAN;.;.	Q	174;174;132;150;150;103;44;276	ENSP00000346440:R174Q;ENSP00000348374:R174Q;ENSP00000439656:R132Q;ENSP00000445202:R150Q;ENSP00000440731:R150Q;ENSP00000441562:R103Q;ENSP00000439827:R44Q;ENSP00000381382:R276Q	ENSP00000346440:R174Q	R	-	2	0	0	TCF4	51168616	51168616	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.985000	0.70556	2.582000	0.87167	0.491000	0.48974	CGA	0.123596		TCGA-HZ-A77P-01A-11D-A33T-08	0.368	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.990000	-3.322927	1	0.220000	NM_003199		0	36	36	0	218	214	1		1	0		0	0	49	0	0	1.000000	8.348268e-01	0	0	0	22	0	36	218
ANKRD24	170961	broad.mit.edu	37	19	4219626	4219626	+	Silent	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr19:4219626C>T	ENST00000600132.1	+	19	3318	c.3042C>T	c.(3040-3042)caC>caT	p.H1014H	ANKRD24_ENST00000318934.4_Silent_p.H1014H|ANKRD24_ENST00000262970.5_Silent_p.H1104H	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1014										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GTGAGCGACACGCAGCCGAGG	0.652																																						ENST00000600132.1	1.000000	0.760000	1	8.700000e-01	0.990000	0.950621	0.990000	1.000000																										0				21						c.(3040-3042)caC>caT		ankyrin repeat domain 24							59.0	70.0	66.0					19																	4219626		2197	4293	6490	SO:0001819	synonymous_variant	170961	2	121320	34				g.chr19:4219626C>T	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3042C>T	chr19.hg19:g.4219626C>T		0					ANKRD24_ENST00000318934.4_Silent_p.H1014H|ANKRD24_ENST00000262970.5_Silent_p.H1104H	p.H1014H	NM_133475.1	NP_597732.1	1	2	3	2.015827	Q8TF21	ANR24_HUMAN		19	3318	+			O75268|O95781	Silent	SNP	ENST00000600132.1	1	1	hg19	c.3042C>T	CCDS45925.1	1																																																																																								0.225114		TCGA-HZ-A77P-01A-11D-A33T-08	0.652	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	1.990000	-19.825400	1	0.220000	XM_114000		0	60	60	0	497	490	1		1	0		0	0	68	0	0	1.000000	6.209867e-02	0	0	0	4	0	60	497
MZF1	7593	broad.mit.edu	37	19	59073841	59073841	+	Missense_Mutation	SNP	C	C	G			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr19:59073841C>G	ENST00000215057.2	-	6	2363	c.1803G>C	c.(1801-1803)gaG>gaC	p.E601D	AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000594234.1_3'UTR|MZF1_ENST00000599369.1_Missense_Mutation_p.E601D	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	601					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GCTGGCCACACTCGGGGCAGG	0.662																																						ENST00000215057.2	1.000000	0.640000	1	8.800000e-01	0.990000	0.956591	0.990000	1.000000																										0				11						c.(1801-1803)gaG>gaC		myeloid zinc finger 1							24.0	20.0	22.0					19																	59073841		2202	4297	6499	SO:0001583	missense	7593	1	121282	26				g.chr19:59073841C>G	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.1803G>C	chr19.hg19:g.59073841C>G	ENSP00000215057:p.Glu601Asp	0					MZF1_ENST00000599369.1_Missense_Mutation_p.E601D|AC016629.8_ENST00000600726.1_RNA|MZF1_ENST00000594234.1_3'UTR|AC016629.8_ENST00000600534.1_RNA|AC016629.8_ENST00000593642.1_RNA	p.E601D	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	1	2	3	2.022047	P28698	MZF1_HUMAN		6	2363	-		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	0	1	hg19	c.1803G>C	CCDS12988.1	1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300340	0.40694	.	.	ENSG00000099326	ENST00000215057	T	0.32988	1.43	3.21	0.896	0.19253	3.21	0.896	0.19253	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.231155	0.22357	N	0.061125	T	0.15869	0.0382	N	0.17594	0.5	0.31431	N	0.673168	B	0.06786	0.001	B	0.09377	0.004	T	0.09509	-1.0671	10	0.37606	T	0.19	-7.1772	7.2841	0.26328	0.1919:0.6218:0.1863:0.0	.	601	P28698	MZF1_HUMAN	D	601	ENSP00000215057:E601D	ENSP00000215057:E601D	E	-	3	2	2	MZF1	63765653	63765653	0.000000	0.05858	0.985000	0.45067	0.990000	0.78478	-1.097000	0.03349	0.320000	0.23234	0.462000	0.41574	GAG	0.225960		TCGA-HZ-A77P-01A-11D-A33T-08	0.662	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.990000	-18.919900	1	0.220000	NM_198055		0	11	11	0	75	74	1		1	1		0	0	9	0	0	0.998616	9.799199e-01	0	9	0	40	0	11	75
ATP1A2	477	broad.mit.edu	37	1	160098814	160098814	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr1:160098814C>T	ENST00000361216.3	+	10	1350	c.1261C>T	c.(1261-1263)Cga>Tga	p.R421*	ATP1A2_ENST00000392233.3_Nonsense_Mutation_p.R421*	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	421					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GGCCCTGTCTCGAATTGCTGG	0.562																																						ENST00000361216.3	1.000000	0.410000	1	5.800000e-01	0.800000	0.790910	0.800000	1.000000																										0				69						c.(1261-1263)Cga>Tga		ATPase, Na+/K+ transporting, alpha 2 polypeptide							44.0	36.0	39.0					1																	160098814		2203	4300	6503	SO:0001587	stop_gained	477	0	0					g.chr1:160098814C>T	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1261C>T	chr1.hg19:g.160098814C>T	ENSP00000354490:p.Arg421*	0					ATP1A2_ENST00000392233.3_Nonsense_Mutation_p.R421*	p.R421*	NM_000702.3	NP_000693.1	1	2	3	2.022475	P50993	AT1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)	10	1350	+	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Nonsense_Mutation	SNP	ENST00000361216.3	0	1	hg19	c.1261C>T	CCDS1196.1	0	.	.	.	.	.	.	.	.	.	.	C	37	6.313929	0.97467	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	.	.	.	4.13	2.17	0.27698	4.13	2.17	0.27698	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6931	0.51527	0.322:0.678:0.0:0.0	.	.	.	.	X	421;421;124	.	ENSP00000354490:R421X	R	+	1	2	2	ATP1A2	158365438	158365438	0.565000	0.26610	0.987000	0.45799	0.612000	0.37316	1.260000	0.32968	0.472000	0.27344	0.561000	0.74099	CGA	0.225960		TCGA-HZ-A77P-01A-11D-A33T-08	0.562	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	1.990000	-15.275600	1	0.220000	NM_000702		0	10	10	0	109	109	0		1	0		0	0	14	0	0	0.997286	9.610789e-01	0	0	0	64	0	10	109
CEP350	9857	broad.mit.edu	37	1	179989235	179989235	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr1:179989235G>T	ENST00000367607.3	+	12	2744	c.2326G>T	c.(2326-2328)Gaa>Taa	p.E776*		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	776					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TAAGGATTTTGAATCTATTTT	0.403																																						ENST00000367607.3	1.000000	0.770000	1	8.800000e-01	0.990000	0.955165	0.990000	1.000000																										0				66						c.(2326-2328)Gaa>Taa		centrosomal protein 350kDa							107.0	108.0	108.0					1																	179989235		2203	4300	6503	SO:0001587	stop_gained	9857	0	0					g.chr1:179989235G>T	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2326G>T	chr1.hg19:g.179989235G>T	ENSP00000356579:p.Glu776*	0						p.E776*	NM_014810.4	NP_055625.4	1	2	3	2.016180	Q5VT06	CE350_HUMAN		12	2744	+			O75068|Q8TDK3|Q8WY20	Nonsense_Mutation	SNP	ENST00000367607.3	0	1	hg19	c.2326G>T	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.531776	0.99196	.	.	ENSG00000135837	ENST00000367607	.	.	.	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.258735	0.26812	N	0.022367	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3137	0.90210	0.0:0.0:1.0:0.0	.	.	.	.	X	776	.	.	E	+	1	0	0	CEP350	178255858	178255858	1.000000	0.71417	0.991000	0.47740	0.696000	0.40369	6.394000	0.73223	2.865000	0.98341	0.655000	0.94253	GAA	0.225114		TCGA-HZ-A77P-01A-11D-A33T-08	0.403	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	1	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	1.990000	-19.806210	1	0.220000	NM_014810		0	61	60	0	500	498	1		1	0		0	0	88	0	0	1.000000	3.411656e-02	0	1	0	2	0	61	500
CEP350	9857	broad.mit.edu	37	1	179989793	179989793	+	Missense_Mutation	SNP	G	G	C			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr1:179989793G>C	ENST00000367607.3	+	12	3302	c.2884G>C	c.(2884-2886)Gat>Cat	p.D962H		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	962					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTCTAGCTCTGATATGCAAGC	0.468																																						ENST00000367607.3			0	0																														0				66						c.(2884-2886)Gat>Cat		centrosomal protein 350kDa							114.0	118.0	117.0					1																	179989793		2203	4300	6503	SO:0001583	missense	9857	0	0					g.chr1:179989793G>C	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2884G>C	chr1.hg19:g.179989793G>C	ENSP00000356579:p.Asp962His							p.D962H	NM_014810.4	NP_055625.4					Q5VT06	CE350_HUMAN		12	3302	+			O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	1	1	hg19	c.2884G>C	CCDS1336.1		.	.	.	.	.	.	.	.	.	.	G	14.63	2.593039	0.46214	.	.	ENSG00000135837	ENST00000367607	T	0.14022	2.54	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.124193	0.35585	N	0.003120	T	0.19565	0.0470	L	0.29908	0.895	0.39682	D	0.970914	D;B	0.54397	0.966;0.303	P;B	0.52710	0.707;0.095	T	0.00756	-1.1579	9	.	.	.	.	17.26	0.87067	0.0:0.0:1.0:0.0	.	962;962	E7EU22;Q5VT06	.;CE350_HUMAN	H	962	ENSP00000356579:D962H	.	D	+	1	0	0	CEP350	178256416	178256416	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.938000	0.87678	2.865000	0.98341	0.655000	0.94253	GAT			TCGA-HZ-A77P-01A-11D-A33T-08	0.468	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	1	0	1	2	2	2	2	0	0	0	0	66	66	66	66	1	1.990000	-3.221904	1	0.220000	NM_014810		0	86	85	0	532	524	1		1	0		0	0	66	0	0	1.000000	2.015626e-01	0	1	0	5	0	86	532
FOXD3	27022	broad.mit.edu	37	1	63789346	63789346	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr1:63789346C>T	ENST00000371116.2	+	1	617	c.617C>T	c.(616-618)cCg>cTg	p.P206L	RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	206					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						CCCCGCGAGCCGGGCAACCCG	0.632																																					Pancreas(68;276 1750 11966 31252)	ENST00000371116.2	1.000000	0.810000	1	9.000000e-01	0.990000	0.965276	0.990000	1.000000																										0				5						c.(616-618)cCg>cTg		forkhead box D3							86.0	101.0	96.0					1																	63789346		2203	4300	6503	SO:0001583	missense	27022	0	0					g.chr1:63789346C>T	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.617C>T	chr1.hg19:g.63789346C>T	ENSP00000360157:p.Pro206Leu	0					RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA	p.P206L	NM_012183.2	NP_036315.1	1	2	3	2.030203	Q9UJU5	FOXD3_HUMAN		1	617	+			Q9BYM2|Q9UDD1	Missense_Mutation	SNP	ENST00000371116.2	1	1	hg19	c.617C>T	CCDS624.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038446	0.75617	.	.	ENSG00000187140	ENST00000371116	D	0.95412	-3.7	2.6	2.6	0.31112	2.6	2.6	0.31112	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	U	0.000000	D	0.96288	0.8789	M	0.72353	2.195	0.80722	D	1	D	0.60160	0.987	D	0.65010	0.931	D	0.96508	0.9376	10	0.87932	D	0	.	13.9222	0.63940	0.0:1.0:0.0:0.0	.	206	Q9UJU5	FOXD3_HUMAN	L	206	ENSP00000360157:P206L	ENSP00000360157:P206L	P	+	2	0	0	FOXD3	63561934	63561934	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.344000	0.44010	1.759000	0.51996	0.460000	0.39030	CCG	0.227646		TCGA-HZ-A77P-01A-11D-A33T-08	0.632	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1	1	0	1	2	2	2	2	0	0	0	0	123	123	123	116	1	1.990000	-20.000000	1	0.220000			0	95	92	0	779	749	0		1	0		0	0	123	0	0	1.000000	3.842954e-01	0	0	0	12	0	95	779
ZNF648	127665	broad.mit.edu	37	1	182027016	182027016	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr1:182027016C>T	ENST00000339948.3	-	2	337	c.130G>A	c.(130-132)Gaa>Aaa	p.E44K		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	44					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CCCTCTTTTTCGGCCTCCCCA	0.577																																					NSCLC(71;908 1374 5429 20458 35642)	ENST00000339948.3	1.000000	0.720000	1	8.400000e-01	0.970000	0.936225	0.970000	1.000000																										0				40						c.(130-132)Gaa>Aaa		zinc finger protein 648							94.0	91.0	92.0					1																	182027016		2203	4300	6503	SO:0001583	missense	127665	1	121412	33				g.chr1:182027016C>T	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.130G>A	chr1.hg19:g.182027016C>T	ENSP00000344129:p.Glu44Lys	0						p.E44K	NM_001009992.1	NP_001009992.1	1	2	3	2.015766	Q5T619	ZN648_HUMAN		2	337	-			B2RP16	Missense_Mutation	SNP	ENST00000339948.3	1	1	hg19	c.130G>A	CCDS30952.1	1	.	.	.	.	.	.	.	.	.	.	C	5.419	0.262519	0.10294	.	.	ENSG00000179930	ENST00000339948	T	0.07114	3.22	2.76	0.83	0.18854	2.76	0.83	0.18854	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46638	-0.9177	9	0.07813	T	0.8	.	9.5485	0.39295	0.0:0.782:0.0:0.218	.	44	Q5T619	ZN648_HUMAN	K	44	ENSP00000344129:E44K	ENSP00000344129:E44K	E	-	1	0	0	ZNF648	180293639	180293639	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.124000	0.10595	-0.031000	0.13781	-1.814000	0.00607	GAA	0.225114		TCGA-HZ-A77P-01A-11D-A33T-08	0.577	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	1	0	1	2	2	2	2	0	0	0	0	65	65	65	65	1	1.990000	-15.995280	1	0.220000	XM_060597		0	48	48	0	407	404	1		1			0	0	65	0	0	1.000000	0	0	0	0	0	0	48	407
DEFB119	245932	broad.mit.edu	37	20	29978252	29978252	+	Missense_Mutation	SNP	A	A	G			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr20:29978252A>G	ENST00000376321.3	-	1	154	c.35T>C	c.(34-36)cTg>cCg	p.L12P	DEFB119_ENST00000376315.2_Missense_Mutation_p.L12P|DEFB119_ENST00000339144.3_Missense_Mutation_p.L12P|DEFB119_ENST00000492344.1_5'UTR	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119	12					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TTCTATGGCCAGAAGGATGGC	0.547																																						ENST00000376321.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				4						c.(34-36)cTg>cCg		defensin, beta 119							158.0	145.0	150.0					20																	29978252		2203	4300	6503	SO:0001583	missense	245932	0	0					g.chr20:29978252A>G	AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.35T>C	chr20.hg19:g.29978252A>G	ENSP00000365499:p.Leu12Pro	1					DEFB119_ENST00000492344.1_5'UTR|DEFB119_ENST00000339144.3_Missense_Mutation_p.L12P|DEFB119_ENST00000376315.2_Missense_Mutation_p.L12P	p.L12P	NM_153289.3	NP_695021.2	2	2	4	2.293173	Q8N690	DB119_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)	1	154	-	all_hematologic(12;0.158)		Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Missense_Mutation	SNP	ENST00000376321.3	1	1	hg19	c.35T>C	CCDS13178.1	1	.	.	.	.	.	.	.	.	.	.	A	8.498	0.863675	0.17250	.	.	ENSG00000180483	ENST00000339144;ENST00000376321;ENST00000376315	T;T	0.50277	0.9;0.75	3.56	3.56	0.40772	3.56	3.56	0.40772	.	0.251087	0.21123	N	0.079786	T	0.64103	0.2568	.	.	.	0.45066	D	0.998088	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.952;0.98	T	0.66976	-0.5787	9	0.87932	D	0	-10.6634	8.8245	0.35047	1.0:0.0:0.0:0.0	.	12;12;12	Q8N690-2;Q8N690;Q5TH42	.;DB119_HUMAN;.	P	12	ENSP00000365499:L12P;ENSP00000365492:L12P	ENSP00000345768:L12P	L	-	2	0	0	DEFB119	29441913	29441913	0.995000	0.38212	0.957000	0.39632	0.058000	0.15608	3.346000	0.52190	1.865000	0.54081	0.374000	0.22700	CTG	0.320202		TCGA-HZ-A77P-01A-11D-A33T-08	0.547	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078514.1	1	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	1.990000	-20.000000	1	0.220000	NM_153289		0	124	124	0	571	564	1		1			0	0	82	0	0	1.000000	0	0	0	0	0	0	124	571
SON	6651	broad.mit.edu	37	21	34922087	34922087	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr21:34922087G>T	ENST00000356577.4	+	3	1025	c.550G>T	c.(550-552)Gca>Tca	p.A184S	SON_ENST00000300278.4_Missense_Mutation_p.A184S|SON_ENST00000381679.4_Missense_Mutation_p.A184S|SON_ENST00000290239.6_Missense_Mutation_p.A184S|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	184					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TGAATCCCCTGCAGTTGTGCT	0.448											OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										ENST00000356577.4	1.000000	0.810000	1	9.300000e-01	0.990000	0.975696	0.990000	1.000000																										0				72						c.(550-552)Gca>Tca		SON DNA binding protein							89.0	89.0	89.0					21																	34922087		2203	4300	6503	SO:0001583	missense	6651	0	0					g.chr21:34922087G>T	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.550G>T	chr21.hg19:g.34922087G>T	ENSP00000348984:p.Ala184Ser	0		OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	851	SON_ENST00000290239.6_Missense_Mutation_p.A184S|SON_ENST00000381679.4_Missense_Mutation_p.A184S|SON_ENST00000300278.4_Missense_Mutation_p.A184S|SON_ENST00000381692.2_Intron	p.A184S	NM_138927.1	NP_620305	1	2	3	2.005489	P18583	SON_HUMAN		3	1025	+			D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	1	1	hg19	c.550G>T	CCDS13629.1	1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185090	0.38609	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.14144	2.72;2.71;2.71;2.53	5.77	-1.16	0.09678	5.77	-1.16	0.09678	.	0.483837	0.19324	N	0.117068	T	0.07324	0.0185	N	0.24115	0.695	0.09310	N	1	P;P;P	0.46859	0.817;0.885;0.794	B;B;B	0.43052	0.23;0.406;0.406	T	0.23119	-1.0197	10	0.62326	D	0.03	.	1.2414	0.01964	0.1591:0.2573:0.3049:0.2787	.	184;184;184	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	S	184	ENSP00000348984:A184S;ENSP00000290239:A184S;ENSP00000300278:A184S;ENSP00000371095:A184S	ENSP00000290239:A184S	A	+	1	0	0	SON	33843957	33843957	0.268000	0.24133	0.147000	0.22382	0.381000	0.30169	0.044000	0.13992	-0.100000	0.12241	0.655000	0.94253	GCA	0.221712		TCGA-HZ-A77P-01A-11D-A33T-08	0.448	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	1	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	1.990000	-19.855490	1	0.220000	NM_138927		0	55	55	0	416	415	1		1	1		0	0	75	0	0	1.000000	9.909461e-01	0	7	0	50	0	55	416
SEZ6L	23544	broad.mit.edu	37	22	26743709	26743709	+	Missense_Mutation	SNP	C	C	T	rs574275567		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr22:26743709C>T	ENST00000248933.6	+	11	2332	c.2237C>T	c.(2236-2238)tCg>tTg	p.S746L	SEZ6L_ENST00000403121.1_Missense_Mutation_p.S519L|SEZ6L_ENST00000529632.2_Missense_Mutation_p.S746L|SEZ6L_ENST00000402979.1_Missense_Mutation_p.S519L|SEZ6L_ENST00000343706.4_Missense_Mutation_p.S746L|SEZ6L_ENST00000404234.3_Missense_Mutation_p.S746L|SEZ6L_ENST00000360929.3_Missense_Mutation_p.S746L|SEZ6L_ENST00000411842.2_5'UTR			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	746	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GACTCCTGCTCGGATTTACCC	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		18252	0.001		0.0	False		,,,				2504	0.0					ENST00000248933.6	1.000000	0.780000	1	9.100000e-01	0.990000	0.969113	0.990000	1.000000																										0				80						c.(2236-2238)tCg>tTg		seizure related 6 homolog (mouse)-like							74.0	70.0	71.0					22																	26743709		2203	4300	6503	SO:0001583	missense	23544	4	121412	37				g.chr22:26743709C>T	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2237C>T	chr22.hg19:g.26743709C>T	ENSP00000248933:p.Ser746Leu	0					SEZ6L_ENST00000403121.1_Missense_Mutation_p.S519L|SEZ6L_ENST00000411842.2_5'UTR|SEZ6L_ENST00000360929.3_Missense_Mutation_p.S746L|SEZ6L_ENST00000404234.3_Missense_Mutation_p.S746L|SEZ6L_ENST00000343706.4_Missense_Mutation_p.S746L|SEZ6L_ENST00000529632.2_Missense_Mutation_p.S746L|SEZ6L_ENST00000402979.1_Missense_Mutation_p.S519L	p.S746L			1	2	3	2.015543	Q9BYH1	SE6L1_HUMAN		11	2332	+			A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	1	1	hg19	c.2237C>T	CCDS13833.1	1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.592053	0.66219	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	4.88	3.84	0.44239	4.88	3.84	0.44239	Complement control module (2);Sushi/SCR/CCP (3);	0.161209	0.29100	N	0.013144	T	0.47764	0.1463	L	0.35487	1.065	0.80722	D	1	B;B;B;P;B;B;B	0.35208	0.429;0.192;0.083;0.49;0.228;0.115;0.115	B;B;B;B;B;B;B	0.28305	0.088;0.08;0.016;0.081;0.081;0.08;0.08	T	0.57136	-0.7863	10	0.72032	D	0.01	.	12.7022	0.57041	0.0:0.9192:0.0:0.0808	.	746;746;519;746;746;746;746	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	L	746;746;746;746;746;519;519	ENSP00000384772:S746L;ENSP00000437037:S746L;ENSP00000354185:S746L;ENSP00000248933:S746L;ENSP00000342661:S746L;ENSP00000384838:S519L;ENSP00000384733:S519L	ENSP00000248933:S746L	S	+	2	0	0	SEZ6L	25073709	25073709	1.000000	0.71417	0.963000	0.40424	0.901000	0.52897	5.529000	0.67135	2.543000	0.85770	0.655000	0.94253	TCG	0.225114		TCGA-HZ-A77P-01A-11D-A33T-08	0.517	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3	1	0	1	2	2	2	2	0	0	0	0	38	38	38	36	1	1.990000	-2.966615	1	0.220000			0	43	42	0	330	325	1		1	0		0	0	38	0	0	1.000000	0	0	0	0	1	0	43	330
UGP2	7360	broad.mit.edu	37	2	64117237	64117237	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr2:64117237T>C	ENST00000337130.5	+	9	1813	c.1337T>C	c.(1336-1338)tTt>tCt	p.F446S	UGP2_ENST00000467648.2_Missense_Mutation_p.F435S|UGP2_ENST00000445915.2_Missense_Mutation_p.F455S|UGP2_ENST00000394417.2_Missense_Mutation_p.F435S	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	446					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						CTAAGAAGATTTGAAAGTATA	0.303																																						ENST00000337130.5	1.000000	0.560000	9.800000e-01	6.800000e-01	0.820000	0.829437	0.820000	1.000000																										0				18						c.(1336-1338)tTt>tCt		UDP-glucose pyrophosphorylase 2							76.0	79.0	78.0					2																	64117237		2202	4300	6502	SO:0001583	missense	7360	0	0					g.chr2:64117237T>C		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.1337T>C	chr2.hg19:g.64117237T>C	ENSP00000338703:p.Phe446Ser	0					UGP2_ENST00000394417.2_Missense_Mutation_p.F435S|UGP2_ENST00000467648.2_Missense_Mutation_p.F435S|UGP2_ENST00000445915.2_Missense_Mutation_p.F455S	p.F446S	NM_006759.3	NP_006750.3	0	1	1	1.995445	Q16851	UGPA_HUMAN		9	1813	+			Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	1	1	hg19	c.1337T>C	CCDS1875.1	0	.	.	.	.	.	.	.	.	.	.	T	28.0	4.881893	0.91740	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000445915	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.044427	0.85682	D	0.000000	T	0.59514	0.2199	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72127	-0.4384	10	0.87932	D	0	-9.7442	16.1814	0.81903	0.0:0.0:0.0:1.0	.	455;446	E7EUC7;Q16851	.;UGPA_HUMAN	S	435;435;446;455	ENSP00000377939:F435S;ENSP00000420793:F435S;ENSP00000338703:F446S;ENSP00000411803:F455S	ENSP00000338703:F446S	F	+	2	0	0	UGP2	63970741	63970741	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.234000	0.73211	0.533000	0.62120	TTT	0.216553		TCGA-HZ-A77P-01A-11D-A33T-08	0.303	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	1.990000	-20.000000	1	0.220000	NM_006759		0	28	27	0	278	276	0		1	1		0	0	34	0	0	1.000000	1	0	30	0	374	0	28	278
NFKBIZ	64332	broad.mit.edu	37	3	101574269	101574269	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr3:101574269C>A	ENST00000326172.5	+	8	1736	c.1621C>A	c.(1621-1623)Cag>Aag	p.Q541K	NFKBIZ_ENST00000326151.5_Missense_Mutation_p.Q419K|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.Q441K	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	541	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						GGGAAGTAATCAGTTTGTGGA	0.413																																						ENST00000326172.5	1.000000	0.800000	1	9.100000e-01	0.990000	0.971361	0.990000	1.000000																										0				24						c.(1621-1623)Cag>Aag		nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta							136.0	137.0	137.0					3																	101574269		2203	4300	6503	SO:0001583	missense	64332	0	0					g.chr3:101574269C>A	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1621C>A	chr3.hg19:g.101574269C>A	ENSP00000325663:p.Gln541Lys	0					NFKBIZ_ENST00000394054.2_Missense_Mutation_p.Q441K|NFKBIZ_ENST00000326151.5_Missense_Mutation_p.Q419K	p.Q541K	NM_031419.3	NP_113607.1	1	2	3	2.007888	Q9BYH8	IKBZ_HUMAN		8	1736	+			B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	ENST00000326172.5	1	1	hg19	c.1621C>A	CCDS2946.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294456	0.81025	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.66	5.66	0.87406	5.66	5.66	0.87406	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000002	T	0.43919	0.1269	N	0.16708	0.43	0.54753	D	0.99998	P;D	0.53885	0.907;0.963	P;P	0.60682	0.568;0.878	T	0.36065	-0.9763	10	0.42905	T	0.14	-20.6546	19.7324	0.96188	0.0:1.0:0.0:0.0	.	419;541	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	K	441;441;419;541	ENSP00000419800:Q441K;ENSP00000377618:Q441K;ENSP00000325593:Q419K;ENSP00000325663:Q541K	ENSP00000325593:Q419K	Q	+	1	0	0	NFKBIZ	103056959	103056959	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.654000	0.61469	2.663000	0.90544	0.655000	0.94253	CAG	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.413	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	1.990000	-3.142702	1	0.220000	NM_031419		0	59	59	0	458	452	1		1	1		0	0	68	0	0	1.000000	9.176416e-01	0	6	0	28	0	59	458
MYH15	22989	broad.mit.edu	37	3	108110745	108110745	+	Missense_Mutation	SNP	C	C	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr3:108110745C>A	ENST00000273353.3	-	38	5408	c.5352G>T	c.(5350-5352)aaG>aaT	p.K1784N		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1784						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TGGTGTCTTGCTTCTTCTTCA	0.428																																						ENST00000273353.3	1.000000	0.770000	1	8.500000e-01	0.950000	0.938259	0.950000	1.000000																										0				105						c.(5350-5352)aaG>aaT		myosin, heavy chain 15							219.0	204.0	209.0					3																	108110745		1884	4121	6005	SO:0001583	missense	22989	0	0					g.chr3:108110745C>A	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5352G>T	chr3.hg19:g.108110745C>A	ENSP00000273353:p.Lys1784Asn	0						p.K1784N	NM_014981.1	NP_055796.1	1	2	3	2.007888	Q9Y2K3	MYH15_HUMAN		38	5408	-				Missense_Mutation	SNP	ENST00000273353.3	1	1	hg19	c.5352G>T	CCDS43127.1	1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101562	0.56183	.	.	ENSG00000144821	ENST00000273353	T	0.77489	-1.1	5.62	0.606	0.17559	5.62	0.606	0.17559	Myosin tail (1);	.	.	.	.	T	0.65709	0.2717	N	0.19112	0.55	0.34830	D	0.739586	B	0.29671	0.254	B	0.39465	0.3	T	0.65212	-0.6223	9	0.87932	D	0	.	5.9578	0.19283	0.121:0.6092:0.0:0.2698	.	1784	Q9Y2K3	MYH15_HUMAN	N	1784	ENSP00000273353:K1784N	ENSP00000273353:K1784N	K	-	3	2	2	MYH15	109593435	109593435	1.000000	0.71417	0.823000	0.32752	0.870000	0.49936	1.227000	0.32576	0.040000	0.15660	0.655000	0.94253	AAG	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.428	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	0	0	1	2	2	2	2	1	1	1	0	114	114	114	114	1	1.990000	-20.000000	1	0.220000	XM_036988		0	88	89	0	755	750	1		1			1	0	114	0	0	1.000000	0	0	0	0	0	0	88	755
SCN5A	6331	broad.mit.edu	37	3	38622673	38622673	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr3:38622673C>T	ENST00000333535.4	-	17	3126	c.2977G>A	c.(2977-2979)Gca>Aca	p.A993T	SCN5A_ENST00000449557.2_Missense_Mutation_p.A993T|SCN5A_ENST00000455624.2_Missense_Mutation_p.A993T|SCN5A_ENST00000451551.2_Missense_Mutation_p.A993T|SCN5A_ENST00000423572.2_Missense_Mutation_p.A993T|SCN5A_ENST00000450102.2_Missense_Mutation_p.A993T|SCN5A_ENST00000443581.1_Missense_Mutation_p.A993T|SCN5A_ENST00000413689.1_Missense_Mutation_p.A993T|SCN5A_ENST00000425664.1_Missense_Mutation_p.A993T|SCN5A_ENST00000414099.2_Missense_Mutation_p.A993T			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	993					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GCAAGGGCTGCGGGCTTCTGA	0.692																																						ENST00000333535.4	1.000000	0.710000	1	9.300000e-01	0.990000	0.969221	0.990000	1.000000																										0				107						c.(2977-2979)Gca>Aca		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						12.0	13.0	13.0					3																	38622673		1922	4105	6027	SO:0001583	missense	6331	2	120716	26				g.chr3:38622673C>T	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2977G>A	chr3.hg19:g.38622673C>T	ENSP00000328968:p.Ala993Thr	0					SCN5A_ENST00000450102.2_Missense_Mutation_p.A993T|SCN5A_ENST00000451551.2_Missense_Mutation_p.A993T|SCN5A_ENST00000413689.1_Missense_Mutation_p.A993T|SCN5A_ENST00000423572.2_Missense_Mutation_p.A993T|SCN5A_ENST00000455624.2_Missense_Mutation_p.A993T|SCN5A_ENST00000443581.1_Missense_Mutation_p.A993T|SCN5A_ENST00000425664.1_Missense_Mutation_p.A993T|SCN5A_ENST00000449557.2_Missense_Mutation_p.A993T|SCN5A_ENST00000414099.2_Missense_Mutation_p.A993T	p.A993T			1	2	3	2.007888	Q14524	SCN5A_HUMAN		17	3126	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	0	1	hg19	c.2977G>A	CCDS46796.1	1	.	.	.	.	.	.	.	.	.	.	C	2.132	-0.398935	0.04865	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.38	2.53	0.30540	5.38	2.53	0.30540	Sodium ion transport-associated (1);	1.066670	0.07154	N	0.849551	T	0.76104	0.3941	L	0.42245	1.32	0.09310	N	1	B;B;B;B;B;B;B	0.10296	0.001;0.002;0.003;0.001;0.001;0.002;0.001	B;B;B;B;B;B;B	0.08055	0.003;0.003;0.002;0.003;0.003;0.003;0.002	T	0.54925	-0.8220	10	0.13853	T	0.58	.	9.7536	0.40490	0.0:0.7672:0.0:0.2328	.	993;993;993;993;993;993;993	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	T	993	ENSP00000398962:A993T;ENSP00000398266:A993T;ENSP00000410257:A993T;ENSP00000388797:A993T;ENSP00000397915:A993T;ENSP00000416634:A993T;ENSP00000328968:A993T;ENSP00000399524:A993T;ENSP00000403355:A993T;ENSP00000413996:A993T	ENSP00000328968:A993T	A	-	1	0	0	SCN5A	38597677	38597677	0.014000	0.17966	0.000000	0.03702	0.045000	0.14185	0.343000	0.19944	0.221000	0.20879	0.561000	0.74099	GCA	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.692	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	1	0	1	2	2	2	2	0	0	0	0	21	21	21	20	1	1.990000	-3.332992	1	0.220000	NM_198056		0	15	15	0	100	100	1		1	0		0	0	21	0	0	0.999910	1.970158e-02	0	0	0	2	0	15	100
SPSB4	92369	broad.mit.edu	37	3	140866041	140866041	+	Missense_Mutation	SNP	G	G	A	rs79933965		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr3:140866041G>A	ENST00000310546.2	+	3	1496	c.752G>A	c.(751-753)cGc>cAc	p.R251H	SPSB4_ENST00000507895.1_3'UTR	NM_080862.1	NP_543138.1	Q96A44	SPSB4_HUMAN	splA/ryanodine receptor domain and SOCS box containing 4	251	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				biliary_tract(1)|large_intestine(1)|lung(1)|pancreas(1)	4						GCCCTGGGCCGCCAGCGCCTG	0.617																																						ENST00000310546.2	1.000000	0.590000	1	7.200000e-01	0.870000	0.864220	0.870000	1.000000																										0				4						c.(751-753)cGc>cAc		splA/ryanodine receptor domain and SOCS box containing 4		G	HIS/ARG	0,4406		0,0,2203	51.0	51.0	51.0		752	5.7	1.0	3	dbSNP_131	51	1,8599	1.2+/-3.3	0,1,4299	no	missense	SPSB4	NM_080862.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	251/274	140866041	1,13005	2203	4300	6503	SO:0001583	missense	92369	1	121412	32				g.chr3:140866041G>A		CCDS3115.1	3q23	2008-02-05			ENSG00000175093	ENSG00000175093			30630	protein-coding gene	gene with protein product		611660				12076535	Standard	NM_080862		Approved	SSB-4	uc003ett.3	Q96A44	OTTHUMG00000160223	ENST00000310546.2:c.752G>A	chr3.hg19:g.140866041G>A	ENSP00000311609:p.Arg251His	0					SPSB4_ENST00000507895.1_3'UTR	p.R251H	NM_080862.1	NP_543138.1	1	2	3	2.007888	Q96A44	SPSB4_HUMAN		3	1496	+				Missense_Mutation	SNP	ENST00000310546.2	1	1	hg19	c.752G>A	CCDS3115.1	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892680	0.91889	0.0	1.16E-4	ENSG00000175093	ENST00000310546	T	0.47528	0.84	5.67	5.67	0.87782	5.67	5.67	0.87782	SOCS protein, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	M	0.72353	2.195	0.47621	D	0.999479	B	0.31655	0.334	B	0.28011	0.085	T	0.45789	-0.9237	10	0.34782	T	0.22	-25.8085	17.2564	0.87057	0.0:0.0:1.0:0.0	.	251	Q96A44	SPSB4_HUMAN	H	251	ENSP00000311609:R251H	ENSP00000311609:R251H	R	+	2	0	0	SPSB4	142348731	142348731	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.577000	0.82486	2.676000	0.91093	0.561000	0.74099	CGC	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.617	SPSB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359727.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	1.990000	-2.774726	1	0.220000	NM_080862		0	27	25	0	257	254	0		1	0		0	0	48	0	0	1.000000	5.078390e-02	0	0	0	4	0	27	257
LETM1	3954	broad.mit.edu	37	4	1838239	1838239	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr4:1838239G>A	ENST00000302787.2	-	4	951	c.655C>T	c.(655-657)Ccg>Tcg	p.P219S		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	219	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			TCCATGAACGGCACCACCACG	0.557																																						ENST00000302787.2	1.000000	0.060000	2.100000e-01	9.000000e-02	0.140000	0.180194	0.140000	0.130000																										0				13						c.(655-657)Ccg>Tcg		leucine zipper-EF-hand containing transmembrane protein 1							168.0	136.0	147.0					4																	1838239		2203	4300	6503	SO:0001583	missense	3954	0	0					g.chr4:1838239G>A	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.655C>T	chr4.hg19:g.1838239G>A	ENSP00000305653:p.Pro219Ser	0						p.P219S	NM_012318.2	NP_036450.1	1	2	3	2.013189	O95202	LETM1_HUMAN	all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)	4	951	-			B4DED2|Q9UF65	Missense_Mutation	SNP	ENST00000302787.2	0	1	hg19	c.655C>T	CCDS3355.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839614	0.91117	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	T	0.79033	-1.23	4.01	4.01	0.46588	4.01	4.01	0.46588	LETM1-like (1);	0.000000	0.85682	D	0.000000	D	0.90099	0.6907	M	0.92412	3.305	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.69479	0.964;0.948	D	0.93036	0.6453	10	0.87932	D	0	-35.3303	16.3116	0.82873	0.0:0.0:1.0:0.0	.	219;219	O95202-3;O95202	.;LETM1_HUMAN	S	219;179	ENSP00000305653:P219S	ENSP00000305653:P219S	P	-	1	0	0	LETM1	1808037	1808037	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.506000	0.97992	2.077000	0.62373	0.563000	0.77884	CCG	0.224267		TCGA-HZ-A77P-01A-11D-A33T-08	0.557	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1	0	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	1.990000	-2.626279	1	0.220000			0	8	8	0	543	537	0		1	0		0	0	64	0	0	0.988974	1.587078e-01	0	0	0	43	0	8	543
SNX2	6643	broad.mit.edu	37	5	122163297	122163297	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:122163297G>A	ENST00000379516.2	+	14	1573	c.1465G>A	c.(1465-1467)Gtt>Att	p.V489I	SNX2_ENST00000510372.1_3'UTR|SNX2_ENST00000514949.1_Missense_Mutation_p.V372I	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	489					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.V489I(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		TTTTAAAACCGTTATCATCAA	0.299																																						ENST00000379516.2	1.000000	0.550000	1	6.800000e-01	0.830000	0.834756	0.830000	1.000000																										1	Substitution - Missense(1)	p.V489I(1)	large_intestine(1)	19						c.(1465-1467)Gtt>Att		sorting nexin 2							83.0	87.0	86.0					5																	122163297		2203	4300	6503	SO:0001583	missense	6643	1	121404	31				g.chr5:122163297G>A	AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1465G>A	chr5.hg19:g.122163297G>A	ENSP00000368831:p.Val489Ile	0					SNX2_ENST00000514949.1_Missense_Mutation_p.V372I|SNX2_ENST00000510372.1_3'UTR	p.V489I	NM_003100.2	NP_003091.2	1	2	3	2.009179	O60749	SNX2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	14	1573	+		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Missense_Mutation	SNP	ENST00000379516.2	1	1	hg19	c.1465G>A	CCDS34217.1	0	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539584	0.27563	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	T;T	0.57907	0.37;0.37	5.72	4.85	0.62838	5.72	4.85	0.62838	Vps5 C-terminal (1);	0.118494	0.64402	D	0.000018	T	0.32823	0.0842	N	0.11255	0.115	0.41069	D	0.985434	B	0.02656	0.0	B	0.06405	0.002	T	0.12268	-1.0554	10	0.14252	T	0.57	-0.4711	15.1561	0.72743	0.068:0.0:0.932:0.0	.	489	O60749	SNX2_HUMAN	I	489;372	ENSP00000368831:V489I;ENSP00000421663:V372I	ENSP00000368831:V489I	V	+	1	0	0	SNX2	122191196	122191196	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.406000	0.59748	1.551000	0.49450	0.650000	0.86243	GTT	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.299	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371392.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.990000	-8.892238	1	0.220000	NM_003100		0	23	23	0	230	230	0		1	1		0	0	41	0	0	1.000000	1	0	12	0	308	0	23	230
ADAMTS19	171019	broad.mit.edu	37	5	129037148	129037148	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:129037148G>A	ENST00000274487.4	+	20	3149	c.3004G>A	c.(3004-3006)Gcc>Acc	p.A1002T	ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1002	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CAGACAAGTGGCCTGTACCCA	0.532																																						ENST00000274487.4	1.000000	0.720000	1	8.300000e-01	0.960000	0.934026	0.960000	1.000000																										0				91						c.(3004-3006)Gcc>Acc		ADAM metallopeptidase with thrombospondin type 1 motif, 19							126.0	113.0	118.0					5																	129037148		2203	4300	6503	SO:0001583	missense	171019	0	0					g.chr5:129037148G>A	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3004G>A	chr5.hg19:g.129037148G>A	ENSP00000274487:p.Ala1002Thr	0					ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	p.A1002T	NM_133638.3	NP_598377.3	1	2	3	2.009179	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	20	3149	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)		Missense_Mutation	SNP	ENST00000274487.4	1	1	hg19	c.3004G>A	CCDS4146.1	1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487084	0.26686	.	.	ENSG00000145808	ENST00000274487	T	0.50813	0.73	4.0	3.13	0.36017	4.0	3.13	0.36017	.	0.088465	0.44902	D	0.000406	T	0.15478	0.0373	N	0.00869	-1.13	0.38121	D	0.93784	B	0.14012	0.009	B	0.15052	0.012	T	0.09037	-1.0693	9	.	.	.	.	9.1005	0.36664	0.1723:0.0:0.8277:0.0	.	1002	Q8TE59	ATS19_HUMAN	T	1002	ENSP00000274487:A1002T	.	A	+	1	0	0	ADAMTS19	129065047	129065047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.694000	0.54742	1.273000	0.44346	0.650000	0.86243	GCC	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.532	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	1	0	0	2	2	2	2	0	0	0	0	78	78	78	78	1	1.990000	-16.446480	1	0.220000	NM_133638		0	47	47	0	398	392	1		1	0		0	0	78	0	0	1.000000	1.169265e-02	0	0	0	2	0	47	398
PCDHGA3	56112	broad.mit.edu	37	5	140725483	140725483	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:140725483C>T	ENST00000253812.6	+	1	1883	c.1883C>T	c.(1882-1884)aCg>aTg	p.T628M	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	628	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGTGCGCACGGCGCGAGCC	0.697																																						ENST00000253812.6	1.000000	0.720000	1	8.400000e-01	0.970000	0.937655	0.970000	1.000000																										0				1						c.(1882-1884)aCg>aTg		protocadherin gamma subfamily A, 3							8.0	12.0	11.0					5																	140725483		1985	3985	5970	SO:0001583	missense	56112	0	0					g.chr5:140725483C>T	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1883C>T	chr5.hg19:g.140725483C>T	ENSP00000253812:p.Thr628Met	0					PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	p.T628M	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	1	2	3	2.009179	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1883	+			Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	0	1	hg19	c.1883C>T	CCDS47290.1	1	.	.	.	.	.	.	.	.	.	.	.	22.0	4.230592	0.79688	.	.	ENSG00000254245	ENST00000253812	T	0.56941	0.43	5.27	5.27	0.74061	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	0.000000	0.34110	U	0.004248	T	0.80586	0.4651	H	0.95402	3.665	0.40444	D	0.980074	D;D	0.89917	1.0;0.998	D;D	0.64776	0.928;0.929	D	0.86843	0.2018	10	0.72032	D	0.01	.	18.9241	0.92537	0.0:1.0:0.0:0.0	.	628;628	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	M	628	ENSP00000253812:T628M	ENSP00000253812:T628M	T	+	2	0	0	PCDHGA3	140705667	140705667	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	7.478000	0.81082	2.636000	0.89361	0.558000	0.71614	ACG	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.697	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	130	1	1.990000	-20.000000	1	0.220000	NM_018916		0	46	18	0	386	147	0		1			0	0	76	0	0	0.999998	0	0	0	0	0	0	46	386
PCDHGB1	56104	broad.mit.edu	37	5	140729951	140729951	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:140729951G>A	ENST00000523390.1	+	1	124	c.124G>A	c.(124-126)Ggc>Agc	p.G42S	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	42	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTAGCCAACGGCTCACGGGT	0.527											OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000523390.1	1.000000	0.430000	1	5.800000e-01	0.760000	0.771383	0.760000	1.000000																										0				16						c.(124-126)Ggc>Agc		protocadherin gamma subfamily B, 1							51.0	51.0	51.0					5																	140729951		1888	4126	6014	SO:0001583	missense	56104	0	0					g.chr5:140729951G>A	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.124G>A	chr5.hg19:g.140729951G>A	ENSP00000429273:p.Gly42Ser	0		OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1658	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	p.G42S	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	1	2	3	2.009179	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	124	+			Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	0	1	hg19	c.124G>A	CCDS54923.1	0	.	.	.	.	.	.	.	.	.	.	.	27.1	4.796737	0.90453	.	.	ENSG00000254221	ENST00000523390	T	0.51574	0.7	5.52	5.52	0.82312	5.52	5.52	0.82312	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.78923	0.4360	H	0.95260	3.645	0.39854	D	0.97328	D;D	0.76494	0.998;0.999	D;D	0.71870	0.947;0.975	D	0.85452	0.1161	9	0.72032	D	0.01	.	19.4222	0.94726	0.0:0.0:1.0:0.0	.	42;42	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	S	42	ENSP00000429273:G42S	ENSP00000429273:G42S	G	+	1	0	0	PCDHGB1	140710135	140710135	1.000000	0.71417	0.999000	0.59377	0.840000	0.47671	6.223000	0.72257	2.756000	0.94617	0.563000	0.77884	GGC	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.527	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.990000	-6.687618	1	0.220000	NM_018922		0	13	13	0	145	142	0		1	0		0	0	19	0	0	0.999553	8.152174e-03	0	0	0	2	0	13	145
PCDHGC3	5098	broad.mit.edu	37	5	140856777	140856777	+	Missense_Mutation	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:140856777C>T	ENST00000308177.3	+	1	1198	c.1094C>T	c.(1093-1095)gCc>gTc	p.A365V	PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA11_ENST00000518882.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	365	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGAGGATGCCCCTCTGGGG	0.582																																						ENST00000308177.3	1.000000	0.060000	2.900000e-01	1.100000e-01	0.190000	0.226192	0.190000	0.170000																										0				29						c.(1093-1095)gCc>gTc		protocadherin gamma subfamily C, 3							48.0	44.0	45.0					5																	140856777		2203	4300	6503	SO:0001583	missense	5098	0	0					g.chr5:140856777C>T	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1094C>T	chr5.hg19:g.140856777C>T	ENSP00000312070:p.Ala365Val	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA12_ENST00000252085.3_Intron	p.A365V	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	1	2	3	2.009179	Q9UN70	PCDGK_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1198	+			O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	0	1	hg19	c.1094C>T	CCDS4261.1	0	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706593	0.89018	.	.	ENSG00000240184	ENST00000308177	T	0.55588	0.51	5.49	5.49	0.81192	5.49	5.49	0.81192	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.69450	0.3112	L	0.54965	1.715	0.39337	D	0.965512	D;D	0.89917	0.999;1.0	D;D	0.75020	0.985;0.984	T	0.68375	-0.5425	9	0.48119	T	0.1	.	19.5755	0.95441	0.0:1.0:0.0:0.0	.	365;365	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	V	365	ENSP00000312070:A365V	ENSP00000312070:A365V	A	+	2	0	0	PCDHGC3	140836961	140836961	1.000000	0.71417	0.981000	0.43875	0.990000	0.78478	5.915000	0.69973	2.865000	0.98341	0.655000	0.94253	GCC	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.582	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	0	0	0	2	2	2	2	0	0	0	0	36	36	36	36	1	1.990000	-4.029790	1	0.220000	NM_002588		0	5	5	0	259	259	0		1	0		0	0	36	0	0	0.938126	3.301946e-01	0	1	0	52	0	5	259
AHRR	57491	broad.mit.edu	37	5	434517	434517	+	Missense_Mutation	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:434517G>T	ENST00000505113.1	+	11	1718	c.1674G>T	c.(1672-1674)tgG>tgT	p.W558C	AHRR_ENST00000512529.1_Missense_Mutation_p.W404C|AHRR_ENST00000506456.1_Missense_Mutation_p.W414C|AHRR_ENST00000316418.5_Missense_Mutation_p.W576C	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	558	Needed for transcriptional repression. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			GCCAGGTGTGGCTGGGGGCCA	0.607																																						ENST00000505113.1	1.000000	0.460000	9.200000e-01	5.900000e-01	0.740000	0.753867	0.740000	1.000000																										0				20						c.(1672-1674)tgG>tgT		aryl-hydrocarbon receptor repressor							51.0	60.0	57.0					5																	434517		2131	4244	6375	SO:0001583	missense	57491	0	0					g.chr5:434517G>T	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.1674G>T	chr5.hg19:g.434517G>T	ENSP00000424601:p.Trp558Cys	0					AHRR_ENST00000316418.5_Missense_Mutation_p.W576C|AHRR_ENST00000512529.1_Missense_Mutation_p.W404C|AHRR_ENST00000506456.1_Missense_Mutation_p.W414C	p.W558C	NM_001242412.1	NP_001229341.1	0	0	0	1.989587	A9YTQ3	AHRR_HUMAN	Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)	11	1718	+			A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Missense_Mutation	SNP	ENST00000505113.1	1	1	hg19	c.1674G>T	CCDS56355.1	0	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580075	0.28180	.	.	ENSG00000063438	ENST00000505113;ENST00000316418;ENST00000512529;ENST00000506456;ENST00000511487	T;T;T;T;T	0.73152	0.77;0.82;0.59;0.58;-0.72	4.74	2.94	0.34122	4.74	2.94	0.34122	.	0.201899	0.46758	N	0.000278	T	0.74512	0.3726	L	0.36672	1.1	0.54753	D	0.999981	B;D;D	0.89917	0.023;1.0;1.0	B;D;D	0.91635	0.024;0.998;0.999	T	0.72903	-0.4151	10	0.56958	D	0.05	.	9.5858	0.39514	0.0:0.1544:0.6854:0.1602	.	414;558;576	D6RE68;A9YTQ3;A9YTQ3-2	.;AHRR_HUMAN;.	C	558;576;404;414;213	ENSP00000424601:W558C;ENSP00000323816:W576C;ENSP00000424880:W404C;ENSP00000426932:W414C;ENSP00000426076:W213C	ENSP00000323816:W576C	W	+	3	0	0	AHRR	487517	487517	1.000000	0.71417	0.841000	0.33234	0.040000	0.13550	3.498000	0.53302	0.523000	0.28482	0.555000	0.69702	TGG	0.213075		TCGA-HZ-A77P-01A-11D-A33T-08	0.607	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	1.990000	-19.999940	1	0.220000	NM_020731		0	18	17	0	201	189	0		1			0	0	39	0	0	0.999975	0	0	0	0	0	0	18	201
ARAP3	64411	broad.mit.edu	37	5	141044614	141044614	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr5:141044614G>A	ENST00000239440.4	-	19	2740	c.2675C>T	c.(2674-2676)aCg>aTg	p.T892M	ARAP3_ENST00000513878.1_Missense_Mutation_p.T554M|ARAP3_ENST00000508305.1_Missense_Mutation_p.T794M|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	892					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GTTCCATGCCGTGAAGTCCAG	0.657											OREG0016871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000239440.4	1.000000	0.090000	4.000000e-01	1.600000e-01	0.250000	0.295417	0.250000	0.240000																										0				53						c.(2674-2676)aCg>aTg		ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3							26.0	29.0	28.0					5																	141044614		2203	4300	6503	SO:0001583	missense	64411	1	121408	30				g.chr5:141044614G>A	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.2675C>T	chr5.hg19:g.141044614G>A	ENSP00000239440:p.Thr892Met	0		OREG0016871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1661	ARAP3_ENST00000508305.1_Missense_Mutation_p.T794M|ARAP3_ENST00000513878.1_Missense_Mutation_p.T554M|ARAP3_ENST00000512390.1_5'UTR	p.T892M	NM_022481.5	NP_071926.4	1	2	3	2.009179	Q8WWN8	ARAP3_HUMAN		19	2740	-			B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	0	1	hg19	c.2675C>T	CCDS4266.1	0	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687765	0.29962	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.29655	1.56;1.56;1.56	4.83	4.83	0.62350	4.83	4.83	0.62350	Pleckstrin homology domain (1);	0.555087	0.17874	N	0.159088	T	0.19127	0.0459	N	0.24115	0.695	0.24003	N	0.996205	B;B;B	0.27498	0.155;0.18;0.113	B;B;B	0.23574	0.047;0.01;0.005	T	0.12142	-1.0559	10	0.16896	T	0.51	.	11.2395	0.48962	0.0843:0.0:0.9157:0.0	.	554;794;892	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	M	794;892;554	ENSP00000421826:T794M;ENSP00000239440:T892M;ENSP00000421468:T554M	ENSP00000239440:T892M	T	-	2	0	0	ARAP3	141024798	141024798	0.979000	0.34478	0.993000	0.49108	0.395000	0.30598	4.406000	0.59748	2.518000	0.84900	0.650000	0.86243	ACG	0.223417		TCGA-HZ-A77P-01A-11D-A33T-08	0.657	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	0	0	0	2	2	2	2	0	0	0	0	28	28	28	27	1	1.990000	-3.551343	1	0.220000	NM_022481		0	5	5	0	189	186	0		1	1		0	0	28	0	0	0.935778	3.199931e-01	0	2	0	36	0	5	189
BTN3A1	11119	broad.mit.edu	37	6	26406286	26406286	+	Missense_Mutation	SNP	T	T	C			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr6:26406286T>C	ENST00000289361.6	+	3	603	c.235T>C	c.(235-237)Tat>Cat	p.Y79H	BTN3A1_ENST00000476549.2_Missense_Mutation_p.Y79H|BTN3A1_ENST00000414912.2_Missense_Mutation_p.Y79H|BTN3A1_ENST00000425234.2_Missense_Mutation_p.Y79H	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	79	Ig-like V-type 1.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GGTGAACGTGTATGCAGATGG	0.562																																						ENST00000289361.6	1.000000	0.680000	9.900000e-01	7.700000e-01	0.870000	0.880828	0.870000	1.000000																										0				28						c.(235-237)Tat>Cat		butyrophilin, subfamily 3, member A1							54.0	84.0	74.0					6																	26406286		2200	4295	6495	SO:0001583	missense	11119	0	0					g.chr6:26406286T>C	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.235T>C	chr6.hg19:g.26406286T>C	ENSP00000289361:p.Tyr79His	0					BTN3A1_ENST00000425234.2_Missense_Mutation_p.Y79H|BTN3A1_ENST00000414912.2_Missense_Mutation_p.Y79H|BTN3A1_ENST00000476549.2_Missense_Mutation_p.Y79H	p.Y79H	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	0	0	0	1.977284	O00481	BT3A1_HUMAN		3	603	+			A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	1	1	hg19	c.235T>C	CCDS4608.1	1	.	.	.	.	.	.	.	.	.	.	.	13.89	2.371832	0.42003	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000450085;ENST00000425234;ENST00000506698;ENST00000414912	T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;4.1;-0.12	2.21	-3.57	0.04612	2.21	-3.57	0.04612	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56217	0.1970	M	0.67625	2.065	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.50725	-0.8794	9	0.54805	T	0.06	.	4.3804	0.11291	0.0:0.3702:0.1798:0.4499	.	79;79;79;79	E9PGB4;O00481-3;O00481-2;O00481	.;.;.;BT3A1_HUMAN	H	79	ENSP00000420010:Y79H;ENSP00000289361:Y79H;ENSP00000394937:Y79H;ENSP00000396684:Y79H;ENSP00000427013:Y79H;ENSP00000406667:Y79H	ENSP00000289361:Y79H	Y	+	1	0	0	BTN3A1	26514265	26514265	0.000000	0.05858	0.000000	0.03702	0.336000	0.28762	-0.501000	0.06398	-0.918000	0.03808	0.454000	0.30748	TAT	0.207800		TCGA-HZ-A77P-01A-11D-A33T-08	0.562	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3	0	0	1	2	2	2	2	0	0	0	0	105	105	105	151	1	1.990000	-20.000000	1	0.220000			0	63	52	0	575	528	0		1	0		0	0	105	0	0	1.000000	4.141757e-01	0	1	0	13	0	63	575
GPX5	2880	broad.mit.edu	37	6	28501886	28501886	+	Missense_Mutation	SNP	C	C	T	rs371361550		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr6:28501886C>T	ENST00000412168.2	+	5	697	c.608C>T	c.(607-609)aCg>aTg	p.T203M	GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	203					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	CACCGGGCTACGGTCAGCTCA	0.522																																						ENST00000412168.2	1.000000	0.740000	1	8.500000e-01	0.980000	0.945063	0.980000	1.000000																										0				16						c.(607-609)aCg>aTg		glutathione peroxidase 5 (epididymal androgen-related protein)	Glutathione(DB00143)	C	MET/THR,	0,4406		0,0,2203	84.0	82.0	83.0		608,	2.7	0.0	6		83	1,8599	1.2+/-3.3	0,1,4299	no	missense,utr-3	GPX5	NM_001509.2,NM_003996.3	81,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,	203/222,	28501886	1,13005	2203	4300	6503	SO:0001583	missense	2880	2	121412	34				g.chr6:28501886C>T	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.608C>T	chr6.hg19:g.28501886C>T	ENSP00000392398:p.Thr203Met	0					GPX5_ENST00000442674.2_3'UTR	p.T203M	NM_001509.2	NP_001500.1	0	0	0	1.977284	O75715	GPX5_HUMAN		5	697	+			A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	1	1	hg19	c.608C>T	CCDS4652.1	1	.	.	.	.	.	.	.	.	.	.	C	7.568	0.666106	0.14710	0.0	1.16E-4	ENSG00000224586	ENST00000412168	T	0.04194	3.68	4.52	2.7	0.31948	4.52	2.7	0.31948	Thioredoxin-like fold (2);	0.659654	0.15691	N	0.249449	T	0.02727	0.0082	M	0.63843	1.955	0.09310	N	1	D	0.59767	0.986	P	0.44772	0.46	T	0.40117	-0.9580	10	0.48119	T	0.1	-14.0316	7.4322	0.27134	0.1803:0.73:0.0:0.0897	.	203	O75715	GPX5_HUMAN	M	203	ENSP00000392398:T203M	ENSP00000392398:T203M	T	+	2	0	0	GPX5	28609865	28609865	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	1.329000	0.33770	0.793000	0.33875	-0.119000	0.15052	ACG	0.207800		TCGA-HZ-A77P-01A-11D-A33T-08	0.522	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	1.990000	-20.000000	1	0.220000			0	50	50	0	403	398	1		1			0	0	67	0	0	1.000000	0	0	0	0	0	0	50	403
XPO7	23039	broad.mit.edu	37	8	21846540	21846540	+	Missense_Mutation	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr8:21846540G>A	ENST00000252512.9	+	16	1914	c.1814G>A	c.(1813-1815)cGt>cAt	p.R605H	XPO7_ENST00000433566.4_Missense_Mutation_p.R606H|XPO7_ENST00000434536.1_Missense_Mutation_p.R614H	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	605					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TACTGGGGCCGTTGTGAACCA	0.448																																						ENST00000252512.9	1.000000	0.500000	9.400000e-01	6.300000e-01	0.790000	0.789070	0.790000	1.000000																										0				36						c.(1813-1815)cGt>cAt		exportin 7							109.0	113.0	112.0					8																	21846540		1900	4123	6023	SO:0001583	missense	23039	3	120856	31				g.chr8:21846540G>A	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1814G>A	chr8.hg19:g.21846540G>A	ENSP00000252512:p.Arg605His	1					XPO7_ENST00000433566.4_Missense_Mutation_p.R606H|XPO7_ENST00000434536.1_Missense_Mutation_p.R614H	p.R605H	NM_015024.4	NP_055839.3	0	1	1	1.793560	Q9UIA9	XPO7_HUMAN		16	1914	+			O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	1	1	hg19	c.1814G>A	CCDS47818.1	0	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390951	0.42410	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.65916	-0.18;-0.18;-0.18	5.89	5.89	0.94794	5.89	5.89	0.94794	Armadillo-type fold (1);	0.052693	0.85682	D	0.000000	T	0.50240	0.1604	N	0.16656	0.425	0.80722	D	1	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.36359	-0.9751	10	0.37606	T	0.19	-10.0541	19.8455	0.96706	0.0:0.0:1.0:0.0	.	606;614;605	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	H	614;605;606	ENSP00000404853:R614H;ENSP00000252512:R605H;ENSP00000410249:R606H	ENSP00000252512:R605H	R	+	2	0	0	XPO7	21902486	21902486	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	7.327000	0.79147	2.800000	0.96347	0.650000	0.86243	CGT	0.127907		TCGA-HZ-A77P-01A-11D-A33T-08	0.448	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	1.990000	-19.999960	1	0.220000	NM_015024		0	17	16	0	148	147	0		1	1		0	0	27	0	0	0.999971	9.690950e-01	0	11	0	42	0	17	148
CNBD1	168975	broad.mit.edu	37	8	88365930	88365930	+	Missense_Mutation	SNP	G	G	A	rs376314855		TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr8:88365930G>A	ENST00000518476.1	+	10	1270	c.1219G>A	c.(1219-1221)Gtc>Atc	p.V407I		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	407								p.V407I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						TGAGATTAGCGTCCTTCTTCA	0.323																																						ENST00000518476.1	1.000000	0.800000	1	9.600000e-01	0.990000	0.980532	0.990000	1.000000																										1	Substitution - Missense(1)	p.V407I(1)	prostate(1)	32						c.(1219-1221)Gtc>Atc		cyclic nucleotide binding domain containing 1		G	ILE/VAL	1,3681		0,1,1840	101.0	98.0	99.0		1219	2.7	0.4	8		99	2,8166		0,2,4082	no	missense	CNBD1	NM_173538.2	29	0,3,5922	AA,AG,GG		0.0245,0.0272,0.0253	benign	407/437	88365930	3,11847	1841	4084	5925	SO:0001583	missense	168975	12	120800	42				g.chr8:88365930G>A	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1219G>A	chr8.hg19:g.88365930G>A	ENSP00000430073:p.Val407Ile	0						p.V407I	NM_173538.2	NP_775809.1	0	1	1	1.991446	Q8NA66	CNBD1_HUMAN		10	1270	+				Missense_Mutation	SNP	ENST00000518476.1	1	1	hg19	c.1219G>A	CCDS55259.1	1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.388099	0.25118	2.72E-4	2.45E-4	ENSG00000176571	ENST00000518476	D	0.92397	-3.03	4.98	2.73	0.32206	4.98	2.73	0.32206	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.322185	0.21804	N	0.068869	T	0.75273	0.3827	N	0.11560	0.145	0.09310	N	1	P	0.36647	0.563	B	0.28011	0.085	T	0.69789	-0.5050	10	0.05351	T	0.99	-13.7869	6.2957	0.21085	0.2887:0.0:0.7113:0.0	.	407	Q8NA66	CNBD1_HUMAN	I	407	ENSP00000430073:V407I	ENSP00000430073:V407I	V	+	1	0	0	CNBD1	88435046	88435046	0.171000	0.23029	0.437000	0.26809	0.931000	0.56810	-0.057000	0.11768	0.288000	0.22398	0.555000	0.69702	GTC	0.215686		TCGA-HZ-A77P-01A-11D-A33T-08	0.323	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	1.990000	-6.203033	1	0.220000	NM_173538		0	32	32	0	221	218	1		1			0	0	31	0	0	1.000000	0	0	0	0	0	0	32	221
MATN2	4147	broad.mit.edu	37	8	99045355	99045355	+	Silent	SNP	C	C	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr8:99045355C>T	ENST00000520016.1	+	16	2791	c.2667C>T	c.(2665-2667)gaC>gaT	p.D889D	MATN2_ENST00000524308.1_Silent_p.D848D|MATN2_ENST00000522025.2_Silent_p.D605D|MATN2_ENST00000521689.1_Silent_p.D870D|RPL30_ENST00000518164.1_Intron|MATN2_ENST00000254898.5_Silent_p.D889D			O00339	MATN2_HUMAN	matrilin 2	889						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TTGAAGAAGACAATCTTTTAC	0.358																																						ENST00000520016.1	1.000000	0.270000	9.100000e-01	4.300000e-01	0.640000	0.665287	0.640000	1.000000																										0				31						c.(2665-2667)gaC>gaT		matrilin 2							86.0	74.0	78.0					8																	99045355		1821	4084	5905	SO:0001819	synonymous_variant	4147	0	0					g.chr8:99045355C>T	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.2667C>T	chr8.hg19:g.99045355C>T		0					MATN2_ENST00000522025.2_Silent_p.D605D|RPL30_ENST00000518164.1_Intron|MATN2_ENST00000521689.1_Silent_p.D870D|MATN2_ENST00000524308.1_Silent_p.D848D|MATN2_ENST00000254898.5_Silent_p.D889D	p.D889D			0	1	1	1.991446	O00339	MATN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.244)	16	2791	+	Breast(36;1.43e-06)		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	0	1	hg19	c.2667C>T	CCDS55264.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.191|8.191	0.795925|0.795925	0.16327|0.16327	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000518154|ENST00000519582;ENST00000522135	.|.	.|.	.|.	5.76|5.76	1.72|1.72	0.24424|0.24424	5.76|5.76	1.72|1.72	0.24424|0.24424	.|.	.|.	.|.	.|.	.|.	.|T	.|0.51736	.|0.1692	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.42899	.|-0.9424	.|4	.|.	.|.	.|.	-37.6152|-37.6152	5.185|5.185	0.15180|0.15180	0.0:0.5998:0.1496:0.2506|0.0:0.5998:0.1496:0.2506	.|.	.|.	.|.	.|.	X|I	653|126;52	.|.	.|.	Q|T	+|+	1|2	0|0	0|0	MATN2|MATN2	99114531|99114531	99114531|99114531	0.064000|0.064000	0.20934|0.20934	0.989000|0.989000	0.46669|0.46669	0.981000|0.981000	0.71138|0.71138	-0.162000|-0.162000	0.10012|0.10012	0.790000|0.790000	0.33803|0.33803	-0.137000|-0.137000	0.14449|0.14449	CAA|ACA	0.215686		TCGA-HZ-A77P-01A-11D-A33T-08	0.358	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	1.990000	-10.722830	1	0.220000			0	6	5	0	81	79	0		1	1		0	0	14	0	0	0.962897	9.998933e-01	0	14	0	312	0	6	81
TAF2	6873	broad.mit.edu	37	8	120770369	120770369	+	Silent	SNP	A	A	G			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chr8:120770369A>G	ENST00000378164.2	-	21	3010	c.2712T>C	c.(2710-2712)taT>taC	p.Y904Y	TAF2_ENST00000519355.1_5'UTR	NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	904					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCAGTTCTTCATAACTTCTGT	0.289																																						ENST00000378164.2	1.000000	0.650000	9.400000e-01	7.300000e-01	0.830000	0.841758	0.830000	1.000000																										0				49						c.(2710-2712)taT>taC		TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa							139.0	140.0	140.0					8																	120770369		2203	4298	6501	SO:0001819	synonymous_variant	6873	0	0					g.chr8:120770369A>G	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.2712T>C	chr8.hg19:g.120770369A>G		0					TAF2_ENST00000519355.1_5'UTR	p.Y904Y	NM_003184.3	NP_003175	0	1	1	1.991446	Q6P1X5	TAF2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)	21	3010	-	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Silent	SNP	ENST00000378164.2	1	1	hg19	c.2712T>C	CCDS34937.1	0																																																																																								0.215686		TCGA-HZ-A77P-01A-11D-A33T-08	0.289	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	1	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.990000	-20.000000	1	0.220000	NM_003184		0	63	62	0	616	614	0		1	1		0	0	80	0	0	1.000000	9.419205e-01	0	5	0	43	0	63	616
PPP2R3B	28227	broad.mit.edu	37	X	299380	299380	+	Silent	SNP	G	G	T			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chrX:299380G>T	ENST00000390665.3	-	12	1554	c.1536C>A	c.(1534-1536)atC>atA	p.I512I		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	512					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGGCCACCAGGATGTCGTACT	0.692																																						ENST00000390665.3	0.550000	0.190000	4.600000e-01	2.600000e-01	0.350000	0.366476	0.350000	0.340000																										0				11						c.(1534-1536)atC>atA		protein phosphatase 2, regulatory subunit B'', beta							91.0	82.0	85.0					X																	299380		2183	4281	6464	SO:0001819	synonymous_variant	28227	0	0					g.chrX:299380G>T	AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.1536C>A	chrX.hg19:g.299380G>T								p.I512I	NM_013239.4	NP_037371.2	0	1	1		Q9Y5P8	P2R3B_HUMAN		12	1554	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	Q6P4G9|Q7RTT1|Q96H01	Silent	SNP	ENST00000390665.3	1	1	hg19	c.1536C>A	CCDS14104.1	0																																																																																								0.220000		TCGA-HZ-A77P-01A-11D-A33T-08	0.692	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055577.2	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.990000	-8.393803	1	0.220000	NM_013239		0	13	13	0	155	153	0		1	1		0	0	25	0	0	0.999550	6.725906e-01	0	5	0	24	0	13	155
CXorf36	79742	broad.mit.edu	37	X	45011191	45011191	+	Silent	SNP	G	G	A			TCGA-HZ-A77P-01A-11D-A33T-08	TCGA-HZ-A77P-10A-01D-A33W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d2c1de61-378f-4a8c-b062-44c00d0a4cfd	cd18be6d-031e-446d-a3ed-4ca43606c221	g.chrX:45011191G>A	ENST00000398000.2	-	5	1082	c.1008C>T	c.(1006-1008)agC>agT	p.S336S	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	336						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						AAACCAGGCAGCTAAAAATGT	0.542																																						ENST00000398000.2	0.990000	0.470000	9.500000e-01	6.500000e-01	0.820000	0.807820	0.820000	0.990000																										0				7						c.(1006-1008)agC>agT		chromosome X open reading frame 36							27.0	27.0	27.0					X																	45011191		1562	3574	5136	SO:0001819	synonymous_variant	79742	2	118268	29				g.chrX:45011191G>A	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.1008C>T	chrX.hg19:g.45011191G>A							CXorf36_ENST00000477281.1_5'UTR	p.S336S	NM_176819.3	NP_789789.2	0	1	1		Q9H7Y0	DIA1R_HUMAN		5	1082	-			A8MUU5|B2RPN7|Q6UWJ5	Silent	SNP	ENST00000398000.2	0	1	hg19	c.1008C>T	CCDS48096.1	0																																																																																								0.220000		TCGA-HZ-A77P-01A-11D-A33T-08	0.542	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	1.990000	-17.704660	1	0.220000	NM_024689		0	8	8	0	24	22	1		1	0		0	0	10	0	0	0.990223	9.678263e-01	0	0	0	22	0	8	24
